Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Home , CYP27A1, CYP2D6, CYP7B1, Steroid hydroxylase

Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy 56

WANJIN TANG

ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6192 UPPSALA ISBN 978-91-554-6876-7 2007 urn:nbn:se:uu:diva-7837 ! " # $ %& ' ( " ' ' )( ( *+ ' )( ,- #( . / "(-

# " 0- $- ! 1" ' ( ! 2)$3 2)$ 4 - 3 - &5- &6 - - 78 9 %$:;%;&&6;5:$5;$-

2)$3 2)$ . ( . < = ( (. ' ' ( - 3 2)$3 ' 2)$ $ ( ;( ' ( ( - ( = ( ' - #( ( ( " ' 2)$3 2)$ - 2)$ . ( . " " " ( < !/>% ?9 ) - @ ' 2)$ 193 ' ( ( . < ("( 2)$ 193 ' . ( ( " ( - #( ; ' " ' 2)$ "" ' ' ( = ' '- 2)$ " " ' ' ( .( 2)$ " ( ( ' 98 ' - #( " '2)$ ( "" ' 2)$ " ( ( - 1 ( . ( 2)$3 " ( " . ( ( 74+; ) 3 " " ; ! 4 - ( " . ( ( 74+; ( " ' 2)$3 .( ( ( ) 3 ( 2)$3- #( " '' ' " " '' " ( - #( ( ( ( 2)$3 " " ' " " ( ' 2)$3 '' " ( ( " . ( " " '' - #( ( ' ( ( ; '' ( ( 2)$3 . - 3 41/ . ' ' 41; " ' 2)$3 -

2)$3 2)$ ( " " " '

! "# $ # $ % &'(# # )*+&(,- #

A 0 B # " $

7889 5&;5% 78 9 %$:;%;&&6;5:$5;$ ;$:$ *( CC -<-C D E ;$:$, To my late grandparents

List of Papers

Th e thesis is based on the following papers, which will be referred to in the text by their Roman numerals.

I Araya, Z., Tang, W., and Wikvall, K Hormonal regulation of the human sterol 27-hydroxylase gene (CYP27A1). Biochem. J. 372, 529-534 (2003)

II Tang, W., Eggertsen, G., Chiang, J.Y.L., and Norlin, M. Estrogen-mediated regulation of CYP7B1: a possible role for controlling DHEA levels in human tissues. J. Steroid Biochem. Mol. Biol. 100, 42-51 (2006)

III Tang, W., and Norlin, M. Regulation of steroid hydroxylase CYP7B1 by androgens and estrogens in prostate cancer LNCaP cells. Biochem. Biophys. Res. Commun. 344, 540-546 (2006)

IV Tang, W., Norlin, M., and Wikvall, K. Regulation of human CYP27A1 by estrogens and androgens in HepG2 and prostate cells. Arch. Biochem. Biophys. (2007) (In press)

V Tang, W., Norlin, M., and Wikvall, K. Glucocorticoid receptor-mediated regulation of human CYP27A1. Manuscript

Reprints were made with permission from the publishers

Contents

Introduction ...... 11 Cholesterol homeostasis and bile acid biosynthesis ...... 11 Cytochrome P450 monoxygenase system ...... 11 Steroid hormones and their receptors ...... 13 Estrogens ...... 15 Androgens ...... 16 Glucocorticoids ...... 16 Prostate ...... 17 Sterol 27-hydroxylase (CYP27A1) ...... 17 CYP27A1, sex hormones and prostate ...... 18 Oxysterol 7α-hydroxylase (CYP7B1) and DHEA ...... 18 CYP7B1, sex hormones and prostate ...... 19 Previous studies on the regulation of CYP27A1 ...... 20 Previous studies on the regulation of CYP7B1 ...... 20 Aims of the Present Investigation ...... 22 Experimental Procedures ...... 23 Materials ...... 23 Cell culture ...... 23 Transient transfection ...... 24 Promoter-luciferase reporter assay ...... 24 Quantitation of CYP7B1 and CYP27A1 mRNA ...... 24 Assay of CYP7B1 enzyme activity ...... 25 Assay of CYP27A1 enzyme activity ...... 25 Electrophoretic mobility shift assay ...... 26 Site-directed mutagenesis ...... 26 Statistical analysis ...... 26 Other methods ...... 26 Results and Discussion ...... 28 CYP7B1...... 28 Human CYP7B1 expression is age-dependent and tissue-specifi c (Paper II) . 28 Estrogens regulate CYP7B1 (Paper II, III) ...... 29 E2 strongly stimulates CYP7B1 promoter in the presence of ERα in HEK 293 cells ...... 29 E2 increases CYP7B1 mRNA levels in the presence of ERα in HEK293 cells ..29 E2 stimulates CYP7B1 activity in the presence of ERs in HEK293 cells ...... 29 Implication of estrogen regulation on CYP7B1 in the presence of ERs ...... 30 E2 aff ects CYP7B1 enzyme activity in the absence of ERs in HEK 293 cells ....31 Implication of estrogen eff ect on CYP7B1 in the absence of ERs ...... 31 Overexpression of ERs increases CYP7B1 promoter activity in LNCaP cells (Paper III) ...... 31 3βAdiol and E2 suppress CYP7B1 promoter activity in LNCaP cells (Paper III) ...... 32 Androgens Regulate CYP7B1 (Paper III) ...... 32 DHT suppresses CYP7B1 promoter activity and CYP7B1-mediated catalytic activity in HEK293 cells ...... 32 DHT suppresses CYP7B1 promoter activity in LNCaP cells ...... 33 Possible implications of hormonal regulation of CYP7B1 for prostate proliferation ...... 33 CYP27A1...... 34 PMA, dexamethasone, thyroid hormones, growth hormone and IGF-1 regulate CYP27A1 (Paper I) ...... 34 Growth hormone, IGF-1 and dexamethasone stimulate the human CYP27A1 promoter activity in HepG2 cells ...... 34 Th yroid hormones and PMA repress the human CYP27A1 promoter activity in HepG2 cells ...... 35 Eff ects of PMA, dexamethasone, thyroid hormones, growth hormone and IGF-1 on the endogenous CYP27A1 activity in HepG2 cells ...... 35 Experiments with progressive deletion constructs of the human CYP27A1 promoter ...... 36 Estrogens and androgens regulate CYP27A1 (Paper IV) ...... 36 Estrogens and androgens aff ect CYP27A1 promoter activity in HepG2 cells .....36 Estrogens and androgens aff ect endogenous CYP27A1 enzyme activity and mRNA levels in HepG2 cells ...... 36 Eff ects of estrogens and androgens on CYP27A1 promoter activity in human prostate cells ...... 37 Experiments with deletion constructs of the CYP27A1 promoter ...... 37 Sequence analysis of the human CYP27A1 5´-fl anking sequence ...... 38 Biological signifi cance of regulation of CYP27A1 by sex hormones ...... 40 Dexamethasone-induced eff ect on the CYP27A1 promoter is mediated via GR (Paper V) ...... 41 Mifepristone abolishes the dexamethasone-induced eff ect on CYP27A1 promoter activity ...... 41 Deletion construct analysis of GR-mediated eff ects on the CYP27A1 promoter ...... 42 Identifi cation of GR-binding sites in the CYP27A1 promoter ...... 42 Site-directed mutagenesis of sequences in the CYP27A1 promoter ...... 42 Mechanism and biological role of glucocorticoid-mediated induction of CYP27A1 transcription ...... 42 Summary and Conclusions ...... 44 Acknowledgements...... 46 References ...... 48 Abbreviations

3βAdiol 5α-Androstane-3β,17β-diol 27-hydroxycholesterol 5-Cholestene-3β,27-diol AR Androgen receptor CYP Cytochrome P 450 DHT 5α-dihydrotestosterone DHEA Dehydroepiandrosterone DMSO Dimethylsulphoxide DPN 2,3-bis(4-Hydroxyphenyl)-propionitrile E2 17β-estradiol ER Estrogen receptor ERE Estrogen response element GAPDH Glyceraldehyde-3-phosphate dehydrogenase GR Glucocorticoid receptor GRE Glucocorticoid response element HEK Human embryonic kidney HRE Hormone response element MR Mineralocorticoid receptor PMA phorbol 12-myristate 13-acetate PPAR Peroxisome proliferator-activated receptor PPT 4,4’,4’’-(4-propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol PR Progesterone receptor PRE Progesterone response element RAR, RXR Retinoic acids receptor RLU Relative light units TR Th yroid hormone receptor TRE Th yroid hormone response element VDR Vitamin D receptor

Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Introduction

Cholesterol homeostasis and bile acid biosynthesis Cholesterol is an indispensable component of all cellular and intracellular membrane structures. Approximately 50-75% of the total cholesterol is synthesized endoge- nously, most of which is formed in the liver. It can be metabolized to various products such as bile acids and steroid hormones. (Norlin and Wikvall, 2007). Cholesterol is mainly removed from the body by the conversion into bile acids and the biliary excretion. Every day about 500 mg of cholesterol is converted into bile acids in the adult human liver. Th is bile acid production is 90% of the cholesterol that is actively metabolized in the body, and steroid hormone biosynthesis accounts for the remaining 10%. Newly synthesized bile acids are secreted into the bile and delivered to the lumen of the small intestine where they are emulsiﬁ ers of dietary lipids, cholesterol, and fat-soluble vitamins. Th e solubilized nutrients bind to lipoproteins, which are delivered to the liver and metabolized. Bile acids are transported back from the intestine to the liver via the portal circulation and then resecreted into the bile. About 95% of bile acids are recovered in this way, and the lost 5% are replaced by new synthesis in the liver (Russell, 2003). Cholesterol is metabolized into bile acids by pathways that involve about 17 dif- ferent enzymes, many of which are preferentially expressed in the liver. Th ere are two main pathways for the conversion of cholesterol into bile acids: the neutral/classic pathway and the acidic/alternative pathway (Fig. 1). Th ere are also minor pathways such as via 24-hydroxylation of cholesterol or 25- hydroxylation of bile acid intermediates (Norlin and Wikvall, 2007). Bile acid synthesis is tightly regulated to maintain cholesterol homeostasis and to provide adequate emulsiﬁ cation in the intestine. When an organism is normal, excess bile acids suppress further synthesis, and conversely when bile acids are in short supply, synthesis is increased. Disturbance of cholesterol homeostasis and bile acid synthesis is related to serious diseases, for instance, atherosclerosis, Alzheimer’s disease and various liver diseases. Th us, the regulation of the key enzymes in those two pathways is of great importance for understanding the mechanism of these diseases. Th ese key enzymes may also be drug targets for curing these diseases.

Cytochrome P450 monoxygenase system Cytochrome P450 is a cellular chromophore. It was ﬁ rst named in 1961 because when it is reduced and bound to carbon monoxide, the pigment (P) has an absor-

11 Wanjin Tang

Figure 1. Biosynthesis of primary bile acids from cholesterol.

bance peak at 450-nm. Sequence comparisons indicated extensive similarity between cytochromes P450 identiﬁ ed in man and bacteria, and suggested that the superfamily originated from a common ancestral gene some three billion years ago (Nebert and Gonzalez, 1987). Cytochrome P450 proteins are divided further into families and subfamilies on the basis of percentage amino acid sequence identity (Nebert and Gonzalez, 1987), (Nebert et al., 1987). Enzymes that share ≥40% identity are classiﬁ ed into a particular family designated by an Arabic numeral, whereas those sharing ≥55% identity make

12 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes up a particular subfamily designated by a letter. For example, in the CYP7 family, enzymes share ≥40% sequence identity. CYP7A and CYP7B are subfamilies, because their protein sequences are <55% identical. (If an additional enzyme was found to have ≥55% identity with the CYP7A, then it would be named CYP7A2, etc.) Up till now, it is known that human beings have 57 CYP genes and 58 pseudogenes arranged into 18 families and 43 subfamilies (Nelson et al., 2004). Th ese 57 genes code for enzymes that can be related to: metabolism of drugs and other foreign chemicals, cholesterol homeostasis, bile acid biosynthesis, steroid synthesis and metabolism, metabolism of arachidonic acid and eicosanoids, and vitamin D3 synthesis and metabolism; retinoic acid hydroxylation; and some have still unknown function. Mutations in many CYP genes will result in inborn errors of metabolism and cause many diseases (Nebert and Russell, 2002). Every Cytochrome P450 enzyme contains a single protein and one haem group. Th e haem group binds oxygen through electron transfer reactions from NADPH and this reaction ﬁ nally incorporates one atom of oxygen into the substrate. Th e typical mono-oxygenation reaction catalysed by cytochrome P450 can be described as follows: P450 + + RH+NADPH+H +O2 NADP +H2O+R-OH R represents a substrate, for instance, a steroid, fatty acid or compound with an alkene, alkane, aromatic ring or heterocyclic ring substituent that serves as a site for oxygenation (Chang and Kam, 1999). First the substrate binds to the oxidized cytochrome P450. Th e formed complex is then reduced by an electron transferred from NADPH. For microsomal cytochrome P450 enzymes, this electron transfer reaction is catalyzed by NADPH-cytochrome P450 reductase. For mitochrondrial enzymes, this reaction involves ferredoxin and ferredoxin reductase. Th en after a series of reactions, the oxygen-oxygen bond will be broken, and one atom of oxygen is inserted into the substrate, the other atom will form H2O . Finally the hydroxylated substrate and H2O leave cytochrome P450. Cytochrome P450 information is updated on the internet: http://drnelson.utmem. edu/CytochromeP450.html

Steroid hormones and their receptors Steroid hormones include glucocorticoids, mineralocorticoids, progesterone, estrogens and androgens. Th ey are mainly produced in the adrenals, gonads, placenta and nervous system. Other tissues might also synthesize some though in much smaller quantities. Th e precursor for steroid hormones is cholesterol which is from three sources: de novo synthesis from acetate, pools of cholesterol esters in steroidogenic tissues and dietary sources. 80% of the cholesterol for hormone synthesis is from dietary sources. Most of the enzymes involved in steroid hormone synthesis are CYP450 enzymes (Gardner, 2007) (Fig. 4). Th e receptors of steroid hormones, thyroid hormones and vitamin D belong to the nuclear receptor superfamily. Th ey have variable N-terminal and C-terminal domains, which are activation function (AF) domains. Th ere is a central DNA-binding domain (DBD), which targets the receptor to speciﬁ c DNA sequence: hormone response ele-

13 Wanjin Tang

ment, in the target gene promoter. A hinge domain is in the middle. Th e C-terminal half of the receptor contains the ligand binding domain (LBD), which is for hormone recognition (Fig. 2). After being activated, these receptors can regulate target gene transcription by binding to their corresponding hormone response element in the target gene promoter region. (Mangelsdorf et al., 1995) (Fig. 3).

NH3AF-1 DBD Hinge LBD AF-2 COOH

Figure 2. Structural motifs of classical nuclear receptors.

Some receptors can also be activated by interacting with other proteins which will then bind to the corresponding response elements in the promoter and modulate gene transcription. For example, ERs can interact with the fos/jun transcription factor complex on AP1 site to aff ect gene transcription. Besides AP1, ERs can also interact with the Sp1 and NF-kB proteins (Nilsson et al., 2001). Non-genomic actions are a common property of steroid hormone receptors. Th ese actions usually involve various protein-kinase cascades. It has been suggested that there are ERs existing in the plasma membrane which can aff ect gene transcription through non-genomic action. Th e possible convergence of genomic and nongenomic actions of estrogen can fi nely regulate gene expression (Björnström and Sjöberg, 2005).

Receptor Element Sequence

GR,MR,PR,AR,ER HRE AGAACANNNTGTTCT

ER ERE AGGTCANNNTGACCT

TR, VDR,RAR, TRE AGGTCA(N) AGGTCA RXR,PPAR n

Figure 3. Response elements for main nuclear hormone receptors. Th e TRE is written as a direct repeat, but may also exist as a palindrome or an inverted palindrome. n= 3, 4, 5 are preferred for binding of the VDR, TR or RAR/RXR, respectively (modiﬁ ed from Greenspan’s Basic and Clinical Endocrinology 8th Edition, Gardner, G. David and Shoback, Dolores).

