Cricetidae, Rodentia): Description of a New Genus and Reinstatement of Another

Home , Cricetulus, Phodopus

Zootaxa 4387 (2): 331–349 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2018 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4387.2.5 http://zoobank.org/urn:lsid:zoobank.org:pub:0C793072-9CBA-4431-BC9A-30FD36817D94

Molecular phylogenetics and taxonomy of dwarf hamsters Cricetulus Milne-Edwards, 1867 (Cricetidae, Rodentia): description of a new genus and reinstatement of another

V.S. LEBEDEV1, A.A. BANNIKOVA2, K. NEUMANN3, M.V. USHAKOVA4, N.V. IVANOVA5 & A.V. SUROV4 1Zoological Museum, Moscow State University, B.Nikitskaya 6, Moscow, Russia 2Lomonosov Moscow State University, Vorobievy Gory 1/12, Moscow, Russia 3Institute of Pathology, City Hospital Dessau, Auenweg 38, D-06847 Dessau-Roßlau, Germany 4Severtsov Institute of Ecology and Evolution, Russian Academy of Sciences, Leninskii pr. 33, Moscow, Russia 5Biodiversity Institute of Ontario, University of Guelph, N1G 2W1, Guelph, Canada

Abstract

The taxonomy of the genus Cricetulus has been controversial. The phylogenetic relationships both within the genus and among Cricetulus lineages and other genera were examined using a set of five nuclear and two mitochondrial genes. The results demonstrate that Cricetulus in its current treatment is a polyphyletic assemblage because the subgenus Urocricetus is phylogenetically unrelated to all other Cricetulus and is a distant sister group to Phodopus. The grey hamster (C. migratorius) proved to be closer to Cricetus and Allocricetulus than to Cricetulus proper, which includes C. barabensis C. sokolovi and C. longicaudatus. Based on these results Urocricetus is elevated to the rank of a full genus and a new genus Nothocricetulus gen.nov. is described for the grey hamster.

Key words: molecular taxonomy, Cricetinae, molecular clock, species tree

Introduction

Palearctic hamsters belonging to the subfamily Cricetinae Fischer, 1817 are an important component of the small mammal fauna of the Eurasian steppe and desert zones, and, thus, the knowledge of cricetine evolution is essential for understanding of the environmental history of the arid Palearctic. The current taxonomy of the group as based on morphological and cytogenetic data suggests recognition of six recent genera with 18 species (Musser & Carleton 2005). However, the status of some taxa remains unclear; such as genus Cricetulus Milne-Edwards, 1867, within which six species are currently recognized (C. barabensis Pallas, 1770, C. sokolovi Orlov and Malygin, 1988, C. longicaudatus Milne-Edwards, 1867, C.migratorius Pallas, 1773, C. kamensis Satunin, 1902, C. alticola Thomas, 1917). Genus Cricetulus was established based on Cricetulus griseus Milne-Edwards, 1867, which is now treated as a subspecies of C. barabensis. According to some previous classifications (e.g. Argyropulo 1932; Ellerman 1941) the genus included also Allocricetulus and Tscherskia as subgenera. Based on molecular data (Neumann et al. 2006) it was suggested that, even in its contemporary narrow treatment, the genus Cricetulus can be, in fact, a taxonomic dustbin. First, it was found that Cricetulus may be non-monophyletic due to the position of C. migratorius. However, the latter conclusion was based on the analysis of mtDNA combined with a single nuclear gene and, therefore should be tested using a more extensive sampling of markers. Second, the group of Tibetan hamsters (C. kamensis, C. alticola) sometimes (e.g. Pavlinov 2003) regarded as a separate subgenus Urocricetus Satunin, 1902, is yet studied insufficiently. Available mitochondrial data (Lebedev et al. 2003; Kang et al. 2014) suggest that this taxon may be unrelated to all other Cricetulus. Finally, the phylogeny of the main lineages of Cricetinae should be tested using additional nuclear genes. To clarify these points, we performed a phylogenetic analysis based on sequences of five nuclear exons and two mitochondrial genes.

Accepted by P. Teta: 20 Dec. 2017; published: 27 Feb. 2018 331 - MG685506 - - MG685506 - - MG685596 - cytb 12S BRCA1 IRBP RAG1 GHR vwF GHR RAG1 IRBP BRCA1 cytb 12S Collecting locality depression depression collection code code collection A24665 Russia, Omsk reg. - - MG685515 MG685575 - MG685575 MG685515 - reg. - reg. MG685595 - - Omsk Saratov - - - Cc1 - MG685532 Gobi Russia, - - - M Ossetia MG685578 Gobi A24665 MG685533 - - MG685556 MG685577 - - - Russia, Russia, 293 reg. - MG685517 MG685531 MG685536 16 MG685518 SW - 178 reg. Russia, Saratov reg. - Astrakhan W MG685599 - valley range reg. Cs1 - - - - - Ossetia 1004 Lake lake - MG685535 Lake valley Mongolia, Russia, Mongolia, - Cm119 Great Lake Mongolia, MG685534 - Buryatia Volgograd Mongolia, - Saratov Cm114 - Mongolia MG685510 - MG685553 MG685594 MG685574 MG685514 Kuraminskii Cm73 - - - MG685598 Kalmykia - - MG685557 - SW Gobi Mongolia, Cm2S Russia, Iskanderkul - Russia, - Cm3O - - - - MG685539 - Russia, Russia, 99-2 MG685613 MG685562 MG685513 MG685583 Luun MG685523 - - MG685559 MG685580 - L K Uzbekistan, - - - - Russia, - - Buryatia 24025 Tajikistan, MG685509 MG685520 part, Cm7 lake - - Cm6 MG685579 MG685519 MG685507 MG685537 - Buriatia Qinghai Iskanderkul Clong - MG685538 - central China, 73 Russia, MG685516 Tajikistan, 449106 MG685610 MG685558 70 - MG685576 NMNH MG685611 MG685560 MG685511 Russia, Mongolia, MG685581 MG685521 MG685508 MG685540 2002 - 2009 - Tuva - Russia, MG685555 - MG685608 - MG685554 - MG685597 - - MG685612 MG685561 MG685512 MG685582 MG685522 - MG685609 …Continued on next page page next on …Continued Species Tissue Characterization of our material used in the study and GB AccNo materialthe study of the new sequences. of our used in Characterization Cricetus cricetus Allocricetulus eversmanni Allocricetulus eversmanni Allocricetulus eversmanni Allocricetulus curtatus Allocricetulus curtatus Cricetulus sokolovi C. m. migratorius C. m. migratorius C. m. migratorius C. m. migratorius phaeus C. migratorius phaeus C. migratorius phaeus C. migratorius phaeus C. migratorius ssp. C. migratorius ssp. C. migratorius ssp. C. migratorius C. longicaudatus C. longicaudatus C. longicaudatus C. longicaudatus C. longicaudatus C. longicaudatus TABLE 1.

