ISSN 2409-4943. Ukr. Biochem. J., 2016, Vol. 88, N 3

UDС 577.112:616 doi: http://dx.doi.org/10.15407/ubj88.03.066

Expr ession of IGFBP6, IGFBP7, NOV, CYR61, WISP1 and WISP2 genes in U87 glioma cells in glutamine deprivation condition

O.n H. Mi chenko1, A. P. Kharkova1,n D. O. Mi chenko1,2, L. L. Karbovskyi1

1Palladin Institute of Biochemistry, National Academy of Sciences of Ukraine, Kyiv; e-mail: [email protected]; 2Bohomolets National Medical University, Kyiv, Ukraine

We have studied gene expression of insulin-like growth factor binding proteins in U87 glioma cells upon glutamine deprivation depending on the inhibition of IRE1 (inositol requiring enzyme-1), a central me- diator of endoplasmic reticulum stress. We have shown that exposure of control glioma cells upon glutamine deprivation leads to down-regulation of NOV/IGFBP9, WISP1 and WISP2 gene expressions and up-regu- lation of CYR61/IGFBP10 gene expression at the mRNA level. At the same time, the expression of IGFBP6 and IGFBP7 genes in control glioma cells was resistant to glutamine deprivation. It was also shown that the inhibition of IRE1 modifies the effect of glutamine deprivation on the expression of all studied genes. Thus, the inhibition of IRE1 signaling enzyme enhances the effect of glutamine deprivation on the expression of CYR61 and WISP1 genes and suppresses effect of the deprivation on WISP2 gene expression in glioma cells. Moreo- ver, the inhibition of IRE1 introduces sensitivity of the expression of IGFBP6 and IGFBP7 genes to glutamine deprivation and removes this sensitivity to NOV gene. We have also demonstrated that the expression of all studied genes in glioma cells growing with glutamine is regulated by IRE1 signaling enzyme, because the inhibition of IRE1 significantly down-regulates IGFBP6 and NOV genes and up-regulates IGFBP7, CYR61, WISP1, and WISP2 genes as compared to control glioma cells. The present study demonstrates that glutamine deprivation condition affects most studied IGFBP and WISP gene expressions in relation to IRE1 signaling enzyme function and possibly contributes to slower glioma cell proliferation upon inhibition of IRE1. K e y w o r d s: mRNA expression, IGFBP6, IGFBP7, NOV/IGFBP9, CYR61/IGFBP10, WISP1, WISP2, IRE1 inhibition, glutamine deprivation, glioma cells.

nsulin-like growth factor binding proteins the stimulation of all three IGF axis ligands, as well (IGFBPs­) play an important role in the regula- as hybrid receptors of IGF1/insulin receptor with I tion of numerous metabolic and proliferative other tyrosine kinase potentiate the transformation processes mainly through interaction with IGF1 and of cells, tumorigenesis, and tumor neovasculariza- IGF2, their cell surface receptors, as well as insulin tion [6]. receptor, alter the half-life of the IGFs and modify The IGFBPs bind and regulate the availabili­ their biological activity because they contain insulin- ty of both insulin-like growth factors and inhibit like growth factor (IGF) binding domain. It is well or stimulate the growth promoting effects of these known that insulin-like growth factors and the signal growth factors through IGF/INS receptors and transduction networks they regulate play important through other signaling pathways. They regulate cell roles in metabolic diseases as well as in tumorigene­ proliferation and survival as well as angiogenesis and sis and metastasis [1, 2]. IGFBPs participate in en- cancer cell migration. Moreover, both negative and doplasmic reticulum stress, which is an important positive correlations between levels of IGF-1/IGF- factor of tumor growth, insulin resistance, and obe- 1-R and clinical outcomes in head and neck cancer sity [3-5]. Therefore, there is the cross talk between have been reported [6]. IGFBPs are now understood IGF and insulin receptor signaling pathways at the to have many actions beyond their endocrine role in receptor level or at downstream signaling level. A IGF transport [6]. These binding proteins function formation of hybrid receptor isoforms between re- both in the cells and extracellular matrix to regulate ceptors for IGF1 and insulin, which are sensitive to cell proliferation and survival and involved in tumor