14 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Cholesterol Pregnenolone Progesterone Aldosterone

17 -Hydroxypregnenolone 17 -Hydroxyprogesterone Cortisol

Dehydroepiandrosterone (DHEA) Androstenedione Estrone CYP7B1 Androstenediol Testosterone Estradiol(E2) 7 -Hydroxy-DHEA

7-Dehydrocholesterol Dihydrotestosterone (DHT)

Vitamin D3 5 -Androstane-3 ,17 -diol (3 Adiol)

CYP7B1 25-Hydroxyvitamin D3 5 -Androstane-3 ,6 /7 ,17 -triol

1 ,25-Dihydroxyvitamin D3 (active form)

Figure 4. Pathways of synthesis of steroid hormones and the active form of vitamin D3.

Estrogens Estrogens are named for their importance in the estrous cycle, and functioning as the primary female sex hormone. Estrogens are used as part of some oral contraceptives and also in estrogen replacement therapy of postmenopausal women. Like other steroid hormones, estrogens readily diff use across the cell membrane; inside the cell, they interact with ERs (Nussey, 2001). Estrogens are produced mainly by developing follicles in the ovaries, the corpus luteum, and the placenta. Estrogens promote the development of female secondary sex characteristics and are also involved in the thickening of the endometrium and other aspects of regulating the menstrual cycle. In males estrogen regulates certain functions of the reproductive system important to the maturation of sperm (Hess et al., 1997). Estrogens are also known to infl uence cell proliferation e.g. in neurogenesis (Galea et al., 2006). Xenoestrogens are synthetic substances that also possess estrogenic activity (Fang et al., 2001). Phytoestrogens are natural plant products with estrogenic activity. Selective estrogen receptor modulators (SERM) are a class of compounds that act on the ER. A characteristic that distinguishes these substances from receptor agonists and antagonists is that their action is diff erent for various tissues, thereby granting the possibility to selectively inhibit or stimulate estrogen-like action in various tissues, such as tamoxifen and raloxifene. Th ey act as agonists of ER in one tissue and antagonists in another. Tamoxifen and toremifen are used for treating breast cancer, and raloxifene is mainly for prevention and treatment of osteoporosis. Designing a compound that acts in only selected tissues is one of the goals of SERM development.

15 Wanjin Tang

Androgens Androgens are steroid hormones, that stimulate or control the development and maintenance of masculine characteristics in vertebrates by binding to ARs. Th is includes the activity of the accessory male sex organs and development of male secondary sex characteristics. Androgens, which were ﬁ rst discovered in 1936, are also called androgenic hormones or testoids. Androgens are also the original anabolic steroids. Th ey are also the precursor of all estrogens, the female sex hormones. Th e primary and most well-known androgen is testosterone. Dihydrotestosterone (DHT), a metabolite of testosterone, is a more potent androgen in that it binds more strongly to ARs. Recent results show that androgens inhibit the ability of some fat cells to store lipids by blocking a signal transduction pathway that normally supports adipocyte function (Singh et al., 2006). Androgens also promote the enlargement of skeletal muscle cells and probably act in a coordinated manner to enhance muscle function by acting on several cell types in skeletal muscle tissue (Sinha-Hikim et al., 2004). Circulating levels of androgens can inﬂ uence human behavior because some neu- rons are sensitive to steroid hormones. Androgen levels have been implicated in the regulation of human aggression (Giammanco et al., 2005) and libido.

Glucocorticoids Glucocorticoids are a class of steroid hormones. Th ey exert their eff ects via interaction with their cognate receptor. Glucocorticoids are distinguished from mineralocorticoids and sex steroids by the specifi c receptors, target cells, and eff ects. Technically, the term corticosteroid refers to both glucocorticoids and mineralocorticoids, but is often used as a synonym for glucocorticoid. Cortisol (or hydrocortisone) is the most important human glucocorticoid. It is essential for life and regulates or supports a variety of important cardiovascular, metabolic, immunologic, and homeostatic functions. Glucocorticoid receptor (GR) is found in the cells of almost all vertebrate tissues. Glucocorticoids have potent anti-infl ammatory and immunosuppressive properties. Th is is particularly evident when they are administered at pharmacological doses, but also is important in normal immune responses. Th us, glucocorticoids are widely used as drugs to treat infl ammatory conditions such as rheumatoid arthritis, infl ammatory bowel disease, and asthma and dermatitis. Th ey are also prescribed in combination therapy for treatment of certain malignancies primarily due to their role in immune cell apoptosis and for their ability to palliate the side eff ects resulting from other chemotherapeutic agents (Smoak and Cidlowski, 2004). Chronic glucocorticoid excess leads to Cushing’s syndrome. Clinical features are obesity, skin changes, hirsutism, hypertension, gonadal dysfunction, central nervous system and psychologic disturbances, muscle weakness and osteoporosis. Dexamethasone is a potent synthetic member of the glucocorticoids. It is used as anti-infl ammatory or immunosuppressive agent. As a glucocorticoid, dexamethasone is roughly 20—30 times more potent than hydrocortisone. It is one of the longest acting corticosteroids used in clinical medicine.

16 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Prostate Prostate is the organ most commonly affl icted with either benign or malignant neo- plasms. AR is expressed in this organ, both at the epithelium and stroma. Andro- gens play a major role in normal prostate development, benign prostatic hyperplasia (BPH) and in established prostate cancer. Major circulating androgen is testosterone. DHT predominates in prostate and binds to AR with greater affi nity and lower dis- sociation constant than does testosterone. Consequently, DHT is the most potent intraprostatic androgen (Parnes et al., 2005). ERα is localized in the prostatic stroma and ERβ is located in the epithelium in most species. It has been reported that ERβ expression is often altered in diseased prostate. 3βAdiol is an important ligand for ERβ in the prostate (Weihua et al., 2002b). Prostate cancer is the most common tumor diagnosed in the western countries. It is one of the leading causes of cancer deaths in men. By early detection and improved local therapies, a large number of men will be cured, but unfortunately, a signifi cant number of men will experience relapse of disease and require continued surveillance and ongoing therapy (Walczak and Carducci, 2007). Prostate cancer develops most frequently in men over fi fty. Many factors, such as genetics and diets, have been implicated in the development of prostate cancer. Prostate cancer is most often discovered by physical examination or by screening blood tests, for instance, the PSA (prostate specifi c antigen) test. Prostate cancer can be treated with surgery, radiation therapy, hormone therapy, occasionally chemotherapy, or some combination of these. Hor- monal therapy uses medications or surgery to block prostate cancer cells from getting DHT, a hormone produced in the prostate and required for the growth and spread of most prostate cancer cells.

Sterol 27-hydroxylase (CYP27A1)

CYP27A1 (sterol 27-hydroxylase, P450c27, mitochondrial vitamin D3 25-hydroxylase) is a multifunctional mitochondrial P450 enzyme. It is present in many human body tissues such as liver, kidney, lung, macrophages, brain, vascular endothelium, skin and prostate (Gascon-Barre et al., 2001; Norlin and Wikvall, 2007; Quinn et al., 2005). It catalyzes hydroxylations in both the neutral and acidic bile acid biosynthesis pathways. In the neutral pathway, CYP27A1 initiates degradation of the

C27-steroid side chain. In the acidic pathway, it catalyzes the initial 27-hydroxylation of cholesterol (Vlahcevic et al., 1997). CYP27A1 is also involved in the bioactivation of vitamin D3 (Sawada et al., 2000). It catalyzes the 25-hydroxylation of vitamin D3 (Hosseinpour and Wikvall, 2000; Sawada et al., 2000). CYP27A1 expressed in extrahepatic tissues appears to have multiple functions, such as in cholesterol metabolism and transport and in the formation of active vitamin D metabolites (Babiker et al., 1997; Gascon-Barre et al., 2001; Quinn et al., 2005; Th eodoropoulos et al., 2001). CYP27A1 is reported to have anti-atherogenic eﬀ ects and play an important role in the regulation of cholesterol homeostasis by formation of oxysterols and elimination of cholesterol from cells (Babiker et al., 1997; Quinn et al., 2005). Th e active forms of vitamin D3, formed by CYP27A1, are found to have antiproliferative and pro-dif- ferentiating eﬀ ects on a variety of malignant cells, such as human prostate cancer cell lines (Chen and Holick, 2003; Tokar and Webber, 2005b; Tuohimaa et al., 2005).

17 Wanjin Tang

In addition, a major biologic role of CYP27A1 is believed to be the genera- tion of ligands such as 27-hydroxycholesterol and 3β-hydroxy-5-cholestenoic acid, which activate nuclear receptors regulating the expression of genes that govern many aspects of cholesterol homeostasis in various cells (Björkhem et al., 2002) (Norlin and Wikvall, 2007; Russell, 2000). 27-Hydroxycholesterol formed by CYP27A1 suppresses, via SREBP, the rate-limiting enzyme in cholesterol biosynthesis, HMG-CoA reductase (Chiang, 2002; Schroepfer, 2000). Th ere are several possible mechanisms in which CYP27A1 could play important roles for elimination of cholesterol from extrahepatic cells. 27-Hydroxycholesterol upregulates the genes for ABC-transport proteins in e.g. macrophages and thus stimulates the transport of cholesterol from the cell via reverse (HDL) cholesterol transport (Fu et al., 2001). Also, 27-hydroxycholesterol and other 27-oxygenated products formed by CYP27A1 are excreted from the cell more eﬃ ciently than cholesterol (Babiker et al., 1997) (Björkhem et al., 1994). 27-Oxygenated products formed in extrahepatic tissues can be transported to the liver and eliminated through conversion to bile acids. Th us, CYP27A1 and its gene may be potential targets for drug development. Th e regulation of the human CYP27A1 gene, such as by hormones, is of inter- est not only in therapy but also in understanding development of diseases related to disturbances in cholesterol homeostasis and vitamin D metabolism. Hormones like pituitary growth hormone, thyroid hormones and the protein kinase C stimula- tor phorbol 12-myristate 13-acetate (PMA) are known to regulate some enzymes in cholesterol metabolism such as the cholesterol 7α-hydroxylase (CYP7A1). Th yroid hormones and PMA have been reported to repress the promoter activity of the human CYP7A1 gene (Drover et al., 2002; Wang et al., 1996). In previous studies, there is no information about the eﬀ ects of these hormones or PMA on the activity of the human CYP27A1 gene promoter or the CYP27A1 enzyme activity.

CYP27A1, sex hormones and prostate

It has been suggested that vitamin D3 inhibits growth and invasion by up-regulating CYP27A1 in human prostate cancer cells (Tokar and Webber, 2005a; Tokar and

Webber, 2005b). Treatment of prostate cancer cells with vitamin D3 increases cell diﬀ erentiation and apoptosis and decreases proliferation (Chen and Holick, 2003) (Tuohimaa et al., 2005). Th ese eﬀ ects have been linked to CYP27A1 in prostate cells

since this enzyme is involved in formation of the active vitamin D3 metabolites 25-

hydroxyvitamin D3 and 1,25-dihydroxyvitamin D3 (Tokar and Webber, 2005a; Tokar and Webber, 2005b). Androgens and estrogens are known to inﬂ uence cell proliferation in prostate development and growth (Galea et al., 2006; Weihua et al., 2002a). Th ere are no previous data reported on the possible regulation of the human CYP27A1 gene by estrogen or androgen at promoter level.

Oxysterol 7α-hydroxylase (CYP7B1) and DHEA CYP7B1 is widely expressed in human tissues. It catalyses 7α-hydroxylation of sev-

18 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes eral steroid substrates, including cholesterol derivatives, neurosteroids and steroids involved in hormonal signalling (Norlin and Wikvall, 1998; Rose et al., 1997; Schwarz et al., 1997; Weihua et al., 2002a; Vlahcevic et al., 1999; Wu et al., 1999). Th e steroid hormone precursors dehydroepiandrosterone (DHEA) and pregnenolone, and the oxysterols 25-hydroxycholesterol and 27-hydroxycholesterol are well-known substrates for CYP7B1. High CYP7B1 mRNA levels are reported in human brain, particularly in the hippocampus, the brain region considered most important for memory and learning (Rose et al., 2001; Yau et al., 2006; Yau et al., 2003). It is reported that CYP7B1 mRNA levels in brains from patients with Alzheimer’s disease were decreased (Yau et al., 2003). DHEA and pregnenolone, which are produced locally in the brain and have been termed neurosteroids, are believed to exert multiple eff ects in the CNS (Wolf and Kirschbaum, 1999). Several studies, most of which have been performed with rodents, suggest that these steroids may modulate neuronal transmission and synaptic plasticity and aff ect GABA and NMDA receptors (Wolf and Kirschbaum, 1999). Other suggested functions for DHEA and/or 7α-hydroxy-DHEA include immunostimulating properties (Dulos et al., 2005). CYP7B1 displays high catalytic activity towards DHEA. Mainly produced in the adrenals, DHEA is an important precursor for androgens and estrogens (Pepe and Albrecht, 1995; Rainey et al., 2004). Large amounts of DHEA and DHEA-sulfate, its sulfated ester, are secreted from the adrenal gland into the circulation (Rainey et al., 2002). CYP7B1-mediated 7α-hydroxylation of DHEA results in a diff erent metabolic fate for these steroids, which does not lead to formation of sex steroids.

CYP7B1, sex hormones and prostate In recent years it has been proposed that CYP7B1-mediated metabolism may play an important role for growth of the prostate and other tissues via eff ects on ligands of ERβ, which modulates cellular proliferation and diff erentiation (Dupont et al., 2000; Jakobsson et al., 2004; Martin et al., 2004; Omoto et al., 2005; Pak et al., 2005; Weihua et al., 2002a). Growth, diff erentiation and function of the prostate are strongly infl uenced by androgens which mediate their eff ects through AR (Brinkmann et al., 1999; Cude et al., 1999; Cunha et al., 2004). DHT is believed to play an essential role for prostate function and growth, both in normal and disease conditions. Interestingly, DHT is enzymatically converted in the prostate to 3βAdiol, an estrogenic compound (Weihua et al., 2002a). 3βAdiol is present in much higher levels than E2 in human prostate and is reported to be a major intraprostatic estrogen (Weihua et al., 2002a; Voigt and Bartsch, 1986). Th us the most potent prostatic androgen is metabolized in the prostate to a compound with estrogenic eff ect. In studies using strains of knockout mice, Weihua et al. (Weihua et al., 2002a) observed that the prostates of CYP7B1-/- mice are hypoproliferative and that treatment with 3βAdiol, a ligand of ERβ and a substrate for CYP7B1, decreases proliferation in wild-type but not in ERβ-/- mice. From these fi ndings the authors proposed a pathway for control of prostate growth involving ERβ, 3βAdiol and CYP7B1. According to this pathway CYP7B1 regulates the function of ERβ by metabolizing its

19 Wanjin Tang

ligand 3βAdiol and thereby counteracts anti-proliferative action of ERβ. In this fashion, a balance between hormonal signalling via ER and AR is maintained. CYP7B1 may play a key role in the maintenance of this balance.