332 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. cytb 12S BRCA1 IRBP RAG1 GHR vwF GHR RAG1 IRBP BRCA1 cytb 12S China, S Tibet Tibet - S MG685547 - - MG685549 MG685570 - China, Collecting locality collection code code collection 155361 TS2 Russia, Volgograd region - - MG685530 - - - MG685530 - region Volgograd 73 Mongolia 177 - V2 Russia, TS2 MG685567 N Transaltai Gobi Mongolia, - - - reg. Russia, Voronezh - - - MG685529 - MG685588 - - MG685589 - - - MG685568 - Cgr Loc3 China, Inner Mongolia - - - - MG685514 - MG685514 - - Mongolia MG685614 - Inner reg. - - - MG685515 part - - - - MG685525 part China, Novosibirsk ------Loc3 central - reg. MG685542 MG685541 part MG685564 central Russia, - - - colony 2007 - reg. Buryatia Cgr MG685543 Mongolia, MG685585 Chita Cgr1 central laboratory - Cbp_09-4 - - MG685563 MG685584 Mongolia, - Cp65 - - Amur - MG685524 Russia, 131 Hangai - - MG685516 Russia, MG685565 319 Hangai MG685526 Mongolia, - - 214 - Buryatiareg. 596 - - - - MG685586 Russia, Buryatia 572 Primorie Mongolia, Hangai MG685545 - 76-09 MG685544 Mongolia, Russia, Cb29 - - - - Russia, 156 MG685615 MG685566 MG685517 MG685587 MG685527 47 Russia, Mongolia, 190 reg. Tt1 Anatolia Mb1 Primorie C 138 Russia, Turkey, - - Lake valley Mongolia, - - MG685552 MG685593 MG685573 MG685513 MG685551 MG685592 MG685572 MG685512 - - - - MG685510 MG685571 MG685591 MG685550 - NMNH 449099 China, Qinghai Qinghai China, 449099 NMNH MG685616 MG685548 MG685590 MG685569 MG685528 MG685505 MG685546 217 Mongolia, central part - - MG685511 - - - MG685511 part - central Mongolia, 217 ZMMU S- ZMMU sungorus alticola aff. (Continued) (Continued) Species Tissue ex. gr. Ellobius tancrei tancrei Ellobius Ellobius tancrei tancrei Ellobius lagurus Lagurus lagurus Lagurus TABLE 1. TABLE 1. C.b. barabensis C.b. griseus C.b. griseus C.b. pseudogriseus C.b. pseudogriseus C.b. pseudogriseus C.b. pseudogriseus C.b. pseudogriseus C.b. ferrugineus C.b. ferrugineus C.b. tuvinicus C.b. tuvinicus C.b. tuvinicus C.b. tuvinicus C.b. tuvinicus Tscherskia triton Mesocricetus brandti roborovskii Phodopus Phodopus Urocricetus kamensis Urocricetus

Specimens examined. Our own material consists of 35 specimens of 14 species of hamsters. Information on specimens used including the list of species, collecting sites and museum catalogue numbers is given in Table 1, For phylogenetic analysis 10 sequences of different genes of Cricetinae were retrieved from GenBank (Supplementary information 1). The total matrix contains 28 specimens of Cricetinae representing six recognized genera and all species belonging to the genus Cricetulus. The subgenus Urocricetus is represented in our original molecular sample by two specimens: a C. kamensis from Qinghai (NMNH 449099) and a specimen from south Tibet identified as C. aff. alticola (ZMMU S-155361). The dataset includes 22 outgroup OTUs (members of Tylomyinae, Neotominae, Sigmodontinae, Arvicolinae). Cranial morphology was examined based on specimens of Cricetulus stored in ZMMU (Zoological Museum of Lomonosov Moscow State University), ZIN (Zoological Institute, Russian Academy of Science, St. Petersburg) and NMNH (National Museum of Natural History, Washington). The sample includes the type specimen of C. kamensis (ZIN 10631). Information on type specimens of C. alticola, C. kamensis lama Bonhote, 1905 and C. kamensis tibetanus Thomas, 1922 (collection of London Natural History Museum) was available to us from images kindly provided by E.G. Potapova. DNA isolation, PCR amplification and sequencing. Total DNA was extracted from ethanol preserved tissues from liver, kidney or from dried muscles using standard protocol of proteinase K digestion, phenol-chloroform deproteinization and isopropanol precipitation (Sambrook et al. 1989). We sequenced two mitochondrial genes, the cytochrome b (cytb, 1140 bp) and 12S ribosomal RNA (12S, ~995 bp), and fragments of five nuclear loci: the exon 10 of the growth hormone receptor (GHR, ~846 bp), the exon 11 of the breast cancer type 1 susceptibility protein (BRCA1, ~1134 bp), recombination activating gene 1 (RAG1, ~1494 bp), the exon 28 of von Willebrand Factor (vWF, ~789 bp) and interphotoreceptor retinoid-binding protein (IRBP,~861 bp). Nucleotide sequences of the 32 original primers designed for this study as well as the sources of other 11 primers are provided in the Supplementary material, Table S1. Polymerase chain reaction (PCR) usually entailed 30–35 thermal cycles as follows: 94°C for 3 min, 30 cycles of 94°C for 30 s, 55–65°C depending on the primers for 1 min, 72°C for 1 min and a final extension of 72°C for 6 min. PCR products were visualized on 1 % agarose gel and then purified using ammonium acetate/ethanol precipitation. Approximately 10–40 ng of the purified PCR product was used for Sanger sequencing with corresponding primers using BigDyeTM Terminator v. 3.1 kit (Applied Biosystems, ThermoFisher Scientific), cycle sequencing products were analyzed on 3100-Avant Genetic Analyzer (Applied Biosystems, ThermoFisher Scientific). New sequences were deposited in GenBank under the Accession numbers MG685505-MG685616 (see also Table 1). Alignment and partitioning. All sequences were aligned by eye in BioEdit version 7.0.9.0 (Hall 1999). Heterozygous positions were coded using the IUB ambiguity codes. The program PartitionFinder ver 1.0.0 (Lanfear et al. 2012) was used to determine the best partitioning strategy for nuclear concatenation among five a priori candidate schemes: (1) partitioning by gene; (2) partitioning by codon position; (3) partitioning by gene and codon position (three subsets per gene); (4) as in variant 3 but with the 1st and 2nd codon positions combined (2 subsets per gene); and (5) no partitioning. Branch lengths were linked across partitions. AICc was used as the criterion. The cytb data set was always partitioned into codon positions. The hypervariable regions of 12S were excluded from all analyses, and the remaining alignment for this gene was subdivided into loops and stems. The latter subset consists of paired positions; considering that the substitutions in two sites of each pair are expected to be non-independent, only one site from a doublet (proximal to the 5′ end of the gene) was used in all analyses. Base frequencies. Base frequency homogeneity was tested for the third codon positions of each protein- coding gene as well as for the stem and loop regions of 12S based on values of the disparity index (Kumar & Gadagkar 2001) Significance tests based on 1000 replicates were performed in MEGA version 6.0 (Tamura et al. 2013). Phylogenetic tree reconstruction. Phylogenetic trees were generated by maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) based on a concatenation of five nuclear exons and 12S stems.