66 O. H. Minchenko, A. P. Kharkova, D. O. Minchenko, L. L. Karbovskyi development and progression as well as resistance and surviving as well as circadian rhythms [15-18]. to treatment. In addition to their canonical ligands The IRE1 (inositol requiring enzyme-1) is a central (IGF1 and IGF2), they play an important role in the mediator of the unfolded protein response and an regulation of various processes including transcrip- important component of tumor growth. Moreover, tion, because they interact with many proteins [6, 7]. its blockade leads to a suppression of tumor growth Therefore, IGFBP6 preferentially binds to IGF2 and through down-regulation of the proliferation pro- also has IGF-independent effects, including inhibi- cesses and angiogenesis [19, 20]. It contributes to the tion of angiogenesis and promotion of cancer cell mi- expression profile of many regulatory genes resul­ting gration [8]. Moreover, IGFBP6 regulate cell prolife­ in proliferation, angiogenesis, and apoptosis [15, 20, ration and apoptosis: down-regulation of this gene 21]. The IRE1 has two enzymatic activities: kinase, expression leads to inhibition of cell proliferation which is responsible for autophosphorylation and and to increased apoptotic cell death. It is interesting some gene expressions, and endoribonuclease, which to note that apoptosis can also be regulated through is responsible for degradation of a specific subset of IGF1 receptor; however, there is data that IGFBP6 mRNA and alternative splicing of the XBP1 (X-box can also suppress cell proliferation [9]. binding protein 1) transcription factor mRNA for The IGFBP7, which is also known as insulin- control of the expression of numerous unfolded pro- like growth factor binding protein-related protein 1 tein response-specific genes [22, 23]. (IGFBPRP1), has a conserved structural homolo­gy The endoplasmic reticulum stress response- with other members of IGFBP family. It is interesting­ signalling pathway is tightly linked to the neovascu- to note that it has a low affinity for IGFs and high af- larization, tumor growth and cell death processes as finity for insulin, suggesting that IGFBP7 may have well as to suppression of insulin receptor signaling a biological function distinct from other members of through activation of c-Jun N-terminal kinase (JNK) the IGFBP family. Moreover, IGFBP7 has diverse and subsequent serine phosphorylation of IRS1. The biological functions, regulating cell proliferation, endoplasmic reticulum has an essential position as a apoptosis and senescence; it may also play a key role signal integrator in the cell and is instrumental in the in vascular biology [6]. It elicits its biological effects different phases of tumor progression because the by both insulin/IGF-dependent and -independent signaling pathways elicited by endoplasmic reticu- mechanisms. It was also shown that IGFBP7 can lum stress sensors have connections with metabolic bind to unoccupied IGF1 receptor, blocks its activa- pathways and with other plasma membrane receptor tion by insulin-like growth factors and suppresses signaling networks [24]. downstream signaling, thereby inhibiting protein Ablation of IRE1 function has been shown to synthesis, cell growth, and survival [10]. Increasing result in a significant anti-proliferative effect in glio­ evidence suggests that IGFBP7 acts as a tumor sup- ma growth through down-regulation of prevalent pressor [6]. pro-angiogenic factors and up-regulation of anti- The NOV/IGFBP9 (nephroblastoma overex- angiogenic genes as well as by modification of these pressed) and CYR61/IGFBP10 (cysteine-rich angio- genes expression by glutamine deprivation [20, 25]. genic inducer 61), which play a role in cell growth Malignant gliomas are highly aggressive tumors regulation and are involved in angiogenesis, in- with very poor prognosis and to date there is no ef- flammation and matrix remodeling are members of ficient treatment available. The moderate efficacy of IGFBP­ and CNN families of regulatory proteins [11]. conventional clinical approaches therefore under- The WNT1 inducible signaling pathway (WISP) pro- lines the need for new therapeutic strategies. Glu- teins WISP1/CCN4 and WISP2/CCN5 are down- tamine and glucose are important substrates for glu- stream in the WNT1 signaling pathway and are also taminolysis and glycolysis, which are important to relevant to malignant transformation, cancer cell glioma development and a more agressive beha­viour surviving, invasion and motility [12-14]. Further- [26-28]. It was recently shown that glioblastoma more, elevated levels of WISP1/CCN4 and CYR61/ proliferation under glutamine deprivation depends CCN1 in primary breast cancers are associated with on glutamate-derived glutamine synthesis through more advanced features [14]. glutamine synthetase activity, which fuels nucleo- Multiple studies have clarified the link between tide biosynthesis and supports growth of glutamine- cancer and endoplasmic reticulum stress, which con- restricted glioblastoma [29, 30]. A better knowledge trols different processes, including cell proliferation of tumor responses to glucose or glutamine depri-

67 ISSN 2409-4943. Ukr. Biochem. J., 2016, Vol. 88, N 3 vation conditions is required to elaborate therapeu- kinase and endoribonuclease activities of this signa­ tical strategies of cell sensibilization, based on the ling enzyme (clone 1C5) [20]. The expression level blocka­de of survival mechanisms [10, 31]. However, of the studied genes in these cells was compared the executive mechanisms of the exhibited anti- with cells, transfected by vector (control 1), but this proliferative effects of IRE1 inhibition are not yet subline was also used as control 2 for investigation known. It is possible that this anti-proliferative ef- the effect of glutamine deprivation on gene expres- fect is also realized through mediation by IFGBPs sions under blockade of both enzymatic activities and its receptors signaling, which are integrated into of IRE1. The efficiency of IRE1 suppression in this the unfolded protein response signaling pathways, to glioma cell subline was estimated previously [21] by regulate cell proliferation and surviving [6, 8, 11, 32, determining the expression level of the XBP1 al- 33]. Previously it was shown that insulin-like growth ternative splice variant, a key transcription factor in factor binding proteins and CCN family proteins the IRE1 signaling, and the level of the phosphoryla­ such as IGFBP6, IGFBP7, NOV/IGFBP9, CYR61/ ted isoform IRE1 using cells treated by tunicamy- IGFBP10, WISP1, and WISP2 are possibly involved cin (0.01 mg/ml during 2 h). The both sublines of in the regulation of glioma cells proliferation by glioma cells are grown with the addition of geneticin IRE1, because inhibition of signaling enzyme IRE1 (G418), while these cells were carrying empty vector significantly affects the expression of all these genes pcDNA3.1 or dn-IRE1 construct. and modifies their hypoxic regulation [34]. Glutamine deprivation condition was created The main goal of this study was to investi- by changing the complete DMEM medium into cul- gate the role of expression of genes encoding the ture plates on the medium without glutamine (Gibco) insulin-like growth binding proteins with different and plates were exposed to this condition for 16 h. affinity for IGF proteins (IGFBP6, IGFBP7, NOV/ RNA isolation. Total RNA was extracted from IGFBP9, CYR61/IGFBP10, WISP1, and WISP2) in glioma cells using Trizol reagent according to manu- U87 glioma cell line and its subline with IRE1 loss facturer’s protocols (Invitrogen, USA) as described of function in glutamine deprivation condition for previously [35]. The RNA pellets were washed with evaluation of its possible significance in the control 75% ethanol and dissolved in nuclease-free wa- of tumor growth through IRE1 mediated endoplas- ter. For additional purification RNA samples were mic reticulum stress signaling. re-precipitated with 95% ethanol and re-dissolved again in nuclease-free water. RNA concentration Materials and Methods and spectral characteristics were measured using Cell Lines and Culture Conditions. The glioma NanoDrop Spectrophotometer ND1000 (PEQLAB, cell line U87 (HTB-14) was obtained from ATCC Biotechnolo­gie GmbH). Absorption coefficients at (USA) and grown in high glutamine (4.5 g/l) Dulbec- 260/280 nm were in the range from 2.12 to 2.19. co’s modified Eagle’s minimum essential medium­ Reverse transcription and quantitative PCR (DMEM; Gibco, Invitrogen, USA) supplemented analysis. QuaniTect Reverse Transcription Kit (QIA- with glutamine (2 mM), 10% fetal bovine serum GEN, Germany) was used for cDNA synthesis ac- (Equitech-Bio, Inc., USA), penicillin (100 units/ml; cording to manufacturer’s protocol. The expression Gibco, USA) and streptomycin (0.1 mg/ml; Gibco) at level of insulin-like growth factor binding proteins (IGFBP6, IGFBP7, IGFBP9/NOV, and IGFBP10/ 37 °C in a 5% CO2 incubator. The sublines of U87 glioma cells used in this CYR61) and WNT1 inducible signaling pathway study were described previously [20, 21]. One sub- proteins (WISP1 and WISP2) mRNAs as well as line was obtained by selection of stable transfected ACTB mRNA were measured in U87 glioma cells clones with overexpression of vector pcDNA3.1, by real-time quantitative polymerase chain reaction which was used for creation of dnIRE1. This untrea­ using “Applied Biosystems 7500” (Applied Biosys- ted subline of glioma cells (control glioma cells) was tems, USA) and Absolute qPCR SYBRGreen Mix used as control 1 in the study of the effect of glu- (Thermo Fisher Scientific, ABgene House, UK). tamine deprivation on the expression level of diffe­ Poly­merase chain reaction was performed in tripli- rent IGFBP and related genes. The other subline was cate using specific primers (Sigma-Aldrich, USA). obtained by selection of a stable transfected clone For amplification of IGFBP6 cDNA we used with overexpression of IRE1 dominant/negative forward (5′–GCTGTTGCAGAGGAGAATCC–3′ construct (dn-IRE1) and has suppressed both protein and reverse (5′–GGTAGAAGCCTCGATGGT-