Hydroxysteroid- 5 -Reductase dehydrogenase Testosterone DHT 3 Adiol

CYP7B1 AR ER

Hydroxy- metabolites

PROLIFERATION

Excretion Figure 5. CYP 7B1 is involved in an endocrine pathway that regulates growth of the rodent ventral prostate. - Modiﬁ ed from Weihua et al. [Proc. Natl. Acad. Sci. U S A 99(2002)13589- 13594]

Previous studies on the regulation of CYP27A1 CYP27A1 activity and mRNA levels are decreased by bile acids in the rat, but unaf- fected in the rabbit and mouse (Vlahcevic et al., 1996). A coordinate regulation of sterol 27-hydroxylase (CYP27A1) and cholesterol 7α-hydroxylase (CYP7A1) by bile acids in rats has been reported (Vlahcevic et al., 1997). However, in humans, there appears to be little or no coordinate regulation of CYP7A1 and CYP27A1 at the transcriptional level, and human CYP27A1 is not subject to a negative feedback control by bile acids (Björkhem et al., 2002). Cholesterol stimulates sterol 27-hydroxylase levels in the rabbit (Norlin and Wikvall, 2007). It was reported that glucocorticoids, such as dexamethasone, probably increase post-transcriptionally sterol 27-hydroxylase mRNA in rat hepatocytes. It was suggested that dexamethasone also increases its protein mass and decreases its rate of protein degradation (Stravitz et al., 1996). Another report indicated that dexamethasone stimulates transcriptional activity of the human CYP27A1 gene (Segev et al., 2001).

Previous studies on the regulation of CYP7B1 Th ere were some reports about the regulation of CYP7B1 before I started work on my thesis. Sp1 was suggested to play a role in the basal transcription of CYP7B1 (Wu

20 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes and Chiang, 2001; Wu et al., 1999). CYP7B1 transcription was suppressed by sterol response element binding protein (SREBP), indicating a link between oxysterol- sensitive regulators and oxysterol metabolism (Norlin and Chiang, 2004). Rodent CYP7B1 expression has been shown to be aff ected by bile acids. CYP7B1 levels in rat hepatocytes are aff ected by cholesterol and squalestatin, a cholesterol synthesis inhibi- tor (Pandak et al., 2002). In the rat CYP7B1 and CYP7A1 were found to undergo diurnal variation, with peak and trough values for CYP7B1 lagging approximately 6 hours behind CYP7A1 (Ren et al., 2003). CYP7B1 levels were reported to be aff ected by thyroid hormones, glucocorticoids and cytokines (Norlin and Wikvall, 2007). An age-related expression pattern of CYP7B1 in the pig was reported in a study by Norlin (Norlin, 2002). Th is study showed marked age-dependent, tissue-specifi c variations in renal and hepatic CYP7B1 levels, suggesting that hormonal factors may be involved in the regulation of this enzyme (Norlin, 2002).

21 Wanjin Tang

Aims of the Present Investigation

Th e aims of the present investigation were:

1. to study if hormones such as glucocorticoids, estrogens and androgens regulate human CYP27A1 and CYP7B1 genes in human tissues. If so, further aims are as follows

2. to study how diﬀ erent hormones regulate CYP27A1 and CYP7B1 in human tissues/cells, including liver for CYP27A1, embryonic kidney for CYP7B1 and prostate for both enzymes

3. to understand the implication of their regulation

4. to study the mechanisms of their regulation.

22 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Experimental Procedures

Materials 27-Hydroxycholesterol, prepared from kryptogenin, was kindly provided by Dr. L. Tökes, Syntex, Palo Alto, CA, USA. Expression vectors containing murine ERβ (orig- inally cloned by Dr. Jan-Åke Gustafsson, Sweden (Kuiper et al., 1996)) or ERα were gifts from Dr. Kenneth Korach, National Institute of Health, NC, USA. Th e expression vectors containing human ERα and ERβ (HEG0), respectively were generously provided by Dr. Pierre Chambon, Institut de génétique et de biologie moléculaire et cellulaire, Strasbourg, France. Th e pSV-AR expression plasmid containing human AR was a kind gift from Dr. A. Brinkmann, Erasmus Medical Centre, Rotterdam, the Netherlands. Empty pSV vector, used as control in experiments with AR, was prepared from the AR expression vector by digestion with SmaI, which removes most of the AR gene fragment, followed by religation of the vector. Th e expression plasmid containing human GR was kindly provided by Professor Ronald M. Evans, Howard Hughes Medical Institute, Th e Salk Institute, San Diego. CYP7B1 promoter-luciferase reporter gene constructs were generous gifts from Dr. John Chiang, Northeastern Ohio Univ. College of Medicine, Rootstown, USA and were generated as previously described (Wu and Chiang, 2001; Wu et al., 1999). Th e 4.2 kb DNA fragment of human CYP27A1 upstream of the translation-initiation codon was a generous gift from Professor Eran Leitersdorf (Hadassah University Hospital, Jerusalem, Israel). Th e CYP27A1-4.2kb-luciferase plasmid and three progressive deletion constructs of CYP27A1 promoter ligated in pGL2 vectors were prepared as described in Paper I. All remaining materials were purchased from commercial sources.

Cell culture HEK293 cells and HepG2 cells were maintained in Dulbecco’s modiﬁ ed Eagle’s medium (DMEM) with 10% (v/v) fetal bovine serum and 1% (v/v) penicillin and streptomycin. LNCaP cells were cultured in RPMI 1640 medium (Invitrogen no. 21875-034) supplemented with 10% (v/v) fetal bovine serum and antibiotics. RWPE- 1 cells were grown in complete keratinocyte serum-free medium containing 50 µg/ml bovine pituitary extract and 5 ng/ml epidermal growth factor supplements and 1% antibiotics. Medium was changed every 72 h. When cells were 90% conﬂ uent, they were lifted by trypsin/EDTA and passaged. Cells were treated with E2, DHT, 3βAdiol or other hormones dissolved in ethanol, dimethylsulphoxide (DMSO) or 45% (2-hydroxypropyl)-β-cyclodextrin. Some

23 Wanjin Tang

cells were starved of serum overnight or for several hours before hormone treatment. Th e same solvent volume was added to control cultures. Cells were cultured in 6-well tissue culture plates for assay of CYP7B1-mediated or CYP27A1-mediated catalytic activity and in 24-well plates for assay of reporter activity.

Transient transfection In experiments to study the eﬀ ects of ER, AR, GR on CYP7B1 or CYP27A1 activity, cells were transiently transfected with expression vectors containing ERα, ERβ, AR or GR using SuperFect transfection reagent (Qiagen), calcium co- precipitation or Lipofectamine 2000 reagent (Invitrogen). Control experiments were performed with empty vector to normalize the amounts of DNA transfected. Th e CYP7B1 reporter vector contained a DNA fragment spanning from -2771 to +189 of the human CYP7B1 promoter sequence (Wu and Chiang, 2001; Wu et al., 1999). Calcium co- precipitation was used for HEK293 and HepG2 cells, and Lipofectamine 2000 was for LNCaP and RWPE-1 cells.

Promoter-luciferase reporter assay In experiments to study the eff ects of hormone treatment on the CYP27A1/CYP7B1 promoter activity, cells were transiently transfected with a human CYP27A1/CYP7B1 promoter-luciferase reporter gene and pCMV β-galactosidase plasmid (to control transfection effi ciency). In control experiments, the empty vectors of the receptor plasmids were transfected to normalize the amounts of DNA transfected. Luciferase and β-galactosidase activities were assayed as previously described (Ellfolk et al., 2006; Wu and Chiang, 2001). Luciferase reporter activity was expressed as relative light units (RLU) divided by β-galactosidase activity (expressed as absorbance at 420 nm). Luciferase activity was measured using TD-20/20 Luminometer, Turner Designs. Th e β-galactosidase reagent contains 100xMg-solution: ONPG (4mg/ml): 0.1M sodium phosphate buff er (ratio, 1:22:67).

Quantitation of CYP7B1 and CYP27A1 mRNA Total RNA was isolated from HEK293 cells or HepG2 with RNeasy total RNA Mini isolation kit (Qiagen). Quantitation of CYP7B1 mRNA in HEK293 cells and in multiple human tissue cDNA panels (BD Biosciences Clontech), and CYP27A1 mRNA in HepG2 cells were performed by real time RT-PCR as described by Holmström et al. (Holmström et al.,2003). Real time PCR analysis (TaqMan assay) was performed with cDNA obtained by reverse transcription of total RNA isolated from the cells or from multiple human tissue cDNA panels, using an ABI PRISM® 7000 Sequence Detec- tion System (Applied Biosystems) or Bio-Rad iCycler, according to the manufacturers’ recommendations. Th e amount of cDNA in the tissue panels (BD Biosciences Clon- tech) had been normalized to mRNA expression levels of several housekeeping genes to standardize the amount of cDNA present within each panel. PCR ampliﬁ cation

24 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes was performed with the gene-speciﬁ c TaqMan probes and primers for human CYP7B1 designed by Applied Biosystems (article no: Hs00191385_m1). CYP27A1 probes and primers are also designed by Applied Biosystems (article no: Hs00168003_m1). Eukaryotic 18S rRNA (Applied Biosystems, article no: Hs99999901_s1) and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Applied Biosystems, article no: Hs99999905_m1) were used as endogenous control. Target and control were ampliﬁ ed in duplicates or triplicates as singleplex assays. All expression data were normalized to the endogenous control. Th e relative mRNA expression levels were ∆∆ calculated according to the comparative CT ( CT) method (for CYP7B1 expression in HEK293 cells) or the standard curve method (for CYP7B1 expression in multiple tissue cDNA panels and for CYP27A1 expression in HepG2 cells) as described by the manufacturer.

Assay of CYP7B1 enzyme activity Endogenous CYP7B1 activity in HEK293 cells was measured by incubation with 27- hydroxycholesterol (5 µM) or DHEA (9 µM, 1 µCi), dissolved in DMSO or 45% (2- hydroxypropyl)-β-cyclodextrin. After incubation with substrate for 1-24 hours, cells were harvested and the medium was analysed for 7α-hydroxylated products. With regard to the use of assay with 27-hydroxycholesterol as substrate, it should be noted that, although several hepatic oxysterol 7α-hydroxylases have been reported (Norlin et al., 2000), CYP7B1 is the only sterol 7α-hydroxylase present in the kidney. In some experiments, CYP7B1 activity was assayed in microsomes prepared from HEK293 cells. Preparation of microsomes from untreated cells was conducted as described by Zissimopoulos and Lai (Zissimopoulos and Lai, 2005) and incubations with substrate were carried out at 37 °C for 60 min. Microsomes (0.3 mg) were incubated with DHEA (9 µM), 1 U of NADPH-cytochrome P450 reductase and 1 µmol NADPH in a total volume of 0.5 ml of 50 mM Tris acetate buﬀ er, pH 7.4, containing 20% glycerol and 0.1 mM EDTA. In incubations with cell microsomes, E2 was added to the incubations in concentrations varying between 0-0.6 µM. Incubations with medium from cell cultures or microsomes were extracted with ethyl acetate and 7α-hydroxylated products formed from DHEA or 27-hydroxycholesterol were analysed by HPLC as previously described (Norlin et al., 2000).

Assay of CYP27A1 enzyme activity HepG2 cells were transfected with the diﬀ erent receptor plasmids using calcium co- precipitation method. After 4 h the cells were treated with hormones which were dissolved in ethanol. Th e control cells were transfected with the corresponding empty vector and treated with ethanol. Cells were treated for 18 or 42 h. Th e CYP27A1 substrate 7α-hydroxy-4-cholesten-3-one (5 µM) dissolved in 45% (2-hydroxypropyl)-β-cyclodextrin was added to the medium and incubated during the last 13 or 24 h of treatment. CYP27A1 converts 7α-hydroxy-4-cholesten-3-one into 7α,27- dihydroxy-4-cholesten-3-one. Th e harvested medium was extracted with ethyl acetate and analysed directly for 27-hydroxylated product by HPLC as described (Norlin et

25 Wanjin Tang

al., 2003). Th e mobile phase was hexane/isopropanol (92:8). Th e retention time was about 7 min for the formed 27-hydroxylated product. In some experiments, radiolabelled 5β-cholestane-3α,7α-diol was added as CYP27A1 substrate to the cells. Th e medium and the cells were extracted with acidi- ﬁ ed diethyl ether or trichloroethane/methanol (2:1, v/v), and analysed for 27-hydroxylated product by TLC and radioactivity scanning (Wikvall 1984).

Electrophoretic mobility shift assay Electrophoretic mobility shift assay (EMSA) was carried out according to methods described (Norlin and Chiang, 2004) and in Paper V. Human GR protein was translated in vitro using the TNT® Transcription/Translation System (Promega).

Site-directed mutagenesis Mutations were introduced into reporter constructs by PCR-based site-directed mutagenesis using the QuikChange Multi Site-Directed Mutagenesis Kit (Strata- gene, La Jolla, CA) according to the manufacturer’s instructions. Oligonucleotides with sequence changes corresponding to appropriate regions of the CYP27A1 promoter were designed as PCR-primers and used in mutagenesis with the wild-type construct designated 1094bp-CYP27A1-Luc (see Paper I) as template. Th is wild type construct contains a fragment spanning from –1094 to +128 of the CYP27A1 promoter sequence (Paper I). A reporter construct containing a mutation in a putative GRE-element between –824 to –819 was generated using the mutagenic primer -849CTGGGTCCTTCATTCCTGGCTTGAAacgGcTCTTTGACCCTGTATT- TATTTTATAC-794. Another construct contained a mutation in the putative GRE- element between –916 to –908 and was generated using the mutagenic primer -941GCCTAATTGAACTTAATATGCCCTTTaaaCgCTGGCTGCCTGTAAAT CACCAATTTTTC-882. Th ermal cycling was performed with the designed primers and wild-type reporter construct as template and was followed by digestion of parental template DNA with DpnI. Th e PCRs were then transformed into XL-10 Gold ultracompetent cells (Strat- agene). All mutations were veriﬁ ed by sequencing.

Statistical analysis Analysis of statistical signiﬁ cance was performed using Student’s t-test. P values <0.05 were considered statistically signiﬁ cant.

Other methods Assay of endogenous metabolism of E2 in HEK293 cells was performed by incubation of cell cultures with radiolabelled E2 (6 µM, 0.1 µCi) for 24 h and analysis by

26 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes silica gel thin layer chromatography with chloroform/ethyl acetate/acetone 60:20:10 (v/v/v) as the mobile phase (Williamson et al., 1985). Cell culture samples harvested immediately after addition of E2 were used as controls. Protein concentrations in microsomes and cell homogenates were determined by the method of Lowry (Lowry et al., 1951).

27 Wanjin Tang

Results and Discussion

CYP7B1

Human CYP7B1 expression is age-dependent and tissue- specifi c (Paper II) CYP7B1 expression in diff erent human tissues was compared. CYP7B1 mRNA levels were quantitated by real time PCR in human multiple tissue cDNA panels (Clontech), containing cDNA from a number of adult and fetal tissues. Th e results demonstrate a striking age-dependent variation in expression pattern among diff erent human tissues. PCR data showed that the mRNA levels of CYP7B1 in almost all the fetal tissues were higher than the corresponding adult ones (by 2 to 20-fold, varying in diff erent tissues), except in the liver where the level was higher in the adult than in the fetus. Adult liver contained about twice as much CYP7B1 mRNA as fetal liver. Th e highest fetal CYP7B1 levels were found in lung and kidney. In fetal tissues, the expression levels of CYP7B1 were in this order: lung >> kidney >> heart ≅ brain ≅ liver >> skeletal muscle; whereas the levels in adult tissues were: liver ≅ lung >> kidney >> brain > heart >> skeletal muscle. Th ese results are in agreement with the previous data on the pig which showed an age-dependent increase in hepatic CYP7B1 levels whereas renal CYP7B1 decreased with age (Norlin, 2002). From the present data it may be concluded that human CYP7B1 expression is age-dependent and tissue-specifi c and that CYP7B1 levels are higher in fetal than in adult extrahepatic tissues. Th e present data, showing age-dependent and tissue-specifi c diff erences in human CYP7B1 expression, indicate a developmental regulation of this enzyme. Also, the high levels found in fetal tissues suggest that CYP7B1 is important in fetal development. Tissue-specifi c variation in CYP7B1 expression has been reported in studies on CYP7B1 in other species (Bean et al., 2001; Norlin, 2002). Hepatic developmental expression of CYP7B1 seems to be diff erent in mice as compared to humans and pigs, since hepatic CYP7B1 is reported to be undetectable in newborn mice (Bean et al., 2001). Bean et al. studied the ontogeny of CYP7B1 in mouse fetus and found widespread expression in fetal extrahepatic tissues which became restricted to fewer organs towards birth. Because the highest expression was observed in early gestation, when the fetus is most vulnerable to steroid excess, these authors suggested that the pattern of CYP7B1 expression could refl ect a protective role for this enzyme in fetal development (Fig. 6).