334 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. A reduced dataset containing 23 taxa for which sequences of all examined genes were available was used to perform tests for potential conflict among genes. Additional tree reconstructions were conducted using individual gene alignments including extended data sets for 12S and cytb. An unweighted parsimony analysis was performed in PAUP* 4.0b10 (Swofford 2003) with the following options: random addition sequence with 100 replicates, no limit for the number of optimal trees and TBR-branch swapping. Clade stability was assessed based on 1000 bootstrap replicates obtained with the same tree search parameters but with 20 replicates of random addition. An incongruence length difference (ILD) test (Farris et al. 1995) was implemented to check for significant discordances among genes (1000 replicates). ML analysis was performed in Treefinder (version October 2008) (Jobb 2008). The appropriate models of sequence evolution were selected for each subset, employing the routine implemented in Treefinder and using BIC as the criterion. A tree search was conducted with the following options: simultaneous parameter optimisation with tree search, optimised partition rates, proportional branch lengths for all partitions, and maximum search depth. Bootstrap support (1000 pseudoreplicates) was estimated using model parameters and rate values optimised for the ML topology. Alternative topological hypotheses were tested using the AU test (Shimodaira 2002) as implemented in Treefinder. To reveal conflict among genes individual gene topologies were compared to the combined tree. A Bayesian tree reconstruction was performed in MrBayes (versions 3.1.2 and 3.2.3) (Ronquist & Huelsenbeck 2003; Ronquist et al. 2011). Models with either two or six rate matrix parameters were selected for each partition based on the results of the model selection in Treefinder. Each analysis included two independent runs of four chains (one cold plus three heated following the default settings). The chain length was set at 25 million generations with sampling every 10000 generations. With these settings, the effective sample size exceeded 200 for all estimated parameters. Tracer 1.5 software (Rambaut & Drummond 2005) was used to check for convergence and determine the necessary burn-in fraction, which was set to 10% million generations in all cases. To test whether all individual genes may correspond to the same unique topology additional analyses were run with either topologies and branch lengths or only branch lengths unlinked across genes. Bayes factors were calculated based on marginal likelihoods estimated via stepping stone sampling method (Xie et al. 2011). The analysis was performed using the following options: Ngen=4.5 million generations, Nsteps=35, burninss= 1000, diagnfreq=2500, fromprior=yes. Species tree estimation. To estimate the species tree from the data on six potentially discordant independent loci (including mtDNA), several approaches were employed. First, we used a Bayesian coalescent framework as implemented in *BEAST (Heled & Drummond 2010). The choice of the appropriate clock model (strict or relaxed) was made based on the results of the likelihood ratio tests. The validity of the molecular clock assumption was tested separately for each gene using with likelihood values calculated in PAML 4.7 (Yang 2007). Based on the results, we used separate strict clock models for GHR and 12S and uncorrelated lognormal relaxed clock models for the remaining nuclear genes. No calibration information was utilised, and the mean rate for GHR was set to one. We used the same partitioning scheme and models as in the ML analysis. Yule prior for the species tree shape and the piecewise constant population size model were assumed. Default priors were used for all other parameters. In total, we conducted four independent runs of 200 million generations each in BEAST version 1.8.0 (Drummond et al. 2012). Parameter convergence was assessed in Tracer. The multispecies coalescent approach is adequate only if deep coalescence is the source of gene tree discordance. To test whether the topology of the species tree is sensitive to relaxation of this constraint we also employed two methods that are not dependent on this assumption: Bayesian Concordance Analysis as implemented in BUCKY v 1.4.0 (Larget et al. 2010) and non-parametric STAR method (Liu et al. 2009) as implemented in Phybase (Liu & Yu 2010). As the input for Bucky we used the tree samples generated by MrBayes (23 taxa, topologies unlinked across the 6 genes). The analysis was run with the several values of alpha (a prior for gene tree discordance) ranging from 1e-5 to 1e5. Each analysis included two independent runs with four chains of 1 million generations each and 10% burnin. To assess the robustness of the result produced by STAR, which estimates a species tree from the average ranks of coalescence taken from the gene trees, the analysis was run 1000 times using the output from MrBayes. Each round of species tree reconstruction employed six gene trees that were extracted from corresponding posterior samples. The obtained 1000 species trees were used to reconstruct the majority-rule consensus tree. Molecular clock analysis. Divergence times in Cricetini were estimated based on the concatenation of the five

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 335 nuclear genes. The molecular clock assumption was tested separately for each gene using likelihood ratio tests with likelihood values calculated in PAML 4.7 (Yang 2007). The analysis was performed in MCMCTREE (part of PAML 4.7) assuming autocorrelated clock model of rate variation. Approximate calculations were performed using the Hessian matrix method. The guide tree corresponded to the ML topology reconstructed in Treefinder. Separate models of sequence evolution were employed for each gene and codon position. We used two independent models of rate variation per gene, one for the 3rd codon positions and one for the concatenation of the 1st and 2nd positions. The priors for both substitution rate and rate variation parameter were modelled with gamma distribution (sd=mean=0.5 per 100 Myr and sd=mean=1, respectively). The parameters of the birth–death process with species sampling were fixed at 1, 1, 0 (default). Five runs of 8 million generations sampled every 4000 generations were conducted, 20000 generations were discarded as the burn-in. Tracer 1.5 was used to check for convergence. The effective sample size was >200 for the estimates of likelihood, node ages, substitution rates and rate variation parameters. Calibration information is given in Table S2. For most of nodes we used default calibration densities: minimum-age priors were specified using Cauchy distribution with 2.5% soft lower bounds, calibration points with both minimum and maximum constraints were specified using uniform distribution with 2.5% soft lower and upper bounds. The prior for the age of the tree root, which corresponds to the basal split among recent cricetids, was assumed to have a normal distribution with mean 19 My and standard deviation 1.5, as follows from the results by Steppan et al. (2004).

Results

Base composition. Both mitochondrial genes demonstrate a lack of compositional homogeneity, however cytb shows more pronounced bias with highly significant differences between three groups: 1) Urocricetus, Phodopus; 2) Mesocricetus, Cricetulus sensu stricto (except C. migratorius); 3) Cricetus, Allocricetulus, Tscherskia and C. migratorius. Variation within 12S loops is less conspicuous with fewer positive tests (at 1% level 10% of tests among cricetines versus 54% for cytb). Nuclear genes are characterized by relative homogeneity of base frequencies. Within Cricetinae RAG1 and GHR show no significant (P<0.01) heterogeneity at all. Only few hamster taxa demonstrate significant deviations in C+G rate for individual genes: Mesocricetus for IRBP, Phodopus for BRCA1, Tscherskia for vWF. Partitioning, model selection. The optimum partitioning scheme for the nuclear genes identified by PartitionFinder corresponded to partitioning by gene and codon position. The best-fit substitution models employed for each of the 15 subsets are given in Table S3. Topology of individual gene trees and congruence tests. The individual gene trees are given in Supplementary Fig. S1. It should be indicated that in most aspects the gene trees are quite similar, however the support for many nodes is moderate or low. The clade comprising Tscherskia, Cricetus, Allocricetulus and two branches of Cricetulus is always robustly supported. Neither of the gene trees contains monophyletic Cricetulus. Urocricetus is invariably recovered as a sister taxon to Phodopus, thus, showing no affinity to the other two branches attributed currently to this genus, which, in turn, never cluster together. Most nodes that are highly supported by one gene are not contradicted by others. A conspicuous exception is the Cricetus+Allocricetulus clade which is supported by BRCA1 and vWF (BS 94% in both case) but not by RAG1, which supports Cricetus+Cricetulus migratorius association (95%). Most genes (except vWF) place the latter taxon as a part of the clade including also Cricetus and Allocricetulus. Incongruence tests produced ambiguous results. ILD test indicates potential lack of homogeneity (P=0.025). AU tests recovered significant deviation from common phylogenetic pattern for RAG1 and IRBP (P= 0.012 and 0.011 respectively). It should be indicated that the results of the test for the other three nuclear genes (GHR, BRCA1, vWF) are as well close to significance (all are near.0.065), however, neither test is significant if we apply Bonferroni correction for multiple comparisons. In contrast to the above Bayes factors suggest that the model implying common topology is significantly better than the model based on separate topology for each gene (delta lnL =207.8). The observed contradictions among the tests validate the approach employing a combination of concatenation-based reconstructions with application of multilocus methods. MtDNA. The analyses of the two mitochondrial genes result in two different topologies: 12S (Fig. 1) supports the clade including Cricetus, Allocricetulus and Cricetulus migratorius while the cytb tree (Fig. 2) contains the clade consisting of Cricetus, Allocricetulus and Tscherskia. The difference is, however, insignificant (P=0.26, AU test)

336 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. Given that the former clade is supported by nuclear genes we consider the cytb result rather an artifact, which requires explanation ad hoc. Therefore, the combined analysis (given below) employs the 12S gene alignment (represented only by stems) and not the cytb data. Both mitochondrial genes indicate that each of the three widespread species of Cricetulus (C. migratorius C. barabensis C. longicaudatus) includes several distinct lineages divergent at 2.5–4 % of the cytb sequence (p- distance).