68 O. H. Minchenko, A. P. Kharkova, D. O. Minchenko, L. L. Karbovskyi

CA–3′) primers. The nucleotide sequences of these CAAGAGATGG–3′ and reverse – 5′– AGCACTGT- primers correspond to sequences 397–416 and 655– GTTGGCGTACAG–3′ primers. These primer nucle- 636 of human IGFBP6 cDNA (GenBank accession otide sequences correspond to 747–766 and 980–961 number NM_002178). The size of amplified frag- of human ACTB cDNA (GenBank accession num- ment is 259 bp. ber NM_001101). The size of amplified fragment is The amplification of IGFBP7 cDNA for 234 bp. The expression of β-actin mRNA was used real time RCR analysis was performed using two as control of analyzed RNA quantity. The primers oligonucleotides primers: forward – 5′–AGCT- were received from Sigma-Aldrich (St. Louis, MO, GTGAGGTCATCGGAAT–3′ and reverse – 5′– USA). TATAGCTCGGCACCTTCACC–3′. The nucleotide Quantitative PCR analysis was performed sequences of these primers correspond to sequences using­ a special computer program “Differential ex- 572–591 and 882–863 of human IGFBP7 cDNA pression calculator”. The values of IGFBP6, IGFBP7, (GenBank accession number NM_001553). The size NOV/GFBP9, CYR61/IGFBP10, WISP1, WISP2, and of amplified fragment is 311 bp. ACTB gene expressions were normalized to the ex- The amplification of NOV/IGFBP9/CCN3 pression of β-actin mRNA and represented as per- cDNA for real time RCR analysis was performed cent of control (100%). All values are expressed as using­ two oligonucleotides primers: forward – 5′– mean ± SEM from triplicate measurements per- GCGAAGAAAGTCTCGTTTGG–3′ and reverse – formed in 4 independent experiments. The amplified 5′–ACACCAGACAGCATGAGCAG–3′. The nuc­ DNA fragments were also analyzed on a 2% agarose leotide sequences of these primers correspond to gel and that visualized by SYBR* Safe DNA Gel sequences 176–195 and 420–401 of human IGFBP9 Stain (Life Technologies, Carlsbad, CA, USA). cDNA (GenBank accession number NM_002514). Statistical analysis. Statistical analysis was per- The size of amplified fragment is 245 bp. formed using Excel program as described previously For amplification of CYR61/IGFBP10/CCN1 [36]. All values are expressed as mean ± SEM from cDNA we used forward (5′–CTCCCTGTTTTTG- triplicate measurements performed in 4 independent GAATGGA–3′ and reverse (5′–TGGTCTTGCTG- experiments. CATTTCTTG–3′) primers. The nucleotide sequen­ ces of these primers correspond to sequences Results and Discussion 852–871 and 1092–1073 of human IGFBP10 cDNA To determine if glutamine deprivation affects (GenBank accession number NM_001554). The size the expression of a subset of genes encoding for dif- of amplified fragment is 241 bp. ferent insulin-like growth factor binding proteins The amplification of WNT1 inducible signaling through the IRE1 branch of endoplasmic reticulum pathway protein 1 (WISP1), also known as CCN4, stress response, we investigated the effect of glu- cDNA for real time RCR analysis was performed tamine deprivation condition on mRNA expression using two oligonucleotides primers: forward – 5′– levels of different members of IGFBP and CCN GACTTTACCCCAGCTCCACT–3′ and reverse – 5’– families, which can participate in the regulation of GTAGTCACAGTAGAGGCCCC –3’. The nucleotide glioma growth through insulin-like growth factor re- sequences of these primers correspond to sequences ceptors as well as through other signaling pathways 203–222 and 415–396 of human WISP1 cDNA (Gen- and mechanisms. Bank accession number NM_003882). The size of To investigate a possible role of endoplasmic amplified fragment is 213 bp. reticulum stress signaling mediated by signaling en- For amplification of WISP2/CCN5 cDNA we zyme IRE1 in the expression of insulin-like growth used forward (5′–CTGTATCGGGAAGGGGA- factor binding protein gene IGFBP6 and its sensitivi­ GAC–3′ and reverse (5′–GGGAAGAGACAAGGC- ty to glutamine deprivation we studied the effect of CAGAA–3′) primers. The nucleotide sequences of glutamine deprivation condition on this gene expres- these primers correspond to sequences 463–482 and sion in glioma cells with functional IRE1 (control 709–690 of human WISP2 cDNA (GenBank acces- glioma cells) and cells without enzymatic activities sion number NM_003881). The size of amplified of this signaling enzyme. As shown in Fig. 1, the fragment is 247 bp. expression level of IGFBP6 mRNA does not change The amplification of β-actin (ACTB) cDNA significantly upon glutamine deprivation in control was performed using forward – 5′–GGACTTCGAG- glioma cells in comparison with the control 1, but