28 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

450 400 Adult 350 Fetal 300 250 200 150 100 50 Relative quantity of CYP7B1 mRNA 0 Brain Heart Lung Liver Kidney Skeletal Muscle Figure 6. In a series of experiments, CYP7B1 mRNA levels were quantitated by real-time PCR in human tissues of adult and fetal origin.

Estrogens regulate CYP7B1 (Paper II, III)

E2 strongly stimulates CYP7B1 promoter in the presence of ERα in HEK 293 cells Th e eff ects of E2 and its receptors on a human CYP7B1 luciferase reporter gene were examined. Treatment with E2 in the absence of ER did not signifi cantly aff ect CYP7B1 promoter activity. Cotransfection of ERα and treatment with E2 resulted in substantial stimulation (by two to four-fold) of CYP7B1 promoter activity. Th e eff ect of E2 under these conditions was dose-dependent. Similar experiments with ERβ showed much less eff ect on the CYP7B1 promoter.

E2 increases CYP7B1 mRNA levels in the presence of ERα in HEK293 cells Th e mRNA levels of CYP7B1 were quantitated by real time RT-PCR in cells transfected with ER and treated with E2. Data showed a signifi cant increase of CYP7B1 mRNA by E2 (about 50%) in the presence of ERα. Transfection of ERβ appeared to result in a slight increase of CYP7B1 mRNA, although not high enough to be statistically signifi cant. Experiments were also performed to investigate if the mRNA level of CYP7B1 is aff ected by E2 in the absence of receptors. However no signifi cant eff ects of E2 on CYP7B1 mRNA could be detected by real time RT-PCR under these conditions.

E2 stimulates CYP7B1 activity in the presence of ERs in HEK293 cells HEK293 cells were transfected with expression vectors containing ERα or ERβ and cultured for various time periods prior to assay of CYP7B1 activity. Overexpression of ERα or β resulted in a signiﬁ cant E2-mediated increase of CYP7B1 activity. Th is is in contrast to the eﬀ ect of E2 treatment alone, resulting in suppression of CYP7B1. Overexpression of ERα or β resulted in an E2-mediated increase of endogenous

29 Wanjin Tang

CYP7B1 activity by about 50%. Th ese fi ndings indicate a role for ER in estrogen- mediated regulation of CYP7B1. It is possible that the diff erent conditions used in our experiments may refl ect situations in diff erent cell types, suggesting that the eff ect of E2 is diff erent depending on whether receptors are present or not.

Implication of estrogen regulation on CYP7B1 in the presence of ERs CYP7B1 converts DHEA into a hydroxyderivative that does not serve as a precursor for estrogens. Th erefore, up-regulation of CYP7B1 should lead to less DHEA available for estrogen synthesis, consequently resulting in less estrogen being formed. In this way CYP7B1 may divert excess DHEA from the sex hormone biosynthetic pathway into another metabolic route (Fig. 7). Th is route will probably lead to excretion of DHEA from the cell since the hydroxyderivative is comparatively polar. Th e widely expressed CYP7B1 may be important for controlling DHEA levels throughout the body, so as to maintain adequate cellular levels of estrogens and androgens. Th is function may be of particular importance during fetal development, which is one of the two periods in life when DHEA reaches its highest serum concentration (Rainey et

al., 2002). Placental estrogen formation is dependent on C19-steroid precursors such as DHEA which is secreted in large amounts by the fetal adrenal cortex. However, excessive levels of estrogens or other sex steroids are deleterious to the development of fetus (McLachlan et al., 2001). DHEA Androstenedione Testosterone

CYP7B1 ER Estrogens

7 -Hydroxy-DHEA

Figure 7. Suggested mechanism: up-regulation of CYP7B1 should lead to less DHEA available for estrogen synthesis, consequently resulting in less estrogen being formed.

Estrogen-mediated regulation of CYP7B1 also may have implications for our understanding of steroid action in other processes. E2, DHEA and pregnenolone are neuro- active steroids which are reported to have neuroprotective and neuroenhancing functions (Brinton, 2001; Rose et al., 1997). Rose et al., 1997 proposed that CYP7B1, which is highly expressed in the hippocampus, might be pivotal for the action of neurosteroids such as DHEA on cognition and behaviour. It is at present unclear whether there is a connection between the reported eﬀ ects by estrogen and the proposed role(s) of DHEA and pregnenolone in the CNS. However, it may be concluded that regulation of CYP7B1 is a means by which estrogen could aﬀ ect the levels of DHEA and pregnenolone in the brain, thereby modulating their action. Another

30 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes interesting potential connection between estrogens and CYP7B1 is related to cellular proliferation. Although the precise mechanisms remain to be elucidated, CYP7B1 action was recently associated with eﬀ ects on cellular proliferation via ligands of ERβ (Martin et al., 2004; Weihua et al., 2002a).

E2 aff ects CYP7B1 enzyme activity in the absence of ERs in HEK 293 cells E2 (1 µM) was added to the culture medium of HEK293 cells. After treatment for 6 or 48 h and subsequent incubation with CYP7B1 substrate, the medium was extracted and the organic phase was analysed by HPLC. From earlier studies it is known that almost all of the 7α-hydroxylated product is secreted to the medium (Norlin et al., 2000). E2 signifi cantly aff ected CYP7B1 levels, resulting in a marked inhibitory eff ect (by about 30-50%) of CYP7B1 activity. Th e eff ects of E2 on CYP7B1 activity at diff erent incubation time periods and concentrations were examined. Treatment times between 12-24 h resulted in the most pronounced eff ects. A signifi cant decrease of CYP7B1 activity by about 40% was observed when cells were treated with E2 in concentrations between 0.04 nM and 1 µM.

Implication of estrogen eff ect on CYP7B1 in the absence of ERs Th e mechanism for the potentially interesting ER-independent suppression by E2, observed in our experiments, is diffi cult to explain at this point. Since eff ects on the enzyme level seem to be excluded, it may be speculated that the suppression could be due to a post-transcriptional regulatory mechanism, perhaps through intracellular second messengers. Another possibility is that the observed ER-independent eff ects by E2 on CYP7B1 may refl ect presently unknown cell-specifi c functions. It has been suggested that estrogen might aff ect DHEA production in the adrenal cortex through ER-independent mechanisms (Gell et al., 1998). Anyway, these results suggest that the eff ect of estrogen on CYP7B1 in cells that for some reason lose their expression of ER, such as some tumor cells, may be opposite to the eff ect in normal cells. Th is may have implications for the eff ect of estrogens in cancer treatment.

Overexpression of ERs increases CYP7B1 promoter activity in LNCaP cells (Paper III) In the prostate ERβ should be the ER subtype of greater importance for CYP7B1 function. ERβ is reported to co-localize with CYP7B1 in human prostate epithelial cells, whereas ERα is expressed in the prostate stroma (Härkonen and Mäkelä, 2004) (Martin et al., 2004). Levels of ERβ are reported to decrease in prostate cancer (Härkonen and Mäkelä, 2004). Prostate cancer LNCaP cells were transfected with an ERβ expression vector and treated with DPN, an agonist of ERβ, or with ICI 182,780, an ER antagonist. Overexpression of ERβ and treatment with DPN resulted in two to three-fold stimulation of the CYP7B1 promoter-luciferase gene. Treatment with ICI 182,780, an ER antagonist, abolished the eﬀ ect of ERβ on CYP7B1 promoter activity. Overexpression of ERα and treatment with the ERα agonist PPT in prostate cancer LNCaP cells showed a similar eﬀ ect as ERβ + agonist on the CYP7B1 reporter gene, resulting in stimulation by about two-fold.

31 Wanjin Tang

3βAdiol and E2 suppress CYP7B1 promoter activity in LNCaP cells (Paper III) It has been reported that CYP7B1-mediated metabolism of 3βAdiol may play a role for ERβ-mediated eff ects on prostate proliferation. 3βAdiol is a well-known ERβ ligand which also binds ERα albeit with a lower affi nity than for ERβ (Kuiper et al., 1997). Experiments were performed to examine the eff ects of treatment with this estrogen on the CYP7B1 promoter-luciferase gene in prostate LNCaP cells. Sur- prisingly, treatment with 3βAdiol suppressed CYP7B1 promoter activity. Signifi cant suppression by this compound was observed both with and without overexpression of ERβ. Th e suppression of CYP7B1 promoter activity was about 30-50% for concentrations between 1-100 nM of 3β-Adiol. Th e eff ect by this compound on CYP7B1 may be mediated via ER even though the results of our experiments can not provide conclusive evidence that this is the case. Furthermore, the suppressive eff ect of 3βAdiol observed in our experiments was not counteracted by overexpression of ERβ. Th e endogenous expression of ERβ in LNCaP cells may be suffi cient for mediating suppression of CYP7B1 by 3βAdiol. Treatment of LNCaP cells with E2 resulted in suppression of CYP7B1 promoter activity in a similar fashion as was observed for 3βΑdiol, by about 50% at a concentration of 100 nM. From the present and previous data (Paper II), it seems that CYP7B1 transcription is aff ected by ERs. Surprisingly, even though overexpression of ER and treatment with ER agonists stimulated promoter activity, treatment with just the ER ligands 3βAdiol and E2 suppressed the CYP7B1 promoter in prostate LNCaP cells. Th ese data indicate that in this cell type CYP7B1 expression is down-regulated also by estrogens. Th e role of estrogenic action in carcinogenesis remains unclear due to confl icting data from many reports using diff erent approaches and methodologies (Härkonen and Mäkelä, 2004). Possibly the physiological eff ects of estrogens may diff er among individual estrogenic compounds and eff ects may vary depending on dosage.

Androgens Regulate CYP7B1 (Paper III)

DHT suppresses CYP7B1 promoter activity and CYP7B1-mediated catalytic activity in HEK293 cells Treatment with DHT and cotransfection with AR signifi cantly suppressed the CYP7B1 promoter-luciferase reporter gene in kidney HEK293 cells. In the kidney cells, suppression by DHT was dependent on cotransfection with AR. Th is is probably due to low endogenous AR expression in HEK293 cells. Th e suppressive eff ect by DHT on CYP7B1 promoter activity in the presence of AR was about 40% in human embryonic kidney 293 cells at a concentration of 1 µM DHT. Consistently, treatment with DHT and cotransfection with AR also resulted in signifi cant suppression of endogenous catalytic CYP7B1 activity. Treatment with DHT without cotransfection of AR did not signifi cantly alter endogenous catalytic activity or promoter activity of CYP7B1 in kidney 293 cells. Th ese fi ndings indicate that the eff ect of DHT on CYP7B1 is indeed mediated via AR.

32 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

DHT suppresses CYP7B1 promoter activity in LNCaP cells Th e eff ects of treatment with DHT on a human CYP7B1 promoter-luciferase gene in prostate cancer LNCaP cells were examined. LNCaP cells are known to respond strongly to androgen treatment leading to induced proliferation (Cude et al., 1999). Treatment with DHT dramatically reduced CYP7B1 promoter activity, in a dose- dependent fashion. Suppression by DHT was about 40-80% for concentrations between 1-100 nM. Th e eff ects of DHT on promoter activity were studied with diff erent deletion constructs of the CYP7B1 promoter-luciferase gene. DHT inhibited the reporter activity of all constructs including the one containing the shortest promoter fragment. Th is indicates that sequence(s) involved in regulation by DHT are present in the proximal promoter region. Th e DHT-responsive element(s) in the CYP7B1 promoter remain to be identifi ed.

Possible implications of hormonal regulation of CYP7B1 for prostate proliferation Th e current study indicates that DHT is not only a precursor of 3βAdiol, but may also control 3βAdiol metabolism via eff ects on the CYP7B1 gene. Th ese fi ndings suggest that androgens might be able to control the intraprostatic levels of estrogen, a previously unknown connection between androgens and estrogens in the prostate. Th is may refl ect a mechanism to balance the levels of androgen vs estrogen in this tissue. Since 3βΑdiol is metabolized by CYP7B1, DHT-mediated suppression of CYP7B1 would lead to higher levels of 3βAdiol. Rising DHT levels in the prostate should therefore lead to rising levels also of 3βAdiol. Th is increase of estrogen levels may be a means to counteract eff ects of high androgen levels. It is possible that hormonal regulation of the CYP7B1 gene, may help to maintain a balance between androgen and estrogen levels adequate for prostate function and growth (Fig. 8). In LNCap cells

AR DHT 3 diol ER

CYP7B1

Hydroxymetabolites Figure 8. Suggested mechanism for regulation of sex hormone levels by CYP7B1 in LNCaP human prostate cancer cells: androgens (DHT) suppress CYP7B1 transcription, which will lead to decreased metabolism of 3βAdiol, thereby increasing the levels of 3βAdiol. As a result, rising levels of DHT would lead to rising levels of estrogen (3βAdiol). Th is may be a means to help maintain a balance between androgen and estrogen in the prostate.

33 Wanjin Tang

A mechanism for control of estrogen and androgen levels involving CYP7B1 may not be unique for prostate and kidney. Gustafsson and coworkers (Omoto et al., 2005; Weihua et al., 2002a) proposed that since CYP7B1 is abundantly expressed in tissues throughout the body, this enzyme may play a widespread role in regulating AR and ER balance in the body. Th e current study supports this proposed role for CYP7B1 and expands it to involve human cells. It should be noted that the data obtained by Weihua et al. (Weihua et al., 2002a) in connection with hormone function related to proliferation were obtained from experiments with mouse and rat. Th e present study suggests that CYP7B1 action may play an important role in this context also in humans. It can not be excluded that the control of androgen/estrogen levels and the mechanism of CYP7B1 action might be diﬀ erent in diﬀ erent cell types. For instance we currently do not know whether the mechanisms for regulation of CYP7B1 are dif- ferent in tumour cells as compared with normal cells. Th e current results, indicating that human CYP7B1 expression is involved in the careful control of prostatic androgen and estrogen levels, suggest an important function for this enzyme in connection with hormonal action in human prostate.

CYP27A1

PMA, dexamethasone, thyroid hormones, growth hormone and IGF-1 regulate CYP27A1 (Paper I)

Growth hormone, IGF-1 and dexamethasone stimulate the human CYP27A1 promoter activity in HepG2 cells Dexamethasone and growth hormone increased CYP27A1 promoter activity. Th e induction by dexamethasone was dose and time dependent. Maximal induction was found when the cells were treated with 1 µM of dexamethasone and harvested after 6 h of treatment. Treatment with 1 µM dexamethasone for 6 h increased the activity about three-fold compared with that in the untreated control cells. Th e induction by growth hormone was time dependent and the promoter acitivity increased up to at least 48 h. Treatment with 0.01-0.03 IU/ml of human growth hormone (2 IU/mg) for 48 h resulted in about twofold higher activity than in the controls. Many biological eff ects of growth hormone are mediated by IGF-1. In contrast to the two-fold induction observed with growth hormone, the luciferase activity of the largest CYP27A1-promoter fragment was not aff ected by IGF-1. However, when a shorter promoter sequence (1094bp) was used, a signifi cant stimulation was found.

34 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

-4158bp +128bp LUC

-1094bp +128bp LUC

-792bp +42bp LUC

-451bp +42bp LUC

Figure 9. Th e CYP27A1 promoter luciferase constructs, containing promoter fragments of diﬀ erent lengths, were used in Paper I, IV, V.

