USOO9585921B2
(12) United States Patent (10) Patent No.: US 9,585,921 B2 McKenzie et al. (45) Date of Patent: Mar. 7, 2017
(54) COMPOSITIONS AND METHODS A61K 35/744 (2013.01); A61K 35/745 (2013.01); A61K 35/747 (2013.01); A61 K (71) Applicant: Seres Therapeutics, Inc., Cambridge, 45/06 (2013.01): CI2N 1/20 (2013.01) MA (US) (58) Field of Classification Search CPC ...... A61K 35/741 (72) Inventors: Gregory McKenzie, Arlington, MA See application file for complete search history. (US); Mary-Jane Lombardo McKenzie, Arlington, MA (US); David (56) References Cited N. Cook, Brooklyn, NY (US); Marin Vulic, Boston, MA (US); Geoffrey von U.S. PATENT DOCUMENTS Maltzahn, Boston, MA (US); Brian 3,009,864 A 1 1/1961 Gordon-Aldterton et al. Goodman, Boston, MA (US); John 3,228,838 A 1/1966 Rinfret Grant Aunins, Doylestown, PA (US); 3,608,030 A 9, 1971 Tint 4,077,227 A 3, 1978 Larson Matthew R. Henn, Somerville, MA 4,205,132 A 5/1980 Sandline (US); David Arthur Berry, Brookline, 4,655,047 A 4/1987 Temple MA (US); Jonathan Winkler, Boston, 4,689,226 A 8, 1987 Nurmi MA (US) 4,839,281 A 6, 1989 Gorbach et al. 5,196.205 A 3/1993 Borody Assignee: SERES THERAPEUTICS, INC., 5.425,951 A 6/1995 Goodrich (73) 5.436,002 A * 7/1995 Payne ...... AON 63,00 Cambridge, MA (US) 424.93.2 5,443,826 A 8/1995 Borody (*) Notice: Subject to any disclaimer, the term of this 5,599,795 A 2f1997 McCann patent is extended or adjusted under 35 5,648,206 A 7, 1997 Goodrich U.S.C. 154(b) by 0 days. 5,951,977 A 9, 1999 Nisbet et al. 5,965,128 A 10/1999 Doyle et al. 6,589.771 B1 7/2003 Marshall (21) Appl. No.: 14/884,655 6,645,530 B1 11/2003 Borody 7.427,398 B2 9, 2008 Baillon et al. (22) Filed: Oct. 15, 2015 7.628,982 B2 12/2009 Klaviniskis 7,632,520 B2 12/2009 Khandelwal (65) Prior Publication Data 7,708,988 B2 5, 2010 Farmer 7,731,976 B2 6, 2010 Cobb US 2016/O199423 A1 Jul. 14, 2016 (Continued) Related U.S. Application Data FOREIGN PATENT DOCUMENTS (60) Continuation of application No. 14/313,828, filed on Jun. 24, 2014, now Pat. No. 9,180,147, which is a EP 0033584 A3 1, 1981 division of application No. 14/197,044, filed on Mar. EP O433299 A4 4f1992 4, 2014, now Pat. No. 9,011,834, which is a (Continued) continuation of application No. PCT/US2014/014745, filed on Feb. 4, 2014. OTHER PUBLICATIONS (60) Provisional application No. 61/760,584, filed on Feb. Robinson etal (International Journal of Systmatic Bacteriology vol. 4, 2013, provisional application No. 61/760,585, filed 31, No. 3, pp. 333-338, 1981).* on Feb. 4, 2013, provisional application No. Aas, J., Gessert, C.E., and Bakken, J.S. (2003). Recurrent 61/760,574, filed on Feb. 4, 2013, provisional Clostridium difficile colitis: case series involving 18 patients treated application No. 61/760,606, filed on Feb. 4, 2013, with donor stool administered via a nasogastric tube. Clinical provisional application No. 61/926,918, filed on Jan. Infectious Diseases 36(5), 580-585. 13, 2014. Abrams, R.S., “Open-Label, Uncontrolled Trial of Bowel Steriliza tion and Repopulation with Normal Bowel Flora for Treatment of Int. C. Inflammatory Bowel Disease.” Current Therapeutic Research, Dec. (51) 1997, pp. 1001-1012, vol. 58, No. 12. CI2N 3/00 (2006.01) Achtman, M., and Wagner, M. (2008), Microbial diversity and the A6 IK 35/74 (2015.01) genetic nature of microbial species, Nat. Rev. Microbiol. 6(6), A6 IK 9/00 (2006.01) 431-440. A6 IK 45/06 (2006.01) A6 IK 35/74 (2015.01) (Continued) CI2N L/20 (2006.01) Primary Examiner — Albert Navarro A6 IK 35/742 (2015.01) (74) Attorney, Agent, or Firm — Fenwick & West LLP A6 IK 35/744 (2015.01) (57) ABSTRACT A 6LX 35/745 (2015.01) A 6LX 35/747 (2015.01) Disclosed herein are therapeutic compositions containing A6 IK 9/48 (2006.01) non-pathogenic, germination-competent bacterial spores, (52) U.S. C. for the prevention, control, and treatment of gastrointestinal CPC ...... A61K 35/741 (2013.01); A61K 9/0053 diseases, disorders and conditions and for general nutritional (2013.01); A61K 9/4816 (2013.01); A61 K health. 35/74 (2013.01); A61K 35/742 (2013.01); 24 Claims, 21 Drawing Sheets US 9,585,921 B2 Page 2
(56) References Cited WO WO 2008/076696 A2 6, 2008 WO WO 2008/083157 A2 T 2008 U.S. PATENT DOCUMENTS WO WO 2010/030997 A1 3f2010 WO WO 2010/062369 A2 6, 2010 7,763,420 B2 7/2010 Stritzker et al. WO WO 2010, 124387 A1 11, 2010 7.981,411 B2 7/2011 Nadeau et al. WO WO 2010, 151842 A2 12/2010 7.998.473 B2 8/2011 Boileau et al. WO WO 2011/005756 A1 1/2011 8,021,654 B2 9/2011 Rehberger et al. WO WO 2011/022542 A2 2/2011 8,034,601 B2 10/2011 Boileau WO WO 2011022660 A1 2/2011 8,039,006 B2 10/2011 Prato WO WO 2011/03331.0 A1 3, 2011 8, 147,482 B2 4/2012 Shimizu WO WO 2011/043654 A1 4, 2011 8, 187,590 B2 5, 2012 Farmer WO WO 2011/046616 A3 4, 2011 8,236,508 B2 8/2012 Mutharasan WO WO 2011 (103123 A2 8, 2011 8,388,996 B2 3/2013 Gehling WO WO 2011, 107482 A2 9, 2011 8.460,648 B2 6/2013 Borody WO WO 2011 113801 A1 9, 2011 8,906,668 B2 12/2014 Henn et al. WO WO 2011 107481 A2 9/2011 9,011,834 B1 4/2015 McKenzie et al. WO WO 2011/152566 A2 12/2011 9,028,841 B2 5, 2015 Hennet al. WO WO 2012/OO9712 A2 1, 2012 9,180,147 B2 11/2015 McKenzie et al. WO WO 2012/O16287 A2 2/2012 2001.0036453 A1 11, 2001 Reid WO WO 2012/045150 A1 4, 2012 2004/0028689 A1 2/2004 Borody WO WO 2012/064981 A2 5, 2012 2004/0170617 A1 9/2004 Finegold WO WO 2012,116289 A2 8, 2012 2005, 0180962 A1 8, 2005 RaZ WO WO 2012/122478 A1 9, 2012 2006/0046246 A1 3/2006 Zeng et al. WO WO 2012/122522 A2 9, 2012 2006,0188523 A1 8, 2006 Pei WO WO 2012/142605 A1 10, 2012 2006/0233830 A1 10/2006 Wong WO WO 2012, 148991 A1 11, 2012 2007/014 1139 A1 6/2007 Vandenberg WO WO 2012/159023 A2 11/2012 2009, O197249 A1 8, 2009 Gilevet WO WO 2013/O19896 A1 2/2013 2010, 0074872 A1 3/2010 Blaser et al. WO WO 2013,032328 A1 3f2013 2010/0215745 A1 8, 2010 LaZZari et al. WO WO 2013,037O67 A1 3f2013 2011/0081320 A1 4, 2011 Westall et al. WO WO 2013,037068 A1 3f2013 2011/0113863 A1 5/2011 Fuhrmann et al. WO WO 2013,053836 A1 4, 2013 2011/O189132 A1 8/2011 Garner et al. WO WO 2013/080561 A1 6, 2013 2011/0280840 A1 11/2011 Blaser WO WO 2013, 166031 A1 11, 2013 2012/0020950 A1 1/2012 Davis et al. WO WO 2013, 171515 A1 11, 2013 2012, 0021429 A1 1/2012 Rublee WO WO 2013, 176774 A1 11, 2013 2012,002 1921 A1 1/2012 Scott WO WO 2014,082050 A1 5, 2014 2012fOO58094 A1 3, 2012 Blaser WO WO 2014, 121298 A2 8, 2014 2012fOO64592 A1 3, 2012 O'Mullan et al. WO WO 2014f12 1301 A1 8, 2014 2012/0128633 A1 5/2012 Veiga et al. WO WO 2014f12 1302 A2 8, 2014 2012/0128634 A1 5/2012 Veiga WO WO 2014f12 1304 A1 8, 2014 2012/0148629 A1 6, 2012 Holvoet et al. WO WO 2014f145958 A2 9, 2014 2012fO149584 A1 6, 2012 Ole WO WO 2014/153194 A2 9, 2014 2012/01652.15 A1 6, 2012 Andersen WO WO 2015, O77794 A1 5, 2015 2012/0177650 A1 7/2012 Borody WO WO 2015,095241 A2 6, 2015 2012fO2O7726 A1 8/2012 Lipkin 2012fO238468 A1 9, 2012 Tuk OTHER PUBLICATIONS 2012,0264.637 A1 10, 2012 Brodie 2012/0276.149 A1 11/2012 Littman Accoceberry, I. et al., “One-Step Purification of Enterocytozoon 2012/0276201 A1 11/2012 Trachtman Bieneusi Spores from Human Stools by Immunoaffinity Expanded 2012/03 15249 A1 12/2012 Olmstead Bed Adsorption.” Journal of Clinical Microbiology, May 2001, pp 2013, OO17999 A1 1/2013 Fremont 2013/0022575 A1 1/2013 Cassity 1974-1951, vol.39, No. 5. 2013,0045274 A1 2/2013 Hlavka Allen-Vercoe, E., Reid, G., Viner, N., Gloor, G.B., Hota, S., Kim, P., Lee, C. O'Doherty, K. Vanner, S.J., Weese, J.S., et al. (2012). A 2013,0045874 A1 2, 2013 Ehrlich Canadian Working Group report on fecal microbial therapy: micro 2013,012 1968 A1 5/2013 Quay bial ecosystems therapeutics. Can. J. Gastroenterol. 26(7), 457-462. 2013, O149339 A1 6, 2013 Honda Allen-Vercoe, E., Strauss, J., and Chadee, K. (2011). Fusobacterium 2013/014.9375 A1 6, 2013 Geall nucleatum: an emerging gutpathogen? Gut Microbes 2(5), 294-298. 2013/0266539 A1 10/2013 Borody Anderson, K.F., Lonsway, D.R., Rasheed, J.K., Biddle, J., Jensen, 2014/0045744 A1 2/2014 Gordon B. McDougal, L.K., Carey, R.B., Thompson, A., Stocker, S., 2014/0199281 A1* 7, 2014 Henn ...... A61K 38.13 Limbago, B., et al. (2007) Evaluation of Methods to Identify the 424,9346 Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae. J. 2015,0190435 A1 7, 2015 Henn et al. Clin. Microbiol. 45(8), 2723-2725. Arumugam, M., Raes, J., Pelletier, E. Paslier, D.L., Yamada, T., FOREIGN PATENT DOCUMENTS Mende, D.R., Fernandes, G.R., Tap, J., Burls, T., Batto, J.-M., et al. (2011). Enterotypes of the human gut microbiome, Nature 473(7346), 174-180. E. ES5 R 33 Atarashi, K., Tanoue, T., Oshima, K., Suda, W., Nagano, Y. EP 2337569 A2 6, 2011 Nishikawa, H., Fukuda, S., Saito, T., Narushima, S., Hase, K., et al. EP 2338989 A1 6, 2011 (2013), Treg induction by a rationally selected mixture of Clostridia EP 2519108 A1 11 2012 strains from the human microbiota, Nature 500(7461), 232-236. EP 2684469 A 1, 2014 Atarashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwahara, T., EP O47982O B1 T 2014 Momose, Y. Cheng, G., Yamasaki, S., Saito, T., Ohba, Y, et al. EP 2626O76 A1 8, 2014 (2011), Induction of colonic regulatory T cells by indigenous WO WO99/O1335 A1 2, 1990 Clostridium species. Science 331(6015), 337-341. WO WO O2/O7741 A1 1, 2002 Backhed, F. et al., (2004). The gut microbiota as an environment WO WO 2005/110445 A2 11/2005 factor that regulates fat storage, PNAS, Nov. 2, 2014, pp. 15718 WO WO 2006/O12586 A2 2, 2006 15723, vol. 101, No. 44. US 9,585,921 B2 Page 3
(56) References Cited Boyles, W.A., and Lincoln, R.E. (1958), Separation and concentra tion of bacterial spores and vegetative cells by foam flotation. Appl OTHER PUBLICATIONS Microbiol 6(5), 327-334. Brandt, L.J. (2012). Fecal Transplantation for the Treatment of Bader, J., Albin, A., and Stahl, U. (2012). Spore-forming bacteria Clostridium difficile Infection, Gastroenterol Hepatol (NY) 8(3), and their utilisation as probiotics, Benef Microbes 3(1), 67-75. 191-194. Bakken, J.S. (2009), Fecal bacteriotherapy for recurrent Clostridium Brandt, L.J. Aroniadis, O.C., Mellow, M., Kanatzar, A., Kelly, C. difficile infection. Anaerobe 15(6), 285-289. Park, T., Stollman, N., Rohlke. F., and Surawicz, C. (2012), Long Bakken, J.S., Borody, T., Brandt, L.J., Brill, J.V. Demarco, D.C., Term Follow-Up of Colonoscopic Fecal Microbiota Transplant for Franzos, M.A., Kelly, C. Khoruts, A., Louie, T., Martinelli, L.P., et Recurrent Clostridium difficile Infection. The American Journal of al. (2011). Treating Clostridium difficile infection with fecal Gastroenterology 107(7), 1079-1087. microbiota transplantation. Clin. Gastroenterol. Hepatol. 9(12), Bräuniger, S. Peters, J., Borchers, U., and Kao, M. (2000). Further 1044-1049. studies on thermal resistance of bovine parvovirus against moist and Barreau, M., Pagnier, I., and La Scola, B. (2013). Improving the dry heat. International Journal of Hygiene and Environmental identification of anaerobes in the clinical microbiology laboratory Health 203(1), 71-75. through MALDI-TOF mass spectrometry. Anaerobe 22, 120-125. Broda, D.M., De Lacy, K.M., and Bell, R.G. (1998). Efficacy of heat Bauer, T.M. et al., “Derivation and Validation of Guidelines for and ethanol spore treatments for the isolation of psychrotrophic Stool Cultures for Enteropathogenic Bacteria. Other Than Clostridium spp. associated with the spoilage of chilled vacuum Clostridium difficile in Hospitalized Adults.” The Journal of the packed meats. International Journal of Food Microbiology 39(1-2), American Medical Association, Jan. 17, 2001, pp. 313-319, vol. 61-68. 285. Brosius, J. et al., "Complete Nucleotide Sequence of a 16S Ribo Ben-Amor, K., Heilig, H. Smidt, H., Vaughan, E.E., Abee, T., and Somal RNA Gene from Eschericia coli,' Proc. Natl. Acad. Sci., Oct. DeVos, W.M. (2005). Genetic diversity of viable, injured, and dead 1978, pp. 4801-4805, vol. 75, No. 10. fecal bacteria assessed by fluorescence-activated cell sorting and Bueche, M., Wunderlin, T., Roussel-Delif, L., Junier, T., Sauvain, 16S rRNA gene analysis. Applied and Environmental Microbiology L., Jeanneret, N., and Junier, P. (2013). Quantification of 71(8), 4679-4689. Endospore-Forming Firmicutes by Quantitative PCR with the Func Berstad, A. et al., “Fecal Fat Determination with a Modified tional Gene spo0A. Applied and Environmental Microbiology Titration Method.” Scandinavian Journal of Gastroenterology, 79(17), 5302-5312. 2010, pp. 603-607, vol. 45. Buffie, C.G., and Pamer, E.G. (2013). Microbiota-mediated colo Bhatia, A. et al., "Proionibacterium Acnes and Chronic Diseases.” nization resistance against intestinal pathogens. Nature Reviews The Infectious Etiology of Chronic Diseases: Defining the Rela Immunology 13(11), 790-801. tionship, Enhancing the Research, and Mitigating the Effects: Burke, C.J., Hsu, T.A., and Volkin, D.B. (1999). Formulation, Workshop Summary. Knobler, S.L. et al. (eds.), 2004, pp. 74-80, stability, and delivery of live attenuated vaccines for human use. may be downloaded at{URL:http://www.nap.edu/catalog/11026. Crit Rev Ther Drug Carrier Syst 16(1), 1-83. html>. Cani, P.D., Possemiers, S., Wiele, T.V. De, Guiot, Y. Everard, A., Bidawid, S., Farber, J.M., Sattar, S.A., and Hayward, S. (2000), Rottier, O., Geurts, L., Naslain, D., Neyrinck, A., Lambert, D.M., et Heat inactivation of hepatitis. A virus in dairy foods. J. Food Prot. al. (2009). Changes in gut microbiota control inflammation in obese 63(4), 522-528. mice through a mechanism involving GLP-2-driven improvement Bloedt, K., Riecker, M., Poppert, S., and Wellinghausen, N. (2009). of gut permeability. Gut 58(8), 1091-1103. Evaluation of new selective culture media and a rapid fluorscence Cavalho, A.S., Silva, J., Ho, P., Teixeira, P., Malcata, F.X., and in situ hybridization assay for identification of Clostridium difficile Gibbs, P. (2008). Effects of Various Sugars Added to Growth and from stool samples. J Med Microbiol 58(7), 874-877. Drying Media upon Thermotolerance and Survival throughout Bokulich, N.A., Subramanian, S., Faith, J.J., Gevers, D., Gordon, Storage of Freeze-Dried Lactobacillus delbrueckii spp. bulgarious. J.I., Knight, R., Mills, D.A., and Caporaso, J.G. (2013). Quality Biotechnology Progress 20(1), 248-254. filtering vastly improves diversity estimates from Illumina amplicon Champagne, C.P. Mondou, F. Raymond, Y., and Roy, D. (1996). sequencing. Nat Methods 10(1), 57-59. Effect of polymers and storage temperature on the stability of Bolivar, I. et al., “Bacterial Diversity in Oral Samples of Children freeze-dried lactic acid bacteria. Food Research International 29(5- in Niger with Acute Noma, Acute Necrotizing Gingivitis and 6), 555-562. Healthy Controls.” PLOS Neglected Tropical Diseases, Mar. 2012, Chang, J.Y., Antonopoulos, D.A., Kalra, A., Tonelli, A., Khalife, pp. 1-11, vol. 6, No. 3. E1556: Uncultured Catonella sp. partial 16S W.T. Schmidt, T.M., and Young, V.B. (2008). Decreased diversity rRNA Gene, Clone 402AO4(oral): Nucleotide: NCBI: GenBank: of the fecal Microbiome in recurrent Clostridium difficile-associated AM420133.1, last accessed Mar. 12, 2014, pp. 12-13. diarrhea. J. Infect. Dis. 197(3), 435-438. Borody, T.J. etal. (2011). Fecal microbiota transplantation (FMT) in Chapman, C.M.C., Gibson, G.R., and Rowland, I. (2012). In vitro multiple Sclerosis. Poster abstract at American College of Gastro evaluation of single- and multi-strain probiotics: Inter-species inhi enterology Annual Scientific Meeting and Postgraduate Course Oct. bition between probiotic strains, and inhibition of pathogens. Anaer 28, 2011. obe 18(4), 405-413. Borody, T.J., and Khoruts, A. (2012), Fecal microbiota transplan Chen, X., Katchar, K., Goldsmith, J.D., Nanthakumar, N., Cheknis, tation and emerging applications. Nat Rev Gastroenterol Hepatol A., Gerding, D.N., and Kelly, C.P. (2008). A Mouse Model of 9(2), 88-96. Clostridium difficile-Associated Disease. Gastroenterology 135(6), Borody, T.J., and Khoruts, A. (2012). Fecal microbiota transplan 1984-1992. tation and emerging applications. Nat Rev Gastroenterol Hepatol Chow, J., Tang, H., and Mazmanian, S.K. (2011). Pathobionts of the 9(2), 88-96. Gastrointestinal Microbiota and Inflammatory Disease. Curr Opin Borriello, S.P. (1990). The influence of the normal flora on Immunol 23(4), 473-480. Clostridium difficile colonisation of the gut. Ann. Med. 22(1), Claesson, M.J. Wang, Q., O'Sullivan, O. Greene-Diniz, R., Cole, 61-67. J.R., Ross, R.P., and O'Toole, P.W. (2010). Comparison of two Borriello, S.P., and Barclay, F.E. (1985). Protection of hamsters next-generation sequencing technologies for resolving highly com against Clostridium difficile ileocaecitis by prior colonisation with plex microbiota composition using tandem variable 16S rRNA gene non-pathogenic strains. J Med Microbiol 19(3), 339-350. regions. Nucleic Acids Res 38(22), e200. Borriello, S.P., and Honour, P. (1981). Simplified procedure for the Clemente, J.C., Ursell, L.K., Parfrey, L.W., and Knight, R. (2012). routine isolation of Clostridium difficile from faeces. J Clin Pathol The impact of the gut microbiota on human health: an integrative 34(10), 1124-1127. view. Cell 148(6), 1258-1270. US 9,585,921 B2 Page 4
(56) References Cited Endt, K., Stecher, B., Chaffron, S., Slack, E., Tchitchek, N., Benecke, A., Van Maele, L., Sirard, J.-C., Mueller, A.J., OTHER PUBLICATIONS Heikenwalder, M., et al. (2010). The Microbiota Mediates Pathogen Clearance from the Gut Lumen after Non-Typhoidal Salmonella D'Souza, D.H., and Su, X. (2010). Efficacy of chemical treatments Diarrhea. PLoS Pathog 6(9), e101097. against murin norovirus, feline calicivirus, and MS2 bacteriophage, Everard, A., Belzer, C., Geurts, L., Ouwerkerk, J.P., Druart, C., Foodborne Pathogens and Disease 7(3), 319-326. Bindels, L.B., Guiot, Y., Derrien, M., Muccioli, G.G., Delzenne, David, L.A., Maurice, C.F. Carmody, R.N., Gootenberg, D.B., N.M., et al. (2013). Cross-talk between Akkermansia muciniphila Button, J.E., Wolfe, B.E., Ling, A.V. Devlin, A.S. Varma, Y. and intestinal epithelium controls diet-induced obesity. Proceedings Fischbach, M.A., et al. (2013). Diet rapidly and reproducibly alters of the National Academy of Sciences 110(22), 9066-9071. the human gut microbiome. Nature advance online publication. Fairhead, H., Setlow, B., Waites, W.M., and Setlow, P. (1994). De Angelis, M., Piccolo, M., Vannini, L., Siragusa, S., De Giacomo, Small, acid-soluble proteins bound to DNA protect Bacillus subtilis A., Serrazzanetti, D.I., Cristofori, F., Guerzoni, M.E., Gobbetti, M., spores from being killed by freeze-drying. Applied and Environ and Francavilla, R. (2013). Fecal Microbiota and Metabolome of mental Microbiology 60(7), 2647-2649. Children with Austism and Pervasive Developmental Disorder Not Faith, J.J. Ahern, P.P. Ridaura, V.K., Cheng, J., and Gordon, J.I., Otherwise Specified. PLoS ONE 8(10), e76993. (2014). Identifying Gut Microbe-Host Phenotype Relationships DeVos, W.M. (2013). Fame and future of faecal transplantations— Using Combinatorial Communities in Gnotobiotic Mice. Sci Transl developing next-generation therapies with synthetic microbiomes: Med 6(220), 220ral 1-220ral 1. Fame and future of faecal transplantations. Microbial Biotechnol Fakhry, S., Sorrentini, I., Ricca, E., De Felice, M., and Baccigalupi, ogy 6(4), 316-325. L. (2008). Characterization of spore forming Bacilli isolated from Defend Fecal Microbiota Transplantation for Clostridium Difficile the human gastrointestinal tract. Journal of Applied Microbiology Diarrhea.
(56) References Cited Hirsch, E.B., and Tam. V.H. (2010). Detection and treatment options for Klebsiella pneumoniae carbapenemases (KPCs): an emerging OTHER PUBLICATIONS cause of multidrug-resistant infection. J. Antimicrob. Chemother. 65(6), 1119-1125. Gough, E. et al., “Systematic Review of Intestinal Microbiota Hofsten, B.V. (1966). Partition of Escherichia coli in an aqueous Transplantation (Fecal Bacteriotherapy) for Recurrent Clostridium polymer two-phase system. Experimental Cell Research 41(1), Dfficile Infection.” Clin. Infect. Dis., Nov. 15, 2011, pp. 994-1002, 117-123. vol. 53, No. 10. Holmes, E., Kinross, J., Gibson, G.R., Burcelin, R., Jia, W., Pet Gould, G.W., and Sale, A.J. (1970). Initation of germination of tersson, S., and Nicholson, J.K. (2012). Therapeutic Modulation of bacterial spores by hydrostatic pressure. J. Gen. Microbiol. 60(3), Microbiota-Host Metabolic Interactions, Science Translational 335-346. Medicine 4(137), 137 rv6-137 rv6. Grabow, W.O., Clay, C.G., Dhaliwal. W. Vrey, M.A., and Müller, Hoppe, B., Groothoff, J.W., Hulton, S.-A., Cochat, P. Niaudet, P. E.E. (1999). Elimination of viruses, phages, bacteria and Kemper, M.J., Deschenes, G., Unwin, R., and Milliner, D. (2011). Cryptosporidium by a new generation Aquaguard point-of-use Efficacy and safety of Oxalobacter formigenes to reduce urinary oxalate in primary hyperoxaluria. Nephrol. Dial. Transplant. 26(11), water treatment unit. Zentralbl Hyg Umweltmed 202(5), 399-410. 3609-3615. Greenway, F. Wang, S., and Heiman, M. (2014). A novel cobiotic Hoyles, L., Honda, H., Logan, N.A., Halket, G., La Ragione, R.M., containing a prebiotic and an antioxidant augments the glucose and McCartney, A.L. (2012). Recognition of greater diversity of control and gastrointestinal tolerability of metformin: a case report. Bacillus species and related bacteria in human faeces. Res. Beneficial Microbes 5(1), 29-32. Microbiol. 163(1), 3-13. Grehan, M.J., Borody, T.J., Leis, S.M., Campbell, J., Mitchell, H., Hurst, C.J., and Gerba, C.P. (1989). Fate of viruses during waste and Wettstein, A. (2010). Durable alteration of the colonic water sludge treatment processes. Critical Reviews in Environmen microbiota by the administration of donor fecal flora. J. Clin. tal Control 18(4), 317-343. Gastroenterol. 44(8), 551-561. Iizuka, M. et al., “Elemental Diet Modulates the Growth of Grimoud, J. et al., “In Vitro Screening of Probiotic Lactic Acid Clostridium difficile in the Gut Flora,' Aliment Pharmacol. Ther., Bacteria and Prebiotic Glucooligosaccharides to Select Effective Jul. 2004, pp. 151-157, vol. 20, Suppl. 1. Synbiotics.” Anaerobe, Clinical Microbiology, Oct. 2010, pp. 493 Itoh, K., and Mitsuoka, T. (1985). Characterization of clostridia 500, vol. 16, No. 5. isolated from faeces of limited flora mice and their effect on caecal Hamilton, M.J., Weingarden, A.R., Sadowsky, M.J., and Khoruts, A. size when associated with germ-free mice. Laboratory Animals (2012). Standardized frozen preparation for transplantation of fecal 19(2), 111-118. microbiota for recurrent Clostridium difficile infection. Am. J. Itoh, K. Lee, W.K., Kawamura, H., Mitsuoka, T., and Magaribuchi, Gastroenterol. 107(5), 761-767. T. (1987). Intestinal bacteria antagonistic to Clostridium difficile in Hamilton, M.J., Weingarden, A.R., Unno, T., Khoruts, A., and mice. Lab Anim 21(1), 20-25. Sadowsky, M.J. (2013). High-throughput DNA sequence analysis Itoh, K., Urano, T., and Mitsuoka, T. (1986). Colonization resistance reveals stable engraftment of gut microbiota following transplan against Pseudomonas aeruginosa in gnotobiotic mice. Lab Anim tation of previously frozen fecal bacteria. Gut Microbes 4(2), 20(3), 197-201. 125-135. Jalanka-Tuovinen, J., Salojarvi, J., Salonen, A., Immonen, O.. Harmsen, H. J. M., Gibson, G. R. Elfferich, P. Raangs, G. C. Garsed, K. Kelly, F.M., Zaitoun, A., Palva, A., Spiller, R.C., and De Wildeboer-Veloo, A. C. M., Argaiz, A., Roberfroid, M.B., and Vos, W.M. (2013). Faecal microbiota composition and host-microbe Welling, G. W. (2000). Comparison of viable cell counts and cross-talk following gastroenteritis and in postinfectious irritable fluorescence in situ hybridization using specific rRNA-based probes bowel syndrome. Gut 0, 1-9. for quantification of human fecal bacteria. FEMS Microbiology Jeffs, L.B., and Khachatourians, G.G. (1997). Estimation of spore Letters 183(1), 125-129. hydrophobicity for members of the genera Beauveria, Metarhizium, Harrison, F. “Bacterial Cooperation in the Wild and in the Clinic: and Tolypociadium by Salt-mediated aggregation and sedimentation, Are Pathogen Social Behaviours Relevant Outside the Laboratory?” Canadian Journal of Microbiology 43(1), 23-28. Bioessays, Dec. 27, 2012. pp. 108-112, vol. 35. No. 2. Jensen, N.S., and Canale-Parola, E. (1986). Bacteroides Hasan, J.A., Japal, K.M., Christensen, E.R., and Samalot-Freire, Pectinophilus sp. nov. and Bacteroides Galacturonicus sp. nov.: two L.C. (2011). In vitro production of Clostridium difficile spores for pectinolytic bacterial from the human intestinal tract. Appl. use in the efficacy evaluation of disinfectants: a precollaborative Environ. Microbiol. 52(4), 880-887. investigation. J AOAC Int 94(1), 259-272. Jones, M.L., Martoni, C.J., and Prakash, S. (2012a). Cholesterol Hayashi, Y. et al., “Western Blot (Immunoblot) Assay of Small lowering and inhibition of sterol absorption by Lactobacillus reuteri Round-Structured Virus Associated with an Acute Gastroenteritis NCIMB 30242: a randomized controlled trial. Eur J. Clin Nutr Outbreak in Tokyo.” Journal of Clinical Microbiology, Aug. 1989, 66(11), 1234-1241. pp. 1728-1733, vol. 27. Jones, M.L., Martoni, C.J., Parent, M., and Prakash, S. (2012b). Hell, M., Bernhofer, C., Stalzer, P., Kern, J.M., and Claassen, E. Cholesterol-lowering efficacy of a microencapsulated bile Salt (2013). Probiotics in Clostridium difficile infection: reviewing the hydrolase-active Lactobacillus reuteri NCIMB 30242 yoghurt for need for multistrain probiotic. Beneficial Microbes 4(1), 39-51. mulation in hypercholesterolaemic adults. British Journal of Nutri Hemmerling, A., Harrison, W., Schroeder, A., Park, J., Korn, A., tion 107(10), 1505-1513. Shiboski, S., Foster-Rosales, A., and Cohen, C.R. (2010). Phase 2a Jorgensen, J.H., and Ferraro, M.J. (2009). Antimicrobial Suscepti Study Assessing Colonization Efficiency, Safety, and Acceptability bility Testing: A Review of General Principles and Contemporary of Lactobacillus crispatus CTV-05 in Women With Bacterial Practices. Clin Infect Dis. Medical Microbiology, 49(11), 1749 Vaginosis: Sexually Transmitted Diseases 37(12), 745-750. 1755. Herron, P.R., and Wellington, E.M.H. (1990). New Method for Jorup-Rönström, C., Håkanson, A., Sandell, S., Edvinsson, O. Extraction of Streptomycete Spores from Soil and Application to the Midtvedt, T. Persson, A.-K., and Norin, E. (2012). Fecal transplant Study of Lysogeny in Sterile Amended and Nonsterile Soil. Appl against relapsing Clostridium difficile-associated diarrhea in 32 Environ Microbiol 56(5), 1406-1412. patients. Scand. J. Gastroenterol. 47(5), 548-552. Hewitt, J., Rivera-Aban, M., and Greening, G.E. (2009). Evaluation Jousimies-Somer, H., Summanen, P., Citron, D.M., Baron, E.J., of murine norovirus as a Surrogate for human norovirus and Wexler, H.M., and Finegold, S.M. (2002). Wadsworth-KLT Anaero hepatitis A virus in heat inactivation studies. Journal of Applied bic Bacteriology Manual, 6th edition (California: Star), pp. 55-74. Microbiology 107(1), 65-71. 81-132, 165-185. Hindle, A.A., and Hall, E. A.H. (1999). Dipicolinic acid (DPA) assay Kailasapathy, K. (2002). Microencapsulation of probiotic bacteria: revisited and appraised for spore detection. The Analyst 124(11), technology and potential applications. Curr Issues Intest Microbiol 1599-1604. 3(2), 39-48. US 9,585,921 B2 Page 6
(56) References Cited microbiota transplantation does not induce remission in patients with chronic active ulcerative colitis. Inflamm. Bowel Dis. 19(10), OTHER PUBLICATIONS 2155-2165. Kunde, S., Pham, A., Bonczyk, S., Crumb, T., Duba, M. Conrad, H., Kamiya, S., Yamakawa, K. Ogura, H., and Nakamura, S. (1989). JR. Cloney, D., and Kugathasan, S. (2013). Safety, tolerability, and Recovery of spores of Clostridium difficile altered by heat or alkali. clincial response after fecal transplantation in children and young J Med Microbiol 28(3), 217-221. adults with ulcerative colitis, J. Pediatr. Gastroenterol. Nutr. 56(5), Kanamoto, T. et al., “Genetic Heterogeneities and Phenotypic 597-601 Characteristics of Strains of the Genus Abiotrophia and Proposal of Landy, J., Al-Hassi, H.O. McLaughlin, S.D., Walker, A.W., Abiotrophia para-adiacens sp. nov...' Journal of Clinical Microbi Ciclitira, P.J., Nicholls, R.J., Clark, S.K., and Hart, A.L. (2011). ology, Feb. 2000, pp. 492-498, vol. 38, No. 2; Abiotropia para Review article: faecal transplantation therapy for gastrointestinal adjacens gene for 16S rRNA, partial sequence, strain: Nucleotide: disease. Alimentary Pharmacology & Therapeutics 34(4), 409–415. NCBI: GenBank: AB022027.1, last accessed Mar. 12, 2014, p. 8. Lawley, T.D., Clare, S. Walker, A.W., Stares, M.D., Connor, T.R., Kanehisa Laboratories. KEGG: Kyoto encyclopedia of genes and Raisen, C., Goulding, D., Rad, R., Schreiber, F. Brandt, C., et al. genomes.