69 ISSN 2409-4943. Ukr. Biochem. J., 2016, Vol. 88, N 3 is up-regulated by +20% in cells with suppressed regulation of angiogenesis, cell migration and pro- function of signaling enzyme IRE1 as compared to liferation [36, 37]. We tested how glutamine dep- control 2. rivation condition affects these insulin-like growth We next tested the sensitivity of IGFBP7 gene factor binding protein genes and how IRE1 inhibi- to glutamine deprivation condition and whether tion modifies the effect of glutamine deprivation on IRE1 also participates in the regulation of this gene the expression of NOV and CYR61 genes. As shown expression upon glutamine deprivation. As shown in Fig. 3 and 4, the expressions of NOV and CYR61 in Fig. 2, the expression of IGFBP7 gene is also re- genes are sensitive to glutamine deprivation, but the sistant to glutamine deprivation in control glioma expression changes in diverse ways. Thus, the ex- cells, but in cells without IRE1 signaling enzyme posure of the control glioma cells upon glutamine the expression of this gene is down-regulated by deprivation decreases the expression of NOV gene glutamine deprivation condition in comparison with (-29%) and induces CYR61 gene expression (+34%). corresponding control (control 2). However, inhibition of IRE1 eliminates the effect of Next we investigated the cysteine-rich regula- glutamine deprivation on NOV gene expression in tory proteins NOV/IGFBP9/CCN3 and CYR61/IG- glioma cells, but enhances the expression of CYR61 FBP10/CCN1, which have insulin-like growth factor gene (+68%) (Fig. 3 and 4). Thus, inhibition of IRE1 binding domain and are members of CCN family signaling enzyme function modifies the expression proteins, associate with the extracellular matrix and level of NOV and CYR61 mRNAs in gene-specific play an important role in cancer development by manner.

120 350

100 300

250 80

200 60 150

40 100

20 50 Relative mRNARelative expression, control % of 1 Relative mRNARelative expression, control % of 1 0 0 Control 1 Glutamine Control 2 Glutamine Control 1 Glutamine Control 2 Glutamine deprivation deprivation deprivation deprivation

Vector dnIRE1 Vector dnIRE1 IGFBP6 IGFBP7

Fig. 1. Expression level of insulin-like growth factor Fig. 2. Expression level of insulin-like growth factor binding protein 6 (IGFBP6) mRNA in control U87 binding protein 7 (IGFBP7) mRNA in control U87 glioma cells (Vector) and cells with inhibition of the glioma cells (Vector) and cells with inhibition of the IRE1 (dnIRE1) upon glutamine deprivation measu­ IRE1 (dnIRE1) upon glutamine deprivation measu­ red by qPCR. Values of IGFBP6 mRNA expressions red by qPCR. Values of IGFBP7 mRNA expressions were normalized to β-actin mRNA level and repre- were normalized to β-actin mRNA level and repre- sented as percent of control 1 (100%); n = 4 sented as percent of control 1 (100%); n = 4

70 O. H. Minchenko, A. P. Kharkova, D. O. Minchenko, L. L. Karbovskyi

120 300

100 250

80 200

60 150

40 100

20 50 Relative mRNARelative expression, control % of 1 Relative mRNARelative expression, control % of 1

0 0 Control 1 Glutamine Control 2 Glutamine Control 1 Glutamine Control 2 Glutamine deprivation deprivation deprivation deprivation

Vector dnIRE1 Vector dnIRE1 NOV CYR61

Fig. 3. Expression level of nephroblastoma overex- Fig. 4. Expression of cysteine-rich angiogenic in- pressed protein (NOV/IGFBP9) mRNA in control ducer 61 (CYR61/IGFBP10), also known as CCN1 U87 glioma cells (Vector) and cells with inhibition (CCN family member 1), mRNA in control U87 of the IRE1 (dnIRE1) upon glutamine deprivation glio­ma cells (Vector) and cells with a blockade of measured by qPCR. Values of NOV mRNA expres- the IRE1 by dnIRE1 (dnIRE1) measured by qPCR. sions were normalized to β-actin mRNA level and Values­ of CYR61 mRNA expressions were normali­ represented as percent of control 1 (100%); n = 4 zed to β-actin mRNA level and represented as per- cent of control 1 (100%); n = 4 We next studied the effect of glutamine depri- vation condition on the expression of WNT1 induci­ IRE1 strongly up-regulated the expression of WISP2/ ble signaling pathway proteins (WISP1 and WISP2), CCN5 gene at mRNA level in glioma cells in nor- which have IGF binding domain and are members of moxic condition (3.6-fold) as compared to control 1. CCN family proteins as well as NOV/IGFBP9/CCN3 Additionally, we analyzed the effect of hypoxic and CYR61/IGFBP10/CCN1. As shown in Fig. 5, the condition on the expression level of CYR61, WISP1, expression of WISP1/CCN4 gene at mRNA level is and WISP2 mRNA in glioma cells with intact and down-regulated by glutamine deprivation both in inhibited IRE1 enzyme function in conditions when cells with native IRE1 and cells with inhibited func- the both controls (control 1 and control 2) are es- tion of IRE1 signaling enzyme: -18% in control glio- tablished as 100% to more precisely clarify the dif- ma cells and -68% (more than 3-fold) in cells with a ference in the sensitivity of these gene expressions deficiency of IRE1 enzyme function. to glutamine deprivation in respect to inhibition Significant up-regulation was also shown for of IRE1. As shown in Fig. 7, there are statistically the expression of WISP2/CCN5 gene upon glutamine significant differences in the expression levels of deprivation in both types of glioma cells: 2.6-fold CYR61, WISP1, and WISP2 mRNA in control glio­ in control glioma cells and 1.8-fold in cells without ma cells and cells without IRE1 function exposure IRE1 enzyme function as compared to correspon­ upon glutamine deprivation: 2.0-fold for CYR61, ding controls (Fig. 6). Moreover, the inhibition of 3.8-fold for WISP1, and 2.2-fold for WISP2.