Th yroid hormones and PMA repress the human CYP27A1 promoter activity in HepG2 cells

Th yroxine (T4), triiodotyronine (T3) and PMA decreased the activity of the CYP27A1 promoter. Th e most marked repression was found when the cells, transfected with 4.2 kb-CYP27A1-Luc, were treated for 48 h with thyroid hormones and for 6 h with PMA. In the presence of 1 µM of thyroxine or triiodothyronine, the promoter activity was 30-40% of that in untreated, transfected control cells. PMA treatment resulted in an even more marked repression. It has been reported that the combined addition of thyroid hormone and dexamethasone stimulates bile acid formation in primary rat hepatocytes but tends to decrease bile acid formation in primary human hepatocytes (Ellis et al., 1998). In the present study, a separate set of experiments was performed with the combined addition of dexamethasone and thyroxine or triiodothyronine (1 µM and 24 h). Dexamethasone+thyroxine and dexamethasone+triiodothyronine, respectively, suppressed the promoter activity to 75 and 79 % of that with control cells.

Eﬀ ects of PMA, dexamethasone, thyroid hormones, growth hormone and IGF-1 on the endogenous CYP27A1 activity in HepG2 cells In HepG2 cells 5β-cholestane-3α,7α-diol is 27-hydroxylated by CYP27A1. To study the eﬀ ect of PMA, dexamethasone and thyroxine on the endogenous CYP27A1 activity, 5β-cholestane-3α,7α-diol was added as substrate to the transfected cells directly after addition of these compounds to HepG2 cells. Th e cells were treated for 6 h or 24 h. Th e medium was extracted and analysed for amount of 27-hydroxylated product formed during the period of treatment. PMA and thyroxine decreased the rate of formation of 27-hydroxylated product to, respectively, 15 and 55% of that in the control. Dexamethasone increased the endogenous CYP27A1 activity almost

35 Wanjin Tang

twofold. Treatment of non-transfected cells with growth hormone or IGF-1 increased the CYP27A1 activity about twofold. Th ese results are consistent with the eﬀ ects observed on the promoter activity.

Experiments with progressive deletion constructs of the human CYP27A1 promoter To identify regions of the human CYP27A1 promoter responsive to potential regulators, progressive deletion constructs were made for transient transfection assays in HepG2 cells (Fig. 9). Th e luciferase vectors harboring the fragments of 1094, 792 and 451 bp upstream of the CYP27A1 translation start were tested for responsiveness to IGF-1, dexamethasone, thyroxine, PMA and growth hormone following transfection of HepG2 cells. IGF-1 increased the promoter activities of all constructs. IGF-1 increased the activity of 451 bp-CYP27A1-Luc two-fold. Dexamethasone increased the activity of the1094- CYP27A1-Luc but not the constructs harboring shorter fragmants. Th yroxine and PMA repressed the activity of all constructs and repressed the activity of the 451- bp-CYP27A1-Luc, harboring the shortest fragment, by 55 and 68%, respectively. Growth hormone had no signiﬁ cant eﬀ ect on the activity of the constructs containing the shorter promoter fragments. Th e results indicate that putative response elements for IGF-1, thyroxine and PMA are located in the nt -451/+42 fragment and suggest that putative response elements for dexamethasone are located in the nt -1095/-792 fragment. As mentioned above, growth hormone increased the activity of the 4.2 kb-CYP27A1-Luc but not that of the constructs with shorter promoter fragments. Th ese data suggest that the response elements for growth hormone are located in a region upstream to nt -1094.

Estrogens and androgens regulate CYP27A1 (Paper IV)

Estrogens and androgens aff ect CYP27A1 promoter activity in HepG2 cells In Paper IV, experiments were performed with liver-derived HepG2 cells to study the eff ects of estrogen and androgen on CYP27A1. In this study, ERα, ERβ or AR was overexpressed in the cells to examine receptor-mediated hormonal eff ects. Overexpression of ERα or ERβ and treatment of the cells with estrogen inhibited CYP27A1 promoter activity by 60-70% in HepG2 cells. No suppression by estrogen was observed without overexpression of receptors. Th ese data indicate that the eff ects of estrogens on CYP27A1 are mediated by ERs. Overexpression of AR and treatment of the cells with androgen resulted in three- to fourfold enhancement of CYP27A1 promoter activity. No enhancement by androgen was observed without overexpression of receptor indicating that the eff ects of androgen are mediated by AR.

Estrogens and androgens aﬀ ect endogenous CYP27A1 enzyme activity and mRNA levels in HepG2 cells Experiments were performed to examine whether the endogenous CYP27A1 gene in HepG2 cells was aﬀ ected in the same way by sex hormones as the transiently

36 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes transfected CYP27A1 promoter-luciferase reporter gene. Th e endogenous CYP27A1 enzyme activity was measured as the rate of 27-hydroxylation of 7α-hydroxy-4-cholesten-3-one. Th e endogenous CYP27A1 enzyme activity (27-hydroxylase activity) in HepG2 cells was signifi cantly suppressed by estrogen in presence of ERs, and signifi - cantly increased by androgen in presence of AR. Th ese results are in agreement with the eff ects observed on the promoter activity. Experiments were carried out to quantitate CYP27A1 mRNA in HepG2 cells using real-time PCR. Th ese experiments showed statistically signifi cant eff ects by ERβ and AR on CYP27A1 mRNA levels. Transfection with AR and treatment with androgen resulted in about 30% increase of CYP27A1 mRNA levels. Transfection of cells with ERα or β and treatment with estrogen resulted in about 10-20% decrease of CYP27A1 messenger RNA levels. Th ese eff ects on mRNA levels are consistent with the eff ects on endogenous enzyme activity by the respective treatment. Taken together, the data on the regulation of CYP27A1 promoter activity together with the eff ects on endogenous CYP27A1 activity and mRNA levels strongly support a receptor-mediated transcriptional regulation of the endogenous CYP27A1 gene by estrogen and androgen in HepG2 cells.

Eff ects of estrogens and androgens on CYP27A1 promoter activity in human prostate cells Overexpression of ERα and treatment with estrogen resulted in a suppression of CYP27A1 promoter activity by about 70% in non-cancerous human prostate cells, RWPE-1 cells. Overexpression of ERβ and treatment of the cells with estrogen resulted in a suppression by about 50%. Treatment with androgen signifi cantly suppressed CYP27A1 promoter activity in RWPE-1 cells. In prostate cancer LNCaP cells (Elo et al., 1995), an ER-mediated enhancement of CYP27A1 promoter activity was found. Overexpression of ERα and treatment of human prostate cancer cells LNCaP cells with estrogen increased CYP27A1 promoter activity about three-fold. Overexpression of ERβ and treatment of the cells with estrogen resulted in about two-fold enhancement of the promoter activity. Th us, in contrast to the receptor-mediated suppression by estrogen in HepG2 and RWPE- 1 cells, an ER-mediated enhancement of CYP27A1 promoter activity was found in prostate cancer LNCaP cells. DHT had no signifi cant eff ects on the promoter activity in LNCaP cells in contrast to a suppression found in RWPE-1 cells. Th ese results indicate that androgens as well as estrogens have diff erent eff ects on CYP27A1 promoter activity in diff erent prostate cell lines.

Experiments with deletion constructs of the CYP27A1 promoter Experiments were conducted with progressive deletion constructs of the human CYP27A1 promoter in order to identify regions of the human CYP27A1 promoter responsive to ERs and ARs (Fig. 9 and 10). In HepG2 cells overexpressed with ERα, estrogen inhibited the reporter activity only of the construct containing the largest fragment. Th e results indicate that sequences involved in ERα-mediated suppression by estrogen are present in a region upstream of –1094. Intriguingly, the reporter activity increased markedly with the construct containing the 792 bp fragment, indicating putative ERα-mediated enhancing sequences in the region –792 to – 451.

37 Wanjin Tang

In cells overexpressed with ERβ, estrogen inhibited the reporter activity of all constructs including the one containing the shortest promoter fragment. Th is indicates that sequence(s) involved in ERβ-mediated suppression by estrogen is present in the proximal promoter region. Interestingly, the results from the experiments with progressive deletion constructs indicate that estrogen signalling for ERα and ERβ may be diff erent in HepG2 cells. Th e eff ects of androgens on promoter activity with diff erent deletion constructs of the CYP27A1 promoter-luciferase gene were also investigated. In HepG2 cells overexpressed with AR, androgen increased the reporter activity of the constructs containing the two largest fragments (4.2 kb and the 1094 bp fragments) two to threefold. Only small increase of reporter activity was obtained with the shorter fragments. Th e results indicate that sequence(s) most important for AR-mediated enhancement by androgen is present in a region upstream of –792. A putative androgen response sequence (ARE) can be found between nt –2453 and -2446 of the CYP27A1 promoter (Fig. 9 and 10). Experiments were also performed in LNCaP cells with progressive deletion constructs of the human CYP27A1 promoter in order to identify regions of the human CYP27A1 promoter responsive to estrogens. Experiments with promoter-deletion constructs in LNCaP cells revealed that, in this cell type, estrogen and ERα and ERβ stimulate the reporter activity of all constructs including the one containing the shortest promoter fragment. Th is indicates that sequence(s) involved in both ERα and ERβ-mediated upregulation by estrogen in LNCaP cells are present in the proximal promoter region. Th us, it seems that the ERβ-mediated eff ects in HepG2 and LNCaP cells are mediated by the same regions whereas ERα-mediated eff ects on CYP27A1 promoter are more complex.

Sequence analysis of the human CYP27A1 5´-ﬂ anking sequence Th e CYP27A1 promoter sequence from -4158 bp to +128bp region was computer analyzed for putative response elements considered of relevance for the observed hormonal eﬀ ects. Th e analysis was carried out using Transcription Element Search Soft- ware (TESS) [http://www.cbil.upenn.edu/] and the associated Transfac DATAbase (Computational Biology and Informatics Laboratory, University of Pennsylvania) (Fig. 10). In this promoter region there are several putative ERE-halfsites and putative binding sites for AP-1 and Sp1. AP-1 and Sp1 are factors known to be involved in ER-mediated regulation of some other genes. A putative androgen response element (ARE) can be found between -2453 and -2446 of the CYP27A1 promoter. Five putative GRE sites could be found at –1183/-1177, -935/-929, -916/-908, -824/-819, and –707/-700 (Paper V) (Fig. 9 and 10).

Biological signifi cance of regulation of CYP27A1 by sex hormones Th e information on the regulation of CYP27A1, particularly in humans has been limited (Quinn et al., 2005; Segev et al., 2001). Th e present study (Paper IV) is the fi rst reporting eff ects of estrogens and androgens on the regulation of CYP27A1 at promoter level in any species. Because estrogens are used in oral contraceptives, in hormone therapy of postmenopausal women and in cancer treatment, the question arises how CYP27A1 is infl uenced by estrogens. Th e present studies clearly show certain eff ects of estrogens and androgens on CYP27A1