(56) References Cited Olle, B. (2013). Medicines from microbiota. Nat. Biotechnol. 31(4), 309-315. OTHER PUBLICATIONS OpenBiome. Quality metrics,
(56) References Cited Rohlke. F. Surawicz, C.M., and Stollman, N. (2010). Fecal flora reconstitution for recurrent Clostridium difficile infection: results OTHER PUBLICATIONS and methodology. J. Clin. Gastroenterol. 44(8), 567-570. Rosen, D.L., Sharpless, C., and McGown, L.B. (1997). Bacterial Perez, F. Pultz, M.J., Endimiani, A., Bonomo, R.A., and Donskey, Spore Detection and Determination by Use of Terbium Dipicolinate C.J. (2011). Effect of antibiotic treatment on establishment and Photoluminescence. Anal. Chem. 69(6), 1082-1085. elimination of intestinal colonization by KPC-producing Klebsiella Sack, D.A., Shimko, J., Sack, R.B., Gomes, J.G., MacLeod, K., pneumoniae in mice. Antimicrob. Agents Chemother. 55(6), 2585 O'Sullivan, D., and Spriggs, D. (1997). Comparison of alternative 2589. buffers for use with a new live oral cholera vaccine, Peru-15, in Perez, J., Springthorpe, V.S., and Sattar, S.A. (2011). Clospore: a outpatient volunteers. Infect. Immun. 65(6), 2107-2111. liquid medium for producing high liters of semi-purified spores of Sacks, L.E., and Alderton, G. (1961). Behavior of bacterial spores Clostridium difficile. J AOAC Int94(2), 618-626. in aqueous polymer two-phase systems. J. Bacteriol. 82. 331-341. Peterson, D.A. et al., “Metagenomic Approaches for Defining the Sahlström, L., Bagge, E., Emmoth, E., Holmqvist, A., Danielsson Pathogenesis of Inflammatory Bowel Diseases,” Cell Host Microbe, Tham, M.-L., and Albihn, A. (2008). A laboratory study of Survival Jun. 2008, pp. 417-427, vol. 3, No. 6. of selected microorganisms after heat treatment of biowaste used in Petrof. E.O., Claud, E.C., Gloor, G.B., and Allen-Vercoe, E. biogas plants. Bioresour. Technol. 99(16), 7859-7865. (2013a). Microbial ecosystems therapeutics: a new paradigm in Santivarangkna, C., Kulozik, U., and Foerst, P. (2007). Alternative medicine? Beneficial Microbes 4(1), 53-65. Drying Processes for the Industrial Preservation of Lactic Acid Petrof. E.O., Gloor, G.B., Vanner, S.J., Weese, S.J., Carter, D., Starter Cultures. Biotechnology Progress 23(2), 302-315. Daigneault, M.C., Brown, E.M., Schroeter, K., and Allen-Vercoe, E. Sattar, S.A., Jason, T., Bidawid, S., and Farber, J. (2000). Foodborne (2013b). Stool substitute transplant therapy for the eradication of spread of hepatitis A: recent studies on virus Survival, transfer and Clostridium difficile infection: “RePOOPulating” the gut, inactivation. The Canadian Journal of Infectious Diseases 11(3), Microbiome, Jan. 9, 2013, p. 3, vol. 1, No. 1. 159. Picot, A., and Lacroix, C. (2004). Encapsulation of bifidobacteria in Savaiano, D.A., Ritter, A.J., Klaenhammer, T., Walker, M.R., whey protein-based microcapsules and Survival in simulated gas Carlson, H.L.F., and Ruckle, J. (2012). A Novel High Purity trointestinal conditions and in yoghurt. International Dairy Journal Short-Chain Galacto-Oligosaccharide (RP-G28) Improves Lactose 14(6), 505-515. Digestion and Symptoms of Lactose Intolerance. Gastroenterology Pinn, D. et al. (2013). Follow-up Study of Fecal Microbiota Trans 142(5), S-182. plantation (FMT) for the Treatment of Refractory Irritable Bowel Savaiano, D.A., Ritter, A.J., Klaenhammer, T.R., Walker, W.A., Syndrome (IBS). Abstract ACG 2013. James, G.M., Longcore, A.T., Chandler, J.R., and Foyt, H.L. (2013). Postgate, J.R., and Hunter, J.R. (1961). On the Survival of Frozen Improving lactose digestion and symptoms of lactose intolerance Bacteria. J Gen Microbiol 26(3), 367-378. with a novel galacto-oligosaccharide (RP-G28): a randomized, Prilassnig, M. et al., “Are Probiotics Detectable in Human Feces double-blind clinical trial. Nutrition Journal 12(1), 160. After Oral Uptake by Healthy Volunteers?” The Middle European Seale, R.B., Flint, S.H. McQuillan, A.J., and Bremer, P.J. (2008). Journal of Medicine, Aug. 2007, pp. 456-462, vol. 119, Nos. 15-16. Recovery of Spores from Thermophilic Dairy Bacilli and Effects of PultZ, N.J., Hoyen, C.K., and Donskey, C.J. (2004). Inhibition of Their Surface Characteristics on Attachment to Different Surfaces. methicillin-resistant Staphylococcus aureus by an in vitro continu Appl Environ Microbiol 74(3), 731-737. ous-flow culture containing human stool microflora. FEMS Micro Seo, M., Inoue, I., Tanaka, M. Matsuda, N., Nakano, T., Awata, T., biology Letters 241(2), 201-205. Katayama, S., Aplers, D.H., and Komoda, T. (2013). Clostridium Queenan, A.M., and Bush, K. (2007). Carbapenemases: the Versa butyricum Miyairi 588 improves high-fat diet-induced non-alco tile B Lactamases. Clin. Microbiol. Rev. 20(3), 440-458. holic fatty liver disease in rats. Dig. Dis. Sci. 58(12), 3534-3544. Quigley, E.M.M. et al., “Small Intestinal Bacterial Overgrowth: Setlow, B., Cowan, A. E., and Setlow, P. (2003). Germination of Roles of Antibiotics, Prebiotics and Probiotics.” Gastroenterology, spores of Bacillus subtilis with dodecylamine, Journal of Applied Feb. 2006, pp. 78-90, vol. 130. Microbiology 95(3), 637-648. Raibaud, P., Ducluzeau, R., Dubos, F., Hudault, S., Bewa, H., and Setlow, B., Yu, J., Li, Y-Q., and Setlow, P. (2013). Analysis of the Muller, M.C. (1980). Implantation of bacteria from the digestive germination kinetics of individual Bacillus Subtilis spores treated tract of man and various animals into gnotobiotic mice. Am J Clin with hydrogen peroxide or sodium hypochlorite. Letters in Applied Nutr 33(11), 2440-2447. Ramirez, N., and Abel-Santos, E. (2010). Requirements for germi Microbiology 57(4), 259-265. nation of Clostridium sordellii spores in vitro. J. Bacteriol. 192(2), Shafaat, H.S., and Ponce, A. (2006). Applications of a Rapid 418-425. Endospore Viability Assay for Monitoring UV Inactivation and Rao, A.V. Shiwnarain, N., and Maharaj, I. (1989). Survival of Characterizing Arctic Ice Cores. Appl Environ Microbiol 72(10), Microencapsulated Bifidobacterium pseudolongirn in Simulated 6808-6814. Gastric and Intestinal Juices. Canadian Institute of Food Science Shah, I.M., Laaberki, M.-H., Popham, D.L., and Dworkin, J. (2008). and Technology Journal 22(4), 345-349. A. eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy Reeves, A.E., Koenigsknecht, M.J., Bergin, I.L., and Young, V.B. in response to peptidoglycan fragments. Cell 135(3), 486-496. (2012). Suppression of Clostridium difficile in the Gastrointestinal Shah, N.P. "Symposium: Probiotic Bacteria: Probiotic Bacteria: Tracts of Germfree Mice Inoculated with a Murine Isolate from the Selective Enumeration and Survival in Dairy Foods.” Oct. 7, 1999, Family Lachnospiraceae. Infection and Immunity 80(11), 3786 14 pages. 3794. Shah, N.P. et al., “Microencapsulation of Probiotic Bacteria and Rexroad, J., Wiethoff, C.M., Jones, L.S., and Middaugh, C.R. Their Survival in Frozen Fermented Diary Desserts.” The Australian (2002). Lyophilization and the thermostability of vaccines. Cell Journal of Dairy Technology, Oct. 2000, pp. 139-144, vol. 55, No. Preservation Technology 1(2), 91-104. 3. Ridaura, V.K., Faith, J.J., Rey, F.E., Cheng, J., Duncan, A.E., Kau, Shah, S. (2012). Clostridium difficile in inflammatory Bowel Dis A.L., Griffin, N.W., Lombard, V., Henrissat, B., Bain, J.R., et al. ease: a dangerous mix (Clostridium difficile Symposium, Miriam (2013). Gut Microbiota from Twins Discordant for Obesity Modu Hospital, Providence, RI). late Metabolism in Mice. Science 341 (6150), 1241214-1241214. Shahinas, D., Silverman, M., Sittler, T., Chiu, C., Kim, P., Allen Rode, L.J., and Foster, J.W. (1961). Germination of bacterial spores Vercoe, E. Weese, S. Wong, A., Low, D.E., and Pillai, D.R. (2012). with alkyl primary amines1.J. Bacteriol 81 (5), 768-779. Toward an Understanding of Changes in Diversity Associated with Roffe, C. (1996). Biotherapy for antibiotic-associated and other Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep diarrhoeas. J. Infect. 32(1), 1-10. Sequencing. mBio 3(5), e()0338-12-e?)0338-12. US 9,585,921 B2 Page 9
(56) References Cited Tvede, M., and Rask-Madsen, J. (1989). Bacteriotherapy for chronic relapsing Clostridium difficile diarrhoea in six patients. OTHER PUBLICATIONS Lancet 1(8648), 1156-1160. Ubeda, C., Bucci, V., Caballero, S., Djukovic, A., Toussaint, N.C., Sharpe, E.S., Nickerson, K.W. Bulla JR. L.A., and Aronson, J.N. Equinda, M., Lipuma, L., Ling, L., Gobourne, A., No, D., et al. (1975). Separation of spores and parasporal crystals of Bacillus (2013). Intestinal Microbiota Containing Barnesiella Species Cures thuringiensis in gradients of certain X-ray contrasting agents. Vancomycin-Resistant Enterococcus faecium Colonization. Infect. Applied Microbiology 30(6), 1052. Immun. 8.1(3), 965-973. Sheu, T.-Y., Marshall, R.T., and Heymann, H. (1993). Improving Ubeda, C., Taur, Y. Jenq, R.R., Equinda, M.J., Son, T., Samstein, Survival of Culture Bacteria in Frozen Desserts by Microentrap M. Viale, A., Socci, N.D., Van Den Brink, M.R.M., Kamboj. M., et ment. Journal of Dairy Science 76(7), 1902-1907. al. (2010). Vancomycin-resistant Enterococcus domination of intes Siaterlis, A., Deepika, G., and Charalampopoulos, D. (2009). Effect tinal microbiota is enabled by antibiotic treatment in mice and of culture medium and cryoprotectants on the growth and Survival precedes bloodstream invasion in humans. Journal of Clinical of probiotic lactobacilli during freeze drying. Letters in Applied Investigation 120(12), 4332-4341. Microbiology 48(3), 295-301. United States Office Action, U.S. Appl. No. 14/313,828, Aug. 13, Sigma-Tau. VSL#3.
(56) References Cited Yunoki, M., Tsujikawa, M., Urayama, T., Sasaki, Y. Morita, M., Tanaka, H., Hattori, S., Takechi, K., and Ikuta, K. (2003). Heat OTHER PUBLICATIONS sensitivity of human parvovirus B19. Vox Sanguinis 84(3), 164-169. Zeng, Y. Fan, H., Chiueh, G., Pham, B., Martin, R. Lechuga restores normal fecal bile acid composition in recurrent Clostridium Ballesteros, D., Truong, V.L., Joshi, S.B., and Middaugh, C.R. difficile infection. AJP: Gastrointestinal and Liver Physiology (2009). Towards development of stable formulations of a live 306(4), G310-G319. Wiencek, K.M. et al., "Hydrophobicity of Bacillus and Clostridium attenuated bacterial vaccine: a preformulation study facilitated by a Spores.” Applied and Environmental Microbiology, Sep. 1990, pp. biophysical approach. Hum. Vaccin 5(5), 322-331. 2600-2605, vol. 56, No. 9. Zhao, J., Krishna, V., Moudgil, B., and Koopman, B. (2008). Wilson, K.H., and Sheagren, J.N. (1983). Antagonism of toxigenic Evaluation of endospore purification methods applied to Bacillus Clostridium difficile by nontoxigenic C. difficile. Journal of Infec cereus. Separation and Purification Technology 61(3), 341-347. tious Diseases 147(4), 733. Dezfulian, M. et al., “Selective Medium for Isolation of Clostridium Wilson, K.H., Silva, J., and Fekety, F.R. (1981). Suppression of botulinum from Human Feces,” Journal of Clinical Microbiology, Clostridium difficile by Normal Hamster Cecal Flora and Preven Mar. 1981, pp. 526-531, vol. 31, No. 3. tion of Antibiotic-Associated Cecitis. Infect Immun34(2), 626-628. Dowell. V.R. et al., “Coproexamination for Botulinal Toxin and Wilson, K. et al., “Role of Competition for Nutrients in Suppression Clostridium botulinum.” JAMA, Oct. 24, 1977, pp. 1829-1832, vol. of Clostridium difficile by the Colonic Microflora.” Infection and 238, No. 7. Immunity, Oct. 1988, pp. 2610-2614m vol. 56, No. 10. Gupta, R.K. et al., “Differentiation Between Heat Resistance and Woo, T.D.H., Oka, K., Takahashi, M., Hojo, F. Osaki, T., Hanawa, Octyl Alcohol Resistance of the Cells of Bacillus Cereus T.” T. Kurata, S. Yonezawa, H., and Kamiya, S. (2011). Inhibition of Biochemical and Biophysical Research Communications, 1970, pp. the cytotoxic effect of Clostridium difficile in vitro by Clostridium 23-30, vol. 38, No. 1. butyricum MIYAIRI 588 strain. J. Med. Microbiol. 60(Pt. 11), Johnston, R. et al., “Method to Facilitate the Isolation of 1617-1625. Clostridium botulinum Type E.” J. Bacteriol., 1964, pp. 1521-1522, Wróbel, B. (2008). Statistical measures of uncertainty for branches vol. 88. in phylogenetic trees inferred from molecular sequences by using Naaber P. et al., “Inhibition of Clostridium difficile Strains by model-based methods. J. Appl. Genet. 49(1), 49-67. Intestinal Lactobacillus Species” Journal of Medical Microbiology, Wroblewski. D., Hannett, G.E., Bopp, D.J., Dumyati, G.K., Halse, 2004, pp. 551-554, vol. 53. T.A., Dumas, N.B., and Musser, K.A. (2009). Rapid Molecular New Zealand Examination Report, New Zealand Application No. Characterization of Clostridium difficile and Assessment of Popu 709392, Jun. 9, 2016, 7 pages. lations of C. difficile in Stool Specimens. Journal of Clinical Russell, A.D., "The Destruction of Bacterial Spores,” 1982, pp. Microbiology 47(7), 2142-2148. 191-193. Yamakawa, K. et al., “Enhancement of Clostridium difficile Toxin Halmann, M. et al., “Stages in Germination of Spores of Bacillus Production in Biotin-Limited Conditions,” J. Med. Microbiol, Feb. Lichenformis,” J. Bacteriol., 1962, pp. 1187-1193, vol. 84. 1996, pp. 111-114, vol. 44, No. 2. McFarland, L.V., "Use of Probiotics to Correct Dysbiosis of Normal Yamamura, H., Hayakawa, M., and Iimura, Y. (2003). Application Microbiota Following Disease or Disruptive Events: A Systematic of Sucrose-gradient centrifugation for selective isolation of Review.” BMJ Open, 2014. pp. 1-18, vol. 4. Nocardia spp. from soil. Journal of Applied Microbiology 95(4), Mierau, I. et al., “Industrial-Scale Production and Purification of a 677-685. Heterologous Protein in Lactococcus Lactis Using the Nisin-Con Yang, W.-W., and Ponce, A. (2009). Rapid endospore viability assay trolled Gene Expression System NICE: The Case of Lysostaphin.” of Clostridium sporogenes spores. International Journal of Food Microbial Cell Factories, May 27, 2005, pp. 1-9, vol. 4, No. 15. Microbiology 133(3), 213-216. New Zealand First Examination Report, New Zealand Application Yang, W.-W., and Ponce, A. (2011). Validation of Clostridium No. 711771, Nov. 23, 2015, 6 pages Endospore Viability Assay and Analysis of Greenland Ices and New Zealand First Examination Report, New Zealand Application Atacama Desert Soils. Appl. Environ. Microbiol. 77(7), 2352-2358. No. 711773, Nov. 24, 2015, 6 pages. Yang, W.-W. Crow-Willard, E.N., and Ponce, A. (2009). Production "Potentials of Probiotics in Pig Nutrition.” AllAboutFeed News, and characterization of pure Clostridium spore suspensions. J. Appl. Jan. 31, 2007, 6 pages. Microbiol. 106(1), 27-33. Russian Office Action, Russian Application No. 2015137399, Mar. Yang, W.W. (2010). Fast Viability Assessment of Clostridium 22, 2016, 8 pages. Spores Survival in Extreme Environments. PhD thesis California United States Office Action, U.S. Appl. No. 15/068,438, Apr. 28, Institute of Technology. 2016, 9 pages. Yi. X., and Setlow, P. (2010). Studies of the Commitment Step in Van Immerseel, F. et al., "Butyric Acid-Producing Anaerobic Bac Germination of Spores of Bacillus Species. J. Bacteriol. 192(13), teria as a Novel Probiotic Treatment Approach for Inflammatory 3424-3433. Bowel Disease,” Journal of Medical Microbiology, JMM Editorial, Yung, P.T., and Ponce, A. (2008). Fast Sterility Assessment by 2010, pp. 141-143. Germinable-Endospore Biodosimetry. Appl. Environ. Microbiol. 74(24), 7669-7674. * cited by examiner
U.S. Patent Mar. 7, 2017 Sheet 2 of 21 US 9,585,921 B2
U.S. Patent Mar. 7, 2017 Sheet 3 of 21 US 9,585,921 B2
U.S. Patent US 9,585,921 B2
??
$ U.S. Patent Mar. 7, 2017 Sheet S of 21 US 9,585,921 B2
??Ã883388A,4.saxx%þæggt&#
×******……………………………………………………………………………………….1…………………………………………·§§******************
388.88 & U.S. Patent Mar. 7, 2017 Sheet 6 of 21 US 9,585,921 B2
8: fix was text 88: U.S. Patent Mar 7, 2017 Sheet 7 of 21 US 9 585,921 B2
*****************************************
########38;
-***************************************************)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*)*
U.S. Patent Mar. 7, 2017 Sheet 9 of 21 US 9,585,921 B2
8 8
88:
& X-3
88:
*
: 8, X:
: w
3. &&&&&&&&&&&&&&&&&&&&&&&&&
sw --
8:38
s
s
r
s 8-8-8 w 88-83 ?&####?****************************************× G, U.S. Patent Mar. 7, 2017 Sheet 10 of 21 US 9,585,921 B2
& 8 8: 8w :W. r & s: : k . 4
- 8::
3:
in to in in n (aotiease ionio U.S. Patent Mar. 7, 2017 Sheet 11 of 21 US 9,585,921 B2
88His ox a ca-pa
: +3.3 -- 88& 8:8 Sw8.ys 828& 8:338(i.ys ------G. U.S. Patent Mar. 7, 2017 Sheet 12 of 21 US 9,585,921 B2
18EtOhioxgaipiated on GAirearritoi & GAFOS rulin-83
Biakia w8x888 Rixxxxxts.sp. X
it.8xxxxxxxixe: R8xxxxx saixas .
ext: iza
109EtOhi piated on PEA sheep boxin-282 Risexxxess sp. K Ruminococcus abus NCB v.
F.C.. 2 U.S. Patent Mar. 7, 2017 Sheet 13 of 21 US 9,585,921 B2
}}}?
u/ O eiod SÞ0+300’t,, U.S. Patent Mar. 7, 2017 Sheet 14 of 21 US 9,585,921 B2
x3 & 8 Sweet 3 iate 3838-38 -
3888-83 & ......
{-iysozyme 388-3-8: * 8 + iyskayte
3888-8 S 8 C 8: Activation emperature
: 388-3s
8 . Lys32y:38 s + iysozyme
83 SC is 83C Activation Temperature U.S. Patent Mar. 7, 2017 Sheet 15 of 21 US 9,585,921 B2
:
unfo U.S. Patent Mar. 7, 2017 Sheet 16 of 21 US 9,585,921 B2
2 day rate Scrape - Etoi
388-3: ...... {{: 8&S &88: 8 *Sii: Sii:
it as 'iate Scrape + Et{38 + {xgai 3.008-08
100E+08
5 tooet of . ii. {
;388-3-8 :... U.S. Patent US 9,585,921 B2
2.3 U.S. Patent Mar. 7, 2017 Sheet 18 of 21 US 9,585,921 B2
------—?ER?E?ERGEL?-oos
tex xxiisex sitext U.S. Patent US 9,585,921 B2
U.S. Patent Mar. 7, 2017 Sheet 20 of 21 US 9,585,921 B2
N: (ss i. særpedsdnouºsuubou?sap?ouanoog
w {} s' . U.S. Patent Mar. 7, 2017 Sheet 21 of 21 US 9,585,921 B2
US 9,585,921 B2 1. 2 COMPOSITIONS AND METHODS Manufacturers of probiotics have asserted that their preparations of bacteria promote mammalian health by RELATED APPLICATIONS preserving the natural microflora in the GI tract and rein forcing the normal controls on aberrant immune responses. This application is a continuation of U.S. application Ser. 5 See, e.g., U.S. Pat. No. 8,034,601. Probiotics, however, have No. 14/313,828 filed Jun. 24, 2014, (allowed), which is a been limited to a very narrow group of genera and a divisional of U.S. application Ser. No. 14/197,044, filed correspondingly limited number of species; as such, they do Mar. 4, 2014, now U.S. Pat. No. 9,011,834, issued Apr. 21, not adequately replace the missing natural microflora of the 2015, which is a continuation of International Application GI tract in many situations. No. PCT/US2014/014745, filed Feb. 4, 2014, which claims 10 Thus practitioners have a need for a method of populating priority to U.S. Provisional Application No. 61/760,584, a subject's gastrointestinal tract with a diverse and useful filed Feb. 4, 2013, and U.S. Provisional Application No. selection of microbiota in order to alter a dysbiosis. 61/760,585, filed Feb. 4, 2013, and U.S. Provisional Appli cation No. 61/760,574, filed Feb. 4, 2013, and U.S. Provi Therefore, in response to the need for durable, efficient, 15 and effective compositions and methods for treatment of GI sional Application No. 61/760,606, filed Feb. 4, 2013, and diseases by way of restoring or enhancing microbiota func U.S. Provisional Application No. 61/926,918, filed Jan. 13, tions, we address these and other shortcomings of the prior 2014. These applications are all incorporated by reference in art by providing compositions and methods for treating their entirety for all purposes. Subjects.
REFERENCE TO ASEQUENCE LISTING SUMMARY OF THE INVENTION This application includes a Sequence Listing Submitted electronically as a text file named 31053 US CRF Se Disclosed herein are therapeutic compositions containing quence Listing..txt, created on Oct. 14, 2015, with a size of non-pathogenic, germination-competent bacterial spores, 4.325,376 bytes. The sequence listing is incorporated by 25 for the prevention, control, and treatment of gastrointestinal reference. diseases, disorders and conditions and for general nutritional health. These compositions are advantageous in being Suit BACKGROUND able for safe administration to humans and other mammalian Subjects and are efficacious in numerous gastrointestinal Mammals are colonized by microbes in the gastrointes 30 diseases, disorders and conditions and in general nutritional tinal (GI) tract, on the skin, and in other epithelial and tissue health. niches such as the oral cavity, eye surface and vagina. The gastrointestinal tract harbors an abundant and diverse micro BRIEF DESCRIPTION OF THE DRAWINGS bial community. It is a complex system, providing an environment or niche for a community of many different 35 FIG. 1A provides a schematic of 16S rRNA gene and species or organisms, including diverse Strains of bacteria. denotes the coordinates of hypervariable regions 1-9 (V1 Hundreds of different species may form a commensal com V9). Coordinates of V1-V9 are 69-99, 137-242, 433-497, munity in the GI tract in a healthy person, and this comple 576-682, 822-879, 986-1043, 1117-1173, 1243-1294, and ment of organisms evolves from the time of birth to ulti 1435-1465 respectively, based on numbering using E. coli mately form a functionally mature microbial population by 40 system of nomenclature defined by Brosius et al., Complete about 3 years of age. Interactions between microbial strains nucleotide sequence of a 16S ribosomal RNA gene (16S in these populations and between microbes and the host, e.g. rRNA) from Escherichia coli, PNAS 75(10):4801-4805 the host immune system, shape the community structure, (1978). FIG. 1B highlights in bold the nucleotide sequences with availability of and competition for resources affecting for each hypervariable region in the exemplary reference E. the distribution of microbes. Such resources may be food, 45 coli 16S sequence described by Brosius et al. FIG. 1B location and the availability of space to grow or a physical discloses SEQ ID NO. 2043. structure to which the microbe may attach. For example, FIG. 2 shows a photograph of a CsCl gradient demon host diet is involved in shaping the GI tract flora. strating the spore separation from other residual habitat A healthy microbiota provides the host with multiple material. benefits, including colonization resistance to a broad spec 50 FIG. 3 shows three phase contrast image demonstrating trum of pathogens, essential nutrient biosynthesis and the progressive enrichment of spores from a fecal Suspen absorption, and immune stimulation that maintains a healthy sion; ethanol treated, CsCl purified spore preparation; and an gut epithelium and an appropriately controlled systemic ethanol treated, CsCl purified. Sucrose purified spore prepa immunity. In settings of dysbiosis or disrupted Symbiosis, ration. microbiota functions can be lost or deranged, resulting in 55 FIG. 4 shows a set of survival curves demonstrating increased Susceptibility to pathogens, altered metabolic pro efficacy of the spore population in a mouse prophylaxis files, or induction of proinflammatory signals that can result model of C. difficile. in local or systemic inflammation or autoimmunity. Thus, FIG. 5 provides a set of survival curves demonstrating the intestinal microbiota plays a significant role in the efficacy of the spore population in a hamster relapse pre pathogenesis of many diseases and disorders, including a 60 vention model of C. difficile. variety of pathogenic infections of the gut. For instance, FIG. 6 demonstrates the cell viability under a variety of Subjects become more Susceptible to pathogenic infections ethanol and heat treatments for varying lengths of time. when the normal intestinal microbiota has been disturbed FIG. 7 demonstrates cell survivability from four donor due to use of broad-spectrum antibiotics. Many of these fecal samples after heat treatment at 60 C for 5 minutes. diseases and disorders are chronic conditions that signifi 65 FIG. 8 demonstrates that ethanol reduces both anaerobic cantly decrease a Subject’s quality of life and can be ulti and aerobic bacterial species by several orders of magnitude mately fatal. in seconds. US 9,585,921 B2 3 4 FIG. 9 demonstrates the spore concentration of fecal FIG. 21 demonstrates the increase in number of species donations from multiple donors over time. engrafting and species augmenting in patient’s microbiomes FIG. 10 shows the strong correlation and linear corre after treatment with an ethanol-treated spore population. spondence between the measurement of DPA concentration Relative abundance of species that engrafted or augmented by a coupled fluorescence assay and the viable spore colony as described were determined based on the number of 16S forming units sequence reads. Each plot is from a different patient treated FIG. 11 demonstrates the effect on various germination with the ethanol-treated spore population for recurrent C. treatments on the ability to cultivate vegetative bacteria from difficile. a spore population. The figures depict various embodiments of the present FIG. 12 demonstrates the increase in bacterial diversity 10 from using a germinant treatment to grow vegetative bac invention for purposes of illustration only. One skilled in the teria from spore populations. art will readily recognize from the following discussion that FIG. 13 demonstrates the role of heat activation at various alternative embodiments of the structures and methods illus temperatures on spores from three different donor fecal trated herein may be employed without departing from the samples. 15 principles of the invention described herein. FIG. 14 demonstrates a lysozyme treatment with heat activation improves germination at most temperatures. DESCRIPTION OF THE TABLES FIG. 15 demonstrates spore concentrations present in a fecal sample grown on various medias. Table 1. List of Operational Taxonomic Units (OTU) with FIG. 16 demonstrates similar spore production from incu taxonomic assignments made to Genus, Species, and Phy bating plates for 2 and 7 days after a spore population was logenetic Clade. Clade membership of bacterial OTUs is germinated on plates with various medias. based on 16S sequence data. Clades are defined based on the FIG. 17 demonstrates the protective efficacy of the spore topology of a phylogenetic tree that is constructed from population in mice challenged with C. difficile as measured full-length 16S sequences using maximum likelihood meth by the change in weight of mice over the course of the 25 ods familiar to individuals with ordinary skill in the art of experiment. Each plot tracks the change in the individual phylogenetics. Clades are constructed to ensure that all mouse's weight relative to day -1 over the course of the OTUs in a given clade are: (i) within a specified number of experiment. The number of deaths over the course of the bootstrap Supported nodes from one another, and (ii) within experiment is indicated at the top of the chart and demon 5% genetic similarity. OTUs that are within the same clade strated by a line termination prior to day 6. The top panels 30 can be distinguished as genetically and phylogenetically (from left to right) are the vehicle control arm, the fecal distinct from OTUs in a different clade based on 16S-V4 suspension arm, and the untreated naive control arm, while sequence data, while OTUs falling within the same clade are the bottom panels are the ethanol treated, gradient purified closely related. OTUs falling within the same clade are spore preparation; the ethanol treated, gradient purified, evolutionarily closely related and may or may not be dis 'germinable' spore preparation, and ethanol treated, gradi 35 ent purified, “sporulatable' preparation. tinguishable from one another using 16S-V4 sequence data. FIG. 18 demonstrates the microbial diversity measured in Members of the same clade, due to their evolutionary the ethanol treated spore treatment sample and patient pre relatedness, play similar functional roles in a microbial and post-treatment samples. Total microbial diversity is ecology Such as that found in the human gut. Compositions defined using the Chaol Alpha-Diversity Index and is mea 40 Substituting one species with another from the same clade Sured at the same genomic sampling depths to confirm are likely to have conserved ecological function and there adequate sequence coverage to assay the microbiome in the fore are useful in the present invention. All OTUs are target samples. The patient pretreatment (purple) harbored a denoted as to their putative capacity to form spores and microbiome that was significantly reduced in total diversity whether they are a Pathogen or Pathobiont (see Definitions as compared to the ethanol treated spore treatment (red) and 45 for description of “Pathobiont'). NIAID Priority Pathogens patient post treatment at days 5 (blue), 14 (orange), and 25 are denoted as “Category-A, Category-B, or Category-C, (green). and Opportunistic Pathogens are denoted as OP. OTUs FIG. 19 demonstrates how the patient microbial ecology that are not pathogenic or for which their ability to exist as is shifted by treatment with an ethanol treated spore treat a pathogen is unknown are denoted as N. The SEQ ID ment from a dysbiotic state to a state of health. Principle 50 Number denotes the identifier of the OTU in the Sequence coordinates analysis based on the total diversity and struc Listing File and Public DB Accession denotes the identifier ture of the microbiome (Bray Curtis Beta Diversity) of the of the OTU in a public sequence repository. patient pre- and post-treatment delineates that the combina Table 2 contains bacterial OTUs identified from the 16s tion of engraftment of the OTUs from the spore treatment analysis of the ethanol treated spore population before and and the augmentation of the patient microbial ecology leads 55 after a CsCl gradient purification. to a microbial ecology that is distinct from both the pre Table 3 contains the mortality and weight change of mice treatment microbiome and the ecology of the ethanol treated treated with a donor fecal Suspension and an ethanol and/or spore treatment. heat-treated spore preparation at various dilutions, FIG. 20 demonstrates the augmentation of bacteroides Table 4 contains OTUs identified from spore forming species in patients treated with the spore population. Com 60 species generated by picking colonies from a spore prepa paring the number of Bacteroides colonies from fecal Sus ration involving various heat treatments pensions pre-treatment and in week 4 post treatment reveals Table 5 contains OTUs not identified in untreated fecal an increase of 4 logs or greater. Colonies were enumerated slurries, but identified in ethanol treated or heat treated spore by serial dilution and plating on Bacteroides Bile Esculin populations. agar which is highly selective for the B. fragilis group. 65 Table 6 contains OTUs identified from an ethanol treated Species were determined by 16S full-length sequence iden spore population isolated from a microbiome sample from tification. donor A. US 9,585,921 B2 5 6 Table 7 contains OTUs identified from an ethanol treated are generally prepared according to various techniques such spore population isolated from a microbiome sample from as lyophilization or spray-drying of liquid bacterial cultures, donor B. resulting in poor efficacy, instability, Substantial variability Table 8 contains OTUs identified from an ethanol treated and lack of adequate safety and efficacy. spore population isolated from a microbiome sample from It has now been found that populations of bacterial spores donor C. can be obtained from biological materials obtained from Table 9 contains OTUs identified from an ethanol treated mammalian Subjects, including humans. These populations spore population isolated from a microbiome sample from are formulated into compositions as provided herein, and donor D. administered to mammalian Subjects using the methods as Table 10 contains OTUs identified from an ethanol treated 10 provided herein. spore population isolated from a microbiome sample from donor E. Definitions Table 11 contains OTUs identified from an ethanol treated spore population isolated from a microbiome sample from “Microbiota refers to the community of microorganisms donor F. 15 that occur (Sustainably or transiently) in and on an animal Table 12 contains OTUs identified from growing ethanol Subject, typically a mammal Such as a human, including treated spore populations on various media types. eukaryotes, archaea, bacteria, and viruses (including bacte Table 13. Species identified as “germinable' and “sporu rial viruses i.e., phage). latable by colony picking approach “Microbiome' refers to the genetic content of the com Table YYY. Species identified as “germinable” using munities of microbes that live in and on the human body, 16S-V4 NGS approach. both Sustainably and transiently, including eukaryotes, Table ZZZ. Species identified as “sporulatable” using archaea, bacteria, and viruses (including bacterial viruses 16s-V4 NGS approach. (i.e., phage)), wherein "genetic content includes genomic Table AC shows spore content data from 3 different DNA, RNA such as ribosomal RNA, the epigenome, plas ethanol treated spore preparations used to Successfully treat 25 mids, and all other types of genetic information. 3 patients suffering from recurrent C. difficile infection. “Microbial Carriage' or simply “Carriage” refers to the Table AD. DPA doses in Table AC when normalized to population of microbes inhabiting a niche within or on 4x10 SCFU per dose humans. Carriage is often defined in terms of relative Table GB. OTUs detected by a minimum often 16S-V4 abundance. For example, OTU1 comprises 60% of the total sequence reads in at least a one ethanol treated spore 30 microbial carriage, meaning that OTU1 has a relative abun preparation (pan-microbiome). OTUS that engraft in a dance of 60% compared to the other OTUs in the sample treated patients and the percentage of patients in which they from which the measurement was made. Carriage is most engraft are denoted, as are the clades, spore forming status, often based on genomic sequencing data where the relative and Keystone OTU status. Starred OTUs occur in 80% of abundance or carriage of a single OTU or group of OTUs is the ethanol preps and engraft in 50% of the treated patients. 35 defined by the number of sequencing reads that are assigned Table GC ranks the top 20 OTUs by CES with the further to that OTU/s relative to the total number of sequencing requirement that an OTU must be shown to engraft to be a reads for the sample. considered an element of a core ecology. “Microbial Augmentation” or simply “augmentation s Table GD: Subsets of the Core Ecology tested in the C. refers to the establishment or significant increase of a difficile mouse model 40 population of microbes that are (i) absent or undetectable (as Table GE: Results of bacterial compositions tested in a C. determined by the use of Standard genomic and microbio difficile mouse model. logical techniques) from the administered therapeutic micro Table GF. OTUs and their clade assignments tested in bial composition, (ii) absent, undetectable, or present at low ternary combinations with results in the in vitro inhibition frequencies in the host niche (as example: gastrointestinal assay 45 tract, skin, anterior-nares, or vagina) before the delivery of Table ZA. Microbial compositions administered via oral the microbial composition, and (iii) are found after the gavage on Day -1 administration of the microbial composition or significantly Table TAB. Population of OTUs on Days 2, 3 and 4 increase, for instance 2-fold, 5-fold, 1x10, 1x10, 1x10, following dosing with Microbial Compositions 1x10, 1x10, 1x107, or greater than 1x10, in cases where Table TAC. Population of Clades on Days 2, 3 and 4 50 they were present at low frequencies. The microbes that following dosing with Microbial Compositions comprise an augmented ecology can be derived from exog Table TAD. Mortality by experimental group in mice enous sources such as food and the environment, or grow out challenged with 104.5 C, difficile spores on Day 0 from micro-niches within the host where they reside at low frequency. DETAILED DESCRIPTION 55 The administration of the therapeutic microbial compo sition induces an environmental shift in the target niche that Overview promotes favorable conditions for the growth of these com mensal microbes. In the absence of treatment with a thera Disclosed herein are therapeutic compositions containing peutic microbial composition, the host can be constantly non-pathogenic, germination-competent bacterial spores, 60 exposed to these microbes; however, Sustained growth and for the prevention, control, and treatment of gastrointestinal the positive health effects associated with the stable popu diseases, disorders and conditions and for general nutritional lation of increased levels of the microbes comprising the health. These compositions are advantageous in being Suit augmented ecology are not observed. able for safe administration to humans and other mammalian “Microbial Engraftment' or simply "engraftment” refers Subjects and are efficacious in numerous gastrointestinal 65 to the establishment of OTUs comprising a therapeutic diseases, disorders and conditions and in general nutritional microbial composition in a target niche that are absent in the health. While spore-based compositions are known, these treated host prior to treatment. The microbes that comprise US 9,585,921 B2 7 8 the engrafted ecology are found in the therapeutic microbial genome, MLSTs, specific genes, or sets of genes OTUS that composition and establish as constituents of the host micro share >95% average nucleotide identity are considered the bial ecology upon treatment. Engrafted OTUs can establish same OTU (see e.g. Achtman M, and Wagner M. 2008. for a transient period of time, or demonstrate long-term Microbial diversity and the genetic nature of microbial stability in the microbial ecology that populates the host post species. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis KT, treatment with a therapeutic microbial composition. The Ramette A, and Tiede J. M. 2006. The bacterial species engrafted ecology can induce an environmental shift in the definition in the genomic era. Philos Trans R Soc Lond B target niche that promotes favorable conditions for the Biol Sci 361: 1929-1940.). OTUs are frequently defined by growth of commensal microbes capable of catalyzing a shift comparing sequences between organisms. Generally, from a dysbiotic ecology to one representative of a health 10 sequences with less than 95% sequence identity are not State. considered to form part of the same OTU. OTUs may also “Ecological Niche' or simply "Niche' refers to the eco be characterized by any combination of nucleotide markers logical space in which a an organism or group of organisms or genes, in particular highly conserved genes (e.g., "house occupies. Niche describes how an organism or population or keeping genes), or a combination thereof. Such character organisms responds to the distribution of resources, physical 15 ization employs, e.g., WGS data or a whole genome parameters (e.g., host tissue space) and competitors (e.g., by Sequence. growing when resources are abundant, and when predators, “Residual habitat products” refers to material derived parasites and pathogens are scarce) and how it in turn alters from the habitat for microbiota within or on a human or those same factors (e.g., limiting access to resources by animal. For example, microbiota live in feces in the gastro other organisms, acting as a food source for predators and a intestinal tract, on the skin itself, in saliva, mucus of the consumer of prey). respiratory tract, or secretions of the genitourinary tract (i.e., “Dysbiosis” refers to a state of the microbiota of the gut biological matter associated with the microbial community). or other body area in a subject, including mucosal or skin Substantially free of residual habitat products means that the surfaces in which the normal diversity and/or function of the bacterial composition no longer contains the biological ecological network is disrupted. This unhealthy State can be 25 matter associated with the microbial environment on or in due to a decrease in diversity, the overgrowth of one or more the human or animal subject and is 100% free, 99% free, pathogens or pathobionts, symbiotic organisms able to cause 98% free, 97% free, 96% free, or 95% free of any contami disease only when certain genetic and/or environmental nating biological matter associated with the microbial com conditions are present in a subject, or the shift to an munity. Residual habitat products can include abiotic mate ecological microbial network that no longer provides an 30 rials (including undigested food) or it can include unwanted essential function to the host Subject, and therefore no longer microorganisms. Substantially free of residual habitat prod promotes health. lucts may also mean that the bacterial composition contains “Pathobionts’ or “Opportunistic Pathogens' refers to no detectable cells from a human or animal and that only symbiotic organisms able to cause disease only when certain microbial cells are detectable. In one embodiment, substan genetic and/or environmental conditions are present in a 35 tially free of residual habitat products may also mean that the Subject. bacterial composition contains no detectable viral (including “Phylogenetic tree' refers to a graphical representation of bacterial viruses (i.e., phage)), fungal, mycoplasmal con the evolutionary relationships of one genetic sequence to taminants. In another embodiment, it means that fewer than another that is generated using a defined set of phylogenetic 1x10%, 1x10%, 1x10%, 1x10%, 1x10%, reconstruction algorithms (e.g. parsimony, maximum like 40 1x107%, 1x10 of the viable cells in the bacterial com lihood, or Bayesian). Nodes in the tree represent distinct position are human or animal, as compared to microbial ancestral sequences and the confidence of any node is cells. There are multiple ways to accomplish this degree of provided by a bootstrap or Bayesian posterior probability, purity, none of which are limiting. Thus, contamination may which measures branch uncertainty. be reduced by isolating desired constituents through mul “Operational taxonomic units.” “OTU (or plural, 45 tiple steps of streaking to single colonies on Solid media until “OTUs) refer to a terminal leaf in a phylogenetic tree and replicate (such as, but not limited to, two) streaks from serial is defined by a nucleic acid sequence, e.g., the entire single colonies have shown only a single colony morphol genome, or a specific genetic sequence, and all sequences ogy. Alternatively, reduction of contamination can be that share sequence identity to this nucleic acid sequence at accomplished by multiple rounds of serial dilutions to single the level of species. In some embodiments the specific 50 desired cells (e.g., a dilution of 10 or 10), such as genetic sequence may be the 16S sequence or a portion of through multiple 10-fold serial dilutions. This can further be the 16S sequence. In other embodiments, the entire genomes confirmed by showing that multiple isolated colonies have of two entities are sequenced and compared. In another similar cell shapes and Gram staining behavior. Other meth embodiment, select regions such as multilocus sequence ods for confirming adequate purity include genetic analysis tags (MLST), specific genes, or sets of genes may be 55 (e.g. PCR, DNA sequencing), serology and antigen analysis, genetically compared. In 16S embodiments, OTUs that enzymatic and metabolic analysis, and methods using instru share >97% average nucleotide identity across the entire 16S mentation Such as flow cytometry with reagents that distin or some variable region of the 16S are considered the same guish desired constituents from contaminants. OTU (see e.g. Claesson M J. Wang Q, O'Sullivan O. “Clade' refers to the OTUs or members of a phylogenetic Greene-Diniz R. Cole J R, Ros RP, and O’Toole PW. 2010. 60 tree that are downstream of a statistically valid node in a Comparison of two next-generation sequencing technolo phylogenetic tree. The clade comprises a set of terminal gies for resolving highly complex microbiota composition leaves in the phylogenetic tree that is a distinct monophy using tandem variable 16S rRNA gene regions. Nucleic letic evolutionary unit and that share some extent of Acids Res 38: e200. Konstantinidis KT, Ramette A, and sequence similarity. Tiede J M. 2006. The bacterial species definition in the 65 In microbiology, “16S sequencing or “16S-rRNA' or genomic era. Philos Trans R Soc Lond B Biol Sci 361: “16S refers to sequence derived by characterizing the 1929-1940.). In embodiments involving the complete nucleotides that comprise the 16S ribosomal RNA gene(s). US 9,585,921 B2 10 The bacterial 16S rDNA is approximately 1500 nucleotides tionally, of a group (i.e., a cluster) of related network in length and is used in reconstructing the evolutionary ecologies. One representation of a Core Network Ecology is relationships and sequence similarity of one bacterial isolate a designed consortium of microbes, typically non-patho to another using phylogenetic approaches. 