71 ISSN 2409-4943. Ukr. Biochem. J., 2016, Vol. 88, N 3

1000 400

900 350 800 300 700 250 600

500 200

400 150 300 100 200 Relative mRNARelative expression, control % of 1 Relative mRNARelative expression, control % of 1 50 100

0 0 Control 1 Glutamine Control 2 Glutamine Control 1 Glutamine Control 2 Glutamine deprivation deprivation deprivation deprivation

Vector dnIRE1 Vector dnIRE1 WISP1/CCN4 WISP2/CCN5 Fig. 5. Expression of WNT1 inducible signaling path- Fig. 6. Expression of WNT1 inducible signaling way protein 1 (WISP1), also known as CCN4, mRNA pathway protein 2 (WISP2), also known as CCN5, in control U87 glioma cells (Vector) and cells with a mRNA in control U87 glioma cells (Vector) and cells blockade of the IRE1 by dnIRE1 (dnIRE1) measured with a blockade of the IRE1 by dnIRE1 (dnIRE1) by qPCR. Values of WISP1 mRNA expressions were measured by qPCR. Values of WISP2 mRNA normalized to β-actin mRNA level and represented expressions were normalized to β-actin mRNA level as percent of control 1 (100%); n = 4 and represented as percent of control 1 (100%); n = 4 In this work we studied the expression of genes encoded different insulin-like growth factor binding­ with potentially lethal metabolic stress induced by proteins in glioma cells with inhibition of IRE1 sign- glutamine deprivation remains poorly understood. aling enzyme function upon glutamine deprivation The growing tumor requires the endoplasmic for evaluation of possible significance of these genes reticulum stress as well as glutamine deprivation in the control of glioma growth through endoplasmic and nutrient deprivation, which initiate the endo- reticulum stress signaling mediated by IRE1 and glu- plasmic reticulum stress for own neovasculariza- tamine deprivation. Investigation of the expression tion and growth, for apoptosis inhibition [19, 20, 24, of different genes of IGFBP and CCN families in 25]. Cell proliferation is strongly dependent upon glioma cells upon glutamine deprivation in respect glutamine deprivation and glycolysis because there of inhibition of IRE1 signaling is very important for is the molecular connection between cell cycle pro- understanding of malignant tumor growth mecha- gression and the provision of substrates essential for nisms, because glutamine deprivation, as well as nu- this purpose [28, 30]. Glutamate-derived glutamine trient deprivation play essential role in the control of is now shown to satisfy the glutamine needs of glio- tumor progression [32]. Thus, our results are consis­ blastoma, because glutamine synthetase activity tent with numerous data [27, 29, 30] that glutamine fuels­ nucleotide biosynthesis and supports growth of deprivation associated with malignant progression glutamine-restricted glioblastoma [29, 30]. The en- through the endoplasmic reticulum unfolded protein doplasmic reticulum has an important position as a response, but mechanism how malignant cells cope signal integrator in both normal and malignant cells

72 O. H. Minchenko, A. P. Kharkova, D. O. Minchenko, L. L. Karbovskyi

200 that the effect of glutamine deprivation on the ex- pression of different studied genes is gene-specific 180 as well as their dependence on inhibition of IRE1 160 signaling enzyme, indica­ting that glutamine depri- vation introduces complex metabolic changes and 140 their significance remains unclear. Moreover, mul- 120 tifunctional protein CYR61 can suppress carcino- genesis by inhibiting compensatory proliferation 100 [34], and increased expression of its gene in control 80 and IRE1 knockdown glioma cells upon glutamine deprivation condition can also contribute to sup- 60 pression of cell proliferation after inhibition of IRE1 and invasive phenotype of these cells [20], although 40 the role of CYR61 in tumor growth is not well es- 20 tablished yet. At the same time, glutamine depriva- Relative mRNARelative expression, control % of tion leads to down-regulation of the expression of 0 both WISP1 and WISP2 genes in control and IRE1 Vector dnIRE1 Vector dnIRE1Vector dnIRE1 knockdown glioma cells, but functional signifi­cance CYR61 WISP1 WISP2 of these changes remains unclear yet. These genes Fig. 7. Inhibition of IRE1 modifies the effect of glu- encoded transcriptional repressors of genes associa­ tamine deprivation condition on the expression of ted with the epithelial-mesenchymal transition; it is CYR61/IGFBP10, WISP1, and WISP2 mRNA in undetectab­le in more aggressive breast cancer cells glioma cells (by qPCR). These mRNA expressions [12, 13]. values were normalized to β-actin mRNA expression The insulin-like growth factor binding proteins and represented as percent of corresponding control as well as IGFBP/CCN family proteins bind and (both controls are taken as 100%); mean ± SEM; regu­late the availability of both IGFs with different n = 4 affinity and inhibit or stimulate the growth promo­ ting effects of the IGFs through IGF/insulin recep- because the endoplasmic reticulum stress signa­ling tors and through many other signaling pathways and pathways have connections with other plasma mem- regulate cell proliferation and survival as well as brane receptor signaling networks and with numer- angiogenesis and cancer cell migration [6, 11]. As ous metabolic pathways [15, 24]. It is known that shown in Fig. 8, IGFBP/CCN family proteins have the complete blockade of the activity of IRE1 signa­ several domains with different functions and can in- ling enzyme in glioma cells had anti-tumor effects teract with various regulatory proteins. [19, 20]. Thus, the changes observed in the most above In this study we have also demonstrated that studied insulin-like growth factor binding proteins the expression of NOV, WISP1, and WISP2 genes is gene expressions correlate well with slower cell pro- down-regulated in control glioma cells upon glu- liferation in cells harboring dnIRE1, attesting to the tamine deprivation condition, but expression of fact that endoplasmic reticulum stress is a necessary CYR61 gene is up-regulated at this experimental component of malignant tumor growth, cell survival condition. At the same time, the expression of IG- and metastasis. Moreover, our results demonstrate FBP6 and IGFBP7 genes in control glioma cells is that glutamine deprivation, which contributes to sup- resistant to glutamine deprivation. However, inhibi- pression of tumor growth, affects most studied in- tion of IRE1 signaling enzyme, which is a central sulin-like growth factor binding protein and WNT1 mediator of the unfolded protein response and an inducible signaling pathway protein genes expres- important component of malignant tumor growth, sion, and that inhibition of IRE1 preferentially modi- modifies expression of all studied genes: introduces fies the expression of these genes and thus possibly sensitivity of the expression of IGFBP6 and IGFBP7 contributes to slower glioma growth. However, the genes to glutamine deprivation condition, and en- detailed molecular mechanisms of IRE1-mediated hances the effect of this condition on CYR61 and regulation of these genes, which have a pivotal role WISP1 genes expression. These results have shown in the control of cell proliferation as well as metas-