38 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes C TG Sp1 GGTGGC Sp1 TAATATG GGAGTTTG GGCCGTGGCCT Sp1 ERE/ GRE ERE Sp1 GATTTCGAAAGAATCTCGCTGCACCCC CTGTATTTATTTTATACTTGCGTGAGTTA AGGCATTTTTGAACAAGCAAGGGCTATCCCTA B AP-1 CTTTGACC TCCGGGGACTCAGCACTCGACCCAAAGGTGCAGGCGCGC NF- GRE ERE AP-1 AAGGAACAAAAATACACAAGACAGGATAAGAGAGAGGAAGGATAC CCTCGCTCCGAACTGACTCCGGGATCAATCCGGAAGGCCATTGGG Sp1 AP-1/GRE AGAGCCAAGGCCGCGATCCCTGCCGCCCTCCCCTCGGACAAGGCCACCGGAGC CTTAGCCACGGCCGGTTCCCGTTCCCTCCAGGACGCGAGGGTCGCCTTGGGTGGG GCTGCGCTGGGCTGCGCGAGGCTGAGGTGGGCGCTGCGAGGGGCC GGCTGCCTGTAAATCACCAATTTTTCAAATGCTGTTAGAACCAGCTGTACCATCCTG ATG AGGGAGCGAGCGGGAAGGGGTCTAGCTGGCCTTTGCTCGGCCCTCCCCAGCGCCCGGCTT CTGCACTGCTGTCTGGGCGGG ERE/ Sp1 Sp1 GCTGTACGTTTTCCGTACTATGTTACTCTTTCCATTTTATTAAAAATAATTCTGGCCATCA TCGTTAATGGCTCCTAAGTCTTGAACTAGATCATATATATATATATATATATATAATTTTTTTT CCACGGGGCC AGAGTTCAGACCAAGCGAAAAGTTATTTGAGAGGCCTCGGGGGCGCGGGGTGAGGAGTCGTGGCG GRE ERE/Sp1 ERE/Sp1 CACCTCTAATTCCAGCTACTCTGGAGGCTGAGACCGGAGAATTGCTTGAACCGGGAGGCGGAGGTTG TTTCTTCTCT ERE ERE/Sp1 Sp1 ERE/Sp1 GRE ERE/Sp1 Sp1 Sp1 -781-711 TTTTTAAACTTTTTGACAACTATACTTTGAATATACATGAAACATAGGATTCATAAGACAATACTTTTTT TTTCTTCTT -151 GGGAGGAGCG -1341 GGG -921 CCC -291 CGCCC -361 GAACCGCGACCGGGCGAGGACCTATCCCGGTGTGGGGCTTCCC -1411 AGACCAGCCTGGCCAACATGGCAAAACCCTATCTCTACTAAAAATACAAAAATTAGCCGGGCGT -1691 TTTTGAGATGGAGTCTCACTCTGTTGTCCAGGTTGGAGTGCATGGCACAATCTCAGCTCACTGCAATCTC -1621 CGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGTCTCCCCAAGTAGCTGGGATCACGTGTGCCACCACG -1551 TTTTTAAAGCATGGCCTCCTGTCCTTCCTGTCCAAAAACCAAATGAAAAATATGGTCTAGGTTGGGTGCT -1481 GTGGCTCACACCTGTAATTCCAGCACTTTGGGAGGCCGAGGTAGGTAGATCATCTGAGGTCA -2111 TGGCATTTTTATTTGAGTCTTCTTTAGTGGGGCTGTATACAAAGATGTTATTTACATACTGGAGTGTGGC -2041 TCTCCTTTTTAGCTCTGGCTTTCTTAACTTTTGTGTCA -641-571 TCTACGAAATCTGGTCTCAACCTGCAGTTTGAAATATCCTGCCTTGGCAGACGCGGCAGGGAGGTGCGTG GAGGGAGAATTGAATTAAAAAAAAAAACAACAAAACACGAATATTTAGATTTCTTTGTTCAGCGGCCCC -501 CTCCAGGGATCAGATGACTGGCCCC +60 CTGCCC -431 AGAAGCCGAGGGCAG -1131 AGGGAGAGCTAACATACATATAGCAGTTTGAAGTCCCGGGAAAGGAGAAAAAAATGGGGAGGAGCAATAT -1061 TTGAACAGATAATATCTGAGAAACTCCCCAGACTGATCAAAGACATCCAGTCACAGAGTCAAGAAACTAG -991 GAGTCCTAGAATAAATAAGTAGAAAGCCACACCTAGCAACTCAGCTGTCAGCCTAATTGAACT -1971 AAGTCATGAGGCAGTATTGTCCTGGTGTACCATTGGGTAATAGTAGTTTCAGGATTAGTCTACTTGAAAG -1901 GAAATAAGTTCTGAGAGTCGAAGTGCAAAGGAATACAAAAGAAAGCATTCTTATGATCTAACACTGTGAA -1831 CTAATTGGTGTTTTCTGGTATTTGGTTAAGTATAGTATAAGGATTTGGCACTATAGGATGTAAGAGAATT -1761 ATGACC -81 TGAACCCGCC -221 GAGGCCTTGGTCGGGGCGCCGTGGATATCCCCGAGTCACCGCGTCCCTCTCCTGCAGCTCCCGCGTCGCT -11 GAGCACAACCC -851 CTGGGTCCTTCATTCCTGGCTTGAATGTGAT -1271 CAGCGAGCCAGGATTGCACCACTGCACTCCAGCCTGGACGACAGGGTGAGACTCTGGGGAGTGGGGAGGA -1201 GAGAATTAACAAACTATATGACACA Sp1 ATTA ERE/Sp1 TGGTGATCCGCCCACC GTGTTTTATATTTACT CACTTAGTAGGTATTT AGCTAATTTTTGTATTT CCAGGTAAAACTGGTGG ERE ERE AP-1 ERE/Sp1 AGCTGGTGCCACTCATGTTTGCAC TGTGTAATTTAATATGTTAATGAGTGTATA TGGAAATTCCTAGCTGCCTGTTTTAAGGGT CCTCGGCCTCCCAAAGTGCTGGGATTACAG ERE/Sp1 CTGGCCAGTATCCAGGTTCTTGACACCACTGC Sp1 Sp1 ERE AATCCAGTGCTGTGTTGGTTCCCATCAGTCTTAGCCAGCTTGG AAATAGTGAAAATATGGAGATTTATTGCAGTGAAAAGTACACAT GGCTAATTTTTTGTATTTTTAATAGAGACAGGGTTTCACCGTGTTA ERE CCCAGGTTCACGCCATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGA AP-1 TTGGCCATGTCTAGTTAGGGCA GGCCGCGTGTTGGTAAATCTTTTGAGCTGGCAGTCTAATTAATCCTGAGTTG Sp1 ACCACGCCC ERE ERE/Sp1 TTATTAGGAGAGTCTGAATCCGAGGCAGGGATTGGTTGGAATTTTTGTATGACC ERE/Sp1 ARE ERE/Sp1 Sp1 Sp1 ERE CTAGGGGAGGTCCCCAAATGTTGGTGAGACCTTGACC GCAGAGATTTTTATTCTTTATTTTTAAGGGTTGATGAGGGAGGGAGGAGGTCA -3581 TCGGCCTCCCAAAGTGCTGGGATCACAAGTGTGAGCCACTGTGCCC -3161 TTTTGTTGATTAGGGTCA -4001 TAAAGAAAGGGGAGTGTGGGCCGGCTCAAGAGAGGCAGTTGCACCAAGAGACAGTTGCACCATAGGGTTT -3931 AGAGTTACCATCTTTATGGGTTTCTTTAACCAAGGGGTGAATATTCATGAAGATTTCTGGAAAAAGGTAA -3861 AGATTTCTTGGAACTATGGTATCATCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3791 TTTTGTGACAGAGTCTCTCTCTGTAGCCCAGACTACAACCTCTGCCTCCCAGTCCCGGTTCAAGCAATTC -3721 TCCTGCCTCAGCCTCCTGAGTAGCTGGAATTACAGGCACGTGCCACCATGCCC -3231 C -4141 G -3371 CCCACATCTTGATTTTCGGGGTCTTCTTGGCCCTTGCAGCTATTTTAACAGTTTCCTTTTGCTAGTTGTG -3301 TGAAGCTGCTGCCTGGAATTGTTTATTTCCCTGCAACCACCGTGTATTATTCCTGCCTAATTTGACTGCC -3441 ATGAGGTCCTAGGTGAAACCTAGGTCA -3091 CCCAAGGGTGGG -2531 GCTTGAGCCACCATGCCC -3021 TTTTGACATGGAACTGCCATAATCCAGAAGACACAAACTTTATAAGGAGGTTAAACAAGCAAGGACCAAA -2951 GATTAGTAGAAATTAGAGTTATTAAAGGTTCCAGGAAAGGTAGGAACTGTGTCA -4071 AAGAAGGAATTCAAGGATGAGTCAGA -3651 TTAGTAGAGATGGGGTTTTACCATGTTGGCCAGGCTGGTCTTGAACTCCTGACC -2881 TTTTGATGAGGTCCCAGATGGTTTGAGCAGTGTGCTTATTGAAATTATGTAGCCAGGTAGCATGTTGGTA -2811 AATCTTTTTGTTTGTTTGTTTGAGACGGAGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGGCGTGATC -2741 TCGGCTCACTGCAAGTTCCGCCT -2671 CCACAGGCGCCCGCC -3511 CAAATATGGGTGCTCCTAGAACTGTCACAGCGCTGGTGGG -2461 TTAATATAAAGAACAGGTGTGGTTTATTACTGTGTAAACCCCTTTGTTTAGCTAGAAGATAAAGCCTTCT -2391 GCTTTTTGATCATTTGAATGGCTTATGTTTTGGCCCTGTTAGGGCCTCATACAATGGCTTAGCAATTCTG -2321 CAAAATCCTGCTATACCCAGGAAAGTTCTTAGGTTTTTTTTTTGTTGTTGTTGTTGTTTATAGAGGTTTT -2251 ACTTCTAAGTAAACTTTTGTTTGATGGACAAGGTCCAGTTTCCTGAGTTTAGAATATACTACAGGTATTT -2181 CACTTTTGGTAGAGAAATTTGGGCTTGGATGGAGAGAACTGATTTTTTTTAAGGAAGTTTAGGACTTGAA -2601 GCCAGGATGGTCTCGATCTCCCGACCTCGTGATCCGCCCT

Figure 10. Several putative regulatory elements and transcription factor binding sites in the CYP27A1 promoter are underlined and labeled.

39 Wanjin Tang

gene expression in liver-derived HepG2 cells. Th e eff ects may be diff erent in diff erent tissues. Th e possibility of a tissue-specifi c regulation by sex hormones is supported by our results with LNCaP prostate cancer cells and non-cancerous prostate RWPE-1 cells. Whether this diff erence in regulatory eff ects is due to diff erent properties of diff erent prostate cell lines or to altered properties of the CYP27A1 regulation in prostate cancer remain to be established. Hormonal action on the CYP27A1 promoter appears to be complex. In addition to cell-dependent eff ects, we also observed diff erences between receptor subtypes and diff erent promoter deletion constructs. For instance, whereas ERα suppressed the full-length promoter in HepG2 cells, deletion of a 3.4 kb long part of the promoter resulted in the opposite response. On the contrary, the response of diff erent promoter constructs to ERβ was similar. From the current data it seems that the CYP27A1 promoter should contain sequences able to mediate both stimulation and suppression by ER. ER-mediated regulation of transcription is often associated with binding of ER homodimers to estrogen response elements (ERE) in target promoters. However, regulation by ER can also involve interaction with sequences containing Sp1 and activator protein (AP-1) sites (Safe, 2001; Schultz et al., 2005). For instance, ERα-mediated transactivation may involve interaction between ERα and Sp1, aff ecting Sp1 sites and EREs or ERE halfsites (Safe, 2001). Interestingly, it has been reported that ER-mediated regulation involving AP-1 sites may lead to opposite eff ects depending on ER subtype. (Paech et al., 1997) reported that estrogen signalling via an AP-1 element resulted in stimulation by ERα but inhibition by ERβ. As mentioned above, the CYP27A1 promoter contains several putative binding sites for ER, AP-1 and Sp1. Further studies are required to evaluate the physiological role(s) of these sequences. It seems possible that cell-specifi c interactions with coactivators may be the reason for the diff erent eff ects we observed with diff erent cell types and receptor subtypes. Th ese results are consistent with reports on an increased risk for cardiovascular disease in postmenopausal women treated with estrogen plus progestin (Rossouw et al., 2002). Also, increased testosterone levels in men have been associated with a favorable lipid profi le (Alexandersen and Christiansen, 2004; Barrett-Connor, 1995; Khaw and Barrett-Connor, 1991; Tchernof et al., 1997; Zmuda et al., 1997). Th e diff erence in prevalence of atherosclerotic coronary disease between men and women can obviously not be explained by eff ects of estrogens and androgens solely on CYP27A1 expression. However, the eff ects described here by sex hormones on the expression of CYP27A1 may have impact on several processes in cholesterol homeostasis (Steinberg, 2006; Stoll and Bendszus, 2006). Activated vitamin D metabolites, that can be formed by CYP27A1, are known to have benefi cial eff ects on cell growth in extrahepatic tissues, such as in prostate cells and prostate cancer cells (Chen and Holick, 2003; Gascon-Barre et al., 2001; Sawada et al., 2000; Tokar and Webber, 2005a; Tokar and Webber, 2005b). Th e current data indicate that estrogens and androgens might regulate the intracellular levels

of active hydroxyvitamin D3 metabolites in prostate cells via regulation of CYP27A1 gene expression. In summary, the human CYP27A1 gene has been identifi ed as a target for estrogens and androgens. Th e results indicate that the eff ects might be diff erent in diff erent tissues and diff erent cell types. Th e results imply that regulation of CYP27A1 may be aff ected by endogenous sex hormones and pharmacological compounds with estrogenic or androgenic eff ects.

40 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

In HepG2 cells Androgens

Glucocorticoids PMA CYP27A1 Growth hormone Thyroid hormones

IGF-1

Estrogens

Figure 11. A summary of hormonal regulation of CYP27A1 in HepG2 cells. Glucocorticoids, growth hormone, IGF-1 and androgens upregulate CYP27A1, whereas PMA, thyroid hormones and estrogens downregulate CYP27A1.

Dexamethasone-induced eﬀ ect on the CYP27A1 promoter is mediated via GR (Paper V)

Mifepristone abolishes the dexamethasone-induced eﬀ ect on CYP27A1 promoter activity Reporter assay experiments were performed with HepG2 cells overexpressed with GR. Treatment of the cells with the GR agonist dexamethasone increased the CYP27A1 promoter activity more than four-fold. Treatment of GR-overexpressed cells with the GR-antagonist mifepristone did not result in induction of the promoter activity. Treatment of the cells with dexamethasone in presence of mifepristone almost completely abolished the dexamethasone-induced eﬀ ect on the promoter activity. Th e results indicate that dexamethasone induction of the CYP27A1 transcriptional activity is mediated by GR.

Deletion construct analysis of GR-mediated eff ects on the CYP27A1 promoter Th e eff ects of dexamethasone and GR on promoter activity were studied with diff erent deletion constructs of the CYP27A1 promoter-luciferase gene. In HepG2 cells overexpressed with GR dexamethasone increased the reporter activity substantially with the constructs containing the two largest DNA fragments (the 4.2 kb and 1094 bp fragments) (Fig. 9). Th e results indicate that sequences involved in GR-mediated induction by dexamethasone are present in a region upstream of –792. Th e promoter sequence was analyzed for putative GRE in this region. Five putative GRE sites could be found at –1183/-1177, -935/-929, -916/-908, -824/-819, and –707/-700 (Fig. 10).

41 Wanjin Tang

Identiﬁ cation of GR-binding sites in the CYP27A1 promoter Analysis of the 5’-ﬂ anking region of the human CYP27A1 gene revealed a number of putative GRE sequences. Deletion construct analysis of the CYP27A1 promoter- luciferase reporter gene indicated that the region mediating the response to GR- mediated induction may be located upstream of –792 of the CYP27A1 promoter sequence. In order to investigate whether GR might bind to sequences in this part of the promoter, EMSA experiments were carried out with in vitro-translated GR protein and several probes designed based on putative GRE sites. Four DNA probes were used in the EMSA experiments, corresponding to –1192 to –1170, –942 to 901, –835 to –812 and –713 to –692 respectively, of the CYP27A1 promoter sequence. Th e sequence corresponding to nucleotides –942 to -901 contains two putative GRE halfsites. As a positive control for GR-binding, a probe was included based on a con- sensus GRE sequence from the rat tyrosine aminotransferase gene (CTAGGCTG- TACAGGATGTTCTGCCTAG) which is known to bind GR (Tseng et al., 2001). As expected, a shifted band indicating binding by GR protein was observed with the known GR-binding sequence used as positive control. EMSA analysis of CYP27A1 promoter sequences revealed strong binding by in vitro-translated GR protein also to the DNA probe corresponding to nucleotides –835 to –812 of the CYP27A1 promoter. Binding was also observed with the DNA probe corresponding to nucleotides –942 to –901. Binding by GR was not observed to the other two CYP27A1 promoter sequences (–1192 to –1170 and –713 to –692) analyzed in EMSA.

Site-directed mutagenesis of sequences in the CYP27A1 promoter Experiments were carried out to compare the eﬀ ects of GR and dexamethasone on wild-type reporter and two reporter constructs with mutations in putative GRE sequences. Mutagenesis in one of the GR-binding putative GRE sequences –824/– 819 resulted in substantial decrease of the response to GR-mediated dexamthasone induction. A construct with this mutation and an additional mutated GRE –916/– 908 did not reduce the response further. Th ese ﬁ ndings suggest that the putative GRE at –824/–819 is important for GR-mediated regulation of CYP27A1 transcriptional activity (Fig. 10).

Mechanism and biological role of glucocorticoid-mediated induction of CYP27A1 transcription Glucocorticoid-mediated eff ects may occur at both transcriptional and post-transcriptional levels. GR may bind dexamethasone and related ligands. Th e activated GR can interact with the regulatory regions of responsive genes to alter the level of gene expression. Variant forms of GREs with diff erent affi nities for GR binding and hence various activation potentials have been reported (Beato and Sanchez-Pacheco, 1996; Pearce et al., 1998; Tseng et al., 2001). Th ere have been diff erent explanations for the mechanism by which dexamethasone increases CYP27A1 mRNA levels in the rat (Mullick et al., 2001; Stravitz et al., 1996). From studies with rat hepatocytes, Stravitz (Stravitz et al., 1996) suggested that the glucocorticoids appears to increase CYP27A1 mRNA posttranscriptionally

42 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes by e.g. stabilization. Mullick et al (Mullick et al., 2001) explained the dexamethasone- mediated transcription activation of the rat CYP27A1 promoter by a physical interaction and functional synergy between GR and Ets2 factor. Th e current results may indicate that dexamethasone aff ects the human CYP27A1 gene by binding to GR which subsequently binds directly to a GRE at –824/–819 in the promoter resulting in the transcription activation of the human CYP27A1 gene. Th e biological role of glucocorticoid-mediated induction of CYP27A1 transcription may be related to one or more of the several important functions of CYP27A1 in cholesterol homeostasis, bile acid biosynthesis, vitamin D metabolism and calcium homeostasis (Babiker et al., 1997; Gascon-Barre et al., 2001; Norlin, 2007; Sakaki et al., 2005). Glucocorticoids are among the most widely used agents for the treatment of infl ammatory and autoimmune diseases. Glucocorticoids, such as the synthetic corticosteroid dexamethasone, were found to increase bile acid metabolism in rat hepatocytes (Princen et al., 1989). CYP27A1 also aff ects cholesterol transport from extrahepatic cells in diff erent ways, such as reverse cholesterol transport (Babiker et al., 1997; Fu et al., 2001). It has been reported that glucocorticoids play an important role in the regulation of genes central in reverse cholesterol transport to get rid of the excess cholesterol (Sporstol et al., 2007).