16S sequences genic bacteria, that represents core features of a set of are used for phylogenetic reconstruction as they are in phylogenetically or functionally related network ecologies general highly conserved, but contain specific hyperVariable seen in many different Subjects. In many occurrences, a Core regions that harbor sufficient nucleotide diversity to differ Network, while designed as described herein, exists as a entiate genera and species of most bacteria. Network Ecology observed in one or more subjects. Core The “V1-V9 regions” of the 16S rRNA refers to the first Network ecologies are useful for reversing or reducing a through ninth hypervariable regions of the 16S rRNA gene 10 dysbiosis in subjects where the underlying, related Network that are used for genetic typing of bacterial samples. These Ecology has been disrupted. regions in bacteria are defined by nucleotides 69-99, 137 The term “Keystone OTU refers to one or more OTUs 242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, that are common to many network ecologies and are mem 1243-1294 and 1435-1465 respectively using numbering bers of networks ecologies that occur in many Subjects (i.e. based on the E. coli system of nomenclature. Brosius et al., 15 are pervasive) (FIG. 1). Due to the ubiquitous nature of Complete nucleotide sequence of a 16S ribosomal RNA Keystone OTUs, they are central to the function of network gene from Escherichia coli, PNAS 75(10):4801-4805 ecologies in healthy Subjects and are often missing or at (1978). In some embodiments, at least one of the V1,V2, reduced levels in subjects with disease. Keystone OTUs may V3, V4, V5, V6, V7, V8, and V9 regions are used to exist in low, moderate, or high abundance in Subjects. characterize an OTU. In one embodiment, the V1,V2, and The term “non-Keystone OTU refers to an OTU that is V3 regions are used to characterize an OTU. In another observed in a Network Ecology and is not a keystone OTU. embodiment, the V3, V4, and V5 regions are used to The term “Phylogenetic Diversity” refers to the biodiver characterize an OTU. In another embodiment, the V4 region sity present in a given Network Ecology or Core Network is used to characterize an OTU. A person of ordinary skill in Ecology based on the OTUs that comprise the network. the art can identify the specific hyperVariable regions of a 25 Phylogenetic diversity is a relative term, meaning that a candidate 16S rRNA by comparing the candidate sequence Network Ecology or Core Network that is comparatively in question to a reference sequence and identifying the more phylogenetically diverse than another network con hypervariable regions based on similarity to the reference tains a greater number of unique species, genera, and hyperVariable regions, or alternatively, one can employ taxonomic families. Uniqueness of a species, genera, or Whole Genome Shotgun (WGS) sequence characterization 30 taxonomic family is generally defined using a phylogenetic of microbes or a microbial community. tree that represents the genetic diversity all species, genera, The term "subject” refers to any animal subject including or taxonomic families relative to one another. In another humans, laboratory animals (e.g., primates, rats, mice), embodiment phylogenetic diversity may be measured using livestock (e.g., cows, sheep, goats, pigs, turkeys, and chick the total branch length or average branch length of a ens), and household pets (e.g., dogs, cats, and rodents). The 35 phylogenetic tree. Subject may be suffering from a dysbiosis, including, but not “Spore' or “endospore” refers to an entity, particularly a limited to, an infection due to a gastrointestinal pathogen or bacterial entity, which is in a dormant, non-vegetative and may be at risk of developing or transmitting to others an non-reproductive stage. Spores are generally resistant to infection due to a gastrointestinal pathogen. environmental stress such as radiation, desiccation, enzy The term “phenotype” refers to a set of observable 40 matic treatment, temperature variation, nutrient deprivation, characteristics of an individual entity. As example an indi and chemical disinfectants. vidual subject may have a phenotype of “health' or "dis A “spore population” refers to a plurality of spores present ease’. Phenotypes describe the state of an entity and all in a composition. Synonymous terms used herein include entities within a phenotype share the same set of character spore composition, spore preparation, ethanol treated spore istics that describe the phenotype. The phenotype of an 45 fraction and spore ecology. A spore population may be individual results in part, or in whole, from the interaction of purified from a fecal donation, e.g. via ethanol or heat the entities genome and/or microbiome with the environ treatment, or a density gradient separation or any combina ment. tion of methods described herein to increase the purity, The term “Network Ecology” refers to a consortium of potency and/or concentration of spores in a sample. Alter OTUs that co-occur in some number of subjects. As used 50 natively, a spore population may be derived through culture herein, a “network” is defined mathematically by a graph methods starting from isolated spore former species or spore delineating how specific nodes (i.e. OTUs) and edges (con former OTUs or from a mixture of such species, either in nections between specific OTUs) relate to one another to vegetative or spore form. define the structural ecology of a consortium of OTUs. Any In one embodiment, the spore preparation comprises given Network Ecology will possess inherent phylogenetic 55 spore forming species wherein residual non-spore forming diversity and functional properties. A Network Ecology can species have been inactivated by chemical or physical also be defined in terms of function where for example the treatments including ethanol, detergent, heat, Sonication, nodes would be comprised of elements such as, but not and the like; or wherein the non-spore forming species have limited to, enzymes, clusters of orthologous groups (COGS: been removed from the spore preparation by various sepa http://www.ncbi.nlm.nih.gov/books/NBK21090/), or KEGG 60 rations steps including density gradients, centrifugation, pathways (www.genome.jp/kegg?). filtration and/or chromatography; or wherein inactivation The terms “Network Class”, “Core Network” and “Core and separation methods are combined to make the spore Network Ecology” refer to a group of network ecologies that preparation. In yet another embodiment, the spore prepara in general are computationally determined to comprise tion comprises spore forming species that are enriched over ecologies with similar phylogenetic and/or functional char 65 viable non-spore formers or vegetative forms of spore acteristics. A Core Network therefore contains important formers. In this embodiment, spores are enriched by 2-fold, biological features, defined either phylogenetically or func 5-fold, 10-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold or US 9,585,921 B2 11 12 greater than 10,000-fold compared to all vegetative forms of rally from plant and animal foods or synthetically made, bacteria. In yet another embodiment, the spores in the spore pro-Vitamins, derivatives, analogs. preparation undergo partial germination during processing As used herein, the term “minerals' is understood to and formulation Such that the final composition comprises include boron, calcium, chromium, copper, iodine, iron, spores and vegetative bacteria derived from spore forming 5 magnesium, manganese, molybdenum, nickel, phosphorus, species. potassium, selenium, silicon, tin, Vanadium, Zinc, or com A "germinant' is a material or composition or physical binations thereof. chemical process capable of inducing vegetative growth of As used herein, the term “antioxidant’ is understood to a bacterium that is in a dormant spore form, or group of include any one or more of various Substances such as bacteria in the spore form, either directly or indirectly in a 10 beta-carotene (a vitamin A precursor), Vitamin C, vitamin E, host organism and/or in vitro. and selenium) that inhibit oxidation or reactions promoted A 'sporulation induction agent' is a material or physical by Reactive Oxygen Species (“ROS) and other radical and chemical process that is capable of inducing sporulation in non-radical species. Additionally, antioxidants are mol a bacterium, either directly or indirectly, in a host organism ecules capable of slowing or preventing the oxidation of and/or in vitro. 15 other molecules. Non-limiting examples of antioxidants To “increase production of bacterial spores' includes an include astaxanthin, carotenoids, coenzyme Q10 activity or a sporulation induction agent. “Production' (“CoQ10), flavonoids, glutathione, Goji (wolfberry), hes includes conversion of vegetative bacterial cells into spores peridin, lactowolfberry, lignan, lutein, lycopene, polyphe and augmentation of the rate of Such conversion, as well as nols, selenium, Vitamin A, vitamin C, Vitamin E. Zeaxanthin, decreasing the germination of bacteria in spore form, or combinations thereof. decreasing the rate of spore decay in Vivo, or ex vivo, or to Compositions of the Invention increasing the total output of spores (e.g. via an increase in Disclosed herein are therapeutic compositions containing volumetric output of fecal material). non-pathogenic, germination-competent bacterial spores, The “colonization' of a host organism includes the non for the prevention, control, and treatment of gastrointestinal transitory residence of a bacterium or other microscopic 25 diseases, disorders and conditions and for general nutritional organism. As used herein, “reducing colonization of a host health. These compositions are advantageous in being Suit Subject’s gastrointestinal tract (or any other microbiotal able for safe administration to humans and other mammalian niche) by a pathogenic bacterium includes a reduction in the Subjects and are efficacious in numerous gastrointestinal residence time of the pathogen in the gastrointestinal tract as diseases, disorders and conditions and in general nutritional well as a reduction in the number (or concentration) of the 30 health. While spore-based compositions are known, these pathogen in the gastrointestinal tract or adhered to the are generally prepared according to various techniques such luminal surface of the gastrointestinal tract. Measuring as lyophilization or spray-drying of liquid bacterial cultures, reductions of adherent pathogens may be demonstrated, e.g., resulting in poor efficacy, instability, Substantial variability by a biopsy sample, or reductions may be measured indi and lack of adequate safety and efficacy. rectly, e.g., by measuring the pathogenic burden in the stool 35 It has now been found that populations of bacterial spores of a mammalian host. can be obtained from biological materials obtained from A “combination' of two or more bacteria includes the mammalian Subjects, including humans. These populations physical co-existence of the two bacteria, either in the same are formulated into compositions as provided herein, and material or product or in physically connected products, as administered to mammalian Subjects using the methods as well as the temporal co-administration or co-localization of 40 provided herein. the two bacteria. Provided herein are therapeutic compositions containing a A “cytotoxic' activity or bacterium includes the ability to purified population of bacterial spores. As used herein, the kill a bacterial cell. Such as a pathogenic bacterial cell. A terms “purify”, “purified’ and “purifying refer to the state “cytostatic' activity or bacterium includes the ability to of a population (e.g., a plurality of known or unknown inhibit, partially or fully, growth, metabolism, and/or pro 45 amount and/or concentration) of desired bacterial spores, liferation of a bacterial cell. Such as a pathogenic bacterial that have undergone one or more processes of purification, cell. e.g., a selection or an enrichment of the desired bacterial To be free of “non-comestible products' means that a spore, or alternatively a removal or reduction of residual bacterial composition or other material provided herein does habitat products as described herein. In some embodiments, not have a Substantial amount of a non-comestible product, 50 a purified population has no detectable undesired activity or, e.g., a product or material that is inedible, harmful or alternatively, the level or amount of the undesired activity is otherwise undesired in a product suitable for administration, at or below an acceptable level or amount. In other embodi e.g., oral administration, to a human Subject. Non-comes ments, a purified population has an amount and/or concen tible products are often found in preparations of bacteria tration of desired bacterial spores at or above an acceptable from the prior art. 55 amount and/or concentration. In other embodiments, the As used herein the term “vitamin' is understood to ratio of desired-to-undesired activity (e.g. spores compared include any of various fat-soluble or water-soluble organic to vegetative bacteria), has changed by 2-, 5-, 10-, 30-, 100-, Substances (non-limiting examples include Vitamin A, Vita 300-, 1x10, 1x10, 1x10, 1x107, 1x10, or greater than min B1 (thiamine), Vitamin B2 (riboflavin), Vitamin B3 1x10'. In other embodiments, the purified population of (niacin or niacinamide), Vitamin B5 (pantothenic acid), 60 bacterial spores is enriched as compared to the starting Vitamin B6 (pyridoxine, pyridoxal, or pyridoxamine, or material (e.g., a fecal material) from which the population is pyridoxine hydrochloride), Vitamin B7 (biotin), Vitamin B9 obtained. This enrichment may be by 10%, 20%, 30%, 40%, (folic acid), and Vitamin B12 (various cobalamins; com 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, monly cyanocobalamin in vitamin Supplements), vitamin C, 99.9%, 99.99%, 99.999%, 99.9999%, 99.9999%, or greater vitamin D, vitamin E, vitamin K. K1 and K2 (i.e. MK-4, 65 than 99.999999% as compared to the starting material. MK-7), folic acid and biotin) essential in minute amounts for In certain embodiments, the purified populations of bac normal growth and activity of the body and obtained natu terial spores have reduced or undetectable levels of one or US 9,585,921 B2 13 14 more pathogenic activities, such as toxicity, an ability to and pooled from multiple samples e.g. 1, 2, 3, 4, 5, 6, 7, 8, cause infection of the mammalian recipient Subject, an 9, 10, 15, 20, 25, 30, 32,35, 40, 45, 48, 50, 100 samples from undesired immunomodulatory activity, an autoimmune a single donor. response, a metabolic response, or an inflammatory response In alternative embodiments, the desired bacterial spores or a neurological response. Such a reduction in a pathogenic 5 are purified from a single fecal material sample obtained activity may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, from a single donor, and after such purification are combined 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, with purified spore populations from other purifications, 99.999%, 99.9999%, or greater than 99.9999% as compared either from the same donor at a different time, or from one to the starting material. In other embodiments, the purified or more different donors, or both. populations of bacterial spores have reduced sensory com 10 Mammalian donor Subjects are generally of good health and have microbiota consistent with Such good health. ponents as compared to fecal material. Such as reduced odor, Often, the donor subjects have not been administered anti taste, appearance, and umami. biotic compounds within a certain period prior to the col Provided are purified populations of bacterial spores that lection of the fecal material. In certain embodiments, the are substantially free of residual habitat products. In certain 15 donor Subjects are not obese or overweight, and may have embodiments, this means that the bacterial spore composi body mass index (BMI) scores of below 25, such as between tion no longer contains a Substantial amount of the biologi 18.5 and 24.9. In other embodiments, the donor subjects are cal matter associated with the microbial community while not mentally ill or have no history or familial history of living on or in the human or animal Subject, and the purified mental illness, such as anxiety disorder, depression, bipolar population of spores may be 100% free, 99% free, 98% free, 20 disorder, autism spectrum disorders, Schizophrenia, panic 97% free, 96% free, or 95% free of any contamination of the disorders, attention deficit (hyperactivity) disorders, eating biological matter associated with the microbial community. disorders or mood disorders. In other embodiments, the Substantially free of residual habitat products may also donor Subjects do not have irritable bowel disease (e.g., mean that the bacterial spore composition contains no crohn's disease, ulcerative colitis), irritable bowel syn detectable cells from a human or animal, and that only 25 drome, celiac disease, colorectal cancer or a family history microbial cells are detectable, in particular, only desired of these diseases. In other embodiments, donors have been microbial cells are detectable. In another embodiment, it screened for blood borne pathogens and fecal transmissible means that fewer than 1x10%, 1x10%, 1x10%, pathogens using standard techniques known to one in the art 1x10%, 1x10%, 1x107%, 1x10% of the cells in the (e.g. nucleic acid testing, serological testing, antigen testing, bacterial composition are human or animal, as compared to 30 culturing techniques, enzymatic assays, assays of cell free microbial cells. In another embodiment, the residual habitat fecal filtrates looking for toxins on susceptible cell culture product present in the purified population is reduced at least substrates). a certain level from the fecal material obtained from the In some embodiments, donors are also selected for the mammalian donor Subject, e.g., reduced by at least about presence of certain genera and/or species that provide 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 35 increased efficacy of therapeutic compositions containing 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, these genera or species. In other embodiments, donors are 99.9999%, or greater than 99.9999%. preferred that produce relatively higher concentrations of In one embodiment, substantially free of residual habitat spores in fecal material than other donors. In further embodi products or substantially free of a detectable level of a ments, donors are preferred that provide fecal material from pathogenic material means that the bacterial composition 40 which spores having increased efficacy are purified; this contains no detectable viral (including bacterial viruses (i.e., increased efficacy is measured using in vitro or in animal phage)), fungal, or mycoplasmal or toxoplasmal contami studies as described below. In some embodiments, the donor nants, or a eukaryotic parasite Such as a helminth. Alterna may be subjected to one or more pre-donation treatments in tively, the purified spore populations are substantially free of order to reduce undesired material in the fecal material, an acellular material, e.g., DNA, viral coat material, or 45 and/or increase desired spore populations. non-viable bacterial material. Alternatively, the purified It is advantageous to Screen the health of the donor Subject spore population may processed by a method that kills, prior to and optionally, one or more times after, the collec inactivates, or removes one or more specific undesirable tion of the fecal material. Such screening identifies donors viruses, such as an enteric virus, including norovirus, polio carrying pathogenic materials such as viruses (HIV, hepati virus or hepatitis A virus. 50 tis, polio) and pathogenic bacteria. Post-collection, donors As described herein, purified spore populations can be are screened about one week, two weeks, three weeks, one demonstrated by genetic analysis (e.g., PCR, DNA sequenc month, two months, three months, six months, one year or ing), serology and antigen analysis, microscopic analysis, more than one year, and the frequency of Such screening microbial analysis including germination and culturing, and may be daily, weekly, bi-weekly, monthly, bi-monthly, semi methods using instrumentation Such as flow cytometry with 55 yearly or yearly. Donors that are screened and do not test reagents that distinguish desired bacterial spores from non positive, either before or after donation or both, are consid desired, contaminating materials. ered “validated donors. Exemplary biological materials include fecal materials Solvent Treatments. Such as feces or materials isolated from the various segments To purify the bacterial spores, the fecal material is sub of the Small and large intestines. Fecal materials are obtained 60 jected to one or more solvent treatments. A solvent treatment from a mammalian donor Subject, or can be obtained from is a miscible solvent treatment (either partially miscible or more than one donor Subject, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10. fully miscible) or an immiscible solvent treatment. Misci 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, bility is the ability of two liquids to mix with each to form 750, 1000 or from greater than 1000 donors, where such a homogeneous Solution. Water and ethanol, for example, materials are then pooled prior to purification of the desired 65 are fully miscible Such that a mixture containing water and bacterial spores. In another embodiment, fecal materials can ethanol in any ratio will show only one phase. Miscibility is be obtained from a single donor subject over multiple times provided as a wit/wt %, or weight of one solvent in 100 g of US 9,585,921 B2 15 16 final solution. If two solvents are fully miscible in all medium is subjected to a diafiltration step, wherein the proportions, their miscibility is 100%. Provided as fully retained spores are contacted with a wash liquid, typically a miscible solutions with water are alcohols, e.g., methanol, sterile Saline-containing solution or other diluent Such as a ethanol, isopropanol, butanol, propanediol, butanediol, etc. water compatible polymer including a low-molecular poly The alcohols can be provided already combined with water; ethylene glycol (PEG) solution, in order to further reduce or e.g., a solution containing 10%, 20%, 25%, 30%, 35%, 40%, remove the undesirable fecal components. 45%, 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, Thermal Treatments. 95% or greater than 95%. Other solvents are only partially Provided herein is the thermal disruption of the fecal miscible, meaning that only some portion will dissolve in material. Generally, the fecal material is mixed in a saline water. Diethyl ether, for example, is partially miscible with 10 containing solution such as phosphate-buffered saline (PBS) water. Up to 7 grams of diethyl ether will dissolve in 93 g and Subjected to a heated environment, such as a warm of water to give a 7% (wit/wt %) solution. If more diethyl room, incubator, water-bath, or the like, such that efficient ether is added, a two-phase solution will result with a heat transfer occurs between the heated environment and the distinct diethyl ether layer above the water. Other partially fecal material. Preferably the fecal material solution is miscible materials include ethers, propanoate, butanoate, 15 mixed during the incubation to enhance thermal conductiv chloroform, dimethoxyethane, or tetrahydrofuran. In con ity and disrupt particulate aggregates. Thermal treatments trast, an oil Such as an alkane and water are immiscible and can be modulated by the temperature of the environment form two phases. Further, immiscible treatments are option and/or the duration of the thermal treatment. For example, ally combined with a detergent, either an ionic detergent or the fecal material or a liquid comprising the fecal material is a non-ionic detergent. Exemplary detergents include Triton Subjected to a heated environment, e.g., a hot water bath of X-100, Tween 20, Tween 80, Nonidet P40, a pluronic, or a at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, polyol. The solvent treatment steps reduces the viability of 80, 85,90, 95, 100 or greater than 100 degrees Celsius, for non-spore forming bacterial species by 10%. 20%, 30%, at least about 1, 5, 10, 15, 20, 30, 45 seconds, or 1, 2, 3, 4, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99%, 99.9%, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 minutes, or 1, 2, 99.99%, 99.999%, or 99.9999%, and it may optionally 25 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 hours. In certain reduce the viability of contaminating protists, parasites embodiments the thermal treatment occurs at two different and/or viruses. temperatures, such as 30 seconds in a 100 degree Celsius Chromatography Treatments. environment followed by 10 minutes in a 50 degree Celsius To purify spore populations, the fecal materials are Sub environment. In preferred embodiments the temperature and jected to one or more chromatographic treatments, either 30 duration of the thermal treatment are sufficient to kill or sequentially or in parallel. In a chromatographic treatment, remove pathogenic materials while not Substantially dam a solution containing the fecal material is contacted with a aging or reducing the germination-competency of the Solid medium containing a hydrophobic interaction chro spores. In other preferred embodiments, the temperature and matographic (HIC) medium or an affinity chromatographic duration of the thermal treatment is short enough to reduce medium. In an alternative embodiment, a Solid medium 35 the germination of the spore population. capable of absorbing a residual habitat product present in the Irradiation Treatments. fecal material is contacted with a solid medium that adsorbs Provided are methods of treating the fecal material or a residual habitat product. In certain embodiments, the HIC separated contents of the fecal material with ionizing radia medium contains Sepharose or a derivatized Sepharose Such tion, typically gamma irradiation, ultraviolet irradiation or as butyl Sepharose, octyl Sepharose, phenyl Sepharose, or 40 electron beam irradiation provided at an energy level suffi butyl-s sepharose. In other embodiments, the affinity chro cient to kill pathogenic materials while not substantially matographic medium contains material derivatized with damaging the desired spore populations. For example, ultra mucin type I, II, III, IV, V, or VI, or oligosaccharides derived violet radiation at 254 nm provided at an energy level below from or similar to those of mucins type I, II, III, IV, V, or VI. about 22,000 microwatt seconds per cm will not generally Alternatively, the affinity chromatographic medium contains 45 destroy desired spores. material derivatized with antibodies that recognize spore Centrifugation and Density Separation Treatments. forming bacteria. Provided are methods of separating desired spore popu Mechanical Treatments. lations from the other components of the fecal material by Provided herein is the physical disruption of the fecal centrifugation. A solution containing the fecal material is material, particularly by one or more mechanical treatment 50 Subjected to one or more centrifugation treatments, e.g., at Such as blending, mixing, shaking, Vortexing, impact pull about 200xg, 1000xg, 2000xg, 3000xg, 4000xg, 5000xg, Verization, and Sonication. As provided herein, the mechani 6000xg, 7000xg, 8000xg or greater than 8000xg. Differen cal disrupting treatment Substantially disrupts a non-spore tial centrifugation separates desired spores from undesired material present in the fecal material and does not Substan non-spore material; at low forces the spores are retained in tially disrupt a spore present in the fecal material, or it may 55 solution, while at higher forces the spores are pelleted while disrupt the spore material less than the non-spore material, Smaller impurities (e.g., virus particles, phage, microscopic e.g. 2-fold less, 5-, 10-, 30-, 100-, 300-, 1000- or greater than fibers, biological macromolecules such as free protein, 1000-fold less. Furthermore, mechanical treatment homog nucleic acids and lipids) are retained in Solution. For enizes the material for Subsequent sampling, testing, and example, a first low force centrifugation pellets fibrous processing. Mechanical treatments optionally include filtra 60 materials; a second, higher force centrifugation pellets unde tion treatments, where the desired spore populations are sired eukaryotic cells, and a third, still higher force centrifu retained on a filter while the undesirable (non-spore) fecal gation pellets the desired spores while Smaller contaminants components to pass through, and the spore fraction is then remain in Suspension. In some embodiments density or recovered from the filter medium. Alternatively, undesirable mobility gradients or cushions (e.g., step cushions). Such as particulates and eukaryotic cells may be retained on a filter 65 CsCl, Percoll, Ficoll, Nycodenz. Histodenz or sucrose gra while bacterial cells including spores pass through. In some dients, are used to separate desired spore populations from embodiments the spore fraction retained on the filter other materials in the fecal material. US 9,585,921 B2 17 18 Also provided herein are methods of producing spore genera including Clostridium and Bacillus. Traditional populations that combine two or more of the treatments approaches of forward genetics have identified many, if not described herein in order to synergistically purify the desired all, genes that are essential for sporulation (spo). The devel spores while killing or removing undesired materials and/or opmental program of sporulation is governed in part by the activities from the spore population. It is generally desirable Successive action of four compartment-specific sigma fac to retain the spore populations under non-germinating and tors (appearing in the order OF, OE, OG and OK), whose non-growth promoting conditions and media, in order to activities are confined to the forespore (OF and OG) or the minimize the growth of pathogenic bacteria present in the mother cell (OE and OK). In other embodiments, spore spore populations and to minimize the germination of spores forming bacteria are identified by the biochemical activity of into vegetative bacterial cells. 10 DPA producing enzymes or by analyzing DPA content of Purified Spore Populations. cultures. As part of the bacterial sporulation, large amounts As described herein, purified spore populations contain of DPA are produced, and comprise 5-15% of the mass of a combinations of commensal bacteria of the human gut spore. Because not all viable spores germinate and grow microbiota with the capacity to meaningfully provide func under known media conditions, it is difficult to assess a total tions of a healthy microbiota when administered to a mam 15 spore count in a population of bacteria. As such, a measure malian subject. Without being limited to a specific mecha ment of DPA content highly correlates with spore content nism, it is thought that such compositions inhibit the growth and is an appropriate measure for characterizing total spore of a pathogen Such as C. difficile, Salmonella spp., entero content in a bacterial population. pathogenic E. coli, Fusobacterium spp., Klebsiella spp. and Provided are spore populations containing more than one Vancomycin-resistant Enterococcus spp., so that a healthy, type of bacterium. As used herein, a “type' or more than one diverse and protective microbiota can be maintained or, in “types of bacteria may be differentiated at the genus level, the case of pathogenic bacterial infections such as C. difficile the species, level, the sub-species level, the strain level or by infection, repopulate the intestinal lumen to reestablish any other taxonomic method, as described herein and oth ecological control over potential pathogens. In one embodi erwise known in the art. ment, the purified spore populations can engraft in the host 25 In some embodiments all or essentially all of the bacterial and remain present for 1 day, 2 days, 3 days, 4 days, 5 days, spores present in a purified population are obtained from a 6 days, 7 days, 10 days, 14 days, 21 days, 25 days, 30 days, fecal material treated as described herein or otherwise 60 days, 90 days, or longer than 90 days. Additionally, the known in the art. In alternative embodiments, one or more purified spore populations can induce other healthy com than one bacterial spores or types of bacterial spores are mensal bacteria found in a healthy gut to engraft in the host 30 generated in culture and combined to form a purified spore that are not present in the purified spore populations or population. In other alternative embodiments, one or more present at lesser levels and therefore these species are of these culture-generated spore populations are combined considered to “augment the delivered spore populations. In with a fecal material-derived spore population to generate a this manner, commensal species augmentation of the puri hybrid spore population. Bacterial compositions may con fied spore population in the recipient's gut leads to a more 35 tain at least two types of these preferred bacteria, including diverse population of gut microbiota then present initially. strains of the same species. For instance, a bacterial com Preferred bacterial genera include Acetanaerobacterium, position may comprise at least 2, at least 3, at least 4, at least Acetivibrio, Alicyclobacillus, Alkaliphilus, Anaerofustis, 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least Anaerosporobacter, Anaerostipes, Anaerotruncus, Anoxyba 11, at least 12, at least 13, at least 14, at least 15, at least 16, cillus, Bacillus, Bacteroides, Blautia, Brachyspira, Breviba 40 at least 17, at least 18, at least 19, or at least 20 or more than cillus, Bryantella, Bulleidia, Butyricicoccus, Butyrivibrio, 20 types of bacteria, as defined by species or operational Catenibacterium, Chlamydiales, Clostridiaceae, Clostridi taxonomic unit (OTU) encompassing Such species. ales, Clostridium, Collinsella, Coprobacillus, Coprococcus, Thus, provided herein are methods for production of a Coxiella, Deferribacteres, Desulfitobacterium, Desulfoto composition containing a population of bacterial spores maculum, Dorea, Eggerthella, Erysipelothrix, Erysipelo 45 Suitable for therapeutic administration to a mammalian trichaceae, Ethanoligenens, Eubacterium, Faecalibacte subject in need thereof. And the composition is produced by rium, Filifactor, Flavonifactor, Flexistipes, Fulvimonas, generally following the steps of: (a) providing a fecal Fusobacterium, Gemmiger, Geobacillus, Gloeobacter; material obtained from a mammalian donor Subject; and (b) Holdemania, Hydrogenoanaerobacterium, Kocuria, Lach Subjecting the fecal material to at least one purification nobacterium, Lachnospira, Lachnospiraceae, Lactobacil 50 treatment or step under conditions such that a population of lus, Lactonifactor, Leptospira, Lutispora, Lysinibacillus, bacterial spores is produced from the fecal material. The Mollicutes, Moorella, Nocardia, Oscillibacter, Oscillospira, composition is formulated Such that a single oral dose Paenibacillus, Papillibacter, Pseudoflavonifactor, Robin contains at least about 1x10" colony forming units of the SOniella, Roseburia, Ruminococcaceae, Ruminococcus, Sac bacterial spores, and a single oral dose will typically contain charomonospora, Sarcina, Solobacterium, Sporobacter, 55 about 1x10, 1x10, 1x10, 1x107, 1x10, 1x10, 1x10", Sporolactobacillus, Streptomyces, Subdoligranulum, Sutte 1x10'', 1x10", 1x10", 1x10", 1x10', or greater than rella, Syntrophococcus, Thermoanaerobacter; Thermobifida, 1x10' CFUs of the bacterial spores. The presence and/or Turicibacter concentration of a given type of bacterial spore may be Preferred bacterial species are provided at Table 1 and known or unknown in a given purified spore population. If demarcated as spore formers. Where specific strains of a 60 known, for example the concentration of spores of a given species are provided, one of skill in the art will recognize strain, or the aggregate of all strains, is e.g., 1x10, 1x10, that other strains of the species can be substituted for the 1x10, 1x107, 1x10, 1x10, 1x10", 1x10'', 1x10", named Strain. 1x10", 1x10", 1x10", or greater than 1x10" viable bac In some embodiments, spore-forming bacteria are iden terial spores per gram of composition or per administered tified by the presence of nucleic acid sequences that modu 65 dose. late sporulation. In particular, signature sporulation genes In some formulations, the composition contains at least are highly conserved across members of distantly related about 0.5%, 1%, 2%. 5%, 10%, 20%, 30%, 40%, 50%, 60%, US 9,585,921 B2 19 20 70%, 80%, 90% or greater than 90% spores on a mass basis. types of bacteria, as defined by species or operational In some formulations, the administered dose does not taxonomic unit (OTU), or otherwise as provided herein. exceed 200, 300, 400, 500, 600, 700, 800, 900 milligrams or In another embodiment, the number of types of bacteria 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9 grams in mass. present in a bacterial composition is at or below a known The bacterial spore compositions are generally formu value. For example, in such embodiments the bacterial lated for oral or gastric administration, typically to a mam composition comprises 50 or fewer types of bacteria, Such as malian Subject. In particular embodiments, the composition 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, is formulated for oral administration as a solid, semi-solid, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, gel, or liquid form, such as in the form of a pill, tablet, 17, 16, 15, 14, 13, 12, 11, or 10 or fewer, or 9 or fewer types capsule, or lozenge. In some embodiments, such formula 10 of bacteria, 8 or fewer types of bacteria, 7 or fewer types of tions contain or are coated by an enteric coating to protect bacteria, 6 or fewer types of bacteria, 5 or fewer types of the bacteria through the stomach and Small intestine, bacteria, 4 or fewer types of bacteria, or 3 or fewer types of although spores are generally resistant to the stomach and bacteria. In another embodiment, a bacterial composition small intestines. In other embodiments, the bacterial spore 15 comprises from 2 to no more than 40, from 2 to no more than compositions may be formulated with a germinant to 30, from 2 to no more than 20, from 2 to no more than 15, enhance engraftment, or efficacy. In yet other embodiments, from 2 to no more than 10, or from 2 to no more than 5 types the bacterial spore compositions may be co-formulated or of bacteria. co-administered with prebiotic Substances, to enhance Bacterial Compositions Described by Species engraftment or efficacy. Bacterial compositions may be prepared comprising at The bacterial spore compositions may be formulated to be least two types of isolated bacteria, chosen from the species effective in a given mammalian Subject in a single admin in Table 1. istration or over multiple administrations. For example, a In one embodiment, the bacterial composition comprises single administration is substantially effective to reduce Cl. at least one and preferably more than one of the following: difficile and/or Cl. difficile toxin content in a mammalian 25 Enterococcus faecalis (previously known as Streptococcus Subject to whom the composition is administered. Substan faecalis), Clostridium innocuum, Clostridium ramosum, tially effective means that Cl. difficile and/or Cl. difficile Bacteroides ovatus, Bacteroides vulgatus, Bacteroides toxin content in the subject is reduced by at least 10%, 20%, thetaoiotaomicron, Escherichia coli (1109 and 1108-1), 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or Clostridum bifermentans, and Blautia producta (previously greater than 99% following administration of the composi 30 known as Peptostreptococcus productus). In an alternative tion. Alternatively, efficacy may be measured by the absence embodiment, at least one of the preceding species is not of diarrheal symptoms or the absence of carriage of C. substantially present in the bacterial composition. difficile or C. difficile toxin after 2 day, 4 days, 1 week, 2 In one embodiment, the bacterial composition comprises weeks, 4 weeks, 8 weeks or longer than 8 weeks. at least one and preferably more than one of the following: Bacterial Compositions 35 Enterococcus faecalis (previously known as Streptococcus Provided are bacteria and combinations of bacteria of the faecalis), Clostridium innocuum, Clostridium ramosum, human gut microbiota with the capacity to meaningfully Bacteroides ovatus, Bacteroides vulgatus, Bacteroides provide functions of a healthy microbiota when adminis thetaoiotaomicron, Escherichia coli (1109 and 1108-1), tered to mammalian hosts. Without being limited to a Clostridum bifermentans, and Blautia producta (previously specific mechanism, it is thought that such compositions 40 known as Peptostreptococcus productus). In an alternative inhibit the growth, proliferation, and/or colonization of one embodiment, at least one of the preceding species is not or a plurality of pathogenic bacteria in the dysbiotic micro Substantially present in the bacterial composition. biotal niche, so that a healthy, diverse and protective micro In another embodiment, the bacterial composition com biota colonizes and populates the intestinal lumen to estab prises at least one and preferably more than one of the lish or reestablish ecological control over pathogens or 45 following: Acidaminococcus intestinalis, Bacteroides ova potential pathogens (e.g., Some bacteria are pathogenic tus, two strains of Bifidobacterium adolescentis, two strains bacteria only when present in a dysbiotic environment). of Bifidobacterium longum, Blautia producta, Clostridium Inhibition of pathogens includes those pathogens Such as C. cocleatum, Collinsella aerofaciens, two strains of Dorea difficile, Salmonella spp., enteropathogenic E coli, multi longicatena, Escherichia coli, Eubacterium desmolans, drug resistant bacteria Such as Klebsiella, and E. coli, 50 Eubacterium eligens, Eubacterium limosum, four strains of Carbapenem-resistent Enterobacteriaceae (CRE), extended Eubacterium rectale, Eubacterium ventriosumi, Faecalibac spectrum beta-lactam resistant Enterococci (ESBL), and terium prausnitzii, Lachnospira pectinoshiza, Lactobacillus Vancomycin-resistant Enterococci (VRE). casei, Lactobacillus casei/paracasei, Paracateroides dista As used herein, a “type' or more than one “types of sonis, Raoultella sp., one strain of Roseburia (chosen from bacteria may be differentiated at the genus level, the species, 55 Roseburia faecalis or Roseburia faecis), Roseburia intesti level, the sub-species level, the strain level or by any other nalis, two strains of Ruminococcus torques, two strains of taxonomic method, as described herein and otherwise Ruminococcus Obeum, and Streptococcus mitis. In an alter known in the art. native embodiment, at least one of the preceding species is Bacterial compositions may comprise two types of bac not substantially present in the bacterial composition. teria (termed “binary combinations' or “binary pairs') or 60 In yet another embodiment, the bacterial composition greater than two types of bacteria. For instance, a bacterial comprises at least one and preferably more than one of the composition may comprise at least 2, at least 3, at least 4, at following: Bamesiella intestinihominis, Lactobacillus reu least 5, at least 6, at least 7, at least 8, at least 9, at least 10, teri; a species characterized as one of Enterococcus hirae, at least 11, at least 12, at least 13, at least 14, at least 15, at Enterococus faecium, or Enterococcus durans; a species least 16, at least 17, at least 18, at least 19, at least 20, or at 65 characterized as one of Anaerostipes caccae or Clostridium least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, indolis; a species characterized as one of Staphylococcus 36, 37, 38, 39, or at least 40, at least 50 or greater than 50 warneri or Staphylococcus pasteuri; and Adlercreutzia US 9,585,921 B2 21 22 equolifaciens. In an alternative embodiment, at least one of cron, Bacteroides uniformis, Bacteroides ureolyticus, and the preceding species is not substantially present in the Bacteroides vulgatus. In an alternative embodiment, at least bacterial composition. one of the preceding species is not Substantially present in In other embodiments, the bacterial composition com the bacterial composition. prises at least one and preferably more than one of the 5 In one embodiment, the bacterial composition comprises following: Clostridium absonium, Clostridium argentinense, at least one and preferably more than one of the following: Clostridium baratii, Clostridium bartlettii, Clostridium Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, bifermentans, Clostridium botulinum, Clostridium butyri Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia cum, Clostridium cadaveris, Clostridium camis, Clostridium coli, Gemmiger; Desulfomonas, and Peptostreptococcus. In cellatum, Clostridium chauvoei, Clostridium clostridio 10 an alternative embodiment, at least one of the preceding forme, Clostridium cochlearium, Clostridium difficile, species is not substantially present in the bacterial compo Clostridium fallax, Clostridium felsineum, Clostridium sition. ghonii, Clostridium glycolicum, Clostridium haemolyticum, In one embodiment, the bacterial composition comprises Clostridium hastiforme, Clostridium histolyticum, at least one and preferably more than one of the following: Clostridium indolis, Clostridium innocuum, Clostridium 15 Bacteroides fragilis SS. Vulgatus, Eubacterium aerofaciens, irregulare, Clostridium limosum, Clostridium malenomina Bacteroides fragilis SS. Thetaiotaomicron, Blautia producta tum, Clostridium novyi, Clostridium Oroticum, Clostridium (previously known as Peptostreptococcus productus II), paraputrificum, Clostridium perfingens, Clostridium pili Bacteroides fragilis SS. Distasonis, Fusobacterium praus forme, Clostridium putrefaciens, Clostridium putrificum, nitzii, Coprococcus eutactus, Eubacterium aerofaciens III, Clostridium ramosum, Clostridium sardiniense, Clostridium 20 Blautia producta (previously known as Peptostreptococcus Sartagoforme, Clostridium scindens, Clostridium septicum, productus I), Ruminococcus bronii, Bifidobacterium adoles Clostridium sordellii, Clostridium sphenoides, Clostridium centis, Gemmiger formicilis, Bifidobacterium longum, spiroforme, Clostridium sporogenes, Clostridium subtermi Eubacterium Siraeum, Ruminococcus torques, Eubacterium male, Clostridium symbiosum, Clostridium tertium, rectale III-H, Eubacterium rectale IV. Eubacterium eligens, Clostridium tetani, Clostridium welchii, and Clostridium 25 Bacteroides eggerthii, Clostridium leptum, Bacteroides fra villosum. In an alternative embodiment, at least one of the gilis SS. A., Eubacterium biforme, Bifidobacterium infantis, preceding species is not substantially present in the bacterial Eubacterium rectale III-F. Coprococcus comes, Bacteroides composition. capillosus, Ruminococcus albus, Eubacterium formicigen In one embodiment, the bacterial composition comprises erans, Eubacterium hafii, Eubacterium ventriosum I, Fuso at least one and preferably more than one of the following: 30 bacterium russii, Ruminococcus obeum, Eubacterium rec Clostridium innocuum, Clostridum bifermentans, tale II, Clostridium ramosum I, Lactobacillus leichmanii, Clostridium butyricum, Bacteroides fragilis, Bacteroides Ruminococcus caillidus, Butyrivibrio CrOSSOtuS, thetaiotaomicron, Bacteroides uniformis, three Strains of Acidaminococcus fermentans, Eubacterium ventriosum, Escherichia coli, and Lactobacillus sp. In an alternative Bacteroides fragilis SS. fragilis, Bacteroides AR, Coprococ embodiment, at least one of the preceding species is not 35 cus catus, Eubacterium hadrum, Eubacterium cylindroides, Substantially present in the bacterial composition. Eubacterium ruminantium, Eubacterium CH-1, Staphyllo In one embodiment, the bacterial composition comprises coccus epidermidis, Peptostreptococcus BL, Eubacterium at least one and preferably more than one of the following: limosum, Bacteroides praeacutus, Bacteroides L., Fusobac Clostridium bifermentans, Clostridium innocuum, terium mortiferum I, Fusobacterium naviforme, Clostridium Clostridium butyricum, three strains of Escherichia coli, 40 innocuum, Clostridium ramosum, Propionibacterium acnes, three strains of Bacteroides, and Blautia producta. In an Ruminococcus flavefaciens, Ruminococcus AT, Peptococcus alternative embodiment, at least one of the preceding species AU-1, Eubacterium AG, -AK, AL, -AL-1, -AN; Bacte is not Substantially present in the bacterial composition. roides fragilis SS. ovatus, -SS. d, -SS. f. Bacteroides L-1, L-5, In one embodiment, the bacterial composition comprises Fusobacterium nucleatum, Fusobacterium mortiferum, at least one and preferably more than one of the following: 45 Escherichia coli, Streptococcus morbilliorum, Peptococcus Bacteroides sp., Escherichia coli, and non pathogenic magnus, Peptococcus G, AU-2; Streptococcus intermedius, Clostridia, including Clostridium innocuum, Clostridium Ruminococcus lactaris, Ruminococcus CO Gemmiger X, bifermentans and Clostridium ramosum. In an alternative Coprococcus BH, -CC: Eubacterium tenue, Eubacterium embodiment, at least one of the preceding species is not ramulus, Eubacterium AE, -AG-H, -AG-M, -AJ, -BN-1; Substantially present in the bacterial composition. 