73 ISSN 2409-4943. Ukr. Biochem. J., 2016, Vol. 88, N 3

Fig. 8. Structure of CCN family proteins. Domains: IGFBP – IGF Binding Protein like, VWC – Von Wille- brand Factor Type C, TSP-1 – Thrombospondin Type-1, and CT – Cysteine-Knot-Containing. Partners (at the bottom): IGF – Insulin Like Growth Factor, BMP4 – Bone Morphogenetic Protein 4, TGF-β – Tumor Growth Factor β, LRP1 – Low Density Lipoprotein Receptor-Related Protein 1, NOTCH1 – Notch Homolog 1 Translocation-Associated, HSPG – Heparan Sulfate Proteoglycan tasis, upon glutamine deprivation are complex and глутаміну в контрольних клітинах гліоми. Та- warrant further investigation. кож показано, що пригнічення IRE1 модифікує ефект дефіциту глутаміну на експресію всіх Експресія генів IGFBP6, IGFBP7, досліджених генів. Так, інгібування сигналь- NOV, CYR61, WISP1 та WISP2 в ного ензиму IRE1 посилювало ефект дефіциту клітинах гліоми лінії U87 в глутаміну на експресію генів CYR61 та WISP1 і умовах дефіциту глутаміну пригнічувало його дію на експресію гена WISP2 в клітинах гліоми. Більше того, інгібування IRE1 O. Г. Мінченко1, А. П. Харькова1, призводило до появи чутливості до дефіциту Д. O. Мінченко1,2, Л. Л. Карбовський1 глутаміну експресії генів IGFBP6 та IGFBP7, 1Інститут біохімії ім. О. В. Палладіна але знімало цю чутливість до гена NOV. Нами НАН України, Київ; також показано, що експресія всіх досліджених e-mail: [email protected]; генів у клітинах гліоми у присутності глутаміну 2Національний медичний університет регулюється сигнальним ензимом IRE1, оскільки ім. О. О. Богомольця, Київ, Україна пригнічення IRE1 істотно знижує експресію Нами вивчалася експресія різних генів генів IGFBP6 та IGFBP9/NOV і посилює протеїнів, що зв’язуються з подібними до експресію генів IGFBP7, CYR61/IGFBP10, інсуліну факторами росту, в клітинах гліоми WISP1 та WISP2 за порівняння з контрольними лінії U87 в умовах дефіциту глутаміну залежно клітинами гліоми. Результати цієї роботи про- від пригнічення IRE1 (залежного від інозитолу демонстрували, що дефіцит глутаміну порушує ензим 1), центрального медіатора стресу ендо- експресію більшості досліджених генів груп плазматичного ретикулума. Встановлено, що IGFBP та WISP залежно від функції IRE1 і, мож- витримування клітин гліоми в умовах дефіциту ливо, робить внесок у зниження проліферації глутаміну призводить до зниження рівня клітин гліоми в умовах пригнічення IRE1. експресії генів NOV/IGFBP9, WISP1 та WISP2 К л ю ч о в і с л о в а: експресія мРНК, і збільшення – гена CYR61/IGFBP10 на рівні IGFBP6, IGFBP7, NOV/IGFBP9, CYR61/IGFBP10, мРНК. У той самий час, експресія генів IGFBP6 WISP1, WISP2, пригнічення IRE1, дефіцит та IGFBP7 є резистентною до умов дефіциту глутаміну, клітини гліоми.