FIGURE 1. The Bayesian phylogeny of Cricetinae as inferred from the complete 12S gene sequence. Values above/below branches denote Bayesian posterior probabilities (BPP) and bootstrap support in Maximum Likelihood (ML) and Maximum Parsimony (MP) analyses. The representatives of Avicolinae, Sigmodontinae, Neotominae and Tylomyinae are used as outgroups.

Analysis of the concatenation. Under all criteria the tree searches resulted in the same topology (Fig. 3). The support values for nearly all nodes in the cricetine subtree are high (PP>0.95 BS>90%). All genera except Cricetulus are recovered as monophyletic. The basal split separates highly supported Phodopus+Urocricetus clade from the rest of taxa. Mesocricetus is branching off next. Tscherskia is placed as the sister group to the association

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 337 including Cricetus, Allocricetulus and two branches of Cricetulus. The grey hamster Cricetulus migratorius does not cluster with other Cricetulus (C. barabensis, C. longicaudatus, C. sokolovi) but stands as the sister branch to a well-supported grouping of Cricetus+Allocricetulus. Cricetulus sokolovi emerged as the most divergent taxon within Cricetulus barabensis species complex. The AU test rejects the monophyly of Cricetulus migratorius+C.barabensis+C.longicaudatus (P=0.024).

FIGURE 2. The Bayesian phylogeny of Cricetinae as inferred from the complete cytb gene sequence in MrBayes. Outgroups are not shown. Values above/below branches denote Bayesian posterior probabilities (BPP) and bootstrap support in Maximum Likelihood (ML) and Maximum Parsimony (MP) analyses. The asterisks indicate the highly supported nodes in all analyses (BPP >0.95, ML and MP bootstrap support >90%). The ML analysis was performed in Treefinder based on either nucleotide (nuc) or protein (AA) sequence alignment. In the latter case a mixed protein model (mixture of mtREV, mtMam and mtArt) with empirical state frequencies and a gamma distribution of rates across sites was used. Transitions at the 3rd codon positions were removed from the ML analysis of the nucleotide alignment via usage of GTR2 model.

Species tree. The topologies of the species tree inferred in *BEAST, primary concordance tree reconstructed in BUCKY and the majority-rule consensus based on STAR output are identical (Fig. 4) being as well very similar to the concatenated tree. The result of the concordance analysis in BUCKY appears to be independent upon the choice of the alpha parameter value. The results of the STAR bootstrap analysis demonstrate that the inferred consensus topology does not depend substantially on gene tree error but is sensitive to sampling of genes. Neither multilocus method provides any support for the subgenus Cricetulus s.str. in its current treatment. The node joining C. migratorius and Cricetus+Allocricetulus has high posterior probability in *BEAST reconstructions but the value of the concordance factor produced by BUCKY (sample wide CF of 0.68) suggest that not all genes support this association (4 to 5 of 6 according to the estimated 95% CI for all tested finite values of alpha parameter). Molecular clock. The results of molecular clock analysis are presented in Fig. 5 and Table 2. The basal split within crown cricetines refers to the latest Middle Miocene or Late/Middle Miocene boundary, Urocricetus splits from Phodopus in the early Late Miocene (ca. 10.4 Myr). Splits between most genera date back to the Latest Miocene and Pliocene. C. migratorius separates from Cricetus+Allocricetulus in the Early Pliocene (ca. 4.5 Myr), C. longicaudatus splits from C. barabensis sensu lato in the Early Pleistocene.

338 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. TABLE 2. The estimates of divergence times (Myr) as inferred from the concatenation of five nuclear genes under relaxed clock in MCMCTree. Divergence times (Myr) mean 95% HPD lower–upper Cricetidae root 17.47 15.02−19.89 Arvicolinae/Cricetinae 17.23 14.84−19.67 Phodopus+Urocricetus/other Cricetinae 12.25 10.24−14.54 Mesocricetus/Cricetus clade 11.65 9.69−13.96 Tscherskia/Cricetus+Cricetulus+… 6.36 4.83−8.01 C. barabensis+C. longicaudatus/Cricetus+… 5.61 4.43−6.99 C. migratorius/Cricetus+Allocricetulus 4.46 3.41−5.88 Cricetus/Allocricetulus 2.65 1.60−4.00 A. eversmanni/A. curtatus 0.31 0.00−0.74 tmrca of C. migratorius 0.29 0.01−0.64 C. longicaudatus/C. barabensis 1.06 0.50−1.64 C. sokolovi/C. barabensis 0.33 0.05−0.69 tmrca of C. barabensis 0.16 0.01−0.34 tmrca of C. longicaudatus 0.33 0.02−0.68 M. brandti/M. auratus 1.81 1.04−2.61 Phodopus/Urocricetus 10.37 8.37−12.52 P. roborovskii/P. campbelli 5.69 4.38−7.04 U. kamensis/U.aff. alticola 0.94 0.02−1.89

Discussion

Concordance among genes. Although the species tree topology is reconstructed with confidence by all methods not all nuclear gene trees are congruent with the species tree, as follows from the results of the AU tests. The conflict can be explained by incomplete lineage sorting, introgression or gene duplication/loss. Less clear is the reason for the lack of agreement between two mitochondrial genes (12S versus cytb) concerning the position of Tscherskia. It is plausible that cytb supports erroneous relationships due to compositional bias while more compositionally conservative 12S produces the same topology as nuclear genes. Instances of conflict among mitochondrial genes are documented in various animal phyla (e.g. Willerslev et al. 2009; Meiklejohn et al. 2014), however, such discrepancies may have different explanations in each case. Taxonomic implications. The most important finding stemming from our data is the isolated phylogenetic position of the hamsters which are attributed to the subgenus Urocricetus of Cricetulus. The same result was demonstrated previously based on the mtDNA data (Lebedev et al. 2003; Ding et al. 2016). Our nuclear data indicate that Urocricetus is phylogenetically distant from all other Cricetulus and is, however, a distant sister group of Phodopus. The molecular dating results suggest that these two genera diverged from each other in the early Late Miocene (~10 Mya), which is comparable to the age of Mesocricetus / Cricetus lineages split. Therefore, we believe that Urocricetus definitely deserves the rank of a separate genus. The Urocricetus lineage is restricted to Tibetan plateau (Zhang et al. 1997). Since the description of Urocricetus as the subgenus of Cricetulus (Satunin 1902) and simultaneously of its type species Cricetulus kamensis the taxon received little attention. Argyropulo (1932) treated Urocricetus not as a valid subgenus but as a synonym of Cricetulus, this view was accepted in most later studies (e.g. Ellerman 1941). Few other taxa that are evidently related to C. kamensis were described as either separate species (C. lama Bonhote, 1905, C. alticola Thomas, 1917) or subspecies (C. alticola tibetanus Thomas, 1922). However, in most checklists only C. alticola is considered a valid species (e.g. Musser & Carleton 2005). In some treatments C. kamensis is regarded as a polytypic species including lama, tibetanus and alticola as well-differentiated subspecies (Wang & Zheng 1973).