43 Wanjin Tang

Summary and Conclusions

In this thesis, the regulation of the human CYP27A1 and CYP7B1 genes is studied. Paper I reports hormonal regulation of the human CYP27A1 gene. HepG2 cells were transiently transfected with luciferase reporter gene constructs containing DNA fragments of the 5´ fl anking region of the human CYP27A1 gene. Growth hormone, IGF-1, and dexamethasone increased the promoter activity two to three-fold whereas thyroxine and PMA repressed the activity as measured with luciferase activity expressed in the cells. Th e endogenous CYP27A1 enzyme activity in the cells was stimulated by growth hormone, IGF-1 and dexamethasone whereas thyroxine and PMA inhibited the activity. Th e results of this study imply that CYP27A1 is regulated in human cells by hormones and signal transduction pathways. In paper II, the regulation of CYP7B1, a DHEA 7α-hydroxylase, by sex hormones is examined. Transfection with ERα and treatment with E2 in human embryonic kidney 293 cells signifi cantly increased CYP7B1 catalytic activity and mRNA, and stimulated a human CYP7B1 reporter gene. In the absence of receptors, E2 suppressed CYP7B1 activity, suggesting that estrogenic eff ects may be diff erent in cells not expressing receptors. Quantitation of CYP7B1 mRNA in adult and fetal human tissues showed markedly higher CYP7B1 mRNA levels in fetal tissues compared with the corresponding adult ones, except in the liver. Th is indicates a tissue-specifi c, developmental regulation of CYP7B1 and suggests an important function for this enzyme in fetal life. DHEA secreted by fetal adrenals is an essential precursor for placental estrogen formation. Since CYP7B1 diverts DHEA from the sex hormone biosynthetic pathway, ER-mediated up-regulation of CYP7B1 should lead to less DHEA available for sex hormone synthesis and may help to maintain normal levels of estrogens and androgens in human tissues, especially during fetal development. Paper III reports eff ects of androgens and estrogens on human CYP7B1 transcription in prostate cancer LNCaP cells. Studies with rodents have suggested a role for the CYP7B1 enzyme in balancing cellular hormone levels important for prostate growth. Th is study showed strong suppression of a human CYP7B1 luciferase reporter gene by DHT in prostate cancer LNCaP cells. Also, DHT and overexpression of AR suppressed CYP7B1 promoter activity and CYP7B1-mediated catalysis in kidney-derived HEK293 cells. Eff ects on CYP7B1 transcription were observed also by ER. Th e eff ects appeared diff erent for diff erent estrogens. CYP7B1 was stimulated by synthetic ER agonists but suppressed by E2 and 3βAdiol in LNCaP cells. Th e data indicate an important role for CYP7B1 in balancing prostate hormone levels in human cells. In particular, the data suggest that androgens may control intraprostatic levels of estrogen via regulation of CYP7B1-mediated metabolism. In paper IV, the regulation of the human CYP27A1 gene by estrogens and androgens was studied in human liver-derived HepG2 and prostate cells. Th e results show that the transcriptional promoter activity and enzymatic activity of CYP27A1 in HepG2 cells are downregulated by estrogen in presence of ERα or ERβ. Similar

44 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes eff ects by estrogen were found in RWPE-1 prostate cells. In contrast, estrogen markedly upregulated the transcriptional activity of CYP27A1 in LNCaP prostate cancer cells. DHT and AR upregulated the transcriptional activity of CYP27A1 in HepG2 cells. Progressive deletion experiments were conducted to map the regions responsible for the eff ects of estrogen and androgen in the CYP27A1 promoter. Th e results imply that regulation of CYP27A1 may be aff ected by endogenous sex hormones and pharmacological compounds with estrogenic or androgenic eff ects. In paper V the mechanism of the dexametasone-induced eff ect on the human CYP27A1 promoter is examined. Treatment of HepG2 cells overexpressed with GR with dexamethasone increased the CYP27A1 promoter activity more than four-fold. Treatment of the cells with dexamethasone in presence of the GR antagonist mifepristone almost completely abolished the dexamethasone-induced eff ect on the promoter activity. Progressive deletion analysis of the CYP27A1 promoter indicated that sequences involved in GR-mediated induction by dexamethasone are present in a region upstream of –792. EMSA experiments revealed that some of the putative GRE in this region could bind to GR. Site-directed mutagenesis identifi ed a putative GRE important for GR-mediated regulation of CYP27A1 transcriptional activity. Th e results of this study imply that CYP27A1 and CYP7B1 are regulated in human cells by hormones.

45 Wanjin Tang

Acknowledgements

I am so grateful to all the people in the Division of Pharmaceutical Biochemistry, without you, I would not be able to write this thesis. Especially, I would like to thank: My supervisor Professor Kjell Wikvall, for your excellent guidance, patience and encouragement. It is really hard to use words to express my gratitude to you. You and Maria are my super-advisors. My assistant supervisor Maria Norlin, for your strong support in my research. Professor Matti Lang for all the invaluable advice and help you gave me and the nice talk in the kitchen. Dr. Ronnie Hansson for all the interesting Swedish conversations during lunch time, for your help when I was teaching in the course lab and for the happy dinner at your home. Angela Lannerbro, for all of your assistance in the lab, especially for always order- ing things for me so fast. Hasse Darberg, for all the excellent technical support. Kyle Christian, for teaching me the fi rst Swedish word in my life and for all of your advice and kind help in the lab. Hanna Pettersson, Maria Ellfolk and Johan Lundqvist for being in the same group these years. Agneta Bergström, for all of your help during my study here. Magnus Jansson, for choosing such a nice computer for me and for help dealing with all the computer problems. Former members in our division: Dr. Fardin Hosseinpour, for teaching me to isolate pig hepatocytes. Dr. Françoise Raff alli-Mathieu, for the fun in washing room. Dr. Kerstin Lundell, for all the happy time with you inside and outside this lab. Dr. Malin Söderberg, for driving me to IKEA on my fi rst day here and for answer- ing many questions of mine regarding Lipofectamine. Dr. Monica Lindell, for accompanying me to go to see the doctor and to pick my huge parcel in the post offi ce, and also for teaching me the tricks about PCR. Dr. Tina Glisovic, for that Änglaspel and all the pleasant moments with you. Ex-jobb students, Ann-Christin Lindgren, Hanna Lindstrand, Amis (Anna Carls- son), Karin Apelqvist, Malin Jansson, Younes Bakali and Lisa Holmberg, for all the happy time working with you. People outside this division: Dr. Qin Zhou, for all the nice and helpful talk with you. Dr. Chao Su, for sharing with me your experience in Uppsala. Dr. Gösta Eggertsen for teaching me real-time RT-PCR and for the good time with you at Huddinge hospital. Britt-Marie Johansson, Sadia Oreland and Kerstin Rönnqvist for your kindness.

46 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Yinchoy Chuan, Shouting Zhang, Lingli Li, Felix Royo, Emanuel Smeds, Magnus Hansson, Ning Lu, Siwei Peng and Ning Xu for your kind help when I needed. Karin Wiman, Jonas Axelsson, Nahid Zarei and Leke Ai for just being such nice friends as you are. My family members, especially my uncle George, for all the unconditional support you give me. Finally, those dear friends that I may have forgotten to mention here, I really cher- ish your friendship.

Uppsala, Feb 2007 Wanjin

47 Wanjin Tang

References

Alexandersen, P. and Christiansen, C. (2004). Th e aging male: testosterone deﬁ ciency and testosterone replacement. An up-date. Atherosclerosis 173, 157-69. Babiker, A., Andersson, O., Lund, E., Xiu, R. J., Deeb, S., Reshef, A., Leitersdorf, E., Diczfalusy, U. and Björkhem, I. (1997). Elimination of cholesterol in macrophages and endothelial cells by the sterol 27-hydroxylase mechanism. Comparison with high density lipoprotein-mediated reverse cholesterol transport. J Biol Chem 272, 26253-61. Barrett-Connor, E. L. (1995). Testosterone and risk factors for cardiovascular disease in men. Diabete Metab 21, 156-61. Bean, R., Seckl, J. R., Lathe, R. and Martin, C. (2001). Ontogeny of the neurosteroid enzyme Cyp7b in the mouse. Mol Cell Endocrinol 174, 137-44. Beato, M. and Sanchez-Pacheco, A. (1996). Interaction of steroid hormone receptors with the transcription initiation complex. Endocr Rev 17, 587-609. Björkhem, I., Andersson, O., Diczfalusy, U., Sevastik, B., Xiu, R. J., Duan, C. and Lund, E. (1994). Atherosclerosis and sterol 27-hydroxylase: evidence for a role of this enzyme in elimination of cholesterol from human macrophages. Proc Natl Acad Sci U S A 91, 8592-6. Björkhem, I. (2002). Do oxysterols control cholesterol homeostasis? J Clin Invest 110, 725- 30. Björkhem, I., Araya, Z., Rudling, M., Angelin, B., Einarsson, C. and Wikvall, K. (2002). Diﬀ erences in the regulation of the classical and the alternative pathway for bile acid synthesis in human liver. No coordinate regulation of CYP7A1 and CYP27A1. J Biol Chem 277, 26804-7. Björnström, L. and Sjöberg, M. (2005). Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 19, 833-42. Brinkmann, A. O., Blok, L. J., de Ruiter, P. E., Doesburg, P., Steketee, K., Berrevoets, C. A. and Trapman, J. (1999). Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69, 307-13. Brinton, R. D. (2001). Cellular and molecular mechanisms of estrogen regulation of memory function and neuroprotection against Alzheimer’s disease: recent insights and remaining challenges. Learn Mem 8, 121-33. Chang, G. W. and Kam, P. C. (1999). Th e physiological and pharmacological roles of cytochrome P450 isoenzymes. Anaesthesia 54, 42-50. Chen, T. C. and Holick, M. F. (2003). Vitamin D and prostate cancer prevention and treatment. Trends Endocrinol Metab 14, 423-30. Chiang, J. Y. (2002). Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocr Rev 23, 443-63. Cude, K. J., Dixon, S. C., Guo, Y., Lisella, J. and Figg, W. D. (1999). Th e androgen receptor: genetic considerations in the development and treatment of prostate cancer. J Mol Med 77, 419-26.

48 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Cunha, G. R., Ricke, W., Th omson, A., Marker, P. C., Risbridger, G., Hayward, S. W., Wang, Y. Z., Donjacour, A. A. and Kurita, T. (2004). Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development. J Steroid Biochem Mol Biol 92, 221-36. Drover, V. A., Wong, N. C. and Agellon, L. B. (2002). A distinct thyroid hormone response element mediates repression of the human cholesterol 7alpha-hydroxylase (CYP7A1) gene promoter. Mol Endocrinol 16, 14-23. Dulos, J., van der Vleuten, M. A., Kavelaars, A., Heijnen, C. J. and Boots, A. M. (2005). CYP7B expression and activity in fi broblast-like synoviocytes from patients with rheumatoid arthritis: regulation by proinfl ammatory cytokines. Arthritis Rheum 52, 770-8. Dupont, S., Krust, A., Gansmuller, A., Dierich, A., Chambon, P. and Mark, M. (2000). Eff ect of single and compound knockouts of estrogen receptors alpha (ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development 127, 4277-91. Ellfolk, M., Norlin, M. and Wikvall, K. (2006). Isolation and properties of the CYP2D25 promoter: transcriptional regulation by vitamin D3 metabolites. Biochem Biophys Res Commun 345, 568-72. Ellis, E., Goodwin, B., Abrahamsson, A., Liddle, C., Mode, A., Rudling, M., Björkhem, I. and Einarsson, C. (1998). Bile acid synthesis in primary cultures of rat and human hepatocytes. Hepatology 27, 615-20. Elo, J. P., Kvist, L., Leinonen, K., Isomaa, V., Henttu, P., Lukkarinen, O. and Vihko, P. (1995). Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol. J Clin Endocrinol Metab 80, 3494-500. Fang, H., Tong, W., Shi, L. M., Blair, R., Perkins, R., Branham, W., Hass, B. S., Xie, Q., Dial, S. L., Moland, C. L. et al. (2001). Structure-activity relationships for a large diverse set of natural, synthetic, and environmental estrogens. Chem Res Toxicol 14, 280-94. Fu, X., Menke, J. G., Chen, Y., Zhou, G., MacNaul, K. L., Wright, S. D., Sparrow, C. P. and Lund, E. G. (2001). 27-hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded cells. J Biol Chem 276, 38378-87. Galea, L. A., Spritzer, M. D., Barker, J. M. and Pawluski, J. L. (2006). Gonadal hormone modulation of hippocampal neurogenesis in the adult. Hippocampus 16, 225-32. Gardner, G. D., Shoback, D. (2007). Greenspan’s Basic and Clinical Endocrinology 8th Edi- tion. Gascon-Barre, M., Demers, C., Ghrab, O., Th eodoropoulos, C., Lapointe, R., Jones, G., Valiquette, L. and Menard, D. (2001). Expression of CYP27A, a gene encoding a vitamin D-25 hydroxylase in human liver and kidney. Clin Endocrinol (Oxf) 54, 107-15. Gell, J. S., Oh, J., Rainey, W. E. and Carr, B. R. (1998). Eff ect of estradiol on DHEAS production in the human adrenocortical cell line, H295R. J Soc Gynecol Investig 5, 144-8. Giammanco, M., Tabacchi, G., Giammanco, S., Di Majo, D. and La Guardia, M. (2005). Testosterone and aggressiveness. Med Sci Monit 11, RA136-45. Hess, R. A., Bunick, D., Lee, K. H., Bahr, J., Taylor, J. A., Korach, K. S. and Lubahn, D. B. (1997). A role for oestrogens in the male reproductive system. Nature 390, 509-12. Holmström, P., Dzikaite, V., Hultcrantz, R., Melefors, O., Eckes, K., Stal, P., Kinnman, N., Smedsrod, B., Gåfvels, M. and Eggertsen, G. (2003). Structure and liver cell expression pattern of the HFE gene in the rat. J Hepatol 39, 308-14. Hosseinpour, F. and Wikvall, K. (2000). Porcine microsomal vitamin D(3) 25-hydroxylase (CYP2D25). Catalytic properties, tissue distribution, and comparison with human CYP2D6. J Biol Chem 275, 34650-5.

49 Wanjin Tang

Härkonen, P. L. and Mäkelä, S. I. (2004). Role of estrogens in development of prostate cancer. J Steroid Biochem Mol Biol 92, 297-305 Jakobsson, J., Karypidis, H., Johansson, J. E., Roh, H. K., Rane, A. and Ekstrom, L. (2004). A functional C-G polymorphism in the CYP7B1 promoter region and its diff erent distribution in Orientals and Caucasians. Pharmacogenomics J 4, 245-50. Khaw, K. T. and Barrett-Connor, E. (1991). Endogenous sex hormones, high density lipoprotein cholesterol, and other lipoprotein fractions in men. Arterioscler Th romb 11, 489-94. Kuiper, G. G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S. and Gus- tafsson, J. A. (1997). Comparison of the ligand binding specifi city and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863-70. Kuiper, G. G., Enmark, E., Pelto-Huikko, M., Nilsson, S. and Gustafsson, J. A. (1996). Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci U S A 93, 5925-30. Lowry, O. H., Rosebrough, N. J., Farr, A. L. and Randall, R. J. (1951). Protein measure- ment with the Folin phenol reagent. J Biol Chem 193, 265-75. Mangelsdorf, D. J., Th ummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blum- berg, B., Kastner, P., Mark, M., Chambon, P. et al. (1995). Th e nuclear receptor superfamily: the second decade. Cell 83, 835-9. Martin, C., Ross, M., Chapman, K. E., Andrew, R., Bollina, P., Seckl, J. R. and Habib, F. K. (2004). CYP7B generates a selective estrogen receptor beta agonist in human prostate. J Clin Endocrinol Metab 89, 2928-35. McLachlan, J. A., Burow, M., Chiang, T. C. and Li, S. F. (2001). Gene imprinting in developmental toxicology: a possible interface between physiology and pathology. Toxicol Lett 120, 161-4. Mullick, J., Anandatheerthavarada, H. K., Amuthan, G., Bhagwat, S. V., Biswas, G., Cam- asamudram, V., Bhat, N. K., Reddy, S. E., Rao, V. and Avadhani, N. G. (2001). Physi- cal interaction and functional synergy between glucocorticoid receptor and Ets2 proteins for transcription activation of the rat cytochrome P-450c27 promoter. J Biol Chem 276, 18007-17. Nebert, D. W., Adesnik, M., Coon, M. J., Estabrook, R. W., Gonzalez, F. J., Guengerich, F. P., Gunsalus, I. C., Johnson, E. F., Kemper, B., Levin, W. et al. (1987). Th e P450 gene superfamily: recommended nomenclature. DNA 6, 1-11. Nebert, D. W. and Gonzalez, F. J. (1987). P450 genes: structure, evolution, and regulation. Annu Rev Biochem 56, 945-93. Nebert, D. W. and Russell, D. W. (2002). Clinical importance of the cytochromes P450. Lancet 360, 1155-62. Nelson, D. R., Zeldin, D. C., Hoff man, S. M., Maltais, L. J., Wain, H. M. and Nebert, D. W. (2004). Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics 14, 1-18. Nilsson, S., Makela, S., Treuter, E., Tujague, M., Th omsen, J., Andersson, G., Enmark, E., Pettersson, K., Warner, M. and Gustafsson, J. A. (2001). Mechanisms of estrogen action. Physiol Rev 81, 1535-65. Norlin, M. (2002). Expression of key enzymes in bile acid biosynthesis during development: CYP7B1-mediated activities show tissue-specifi c diff erences. J Lipid Res 43, 721-31. Norlin, M., Andersson, U., Björkhem, I. and Wikvall, K. (2000). Oxysterol 7 alpha-hydroxylase activity by cholesterol 7 alpha-hydroxylase (CYP7A). J Biol Chem 275, 34046-53.