74 O. H. Minchenko, A. P. Kharkova, D. O. Minchenko, L. L. Karbovskyi

Экспр ессия генов IGFBP6, К л ю ч е в ы е с л о в а: экспрессия мРНК, IGFBP7, NOV, CYR61, WISP1 и WISP2 в IGFBP6, IGFBP7, NOV/IGFBP9, CYR61/IGFBP10, клетках глиомы линии U87 при WISP1, WISP2, угнетение IRE1, дефицит глюта- дефиците глютамина мина, клетки глиомы. O. Г. Минченко1, А. П. Харькова1, References Д. O. Минченко1,2, Л. Л. Карбовский1 1. Pollak M. Insulin and insulin-like growth factor 1Институт биохимии им. А. В. Палладина signalling in neoplasia. Nat Rev Cancer. 2008; НАН Украины, Киев; 8(12): 915-928. e-mail: [email protected]; 2. Ozcan U, Cao Q, Yilmaz E, Lee AH, 2Национальный медицинский университет Iwakoshi NN, Ozdelen E, Tuncman G, Görgün C, им. А. А. Богомольца, Киев, Украина Glimcher LH, Hotamisligil GS. Endoplasmic Нами изучена экспрессия генов протеинов, reticulum stress links obesity, insulin action, связывающихся с подобными инсулину факто- and type 2 diabetes. Science. 2004; 306(5695): рами роста, в клетках глиомы линии U87 при 457-461. дефиците глютамина в зависимости от угнете- 3. Kuijjer ML, Peterse EF, van den Akker BE, ния IRE1 (зависимого от инозитола энзима 1), Briaire-de Bruijn IH, Serra M, Meza-Zepeda LA, центрального медиатора стресса эндоплазма- Myklebost O, Hassan AB, Hogendoorn PC, тического ретикулума. Установлено, что вы- Cleton-Jansen AM. IR/IGF1R signaling as держивание контрольных клеток глиомы при potential target for treatment of high-grade дефиците глютамина приводит к снижению osteosarcoma. BMC Cancer. 2013; 13: 245. уровня экспрессии генов IGFBP9/NOV, WISP1 4. Lee J, Ozcan U. Unfolded protein response и WISP2 и усилению – гена CYR61/IGFBP10 на signaling and metabolic diseases. J Biol Chem. уровне мРНК. В то же время экспрессия генов 2014; 289(3): 1203-1211. IGFBP6 та IGFBP7 резистентна к дефициту глю- 5. Minchenko DO, Kharkova AP, Karbovskyi LL, тамина в контрольных клетках глиомы. Также Minchenko OH. Expression of insulin-like показано, что угнетение IRE1 модифицирует growth factor binding protein genes and its эффект дефицита глютамина на экспрессию hypoxic regulation in U87 glioma cells depends всех исследованных генов. Так, ингибирование on ERN1 mediated signaling pathway of сигнального энзима IRE1 усиливало эффект де- endoplasmic reticulum stress. Endocr Regul. фицита глютамина на экспрессию генов CYR61 2015; 49(2): 73-83. и WISP1 и снижало его действие на экспрессию 6. Baxter RC. IGF binding proteins in cancer: гена WISP2 в клетках глиомы. Более того, инги- mechanistic and clinical insights. Nat Rev бирование IRE1 приводило к развитию чувстви- Cancer. 2014; 14(5): 329-341. тельности экспрессии генов IGFBP6 и IGFBP7 к 7. Ellis BC, Graham LD, Molloy PL. CRNDE, a дефициту глютамина, но снимало эту чувстви- long non-coding RNA responsive to insulin/IGF тельность к гену NOV. Нами также показано, что signaling, regulates genes involved in central экспрессия всех исследованных генов в клетках metabolism. Biochim Biophys Acta. 2014; глиомы в присутствии глютамина регулируется 1843(2): 372-386. сигнальным энзимом IRE1, поскольку его угне- 8. Bach LA, Fu P, Yang Z. Insulin-like growth тение существенно снижает экспрессию генов factor-binding protein-6 and cancer. Clin Sci IGFBP6 и NOV/IGFBP9 и усиливает экспрессию (Lond). 2013; 124(4): 215-229. генов IGFBP7, CYR61/IGFBP10, WISP1 и WISP2 9. Pan Y, Liang H, Liu H, Li D, Chen X, по сравнению с контрольными клетками глио- Li L, Zhang CY, Zen K. Platelet-secreted мы. Результаты работы продемонстрировали, microRNA-223 promotes endothelial cell что дефицит глютамина нарушает экспрессию apoptosis induced by advanced glycation end большинства исследованных генов групп IGFBP products via targeting the insulin-like growth и WISP в зависимости от функции IRE1 и, воз- factor 1 receptor. J Immunol. 2014; 192(1): 437- можно, играющих определенную роль в сниже- 446. нии пролиферации клеток глиомы при угнете- 10. Evdokimova V, Tognon CE, Benatar T, Yang W, нии IRE1. Krutikov K, Pollak M, Sorensen PH, Seth A.

75 ISSN 2409-4943. Ukr. Biochem. J., 2016, Vol. 88, N 3

IGFBP7 binds to the IGF-1 receptor and blocks 21. Auf G, Jabouille A, Delugin M, Guérit S, its activation by insulin-like growth factors. Sci Pineau R, North S, Platonova N, Maitre M, Signal. 2012; 5(255): ra92. Favereaux A, Vajkoczy P, Seno M, Bikfalvi A, 11. Wagener J, Yang W, Kazuschke K, Winterhager E, Minchenko D, Minchenko O, Moenner M. High Gellhaus A. CCN3 regulates proliferation and epiregulin expression in human U87 glioma migration properties in Jeg3 trophoblast cells cells relies on IRE1α and promotes autocrine via ERK1/2, Akt and Notch signalling. Mol growth through EGF receptor. BMC Cancer. Hum Reprod. 2013; 19(4): 237-249. 2013; 13: 597. 12. Schlegelmilch K, Keller A, Zehe V, Hondke S, 22. Acosta-Alvear D, Zhou Y, Blais A, Tsikitis M, Schilling T, Jakob F, Klein-Hitpass L, Schütze N. Lents NH, Arias C, Lennon CJ, Kluger Y, WISP 1 is an important survival factor in human Dynlacht BD. XBP1 controls diverse cell type- mesenchymal stromal cells. Gene. 2014; 551(2): and condition-specific transcriptional regulatory 243-254. networks. Mol Cell. 2007; 27(1): 53-66. 13. Gurbuz I, Chiquet-Ehrismann R. CCN4/WISP1 23. Pluquet O, Dejeans N, Bouchecareilh M, (WNT1 inducible signaling pathway protein 1): Lhomond S, Pineau R, Higa A, Delugin M, a focus on its role in cancer. Int J Biochem Cell Combe C, Loriot S, Cubel G, Dugot-Senant N, Biol. 2015; 62: 142-146. Vital A, Loiseau H, Gosline SJ, Taouji S, 14. Xie D, Nakachi K, Wang H, Elashoff R, Hallett M, Sarkaria JN, Anderson K, Wu W, Koeffler HP. Elevated levels of connective tissue Rodriguez FJ, Rosenbaum J, Saltel F, Fernandez- growth factor, WISP-1, and CYR61 in primary Zapico ME, Chevet E. Posttranscriptional breast cancers associated with more advanced regulation of PER1 underlies the oncogenic features. Cancer Res. 2001; 61(24): 8917-8923. function of IREα. Cancer Res. 2013; 73(15): 15. Yadav RK, Chae SW, Kim HR, Chae HJ. 4732-4743. Endoplasmic reticulum stress and cancer. 24. Manié SN, Lebeau J, Chevet E. Cellular J Cancer Prev. 2014; 19(2): 75-88. mechanisms of endoplasmic reticulum stress 16. Hetz C, Chevet E, Harding HP. Targeting the signaling in health and disease. 3. Orchestrating unfolded protein response in disease. Nat Rev the unfolded protein response in oncogenesis: an Drug Discov. 2013; 12(9): 703-719. update. Am J Physiol Cell Physiol. 2014; 307(10): 17. Clarke HJ, Chambers JE, Liniker E, Marciniak C901-C907. SJ. Endoplasmic reticulum stress in malignancy. 25. Minchenko DO, Danilovskyi SV, Kryvdiuk IV, Cancer Cell. 2014; 25(5): 563-573. Hlushchak NA, Kovalevska OV, Karbovskyi LL, 18. Pluquet O, Dejeans N, Chevet E. Watching the Minchenko OH. Acute L-glutamine deprivation clock: endoplasmic reticulum-mediated control affects the expression of TP53-related protein of circadian rhythms in cancer. Ann Med. 2014; genes in U87 glioma cells. Fiziol Zh. 2014; 60(4): 46(4): 233-243. 11-21. 19. Drogat B, Auguste P, Nguyen DT, Bouche­ 26. Wise DR, DeBerardinis RJ, Mancuso A, Sayed N, careilh M, Pineau R, Nalbantoglu J, Zhang XY, Pfeiffer HK, Nissim I, Daikhin E, Kaufman RJ, Chevet E, Bikfalvi A, Moenner M. Yudkoff M, McMahon SB, Thompson CB. IRE1 signaling is essential for ischemia-induced Myc regulates a transcriptional program that vascular endothelial growth factor-A expression stimulates mitochondrial glutaminolysis and and contributes to angiogenesis and tumor leads to glutamine addiction. Proc Natl Acad Sci growth in vivo. Cancer Res. 2007; 67(14): 6700- USA. 2008; 105(48): 18782-18787. 6707. 27. Fogal V, Babic I, Chao Y, Pastorino S, 20. Auf G, Jabouille A, Guérit S, Pineau R, Mukthavaram R, Jiang P, Cho YJ, Pingle SC, Delugin M, Bouchecareilh M, Magnin N, Crawford JR, Piccioni DE, Kesari S. Favereaux A, Maitre M, Gaiser T, von Mitochondrial p32 is upregulated in Myc Deimling A, Czabanka M, Vajkoczy P, Chevet expressing brain cancers and mediates glutamine E, Bikfalvi A, Moenner M. Inositol-requiring addiction. Oncotarget. 2015; 6(2): 1157-1170. enzyme 1alpha is a key regulator of angiogenesis 28. Colombo SL, Palacios-Callender M, Frakich N, and invasion in malignant glioma. Proc Natl Carcamo S, Kovacs I, Tudzarova S, Moncada S. Acad Sci USA. 2010; 107(35): 15553-15558. Molecular basis for the differential use of glucose