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 339 Recently it was suggested to accept all four taxa as separate species (Smith & Xie 2008), however, the empirical basis for this conclusion is unclear. C. kozlovi, which is frequently considered a subspecies of C. kamensis (e.g. Wang & Zheng, 1973), in fact, should be attributed to C. migratorius (Lebedev & Potapova 2008).

FIGURE 3. The Bayesian phylogeny of Cricetinae as inferred from a concatenated alignment of five nuclear genes and 12S mitochondrial gene. The asterisks denote the highly supported nodes in all analyses (Bayesian posterior probabilities (BPP) >0.95, ML and MP bootstrap support >90%), the filled circles mark moderately supported nodes (BPP>0.85, ML>70% and MP bootstrap support >65%). The representatives of the subfamilies Avicolinae, Sigmodontinae, Neotominae and Tylomyinae are used as the outgroups.

340 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. FIGURE 4. Species tree of Cricetinae produced by *BEAST based on Bayesian coalescent approach. Values above the branches correspond to Bayesian posterior probabilities in *BEAST, bootstrap support with STAR method and concordance factors in BUCKy analysis, respectively.

FIGURE 5. Timescale of major divergence events among taxa of Cricetinae based on nuclear gene data. The chronogram was reconstructed under the autocorrelated clock model implemented in MCMCTree software. The divergence times correspond to the mean posterior estimate of their age in Myr. The bars represent the 95% HPD interval.

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 341 Our nuclear and mitochondrial data on representatives of U. kamensis and Urocricetus aff. alticola are consistent with the view that they belong to distinct, albeit closely related species (the cytb p-distance between them is ca. 7%). The status of the hamster examined in Kang et al. (2014) remains unclear, it is rather close to U. aff. alticola (the cytb p-distance of ca. 3.5%). A thorough taxonomic revision of Urocricetus at the species level is highly warranted. The description of Urocricetus by Satunin (1902) is rather incomplete as its essential cranial characters were not considered. In fact, the diagnosis was based on the length of tail; correspondingly, the author supposed that C. (Urocricetus) kamensis may be close to C. longicaudatus. Below we present a brief synopsis of the genus.

Urocricetus Satunin 1902, new rank

Type species: Cricetulus kamensis Satunin, 1902

Diagnosis. Small hamsters with long to moderately sized tail, naked elongated feet and wavy margin of dorsal coloration. Rostrum slender and long, zygomatic plate straight. Hamular process of squamosum narrow and straight. Molars relatively narrow and high-crowned, main cusps elongated, labial and lingual anterocones (-conids) positioned close to each other, mesolophids (posterior ridges of metaconid) in m1 and m2 usually present. Auditory bullae small to medium-sized with extended tubular anterior part, stapedial foramen of normal size and position. Differential diagnosis. Urocricetus can be distinguished from all recent cricetines other than Phodopus by the shape of bullae tympani, which has a long tube-like protrusion on its anterior part (Fig. 6). It differs from Phodopus by position and size of the stapedial foramen, lack of fur on palms and soles, and length of tail.

FIGURE 6. Ventro-lateral view of the auditory bulla; (a) Cricetulus longicaudatus (ZMMU S-63115), (b) Urocricetus aff.alticola (ZMMU S-155360).

342 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. Content. Includes at least two species–U. kamensis and U. alticola, the status of thibetanus and lama requires additional examination. Does not include kozlovi. The monophyly of Cricetulus sensu lato is also violated by the phylogenetic position of C. migratorius, which proves to be more closely related to Cricetus and Allocricetulus than to C. barabensis and C. longicaudatus. This result, which was first obtained by Neumann et al. (2006), is fully supported here based on a more extensive sampling. There is no evidence that this phylogenetic arrangement is an artifact of some secondary signal such as base composition bias. It should be indicated that the genus Cricetulus in its traditional sense (i.e. including C. migratorius) appears to be an artificial grouping of small-sized hamsters. No morphological or chromosomal synapomorphies are known to support its monophyly despite the fact that Palearctic hamsters are relatively well studied from both perspectives (e.g. Vorontsov 1982; Romanenko et al. 2007).Thus, the grey hamster can not be retained within Cricetulus sensu stricto, which should include only C. barabensis (type species), C. sokolovi and C. longicaudatus. From a morphological viewpoint, there are no reasons to lump C. migratorius and its sister taxa—Cricetus and Allocricetulus—into a single genus taking into account the substantial level of morphological and genetic divergence among the three branches. Therefore, the only possible decision is to assign C. migratorius to a new genus, the description of which is given below.

Nothocricetulus gen.nov.

Type species: Mus migratorius Pallas, 1773

Diagnosis. Small hamsters with moderately sized tail (~30% of body length), naked palms and soles. Auditory bullae moderately inflated, tube-like anterior processi absent, stapedial foramen present. Hamular process of squamosal is broad, distally spatulated. Molars relatively broad, with widely separated cusps and large anterocones(-conids). In the upper M1 and M2, the median mures formed by the posterior ridges of the para- and protocones and anterior ridges of the meta- and hypocones are characteristically X-shaped, in particular the anterior ridge of the metacone (metalophule) tends to join the posterior ridge of the protocone but not the anterior ridge of the hypocone (Fig. 7). Mesolophids absent. Molar proportion as in Cricetulus. [A detailed description of dentition is provided by Pradel (1981).] Zygomatic plate is straight (as in Cricetus) in most; however, the morphology of the anterior zygoma is polymorphic in Chinese and Mongolian populations (Lebedev & Potapova 2008) where, in many specimens, the infraorbital foramen is rounded on the outer side and lacks external plate (as in Allocricetulus).

FIGURE 7. Occlusal view of M1 and M2; (a) Cricetulus barabensis (ZMMU S-187357), (b) Cricetulus longicaudatus (ZMMU S-187364), (c) Nothocricetulus migratorius (ZMMU S-15931), (d) Urocricetus aff.alticola (ZMMU S-155362), (e) Allocricetulus eversmanni (ZMMU S-171981). Arrow points to the median mure.

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 343 Differential diagnosis. Nothocricetulus can be distinguished from all other hamsters by molar morphology (position of metalophule on M1 and M2). Among small-sized hamsters, it differs from Allocricetulus by a more slender rostrum and narrower braincase, from Urocricetus and Phodopus by bullae morphology; from the latter genus it also differs by the presence of a well-developed stapedial foramen. Nothocricetulus is separated from Cricetulus proper by the above-mentioned dental traits and also by larger width of the distal part of the hamular process, which is relatively narrow and assymetric in the latter genus, as well as by the shape of the fronto-parietal suture: in Cricetulus the anterior angles of the parietals extend anteriorly from the rostral-most point of the squamoso-frontal suture but are level with the latter in Nothocricetulus. Etymology Nothos—false, cricetulus—small hamster Content. a single polymorphic species with several semispecies or subspecies groups (see Lebedev 2000). Interspecific taxonomy requires revision. The relationships of Nothocricetulus with fossil genera also need clarification. As follows from the cladistic analysis by Bescós (2003) several taxa, which are now attributed to Allocricetus in its wider treatment, can in fact be closer to Nothocricetulus. Nevertheless, it is unlikely that the genus Allocricetus Schaub 1930 as based on A. bursae Schaub 1930 should include Nothocricetulus. The former demonstrates closer affinities to Cricetus and Allocricetulus, which share with it a potential synapomorphy—the presence of enamel on the rear surface of lower incisors (Topachevsky & Skorik 1992), which is absent in Nothocricetulus.