50 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Norlin, M. and Chiang, J. Y. (2004). Transcriptional regulation of human oxysterol 7alpha- hydroxylase by sterol response element binding protein. Biochem Biophys Res Commun 316, 158-64. Norlin, M. and Wikvall, K. (1998). Biochemical characterization of the 7alpha-hydroxylase activities towards 27-hydroxycholesterol and dehydroepiandrosterone in pig liver microsomes. Biochim Biophys Acta 1390, 269-81. Norlin, M. and Wikvall, K. (2007). Enzymes in the conversion of cholesterol into bile acids. Curr Mol Med 7, 199-218. Norlin, M., von Bahr, S., Björkhem, I. and Wikvall, K. (2003). On the substrate speciﬁ city of human CYP27A1: implications for bile acid and cholestanol formation. J Lipid Res 44, 1515-22. Norlin, M. a. W., K. (2007). Enzymes in the conversion of cholesterol into bile acids. Current Molecular Medicine 7, In Press. Nussey, W. (2001). Endocrinology, an integrated approach. Omoto, Y., Lathe, R., Warner, M. and Gustafsson, J. A. (2005). Early onset of puberty and early ovarian failure in CYP7B1 knockout mice. Proc Natl Acad Sci U S A. Paech, K., Webb, P., Kuiper, G. G., Nilsson, S., Gustafsson, J., Kushner, P. J. and Scanlan, T. S. (1997). Diﬀ erential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science 277, 1508-10. Pak, T. R., Chung, W. C., Lund, T. D., Hinds, L. R., Clay, C. M. and Handa, R. J. (2005). Th e androgen metabolite, 5alpha-androstane-3beta, 17beta-diol, is a potent modulator of estrogen receptor-beta1-mediated gene transcription in neuronal cells. Endocrinology 146, 147-55. Pandak, W. M., Hylemon, P. B., Ren, S., Marques, D., Gil, G., Redford, K., Mallonee, D. and Vlahcevic, Z. R. (2002). Regulation of oxysterol 7alpha-hydroxylase (CYP7B1) in primary cultures of rat hepatocytes. Hepatology 35, 1400-8. Parnes, H. L., Th ompson, I. M. and Ford, L. G. (2005). Prevention of hormone-related cancers: prostate cancer. J Clin Oncol 23, 368-77. Pearce, D., Matsui, W., Miner, J. N. and Yamamoto, K. R. (1998). Glucocorticoid receptor transcriptional activity determined by spacing of receptor and nonreceptor DNA sites. J Biol Chem 273, 30081-5. Pepe, G. J. and Albrecht, E. D. (1995). Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev 16, 608-48. Princen, H. M., Meijer, P. and Hofstee, B. (1989). Dexamethasone regulates bile acid synthesis in monolayer cultures of rat hepatocytes by induction of cholesterol 7 alpha-hydroxylase. Biochem J 262, 341-8. Quinn, C. M., Jessup, W., Wong, J., Kritharides, L. and Brown, A. J. (2005). Expression and regulation of sterol 27-hydroxylase (CYP27A1) in human macrophages: a role for RXR and PPARgamma ligands. Biochem J 385, 823-30. Rainey, W. E., Carr, B. R., Sasano, H., Suzuki, T. and Mason, J. I. (2002). Dissecting human adrenal androgen production. Trends Endocrinol Metab 13, 234-9. Rainey, W. E., Rehman, K. S. and Carr, B. R. (2004). Th e human fetal adrenal: making adrenal androgens for placental estrogens. Semin Reprod Med 22, 327-36. Ren, S., Marques, D., Redford, K., Hylemon, P. B., Gil, G., Vlahcevic, Z. R. and Pandak, W. M. (2003). Regulation of oxysterol 7alpha-hydroxylase (CYP7B1) in the rat. Metabo- lism 52, 636-42.

51 Wanjin Tang

Rose, K., Allan, A., Gauldie, S., Stapleton, G., Dobbie, L., Dott, K., Martin, C., Wang, L., Hedlund, E., Seckl, J. R. et al. (2001). Neurosteroid hydroxylase CYP7B: vivid reporter activity in dentate gyrus of gene-targeted mice and abolition of a widespread pathway of steroid and oxysterol hydroxylation. J Biol Chem 276, 23937-44. Rose, K. A., Stapleton, G., Dott, K., Kieny, M. P., Best, R., Schwarz, M., Russell, D. W., Björkhem, I., Seckl, J. and Lathe, R. (1997). Cyp7b, a novel brain cytochrome P450, catalyzes the synthesis of neurosteroids 7alpha-hydroxy dehydroepiandrosterone and 7alpha-hydroxy pregnenolone. Proc Natl Acad Sci U S A 94, 4925-30. Rossouw, J. E., Anderson, G. L., Prentice, R. L., LaCroix, A. Z., Kooperberg, C., Stefanick, M. L., Jackson, R. D., Beresford, S. A., Howard, B. V., Johnson, K. C. et al. (2002). Risks and benefi ts of estrogen plus progestin in healthy postmenopausal women: principal results From the Women’s Health Initiative randomized controlled trial. Jama 288, 321- 33. Russell, D. W. (2000). Oxysterol biosynthetic enzymes. Biochim Biophys Acta 1529, 126-35. Russell, D. W. (2003). Th e enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 72, 137-74. Safe, S. (2001). Transcriptional activation of genes by 17 beta-estradiol through estrogen receptor-Sp1 interactions. Vitam Horm 62, 231-52. Sakaki, T., Kagawa, N., Yamamoto, K. and Inouye, K. (2005). Metabolism of vitamin D3 by cytochromes P450. Front Biosci 10, 119-34. Sawada, N., Sakaki, T., Ohta, M. and Inouye, K. (2000). Metabolism of vitamin D(3) by human CYP27A1. Biochem Biophys Res Commun 273, 977-84. Schroepfer, G. J., Jr. (2000). Oxysterols: modulators of cholesterol metabolism and other processes. Physiol Rev 80, 361-554. Schultz, J. R., Petz, L. N. and Nardulli, A. M. (2005). Cell- and ligand-specifi c regulation of promoters containing activator protein-1 and Sp1 sites by estrogen receptors alpha and beta. J Biol Chem 280, 347-54. Schwarz, M., Lund, E. G., Lathe, R., Bjökhem, I. and Russell, D. W. (1997). Identifi cation and characterization of a mouse oxysterol 7alpha-hydroxylase cDNA. J Biol Chem 272, 23995-4001. Segev, H., Honigman, A., Rosen, H. and Leitersdorf, E. (2001). Transcriptional regulation of the human sterol 27-hydroxylase gene (CYP27) and promoter mapping. Atherosclerosis 156, 339-47. Singh, R., Artaza, J. N., Taylor, W. E., Braga, M., Yuan, X., Gonzalez-Cadavid, N. F. and Bhasin, S. (2006). Testosterone inhibits adipogenic diff erentiation in 3T3-L1 cells: nuclear translocation of androgen receptor complex with beta-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription factors. Endocrinology 147, 141-54. Sinha-Hikim, I., Taylor, W. E., Gonzalez-Cadavid, N. F., Zheng, W. and Bhasin, S. (2004). Androgen receptor in human skeletal muscle and cultured muscle satellite cells: up-regulation by androgen treatment. J Clin Endocrinol Metab 89, 5245-55. Smoak, K. A. and Cidlowski, J. A. (2004). Mechanisms of glucocorticoid receptor signaling during infl ammation. Mech Ageing Dev 125, 697-706. Sporstol, M., Mousavi, S. A., Eskild, W., Roos, N. and Berg, T. (2007). ABCA1, ABCG1 and SR-BI: Hormonal regulation in primary rat hepatocytes and human cell lines. BMC Mol Biol 8, 5.

52 Hormonal Regulation of the Human CYP27A1 and CYP7B1 Genes

Steinberg, D. (2006). Th ematic review series: the pathogenesis of atherosclerosis. An interpre- tive history of the cholesterol controversy, part V: the discovery of the statins and the end of the controversy. J Lipid Res 47, 1339-51. Stoll, G. and Bendszus, M. (2006). Inﬂ ammation and atherosclerosis: novel insights into plaque formation and destabilization. Stroke 37, 1923-32. Stravitz, R. T., Vlahcevic, Z. R., Russell, T. L., Heizer, M. L., Avadhani, N. G. and Hylemon, P. B . (1996). Regulation of sterol 27-hydroxylase and an alternative pathway of bile acid biosynthesis in primary cultures of rat hepatocytes. J Steroid Biochem Mol Biol 57, 337- 47. Tchernof, A., Labrie, F., Belanger, A., Prud’homme, D., Bouchard, C., Tremblay, A., Nadeau, A. and Despres, J. P. (1997). Relationships between endogenous steroid hormone, sex hormone-binding globulin and lipoprotein levels in men: contribution of vis- ceral obesity, insulin levels and other metabolic variables. Atherosclerosis 133, 235-44. Th eodoropoulos, C., Demers, C., Mirshahi, A. and Gascon-Barre, M. (2001). 1,25- Dihydroxyvitamin D(3) downregulates the rat intestinal vitamin D(3)-25-hydroxylase CYP27A. Am J Physiol Endocrinol Metab 281, E315-25. Tokar, E. J. and Webber, M. M. (2005a). Chemoprevention of prostate cancer by cholecalciferol (vitamin D3): 25-hydroxylase (CYP27A1) in human prostate epithelial cells. Clin Exp Metastasis 22, 265-73. Tokar, E. J. and Webber, M. M. (2005b). Cholecalciferol (vitamin D3) inhibits growth and invasion by up-regulating nuclear receptors and 25-hydroxylase (CYP27A1) in human prostate cancer cells. Clin Exp Metastasis 22, 275-84. Tseng, Y. T., Stabila, J. P., Nguyen, T. T., McGonnigal, B. G., Waschek, J. A. and Padbury, J. F. (2001). A novel glucocorticoid regulatory unit mediates the hormone responsiveness of the beta1-adrenergic receptor gene. Mol Cell Endocrinol 181, 165-78. Tuohimaa, P., Golovko, O., Kalueﬀ , A., Nazarova, N., Qiao, S., Syvala, H., Talonpoika, R. and Lou, Y. R. (2005). Calcidiol and prostate cancer. J Steroid Biochem Mol Biol 93, 183-90. Walczak, J. R. and Carducci, M. A. (2007). Prostate cancer: a practical approach to current management of recurrent disease. Mayo Clin Proc 82, 243-9. Wang, D. P., Stroup, D., Marrapodi, M., Crestani, M., Galli, G. and Chiang, J. Y. (1996). Transcriptional regulation of the human cholesterol 7 alpha-hydroxylase gene (CYP7A) in HepG2 cells. J Lipid Res 37, 1831-41. Weihua, Z., Lathe, R., Warner, M. and Gustafsson, J. A. (2002a). An endocrine pathway in the prostate, ERbeta, AR, 5alpha-androstane-3beta,17beta-diol, and CYP7B1, regulates prostate growth. Proc Natl Acad Sci U S A 99, 13589-94. Weihua, Z., Warner, M. and Gustafsson, J. A. (2002b). Estrogen receptor beta in the prostate. Mol Cell Endocrinol 193, 1-5. Williamson, J., Van Orden, D. and Rosazza, J. P. (1985). Microbiological hydroxylation of estradiol: formation of 2- and 4-hydroxyestradiol by Aspergillus alliaceus. Appl Environ Microbiol 49, 563-7. Vlahcevic, Z. R., Jairath, S. K., Heuman, D. M., Stravitz, R. T., Hylemon, P. B., Avadhani, N. G. and Pandak, W. M. (1996). Transcriptional regulation of hepatic sterol 27-hydroxylase by bile acids. Am J Physiol 270, G646-52. Vlahcevic, Z. R., Pandak, W. M. and Stravitz, R. T. (1999). Regulation of bile acid biosynthesis. Gastroenterol Clin North Am 28, 1-25, v.

53 Wanjin Tang

Vlahcevic, Z. R., Stravitz, R. T., Heuman, D. M., Hylemon, P. B. and Pandak, W. M. (1997). Quantitative estimations of the contribution of diﬀ erent bile acid pathways to total bile acid synthesis in the rat. Gastroenterology 113, 1949-57. Voigt, K. D. and Bartsch, W. (1986). Intratissular androgens in benign prostatic hyperplasia and prostatic cancer. J Steroid Biochem 25, 749-57. Wolf, O. T. and Kirschbaum, C. (1999). Actions of dehydroepiandrosterone and its sulfate in the central nervous system: eﬀ ects on cognition and emotion in animals and humans. Brain Res Brain Res Rev 30, 264-88. Wu, Z. and Chiang, J. Y. (2001). Transcriptional regulation of human oxysterol 7 alpha- hydroxylase gene (CYP7B1) by Sp1. Gene 272, 191-7. Wu, Z., Martin, K. O., Javitt, N. B. and Chiang, J. Y. (1999). Structure and functions of human oxysterol 7alpha-hydroxylase cDNAs and gene CYP7B1. J Lipid Res 40, 2195- 203. Yau, J. L., Noble, J., Graham, M. and Seckl, J. R. (2006). Central administration of a cytochrome P450-7B product 7 alpha-hydroxypregnenolone improves spatial memory retention in cognitively impaired aged rats. J Neurosci 26, 11034-40. Yau, J. L., Rasmuson, S., Andrew, R., Graham, M., Noble, J., Olsson, T., Fuchs, E., Lathe, R. and Seckl, J. R. (2003). Dehydroepiandrosterone 7-hydroxylase CYP7B: predominant expression in primate hippocampus and reduced expression in Alzheimer’s disease. Neu- roscience 121, 307-14. Zissimopoulos, S. and Lai, F. A. (2005). Interaction of FKBP12.6 with the cardiac ryanodine receptor C-terminal domain. J Biol Chem 280, 5475-85. Zmuda, J. M., Cauley, J. A., Kriska, A., Glynn, N. W., Gutai, J. P. and Kuller, L. H. (1997). Longitudinal relation between endogenous testosterone and cardiovascular disease risk factors in middle-aged men. A 13-year follow-up of former Multiple Risk Factor Interven- tion Trial participants. Am J Epidemiol 146, 609-17.

Acta Universitatis Upsaliensis Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy 56

Editor: The Dean of the Faculty of Pharmacy

A doctoral dissertation from the Faculty of Pharmacy, Uppsala University, is usually a summary of a number of papers. A few copies of the complete dissertation are kept at major Swedish research libraries, while the summary alone is distributed internationally through the series Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy. (Prior to January, 2005, the series was published under the title “Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy”.)

ACTA UNIVERSITATIS UPSALIENSIS Distribution: publications.uu.se UPPSALA urn:nbn:se:uu:diva-7837 2007