50 Bacteroides clostridiiformis ss. Clostridliformis, Bacteroides In one embodiment, the bacterial composition comprises coagulans, Bacteroides Orails, Bacteroides ruminicola SS. at least one and preferably more than one of the following: brevis, -SS. ruminicola, Bacteroides splanchnicus, Desui Bacteroides species, Escherichia coli and non-pathogenic fomonas pigra, Bacteroides L-4, -N-i; Fusobacterium H. Clostridia, such as Clostridium butyricum, Clostridium Lactobacillus G, and Succini vibrio A. In an alternative bifermentans and Clostridium innocuum. In an alternative 55 embodiment, at least one of the preceding species is not embodiment, at least one of the preceding species is not Substantially present in the bacterial composition. Substantially present in the bacterial composition. Bacterial Compositions Described by Operational Taxo In one embodiment, the bacterial composition comprises nomic Unit (OTUs) at least one and preferably more than one of the following: Bacterial compositions may be prepared comprising at Bacteroides caccae, Bacteroides capillosus, Bacteroides 60 least two types of isolated bacteria, chosen from the species coagulans, Bacteroides distasonis, Bacteroides eggerthii, in Table 1. Bacteroides forsythus, Bacteroides fragilis, Bacteroides fra In one embodiment, the OTUs can be characterized by gilis-ryhn, Bacteroides gracilis, Bacteroides levi, Bacte one or more of the variable regions of the 16S sequence roides macacae, Bacteroides merdae, Bacteroides ovatus, (V1-V9). These regions in bacteria are defined by nucleo Bacteroides pneumosintes, Bacteroides putredinis, Bacte 65 tides 69-99, 137-242, 433-497, 576-682, 822-879, 986 roides pyogenes, Bacteroides splanchnicus, Bacteroides 1043, 1117-1173, 1243-1294 and 1435-1465 respectively Stercoris, Bacteroides tectum, Bacteroides thetaiotaomi using numbering based on the E. coli system of nomencla US 9,585,921 B2 23 24 ture. (See, e.g., Brosius et al., Complete nucleotide sequence In another embodiment, the bacterial composition does of a 16S ribosomal RNA gene from Escherichia coli, PNAS not comprise at least one of Clostridium bifermentans, 75(10):4801-4805 (1978)). In some embodiments, at least Clostridium innocuum, Clostridium butyricum, three strains one of the V1,V2, V3, V4, V5, V6, V7, V8, and V9 regions of Escherichia coli, three strains of Bacteroides, and Blautia are used to characterize an OTU. In one embodiment, the 5 producta (previously known as Peptostreptococcus produc V1,V2, and V3 regions are used to characterize an OTU. In tus). another embodiment, the V3, V4, and V5 regions are used In another embodiment, the bacterial composition does to characterize an OTU. In another embodiment, the V4 not comprise at least one of Bacteroides sp., Escherichia region is used to characterize an OTU s coli, and non pathogenic Clostridia, including Clostridium Bacterial Compositions Exclusive of Certain Bacterial 10 innocuum, Clostridium bifermentans and Clostridium ramo St. S pecies or StrainsSt In another embodiment, the bacterial composition does In one embodiment, the bacterial composition does not not comprise at least one of more than one Bacteroides comprisekn at least one of EnterococcusIi lostridi faecalis (previously species, Escherichia coli and non-pathogenic Clostridia, own as Streptococcus faeca is), Clostridium ''' 15 such as Clostridium butyricum, Clostridium bifermentans Clostridium ramosum, Bacteroides ovatus, Bacteroides and Clostridium innocuum. vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli In another embodiment, the bacterial composition does (1109 and 1108-1), Clostridum bifermentans, and Blautia not comprise at least one of Bacteroides Caccae, Bacteroides producta (previously known as Peptostreptococcus produc- capillosus, Bacteroides coagulans, Bacteroides distasonis, tus). 20 Bacteroides eggerthii, Bacteroides forsythus, Bacteroides In another embodiment, the bacterial composition does fragilis, Bacteroides fragilis-ryhm, Bacteroides gracilis, not comprise at least one of Acidaminococcus intestinalis, Bacteroides levi, Bacteroides macacae, Bacteroides mer Bacteroides ovatus, two species of Bifidobacterium adoles- dae, Bacteroides ovatus, Bacteroides pneumosintes, Bacte centis, two species of Bifidobacterium longum, Collinsella roides putredinis, Bacteroides pyogenes, Bacteroides aerofaciens, two species of Dorea longicatena, Escherichia 25 splanchnicus, Bacteroides Stercoris, Bacteroides tectum, coli, Eubacterium eligens, Eubacterium limosum, four spe- Bacteroides thetaiotaomicron, Bacteroides uniformis, cies of Eubacterium rectale, Eubacterium ventriosumi, Fae- Bacteroides ureolyticus, and Bacteroides vulgatus. calibacterium prausnitzii, Lactobacillus casei, Lactobacil- In another embodiment, the bacterial composition does lus paracasei, Paracateroides distasonis, Raoultella sp., one not comprise at least one of Bacteroides, Eubacteria, Fuso species of Roseburia (chosen from Roseburia faecalis or 30 bacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Roseburia faecis), Roseburia intestinalis, two species of Ruminococcus, Escherichia coli, Gemmiger; Desulfomonas, Ruminococcus torques, and Streptococcus mitis. and Peptostreptococcus. In yet another embodiment, the bacterial composition In another embodiment, the bacterial composition does does not comprise at least one of Bamesiella intestinihomi- not comprise at least one of Bacteroides fragilis SS. Vulgatus, nis, Lactobacillus reuteri; a species characterized as one of 35 Eubacterium aerofaciens, Bacteroides fragilis SS. Thetaio Enterococcus hirae, Enterococus faecium, or Enterococcus taOmicron, Blautia producta (previously known as Pepto durans; a species characterized as one of Anaerostipes streptococcus productus II), Bacteroides fragilis SS. Dista caccae or Clostridium indolis; a species characterized as one sonis, Fusobacterium prausnitzii, Coprococcus eutactus, of Staphylococcus warneri or Staphylococcus pasteuri; and Eubacterium aerofaciens III, Blautia producta (previously Adlercreutzia equolifaciens. 40 known as Peptostreptococcus productus I), Ruminococcus In other embodiments, the bacterial composition does not bromii, Bifidobacterium adolescentis, Gemmiger formicilis, comprise at least one of Clostridium absonium, Clostridium Bifidobacterium longum, Eubacterium Siraeum, Ruminococ argentinense, Clostridium baratii, Clostridium bifermen- cus torques, Eubacterium rectale III-H. Eubacterium rectale tans, Clostridium botulinum, Clostridium butyricum, IV, Eubacterium eligens, Bacteroides eggerthii, Clostridium Clostridium cadaveris, Clostridium camis, Clostridium 45 leptum, Bacteroides fragilis SS. A., Eubacterium biforme, cellatum, Clostridium chauvoei, Clostridium clostridio- Bifidobacterium infantis, Eubacterium rectale III-F. Copro forme, Clostridium cochlearium, Clostridium difficile, coccus comes, Bacteroides capillosus, Ruminococcus albus, Clostridium fallax, Clostridium felsineum, Clostridium Eubacterium formicigenerans, Eubacterium hallii, Eubac ghonii, Clostridium glycolicum, Clostridium haemolyticum, terium ventriosum I, Fusobacterium russii, Ruminococcus Clostridium hastiforme, Clostridium histolyticum, 50 obeum, Eubacterium rectale II, Clostridium ramosum I. Clostridium indolis, Clostridium innocuum, Clostridium Lactobacillus leichmanii, Ruminococcus Cailidus, Butyrivi irregulare, Clostridium limosum, Clostridium malenomina- brio crossotus, Acidaminococcus fermentans, Eubacterium tum, Clostridium novyi, Clostridium Oroticum, Clostridium ventriosum, Bacteroides fragilis SS. fragilis, Bacteroides paraputrificum, Clostridium perfingens, Clostridium pili- AR, Coprococcus catus, Eubacterium hadrum, Eubacterium forme, Clostridium putrefaciens, Clostridium putrificum, 55 cylindroides, Eubacterium ruminantium, Eubacterium Clostridium ramosum, Clostridium sardiniense, Clostridium CH-1, Staphylococcus epidermidis, Peptostreptococcus BL, Sartagoforme, Clostridium scindens, Clostridium septicum, Eubacterium limosum, Bacteroides praeacutus, Bacteroides Clostridium sordellii, Clostridium sphenoides, Clostridium L., Fusobacterium mortiferum I, Fusobacterium naviforme, spiroforme, Clostridium sporogenes, Clostridium subtermi- Clostridium innocuum, Clostridium ramosum, Propionibac male, Clostridium symbiosum, Clostridium tertium, 60 terium acnes, Ruminococcus flavefaciens, Ruminococcus Clostridium tetani, Clostridium welchii, and Clostridium AT, Peptococcus AU-1, Eubacterium AG, -AK, AL. -AL villosum. 1. -AN; Bacteroides fragilis SS. ovatus, -SS. d, -SS. f. Bacte In another embodiment, the bacterial composition does roides L-1, L-5. Fusobacterium nucleatum, Fusobacterium not comprise at least one of Clostridium innocuum, Clostri- mortiferum, Escherichia coli, Streptococcus morbilliorum, dum bifermentans, Clostridium butyricum, Bacteroides fra- 65 Peptococcus magnus, Peptococcus G, AU-2; Streptococcus gilis, Bacteroides thetaiotaomicron, Bacteroides uniformis, intermedius, Ruminococcus lactaris, Ruminococcus CO three Strains of Escherichia coli, and Lactobacillus sp. Gemmiger X. Coprococcus BH, —CC, Eubacterium tenue, US 9,585,921 B2 25 26 Eubacterium ramulus, Eubacterium AE, -AG-H, -AG-M, Subjects and are efficacious in numerous gastrointestinal -AJ, -BN-1; Bacteroides clostridiiformis ss. Clostridliformis, diseases, disorders and conditions and in general nutritional Bacteroides coagulans, Bacteroides Orails, Bacteroides health. While spore-based compositions are known, these ruminicola SS. brevis, -SS. ruminicola, Bacteroides splanch are generally prepared according to various techniques such nicus, Desuifomonas pigra, Bacteroides L-4, -N-i; Fusobac as lyophilization or spray-drying of liquid bacterial cultures, terium H, Lactobacillus G, and Succini vibrio A. resulting in poor efficacy, instability, Substantial variability Inhibition of Bacterial Pathogens and lack of adequate safety. In some embodiments, the bacterial composition provides It has now been found that populations of bacterial spores a protective or therapeutic effect against infection by one or can be obtained from biological materials obtained from more GI pathogens of interest. 10 mammalian Subjects, including humans. These populations A list of exemplary bacterial pathogens is provided in are formulated into compositions as provided herein, and Table 1 as indicated by pathogen status. administered to mammalian Subjects using the methods as In some embodiments, the pathogenic bacterium is provided herein. selected from the group consisting of Yersinia, Vibrio, Provided herein are therapeutic compositions containing a Treponema, Streptococcus, Staphylococcus, Shigella, Sal 15 purified population of bacterial spores. As used herein, the monella, Rickettsia, Orientia, Pseudomonas, Neisseria, terms “purify”, “purified’ and “purifying refer to the state Mycoplasma, Mycobacterium, Listeria, Leptospira, Legio of a population (e.g., a plurality of known or unknown nella, Klebsiella, Helicobacter, Haemophilus, Francisella, amount and/or concentration) of desired bacterial spores, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebac that have undergone one or more processes of purification, terium, Clostridium, Chlamydia, Chlamydophila, Campy e.g., a selection or an enrichment of the desired bacterial lobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bifi spore, or alternatively a removal or reduction of residual dobacterium, Bacillus, multi-drug resistant bacteria, habitat products as described herein. In some embodiments, extended spectrum beta-lactam resistant Enterococci a purified population has no detectable undesired activity or, (ESBL), Carbapenem-resistent Enterobacteriaceae (CRE), alternatively, the level or amount of the undesired activity is and Vancomycin-resistant Enterococci (VRE). 25 at or below an acceptable level or amount. In other embodi In some embodiments, these pathogens include, but are ments, a purified population has an amount and/or concen not limited to, Aeromonas hydrophila, Campylobacter fetus, tration of desired bacterial spores at or above an acceptable Plesiomonas Shigelloides, Bacillus cereus, Campylobacter amount and/or concentration. In other embodiments, the jejuni, Clostridium botulinum, Clostridium difficile, purified population of bacterial spores is enriched as com Clostridium perfingens, enteroaggregative Escherichia 30 pared to the starting material (e.g., a fecal material) from coli, enterohemorrhagic Escherichia coli, enteroinvasive which the population is obtained. This enrichment may be Escherichia coli, enterotoxigenic Escherichia coli (such as, by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, but not limited to, LT and/or ST), Escherichia coli O157:H7, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, Helicobacter pylori, Klebsiellia pneumonia, Lysteria mono 99.9999%, or greater than 99.9999% as compared to the cytogenes, Plesiomonas Shigelloides, Salmonella spp., Sal 35 starting material. monella typhi, Salmonella paratyphi, Shigella spp., Staphy In certain embodiments, the purified populations of bac lococcus spp., Staphylococcus aureus, Vancomycin-resistant terial spores have reduced or undetectable levels of one or enterococcus spp., Vibrio spp., Vibrio cholerae, Vibrio para more pathogenic activities, such as toxicity, an infection of haemolyticus, Vibrio vulnificus, and Yersinia enterocolitica. the mammalian recipient Subject, an immunomodulatory In one embodiment, the pathogen of interest is at least one 40 activity, an autoimmune response, a metabolic response, or pathogen chosen from Clostridium difficile, Salmonella spp., an inflammatory response or a neurological response. Such pathogenic Escherichia coli, Vancomycin-resistant Entero a reduction in a pathogenic activity may be by 10%. 20%, coccus spp., and extended spectrum beta-lactam resistant 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, Enterococci (ESBL). 98%, 99%, 99.9%, 99.99%. 99.999%, 99.9999%, or greater Purified Spore Populations 45 than 99.9999% as compared to the starting material. In other In some embodiments, the bacterial compositions com embodiments, the purified populations of bacterial spores prise purified spore populations. Purified spore populations have reduced sensory components as compared to fecal contain combinations of commensal bacteria of the human material. Such as reduced odor, taste, appearance, and gut microbiota with the capacity to meaningfully provide umami. functions of a healthy microbiota when administered to a 50 Provided are purified populations of bacterial spores that mammalian subject. Without being limited to a specific are substantially free of residual habitat products. In certain mechanism, it is thought that Such compositions inhibit the embodiments, this means that the bacterial spore composi growth of a pathogen Such as C. difficile, Salmonella spp., tion no longer contains a Substantial amount of the biologi enteropathogenic E. coli, and Vancomycin-resistant Entero cal matter associated with the microbial community while coccus spp., so that a healthy, diverse and protective micro 55 living on or in the human or animal Subject, and the purified biota can be maintained or, in the case of pathogenic population of spores may be 100% free, 99% free, 98% free, bacterial infections such as C. difficile infection, repopulate 97% free, 96% free, or 95% free of any contamination of the the intestinal lumen to reestablish ecological control over biological matter associated with the microbial community. potential pathogens. In some embodiments, yeast spores and Substantially free of residual habitat products may also other fungal spores are also purified and selected for thera 60 mean that the bacterial spore composition contains no peutic use. detectable cells from a human or animal, and that only Disclosed herein are therapeutic compositions containing microbial cells are detectable, in particular, only desired non-pathogenic, germination-competent bacterial spores, microbial cells are detectable. In another embodiment, it for the prevention, control, and treatment of gastrointestinal means that fewer than 1x10%, 1x10%, 1x10%, 1x10 diseases, disorders and conditions and for general nutritional 65 5%, 1x10%, 1x107%, 1x10% of the cells in the bac health. These compositions are advantageous in being Suit terial composition are human or animal, as compared to able for safe administration to humans and other mammalian microbial cells. In another embodiment, the residual habitat US 9,585,921 B2 27 28 product present in the purified population is reduced at least tors (appearing in the order OF, OE, OG and OK), whose a certain level from the fecal material obtained from the activities are confined to the forespore (OF and OG) or the mammalian donor Subject, e.g., reduced by at least about mother cell (OE and OK). 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, Provided are spore populations containing more than one 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, type of bacterium. As used herein, a “type' or more than one 99.9999%, or greater than 99.9999%. “types of bacteria may be differentiated at the genus level, In one embodiment, substantially free of residual habitat the species, level, the sub-species level, the strain level or by products or substantially free of a detectable level of a any other taxonomic method, as described herein and oth pathogenic material means that the bacterial composition erwise known in the art. contains no detectable viral (including bacterial viruses (i.e., 10 phage)), fungal, or mycoplasmal or toxoplasmal contami In some embodiments, all or essentially all of the bacterial nants, or a eukaryotic parasite Such as a helminth. Alterna spores present in a purified population are obtained from a tively, the purified spore populations are substantially free of fecal material treated as described herein or otherwise an acellular material, e.g., DNA, viral coat material, or known in the art. In alternative embodiments, one or more non-viable bacterial material. 15 than one bacterial spores or types of bacterial spores are As described herein, purified spore populations can be generated in culture and combined to form a purified spore demonstrated by genetic analysis (e.g., PCR, DNA sequenc population. In other alternative embodiments, one or more ing), serology and antigen analysis, and methods using of these culture-generated spore populations are combined instrumentation Such as flow cytometry with reagents that with a fecal material-derived spore population to generate a distinguish desired bacterial spores from non-desired, con hybrid spore population. Bacterial compositions may con taminating materials. tain at least two types of these preferred bacteria, including Exemplary biological materials include fecal materials strains of the same species. For instance, a bacterial com Such as feces or materials isolated from the various segments position may comprise at least 2, at least 3, at least 4, at least of the Small and large intestines. Fecal materials are obtained 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least from a mammalian donor Subject, or can be obtained from 25 11, at least 12, at least 13, at least 14, at least 15, at least 16, more than one donor Subject, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10. at least 17, at least 18, at least 19, or at least 20 or more than 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 20 types of bacteria, as defined by species or operational 750, 1000 or from greater than 1000 donors, where such taxonomic unit (OTU) encompassing Such species. materials are then pooled prior to purification of the desired Thus, provided herein are methods for production of a bacterial spores. 30 composition containing a population of bacterial spores In alternative embodiments, the desired bacterial spores Suitable for therapeutic administration to a mammalian are purified from a single fecal material sample obtained subject in need thereof. And the composition is produced by from a single donor, and after Such purification are combined generally following the steps of: (a) providing a fecal with purified spore populations from other purifications, material obtained from a mammalian donor Subject; and (b) either from the same donor at a different time, or from one 35 Subjecting the fecal material to at least one purification or more different donors, or both. treatment or step under conditions such that a population of Preferred bacterial genera include Acetonema, Alkaliphi bacterial spores is produced from the fecal material. The lus, Alicyclobacillus, Amphibacillus, Ammonifex, Anaero composition is formulated Such that a single oral dose bacter, Anaerofitstis, Anaerostipes, Anaerotruncus, Anoxy contains at least about 1x10" colony forming units of the bacillus, Bacillus, Blautia, Brevibacillus, Bryantella, 40 bacterial spores, and a single oral dose will typically contain Caldicellulosiruptor, Caloramator; Candidatus, Carboxy about 1x10, 1x10, 1x10, 1x107, 1x10, 1x10, 1x10', dibrachium, Carboxydothermus, Clostridium, Cohnella, 1x10'', 1x10", 1x10", 1x10", 1x10', or greater than Coprococcus, Dendrosporobacter Desulfitobacterium, Des 1x10' CFUs of the bacterial spores. The presence and/or ulfosporosinus, Desulfotomaculum, Dorea, Eubacterium, concentration of a given type of bacteria spore may be Faecalibacterium, Filifactor, Geobacillus, Halobacteroides, 45 known or unknown in a given purified spore population. If Heliobacillus, Heliobacterium, Heliophilum, Heliorestis, known, for example the concentration of spores of a given Lachnoanaerobaculum, Lysinibacillus, Moorella, Oceano strain, or the aggregate of all strains, is e.g., 1x10, 1x10, bacillus, Orenia (S.), Oxalophagus, Oxobacter, Paenibacil 1x10, 1x107, 1x10, 1x10, 1x10", 1x10'', 1x10", lus, Pelospora, Pelotomaculum, Propionispora, Roseburia, 1x10", 1x10", 1x10", or greater than 1x10" viable bac Ruminococcus, Sarcina, Sporobacterium, Sporohalobacter, 50 terial spores per gram of composition or per administered Sporolactobacillus, Sporomusa, Sporosarcina, Sporoto dose. maculum, Subdoligranulum, Symbiobacterium, Syntropho In some formulations, the composition contains at least botulus, Syntrophospora, Terribacillus, Thermoanaero about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or bacter, and Thermosinus. greater than 90% spores on a mass basis. In some formula Preferred bacterial species are provided at Table X4. 55 tions, the administered dose does not exceed 200, 300, 400, Where specific strains of a species are provided, one of skill 500, 600, 700, 800, 900 milligrams or 1, 1.1, 1.2, 1.3, 1.4, in the art will recognize that other strains of the species can 1.5, 1.6, 1.7, 1.8, or 1.9 grams in mass. be substituted for the named strain. The bacterial spore compositions are generally formu In some embodiments, spore-forming bacteria are iden lated for oral or gastric administration, typically to a mam tified by the presence of nucleic acid sequences that modu 60 malian Subject. In particular embodiments, the composition late sporulation. In particular, signature sporulation genes is formulated for oral administration as a Solid, semi-solid, are highly conserved across members of distantly related gel, or liquid form, Such as in the form of a pill, tablet, genera including Clostridium and Bacillus. Traditional capsule, or lozenge. In some embodiments, such formula approaches of forward genetics have identified many, if not tions contain or are coated by an enteric coating to protect all, genes that are essential for sporulation (spo). The devel 65 the bacteria through the stomach and Small intestine, opmental program of sporulation is governed in part by the although spores are generally resistant to the stomach and Successive action of four compartment-specific sigma fac Small intestines. US 9,585,921 B2 29 30 The bacterial spore compositions may be formulated to be In embodiments that use a culturing step, the agar or broth effective in a given mammalian Subject in a single admin can contain nutrients that provide essential elements and istration or over multiple administrations. For example, a specific factors that enable growth. An example would be a single administration is substantially effective to reduce Cl. medium composed of 20 g/L glucose, 10 g/L yeast extract, difficile and/or Cl. difficile toxin content in a mammalian 5 10 g/L Soy peptone, 2 g/L citric acid, 1.5 g/L Sodium Subject to whom the composition is administered. Substan phosphate monobasic, 100 mg/L ferric ammonium citrate, tially effective means that Cl. difficile and/or Cl. difficile 80 mg/L magnesium sulfate, 10 mg/L hemin chloride, 2 toxin content in the subject is reduced by at least 10%, 20%, mg/L calcium chloride, 1 mg/L menadione. A variety of 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or microbiological media and variations are well known in the greater than 99% following administration of the composi 10 art (e.g. R. M. Atlas, Handbook of Microbiological Media tion. (2010) CRC Press). Medium can be added to the culture at Methods of the Invention the start, may be added during the culture, or may be Methods for Determining 16S Sequences intermittently/continuously flowed through the culture. The OTUs can be defined either by full 16S sequencing of the strains in the bacterial composition may be cultivated alone, rRNA gene, by sequencing of a specific hyperVariable 15 as a Subset of the bacterial composition, or as an entire region of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or collection comprising the bacterial composition. As an V9), or by sequencing of any combination of hyperVariable example, a first strain may be cultivated together with a regions from this gene (e.g. V1-3 or V3-5). The bacterial second strain in a mixed continuous culture, at a dilution rate 16S rDNA is approximately 1500 nucleotides in length and lower than the maximum growth rate of either cell to prevent is used in reconstructing the evolutionary relationships and the culture from washing out of the cultivation. sequence similarity of one bacterial isolate to another using The inoculated culture is incubated under favorable con phylogenetic approaches. 16S sequences are used for phy ditions for a time sufficient to build biomass. For bacterial logenetic reconstruction as they are in general highly con compositions for human use, this is often at 37° C. tem served, but contain specific hyperVariable regions that har perature, pH, and other parameter with values similar to the bor sufficient nucleotide diversity to differentiate genera and 25 normal human niche. The environment can be actively species of most microbes. controlled, passively controlled (e.g., via buffers), or Using well known techniques, in order to determine the allowed to drift. For example, for anaerobic bacterial com full 16S sequence or the sequence of any hypervariable positions (e.g., gut microbiota), an anoxic/reducing environ region of the 16S sequence, genomic DNA is extracted from ment can be employed. This can be accomplished by addi a bacterial sample, the 16S rDNA (full region or specific 30 tion of reducing agents such as cysteine to the broth, and/or hyperVariable regions) amplified using polymerase chain stripping it of oxygen. As an example, a culture of a bacterial reaction (PCR), the PCR products cleaned, and nucleotide composition can be grown at 37° C. pH 7, in the medium sequences delineated to determine the genetic composition above, pre-reduced with 1 g/L cysteine HC1. of 16S gene or subdomain of the gene. If full 16S sequencing When the culture has generated sufficient biomass, it can is performed, the sequencing method used may be, but is not 35 be preserved for banking. The organisms can be placed into limited to, Sanger sequencing. If one or more hyperVariable a chemical milieu that protects from freezing (adding cryo regions are used. Such as the V4 region, the sequencing can protectants), drying (lyoprotectants), and/or osmotic be, but is not limited to being, performed using the Sanger shock (osmoprotectants), dispensing into multiple (option method or using a next-generation sequencing method. Such ally identical) containers to create a uniform bank, and then as an Illumina (sequencing by synthesis) method using 40 treating the culture for preservation. Containers are gener barcoded primers allowing for multiplex reactions. ally impermeable and have closures that assure isolation OTUs can be defined by a combination of nucleotide from the environment. Cryopreservation treatment is accom markers or genes, in particular highly conserved genes (e.g., plished by freezing a liquid at ultra-low temperatures (e.g., "house-keeping genes), or a combination thereof, full at or below -80° C.). Dried preservation removes water genome sequence, or partial genome sequence generated 45 from the culture by evaporation (in the case of spray drying using amplified genetic products, or whole genome or 'cool drying) or by Sublimation (e.g., for freeze drying, sequence (WGS). Using well defined methods DNA spray freeze drying). Removal of water improves long-term extracted from a bacterial sample will have specific genomic bacterial composition storage stability at temperatures regions amplified using PCR and sequenced to determine the elevated above cryogenic. If the bacterial composition com nucleotide sequence of the amplified products. In the whole 50 prises spore forming species and results in the production of genome shotgun (WGS) method, extracted DNA will be spores, the final composition can be purified by additional directly sequenced without amplification. Sequence data can means. Such as density gradient centrifugation preserved be generated using any sequencing technology including, using the techniques described above. Bacterial composition but not limited to Sanger, Illumina, 454 Life Sciences, Ion banking can be done by culturing and preserving the strains Torrent, ABI, Pacific Biosciences, and/or Oxford Nanopore. 55 individually, or by mixing the strains together to create a Methods for Preparing a Bacterial Composition for combined bank. As an example of cryopreservation, a bac Administration to a Subject terial composition culture can be harvested by centrifugation Methods for producing bacterial compositions can to pellet the cells from the culture medium, the Supernate include three main processing steps, combined with one or decanted and replaced with fresh culture broth containing more mixing steps. The steps include organism banking, 60 15% glycerol. The culture can then be aliquoted into 1 mL organism production, and preservation. cryotubes, sealed, and placed at -80° C. for long-term For banking, the strains included in the bacterial compo viability retention. This procedure achieves acceptable sition may be (1) isolated directly from a specimen or taken viability upon recovery from frozen storage. from a banked stock, (2) optionally cultured on a nutrient Organism production can be conducted using similar agar or broth that Supports growth to generate viable bio 65 culture steps to banking, including medium composition and mass, and (3) the biomass optionally preserved in multiple culture conditions. It can be conducted at larger scales of aliquots in long-term storage. operation, especially for clinical development or commer US 9,585,921 B2 31 32 cial production. At larger Scales, there can be several Sub medical procedure (such as Surgery), who will be hospital cultivations of the bacterial composition prior to the final ized, who live in a long-term care or rehabilitation facility, cultivation. At the end of cultivation, the culture is harvested who are exposed to pathogens by virtue of their profession to enable further formulation into a dosage form for admin (livestock and animal processing workers), or who could be istration. This can involve concentration, removal of unde carriers of pathogens (including hospital workers such as sirable medium components, and/or introduction into a physicians, nurses, and other healthcare professionals). chemical milieu that preserves the bacterial composition and Also provided are methods of treating or preventing a renders it acceptable for administration via the chosen route. mammalian Subject Suffering from or at risk of developing For example, a bacterial composition can be cultivated to a a metabolic disease, and disorder or condition selected from concentration of 10' CFU/mL, then concentrated 20-fold 10 by tangential flow microfiltration; the spent medium can be the group consisting of diabetes, metabolic syndrome, obe exchanged by diafiltering with a preservative medium con sity, heart disease, autoimmune disease, liver disease, and sisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium autism using the therapeutic compositions provided herein. phosphate buffer. The suspension can then be freeze-dried to In embodiments, the bacterial spore composition is a powder and titrated. 15 administered enterically. This preferentially includes oral After drying, the powder can be blended to an appropriate administration, or by an oral or nasal tube (including naso potency, and mixed with other cultures and/or a filler such gastric, nasojejunal, oral gastric, or oral jejunal). In other as microcrystalline cellulose for consistency and ease of embodiments, administration includes rectal administration handling, and the bacterial composition formulated as pro (including enema, Suppository, or colonoscopy). The bacte vided herein. rial composition may be administered to at least one region Administration of Bacterial Compositions. of the gastrointestinal tract, including the mouth, esophagus, The bacterial compositions of the invention are suitable stomach, Small intestine, large intestine, and rectum. In for administration to mammals and non-mammalian animals Some embodiments, it is administered to all regions of the in need thereof. In certain embodiments, the mammalian gastrointestinal tract. The bacterial compositions may be Subject is a human Subject who has one or more symptoms 25 administered orally in the form of medicaments such as of a dysbiosis, including but not limited to overgrowth of an powders, capsules, tablets, gels or liquids. The bacterial undesired pathobiont or pathogen, reduced representation of compositions may also be administered in gel or liquid form key bacterial taxa such as the Bacteroidetes or Firmicutes or by the oral route or through a nasogastric tube, or by the genera or species thereof, or reduced diversity of microbial rectal route in a gel or liquid form, by enema or instillation species compared to a healthy individual, or reduced overall 30 through a colonoscope or by a Suppository. abundance of anaerobic bacteria. When the mammalian subject is suffering from a disease, If the composition is administered colonoscopically and, disorder or condition characterized by an aberrant micro optionally, if the bacterial composition is administered by biota, the bacterial compositions described herein are suit other rectal routes (such as an enema or Suppository) or even able for treatment thereof. In some embodiments, the mam 35 if the Subject has an oral administration, the Subject may malian Subject has not received antibiotics in advance of have a colonic-cleansing preparation. The colon-cleansing treatment with the bacterial compositions. For example, the preparation can facilitate proper use of the colonoscope or mammalian Subject has not been administered at least two other administration devices, but even when it does not serve doses of Vancomycin, metronidazole and/or or similar anti a mechanical purpose it can also maximize the proportion of biotic compound within one week prior to administration of 40 the bacterial composition relative to the other organisms the therapeutic composition. In other embodiments, the previously residing in the gastrointestinal tract of the Sub mammalian Subject has not previously received an antibiotic ject. Any ordinarily acceptable colonic-cleansing prepara compound in the one month prior to administration of the tion may be used such as those typically provided when a therapeutic composition. In other embodiments, the mam Subject undergoes a colonoscopy. malian Subject has received one or more treatments with one 45 To evaluate the Subject, symptoms of dysbiosis are evalu or more different antibiotic compounds and Such ated post treatment ranging from 1 day to 6 months after treatment(s) resulted in no improvement or a worsening of administration of the purified spore population. Fecal mate symptoms. In some embodiments, the spore composition is rial is collected during this period and the microbes present administered following a Successful course of antibiotics to in the gastrointestinal tract can be assessed by 16S rDNA or prevent dysbiosis and enhance recovery of a diverse, healthy 50 metagenomic sequencing analysis or other analyses com microbiota. monly used by the skilled artisan. Repopulation by species In some embodiments, the gastrointestinal disease, disor provided by the spore population as well as Augmentation der or condition is diarrhea caused by C. difficile including by commensal microbes not present in the spore population recurrent C. difficile infection, ulcerative colitis, colitis, will occur in this time as the spore population catalyzes a Crohn's disease, or irritable bowel disease. Beneficially, the 55 reshaping of the gut ecology to a state of healthy biosis. The therapeutic composition is administered only once prior to specification is most thoroughly understood in light of the improvement of the disease, disorder or condition. In some teachings of the references cited within the specification. embodiments the therapeutic composition is administered at The embodiments within the specification provide an illus intervals greater than two days, such as once every three, tration of embodiments and should not be construed to limit four, five or six days, or every week or less frequently than 60 the scope. The skilled artisan readily recognizes that many every week. Or the preparation may be administered inter other embodiments are encompassed. All publications and mittently according to a set schedule, e.g., once a day, once patents cited in this disclosure are incorporated by reference weekly, or once monthly, or when the Subject relapses from in their entirety. To the extent the material incorporated by the primary illness. In another embodiment, the preparation reference contradicts or is inconsistent with this specifica may be administered on a long-term basis to individuals who 65 tion, the specification will Supersede any Such material. The are at risk for infection with or who may be carriers of these citation of any references herein is not an admission that pathogens, including individuals who will have an invasive Such references are prior art. US 9,585,921 B2 33 34 Methods of Treating a Subject As one way of preparing the patient for administration of In some embodiments, the compositions disclosed herein the microbial ecosystem, at least one antibiotic can be are administered to a patient or a user (sometimes collec administered to alter the bacteria in the patient. As another tively referred to as a “subject”). As used herein “adminis way of preparing the patient for administration of the ter” and “administration' encompasses embodiments in 5 microbial ecosystem, a standard colon-cleansing preparation which one person directs another to consume a bacterial can be administered to the patient to Substantially empty the composition in a certain manner and/or for a certain purpose, contents of the colon, such as used to prepare a patient for and also situations in which a user uses a bacteria compo a colonscopy. By “substantially emptying the contents of the sition in a certain manner and/or for a certain purpose colon,' this application means removing at least 75%, at 10 least 80%, at least 90%, at least 95%, or about 100% of the independently of or in variance to any instructions received contents of the ordinary volume of colon contents. Antibi from a second person. Non-limiting examples of embodi otic treatment can precede the colon-cleansing protocol. ments in which one person directs another to consume a If a patient has received an antibiotic for treatment of an bacterial composition in a certain manner and/or for a infection, or if a patient has received an antibiotic as part of certain purpose include when a physician prescribes a course 15 a specific pretreatment protocol, in one embodiment, the of conduct and/or treatment to a patient, when a parent antibiotic can be stopped in sufficient time to allow the commands a minor user (such as a child) to consume a antibiotic to be substantially reduced in concentration in the bacterial composition, when a trainer advises a user (Such as gut before the bacterial composition is administered. In