Implications for evolutionary history of cricetines

While our results generally conform to those by Neumann et al. (2006) several new conclusions can be made regarding the phylogenetic history of the group. First, there are four (and not three as in Neumann et al. 2006) main cricetine branches, which diverged in the beginning of the Late Miocene or Late/Middle Miocene boundary, two of them (Phodopus and Urocricetus) definitely originated in the East Central Asia (east of the Altai-Tianshan boundary). The third group—Mesocricetus—is restricted to east Mediterranean, while the fourth—Cricetus clade sensu Neumann et al. 2006—is widely distributed both in the eastern and western Eurasia. Contrary to previous results, our data consistently support Tscherskia as the sister group to all other members of the Cricetus clade, while the next split separates Cricetulus sensu stricto from the rest. This pattern is in line with the results of a previous comparative cytogenetic study (Romanenko et al. 2007). Both Tscherskia and Cricetulus s.s. are distributed mainly in the eastern part of the Eurasian arid/semiarid belt, thus, providing more support to the hypothesis of the eastern origin of the Cricetus lineage as well. This finding conform well to the hypothesis that East/Central Asian inland was the primary centre of diversification of major hamster taxa. Although the fossil history of Cricetini in Europe is rich as well (e.g. Freudenthal et al. 1998), we have to conclude that Mesocricetus is probably the only descendant of Miocene West Eurasian diversity. At the same time, Cricetus, Nothocricetulus and Allocricetulus (except A. curtatus) belong to west Eurasian steppe fauna, thus, suggesting the existence of a western center of radiation in Early Pliocene.

Acknowledgments

We are grateful to two anonymous reviewers for their helpful and constructive comments on the manuscript. This work was supported by the Russian Foundation for Basic Research, projects 17-04-00065a (collection of material and genetic studies) and Russian Science Foundation, project 14-50-00029 (phylogenetic analysis and the processing of the paper). We would like to thank Dr. E.G. Potapova for her invaluable help with morphological issues and Drs. A.S. Tesakov and I.Ya. Pavlinov for their important comments on current results. We are indebted to Dr. N.I. Abramson for sequences of Arvicolinae.

References

Alexeeva, N.V. & Erbajeva, M.A. (2008) Diversity of Late Neogene-Pleistocene small mammals of the Baikalian region and implications for paleoenvironment and biostratigraphy: An overview. Quaternary International, 179, 190–195.