76 O. H. Minchenko, A. P. Kharkova, D. O. Minchenko, L. L. Karbovskyi

and glutamine in cell proliferation as revealed expression of genes that encode some IGFBP by synchronized HeLa cells. Proc Natl Acad Sci and CCN proteins in U87 glioma cells depends USA. 2011; 108(52): 21069-21074. on IRE1 signaling. Ukr Biochem J. 2015; 87(6): 29. Krall AS, Christofk HR. Rethinking glutamine 52-63. addiction. Nat Cell Biol. 2015; 17(12): 1515-1517. 35. Minchenko OH, Tsymbal DO, Moenner M, 30. Tardito S, Oudin A, Ahmed SU, Fack F, Minchenko DO, Kovalevska OV, Lypova NM. Keunen O, Zheng L, Miletic H, Sakariassen PØ, Inhibition of kinase and endoribonuclease Weinstock A, Wagner A, Lindsay SL, Hock AK, activity of ERN1/IRE1α affects expression of Barnett SC, Ruppin E, Mørkve SH, Lund- proliferationrelated genes in U87 glioma cells. Johansen M, Chalmers AJ, Bjerkvig R, Niclou SP, Endoplasm Reticul Stress Dis. 2015; 2(1): 18-29. Gottlieb E. Glutamine synthetase activity fuels 36. Bochkov VN, Philippova M, Oskolkova O, nucleotide biosynthesis and supports growth Kadl A, Furnkranz A, Karabeg E, Afonyushkin T, of glutamine-restricted glioblastoma. Nat Cell Gruber F, Breuss J, Minchenko A, Mechtche­ Biol. 2015; 17(12): 1556-1568. riakova D, Hohensinner P, Rychli K, Wojta J, 31. Huber AL, Lebeau J, Guillaumot P, Pétrilli V, Resink T, Erne P, Binder BR, Leitinger N. Malek M, Chilloux J, Fauvet F, Payen L, Oxidized phospholipids stimulate angiogenesis Kfoury A, Renno T, Chevet E, Manié SN. via autocrine mechanisms, implicating a novel p58(IPK)-mediated attenuation of the role for lipid oxidation in the evolution of proapoptotic PERK-CHOP pathway allows atherosclerotic lesions. Circ Res. 2006; 99(8): malignant progression upon low glucose. Mol 900-908. Cell. 2013; 49(6): 1049-1059. 37. Cheng G, Zhang H, Zhang L, Zhang J. Cyr61 32. Frewer KA, Sanders AJ, Owen S, Frewer NC, promotes growth of glioblastoma in vitro and in Hargest R, Jiang WG. A role for WISP2 in vivo. Tumour Biol. 2015; 36(4): 2869-2873. colorectal cancer cell invasion and motility. 38. Hou CH, Lin FL, Hou SM1, Liu JF. Cyr61 Cancer Genomics Proteomics. 2013; 10(4): 187- promotes epithelial-mesenchymal transition 196. and tumor metastasis of osteosarcoma by Raf-1/ 33. Weroha SJ, Haluska P. The insulin-like growth MEK/ERK/Elk-1/TWIST-1 signaling pathway. factor system in cancer. Endocrinol Metab Clin Mol Cancer. 2014; 13: 236. North Am. 2012; 41(2): 335-350. 34. Minchenko OH, Kharkova AP, Minchenko DO, Received 23.05.2016 Karbovskyi LL. Effect of hypoxia on the

77