one an athlete) to follow a particular course of conduct and/or embodiment, the antibiotic can be discontinued 1, 2, or 3 treatment, and when a manufacturer, distributer, or marketer days before the administration of the bacterial composition. recommends conditions of use to an end user, for example In another embodiment, the antibiotic can be discontinued 3, through advertisements or labeling on packaging or on other 4, 5, 6, or 7 antibiotic half-lives before administration of the materials provided in association with the sale or marketing bacterial composition. In another embodiment, the antibiotic of a product. can be chosen so the constituents in the bacterial composi The bacterial compositions offer a protective and/or thera 25 tion have an MIC50 that is higher than the concentration of peutic effect against infection by one or more GI pathogens the antibiotic in the gut. of interest and can be administered after an acute case of MIC50 of a bacterial composition or the elements in the infection has been resolved in order to prevent relapse, composition can be determined by methods well known in during an acute case of infection as a complement to the art. Reller et al., Antimicrobial Susceptibility Testing: A antibiotic therapy if the bacterial composition is not sensi 30 Review of General Principles and Contemporary Practices, tive to the same antibiotics as the GI pathogen, or to prevent Clinical Infectious Diseases 49(11):1749-1755 (2009). In infection or reduce transmission from disease carriers. such an embodiment, the additional time between antibiotic The present bacterial compositions can be useful in a administration and administration of the bacterial composi variety of clinical situations. For example, the bacterial tion is not necessary. If the pretreatment protocol is part of compositions can be administered as a complementary treat 35 treatment of an acute infection, the antibiotic can be chosen ment to antibiotics when a patient is suffering from an acute so that the infection is sensitive to the antibiotic, but the infection, to reduce the risk of recurrence after an acute constituents in the bacterial composition are not sensitive to infection has subsided, or when a patient will be in close the antibiotic. proximity to others with or at risk of serious gastrointestinal Routes of Administration infections (physicians, nurses, hospital workers, family 40 The bacterial compositions of the invention are suitable members of those who are ill or hospitalized). for administration to mammals and non-mammalian animals The present bacterial compositions can be administered to in need thereof. In certain embodiments, the mammalian animals, including humans, laboratory animals (e.g., pri Subject is a human Subject who has one or more symptoms mates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, of a dysbiosis. turkeys, chickens), and household pets (e.g., dogs, cats, 45 When a mammalian Subject is suffering from a disease, rodents). disorder or condition characterized by an aberrant micro In the present method, the bacterial composition can be biota, the bacterial compositions described herein are suit administered enterically, in other words, by a route of access able for treatment thereof. In some embodiments, the mam to the gastrointestinal tract. This includes oral administra malian Subject has not received antibiotics in advance of tion, rectal administration (including enema, Suppository, or 50 treatment with the bacterial compositions. For example, the colonoscopy), by an oral or nasal tube (nasogastric, naso mammalian Subject has not been administered at least two jejunal, oral gastric, or oral jejunal), as detailed more fully doses of Vancomycin, metronidazole and/or or similar anti herein. biotic compound within one week prior to administration of Pretreatment Protocols the therapeutic composition. In other embodiments, the Prior to administration of the bacterial composition, the 55 mammalian Subject has not previously received an antibiotic patient can optionally have a pretreatment protocol to pre compound in the one month prior to administration of the pare the gastrointestinal tract to receive the bacterial com therapeutic composition. In other embodiments, the mam position. In certain embodiments, the pretreatment protocol malian Subject has received one or more treatments with one is advisable, such as when a patient has an acute infection or more different antibiotic compounds and Such with a highly resilient pathogen. In other embodiments, the 60 treatment(s) resulted in no improvement or a worsening of pretreatment protocol is entirely optional. Such as when the symptoms. pathogen causing the infection is not resilient, or the patient In some embodiments, the gastrointestinal disease, disor has had an acute infection that has been Successfully treated der or condition is diarrhea caused by C. difficile including but where the physician is concerned that the infection may recurrent C. difficile infection, ulcerative colitis, colitis, recur. In these instances, the pretreatment protocol can 65 Crohn's disease, or irritable bowel disease. Beneficially, the enhance the ability of the bacterial composition to affect the therapeutic composition is administered only once prior to patient’s microbiome. improvement of the disease, disorder or condition. In some US 9,585,921 B2 35 36 embodiments, the therapeutic composition is administered at from 1 week to 4 weeks, from 1 month, to 3 months, from intervals greater than two days, such as once every three, 3 months to 6 months, from 6 months to 1 year, or for over four, five or six days, or every week or less frequently than a year. every week. In other embodiments, the preparation can be In one embodiment, 105 and 1012 microorganisms total administered intermittently according to a set schedule, e.g., can be administered to the patient in a given dosage form. In once a day, once weekly, or once monthly, or when the another embodiment, an effective amount can be provided in Subject relapses from the primary illness. In another embodi from 1 to 500 ml or from 1 to 500 grams of the bacterial ment, the preparation may be administered on a long-term composition having from 107 to 1011 bacteria per ml or per basis to subjects who are at risk for infection with or who gram, or a capsule, tablet or Suppository having from 1 mg 10 to 1000 mg lyophilized powder having from 107 to 1011 may be carriers of these pathogens, including Subjects who bacteria. Those receiving acute treatment can receive higher will have an invasive medical procedure (such as Surgery), doses than those who are receiving chronic administration who will be hospitalized, who live in a long-term care or (such as hospital workers or those admitted into long-term rehabilitation facility, who are exposed to pathogens by care facilities). virtue of their profession (livestock and animal processing 15 Any of the preparations described herein can be admin workers), or who could be carriers of pathogens (including istered once on a single occasion or on multiple occasions, hospital workers such as physicians, nurses, and other health Such as once a day for several days or more than once a day care professionals). on the day of administration (including twice daily, three In certain embodiments, the bacterial composition is times daily, or up to five times daily). In another embodi administered enterically. This preferentially includes oral ment, the preparation can be administered intermittently administration, or by an oral or nasal tube (including naso according to a set schedule, e.g., once weekly, once monthly, gastric, nasojejunal, oral gastric, or oral jejunal). In other or when the patient relapses from the primary illness. In one embodiments, administration includes rectal administration embodiment, the preparation can be administered on a (including enema, Suppository, or colonoscopy). The bacte long-term basis to individuals who are at risk for infection rial composition can be administered to at least one region 25 with or who may be carriers of these pathogens, including of the gastrointestinal tract, including the mouth, esophagus, individuals who will have an invasive medical procedure stomach, Small intestine, large intestine, and rectum. In (such as Surgery), who will be hospitalized, who live in a Some embodiments, it is administered to all regions of the long-term care or rehabilitation facility, who are exposed to gastrointestinal tract. The bacterial compositions can be pathogens by virtue of their profession (livestock and animal administered orally in the form of medicaments such as 30 processing workers), or who could be carriers of pathogens powders, capsules, tablets, gels or liquids. The bacterial (including hospital workers such as physicians, nurses, and compositions can also be administered in gel or liquid form other health care professionals). by the oral route or through a nasogastric tube, or by the Patient Selection rectal route in a gel or liquid form, by enema or instillation Particular bacterial compositions can be selected for indi through a colonoscope or by a Suppository. 35 vidual patients or for patients with particular profiles. For If the composition is administered colonoscopically and, example, 16S sequencing can be performed for a given optionally, if the bacterial composition is administered by patient to identify the bacteria present in his or her micro other rectal routes (such as an enema or Suppository) or even biota. The sequencing can either profile the patient’s entire if the Subject has an oral administration, the Subject can have microbiome using 16S sequencing (to the family, genera, or a colon-cleansing preparation. The colon-cleansing prepa 40 species level), a portion of the patient's microbiome using ration can facilitate proper use of the colonoscope or other 16S sequencing, or it can be used to detect the presence or administration devices, but even when it does not serve a absence of specific candidate bacteria that are biomarkers mechanical purpose, it can also maximize the proportion of for health or a particular disease state, such as markers of the bacterial composition relative to the other organisms multi-drug resistant organisms or specific genera of concern previously residing in the gastrointestinal tract of the Sub 45 Such as Escherichia. Based on the biomarker data, a par ject. Any ordinarily acceptable colon-cleansing preparation ticular composition can be selected for administration to a may be used such as those typically provided when a subject patient to Supplement or complement a patient’s microbiota undergoes a colonoscopy. in order to restore health or treat or prevent disease. In Dosages and Schedule for Administration another embodiment, patients can be screened to determine In some embodiments, the bacteria and bacterial compo 50 the composition of their microbiota to determine the likeli sitions are provided in a dosage form. In certain embodi hood of Successful treatment. ments, the dosage form is designed for administration of at Combination Therapy least one OTU or combination thereof disclosed herein, The bacterial compositions can be administered with wherein the total amount of bacterial composition adminis other agents in a combination therapy mode, including tered is selected from 0.1 ng to 10 g, 10 ng to 1 g, 100 ng 55 anti-microbial agents and prebiotics. Administration can be to 0.1 g, 0.1 mg to 500 mg, 1 mg to 100 mg. or from 10-15 sequential, over a period of hours or days, or simultaneous. mg. In other embodiments, the bacterial composition is In one embodiment, the bacterial compositions are consumed at a rate of from 0.1 ng to 10 g a day, 10 ng to 1 included in combination therapy with one or more anti g a day, 100 ng to 0.1 g a day, 0.1 mg to 500 mg a day, 1 mg microbial agents, which include anti-bacterial agents, anti to 100 mg a day, or from 10-15 mg a day, or more. 60 fungal agents, anti-viral agents and anti-parasitic agents. In certain embodiments, the treatment period is at least 1 Anti-bacterial agents can include cephalosporin antibiot day, at least 2 days, at least 3 days, at least 4 days, at least ics (cephalexin, cefuroxime, cefadroxil, cefazolin, cepha 5 days, at least 6 days, at least 1 week, at least 2 weeks, at lothin, cefaclor, cefamandole, cefoxitin, cefprozil, and cefto least 3 weeks, at least 4 weeks, at least 1 month, at least 2 biprole); fluoroquinolone antibiotics (cipro, Levacquin, months, at least 3 months, at least 4 months, at least 5 65 floxin, tequin, avelox, and norflox); tetracycline antibiotics months, at least 6 months, or at least 1 year. In some (tetracycline, minocycline, oxytetracycline, and doxycy embodiments the treatment period is from 1 day to 1 week, cline); penicillin antibiotics (amoxicillin, amplicillin, peni US 9,585,921 B2 37 38 cillin V, dicloxacillin, carbenicillin, Vancomycin, and methi using quantitative PCR (qPCR), described below, or by cillin); and carbapenem antibiotics (ertapenem, doripenem, using traditional microbiological techniques and counting imipenem/cilastatin, and meropenem). colony formation. Anti-viral agents can include Abacavir, Acyclovir, Adefo Optionally, the mice can receive an antibiotic treatment to vir, Amprenavir, Atazanavir, Cidofovir, Darunavir, Delavir mimic the condition of dysbiosis. Antibiotic treatment can dine, Didanosine, Docosanol, Efavirenz, Elvitegravir, decrease the taxonomic richness, diversity, and evenness of Emtricitabine, Enfluvirtide, Etravirine, Famciclovir, Foscar the community, including a reduction of abundance of a net, Fomivirsen, Ganciclovir, Indinavir, Idoxuridine, Lami significant number of bacterial taxa. Dethlefsen et al., The Vudine, Lopinavir Maraviroc, MK-2048, Nelfinavir, Nevi pervasive effects of an antibiotic on the human gut micro rapine, Penciclovir, Raltegravir, Rilpivirine, Ritonavir, 10 biota, as revealed by deep 16S rRNA sequencing, PLOS Saquinavir, Stavudine, Tenofovir Trifluridine, Valaciclovir, Biology 6(11):3280 (2008). At least one antibiotic can be Valganciclovir, Vidarabine, Ibacitabine, Amantadine, Osel used, and antibiotics are well known. Antibiotics can include tamivir, Rimantidine, Tipranavir, Zalcitabine, Zanamivir aminoglycoside antibiotic (amikacin, arbekacin, gentamicin, and Zidovudine. kanamycin, neomycin, netilmicin, paromomycin, rho Examples of antifungal compounds include, but are not 15 dostreptomycin, Streptomycin, tobramycin, and apramycin), limited to polyene antifungals such as natamycin, rimocidin, amoxicillin, amplicillin, Augmentin (an amoxicillin/clavu filipin, nystatin, amphotericin B, candicin, and hamycin; lanate potassium combination), cephalosporin (cefaclor, imidazole antifungals such as miconazole, ketoconazole, defadroxil, cefazolin, cefixime, fefoxitin, cefprozil, ceftaz clotrimazole, econazole, omoconazole, bifonazole, butocon imdime, cefuroxime, cephalexin), clavulanate potassium, azole, fenticonazole, isoconazole, oxiconazole, Sertacon clindamycin, colistin, gentamycin, kanamycin, metronida azole, Sulconazole, and tioconazole; triazole antifungals Zole, or Vancomycin. As an individual, nonlimiting specific Such as fluconazole, itraconazole, isavuconazole, ravucon example, the mice can be provided with drinking water azole, posaconazole, Voriconazole, terconazole, and alba containing a mixture of the antibiotics kanamycin, colistin, conazole; thiazole antifungals such as abafungin; allylamine 25 gentamycin, metronidazole and Vancomycin at 40 mg/kg, antifungals such as terbinafine, naftifine, and butenafine; and 4.2 mg/kg, 3.5 mg/kg, 21.5 mg/kg, and 4.5 mg/kg (mg per echinocandin antifungals such as anidulafungin, caspo average mouse body weight), respectively, for 7 days. Alter fungin, and micafungin. Other compounds that have anti natively, mice can be administered ciprofloxacin at a dose of fungal properties include, but are not limited to polygodial, 15-20 mg/kg (mg per average mouse body weight), for 7 benzoic acid, ciclopiroX, tolnaftate, undecylenic acid, flu 30 days. If the mice are provided with an antibiotic, a wash out cytosine or 5-fluorocytosine, griseofulvin, and haloprogin. period of from one day to three days may be provided with In one embodiment, the bacterial compositions are no antibiotic treatment and no bacterial composition treat included in combination therapy with one or more corticos ment. teroids, mesalazine, mesalamine, Sulfasalazine, Sulfasala Subsequently, the test bacterial composition is adminis Zine derivatives, immunosuppressive drugs, cyclosporin A, 35 tered to the mice by oral gavage. The test bacterial compo mercaptopurine, azathiopurine, prednisone, methotrexate, sition may be administered in a Volume of 0.2 ml containing antihistamines, glucocorticoids, epinephrine, theophylline, 10 CFUs of each type of bacteria in the bacterial compo cromolyn Sodium, anti-leukotrienes, anti-cholinergic drugs sition. Dose-response may be assessed by using a range of for rhinitis, anti-cholinergic decongestants, mast-cell stabi 40 doses, including, but not limited to 10, 10, 10, 10, 10, lizers, monoclonal anti-IgE antibodies, vaccines, and com 107, 10, 10, and/or 10'. binations thereof. The mice can be evaluated using 16S sequencing, full A prebiotic is a selectively fermented ingredient that genome sequencing, whole genome shotgun sequencing allows specific changes, both in the composition and/or (WGS), or traditional microbiological techniques to deter activity in the gastrointestinal microbiota that confers ben 45 mine whether the test bacterial composition has populated efits upon host well-being and health. Prebiotics can include the gastrointestinal tract of the mice. For example only, one complex carbohydrates, amino acids, peptides, or other day, three days, one week, two weeks, and one month after essential nutritional components for the survival of the administration of the bacterial composition to the mice, 16S bacterial composition. Prebiotics include, but are not limited profiling is conducted to determine whether the test bacterial to, amino acids, biotin, fructooligosaccharide, galactooli 50 composition has populated the gastrointestinal tract of the gosaccharides, inulin, lactulose, mannan oligosaccharides, oligofructose-enriched inulin, oligofructose, oligodextrose, mice. Quantitative assessments, including qPCR and tradi tagatose, trans-galactooligosaccharide, and Xylooligosac tional microbiological techniques such as colony counting, charides. can additionally or alternatively be performed, at the same time intervals. Methods for Testing Bacterial Compositions for Populat 55 ing Effect Furthermore, the number of sequence counts that corre In Vivo Assay for Determining Whether a Bacterial spond exactly to those in the bacterial composition over time Composition Populates a Subjects Gastrointestinal Tract can be assessed to determine specifically which components In order to determine that the bacterial composition of the bacterial composition reside in the gastrointestinal populates the gastrointestinal tract of a subject, an animal 60 tract over a particular period of time. In one embodiment, the model. Such as a mouse model, can be used. The model can strains of the bacterial composition persist for a desired begin by evaluating the microbiota of the mice. Qualitative period of time. In another embodiment, the components of assessments can be accomplished using 16S profiling of the the bacterial composition persist for a desired period of time, microbial community in the feces of normal mice. It can also while also increasing the ability of other microbes (such as be accomplished by full genome sequencing, whole genome 65 those present in the environment, food, etc.) to populate the shotgun sequencing (WGS), or traditional microbiological gastrointestinal tract, further increasing overall diversity, as techniques. Quantitative assessments can be conducted discussed below. US 9,585,921 B2 39 40 Ability of Bacterial Compositions to Populate Different tiple bacterial constituents (collectively referred to in this Regions of the Gastrointestinal Tract section as bacterial composition). The present bacterial compositions can also be assessed pH Sensitivity Testing for their ability to populate different regions on the gastro If a bacterial composition will be administered other than intestinal tract. In one embodiment, a bacterial composition to the colon or rectum (i.e., for example, an oral route), can be chosen for its ability to populate one or more than one optionally testing for pH resistance enhances the selection of region of the gastrointestinal tract, including, but not limited bacterial compositions that will survive at the highest yield to the stomach, the Small intestine (duodenum, jejunum, and possible through the varying pH environments of the distinct ileum), the large intestine (the cecum, the colon (the ascend regions of the GI tract. Understanding how the bacterial 10 compositions react to the pH of the GI tract also assists in ing, transverse, descending, and sigmoid colon), and the formulation, so that the number of bacteria in a dosage form rectum). can be increased if beneficial and/or so that the composition An in vivo study can be conducted to determine which may be administered in an enteric-coated capsule or tablet or regions of the gastrointestinal tract a given bacterial com with a buffering or protective composition. As the pH of the position will populate. A mouse model similar to the one 15 stomach can drop to a pH of 1 to 2 after a high-protein meal described above can be conducted, except instead of assess for a short time before physiological mechanisms adjust it to ing the feces produced by the mice, particular regions of the a pH of 3 to 4 and often resides at a resting pH of 4 to 5, and gastrointestinal tract can be removed and studied individu as the pH of the small intestine can range from a pH of 6 to ally. For example, at least one particular region of the 7.4, bacterial compositions can be prepared that Survive gastrointestinal tract can be removed and a qualitative or these varying pH ranges (specifically wherein at least 1%, quantitative determination can be performed on the contents 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, of that region of the gastrointestinal tract. In another 80%, 90%, or as much as 100% of the bacteria can survive embodiment, the contents can optionally be removed and the gut transit times through various pH ranges). This can be qualitative or quantitative determination may be conducted tested by exposing the bacterial composition to varying pH on the tissue removed from the mouse. 25 ranges for the expected gut transit times through those pH qPCR ranges. Therefore, as a nonlimiting example only, 18-hour As one quantitative method for determining whether a cultures of bacterial compositions can be grown in standard bacterial composition populates the gastrointestinal tract, media, such as gut microbiota medium (“GMM, see Good quantitative PCR (qPCR) can be performed. Standard tech man et al., Extensive personal human gut microbiota culture niques can be followed to generate a standard curve for the 30 collections characterized and manipulated in gnotobiotic bacterial composition of interest, either for all of the com mice, PNAS 108(15):6252-6257 (2011)) or another animal ponents of the bacterial composition collectively, individu products-free medium, with the addition of pH adjusting ally, or in subsets (if applicable). Genomic DNA can be agents for a pH of 1 to 2 for 30 minutes, a pH of 3 to 4 for extracted from samples using commercially-available kits, 1 hour, a pH of 4 to 5 for 1 to 2 hours, and a pH of 6 to 7.4 such as the Mo Bio Powersoil(R)-htp 96 Well Soil DNA 35 for 2.5 to 3 hours. An alternative method for testing stability Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), the to acid is described in U.S. Pat. No. 4,839,281. Survival of Mo Bio Powersoil.R DNA Isolation Kit (Mo Bio Laborato bacteria may be determined by culturing the bacteria and ries, Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit counting colonies on appropriate selective or non-selective (QIAGEN, Valencia, Calif.) according to the manufacturers media. instructions. 40 Bile Acid Sensitivity Testing In some embodiments, qPCR can be conducted using Additionally, in Some embodiments, testing for bile-acid HotMasterMix (5PRIME, Gaithersburg, Md.) and primers resistance enhances the selection of bacterial compositions specific for the bacterial composition of interest, and may be that will survive exposures to bile acid during transit through conducted on a MicroAmp(R) Fast Optical 96-well Reaction the GI tract. Bile acids are secreted into the small intestine Plate with Barcode (0.1 mL) (Life Technologies, Grand 45 and can, like pH, affect the survival of bacterial composi Island, N.Y.) and performed on a BioRad C1000TM Thermal tions. This can be tested by exposing the bacterial compo Cycler equipped with a CFX96TM Real-Time System (Bio sitions to bile acids for the expected gut exposure time to Rad, Hercules, Calif.), with fluorescent readings of the FAM bile acids. For example, bile acid solutions can be prepared and ROX channels. The Cd value for each well on the FAM at desired concentrations using 0.05 mM Tris at pH 9 as the channel is determined by the CFX ManagerTM software 50 solvent. After the bile acid is dissolved, the pH of the version 2.1. The logo (cfu/ml) of each experimental sample solution may be adjusted to 7.2 with 10% HC1. Bacterial is calculated by inputting a given sample's Cd value into compositions can be cultured in 2.2 ml of a bile acid linear regression model generated from the standard curve composition mimicking the concentration and type of bile comparing the Cd values of the standard curve wells to the acids in the patient, 1.0 ml of 10% sterile-filtered feces known logo (cfu/ml) of those samples. The skilled artisan 55 media and 0.1 ml of an 18-hour culture of the given strain may employ alternative qPCR modes. of bacteria. Incubations may be conducted for from 2.5 to 3 Methods for Characterization of Bacterial Compositions hours or longer. An alternative method for testing stability to In certain embodiments, provided are methods for testing bile acid is described in U.S. Pat. No. 4,839,281. Survival of certain characteristics of bacterial compositions. For bacteria may be determined by culturing the bacteria and example, the sensitivity of bacterial compositions to certain 60 counting colonies on appropriate selective or non-selective environmental variables is determined, e.g., in order to media. select for particular desirable characteristics in a given Antibiotic Sensitivity Testing composition, formulation and/or use. For example, the con As a further optional sensitivity test, bacterial composi stituents in the bacterial composition can be tested for pH tions can be tested for sensitivity to antibiotics. In one resistance, bile acid resistance, and/or antibiotic sensitivity, 65 embodiment, bacterial compositions can be chosen so that either individually on a constituent-by-constituent basis or the bacterial constituents are sensitive to antibiotics Such collectively as a bacterial composition comprised of mul that if necessary they can be eliminated or substantially US 9,585,921 B2 41 42 reduced from the patient's gastrointestinal tract by at least the desired spore populations are retained on a filter while one antibiotic targeting the bacterial composition. the undesirable (non-spore) fecal components to pass Adherence to Gastrointestinal Cells through, and the spore fraction is then recovered from the The bacterial compositions may optionally be tested for filter medium. Alternatively, undesirable particulates and the ability to adhere to gastrointestinal cells. A method for eukaryotic cells may be retained on a filter while bacterial testing adherence to gastrointestinal cells is described in cells including spores pass through. In some embodiments U.S. Pat. No. 4,839,281. the spore fraction retained on the filter medium is subjected Methods for Purifying Spores to a diafiltration step, wherein the retained spores are con Solvent Treatments tacted with a wash liquid, typically a sterile Saline-contain To purify the bacterial spores, the fecal material is sub 10 jected to one or more solvent treatments. A solvent treatment ing solution or other diluent, in order to further reduce or is a miscible solvent treatment (either partially miscible or remove the undesirable fecal components. fully miscible) or an immiscible solvent treatment. Misci Thermal Treatments bility is the ability of two liquids to mix with each to form Provided herein is the thermal disruption of the fecal a homogeneous Solution. Water and ethanol, for example, 15 material. Generally, the fecal material is mixed in a saline are fully miscible Such that a mixture containing water and containing solution such as phosphate-buffered saline (PBS) ethanol in any ratio will show only one phase. Miscibility is and Subjected to a heated environment, such as a warm provided as a wit/wt %, or weight of one solvent in 100 g of room, incubator, water-bath, or the like, such that efficient final solution. If two solvents are fully miscible in all heat transfer occurs between the heated environment and the proportions, their miscibility is 100%. Provided as fully fecal material. Preferably the fecal material solution is miscible solutions with water are alcohols, e.g., methanol, mixed during the incubation to enhance thermal conductiv ethanol, isopropanol, butanol, etc. The alcohols can be ity and disrupt particulate aggregates. Thermal treatments provided already combined with water, e.g., a Solution can be modulated by the temperature of the environment containing 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, and/or the duration of the thermal treatment. For example, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% or 25 the fecal material or a liquid comprising the fecal material is greater than 95% Other solvents are only partially miscible, Subjected to a heated environment, e.g., a hot water bath of meaning that only some portion will dissolve in water. at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, Diethyl ether, for example, is partially miscible with water. 80, 85,90, 95, 100 or greater than 100 degrees Celsius, for Up to 7 grams of diethyl ether will dissolve in 93 g of water at least about 1, 5, 10, 15, 20, 30, 45 seconds, or 1, 2, 3, 4, to give a 7% (wit/wt %) solution. If more diethyl ether is 30 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 minutes, or 1, 2, added, a two phase solution will result with a distinct diethyl 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 hours. In certain ether layer above the water. Other miscible materials include embodiments the thermal treatment occurs at two different ethers, dimethoxyethane, or tetrahydrofuran. In contrast, an temperatures, such as 30 seconds in a 100 degree Celsius oil such as an alkane and water are immiscible and form two environment followed by 10 minutes in a 50 degree Celsius phases. Further, immiscible treatments are optionally com 35 environment. In preferred embodiments the temperature and bined with a detergent, either an ionic detergent or a non duration of the thermal treatment are sufficient to kill or ionic detergent. Exemplary detergents include Triton X-100, remove pathogenic materials while not Substantially dam Tween 20, Tween 80, Nonidet P40, a pluronic, or a polyol. aging or reducing the germination-competency of the Chromatography Treatments spores. To purify spore populations, the fecal materials are Sub 40 Irradiation Treatments jected to one or more chromatographic treatments, either Provided are methods of treating the fecal material or sequentially or in parallel. In a chromatographic treatment, separated contents of the fecal material with ionizing radia a solution containing the fecal material is contacted with a tion, typically gamma irradiation, ultraviolet irradiation or Solid medium containing a hydrophobic interaction chro electron beam irradiation provided at an energy level suffi matographic (HIC) medium or an affinity chromatographic 45 cient to kill pathogenic materials while not substantially medium. In an alternative embodiment, a Solid medium damaging the desired spore populations. For example, ultra capable of absorbing a residual habitat product present in the violet radiation at 254 nm provided at an energy level below fecal material is contacted with a solid medium that adsorbs about 22,000 microwatt seconds per cm will not generally a residual habitat product. In certain embodiments, the HIC destroy desired spores. medium contains Sepharose or a derivatized Sepharose Such 50 Centrifugation and Density Separation Treatments as butyl Sepharose, octyl Sepharose, phenyl Sepharose, or Provided are methods of separating desired spore popu butyl-s sepharose. In other embodiments, the affinity chro lations from the other components of the fecal material by matographic medium contains material derivatized with centrifugation. A solution containing the fecal material is mucin type I, II, III, IV, V, or VI, or oligosaccharides derived Subjected to one or more centrifugation treatments, e.g., at from or similar to those of mucins type I, II, III, IV, V, or VI. 55 about 1000xg, 2000xg, 3000xg, 4000xg, 5000xg, 6000xg, Alternatively, the affinity chromatographic medium contains 7000xg, 8000xg or greater than 8000xg. Differential cen material derivatized with antibodies that recognize spore trifugation separates desired spores from undesired non forming bacteria. spore material; at low forces the spores are retained in Mechanical Treatments solution, while at higher forces the spores are pelleted while Provided herein is the physical disruption of the fecal 60 Smaller impurities (e.g., virus particles, phage) are retained material, particularly by one or more mechanical treatment in Solution. For example, a first low force centrifugation Such as blending, mixing, shaking, Vortexing, impact pull pellets fibrous materials; a second, higher force centrifuga Verization, and Sonication. As provided herein, the mechani tion pellets undesired eukaryotic cells, and a third, still cal disrupting treatment Substantially disrupts a non-spore higher force centrifugation pellets the desired spores while material present in the fecal material and does not Substan 65 Small contaminants remain in Suspension. In some embodi tially disrupt a spore present in the fecal material. Mechani ments density or mobility gradients or cushions (e.g., step cal treatments optionally include filtration treatments, where cushions), such as Percoll, Ficoll, Nycodenz, Histodenz or US 9,585,921 B2 43 44 Sucrose gradients, are used to separate desired spore popu minerals include, without limitation: chloride, Sodium, cal lations from other materials in the fecal material. cium, iron, chromium, copper, iodine, Zinc, magnesium, Also provided herein are methods of producing spore manganese, molybdenum, phosphorus, potassium, and sele populations that combine two or more of the treatments nium. Suitable forms of any of the foregoing minerals described herein in order to synergistically purify the desired include soluble mineral salts, slightly soluble mineral salts, spores while killing or removing undesired materials and/or insoluble mineral salts, chelated minerals, mineral com activities from the spore population. It is generally desirable plexes, non-reactive minerals such as carbonyl minerals, and to retain the spore populations under non-germinating and reduced minerals, and combinations thereof. non-growth promoting conditions and media, in order to In certain embodiments, the composition comprises at minimize the growth of pathogenic bacteria present in the 10 spore populations and to minimize the germination of spores least one Supplemental vitamin. The at least one vitamin can into vegetative bacterial cells. be fat-soluble or water soluble vitamins. Suitable vitamins Pharmaceutical Compositions and Formulations of the include but are not limited to vitamin C, vitamin A, vitamin Invention E, vitamin B12, vitamin K, riboflavin, niacin, vitamin D, Formulations 15 Vitamin B6, folic acid, pyridoxine, thiamine, pantothenic Provided are formulations for administration to humans acid, and biotin. Suitable forms of any of the foregoing are and other subjects in need thereof. Generally the bacterial salts of the vitamin, derivatives of the vitamin, compounds compositions are combined with additional active and/or having the same or similar activity of the vitamin, and inactive materials in order to produce a final product, which metabolites of the vitamin. may be in single dosage unit or in a multi-dose format. In other embodiments, the composition comprises an In some embodiments, the composition comprises at least excipient. Non-limiting examples of Suitable excipients one carbohydrate. A “carbohydrate” refers to a sugar or include a buffering agent, a preservative, a stabilizer, a polymer of Sugars. The terms 'saccharide,” “polysaccha binder, a compaction agent, a lubricant, a dispersion ride,” “carbohydrate,” and "oligosaccharide' may be used enhancer, a disintegration agent, a flavoring agent, a Sweet interchangeably. Most carbohydrates are aldehydes or 25 ener, and a coloring agent. ketones with many hydroxyl groups, usually one on each In another embodiment, the excipient is a buffering agent. carbon atom of the molecule. Carbohydrates generally have Non-limiting examples of Suitable buffering agents include the molecular formula CHO. A carbohydrate can be a Sodium citrate, magnesium carbonate, magnesium bicarbon monosaccharide, a disaccharide, trisaccharide, oligosaccha ate, calcium carbonate, and calcium bicarbonate. ride, or polysaccharide. The most basic carbohydrate is a 30 In some embodiments, the excipient comprises a preser monosaccharide. Such as glucose. Sucrose, galactose, man vative. Non-limiting examples of suitable preservatives nose, ribose, arabinose, xylose, and fructose. Disaccharides include antioxidants, such as alpha-tocopherol and ascor are two joined monosaccharides. Exemplary disaccharides bate, and antimicrobials, such as parabens, chlorobutanol, include Sucrose, maltose, cellobiose, and lactose. Typically, and phenol. an oligosaccharide includes between three and six mono 35 In other embodiments, the composition comprises a saccharide units (e.g., raffinose, stachyose), and polysaccha binder as an excipient. Non-limiting examples of Suitable rides include six or more monosaccharide units. Exemplary binders include starches, pregelatinized starches, gelatin, polysaccharides include starch, glycogen, and cellulose. polyvinylpyrolidone, cellulose, methylcellulose, sodium Carbohydrates can contain modified saccharide units. Such carboxymethylcellulose, ethylcellulose, polyacrylamides, as 2'-deoxyribose wherein a hydroxyl group is removed, 40 polyvinyloxoazolidone, polyvinylalcohols, C-Cs fatty 2'-fluororibose wherein a hydroxyl group is replace with a acid alcohol, polyethylene glycol, polyols, saccharides, oli fluorine, or N-acetylglucosamine, a nitrogen-containing gosaccharides, and combinations thereof. form of glucose (e.g., 2'-fluororibose, deoxyribose, and In another embodiment, the composition comprises a hexose). Carbohydrates can exist in many different forms, lubricant as an excipient. Non-limiting examples of Suitable for example, conformers, cyclic forms, acyclic forms, Ste 45 lubricants include magnesium Stearate, calcium Stearate, reoisomers, tautomers, anomers, and isomers. Zinc Stearate, hydrogenated vegetable oils, sterotex, poly In some embodiments, the composition comprises at least oxyethylene monoStearate, talc, polyethyleneglycol, Sodium one lipid. As used herein, a “lipid includes fats, oils, benzoate, Sodium lauryl Sulfate, magnesium lauryl Sulfate, triglycerides, cholesterol, phospholipids, fatty acids in any and light mineral oil. form including free fatty acids. Fats, oils and fatty acids can 50 In other embodiments, the composition comprises a dis be saturated, unsaturated (cis or trans) or partially unsatu persion enhancer as an excipient. Non-limiting examples of rated (cis or trans). In some embodiments, the lipid com Suitable dispersants include starch, alginic acid, polyvi prises at least one fatty acid selected from lauric acid (12:0). nylpyrrolidones, guar gum, kaolin, bentonite, purified wood myristic acid (14:0), palmitic acid (16:0), palmitoleic acid cellulose, sodium starch glycolate, isoamorphous silicate, (16:1), margaric acid (17:0), heptadecenoic acid (17:1), 55 and microcrystalline cellulose as high HLB emulsifier sur stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2), factants. linolenic acid (18:3), octadecatetraenoic acid (18:4). In some embodiments, the composition comprises a dis arachidic acid (20:0), eicosenoic acid (20:1), eicosadienoic integrant as an excipient. In other embodiments, the disin acid (20:2), eicosatetraenoic acid (20:4), eicosapentaenoic tegrant is a non-effervescent disintegrant. Non-limiting acid (20:5) (EPA), docosanoic acid (22:0), docosenoic acid 60 examples of Suitable non-effervescent disintegrants include (22:1), docosapentaenoic acid (22:5), docosahexaenoic acid starches such as corn starch, potato starch, pregelatinized (22:6) (DHA), and tetracosanoic acid (24:0). In other and modified Starches thereof, Sweeteners, clays, such as embodiments, the composition comprises at least one modi bentonite, micro-crystalline cellulose, alginates, sodium fied lipid, for example, a lipid that has been modified by Starch glycolate, gums such as agar, guar, locust bean, cooking. 65 karaya, pectin, and tragacanth. In another embodiment, the In some embodiments, the composition comprises at least disintegrant is an effervescent disintegrant. Non-limiting one Supplemental mineral or mineral source. Examples of examples of Suitable effervescent disintegrants include US 9,585,921 B2 45 46 Sodium bicarbonate in combination with citric acid, and those formed from acrylic acid, methacrylic acid, methyl Sodium bicarbonate in combination with tartaric acid. acrylate, ammonio methylacrylate, ethyl acrylate, methyl In another embodiment, the excipient comprises a flavor methacrylate and/or ethyl methacrylate (e.g., those copoly ing agent. Flavoring agents can be chosen from Synthetic mers sold under the trade name “Eudragit); vinyl polymers flavor oils and flavoring aromatics; natural oils; extracts and copolymers such as polyvinyl pyrrolidone, polyvinyl from plants, leaves, flowers, and fruits; and combinations acetate, polyvinylacetate phthalate, vinylacetate crotonic thereof. In some embodiments the flavoring agent is selected acid copolymer, and ethylene-vinyl acetate copolymers; and from cinnamon oils; oil of wintergreen; peppermint oils; shellac (purified lac). In yet other embodiments, at least one clover oil; hay oil; anise oil; eucalyptus; Vanilla; citrus oil polymer functions as taste-masking agents. Such as lemon oil, orange oil, grape and grapefruit oil; and 10 Tablets, pills, and the like can be compressed, multiply fruit essences including apple, peach, pear, strawberry, rasp compressed, multiply layered, and/or coated. The coating berry, cherry, plum, pineapple, and apricot. can be single or multiple. In one embodiment, the coating In other embodiments, the excipient comprises a Sweet material comprises at least one of a saccharide, a polysac ener. Non-limiting examples of Suitable Sweeteners include charide, and glycoproteins extracted from at least one of a glucose (corn Syrup), dextrose, invert Sugar, fructose, and 15 plant, a fungus, and a microbe. Non-limiting examples mixtures thereof (when not used as a carrier); saccharin and include corn starch, wheat starch, potato starch, tapioca its various salts such as the Sodium salt; dipeptide Sweeten starch, cellulose, hemicellulose, dextrans, maltodextrin, erS Such as aspartame; dihydrochalcone compounds, glycyr cyclodextrins, inulins, pectin, mannans, gum arabic, locust rhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of bean gum, mesquite gum, guar gum, gum karaya, gum Sucrose such as Sucralose; and Sugar alcohols such as ghatti, tragacanth gum, funori, carrageenans, agar, alginates, Sorbitol, mannitol, Sylitol, and the like. Also contemplated chitosans, or gellan gum. In some embodiments the coating are hydrogenated Starch hydrolysates and the synthetic material comprises a protein. In another embodiment, the sweetener 3,6-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2, coating material comprises at least one of a fat and an oil. In 2-dioxide, particularly the potassium salt (acesulfame-K), other embodiments, the at least one of a fat and an oil is high and Sodium and calcium salts thereof. 