344 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. https://doi.org/10.1016/j.quaint.2007.10.011 Argyropulo, A.I. (1933) Die Gattungen und Arten der Hamster (Cricetinae Murray, 1866) der Palaearctic. Zeitschrift für Säugetierkunde, 20, 129–149. Bell, C.J., Lundelius, E.L., Barnosky, A., Graham, R.W., Lindsay, E.H., Ruez, D.R., Semken, H.A., Webb, S.D. & Zakrzewski, R.J. (2004) The Blancan, Irvingtonian, and Rancholabrean mammal ages. In: Woodburne, M.O. (Ed.), Late Cretaceous and Cenozoic mammals of North America: Biostratigraphy and Geochronology. Columbia University Press, New York, pp. 232–314. https://doi.org/10.7312/wood13040-009 Bescós, G.C. (2003) Análisis filogenético de Allocricetus del Pleistoceno (Cricetidae, Rodentia, Mammalia) Allocricetus (Cricetidae, Rodentia, Mammalia) from the Pleistocene.A phylogenetical approach. Coloquios de Paleontología, 1, 95– 113. Ding, Li, Wenjia, Li. & Lia, J. (2016) Mitochondrial genome of Cricetulus migratorius (Rodentia: Cricetidae): Insights into the characteristics of the mitochondrial genome and the phylogenetic relationships of Cricetulus species. Gene, 595, 121–129. https://doi.org/10.1016/j.gene.2016.10.003 Drummond, A.J., Suchard, M.A., Xie, D. & Rambaut, A. (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29, 1969–1973. https://doi.org/10.1093/molbev/mss075 Ellerman, J.R. (1941) The families and genera of living rodents. V.I. Rodents, other than Muridae. British Museum Natural History, London, 689 pp. Farris, J.S., Källersjö, M., Kluge, A.B. & Bult, C. (1995) Testing significans of incongruence. Cladistics, 10, 315–319. https://doi.org/10.1111/j.1096-0031.1994.tb00181.x Fahlbusch, V, (1969) Pliozäne und Pleistozäne Cricetinae (Rodentia, Mammalia) aus Polen. Acta Zoologica Cracoviensia, 5, 99–138. Freudenthal, M., Mein, P. & Suárez, E.M. (1998) Revision of Late Miocene and Pliocene Cricetinae (Rodentia, Mammalia) from Spain and France. Treballs del Museu de Geologia de Barcelona, 7, 11–93. Heled, J. & Drummond, A.J. (2010) Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution, 27, 570–580. https://doi.org/10.1093/molbev/msp274 Jobb, G. (2008) TREEFINDER version of June 2008. Munich, Germany. Distributed by the author. Available from: http:// www.treefinder.de/ (accessed 22 January 2018) Kang, C., Yue, H., Liu, M., Huang, T., Liu, Y., Zhang, X., Yue, B., Zeng, T. & Liu, S. (2014) The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae). Mitochondrial DNA, Early Online, 1–2. Kumar, S. & Gadagkar, S.R. (2001) Disparity Index: A simple statistic to measure and test the homogeneity of substitution patterns between molecular sequences. Genetics, 158, 1321–1327. Lanfear, R., Calcott, B., Ho, S.Y.W. & Guindon, S. (2012) PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution, 29, 1695–1701. https://doi.org/10.1093/molbev/mss020 Larget, B.R., Kotha, S,K., Dewey, C.N. & Ané, C. (2010) BUCKy: Gene tree/species tree reconciliation with Bayesian concordance analysis. Bioinformatics, 26, 2910–2911. https://doi.org/10.1093/bioinformatics/btq539 Lebedev, V.S. (2000) A morphometric study of geographic variability in grey hamsters (Cricetulus migratorius Pall.). In: Agadjianian, A.K. & Orlov, V.N. (Eds.), Systematics and phylogeny of the rodents and lagomorphs. A.N. Severtsov Institute of ecology and evolution and Paleontological Institute RAS, Moscow, pp. 82–84. Lebedev, V.S., Ivanova, N.V., Pavlova, N.K. & Poltoraus, A.B. (2003) Molecular phylogeny of the Palearctic hamsters. In: Averianov, A. & Abramson, N. (Eds.), Systematics, phylogeny and paleontology of small mammals. Zoological Institute RAS, Saint-Petersburg, pp. 114–118. Lebedev, V.S. & Potapova, E.G. (2008) The zygomasseteric structure in Palearctic hamsters Cricetinae (Rodentia) and the taxonomic status of Cricetulus Kozlovi Satunin 1902. Zoologicheskii Zhurnal, 87, 90–103. Liu, L., Yu, L., Kubatko, Pearl, D.K. & Edwards, S.V. (2009) Coalescent methods for estimating phylogenetic trees. Molecular Phylogenetics and Evolution, 53, 320–328. https://doi.org/10.1016/j.ympev.2009.05.033 Liu, L. & Yu, L. (2010) Phybase: an R package for species tree analysis. Bioinformatics, 26, 962–963. https://doi.org/10.1093/bioinformatics/btq062 Meiklejohn, K.A., Danielson, M.J., Faircloth, B.C., Glenn, T.C., Braun, E.L., Kimball, R.T. (2014) Incongruence among different mitochondrial regions: a case study using complete mitogenomes. Molecular Phylogenetics & Evolution, 78, 314–323. https://doi.org/10.1016/j.ympev.2014.06.003 Musser, G.G. & Carleton, M.D. (2005) Superfamily Muroidea. In: Wilson, D.E. & Reeder, D.M. (Eds.), Mammals Species of the World. A Taxonomic and Geographic Reference. 3rd Edition. The Johns Hopkins University Press, Baltimore, pp. 2142. Neumann, K., Neumann, S., Gattermann, R., Michaux, J., Lebedev, V., Yigit, N., Colak, E., Ivanova, N., Poltoraus, A, Surov, A., Markov, G. & Maak, S. (2006) Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 345 cytochrome b and 12S rRNA. Molecular Phylogenetics and Evolution, 39, 135–148. https://doi.org/10.1016/j.ympev.2006.01.010 Pavlinov, I.Y. (2003) Taxonomy of Recent mammals. Archives of Zoological Museum of Moscow State University, 46, 3–297 [in Russian] Pradel, A. (1981) Biometrical remarks on the hamster Cricetulus migratorius (Pallas 1773) (Rodentia, Mammalia) from Krak de Chevaliers (Syria). Acta Zoologica Cracoviensia, 25, 271–292. Romanenko, S.A., Volobouev, V.T., Perelman, P.L., Lebedev, V.S., Serdukova, N.A., Trifonov, V.A., Biltueva, L.S., Nie, W., O`Brien, P.C.M., Bulatova, N. Sh., Ferguson-Smith, M.A., Yang F. & Graphodatsky, A.S. (2007) Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison. Chromosome Research, 15, 283–297. https://doi.org/10.1007/s10577-007-1124-3 Rambaut, A. & Drummond, A. (2005) Tracer. Version 1.5. Computer program distributed by the authors. Department of Zoology, University of Oxford, UK. Available from: http://evolve.zoo.ox.ac.uk/software.html (accessed 17 January 2017) Ronquist, F. & Huelsenbeck, J.P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. https://doi.org/10.1093/bioinformatics/btg180 Sambrook, J., Green, M.R. & Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Lab. Press, New York, 398 pp. Satunin, K.A. (1902) Neue Nagetiere aus den Materialien der grossen russischen Expeditionen nach Centralasien. Annuaire du Musee Zoologique St. Petersb, 7, 549–587. Schenk, J.J., Rowe, K.C. & Steppan, S.J. (2013) Ecological opportunity and incumbency in the diversification of repeated continental colonizations by muroid rodents. Systematic Biology, 62, 837–864. https://doi.org/10.1093/sysbio/syt050 Shimodaira, H. (2002) An approximately unbiased test of phylogenetic tree selection. Systematic Biology, 51, 492–508. https://doi.org/10.1080/10635150290069913 Smith, A.T. & Xie, Y. (2009) (Eds.) A guide to the mammals of China. Princeton University Press, Princeton, 544 рp. Steppan, S.J., Storz, B.L. & Hoffmann, R.S. (2004) Nuclear DNA phylogeny of the squirrels (Mammalia: Rodentia) and the evolution of arboreality from c-myc and RAG. Molecular Phylogenetics and Evolution, 30, 703–719. https://doi.org/10.1016/S1055-7903(03)00204-5 Swofford, D.L. (2003) PAUP*—Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4. Sunderland, Sinauer Associates, Massachusetts. [software] Tamura, K. Dudley, J. Nei, M. & Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24, 1596–1599. https://doi.org/10.1093/molbev/msm092 Tesakov, A. (2004) Biostratigraphy of Middle Pliocene—Eopleistocene of Eastern Europe (based on small mammals). Nauka, Moscow, 247 pp. Tjutkova, L.A. & Kaipova, G.O. (1996) Late Pliocene and Eopleistocene micromammal faunas of south-eastern Kazakhstan. Acta Zoologica Cracoviensia, 39, 546–557. Topachevskiy, V.A. & Skorik, A.F. (1992) Neogene and Pleistocene primitive Cricetidae of the south of eastern Europe. Naukova dumka, Kiev, pp. 242 [in Russian] Vasileiadou, K.V., Koufos, G.D. & Syrides, G.E. (2003) Silata, a new locality with micromammals from the Miocene/Pliocene boundary of the Chalkidiki peninsula, Macedonia, Greece. Deinsea, 10, 549–562. Vorontsov, N.N. (1982) [The hamsters (Cricetidae) of the world fauna. Part I. Morphology and ecology]. Fauna of the USSR, Series Nov., No. 125, Mammals, 3 (6), 1–451. [in Russian] Wang, S. & Zheng, C. (1973) Notes on Chinese hamsters (Cricetinae). Acta Zoologica Sinica, 19, 61–68. Willerslev, E., Gilbert, M.T., Binladen, J., Ho, S.Y., Campos, P.F., Ratan, A., Tomsho, L.P., da Fonseca, R.R., Sher, A., Kuznetsova, T.V., Nowak-Kemp, M., Roth, T.L., Miller, W. & Schuster, S.C. (2009) Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution. BMC Evolutionary Biology, 9, 95. https://doi.org/10.1186/1471-2148-9-95 Xie, W., Lewis, P.O., Fan, Y., Kuo, L. & Chen, M.H. (2011) Improving marginal likelihood estimation for Bayesian phylogenetic model selection. Systematic Biology, 60, 150–160. https://doi.org/10.1093/sysbio/syq085 Yang, Z. (2007) PAML 4: a program package for phylogenetic analysis by maximum likelihood. Molecular Biology and Evolution, 24, 1586–1591. https://doi.org/10.1093/molbev/msm088 Zhang, Y., Jin, S., Quan, G., Li, S.,Ye, Z., Wang, F. & Zhang, M. (1997) Distribution of mammalian species in China. China Forestry Publishing House, Beijing, 280 pp.

346 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. FIGURE S1. Maximum likelihood gene trees for Cricetinae produced by separate analyses of the fragments of BRCA1 exon 11, GHR exon 10, IRBP, RAG1 and vWF exon 28. The asterisks denote the highly supported nodes in all analyses (Bayesian posterior probabilities (BPP) >0.95, ML and MP bootstrap support >90%). The representatives of the subfamilies Avicolinae, Sigmodontinae, Neotominae and Tylomyinae are used as the outgroups.