25 temperature melting. In yet another embodiment, the at least In yet other embodiments, the composition comprises a one of a fat and an oil is hydrogenated or partially hydro coloring agent. Non-limiting examples of Suitable color genated. In one embodiment, the at least one of a fat and an agents include food, drug and cosmetic colors (FD&C), drug oil is derived from a plant. In other embodiments, the at least and cosmetic colors (D&C), and external drug and cosmetic one of a fat and an oil comprises at least one of glycerides, colors (Ext. D&C). The coloring agents can be used as dyes 30 free fatty acids, and fatty acid esters. In some embodiments, or their corresponding lakes. the coating material comprises at least one edible wax. The The weight fraction of the excipient or combination of edible wax can be derived from animals, insects, or plants. excipients in the formulation is usually about 99% or less, Non-limiting examples include beeswax, lanolin, bayberry such as about 95% or less, about 90% or less, about 85% or wax, carnauba wax, and rice bran wax. Tablets and pills can less, about 80% or less, about 75% or less, about 70% or 35 additionally be prepared with enteric coatings. less, about 65% or less, about 60% or less, about 55% or Alternatively, powders or granules embodying the bacte less, 50% or less, about 45% or less, about 40% or less, rial compositions disclosed herein can be incorporated into about 35% or less, about 30% or less, about 25% or less, a food product. In some embodiments, the food product is a about 20% or less, about 15% or less, about 10% or less, drink for oral administration. Non-limiting examples of a about 5% or less, about 2% or less, or about 1% or less of 40 suitable drink include fruit juice, a fruit drink, an artificially the total weight of the composition. flavored drink, an artificially sweetened drink, a carbonated The bacterial compositions disclosed herein can be for beverage, a sports drink, a liquid diary product, a shake, an mulated into a variety of forms and administered by a alcoholic beverage, a caffeinated beverage, infant formula number of different means. The compositions can be admin and so forth. Other suitable means for oral administration istered orally, rectally, or parenterally, in formulations con 45 include aqueous and nonaqueous solutions, emulsions, Sus taining conventionally acceptable carriers, adjuvants, and pensions and solutions and/or Suspensions reconstituted vehicles as desired. The term “parenteral as used herein from non-effervescent granules, containing at least one of includes subcutaneous, intravenous, intramuscular, or Suitable solvents, preservatives, emulsifying agents, Sus intrasternal injection and infusion techniques. In an exem pending agents, diluents, Sweeteners, coloring agents, and plary embodiment, the bacterial composition is administered 50 flavoring agents. orally. In some embodiments, the food product can be a solid Solid dosage forms for oral administration include cap foodstuff. Suitable examples of a solid foodstuff include Sules, tablets, caplets, pills, troches, lozenges, powders, and without limitation a food bar, a Snack bar, a cookie, a granules. A capsule typically comprises a core material brownie, a muffin, a cracker, an ice cream bar, a frozen comprising a bacterial composition and a shell wall that 55 yogurt bar, and the like. encapsulates the core material. In some embodiments, the In other embodiments, the compositions disclosed herein core material comprises at least one of a solid, a liquid, and are incorporated into a therapeutic food. In some embodi an emulsion. In other embodiments, the shell wall material ments, the therapeutic food is a ready-to-use food that comprises at least one of a soft gelatin, a hard gelatin, and optionally contains some or all essential macronutrients and a polymer. Suitable polymers include, but are not limited to: 60 micronutrients. In another embodiment, the compositions cellulosic polymers such as hydroxypropyl cellulose, disclosed herein are incorporated into a Supplementary food hydroxyethyl cellulose, hydroxypropyl methyl cellulose that is designed to be blended into an existing meal. In one (HPMC), methyl cellulose, ethyl cellulose, cellulose acetate, embodiment, the Supplemental food contains some or all cellulose acetate phthalate, cellulose acetate trimellitate, essential macronutrients and micronutrients. In another hydroxypropylmethyl cellulose phthalate, hydroxypropylm 65 embodiment, the bacterial compositions disclosed herein are ethyl cellulose succinate and carboxymethylcellulose blended with or added to an existing food to fortify the Sodium; acrylic acid polymers and copolymers, such as food’s protein nutrition. Examples include food staples US 9,585,921 B2 47 48 (grain, Salt, Sugar, cooking oil, margarine), beverages (cof then delivered on ice within 1-4 hours for processing. fee, tea, Soda, beer, liquor, sports drinks), Snacks, Sweets and Samples were mixed with a sterile disposable tool, and 2-4 other foods. g aliquots were weighed and placed into tubes and flash In one embodiment, the formulations are filled into gela frozen in a dry ice/ethanol bath. Aliquots are frozen at -80 tin capsules for oral administration. An example of an degrees Celsius until use. appropriate capsule is a 250 mg gelatin capsule containing Optionally, the fecal material was suspended in a solution, from 10 (up to 100 mg) of lyophilized powder (10 to 10' and/or fibrous and/or particulate materials were removed. A bacteria), 160 mg microcrystalline cellulose, 77.5 mg gela frozen aliquot containing a known weight of feces was tin, and 2.5 mg magnesium Stearate. In an alternative removed from storage at -80 degrees Celsius and allowed to embodiment, from 10 to 10° bacteria may be used, 10 to 10 thaw at room temperature. Sterile 1 xPBS was added to 107, 10° to 107, or 10 to 10', with attendant adjustments of create a 10% w/v Suspension, and vigorous Vortexing was the excipients if necessary. In an alternative embodiment, an performed to suspend the fecal material until the material enteric-coated capsule or tablet or with a buffering or appeared homogeneous. The material was then left to sit for protective composition can be used. 10 minutes at room temperature to sediment fibrous and 15 particulate matter. The Suspension above the sediment was EXAMPLES then carefully removed into a new tube and contains a purified spore population. Optionally, the Suspension was Below are examples of specific embodiments for carrying then centrifuged at a low speed, e.g., 1000xg, for 5 minutes out the present invention. The examples are offered for to pellet particulate matter including fibers. The pellet was illustrative purposes only, and are not intended to limit the discarded and the Supernatant, which contained vegetative scope of the present invention in any way. Efforts have been organisms and spores, was removed into a new tube. The made to ensure accuracy with respect to numbers used (e.g., supernatant was then centrifuged at 6000xg for 10 minutes amounts, temperatures, etc.), but some experimental error to pellet the vegetative organisms and spores. The pellet was and deviation should, of course, be allowed for. then resuspended in 1xEBS with vigorous vortexing until The practice of the present invention will employ, unless 25 the material appears homogenous. otherwise indicated, conventional methods of protein chem istry, biochemistry, recombinant DNA techniques and phar Example 2 macology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T. E. Creighton, Spore Purification from Alcohol Treatment of Fecal Proteins. Structures and Molecular Properties (W.H. Free 30 Material man and Company, 1993); A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., A 10% w/v suspension of human fecal material in PBS Molecular Cloning: A Laboratory Manual (2nd Edition, was mixed with absolute ethanol in a 1:1 ratio and vortexed 1989); Methods In Enzymology (S. Colowick and N. Kaplan to mix for 1 minute. The suspension was incubated at 37 eds. Academic Press, Inc.); Remington's Pharmaceutical 35 degrees Celsius for 1 hour. After incubation the Suspension Sciences, 18th Edition (Easton, Pa.; Mack Publishing Com was centrifuged at 13,000 rpm for 5 minutes to pellet spores. pany, 1990); Carey and Sundberg Advanced Organic Chem The Supernatant was discarded and the pellet was resus istry 3' Ed. (Plenum Press) Vols A and B (1992). pended in an equal volume of PBS. Glycerol was added to a final concentration of 15% and then the purified spore Example 1 40 fraction is stored at -80 degrees Celsius. Provision of Fecal Material Example 2A Fresh fecal samples were obtained from healthy human Generation of a Spore Preparation from Alcohol donors who have been screened for general good health and 45 Treatment of Fecal Material for the absence of infectious diseases, and meet inclusion and exclusion criteria, inclusion criteria include being in A 10% w/v suspension of human fecal material in PBS good general health, without significant medical history, was mixed with absolute ethanol in a 1:1 ratio and vortexed physical examination findings, or clinical laboratory abnor to mix for 1 minute. The suspension was incubated at 37 malities, regular bowel movements with stool appearance 50 degrees Celsius for 1 hour. After incubation the Suspension typically Type 2, 3, 4, 5 or 6 on the Bristol Stool Scale, and is centrifuged at 13,000 rpm for 5 minutes to concentrate having a BMI 18 kg/m and 25 kg/m. Exclusion criteria spores into a pellet containing a purified sprore-containing generally included significant chronic or acute medical preparation. The Supernatant was discarded and the pellet conditions including renal, hepatic, pulmonary, gastrointes resuspended in an equal volume of PBS. Glycerol was added tinal, cardiovascular, genitourinary, endocrine, immuno 55 to a final concentration of 15% and then the purified spore logic, metabolic, neurologic or hematological disease, a preparation was stored at -80 degrees Celsius. family history of inflammatory bowel disease including Crohn's disease and ulcerative colitis, Irritable bowel syn Example 3 drome, colon, stomach or other gastrointestinal malignan cies, or gastrointestinal polyposis syndromes, or recent use 60 Spore Purification from Thermal Treatment of of yogurt or commercial probiotic materials in which an Fecal Material organism(s) is a primary component. Samples were col lected directly using a commode specimen collection sys A 10% w/v suspension of human fecal material in PBS tem, which contains a plastic Support placed on the toilet was incubated in a water bath at 80 degrees Celsius for 30 seat and a collection container that rests on the Support. 65 minutes. Glycerol was added to a final concentration of 15% Feces were deposited into the container, and the lid was then and then the enriched spore containing material was stored placed on the container and sealed tightly. The sample was at -80 degrees Celsius. US 9,585,921 B2 49 50 Example 4 end of the diafiltration, the spores are concentrated approxi mately ten-fold to the original concentration. The purified Spore Purification from Alcohol Treatment and spores are collected from the reservoir and stored as pro Thermal Treatment of Fecal Material vided herein. A 10% w/v suspension of human feces in PBS was mixed Example 8 with absolute ethanol in a 1:1 ratio and vortexed to mix for 1 minute. The Suspension was incubated in a water bath Characterization of Purified Spore Populations under aerobic conditions at 37 degrees Celsius for 1 hour. After incubation the suspension was centrifuged at 13,000 10 Counts of viable spores are determined by performing 10 rpm for 5 minutes to pellet spores. The Supernatant was fold serial dilutions in PBS and plating to Brucella Blood discarded and the pellet was resuspended in equal volume Agar Petri plates or applicable solid media. Plates are PBS. The ethanol treated spore population was then incu incubated at 37 degrees Celsius for 2 days. Colonies are bated in a water bath at 80 degrees Celsius for 30 minutes. counted from a dilution plate with 50-400 colonies and used Glycerol was added to a final concentration of 15% and the 15 to back-calculate the number of viable spores in the popu purified spore fraction was stored at -80 C. lation. The ability to germinate into vegetative bacteria is also demonstrated. Visual counts are determined by phase Example 5 contrast microscopy. A spore preparation is either diluted in PBS or concentrated by centrifugation, and a 5 microliter Spore Purification from Detergent Treatment of aliquot is placed into a Petroff Hauser counting chamber for Fecal Material visualization at 400x magnification. Spores are counted within ten 0.05 mmx0.05 mm grids and an average spore A 10% w/v suspension of human feces in PBS is prepared count per grid is determined and used to calculate a spore to contain a final concentration of 0.5 to 2% Triton X-100. count per ml of preparation. Lipopolysaccharide (LPS) After shaking incubation for 30 minutes at 25 to 37 degrees 25 reduction in purified spore populations is measured using a Celsius, the sample is centrifuged at 1000 g for 5-10 minutes Limulus amebocyte lysate (LAL) assay Such as the com to pellet particulate matter and large cells. The bacterial mercially available ToxinSensorTM Chromogenic LAL spores are recovered in the Supernatant fraction, where the Endotoxin Assay Kit (GenScript, Piscataway, N.J.) or other purified spore population is optionally further treated. Such standard methods known to those skilled in the art. as in Example 4. Without being bound by theory, detergent 30 addition to the fecal mixture produces better spore popula Example 9 tions, at least in part by enhancing separation of the spores from particulates thereby resulting in higher yields of Determination of Bacterial Pathogens in Purified spores. Spore Populations 35 Example 6 Bacterial pathogens present in a purified spore population are determined by qPCR using specific oligonucleotide Spore Purification by Chromatographic Separation primers as follows. of Fecal Material Standard Curve Preparation. The standard curve is gen 40 erated from wells containing the pathogen of interest at a A spore-enriched population Such as obtained from known concentration or simultaneously quantified by selec Examples 1-5 above, is mixed with NaCl to a final concen tive spot plating. Serial dilutions of duplicate cultures are tration of 4M total salt and contacted with octyl Sepharose performed in sterile phosphate-buffered saline. Genomic 4 Fast Flow to bind the hydrophobic spore fraction. The DNA is then extracted from the standard curve samples resin is washed with 4MNaCl to remove less hydrophobic 45 along with the other samples. components, and the spores are eluted with distilled water, Genomic DNA Extraction. and the desired enriched spore fraction is collected via UV Genomic DNA may be extracted from 100 ul of fecal absorbance. samples, fecal-derived samples, or purified spore prepara tions using the Mo Bio Powersoil(R)-htp 96 Well Soil DNA Example 7 50 Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.) according to the manufacturers instructions with two excep Spore Purification by Filtration of Fecal Material tions: the beadbeating is performed for 2x4:40 minutes using a BioSpec Mini-Beadbeater-96 (BioSpec Products, A spore-enriched population Such as obtained from Bartlesville, Okla.) and the DNA is eluted in 50 ul of Examples 1-6 above is diluted 1:10 with PBS, and placed in 55 Solution C6. Alternatively the genomic DNA could be the reservoir vessel of a tangential flow microfiltration isolated using the Mo Bio Powersoil.R DNA Isolation Kit system. A 0.2 um pore size mixed cellulose ester hydrophilic (Mo Bio Laboratories, Carlsbad, Calif.), the Sigma-Aldrich tangential flow filter is connected to the reservoir such as by Extract-N-AmpTM Plant PCR Kit, the QIAamp DNA Stool a tubing loop. The diluted spore preparation is recirculated Mini Kit (QIAGEN, Valencia, Calif.) according to the through the loop by pumping, and the pressure gradient 60 manufacturers instructions. across the walls of the microfilter forces the supernatant qPCR Composition and Conditions. liquid through the filter pores. By appropriate selection of The qPCR reaction to detect C. difficile contains 1 x the filter pore size the desired bacterial spores are retained, HotMasterMix (5PRIME, Gaithersburg, Md.), 900 nM of while Smaller contaminants such as cellular debris, and other Wr-tcdB-F (AGCAGTTGAATATAGTGGTTTAGTTA contaminants in feces such as bacteriophage pass through 65 GAGTTG, (SEQ ID NO. 2040) IDT, Coralville, Iowa), 900 the filter. Fresh PBS buffer is added to the reservoir peri nM of Wr-tcdB-R (CATGCTTTTTTAGTTTCTGGATT odically to enhance the washout of the contaminants. At the GAA, (SEQ ID NO. 2041) IDT, Coralville, Iowa), 250 nM US 9,585,921 B2 51 52 of We-tcdB-P (6FAM-CATCCAGTCTCAATTGTATAT mass spec can also be used for species identification (as GTTTCTCCA-MGB (SEQ ID NO. 2042), Life Technolo reviewed in Anaerobe 22:123). gies, Grand Island, N.Y.), and PCR Water (Mo Bio Labo ratories, Carlsbad, Calif.) to 18 lul (Primers adapted from: Example 11 Wroblewski, D. et al. Rapid Molecular Characterization of 5 Clostridium difficile and Assessment of Populations of C. 16S Sequencing to Determine Operational difficile in Stool Specimens. Journal of Clinical Microbiol Taxonomic Unit (OTU) ogy 47:2142-2148 (2009)). This reaction mixture is ali quoted to wells of a MicroAmpR Fast Optical 96-well Method for Determining 16S Sequence Reaction Plate with Barcode (0.1 mL) (Life Technologies, 10 OTUs may be defined either by full 16S sequencing of the Grand Island, N.Y.). To this reaction mixture, 2 ul of rRNA gene, by sequencing of a specific hyperVariable extracted genomic DNA is added. The qPCR is performed region of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or on a BioRad C1000TM Thermal Cycler equipped with a V9), or by sequencing of any combination of hyperVariable CFX96TM Real-Time System (BioRad, Hercules, Calif.). 15 regions from this gene (e.g. V1-3 or V3-5). The bacterial The thermocycling conditions are 95° C. for 2 minutes 16S rDNA is approximately 1500 nucleotides in length and followed by 45 cycles of 95° C. for 3 seconds, 60° C. for 30 is used in reconstructing the evolutionary relationships and seconds, and fluorescent readings of the FAM and ROX sequence similarity of one bacterial isolate to another using channels. Other bacterial pathogens can be detected by using phylogenetic approaches. 16S sequences are used for phy primers and a probe specific for the pathogen of interest. logenetic reconstruction as they are in general highly con Data Analysis. served, but contain specific hyperVariable regions that har The Cd value for each well on the FAM channel is bor sufficient nucleotide diversity to differentiate genera and determined by the CFX ManagerTM Software Version 2.1. species of most microbes. The log 10 (cfu/ml) of each experimental sample is calcu Using well known techniques, in order to determine the lated by inputting a given sample's Cd value into linear 25 full 16S sequence or the sequence of any hypervariable regression model generated from the standard curve com region of the 16S sequence, genomic DNA is extracted from paring the Cd values of the standard curve wells to the a bacterial sample, the 16S rDNA (full region or specific known log 10 (cfu/ml) of those samples. hyperVariable regions) amplified using polymerase chain Viral pathogens present in a purified spore population are reaction (PCR), the PCR products cleaned, and nucleotide determined by qPCR as described herein and otherwise 30 sequences delineated to determine the genetic composition known in the art. of 16S gene or subdomain of the gene. If full 16S sequencing is performed, the sequencing method used may be, but is not Example 10 limited to, Sanger sequencing. If one or more hyperVariable regions are used. Such as the V4 region, the sequencing may Species Identification 35 be, but is not limited to being, performed using the Sanger method or using a next-generation sequencing method. Such The identity of the spore-forming species which grew up as an Illumina (sequencing by synthesis) method using from a complex fraction can be determined in multiple ways. barcoded primers allowing for multiplex reactions. First, individual colonies can be picked into liquid media in 40 In addition to the 16S rRNA gene, one may define an OTU a 96 well format, grown up and saved as 15% glycerol stocks by sequencing a selected set of genes that are known to be at -80 C. Aliquots of the cultures can be placed into cell lysis marker genes for a given species or taxonomic group of buffer and colony PCR methods can be used to amplify and OTUS. These genes may alternatively be assayed using a sequence the 16S rDNA gene (Example 2). Alternatively, PCR-based screening strategy. As example, various strains colonies may be streaked to purity in several passages on 45 of pathogenic Escherichia coli can be distinguished using solid media. Well separated colonies are streaked onto the DNAs from the genes that encode heat-labile (LTI, LTIIa, fresh plates of the same kind and incubated for 48-72 hours and LTIIb) and heat-stable (STI and STII) toxins, verotoxin at 37 C. The process is repeated multiple times in order to types 1, 2, and 2e (VT1, VT2, and VT2e, respectively), ensure purity. Pure cultures can be analyzed by phenotypic cytotoxic necrotizing factors (CNF 1 and CNF2), attaching or sequence-based methods, including 16S rDNA amplifi 50 and effacing mechanisms (eaeA), enteroaggregative mecha cation and sequencing as described in Examples 11 & 12. nisms (Eagg), and enteroinvasive mechanisms (Einv). The Sequence characterization of pure isolates or mixed com optimal genes to utilize for taxonomic assignment of OTUS munities e.g. plate scrapes and spore fractions can also by use of marker genes will be familiar to one with ordinary include whole genome shotgun sequencing. The latter is skill of the art of sequence based taxonomic identification. 55 Genomic DNA Extraction valuable to determine the presence of genes associated with Genomic DNA is extracted from pure microbial cultures sporulation, antibiotic resistance, pathogenicity, and viru using a hot alkaline lysis method. 1 ul of microbial culture lence. Colonies can also be scraped from plates en masse is added to 9 ul of Lysis Buffer (25 mM NaOH, 0.2 mM and sequenced using a massively parallel sequencing EDTA) and the mixture is incubated at 95° C. for 30 method as described in Examples 11 & 12 such that indi 60 minutes. Subsequently, the samples are cooled to 4°C. and vidual 16S signatures can be identified in a complex mix neutralized by the addition of 10 ul of Neutralization Buffer ture. Optionally, the sample can be sequenced prior to (40 mM Tris-HCl) and then diluted 10-fold in Elution Buffer germination (if appropriate DNA isolation procedures are (10 mM Tris-HCl). Alternatively, genomic DNA is extracted used to 1sye and release the DNA from spores) in order to from pure microbial cultures using commercially available compare the diversity of germinable species with the total 65 kits such as the Mo Bio Ultraclean R. Microbial DNA Iso number of species in a spore sample. As an alternative or lation Kit (Mo Bio Laboratories, Carlsbad, Calif.) or by complementary approach to 16S analysis, MALDI-TOF standard methods known to those skilled in the art. US 9,585,921 B2 53 54 Amplification of 16S Sequences for Downstream Sanger alville, Iowa), with PCR Water (Mo Bio Laboratories, Sequencing Carlsbad, Calif.) for the balance of the volume. These To amplify bacterial 16S rDNA (FIG. 1A), 2 ul of primers incorporate barcoded adapters for Illumina sequenc extracted gldNA is added to a 20 ul final volume PCR ing by Synthesis. Optionally, identical replicate, triplicate, or reaction. For full-length 16 sequencing the PCR reaction quadruplicate reactions may be performed. Alternatively also contains 1x HotMasterMix (5PRIME, Gaithersburg, other universal bacterial primers or thermostable poly Md.), 250 nM of 27f (AGRGTTTGATCMTGGCTCAG merases known to those skilled in the art are used to obtain (SEQ ID NO: 2033), IDT, Coralville, Iowa), and 250 nM of different amplification and sequencing error rates as well as 1492r (TACGGYTACCTTGTTAYGACTT (SEQ ID NO: results on alternative sequencing technologies. 2034), IDT, Coralville, Iowa), with PCR Water (Mo Bio 10 The PCR amplification is performed on commercially Laboratories, Carlsbad, Calif.) for the balance of the vol available thermocyclers such as a BioRad MyCyclerTM ume. Alternatively, other universal bacterial primers or Thermal Cycler (BioRad, Hercules, Calif.). The reactions thermostable polymerases known to those skilled in the art are run at 94° C. for 3 minutes followed by 25 cycles of 94° are used. For example primers are available to those skilled C. for 45 seconds, 50° C. for 1 minute, and 72° C. for 1 in the art for the sequencing of the “V1-V9 regions of the 15 minute 30 seconds, followed by a 10 minute extension at 72° 16S rRNA (FIG. 1A). These regions refer to the first through C. and a indefinite hold at 4° C. Following PCR, gel ninth hypervariable regions of the 16S rRNA gene that are electrophoresis of a portion of the reaction products is used used for genetic typing of bacterial samples. These regions to confirm successful amplification of a ~ 1.5 kb product. in bacteria are defined by nucleotides 69-99, 137-242, PCR cleanup is performed as specified in the previous 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243 example. 1294 and 1435-1465 respectively using numbering based on Sanger Sequencing of Target Amplicons from Pure the E. coli system of nomenclature. Brosius et al., Complete Homogeneous Samples nucleotide sequence of a 16S ribosomal RNA gene from To detect nucleic acids for each sample, two sequencing Escherichia coli, PNAS 75(10):4801-4805 (1978). In some reactions are performed to generate a forward and reverse embodiments, at least one of the V1,V2, V3, V4, V5, V6, 25 sequencing read. For full-length 16S sequencing primers 27f V7, V8, and V9 regions are used to characterize an OTU. In and 1492r are used. 40 ng of ExoSap-IT-cleaned PCR one embodiment, the V1,V2, and V3 regions are used to products are mixed with 25 pmol of sequencing primer and characterize an OTU. In another embodiment, the V3, V4, Mo Bio Molecular Biology Grade Water (Mo Bio Labora and V5 regions are used to characterize an OTU. In another tories, Carlsbad, Calif.) to 15 ul total volume. This reaction embodiment, the V4 region is used to characterize an OTU. 30 is Submitted to a commercial sequencing organization Such A person of ordinary skill in the art can identify the specific as Genewiz (South Plainfield, N.J.) for Sanger sequencing. hypervariable regions of a candidate 16S rRNA (in FIG. 1A) Massively Parallel Sequencing of Target Amplicons from by comparing the candidate sequence in question to the Heterogeneous Samples reference sequence (FIG. 1B) and identifying the hypervari DNA Quantification & Library Construction. able regions based on similarity to the reference hypervari 35 The cleaned PCR amplification products are quantified able regions. using the Quant-iTTM PicoGreen(R) dsDNA Assay Kit (Life The PCR is performed on commercially available ther Technologies, Grand Island, N.Y.) according to the manu mocyclers such as a BioRad MyCyclerTM Thermal Cycler facturers instructions. Following quantification, the bar (BioRad, Hercules, Calif.). The reactions are run at 94° C. coded cleaned PCR products are combined such that each for 2 minutes followed by 30 cycles of 94° C. for 30 40 distinct PCR product is at an equimolar ratio to create a seconds, 51° C. for 30 seconds, and 68° C. for 1 minute 30 prepared Illumina library. seconds, followed by a 7 minute extension at 72° C. and an Nucleic Acid Detection. indefinite hold at 4°C. Following PCR, gel electrophoresis The prepared library is sequenced on Illumina HiSeq or of a portion of the reaction products is used to confirm MiSeq sequencers (Illumina, San Diego, Calif.) with cluster successful amplification of a ~1.5 kb product. 45 generation, template hybridization, iso-thermal amplifica To remove nucleotides and oligonucleotides from the tion, linearization, blocking and denaturization and hybrid PCR products, 2 ul of HT ExoSap-IT (Affymetrix, Santa ization of the sequencing primers performed according to Clara, Calif.) is added to 5 ul of PCR product followed by the manufacturer's instructions. 16SV4SeqFw (TATGG a 15 minute incubation at 37° C. and then a 15 minute TAATTGTGTGCCAGCMGCCGCGGTAA (SEQ ID NO: inactivation at 80° C. 50 2038)), 16SV4SeqRev (AGTCAGTCAGCCGGAC Amplification of 16S Sequences for Downstream Char TACHVGGGTWTCTAAT (SEQ ID NO: 2037)), and acterization by Massively Parallel Sequencing Technologies 16SV4Index (ATTAGAWACCCBDGTAGTCCGGCT Amplification performed for downstream sequencing by GACTGACT (SEQID NO: 2039)) (IDT, Coralville, Iowa) short read technologies such as Illumina require amplifica are used for sequencing. Other sequencing technologies can tion using primers known to those skilled in the art that 55 be used such as but not limited to 454, Pacific Biosciences, additionally include a sequence-based barcoded tag. As Helicos, Ion Torrent, and Nanopore using protocols that are example, to amplify the 16S hyperVariable region V4 region standard to someone skilled in the art of genomic sequenc of bacterial 16S rDNA, 2 ul of extracted gldNA is added to 1ng. a 20 ul final volume PCR reaction. The PCR reaction also contains 1x HotMasterMix (5PRIME, Gaithersburg, Md.), 60 Example 12 200 nM of V4 515 f adapt (AATGATACGGCGACCAC CGAGATCTACACTATGGTAATTGTGTGCCAGC Sequence Read Annotation MGCC GCGGTAA (SEQ ID NO: 2035), IDT, Coralville, Iowa), and 200 nM of barcoded 806rbc (CAAGCA Primary Read Annotation GAAGACGGCATACGAGAT (SEQ ID NO: 2036) 12 65 Nucleic acid sequences are analyzed and annotations are bpGolayBarcode AGTCAGTCAGCCGGAC to define taxonomic assignments using sequence similarity TACHVGGGTWTCTAAT (SEQ ID NO: 2037), IDT, Cor and phylogenetic placement methods or a combination of US 9,585,921 B2 55 56 the two strategies. A similar approach can be used to from OTUs in a different clade based on 16S-V4 sequence annotate protein names, transcription factor names, and any data. OTUs falling within the same clade are evolutionarily other classification schema for nucleic acid sequences. closely related and may or may not be distinguishable from Sequence similarity based methods include those familiar to one another using 16S-V4 sequence data. The power of individuals skilled in the art including, but not limited to clade based analysis is that members of the same clade, due BLAST, BLASTX, tBLASTn, tBLASTX, RDP-classifier, to their evolutionary relatedness, are likely to play similar DNAclust, and various implementations of these algorithms functional roles in a microbial ecology Such as that found in Such as Qilime or Mothur. These methods rely on mapping a the human gut. Compositions Substituting one species with sequence read to a reference database and selecting the another from the same clade are likely to have conserved match with the best score and e-value. Common databases 10 ecological function and therefore are useful in the present include, but are not limited to the Human Microbiome invention. Project, NCBI non-redundant database, Greengenes, RDP. Notably, 16S sequences of isolates of a given OTU are and Silva. Phylogenetic methods can be used in combination phylogenetically placed within their respective clades, with sequence similarity methods to improve the calling sometimes in conflict with the microbiological-based accuracy of an annotation or taxonomic assignment. Here 15 assignment of species and genus that may have preceded tree topologies and nodal structure are used to refine the 16S-based assignment. Discrepancies between taxonomic resolution of the analysis. In this approach we analyze assignment based on microbiological characteristics versus nucleic acid sequences using one of numerous sequence genetic sequencing are known to exist from the literature. similarity approaches and leverage phylogenetic methods that are well known to those skilled in the art, including but Example 13 not limited to maximum likelihood phylogenetic reconstruc tion (see e.g. Liu K, Linder C R. and Warnow T. 2011. Germinating Spores RAXML and FastTree: Comparing Two Methods for Large Scale Maximum Likelihood Phylogeny Estimation. PLoS Germinating a spore fraction increases the number of ONE 6: e27731. McGuire G, Denham MC, and Balding D 25 viable spores that will grow on various media types. To J. 2001. Models of sequence evolution for DNA sequences germinate a population of spores, the sample is moved to the containing gaps. Mol. Biol. Evol 18: 481-490. Wróbel B. anaerobic chamber, resuspended in prereduced PBS, mixed 2008. Statistical measures of uncertainty for branches in and incubated for 1 hour at 37 C to allow for germination. phylogenetic trees inferred from molecular sequences by Germinants can include amino-acids (e.g., alanine, glycine), using model-based methods. J. Appl. Genet. 49: 49-67.) 30 Sugars (e.g., fructose), nucleosides (e.g., inosine), bile salts Sequence reads are placed into a reference phylogeny com (e.g., cholate and taurocholate), metal cations (e.g., Mg2+, prised of appropriate reference sequences. Annotations are Ca2+), fatty acids, and long-chain alkyl amines (e.g., made based on the placement of the read in the phylogenetic dodecylamine, Germination of bacterial spores with alkyl tree. The certainty or significance of the OTU annotation is primary amines' J. Bacteriology, 1961.). Mixtures of these defined based on the OTU’s sequence similarity to a refer 35 or more complex natural mixtures, such as rumen fluid or ence nucleic acid sequence and the proximity of the OTU Oxgall, can be used to induce germination. Oxgall is dehy sequence relative to one or more reference sequences in the drated bovine bile composed of fatty acids, bile acids, phylogeny. As an example, the specificity of a taxonomic inorganic salts, Sulfates, bile pigments, cholesterol, mucin, assignment is defined with confidence at the the level of lecithin, glycuronic acids, porphyrins, and urea. The germi Family, Genus, Species, or Strain with the confidence deter 40 nation can also be performed in a growth medium like mined based on the position of bootstrap Supported branches prereduced BHIS/oxgall germination medium, in which in the reference phylogenetic tree relative to the placement BHIS (Brain heart infusion powder (37 g/L), yeast extract (5 of the OTU sequence being interrogated. g/L), L-cysteine HCl (1 g/L)) provides peptides, amino Clade Assignments acids, inorganic ions and Sugars in the complex BHI and The ability of 16S-V4 OTU identification to assign an 45 yeast extract mixtures and Oxgall provides additional bile OTU as a specific species depends in part on the resolving acid germinants. power of the 16S-V4 region of the 16S gene for a particular In addition, pressure may be used to germinate spores. species or group of species. Both the density of available The selection of germinants can vary with the microbe being reference 16S sequences for different regions of the tree as sought. Different species require different germinants and well as the inherent variability in the 16S gene between 50 different isolates of the same species can require different different species will determine the definitiveness of a germinants for optimal germination. Finally, it is important taxonomic annotation. Given the topological nature of a to dilute the mixture prior to plating because some germi phylogenetic tree and the fact that tree represents hierarchi nants are inhibitory to growth of the vegetative-state micro cal relationships of OTUs to one another based on their organisms. For instance, it has been shown that alkyl amines sequence similarity and an underlying evolutionary model, 55 must be neutralized with anionic lipophiles in order to taxonomic annotations of a read can be rolled up to a higher promote optimal growth. Bile acids can also inhibit growth level using a clade-based assignment procedure (Table 1). of some organisms despite promoting their germination, and Using this approach, clades are defined based on the topol must be diluted away prior to plating for viable cells. ogy of a phylogenetic tree that is constructed from full For example, BHIS/oxgall solution is used as a germinant length 16S sequences using maximum likelihood or other 60 and contains 0.5xBHIS medium with 0.25% oxgall (dehy phylogenetic models familiar to individuals with ordinary drated bovine bile) where 1xEHIS medium contains the skill in the art of phylogenetics. Clades are constructed to following per L of solution: 6 g Brain Heart Infusion from ensure that all OTUs in a given clade are: (i) within a Solids, 7 g peptic digest of animal tissue, 14.5g of pancreatic specified number of bootstrap Supported nodes from one digest of casein, 5 g of yeast extract, 5 g sodium chloride, 2 another (generally, 1-5 bootstraps), and (ii) within a 5% 65 g glucose, 2.5 g disodium phosphate, and 1 g cysteine. genetic similarity. OTUs that are within the same clade can Additionally, Ca-DPA is a germinant and contains 40 mM be distinguished as genetically and phylogenetically distinct CaCl2, and 40 mM dipicolinic acid (DPA). Rumen fluid (Bar US 9,585,921 B2 57 58 Diamond, Inc.) is also a germinant. Simulated gastric fluid (0.4%), mannitol (0.4%), inulin (0.4%), or fructose (Ricca Chemical) is a germinant and is 0.2% (w/v) Sodium (0.4%), or a combination thereof. Chloride in 0.7% (v/v) Hydrochloric Acid. Mucin medium is Sweet GAM Gifu Anaerobic Medium (GAM, Nissui) a germinant and prepared by adding the following items to modified, Supplemented with glucose, cellobiose, malt 1 L of distilled sterile water: 0.4 g KHPO, 0.53 g ose, L-arabinose, fructose, fructooligosaccharides/inu NaHPO, 0.3 g NHCl, 0.3 g NaCl, 0.1 g MgClx6HO, lin, mannitol and sodium lactate) 0.11g CaCl2, 1 ml alkaline trace element Solution, 1 ml acid Brucella Blood Agar (BBA, Atlas, Handbook of Micro trace element solution, 1 ml vitamin solution, 0.5 mg resa biological Media, 4th ed, ASM Press, 2010) Zurin, 4 g NaHCO, 0.25 g NaSx9H2O. The trace element PEA sheep blood (Anaerobe Systems; 5% Sheep Blood and vitamin Solutions prepared as described previously 10 Agar with Phenylethyl Alcohol) (Stams et al., 1993). All compounds were autoclaved, except Egg Yolk Agar (EYA) (Atlas, Handbook of Microbiologi cal Media, 4th ed, ASM Press, 2010) the vitamins, which were filter-sterilized. The basal medium Sulfite polymyxin milk agar (Mevissen-Verhage et al., J. was supplemented with 0.7% (v/v) clarified, sterile rumen Clin. Microbiol. 25:285-289 (1987)) fluid and 0.25% (v/v) commercial hog gastric mucin (Type 15 Mucinagar (Derrien et al., IJSEM 54: 1469-1476 (2004)) III: Sigma), purified by ethanol precipitation as described Polygalacturonate agar (Jensen & Canale-Parola, Appl. previously (Miller & Hoskins, 1981). This medium is Environ. Microbiol. 52:880-997 (1986)) referred herein as mucin medium. M2GSC (Atlas, Handbook of Microbiological Media, 4th Fetal Bovine Serum (Gibco) can be used as a germinant ed, ASM Press, 2010) and contains 5% FBS heat inactivated, in Phosphate Buff M2 agar (Atlas, Handbook of Microbiological Media, 4th ered Saline (PBS, Fisher Scientific) containing 0.137M ed, ASM Press, 2010) supplemented with starch (1%), Sodium Chloride, 0.0027M Potassium Chloride, 0.01 19M mannitol (0.4%), lactate (1.5 g/L) or lactose (0.4%) Phosphate Buffer. Thioglycollate is a germinant as described Sweet B Brain Heart Infusion agar (Atlas, Handbook of previously (Kamiya et al Journal of Medical Microbiology Microbiological Media, 4th ed, ASM Press, 2010) 1989) and contains 0.25M (pH10) sodium thioglycollate. 25 supplemented with yeast extract (0.5%), hemin, cyste Dodecylamine Solution containing 1 mM dodecylamine in ine (0.1%), maltose (0.1%), cellobiose (0.1%), soluble PBS is a germinant. A Sugar Solution can be used as a starch (sigma, 1%), MOPS (50 mM, pH 7). germinant and contains 0.2% fructose, 0.2% glucose, and PY-Salicin (peptone-yeast extract agar Supplemented with 0.2% mannitol. Amino acid solution can also be used as a salicin) (Atlas, Handbook of Microbiological Media, germinant and contains 5 mMalanine, 1 mMarginine, 1 mM 30 4th ed, ASM Press, 2010). histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 Modified Brain Heart Infusion (M-BHI) sweet and mM aspartic acid, 1 mM phenylalanine. A germinant mix sour contains the following per L: 37.5 g Brain Heart ture referred to herein as Germix 3 can be a germinant and Infusion powder (Remel), 5 g yeast extract, 2.2 g meat contains 5 mMalanine, 1 mM arginine, 1 mM histidine, 1 extract, 1.2 g liver extract, 1 g cystein HCl, 0.3 g mM lysine, 1 mM proline, 1 mM asparagine, 1 mM aspartic 35 Sodium thioglycolate, 10 mg hemin, 2 g soluble starch, acid, 1 mM phenylalanine, 0.2% taurocholate, 0.2% fruc 2 g FOS/Inulin, 1 g cellobiose, 1 g L-arabinose, 1 g tose, 0.2% mannitol, 0.2% glucose, 1 mM inosine, 2.5 mM mannitol, 1 Na-lactate, 1 mL Tween 80, 0.6 g. Ca-DPA, and 5 mM KC1. BHIS medium+DPA is a germi MgSO4x7H2O, 0.6 g CaCl2, 6 g (NH4)2SO4, 3 g nant mixture and contains BHIS medium and 2 mM Ca KH2PO4, 0.5g K2HPO4, 33 mM Acetic acid, 9 mM DPA. Escherichia coli spent medium supernatant referred to 40 propionic acid, 1 mM Isobutyric acid, 1 mM isovaleric herein as EcSN is a germinant and is prepared by growing acid, 15 gagar, and after autoclaving add 50 mL of 8% E. coli MG 1655 in SweetB/Fos inulin medium anaerobically NaHCO, solution and 50 mL 1MMOPS-KOH (pH 7). for 48 hr, spinning down cells at 20,000 rcf for 20 minutes, Noack-Blaut Eubacterium agar (See Noack et al. J. Nutr. collecting the Supernatant and heating to 60 C for 40 min. (1998) 128:1385-1391) Finally, the solution is filter sterilized and used as a germi 45 BHIS aZ1/ge2—BHIS az/ge agar (Reeves et. al. Infect. nant solution. Immun. 80:3786-3794 (2012)) Brain Heart Infusion agar (Atlas, Handbook of Microbiological Media, 4th Example 14 ed, ASM Press, 2010) supplemented with yeast extract 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, Selection of Media for Growth 50 0.1% maltose, aztreonam 1 mg/L, gentamycin 2 mg/L BHIS CInMaz1/ge2-BHIS CInM Brain Heart Infusion It is important to select appropriate media to Support agar (Atlas, Handbook of Microbiological Media, 4th growth, including preferred carbon Sources. For example, ed, ASM Press, 2010) supplemented with yeast extract Some organisms prefer complex Sugars such as cellobiose 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, over simple Sugars. Examples of media used in the isolation 55 0.1% maltose, aztreonam 1 mg/L, gentamycin 2 mg/L of sporulating organisms include EYA, BHI, BHIS, and GAM (see below for complete names and references). Example 15 Multiple dilutions are plated out to ensure that some plates will have well isolated colonies on them for analysis, or The Purification and Isolation of a Spore Forming alternatively plates with dense colonies may scraped and 60 Fraction from Feces Suspended in PBS to generate a mixed diverse community. Plates are incubated anaerobically or aerobically at 37 C To purify and selectively isolate efficacious spores from for 48-72 or more hours, targeting anaerobic or aerobic fecal material a donation is first blended with Saline using a spore formers, respectively. homogenization device (e.g., laboratory blender) to produce Solid plate media include: 65 a 20% slurry (w/v). 100% ethanol is added for an inactiva Gifu Anaerobic Medium (GAM, Nissui) without dextrose tion treatment that lasts 10 seconds to 1 hour. The final Supplemented with fructooligosaccharides/inulin alcohol concentration can range from 30-90%, preferably US 9,585,921 B2 59 60 50-70%. High speed centrifugation (3200 rcf for 10 min) is gavage. On day 0 they were challenged by administration of performed to remove solvent and the pellet is retained and approximately 4.5 log 10 cfu of C. difficile (ATCC 43255) washed. Subsequently, once the washed pellet is resus via oral gavage. Optionally a positive control group received pended, a low speed centrifugation step (200 rcf for 4 min) Vancomycin from day -1 through day 3 in addition to the is performed to remove large particulate vegetative matter 5 antibiotic protocol and C. difficile challenge specified above. and the Supernatant containing the spores is retained. High Feces were collected from the cages for analysis of bacterial speed centrifugation (3200 rcf for 10 min) is performed on carriage, mortality was assessed every day from day 0 to day the Supernatant to concentrate the spore material. The pellet 6 and the weight and Subsequent weight change of the is then washed and resuspended to generate a 20% slurry. animal was assessed with weight loss being associated with This is the ethanol treated spore preparation. The concen- 10 trated slurry is then separated with a density based gradient C. difficile infection. Mortality and reduced weight loss of e.g. a CsCl gradient, Sucrose gradient or combination of the the test article compared to the vehicle were used to assess two generating a ethanol treated, gradient-purified spore the success of the test article. Additionally, a C. difficile preparation. For example, a CsCl gradient is performed by symptom scoring was performed each day from day -1 loading a 20% volume of spore suspension on top a 80% 15 through day 6. Clinical Score was based on a 0-4 scale by Volume of a stepwise CsCl gradient (w/v) containing the combining scores for Appearance (0-2 pts based on normal, steps of 64%, 50%, 40% CsCl (w/v) and centrifuging for 20 hunched, piloerection, or lethargic), and Clinical Signs (0-2 min at 3200 rcf. The spore fraction is then run on a sucrose points based on normal, wet tail, cold-to-the-touch, or iso step gradient with steps of 67%, 50%, 40%, and 30% (w/v). lation from other animals). When centrifuged in a swinging bucket rotor for 10 min at 20 In a naive control arm, animals were challenged with C. 3200 rcf. The spores run roughly in the 30% and 40% difficile. In the Vancomycin positive control arm animals sucrose fractions. The lower spore fraction (FIG. 2) is then were dosed with C. difficile and treated with Vancomycin removed and washed to produce a concentrated ethanol from day -1 through day 3. The negative control was treated, gradient-purified spore preparation. Taking advan gavaged with PBS alone and no bacteria. The test arms of tage of the refractive properties of spores observed by phase 25 the experiment tested 1x, 0.1x, 0.01 x dilutions derived from contrast microscopy (spores are bright and refractive while a single donor preparation of ethanol treated spores (e.g. see germinated spores and vegetative cells are dark) one can see example 6) or the heat treated feces prepared by treating a an enrichment of the spore fraction from a fecal bacterial cell 20% slurry for 30 min at 80 C. Dosing for CFU counts was suspension (FIG. 3, left) compared to an ethanol treated, determined from the final ethanol treated spores and dilu CsCl gradient purified, spore preparation (FIG. 3, center), 30 tions of total spores were administered at 1x, 0.1x, 0.01 x of and to an ethanol treated, CsCl gradient purified. Sucrose the spore mixture for the ethanol treated fraction and a 1 x gradient purified, spore preparation (FIG. 3, right). dose for the heat treated fraction. Furthermore, growth of spores after treatment with a Weight loss and mortality were assessed on day 3. The germinant can also be used to quantify a viable spore negative control, treated with C. difficile only, exhibits 20% population. Briefly, samples were incubated with a germi- 35 mortality and weight loss on Day 3, while the positive nant (Oxgall, 0.25% for up to 1 hour), diluted and plated control of 10% human fecal Suspension displays no mortal anaerobically on BBA (Brucella Blood Agar) or similar ity or weight loss on Day 3 (Table 3). EtOH-treated feces media (e.g. see Examples 4 and 5). Individual colonies were prevents mortality and weight loss at three dilutions, while picked and DNA isolated for full-length 16S sequencing to the heat-treated fraction was protective at the only dose identify the species composition (e.g. see examples 2 and 3). 40 tested. These data indicate that the spore fraction is effica Analysis revealed that 22 species were observed in total cious in preventing C. difficile infection in the mouse. (Table 2) with a vast majority present in both the material purified with the gradient and without the gradient, indicat Example 17 ing no or inconsequential shift in the ecology as a result of gradient purification. Spore yield calculations demonstrate 45 The Prophylactic and Relapse Prevention Hamster an efficient recovery of 38% of the spores from the initial Models fecal material as measured by germination and plating of spores on BBA or measuring DPA count in the sample. Previous studies with hamsters using toxigenic and non toxigenic strains of C. difficile demonstrated the utility of the Example 16 50 hamster model in examining relapse post antibiotic treat ment and the effects of prophylaxis treatments with cecal Bacterial Compositions Prevent C. difficile flora in C. difficile infection (Wilson et al. 1981, Wilson et Infection in a Mouse Model al. 1983, Borriello et al. 1985) and more broadly gastroin testinal infectious disease. To demonstrate prophylactic use To test the therapeutic potential of the bacterial compo- 55 of a test article to ameliorate C. difficile infection, the sitions a prophylactic mouse model of C. difficile infection following hamster model is used. In a prophylactic model, (model based on Chen, et al. A mouse model of Clostridium Clindamycin (10 mg/kg, s.c.) is given on day -5, the test difficile associated disease, Gastroenterology 135(6):1984 article or control is administered on day -3, and C. difficile 1992) was used. Two cages of five mice each were tested for challenge occurs on day 0. In the positive control arm, each arm of the experiment. All mice received an antibiotic 60 Vancomycin is then administered on day 1-5 (and vehicle cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), control is delivered on day -3). Feces are collected on day gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metron -5,-4, -1. 1, 3, 5, 7, 9 and fecal samples are assessed for idazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampi pathogen carriage and reduction by microbiological meth cillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their ods, 16S sequencing approaches or other methods utilized drinking water on days -14 through -5 and a dose of 10 65 by one skilled in the art. Mortality is assessed throughout the mg/kg. Clindamycin by oral gavage on day -3. On day -1, experiment through 21 days post C. difficile challenge. The they received either the test article or vehicle control via oral percentage Survival curves show that ethanol treated spores US 9,585,921 B2 61 62 and ethanol treated, gradient-purified spores better protect approximately 30 size 0 delayed release capsules (hypromel the hamsters compared to the Vancomycin control, and lose DRcaps, Capsugel, Inc.) at 0.65 mL Suspension each. vehicle control. The capsules were immediately capped and placed onto an See FIG. 4: Prophylaxis model with the ethanol treated aluminum freezing block held at -80° C. via dry ice to spore preparation and the ethanol treated, gradient-purified freeze. The frozen capsules were in turn over-capsulated spore preparation. with size 00 DRcaps to enhance capsule stability, labeled, In the relapse prevention model, hamsters are challenged and placed into <-65° C. storage immediately. The final with toxigenic C. difficile strains on day 0, and treated with product was stored at <-65°C. until the day and time of use. clindamycin by oral gavage on day 1, and Vancomycin Encapsulated product may be stored for indefinitely at dosing day 2-6. Test or control treatment was then admin 10 <-65° C. On the day of dosing capsules were warmed on istered on day 7, 8, and 9. The groups of hamsters for each wet ice for 1 to 2 hours to improve tolerability, and were then arm consist of 8 hamsters per group. Fecal material is dosed with water ad libitium. collected on day -1. 1, 3, 5, 7, 10 and 13 and hamster Patient 1 is a 45-year old woman with a history of C. mortality is assessed throughout. Survival curves are used to difficile infection and diarrhea for at least 1 year prior to assess the Success of the test article e.g. ethanol treated or 15 treatment. She has been previously treated with multiple ethanol treated, gradient purified spores versus the control courses of antibiotics followed each time by recurrence of C. treatment in preventing hamster death. The Survival curves difficile-associated diarrhea. demonstrate maximum efficacy for the ethanol treated, gra Patient 2 is an 81-year old female who has experienced dient-purified spores followed by the ethanol treated spores. recurrent C. difficile infection for 6 months prior to treatment Both treatments improved Survival percentage over Vanco despite adequate antibiotic therapy following each recur mycin treatment alone. CC. See FIG. 5: Relapse prevention model with ethanol 24 hours prior to starting oral treatment, CDAD antibiotic treated spores and ethanol treated, gradient purified spores therapy was discontinued. Each patient received a colon preparation procedure intended to reduce the competing Example 18 25 microbial burden in the gastrointestinal tract and to facilitate repopulation by the spore forming organisms in the inves Clinical Treatment of Recurrent C. difficile in tigational product. Patients On the morning of the first treatment day, the patients received a dose of delayed release capsules containing the To assess the efficacy of a test article (e.g., ethanol treated 30 investigational product with water ad libitum. Patients were spore preparations, see Example 15) to treat recurrent C. requested to avoid food for 1 hour thereafter. The next day, difficile in human patients, the following procedure was the patient returned to the clinic to receive an additional performed to take feces from a healthy donor, inactivate via dose. Patients were asked to avoid food for 4 hours prior to the ethanol treated spore preparation protocol described receiving their second dose and for 1 hour following dosing. below, and treat recurrent C. difficile in patients presenting 35 Both patients were followed closely for evidence of with this indication. Non-related donors were screened for relapse or adverse symptoms following treatment. Patients general health history for absence of chronic medical con were contacted by phone on Day 2, Day 4, and Weeks 1, 2 ditions (including inflammatory bowel disease; irritable and 4 and each was queried about her general status and the bowel syndrome; Celiac disease; or any history of gastro condition of her CDAD and related symptoms. Stool intestinal malignancy or polyposis), absence of risk factors 40 samples were collected at baseline and Weeks 1, 2, 4 and 8 for transmissible infections, antibiotic non-use in the previ post-treatment to assess changes in the gut microbiota via ous 6 months, and negative results in laboratory assays for 16S sequencing and spore count with methods explained blood-borne pathogens (HIV, HTLV. HCV, HBV. CMV, previously (e.g. see Examples 11 and 12). Through 4 weeks HAV and Treponema pallidum) and fecal bacterial patho post treatment, each patient has gradually improved with no gens (Salmonella, Shigella, Yersinia, Campylobacter, E. coli 45 evidence of C. difficile recurrence. O157), ova and parasites, and other infectious agents (Giar Six other patients with recurrent C. difficile-associated dia, Cryptosporidium Cyclospora, Isospora) prior to stool diarrhea were treated in a similar fashion, with no CDI donation. recurrence and no requirement for resumption of antibiotics Donor stool was frozen shortly after donation and (total of 8 patients). Additionally, there were no treatment sampled for testing. At the time of use, approximately 75 g 50 related serious adverse events. of donor stool was thawed and resuspended in 500 mL of non-bacteriostatic normal saline and mixed in a single use Example 19 glass or plastic blender. The resulting slurry was sequentially passed through sterile, disposable mesh screens that remove Treatment of Fecal Suspensions with Ethanol or particles of size 600, 300 and 200 microns. The slurry was 55 Heat Drastically Reduces Vegetative Cell Numbers then centrifuged briefly (200 rcf for 4 min) to separate and Results in an Enrichment of Spore Forming fibrous and particulate materials, and the Supernatant (con Species taining bacterial cells and spores) was transferred to a fresh container. Ethanol was added to a final concentration of 50% Treatment of a sample, preferably a human fecal sample, and the resulting ~1500 ml slurry was incubated at room 60 in a manner to inactivate or kill substantially all of the temperature for 1 hr with continuous mixing to inactivate vegetative forms of bacteria present in the sample results in vegetative bacterial cells. Midway through inactivation the selection and enrichment of the spore fraction. Methods for slurry was transferred to a new bottle to ensure complete inactivation can include heating, Sonication, detergent lysis, contact with the ethanol. The solid matter was pelleted in a enzymatic digestion (such as lysozyme and/or proteinase K). centrifuge and washed 3 times with normal saline to remove 65 ethanol or acid treatment, exposure to solvents (Tetrahydro residual ethanol. The final pellet was resuspended in 100% furan, 1-butanol, 2-butanol, 1.2 propanediol. 1.3 propane sterile, USP glycerol at a minimum volume, and filled into diol, butanoate, propanoate, chloroform, dimethyl ether and US 9,585,921 B2 63 64 a detergent like triton X-100, diethyl ether), or a combina >7000 colony isolates was performed to identify species in tion of these methods. To demonstrate the efficacy of ethanol a repeatable fashion (e.g., identified independently in mul induced inactivation of vegetative cells, a 10% fecal sus tiple preparations, see examples 1, 2, and 3) only isolated pension was mixed with absolute ethanol in a 1:1 ratio and from fecal suspensions treated with 50% ethanol or heat Vortexed to mix for 1 min. The Suspension was incubated at treatment and not from untreated fecal Suspensions (Table room temperature for 30 min, 1 h, 4 h or 24 h. After 5). These data demonstrate the ability to select for spore incubation the suspension was centrifuged at 13,000 rpm for forming species from fecal material, and identify organisms 5 minto pellet spores. The Supernatant is discarded and the pellet is resuspended in equal volume of PBS. Viable cells as spore formers not previously described as such in the were measured as described below. literature. In each case, organisms were picked as an isolated To demonstrate the efficacy of heat treatment on vegeta 10 colony, grown anaerobically, and then Subjected to full tive cell inactivation a 10-20% fecal suspension was incu length 16S sequencing in order to assign species identity. bated at 70 C, 80 C, 90 C or 100 C for 10 min or 1 h. To further identify spore formers, ethanol treated fecal After ethanol or heat treatment, remaining viable cells samples from donors A, B, C, D, E and F were plated to a were measured after 24h incubation on plates by determin variety of Solid media types, single colonies were picked and ing the bacterial titer on Brucella blood agar (BBA) as a 15 grown up in broth in a 96 well format (Table 6-11). The 16S function of treatment and time (See FIG. 6). Ethanol treat rRNA gene was then amplified by PCR and direct cycle ment for 1 h and 25 h have similar effects, reducing the sequencing was performed (See examples 11 and 12). The number of viable cells by approximately 4 logs, while ID is based on the forward read from direct cycle sequencing increasing temperature and time at high temperature leads to of the 16S rRNA gene. higher losses in viable cell number, with no colonies detect There is Surprising heterogeneity in the microbiome from able at 100° C. at either 10 min or 1 h. In this experiment no one individual to another (Clemente et al., 2012) and this has germinants were used. After several days of additional consequences for determining the potential efficacy of vari growth on plates, a number of colonies were picked from ous donors to generate useful spore compositions. The these treated samples and identified by 16S rDNA analysis method described below is useful for screening donors (e.g. see Examples 11 and 12). These included known spore 25 when, for instance, a particular quantity or diversity of spore forming Clostridium spp. as well as species not previously forming organisms is useful or desired for repopulating the reported to be spore formers including Ruminococcus bro microbiome following antibiotic treatment or treating a mii, and Anaerotruncus colihominis (Lawson, et al 2004), and a Eubacterium sp. (Table 4). See FIG. 6: Heat and particular disease or condition. Further, Such screening is ethanol treatments reduce cell viability useful when there is a need to screen donors for the purpose To demonstrate that vegetative cells are greatly reduced 30 of isolating microorganisms capable of spore formation, or by ethanol treatment, known non-spore forming bacteria are when a purified preparation of spore forming organisms is ethanol treated as described previously (e.g. see Example desired from a particular donor. 15) and viability was determined by plating on BBA in Total spore count is also a measure of potency of a anaerobic conditions (e.g. see Example 14). Fecal material particular donation or purified spore preparation and is vital from four independent donors was exposed to 60 C for 5 min 35 to determine the quantity of material required to achieve a and Subsequently plated on three types of selective media desired dose level. To understand the variability in total under either aerobic (+O) or anaerobic conditions (-O.) spore counts, donor samples were collected and processed as (BBA+aerobic, MacConkey lactose--aerobic, Bacteroides described in prior examples. Donor spore counts in CFU/g Bile esculin-i-anaerobic) to identify known nonsporeforming were then determined by growth on media plates at various Enterobacteria (Survivors on MacConkey agar) and Bacte 40 titrations to determine the spore content of the donation. roides fragilis group species (Survivors on Bacteroides Bile Furthermore, DPA assays were used to assess spore content Esculin plates). The detectable limit for these assays was (expressed as spore equivalents) as described in Example roughly 20 cfu/mL. Germinants were not used in this 21. As seen in FIG.9, there is as much as two logs difference experiment (FIG. 7). Both ethanol and heat inactivation in an individual donor over time and can be up to three logs greatly reduces the cell viability from fecal material to the 45 difference between donors. One possible reason for the limit of detection under using MacConkey lactose agar and difference in spore content measures is that nonviable spores BBE agar. The remaining cells identified on BBA media and non-germinable spores will not be observed by plating grown in anaerobic conditions comprise the non-germinant but will have measurable DPA content. Another possibility dependent spore forming species. See FIG. 7: Reduction in is the variability between species of DPA content in spores non-spore forming vegetative cells by treatment at 60°C. for 50 making some complex mixtures containing high DPA spores 5 min while other mixtures contain low DPA content spores. Additionally, the ethanol treatment was shown to rapidly Selecting donors with high spore counts is important in kill both aerobic and non-spore forming anaerobic colony determining productivity of isolating spores from fecal forming units in 10% fecal Suspensions as determined by donations by identifying preferred donors. plating on rich (BBA) media. The reduction of plated CFUs 55 See FIG. 9: Donation Spore concentrations from clinical decreases four orders of magnitude in seconds as shown in donors FIG 8. A fresh fecal sample from donor F was treated as See FIG. 8: Time course demonstrates ethanol reduces described in Example 15 to generate an ethanol treated spore both anaerobic and aerobic bacterial CFUs fraction, germinated with BHIS/Oxgall for 1 has a described 60 (e.g. see Example 13), then plated to a variety of media (e.g. Example 20 See example 14). Colonies were picked with a focus on picking several of each type of morphologically distinct Species Identified and Isolated as Spore Formers by colony on each plate to capture as much diversity as pos Ethanol Treatment sible. Colonies are counted on a plate of each media type 65 with well isolated colonies such that the number of colony To demonstrate that spore-forming species are enriched forming units per ml can be calculated (Table 12). Colonies by heat or ethanol treatment methods, a comparison of were picked into one of several liquid media and the 16S US 9,585,921 B2 65 66 rDNA sequences (e.g. see Examples 11 and 12) were deter TbCl) to the sample. Make serial dilutions of the autoclaved mined and analyzed as described above. The number of material and measure the fluorescence of each sample by unique OTUs for each media type is shown below with the exciting with 275 nm light and measuring the emission media with the most unique OTUs at the top (Table 12). wavelength of 543 mm for an integration time of 1.25 ms and Combinations of 3 to 5 of the top 5 media types capture a 0.1 ms delay. diversity, and some other can be chosen to target specific Purified spores are produced as described previously (e.g. species of interest. Colony forming units can be calculated see http://www.epa.gov/pesticides/methods/MB-28-00.pdf). for a given species using the 16S data, and could be used to Serial dilutions of purified spores from C. bifermentans, C. determine whether a Sufficient level of a given organism is sporogenes, and C. butyricum cultures were prepared and present. The spore complement from Donor F as determined 10 measured by plating on BBA media and incubating over in this experiment includes these 52 species as determined night at 37 C to determine CFU/ml. FIG. 10 shows the linear by 16S sequencing (Table 12). correspondence across different spore producing bacteria To screen human donors for the presence of a diversity of across several logs demonstrating the DPA assay as means spore forming bacteria and/or for specific spore-forming to assess spore content. bacteria, fecal samples were prepared using germinants and 15 See FIG.10: Linear range of DPA assay compared to CFU selective plating conditions and colonies were picked (e.g. counts/ml see Examples 13 and 14) and analyzed for 16S diversity as The discrepancy for complex spore populations between described previously (see Examples 11 and 12). An assess spore counts measured by germinable spore CFU and by ment of donor diversity could include the cfu/ml of ethanol DPA has important implications for determining the potency resistant cells on a given media type, or cfu/ml of a given of an ethanol treated spore preparation for clinical use. Table species using the 16S analysis of colonies picked from that AC shows spore content data from 3 different ethanol treated media to determine the level of spores of a given species of spore preparations used to Successfully treat 3 patients interest. This type of culture-based analysis could be suffering from recurrent C. difficile infection. The spore complemented by culture-independent methods such as content of each spore preparation is characterized using the qPCR with probes specific to species or genera of interest or 25 two described methods. metagenomic sequencing of spore preparations, or 16S profiling of spore preparations using IIlumina 16S variable TABLE AC region sequencing approaches (e.g. see Examples 11 and 12). Spore quantitation for ethanol treated spore preparations 30 using spore CFU (SCFU) assay and DPA assay Example 21 DPASEq/30 Preparation SCFU/30 capsules capsules Ratio SCFUDPA Quantification of Spore Concentrations. Using DPA Preparation 1 4.0 x 105 6.8 x 107 5.9 x 10-3 Assay Preparation 2 2.1 x 107 9.2 x 108 O.O23 35 Preparation 3 6.9 x 109 9.6 x 109 0.72 Methods to assess spore concentration in complex mix tures typically require the separation and selection of spores and Subsequent growth of individual species to determine What is immediately apparent is that spore content varies the colony forming units. The art does not teach how to greatly per 30 capsules. As measured by germinable SCFU, quantitatively germinate all the spores in a complex mixture 40 spore content varies by greater than 10,000-fold. As mea as there are many species for which appropriate germinants sured by DPA, spore content varies by greater than 100-fold. have not been identified. Furthermore, sporulation is thought In the absence of the DPA assay, it would be difficult to set to be a stochastic process as a result of evolutionary selec a minimum dose for administration to a patient. For tion, meaning that not all spores from a single species instance, without data from the DPA assay, one would germinate with same response to germinant concentration, 45 conclude that a minimum effective dose of spores is 4x10 time and other environmental conditions. Alternatively, a or less using the SCFU assay (e.g. Preparation 1, Table AC). key metabolite of bacterial spores, dipicolinic acid (DPA) If that SCFU dose was used to normalize dosing in a clinical has been developed to quantify spores particles in a sample setting, however, then the actual spore doses given to and avoid interference from fecal contaminants. The assay patients would be much lower for other ethanol treated spore utilizes the fact that DPA chelates Terbium 3+ to form a 50 preparations as measured as by the DPA assay (Table AD). luminescent complex (Fichte) et al. FEMS Microbiology Ecology, 2007; Kort et al. Applied and Environmental TABLE AD Microbiology, 2005; Shafaat and Ponce, Applied and Envi DPA doses in Table AC when normalized to 4 x 10 ronmental Microbiology, 2006; Yang and Ponce, Interna SCFU per dose tional Journal of Food Microbiology, 2009; Hindle and Hall, 55 Analyst, 1999). A time-resolved fluorescence assay detects SCFU3O DPA SEq/30 Fraction of Preparation 1 terbium luminescence in the presence of DPA giving a Preparation capsules capsules Dose quantitative measurement of DPA concentration in a solu Preparation 1 4.0 x 105 6.8 x 107 1.O tion. Preparation 2 4.0 x 105 1.8 x 107 O.26 Preparation 3 4.0 x 105 5.6 x 105 O.OO82 To perform the assay 1 mL of the spore standard to be 60 measured was transferred to a 2 mL microcentrifuge tube. The samples were centrifuged at 13000 RCF for 10 min and It becomes clear from the variability of SCFU and DPA the sample is washed in 1 mL sterile deionized H.O. Wash counts across various donations that using SCFU as the an additional time by repeating the centrifugation. Transfer measure of potency would lead to significant underdosing in the 1 mL Solution to hungate tubes and autoclave samples on 65 certain cases. For instance, setting a dose specification of a steam cycle for 30 min at 250 C. Add 100 uL of 30 uM 4x10 SCFU (the apparent effective dose from donor Prepa TbCl solution (400 mM sodium acetate, pH 5.0, 30 uM ration 1) for product Preparation 3 would lead to a potential US 9,585,921 B2 67 68 underdosing of more than 100-fold. This can be rectified and 14). 60 minutes resulted in the most CFU units across only by setting potency specifications based on the DPA all various combinations germinates and plate media tested. assay, which better reflects total spore counts in an ethanol treated spore preparation. The unexpected finding of this Example 23 work is that the DPA assay is uniquely suited to set potency 5 and determine dosing for an ethanol treated spore prepara Demonstrating Efficacy of Germinable and tion. Sporulatable Fractions of Ethanol Treated Spores Example 22 To define methods for characterization and purification, 10 and to improve (e.g., such as by modulating the diversity of Demonstration of Enhanced Growth with a the compositions) the active spore forming ecology derived Germinant from fecal donations, the ethanol treated spore population (as described in Example 15) was further fractionated. A To enhance the ethanol treated spores germination capa “germinable fraction' was derived by treating the ethanol bility and demonstrate spore viability, spores from three 15 treated spore preparation with oxgall, plating to various different donors were germinated by various treatments and Solid media, and then, after 2 days or 7 days of growth, plated on various media. Germination with BHIS/oxgall scraping all the bacterial growth from the plates into 5 mL (BHIS ox), Ca-DPA, rumen fluid (RF), simulated gastric of PBS per plate to generate a bacterial suspension. A fluid (SGF), mucin medium (Muc), fetal bovine serum “sporulatable fraction' was derived as above except that the (FBS), or thioglycolate (Thi) for 1 hour at 37 C in anaerobic 20 cells were allowed to grow on solid media for 2 days or 7 conditions was performed as described previously (e.g. see days (the time was extended to allow sporulation, as is Examples 13 and 14) with samples derived from two inde typical in sporulation protocols), and the resulting bacterial pendent donors (FIG. 11). The spore-germinant mixture was suspension was treated with 50% ethanol to derive a popu serially diluted and plated on different plate media including lation of “sporulatable spores, or species that were capable BBA, Sweet B, Sweet B+lysozyme (2 ug/ml), M2GSC and 25 of forming spores. In preparing these fractions, fecal mate M2GSC+lysozyme (2 ug/ml) as previously described (e.g. rial from donor A was used to generate an ethanol treated See Examples 13 and 14) to determine spore germination. spore preparation as previously described in Example 15; Colony forming units were tallied and titers were deter then spore content was determined by DPA assay and mined using standard techniques by one skilled in the art. As CFU/ml grown on various media (FIG. 15) as previously FIG. 11 shows, maximum colony forming units are derived 30 described (see Example 21). See FIG. 15: Spores initially from BHI-oxgall treatment. This germination treatment also present in ethanol treated spore preparation as measured by greatly increases the diversity as measured by the number of DPA and CFU/ml grown on specified media. OTUs identified when samples were submitted for 16S To characterize the fraction that is sporulatable, the 2 day sequencing (e.g. see Examples 11 and 12) compared to and 7 day “germinable' fractions were assessed for CFU and plating without a germination step (FIG. 12). As shown in 35 DPA content before and after ethanol treatment to generate FIG. 11: Different germinant treatments have variable a spore fraction. Bacterial Suspensions were treated with effects on CFU counts from donor A (upper left) and donor ethanol, germinated with Oxgall, and plated on the same B (lower right). The Y-Axes are spore CFU per ml. As types of media that the 'germinable fraction was grown on. shown in FIG. 12: Germinates greatly increase the diversity DPA data showed that growth on plates for 2 and 7 days of cultured spore forming OTUs. 40 produced the same amount of total spores. Colonies on the To test the effect of heat activation to promote germina several types of media were picked for 16S sequence tion, ethanol treated fecal samples were treated for 15 min analysis to identify the spore forming bacteria present (Table at room temperature, 55 C, 65 C, 75 C or 85 C from three 13). different donors and germinated subsequently with BHIS+ A 2 day “germinable' fraction and a 7 day “sporulatable Oxgall for 1 hr at 37 C then plated on BBA media (FIG. 13) 45 fraction were used as a treatment in the mouse prophylaxis as previously described (e.g. see Examples 13 and 14). assay as described (e.g. see Example 16). As a control, a Pretreatment at room temperature produced equal if not 10% fecal suspension prepared from a donor (Donor B) was more spores than the elevated temperatures in all three also administered to mice to model fecal microbiota trans donors. The temperature of germinating was also examined plant (FMT). Weight loss and mortality of the various test by incubating samples at room temperature or 37 C for 1 hr 50 and control arms of the study are plotted in FIG. 17 and in anaerobic conditions before plating on BBA. No differ Summarized in Table 15 which also contains the dosing ence in the number of CFUs was observed between the two information. The data clearly shows both the “germinable' conditions. Lysozyme addition to the plates (2 ug/ml) was and “sporulatable' fractions are efficacious in providing also tested on a single donor sample by the testing of various protection against C. difficile challenge in a prophylaxis activation temperature followed by an incubation in the 55 mouse model (e.g. see Example 16). The efficacy of these presence or absence of lysozyme. The addition of lysozyme fractions further demonstrates that the species present are had a small effect when plated on Sweet B or M2GSC media responsible for the efficacy of the spore fraction, as the but less so than treatment with BHIS oxgall without fractionation further dilutes any potential contaminant from lysozyme for 1 hr (FIG. 14). the original spore preparation. As shown in FIG. 13: Heat Activation as a germination 60 See FIG. 16: Titer of “germinable' fraction after 2 days treatment with BHIS+ oxgall. As shown in FIG. 14: Effect (left) and Sporulatable fraction (right) by DPA and CFU/ml. of lysozyme slightly enhances germination. The “sporulatable' fraction made following 7 days of Germination time was also tested by treating a 10% growth was measured as previously described using germi Suspension of a single donor ethanol treated feces (e.g. see nation and growth assays or DPA content as previously Example 15) incubated in either BHIS, taurocholate, oxgall, 65 described (see Example 21). or germix for 0, 15, 30, or 60 minutes and subsequently The species present in the “germinable' and “sporulat plated on BHIS, EYA, or BBA media (e.g. see Examples 13 able' fractions were determined by full length 16S sequenc US 9,585,921 B2 69 70 ing of colony picks and by 16S NGS sequencing of the initial spore fraction may be conducted under controlled fractions themselves. The colony pick data indicate conditions (cGMPs) and validated to remove non-spore Clostridium species are very abundant in both fractions, organisms to a high degree. The germination may be con while the NGS data reveal other spore forming organisms ducted using reagents that are more standardizable than that are typically found in ethanol treated spore preparations natural products such as oxgall, e.g.—Synthetic mixtures of are present. bile salts. Amplification may be done using media with Results are shown in the following: See Table 13. Species components that are preferred for clinical safety, e.g.— identified as “germinable' and “sporulatable” by colony Sourced from qualified animals, or non-animal sourced. picking approach. See Table YYY. Species identified as Conditions may be arranged so as to ensure consistent “germinable” using 16S-V4 NGS approach. See Table ZZZ. 10 compositions of sporulated organisms, are less prone to Species identified as “sporulatable” using 16s-V4 NGS contamination, and are more amenable to scale-up, e.g.— approach. See FIG. 17: Mouse prophylaxis model demon closed stirred fermenters with feedback control loops. Spo strates “germinable' and “sporulatable' preparations are rulated organisms from the process may be isolated using protective against C. difficile challenge. Each plot tracks the procedures that alone or combined stringently eliminate change in the individual mouse's weight relative to day -1 15 non-spores and other process residuals, e.g.—solvent treat over the course of the experiment. The number of deaths ment, aqueous two-phase extraction, and/or 60° C. long over the course of the experiment is indicated at the top of time heat treatment. Preservation may involve addition of the chart and demonstrated by a line termination prior to day excipients and/or adjustment of conditions to enable con 6. The top panels (from left to right) are the vehicle control version to a preferred dosage form amenable to long-term arm, the fecal Suspension arm, and the untreated naive shelf storage, e.g.—addition of trehalose, followed by control arm, while the bottom panels are the ethanol treated, lyophilization or spray drying, further blending of the pow gradient purified spore preparation; the ethanol treated, der with microcrystalline cellulose, and encapsulation in a gradient purified, “germinable' preparation, and ethanol gelatin capsule to form an orally dosable product. treated, gradient purified, “sporulatable' preparation. See Table 15: Results of the prophylaxis mouse model and 25 Example 25 dosing information Engraftment, Augmentation and Reduction of Example 24 Pathogen Carriage in Patients Treated with Spore Compositions Donor Pooling Efficacy in Prophylaxis Mouse 30 Complementary genomic and microbiological methods To test the efficacy and dosing of pooled donor samples were used to characterize the composition of the microbiota the C. difficile prophylaxis mouse model (e.g., see Example from Patient 1, 2, 3, 4, and 5, 6, 7, 8, 9, and 10 at 16) is used with donations mixed from two or more donor pretreatment (pretreatment) and on up to 4 weeks post samples as previously described. Weight loss and mortality 35 treatment. with the mixed spore product versus the spore product To determine the OTUs that engraft from treatment with derived from a single donor at the various dosing is deter an ethanol treated spore preparation in the patients and how mine whether the two treatment schemes are equivalent or their microbiome changed in response, the microbiome was one is significantly better than the other. characterized by 16S-V4 sequencing prior to treatment Dosing of the spore product derived from a single or 40 (pretreatment) with an ethanol treated spore preparation and multiple donors is between 1 E4 to 1E10 CFU/ml. The spore up to 25 days after receiving treatment. As example, the product is mixed from product derived from any number of treatment of patient 1 with an ethanol treated spore prepa donors ranging from 1-10 at either equal concentrations or ration led to the engraftment of OTUs from the spore different known concentrations. treatment and augmentation in the microbiome of the patient Additionally, this method can be used to expand the spore 45 (FIG. 18 and FIG. 19). By day 25 following treatment, the fraction for production purposes. For production purposes, total microbial carriage was dominated by species of the an enriched spore fraction (e.g.—a purified and EtOH following taxonomic groups: Bacteroides, Sutterella, Rumi treated fraction of a fecal sample) is preserved in multiple nococcus, Blautia, Eubacterium, Gemmiger/Faecalibacte aliquots to form a bank of viable spore-forming organisms. rium, and the non-sporeforming Lactobacillus (see Table 16 An aliquot of this bank is then recovered by germinant 50 and Table 2 for specific OTUs). The first two genera treatment followed by cultivation in a medium, and under represent OTUs that do not form spores while the latter conditions, that are broadly permissive for spore-forming taxonomic groups represent OTUs that are believed to form organisms and encourage sporulation. After a suitable spores. amplification time, the amplified bacteria including spores Patient treatment with the ethanol treated spore prepara are harvested, and this preparation is solvent or heat-treated 55 tion leads to the establishment of a microbial ecology that to isolate the spore fraction. This fraction may be further has greater diversity than prior to treatment (FIG. 18). purified away from non-spore forms and culture constitu Genomic-based microbiome characterization confirmed ents. The process of amplification, spore isolation and engraftment of a range of OTUs that were absent in the optional purification may be repeated at increasing scales to patient pretreatment (Table 16). These OTUs comprised generate large quantities for further use. When enough 60 both bacterial species that were capable and not capable of germinable/sporulatable material has been accumulated by forming spores, and OTUS that represent multiple phyloge amplification, it may be further purified, concentrated or netic clades. Organisms absent in Patient 1 pre-treatment diluted, and/or preserved to a state suitable for further use, either engraft directly from the ethanol treated spore fraction e.g.—clinical dosing. or are augmented by the creation of a gut environment Features may be incorporated into the above process to 65 favoring a healthy, diverse microbiota. Furthermore, Bacte make it suitable for further utility, especially for product roides fragilis group species were increased by 4 and 6 logs applications such as clinical use. The production of the in patients 1 and 2 (FIG. 20). US 9,585,921 B2 71 72 OTUS that comprise an augmented ecology are not pres Using this approach, clades are defined based on the topol ent in the patient prior to treatment and/or exist at extremely ogy of a phylogenetic tree that is constructed from full low frequencies Such that they do not comprise a significant length 16S sequences using maximum likelihood or other fraction of the total microbial carriage and are not detectable phylogenetic models familiar to individuals with ordinary by genomic and/or microbiological assay methods. OTUS skill in the art of phylogenetics. Clades are constructed to that are members of the engrafting and augmented ecologies ensure that all OTUs in a given clade are: (i) within a were identified by characterizing the OTUs that increase in specified number of bootstrap Supported nodes from one their relative abundance post treatment and that respectively another (generally, 1-5 bootstraps), and (ii) within a 5% are: (i) present in the ethanol treated spore preparation and genetic similarity. OTUs that are within the same clade can absent in the patient pretreatment, or (ii) absent in the 10 be distinguished as genetically and phylogenetically distinct ethanol treated spore preparation, but increase in their rela tive abundance through time post treatment with the prepa from OTUs in a different clade based on 16S-V4 sequence ration due to the formation of favorable growth conditions data. OTUs falling within the same clade are evolutionarily by the treatment. Notably, the latter OTUs can grow from closely related and may or may not be distinguishable from low frequency reservoirs in the patient, or be introduced 15 one another using 16S-V4 sequence data. The power of from exogenous sources such as diet. OTUS that comprise a clade based analysis is that members of the same clade, due “core” augmented or engrafted ecology can be defined by to their evolutionary relatedness, play similar functional the percentage of total patients in which they are observed roles in a microbial ecology Such as that found in the human to engraft and/or augment; the greater this percentage the gut. Compositions Substituting one species with another more likely they are to be part of a core ecology responsible from the same clade are likely to have conserved ecological for catalyzing a shift away from a dysbiotic ecology. The function and therefore are useful in the present invention. dominant OTUS in an ecology can be identified using Stool samples were aliquoted and resuspended 10x vol/wt several methods including but not limited to defining the in either 100% ethanol (for genomic characterization) or OTUs that have the greatest relative abundance in either the PBS containing 15% glycerol (for isolation of microbes) and augmented or engrafted ecologies and defining a total rela 25 then stored at -80°C. until needed for use. For genomic 16S tive abundance threshold. As example, the dominant OTUs sequence analysis colonies picked from plate isolates had in the augmented ecology of Patient-1 were identified by their full-length 16S sequence characterized as described in defining the OTUs with the greatest relative abundance, Examples 11 and 12, and primary stool samples were which together comprise 60% of the microbial carriage in prepared targeting the 16S-V4 region using the method for this patient's augmented ecology. 30 heterogeneous samples in Example 10. See FIG. 18: Microbial diversity measured in the ethanol Notably, 16S sequences of isolates of a given OTU are treated spore treatment sample and patient pre- and post phylogenetically placed within their respective clades treatment samples. Total microbial diversity is defined using despite that the actual taxonomic assignment of species and the Chao 1 Alpha-Diversity Index and is measured at differ genus may suggest they are taxonomically distinct from ent genomic sampling depths to confirm adequate sequence 35 other members of the clades in which they fall. Discrepan coverage to assay the microbiome in the target samples. The cies between taxonomic names given to an OTU is based on patient pretreatment (purple) harbored a microbiome that microbiological characteristics versus genetic sequencing was significantly reduced in total diversity as compared to are known to exist from the literature. The OTUs footnoted the ethanol treated spore treatment (red) and patient post in this table are known to be discrepant between the different treatment at days 5 (blue), 14 (orange), and 25 (green). 40 methods for assigning a taxonomic name. See FIG. 19: Patient microbial ecology is shifted by Engraftment of OTUs from the ethanol treated spore treatment with an ethanol treated spore treatment from a preparation treatment into the patient as well as the resulting dysbiotic state to a state of health. Principle Coordinates augmentation of the resident microbiome led to a significant Analysis based on the total diversity and structure of the decrease in and elimination of the carriage of pathogenic microbiome (Bray-Curtis Beta-Diversity) of the patient pre 45 species other than C. difficile in the patient. 16S-V4 sequenc and post-treatment delineates that the engraftment of OTUs ing of primary stool samples demonstrated that at pretreat from the spore treatment and the augmentation of the patient ment, 20% of reads were from the genus Klebsiella and an microbial ecology leads to a microbial ecology that is additional 19% were assigned to the genus Fusobacterium. distinct from both the pretreatment microbiome and the These striking data are evidence of a profoundly dysbiotic ecology of the ethanol treated spore treatment (Table 16). 