SUPPLEMENTARY 1 The list of sequences retrieved from GenBank

Tylomyinae. Tylomys nudicaudus: DQ179812 [cytb]; Ototylomys phyllotis: DQ179814 [cytb]. Neotominae. Neotoma lepida: DQ781256 [cytb];. Reithrodontomys megalotis: AY859468 [cytb]; Peromyscus leucopus: DQ000483 [cytb]; Ochrotomys nuttalli: AY195798 [cytb]; Scotinomys xerampelinus: DQ861371[cytb]; Sigmodontinae. Sigmodon hispidus eremicus: EU293757 [cytb]; Rhipidomys macconnelli: AF108681 [cytb]; Reithrodon auritus: EU579474 [cytb];. Oryzomys couesi: EU074667 [cytb]; Calomys lepidus: EU579473 [cytb];. Phyllotis darwini: AY956729 [cytb]; Abrothrix andinus: AF108671 [cytb]. Arvicolinae. Prometheomys schaposchnikowi: AM392372 [cytb]; Chionomys nivalis: AY513845 [cytb]; Microtus rossiaemeridionalis: AY513819 [cytb]; Microtus oeconomus: AY21999 [cytb]; Microtus kikuchii: AF163896 [cytb]; Eothenomys melanogaster: AY426682 [cytb], E. chinensis: FJ483847 [12S]; Clethrionomys glareolus: AY309421 [cytb]; Proedromys sp. FJ463038 [12S]; Phenacomys intermedius: AF119260 [cytb]; Lemmus trimucronatus: AF119276 [cytb]; Ondatra zibethicus: AF119277 [cytb]; Arvicola terrestris: AY275106 [cytb]; Ellobius tancrei: AF119270 [cytb]; Lagurus lagurus: AF429818 [cytb]. Cricetinae. Cricetus cricetus AY275109 [cytb]; Cricetulus migratorius: AJ973387 [cytb]; Cricetulus sokolovi AB033693 [cytb]; Cricetulus griseus: EU660217, NC007936 [cytb]; C. longicaudatus: KM067270 [12S]; Mesocricetus auratus EU660218 [cytb], AM000038 [vWF]; AY295012 [BRCA1]; Mesocricetus raddei: AJ973383, AJ973382 [cytb] AM000042, AM000041 [vWF]; Mesocricetus newtoni: AJ973381 [cytb], AM000040 [vWF]; Mesocricetus brandti: AJ973380 [cytb], AM000039 [vWF]; Phodopus roborovskii: EF025539 [cytb]; Phodopus sungorus: EU677455 [cytb]; Phodopus campbelli: EF025538 [cytb]; Tscherskia triton: AJ973388, NC013068 [cytb], EU031048 [12S]; Urocricetus aff. kamensis: KJ680375 [cytb].

MOLECULAR PHYLOGENETICS OF CRICETULUS Zootaxa 4387 (2) © 2018 Magnolia Press · 347 TABLE S1. Primers used for PCR amplification and sequencing of the examined mitochondrial genes and nuclear loci in Cricetinae. Primer sequence (5`-3`) or source of informatio Cytb L14728 Lebedev et al. 2007 H15985 Ohdachi et al. 2001 H774 Poplavskaya et al. 2012 L524 Poplavskaya et al. 2012 12S rRNA Phe389L Neumann et al. 2006 842L Neumann et al. 2006 L329: Neumann et al. 2006 1379H Neumann et al. 2006 1015H Neumann et al. 2006 860H Neumann et al. 2006 H618 Neumann et al. 2006 GHR, exon 10 ghr_arv_F GGCGTTCATGACAACTACAAACCTGA ghr_cri_arv_F GGCGTTCATGACAACTACAAATCTGA ghr_cric_F GGCATTCATGATAACTACAAATCTGA ghr_arvic_R ATAGCCACACGAGGAGAGGAACT R556 GGCTGTGGCTGTGTGTTGC F485 CCAAGTAAGCGACATTACACCAG BRCA1, exon 11 F170_cric CCAGGAGCCAACAGAACAGARG F50 (external) GGCTGAATTCTATAATAAAAGCAAACAGTC F380 (internal) GCAGCTGTTGTGTTAGAAGTTTCAG F600 (internal) CAGAACCACAGATAACACAAGAACAC F240 (external) GCTACCCAAGATGTTCCTTGGATGACACT F625 (internal) CAAGAACACCCCTTCACAAATAAAT R1300_cric (external) GCATCGCTGGCCCTCCTCTTC R1300_Ph (external) AGCATCGCTGGCCCTTCTCTTC R1120 (external) ATGTTCTTGACTGGTGTTTGGTTGGAAT R500 (internal) GGTTTGGAGAGGTCTCTTTCACTTTTAC R440 (internal) TGGGGATCAGAGGCCACTAAGTC R670 (internal) CCTCAGGATGAAGGCATGTAGTTC R752 (internal) CATCTGGCTCCATTTGGTCAGTTC R870 (internal) ACCCCTTTTCCAAGGACTTCACTGG RAG1 F: rag1_all940F GACCTGGAGAGTCCAGTGAAGTCCTTTCT F: rag1_arv980F TGAAYTCTCTGATGGTGAAGTGTCC F: rag1_arv957F GGAGAGTCCAGTGAAGTCCTTTCTGA R: cm_1800_R GGGTTCCTCAAACACCTTCACATTCT R: rag1_arv2117R CCAGACGAGTGGCATCACAAAGT vWF, exon 28 F: vwf_bar_f GCCAGGTTAGGTACGCAGGTAG ...... continued on the next page

348 · Zootaxa 4387 (2) © 2018 Magnolia Press LEBEDEV ET AL. TABLE S1. (Continued) Primer sequence (5`-3`) or source of informatio F: vwf_ae_f GCCAGGTTAAGTATGCAGGTAGC R: vwf_cri_ R CCTGTGACCAAGTAGACCAGATTAG R vwf_ae_r CCTGTGACCAAGTATACCAGATTAG IRBP F11 CAGCCATTGAGCAGGCTATGAA R22cr AGACCACGGCTGAGTAGTCCAT R22ar GAGACCACAGCTGAGTAGTCCA F465 GCACGTGGATACCATCTATGAT R632 CGCATCTGCTTGAGGATGTAGGC F302 GCCAGGAGGTACTGAGTGAGC R720 GGCACTGTGAGGAAGAAGTTGG R790 CCTTTTCTAGGGCCTGCTCTGC R770 GCACTCCACTGCCTTCCCAT F365 ACCTCCTCCTTGGTGCTAGAT

TABLE S2. Calibration information used for molecular dating. Node Age Relevant fossil data Reference constraints separation of Mesocricetus lineage >4.9 earliest Mesocricetus -Mesocricetus primitivus Vasileiadou et al. MN13/MN14 boundary (Silata—the very end 2003 of Miocene) Cricetus/Allocricetulus split >2.7 earliest unambiguous Cricetus and Fahlbusch 1969 Allocricetulus Tjutkova & Kaipova -C. runtonensis (Rebielice-Królewskie, MN16) 1996 -Cricetus (Selim-Dzhevar, early Illian fauna 3.4 Ma—2.675 Ma ) -Allocricetulus (Kiikbay, end of MN16) separation of Cricetulus proper branch >2.7 earliest Cricetulus Alexeeva & Erbajeva Cricetulus cf. barabensis Transbaikalia MN16 2008 Calomys /Phyllotis split > 4.0 Schenk et al. 2013 separation of Ondatra lineage >4.1 earliest Ondatrini—Pliopotamys Early Blancan Bell et al. 2004 (before Blancan III) Eothenomys/Clethrionomys split >2.7 earliest Clethrionomys Tesakov 2004 C. kretzoi—C. glareolus branch Arvicola/Microtus split >3.0 <4.0 separation of the branch of large Mimomys Tesakov pers.comm. ancestral to Arvicola

TABLE S3. The best-fit substitution models employed for the mitochondrial and nuclear genes

1st codon positions 2nd codon position 3rd codon position cytb GTR+G TVM+G GTR+G 12S stems / loops HKY+G / HKY+G GHR HKY+G J3+G HKY+G IRBP J3+G TN+G J3+G BRCA1 HKY+G HKY+G J3+G RAG1 HKY+G HKY HKY+G vWF HKY+G HKY+G HKY+G