50 microbiota associated with recurrent C. difficile infection See FIG. 20: Augmentation of Bacteroides species in and chronic antibiotic use. In healthy individuals, Klebsiella patients. Comparing the number of Bacteroides fragilis is a resident of the human microbiome in only about 2% of groups species per cfu/g of feces pre-treatment and in week subjects based on an analysis of HMP database (www.hmp 4 post treatment reveals an increase of 4 logs or greater. The dacc.org), and the mean relative abundance of Klebsiella is ability of 16S-V4 OTU identification to assign an OTU as a 55 only about 0.09% in the stool of these people. It’s surprising specific species depends in part on the resolution of the presence at 20% relative abundance in Patient 1 before 16S-V4 region of the 16S gene for a particular species or treatment is an indicator of a proinflammatory gut environ group of species. Both the density of available reference 16S ment enabling a “pathobiont' to overgrow and outcompete sequences for different regions of the tree as well as the the commensal organisms normally found in the gut. Simi inherent variability in the 16S gene between different spe 60 larly, the dramatic overgrowth of Fusobacterium indicates a cies will determine the definitiveness of a taxonomic anno profoundly dysbiotic gut microbiota. One species of Fuso tation to a given sequence read. Given the topological nature bacterium, F. nucleatum (an OTU phylogenetically indis of a phylogenetic tree and that the tree represents hierarchi tinguishable from Fusobacterium sp. 3 133 based on 16S cal relationships of OTUs to one another based on their V4), has been termed “an emerging gut pathogen' based on sequence similarity and an underlying evolutionary model, 65 its association with IBD, Crohn's disease, and colorectal taxonomic annotations of a read can be rolled up to a higher cancer in humans and its demonstrated causative role in the level using a clade-based assignment procedure (Table 1). development of colorectal cancer in animal models Allen US 9,585,921 B2 73 74 Vercoe, Gut Microbes (2011) 2:294-8. Importantly, neither 10 cfu/ml). Thus, administration of the ethanol treated spore Klebsiella nor Fusobacterium was detected in the 16S-V4 population to Patient 1 resulted not only in the engraftment reads by Day 25 (Table 18). of spore-forming species, but also the restoration of high To further characterize the colonization of the gut by levels of non-spore forming species commonly found in Klebsiella and other Enterobacteriaceae and to speciate healthy individuals through the creation of a niche that these organisms, pretreatment and Day 25 fecal samples allowed for the repopulation of Bacteroides species. These stored at -80C as PBS-glycerol suspensions were plated on organisms were most likely either present at extremely low a variety of selective media including MacConkey lactose abundance in the GI tract of Patient 1, or present in a media (selective for gram negative enterobacteria) and Sim reservoir in the GI tract from which they could rebound to mons Citrate Inositol media (selective for Klebsiella spp) 10 Van Cregten et al. J. Clin. Microbiol. (1984) 20:936-411. high titer. Those species may also be reinoculated via oral Enterobacteria identified in the patient samples included K. uptake from food following treatment. We term this healthy pneumoniae, Klebsiella sp. Co. 9935 and E. coli. Strikingly, repopulation of the gut with OTUs that are not present in the each Klebsiella species was reduced by 2-4 logs whereas E. ethanol treated spore population “Augmentation.” Augmen coli, a normal commensal organism present in a healthy 15 tation is an important phenomenon in that it shows the microbiota, was reduced by less than 1 log (Table 19). This ability to use an ethanol treated spore ecology to restore a decrease in Klebsiella spp. carriage is consistent across healthy microbiota by seeding a diverse array or commensal multiple patients (Table 19). Four separate patients were organisms beyond the actual component organisms in the evaluated for the presence of Klebsiella spp. pre treatment ethanol treated spore population itself: specifically the spore and 4 weeks post treatment. Klebsiella spp. were detected by treatment itself and the engraftment of OTUs from the spore growth on selective Simmons Citrate Inositol media as composition create a niche that enables the outgrowth of previously described. Serial dilution and plating, followed OTUs required to shift a dysbiotic microbiome to a micro by determining cfu/mL titers of morphologically distinct bial ecology that is associated with health. The diversity of species and 16S full length sequence identification of rep Bacteroides species and their approximate relative abun resentatives of those distinct morphological classes, allowed 25 dance in the gut of Patient 1 is shown in Table 21, com calculation of titers of specific species. prising at least 8 different species. The genus Bacteroides is an important member of the See FIG. 21: Species Engrafting versus Species Augment gastrointestinal microbiota; 100% of stool samples from the ing in patients microbiomes after treatment with an ethanol Human Microbiome Project contain at least one species of treated spore population. Relative abundance of species that Bacteroides with total relative abundance in these samples 30 engrafted or augmented as described were determined based ranging from 0.96% to 93.92% with a median relative on the number of 16S sequence reads. Each plot is from a abundance of 52.67% (www.hmpdacc.org reference data set different patient treated with the ethanol-treated spore popu HMSMCP). Bacteroides in the gut has been associated with lation for recurrent C. difficile. amino acid fermentation and degradation of complex poly The impact of ethanol treated spore population treatment saccharides. Its presence in the gut is enhanced by diets rich 35 on carriage of imipenem resistant Enterobacteriaceae was in animal-derived products as found in the typical western assessed by plating pretreatment and Day 28 clinical diet David, L. A. et al, Nature (2013) doi:10.1038/na samples from Patients 2, 4 and 5 on MacConkey lactose plus ture 12820. Strikingly, prior to treatment, fewer than 1 ug/mL of imipenem. Resistant organisms were scored by 0.008% of the 16S-V4 reads from Patient 1 mapped to the morphology, enumerated and DNA was submitted for full genus Bacteroides strongly suggesting that Bacteroides spe 40 length 16S rDNA sequencing as described above. Isolates cies were absent or that viable Bacteroides were reduced to were identified as Morganella morganii, Providencia rett an extremely minor component of the patient's gut micro geri and Proteus pennerii. Each of these are gut commensal biome. Post treatment, a 42% of the 16S-V4 reads could be organisms; overgrowth can lead to bacteremia and/or uri assigned to the genus Bacteroides within 5 days of treatment nary tract infections requiring aggressive antibiotic treat and by Day 25 post treatment 59.48% of the patients gut 45 ment and, in Some cases, hospitalization Kim, B-N, et al microbiome was comprised of Bacteroides. These results Scan J. Inf Dis (2003) 35: 98-103; Lee, I-K and Liu, J-WJ. were confirmed microbiologically by the absence of detect Microbiol Immunol Infect (2006)39: 328-334; O'Hara et al. able Bacteroides in the pretreatment sample plated on two Clin Microbiol Rey (2000) 13: 534). The titer of organisms different Bacteroides selective media: Bacteroides Bile at pretreatment and Day 28 by patient is shown in Table 22. Esculin (BBE) agar which is selective for Bacteroides 50 Importantly, administration of the ethanol treated spore fragilis group species Livingston, S.J. et al J. Clin. Micro preparation resulted in greater than 100-fold reduction in 4 biol (1978). 7: 448-453 and Polyamine Free Arabinose of 5 cases of Enterobacteriaceae carriage with multiple (PFA) agar Noack et al. J. Nutr. (1998) 128: 1385-1391; imipenem resistant organisms (Table 22). modified by replacing glucose with arabinose. The highly In addition to speciation and enumeration, multiple iso selective BBEagar had a limit of detection of <2x10 cfu/g, 55 lates of each organism from Patient 4 were grown overnight while the limit of detection for Bacteroides on PFAagar was in 96-well trays containing a 2-fold dilution series of imi approximately 2x10 cfu/g due to the growth of multiple penem in order to quantitatively determine the minimum non-Bacteroides species in the pretreatment sample on that inhibitory concentration (MIC) of antibiotic. Growth of medium. Colony counts of Bacteroides species on Day 25 organisms was detected by light scattering at 600 nm on a were up to 2x10" cfu/g, consistent with the 16S-V4 60 SpectraMax M5e plate reader. In the clinical setting, these sequencing, demonstrating a profound reconstitution of the species are considered resistant to imipenem if they have an gut microbiota in Patient 1 (Table 20). MIC of 1 ug/mL or greater. M. morganii isolates from The significant abundance of Bacteroides in Patient 1 on pretreatment samples from Patient D had MICs of 2-4 Day 25 (and as early as Day 5 as shown by 16S-V4 ug/mL and P. pennerii isolates had MICs of 4-8 ug/mL. Thus sequencing) is remarkable. Viable Bacteroides fragilis group 65 the ethanol treated spore population administered to Patient species were not present in the ethanol treated spore popu 4 caused the clearance of 2 imipenem resistant organisms lation based on microbiological plating (limit of detection of (Table 16). US 9,585,921 B2 75 76 Example 26 cultures, and in a variety of bacteria the mechanisms of varying colony morphologies have been well described (van Enrichment and Purification of Bacteria der Woude, Clinical Microbiology Reviews, 17:518, 2004), including in Clostridium species (Wadsworth-KTL Anaero To purify individual bacterial strains, dilution plates were 5 bic Bacteriology Manual, 6th Ed. Jousimie-Somer, et al selected in which the density enables distinct separation of 2002). For obligate anaerobes, RCBs were confirmed to lack single colonies. Colonies were picked with a sterile imple aerobic colony forming units at a limit of detection of 10 ment (either a sterile loop or toothpick) and re-streaked to cfu/ml. BBA or other Solid media. Plates were incubated at 37° C. for 3-7 days. One or more well-isolated single colonies of 10 Example 28 the major morphology type were re-streaked. This process was repeated at least three times until a single, stable colony Titer Determination morphology is observed. The isolated microbe was then cultured anaerobically in liquid media for 24 hours or longer The number of viable cells per ml was determined on the to obtain a pure culture of 10°-10" cfu/ml. Liquid growth 15 freshly harvested, washed and concentrated culture by plat medium might include Brain Heart Infusion-based medium ing serial dilutions of the RCB to Brucella blood agar or (Atlas, Handbook of Microbiological Media, 4th ed, ASM other solid media, and varied from 10° to 10' cfu/ml. The Press, 2010) supplemented with yeast extract, hemin, cys impact of freezing on viability was determined by titering teine, and carbohydrates (for example, maltose, cellobiose, the banks after one or two freeze-thaw cycles on dry ice or soluble starch) or other media described previously (e.g. see at -80°C., followed by thawing in an anaerobic chamber at example 14). The culture was centrifuged at 10,000xg for 5 room temperature. Some strains displayed a 1-3 log drop in min to pellet the bacteria, the spent culture media was viable cfu/ml after the 1st and/or 2nd freeze thaw, while the removed, and the bacteria were resuspended in sterile PBS. viability of others were unaffected. Sterile 75% glycerol was added to a final concentration of 20%. An aliquot of glycerol stock was titered by serial 25 Example 29 dilution and plating. The remainder of the stock was frozen on dry ice for 10-15 min and then placed at -80C for long Preparation of Bacterial Compositions term storage. Individual strains were typically thawed on ice and com Example 27 30 bined in an anaerobic chamber to create mixtures, followed by a second freeze at -80°C. to preserve the mixed samples. Cell Bank Preparation When making combinations of strains for in vitro or in vivo assays, the cfu in the final mixture was estimated based on Cell banks (RCBs) of bacterial strains were prepared as the second freeze-thaw titer of the individual strains. For follows. Bacterial strains were struck from -80° C. frozen 35 experiments in rodents, strains may be combined at equal glycerol stocks to Brucella blood agar with Hemin or counts in order to deliver between 1e4 and le10 per strain. Vitamin K (Atlas, Handbook of Microbiological Media, 4th Additionally, some bacteria may not grow to Sufficient titer ed, ASM Press, 2010), M2GSC (Atlas, Handbook of Micro to yield cell banks that allowed the production of composi biological Media, 4th ed. ASM Press, 2010) or other solid tions where all bacteria were present at le10. growth media and incubated for 24 to 48 h at 37° C. in an 40 anaerobic chamber with a gas mixture of H:CON of Example 30 10:10:80. Single colonies were then picked and used to inoculate 250 ml to 1 L of Wilkins-Chalgren broth, Brain Identification of Keystone OTUs and Functions Heart Infusion broth, M2GSC broth or other growth media, and grown to mid to late exponential phase or into the 45 The human body is an ecosystem in which the microbiota, stationary phase of growth. Alternatively, the single colonies and the microbiome, play a significant role in the basic may be used to inoculate a pilot culture of 10 ml, which were healthy function of human systems (e.g. metabolic, immu then used to inoculate a large Volume culture. The growth nological, and neurological). The microbiota and resulting media and the growth phase at harvest were selected to microbiome comprise an ecology of microorganisms that enhance cell titer, sporulation (if desired) and phenotypes 50 co-exist within single subjects interacting with one another that might be associated desired in vitro or in vivo. Option and their host (i.e., the mammalian Subject) to form a ally, Cultures were grown static or shaking, depending dynamic unit with inherent biodiversity and functional char which yielded maximal cell titer. The cultures were then acteristics. Within these networks of interacting microbes concentrated 10 fold or more by centrifugation at 5000 rpm (i.e. ecologies), particular members can contribute more for 20 min, and resuspended in sterile phosphate buffered 55 significantly than others; as such these members are also saline (PBS) plus 15% glycerol. 1 ml aliquots were trans found in many different ecologies, and the loss of these ferred into 1.8 ml cryovials which were then frozen on dry microbes from the ecology can have a significant impact on ice and stored at -80 C. The identity of a given cell bank was the functional capabilities of the specific ecology. Robert confirmed by PCR amplification of the 16S rDNA gene, Paine coined the concept “Keystone Species” in 1969 (see followed by Sanger direct cycle sequencing, and comparison 60 Paine R T. 1969. A note on trophic complexity and com to a curated r)NA database to determine a taxonomic ID. munity stability. The American Naturalist 103: 91-93) to Each bank was confirmed to yield colonies of a single describe the existence of Such lynchpin species that are morphology upon streaking to Brucella blood agar or integral to a given ecosystem regardless of their abundance M2GSC agar. When more than one morphology was in the ecological community. Paine originally describe the observed, colonies were confirmed to be the expected spe 65 role of the starfish Pisaster ochraceus in marine systems and cies by PCR and sequencing analysis of the 16S rDNA gene. since the concept has been experimentally validated in Variant colony morphologies can be observed within pure numerous ecosystems. US 9,585,921 B2 77 78 Keystone OTUs and/or Functions are computationally Example 31 derived by analysis of network ecologies elucidated from a defined set of samples that share a specific phenotype. Identifying the Core Ecology from the Ethanol Keystone OTUs and/or Functions are defined as all Nodes Treated Spore Preparation within a defined set of networks that meet two or more of the Ten different ethanol treated spore preparations were following criteria. Using Criterion 1, the node is frequently made from 6 different donors (as described in Example 15). observed in networks, and the networks in which the node The spore preparations were used to treat 10 patients, each is observed are found in a large number of individual suffering from recurrent C. difficile infection. Patients were subjects; the frequency of occurrence of these Nodes in identified using the inclusion/exclusion criteria described in networks and the pervasiveness of the networks in individu 10 Example 18, and donors were identified using the criteria als indicates these Nodes perform an important biological described in Example 1. None of the patients experienced a function in many individuals. Using Criterion 2, the node is relapse of C. difficile in the 4 weeks of follow up after frequently observed in networks, and each the networks in treatment, whereas the literature would predict that 70-80% which the node is observed contain a large number of of Subjects would experience a relapse following cessation 15 of antibiotic Van Nood, et al., NEJM (2013). Thus, the Nodes—these Nodes are thus "Super-connectors', meaning ethanol treated spore preparations derived from multiple that they form a nucleus of a majority of networks and as different donors and donations showed remarkable clinical Such have high biological significance with respect to their efficacy. functional contributions to a given ecology. Using Criterion To define the Core Ecology underlying the remarkable 3, the node is found in networks containing a large number clinical efficacy of the ethanol treated spore preparation, the of Nodes (i.e. they are large networks), and the networks in following analysis was carried out. The OTU composition of which the node is found occur in a large number of subjects; the spore preparation was determined by 16S-V4 rDNA these networks are potentially of high interest as it is sequencing and computational assignment of OTUS per unlikely that large networks occurring in many individuals Example 12. A requirement to detect at least ten sequence would occur by chance alone strongly suggesting biological 25 reads in the ethanol treated spore preparation was set as a relevance. Optionally, the required thresholds for the fre conservative threshold to define only OTUs that were highly quency at which a node is observed in network ecologies, unlikely to arise from errors during amplification or the frequency at which a given network is observed across sequencing. Methods routinely employed by those familiar Subject samples, and the size of a given network to be to the art of genomic-based microbiome characterization use 30 a read relative abundance threshold of 0.005% (see e.g. considered a Keystone node are defined by the 50th, 70th, Bokulich, A. et al. 2013. Quality-filtering vastly improves 80th, or 90th percentiles of the distribution of these vari diversity estimates from Illumina amplicon sequencing. ables. Optionally, the required thresholds are defined by the Nature Methods 10: 57-59), which would equate to reads value for a given variable that is significantly different from given the sequencing depth obtained for the samples ana the mean or median value for a given variable using standard 35 lyzed in this example, as cut-off which is substantially lower parametric or non-parametric measures of Statistical signifi than the 210 reads used in this analysis. All taxonomic and cance. In another embodiment a Keystone node is defined as clade assignments were made for each OTU as described in one that occurs in a sample phenotype of interest Such as but Examples 12. The resulting list of OTUs, clade assignments, not limited to “health' and simultaneously does not occur in and frequency of detection in the spore preparations are a sample phenotype that is not of interest Such as but not 40 shown in Table GB. OTUs that engraft in a treated patients limited to “disease. Optionally, a Keystone Node is defined and the percentage of patients in which they engraft are as one that is shown to be significantly different from what denoted, as are the clades, spore forming status, and Key is observed using permuted test datasets to measure signifi Stone OTU status. Starred OTUS occur in 80% of the CaCC. ethanol preps and engraft in a 50% of the treated patients. TABLE GE OTUs detected by a minimum often 16S-V4 sequence reads in at least a one ethanol treated spore preparation pan-microbiome).
% of % of Spore Patients Preps with OTU Spore Keystone OTU C 8. de OTU Engrafts Former OTU Prevotella maculosa e 104 10% Prevotella copri e 168 20% Bacteroides caccae e 170 30% O% Bifidobacterium sp. TM 7* e 172 90% 60% Bifidobacterium gallicum e 172 70% 20% Bifidobacterium dentium e 172 50% O% Lactobacillus casei e 198 20% 10% Actinomyces odontolyticus e 212 20% 30% Clostridium colicanis e 223 10% 10% Clostridiales sp SS3 4* e 246 100% 70% Clostridium sporogenes e 252 40% 40% Clostridium butyricum e 252 20% 20% Clostridium disporicum e 253 40% 30% Clostridium hylemonae'' e 260 100% SO% Clostridium Scindens e 260 10% 60% US 9,585,921 B2 79 TABLE GB-continued OTUs detected by a minimum often 16S-V4 sequence reads in at least a one ethanol treated spore preparation pan-microbiome).
% of % of Spore Patients Preps with OTU Spore Keystone OTU C 8. de OTU Engrafts Former OTU Coprococcus comes e 262 90% 80% Lachnospiraceae bacterium 1 4 56FAA* e 262 90% 80% Ruminococcus torques e 262 30% 70% Parabacteroides merdae e 286 30% 20% Bifidobacterium bifidum e 293 10% O% Johnsonella ignava e 298 10% 10% Blautia glucerasea e 309 100% 80% Blautia sp M25* e 309 100% 70% Lachnospiraceae bacterium 6 1 63FAA* e 309 100% 60% Eubacterium cellulosolvens e 309 10% 30% Lactobacillus fermentum e 313 10% O% Sarcina Ventriculi e 353 10% 10% Clostridium bartlettii e 354 90% 70% Clostridium bifermentans e 354 70% 70% Clostridium mayombei e 354 SO% SO% Dorea longicatena e 360 100% 60% Lachnospiraceae bacterium 9 1 43BFAA e 360 100% 30% Lachnospiraceae bacterium 2 1 58FAA* e 360 80% 80% Lachnospiraceae bacterium 2 1 46FAA e 360 SO% SO% Lactobacillus perolens e 373 O% O% Bacteroides dorei e 378 60% SO% Eubacterium biforme e 385 O% O% Peptoniphilus sp. gpac077 e 389 O% 20% Coprococcus catus e 393 100% 70% Eubacterium hallii e 396 90% 60% Anaerosporobacter mobilis e 396 40% 60% Bacteroides pectinophilus e 396 O% 60% Lactobacillus hominis e 398 O% O% Lactococcus lactis e 401 40% 40% Ruminococcus champanellensis e 406 80% SO% Ruminococcus callidus e 406 O% 10% Clostridium clostridioforme e 408 100% 60% Eubacterium hadrum e 408 100% 90% Clostridium symbiosum e 408 30% SO% Anaerostipes caccae e 408 O% SO% Parasutterella excrementihominis e 432 O% O% Sutterella stercoricanis e 432 O% O% Eubacterium rectale e 444 100% 80% Lachnobacterium bovis e 444 100% 80% Desulfovibrio desulfuricans e 445 O% O% Eubacterium sp. oral clone JS001* e 476 80% 70% Faecalibacterium prausnitzii e 478 100% 60% Subdoligranulum variabile e 478 100% 80% Coprobacillus sp D7* e 481 90% 60% Clostridium cocleatum e 481 60% 20% Clostridium spiroforme e 481 40% SO% Eubacterium ramulus e 482 80% 60% Flavonifractor plautii e 494 70% 60% Pseudoflavonifractor capillosus e 494 60% 60% Ruminococcaceae bacterium D16 e 494 30% SO% Acetivibrio cellulolyticus* e 495 70% 80% Clostridium stercorarium e 495 40% SO% Enterococcus durans e 497 10% 10% Enterococcus faecium e 497 10% 10% Dialister invisus e 506 SO% 10% Eubacterium limosum e 512 20% O% Ruminococcus flavefaciens e 516 60% 60% Eubacterium ventriosum e 519 30% 60% Bilophila wadsworthia e 521 90% O% Lachnospira pectinoschiza e 522 40% 60% Eubacterium eligens e 522 30% SO% Catonella morbi e 534 20% O% Clostridium sporosphaeroides' e 537 100% 80% Ruminococcus bromii e 537 60% 30% Clostridium leptum e 537 40% 70% Clostridium sp. YIT 12069 e 537 40% 60% Clostridium viride e 540 10% 10% Megamonas funiformis e 542 SO% O% Eubacterium ruminantium e 543 80% 90% Coprococcus eutactus e 543 20% 20% Collinsella aerofaciens e 553 SO% 10% US 9,585,921 B2 81 82 TABLE GB-continued OTUs detected by a minimum often 16S-V4 sequence reads in at least a one ethanol treated spore preparation pan-microbiome).
% of % of Spore Patients Preps with OTU Spore Keystone OTU Clade OTU Engrafts Former OTU Alkaliphilus metalliredigenes clade 554 40% 10% Y N Turicibacter sanguinis clade 555 80% 40% Y N Phascolarctobacterium faecium clade 556 20% O% N N Clostridiales bacterium oral clone P4PA clade 558 80% SO% N N Lutispora thermophila clade 564 100% O% Y N Coriobacteriaceae bacterium JC110 clade 566 70% O% N N Eggerthella sp. 1 3 56FAA clade 566 70% 30% N N Adlercreutzia equolifaciens clade 566 40% O% N N Gordonibacter pamelaeae clade 566 30% O% N Y Slackia isoflavoniconvertens clade 566 10% O% N N Eubacterium desmolans clade 572 90% 70% Y N Papillibacter cinnamivorans* clade 572 90% 80% Y N Clostridium colinum clade 576 30% 30% Y N Akkermansia muciniphila clade 583 60% 10% N Y Clostridiales bacterium oral taxon F32 clade 584 60% 30% N N Prochlorococcus marinus clade 592 30% O% N N Methanobrevibacter wolinii clade 595 30% O% N N Bacteroides fragilis clade 65 20% 30% N Y Lactobacillus delbrueckii clade 72 10% O% N N Escherichia coli clade 92 SO% O% N Y Clostridium sp. D5 clade 96 80% 60% Y N Streptococcus thermophilus clade 98 90% 20% N Y Streptococcus sp. CM6 clade 98 20% 10% N N Streptococcus sp. oral clone ASCE05 clade 98 10% O% N N
Next, it was reasoned that for an OTU to be considered a notes which of the OTUs in the spore preparation are member of the Core Ecology of the spore preparation, that Keystone OTUs exclusively associated with individuals that OTU must be shown to engraft in a patient. Engraftment is are healthy and do not harbor disease. important for two reasons. First, engraftment is a sine qua 35 There are several important findings from this data. A non of the mechanism to reshape the microbiome and relatively small number of species, 16 in total, are detected eliminate C. difficile colonization. OTUs that engraft with in all of the spore preparations from 6 donors and 10 higher frequency are highly likely to be a component of the donations. This is surprising because the HMP database Core Ecology of the spore preparation. Second, OTUs (www.hmpdacc.org) describes the enormous variability of detected by sequencing the spore preparation (as in Table 40 commensal species across healthy individuals. The presence GB) may include non-viable spores or other contaminant of a small number of consistent OTUs lends support to the DNA molecules not associated with spores. The requirement concept of a Core Ecology. The engraftment data further that an OTU must be shown to engraft in the patient Supports this conclusion. A regression analysis shows a eliminates OTUs that represent non-viable spores or con significant correlation between frequency of detection in a taminating sequences. Table GB also identifies all OTUs 45 spore preparation and frequency of engraftment in a donor: detected in the spore preparation that also were shown to R=0.43 (p<0.001). There is no a priori requirement that an engraft in at least one patient post-treatment. OTUS that are OTU detected frequently in the spore preparation will or present in a large percentage of the ethanol spore prepara should engraft. For instance, Lutispora thermophila, a spore tions analyzed and that engraft in a large number of patients former found in all ten spore preparations, did not engraft in represent a subset of the Core Ecology that are highly likely 50 any of the patients. Bilophila Wadsworthia, a gram negative to catalyze the shift from a dysbiotic disease ecology to a anaerobe, is present in 9 of 10 donations, yet it does not healthy microbiome. engraft in any patient, indicating that it is likely a non-viable A third lens was applied to further refine insights into the contaminant in the ethanol treated spore preparation. Finally, Core Ecology of the spore preparation. Computational it is worth noting the high preponderance of previously based, network analysis has enabled the description of 55 defined Keystone OTUs among the most frequent OTUs in microbial ecologies that are present in the microbiota of a the spore preparations. broad population of healthy individuals. These network These three factors—prevalence in the spore preparation, ecologies are comprised of multiple OTUs, some of which frequency of engraftment, and designation as a Keystone are defined as Keystone OTUs. Keystone OTUs are com OTUs—enabled the creation of a “Core Ecology Score” putationally defined as described in Example 30. Keystone 60 (CES) to rank individual OTUs. CES was defined as fol OTUs form a foundation to the microbially ecologies in that lows: they are found and as such are central to the function of 40% weighting for presence of OTU in spore preparation network ecologies in healthy subjects. Keystone OTUs multiplier of 1 for presence in 1-3 spore preparations associated with microbial ecologies associated with healthy multiplier of 2.5 for presence in 4-8 spore preparations Subjects are often are missing or exist at reduced levels in 65 multiplier of 5 for presences in 9 spore preparations subjects with disease. Keystone OTUs may exist in low, 40% weighting for engraftment in a patient moderate, or high abundance in subjects. Table GB further multiplier of 1 for engraftment in 1-4 patients US 9,585,921 B2 83 84 multiplier of 2.5 for engraftment in 5-6 patients ships defined in Example 12 and Table 1 above, related multiplier of 5 for engraftment in 7 patients OTUs can be selected as substitutes for OTUs with accept 20% weighting to Keystone OTUS able CES values. These organisms can be cultured anaero multiplier of 1 for a Keystone OTU bically in vitro using the appropriate media (selected from multiplier of 0 for a non-Keystone OTU those described in Example 14 above), and then combined Using this guide, the CES has a maximum possible score in a desired ratio. A typical experiment in the mouse C. of 5 and a minimum possible score of 0.8. As an example, difficile model utilizes at least 10 and preferably at least 10, an OTU found in 8 of the 10 spore preparations that 10, 107, 10, 10 or more than 10 colony forming units of engrafted in 3 patients and was a Keystone OTU would be a each microbe in the composition. Variations in the culture assigned the follow CES: yields may sometimes mean that organisms are combined in 10 unequal ratios, e.g. 1:10, 1:100, 1:1,000, 1:10,000, 1:100, 000, or greater than 1:100,000. What is important in these Table GC ranks the top 20 OTUs by CES with the further compositions is that each strain be provided in a minimum requirement that an OTU must be shown to engraft to be a amount so that the strain's contribution to the efficacy of the considered an element of a core ecology. Core Ecology Subset can be measured. Using the principles TABLE GC Top 20 OTUS ranked by CES Spore Keystone OTU Clade CES Former OTU Eubacterium hadrum clade 408 4.2 Y Eubacterium rectale clade 444 4.2 Y Subdoligranulum variabile clade 478 4.2 Y Blautia sp M25 clade 309 4.2 Y Coprococcus catus clade 393 4.2 Y Lachnospiraceae bacterium 1 4 56FAA clade 262 4.2 Y Coprococcus comes clade 262 4.2 Y Blautia glucerasea clade 309 4.0 Y Lachnobacterium bovis clade 444 4.0 Y Clostridium sporosphaeroides clade 537 4.0 Y Clostridiales sp SS3 4 clade 246 4.0 Y Papillibacter cinnamivorans clade 572 4.0 Y Clostridium bartlettii clade 354 4.0 Y Eubacterium desmolans clade 572 4.0 Y Clostridium clostridioforme clade 408 3.2 Y Dorea longicatena clade 360 3.2 Y Faecalibacterium prausnitzii clade 478 3.2 Y Eubacterium hallii clade 396 3.2 Y Clostridium leptum clade 537 3.2 Y Lachnospiraceae bacterium 6 1 63FAA clade 309 3.0 Y
Example 32 40 and instructions described here, it is straightforward for one of skill in the art to make clade-based substitutions to test the Defining Efficacious Subsets of the Core Ecology efficacy of subsets of the Core Ecology. Table GB describes the clades for each OTU detected in a spore preparation and The number of organisms in the human gastrointestinal Table 1 describes the OTUs that can be used for substitutions tract, as well as the diversity between healthy individuals, is 45 based on clade relationships. indicative of the functional redundancy of a healthy gut microbiome ecology (see The Human Microbiome Consor Example 33 tia. 2012. Structure, function and diversity of the healthy Testing Subsets of the Core Ecology in the Mouse human microbiome. Nature 486: 207-214). This redundancy Model makes it highly likely that subsets of the Core Ecology 50 describe therapeutically beneficial components of the etha nol treated spore preparation and that Such Subsets may Several subsets of the Core Ecology were tested in the C. themselves be useful compositions for the treatment of C. difficile mouse model. The negative control was phosphate difficile infection given the ecologies functional character buffered saline and the positive control was a 10% human istics. Using the CES, individual OTUs can be prioritized for fecal suspension. The subsets are described in Table GD. evaluation as an efficacious Subset of the Core Ecology. 55 Another aspect of functional redundancy is that evolu TABLE GD tionarily related organisms (i.e. those close to one another on Subsets of the Core Ecology tested in the C. difficile the phylogenetic tree, e.g. those grouped into a single clade) mouse model will also be effective substitutes in the Core Ecology or a 60 subset thereof for treating C. difficile. Substitute For OTU in Table 1 To one skilled in the art, the selection of appropriate OTU Subset OTU (Clade) subsets for testing in vitro (e.g. see Example 33 below) or in Subset 1 Collinsella aerofaciens none (Clade 553) vivo (e.g. see Examples 16 or 17) is straightforward. Subsets Cliostridium tertium C. Sporogenes (Clade 252) may be selected by picking any 2, 3, 4, 5, 6, 7, 8, 9, 10, or Clostridium disporicum none (Clade 253) more than 10 OTUs from Table GB, with a particular 65 Cliostridium innocuum Clostridium sp. HGF2 emphasis on those with higher CES, such as the OTUs (Clade 351) described in Table GC. In addition, using the clade relation US 9,585,921 B2 85 86 TABLE GD-continued (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drink ing water on days -14 through -5 and a dose of 10 mg/kg Subsets of the Core Ecology tested in the C. difficile mouse model Clindamycin by oral gavage on day -3. On day -1, they received either the test articles or control articles via oral Substitute For OTU in Table 1 gavage. On day 0 they were challenged by administration of Subset OTU (Clade) approximately 4.5 log 10 cfu of C. difficilea (ATCC 43255) Clostridium mayombeibutyricum none (Clade 354)252) Via oral gavage. Mortality was assessed every day from day Coprococci is comes none (Clade 262) 0 to day 6 and the weight and Subsequent weight change of ClostridiumCliostridium hylemonaeboiteae E.none hadrum (Clade (Clade 260) 408) 10 the animal1A was assessed with weight loss being associated Clostridium symbiosum C. clostridioforme (Clade 408) with C. difficile infection. Mortality and reduced weight loss Clostridium orbiscindens R. bacterium D16 (Clade 494) of the test article compared to the empty vehicle was used to Lachnospiraceaebacterium 5 157FAA C. Scindens (Clade 260) assess the Success of the test article. Additionally, a C. Bialitia producta Blautia sp M25 (Clade 309) 15 difficile symptom scoring was performed each day from day Raiminococcus gnavus D. longicatena (Clade 360) -1 through day 6. Symptom scoring was based on Appear Ruminococcus bromii none (Clade 537) 0-2 pts based 1, h hed, pil ti Subset 2 Collinseila aerofaciens none (Clade 553) aCC (0- pus ase on normal, nunched, p11oerec ion, O Clostridium butyricum none (Clade 252) lethargic), Respiration (0-2 pts based on normal, rapid or Clostridium hylemonae none (Clade 260) shallow, with abdominal breathing), Clinical Signs (0-2 Bialitia producta Blautia sp M25 (Clade 309) 2O Subset 3 Collinseila aerofaciens none (Clade 553) points based on normal, wet tail, cold-to-the-touch, or iso Cliostridium innocuum Clostridium sp. HGF2 lation from other animals). Coprococci is comes none(Clade (Clade 351) 262) In addition to compiling- the cumulative mortality for each Ruminococcus bromii none (Clade 537) arm, the average minimum relative weight is calculated as Subset 4 Clostridium butyricum none (Clade 252) 25 the mean of each mouse's minimum weight relative to Day BialitiaClostridium producta hylemonae Blautianone (Clade sp M25260) (Clade 309) -1 and the average maximums clinical score is calculated as Subset 5 Clostridium butyricum none (Clade 252) the mean of each mouse's maximum combined clinical Clostridium hyiemonae none (Clade 260) score with a score of 4 assigned in the case of death. The results are reported in Table GE. TABLE GE Results of bacterial compositions tested in a C. difficile mouse model. Avg. Maximum Cumulative Avg. Minimum Clinical Score Group Dose Mortality (%) Relative Weight (Death = 4) Vehicle Control 40 O.87 2.8 Feces Control 5.8e8 cfu total O O.99 O Subset 1 1e8 cfu? OTU O O.98 O Subset 2 1e8 cfu? OTU 10 O.84 2.1 Subset 3 1e8 cfu? OTU 10 O.84 2.2 Subset 4 1e8 cfu? OTU O O.87 2 Subset 5 1e8 cfu? OTU 2O O.91 1.7 Subset 6 1e8 cfu? OTU 40 O.82 2.8 Subset 7 1e8 cfu? OTU O O.90 1
TABLE GD-continued Example 34 Subsets of the Core Ecology tested in the C. difficile 50 Defining Subsets of the Core Ecology in the In mouse model Vitro C. Difficile Inhibition Assay Substitute For OTU in Table 1 Vials of -80° C. glycerol stock banks were thawed and Subset OTU (Clade) diluted to le8 CFU/mL. Selected strains and their clade Subset 6 Blautia producta Blautia sp M25 (Clade 309) 55 assignment are given in Table GF. Each strain was then Clostridium butyricum none (Clade 252) diluted 10x (to a final concentration of 1e7 CFU/mL of each Subset 7 Clostridium orbiscindens R. bacterium D16 (Clade 494) strain) into 200 uL of PBS+15% glycerol in the wells of a Lachnospiraceae C. Scindens (Clade 260) 96-well plate. Plates were then frozen at -80° C. When bacterium 5 1 57FAA needed for the assay, plates were removed from -80° C. and Eubacterium reciaie none (Clade 444) 60 thawed at room temperature under anaerobic conditions when testing in a in vitro C. difficile inhibition assay (CivSim). Two cages of five mice each were tested for each arm of An overnight culture of Clostridium difficile is grown the experiment. All mice received an antibiotic cocktail under anaerobic conditions in SweetB-Fosin or other suit consisting of 10% glucose, kanamycin (0.5 mg/ml), gen 65 able media for the growth of C. difficile. SweetB-Fos.In is a tamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronida complex media composed of brain heart infusion, yeast Zole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), amplicillin extract, cysteine, cellobiose, maltose, Soluble starch, and US 9,585,921 B2 87 88 fructooligosaccharides/inulin, and hemin, and is buffered mens, Journal of Clinical Microbiology 47:2142-2148 with MOPs. After 24 hr of growth the culture is diluted (2009)). This reaction mixture is aliquoted to wells of a 100,000 fold into a complex media such as SweetB-Foslin Hard-shell Low-Profile Thin Wall 96-well Skirted PCR Plate (BioRad, Hercules, Calif.). To this reaction mixture, 2 ul of which is suitable for the growth of a wide variety of diluted, frozen, and thawed samples are added and the plate anaerobic bacterial species. The diluted C. difficile mixture 5 sealed with a Microseal B. Adhesive Seal (BioRad, Her is then aliquoted to wells of a 96-well plate (180 uL to each cules, Calif.). The qPCR is performed on a BioRad C1000TM well). 20 u, of a subset Core Ecology is then added to each Thermal Cycler equipped with a CFX96TM Real-Time Sys well at a final concentration of le6 CFU/mL of each species. tem (BioRad, Hercules, Calif.). The thermocycling condi Alternatively the assay can be tested each species at different tions are 95°C. for 15 minutes followed by 45 cycles of 95° initial concentrations (1e9 CFU/mL, 1e8 CFU/mL, 1e7 10 C. for 5 seconds, 60° C. for 30 seconds, and fluorescent CFU/mL, 1e5 CFU/mL, 1e4 CFU/mL, 1e3 CFU/mL, 1e2 readings of the FAM channel. Alternatively, the qPCR is CFU/mL). Control wells only inoculated with C. difficile are performed with other standard methods known to those included for a comparison to the growth of C. difficile skilled in the art. without inhibition. Additional wells are used for controls The Cd value for each well on the FAM channel is 15 determined by the CFX ManagerTM 3.0 software. The logo that either inhibit or do not inhibit the growth of C. difficile. (cfu/mL) of C. difficile each experimental sample is calcu One example of a positive control that inhibits growth is a lated by inputting a given sample's Cd value into a linear combination of Blautia producta, Clostridium bifermentans regression model generated from the standard curve com and Escherichia coli. One example of a control that shows paring the Cd values of the standard curve wells to the reduced inhibition of C. difficile growth is a combination of known logo (cfu/mL) of those samples. The log inhibition Bacteroides thetaiotaOmicron, Bacteroides ovatus and is calculated for each sample by Subtracting the logo Bacteroides vulgatus. Plates are wrapped with parafilm and (cfu/mL) of C. difficile in the sample from the logo (cfu/mL) incubated for 24 hr at 37° C. under anaerobic conditions. of C. difficile in the sample on each assay plate used for the After 24 hr the wells containing C. difficile alone are serially generation of the standard curve that has no additional diluted and plated to determine titer. The 96-well plate is bacteria added. The mean log inhibition is calculated for all then frozen at -80C before quantifying C. difficile by qPCR 25 replicates for each composition. assay. A histogram of the range and standard deviation of each A standard curve is generated from a well on each assay composition is plotted. Ranges or standard deviations of the plate containing only pathogenic C. difficile grown in log inhibitions that are distinct from the overall distribution SweetB+FosIn media and quantified by selective spot plat are examined as possible outliers. If the removal of a single ing. Serial dilutions of the culture are performed in sterile 30 log inhibition datum from one of the binary pairs that is phosphate-buffered saline. Genomic DNA is extracted from identified in the histograms would bring the range or stan the standard curve samples along with the other wells. dard deviation in line with those from the majority of the Genomic DNA is extracted from 5ul of each sample using samples, that datum is removed as an outlier, and the mean a dilution, freeze/thaw, and heat lysis protocol. 5 L of log inhibition is recalculated. thawed samples is added to 45 uL of UltraPure water (Life 35 The pooled variance of all samples evaluated in the assay Technologies, Carlsbad, Calif.) and mixed by pipetting. The is estimated as the average of the sample variances weighted plates with diluted samples are frozen at -20°C. until use for by the sample's degrees of freedom. The pooled standard qPCR which includes a heated lysis step prior to amplifi error is then calculated as the square root of the pooled cation. Alternatively the genomic DNA is isolated using the variance divided by the square root of the number of Mo Bio Powersoil(R)-htp 96 Well Soil DNA. Isolation Kit samples. Confidence intervals for the null hypothesis are (Mo Bio Laboratories, Carlsbad, Calif.), Mo Bio Power 40 determined by multiplying the pooled standard error to the soil.R DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Z score corresponding to a given percentage threshold. Mean Calif.), or the QIAamp DNA Stool Mini Kit (QIAGEN, log inhibitions outside the confidence interval are considered Valencia, Calif.) according to the manufacturers instruc to be inhibitory if positive or stimulatory if negative with the tions. percent confidence corresponding to the interval used. Ter The qPCR reaction mixture contains 1x Sso Advanced 45 nary combinations with mean log inhibition greater than Universal Probes Supermix, 900 nM of Wr-tcdB-F primer 0.312 are reported as ++++(s.99% confidence interval (C.I.) (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG (SEQ of the null hypothesis), those with mean log inhibition ID NO: 2040), IDT, Coralville, Iowa),900 nM of Wr-tcdB-R between 0.221 and 0.312 as +++ (95% OTU1 Clade1 OTU2 Clade2 OTU3 Clade3 Results Clostridium bolteae clade 408 Blautia producta clade 309 Eubacterium rectale clade 444 ------Clostridium bolteae clade 408 Clostridium symbiosum clade 408 Blautia producta clade 309 ------Clostridium bolteae clade 408 Clostridium symbiosum clade 408 Eubacterium rectale clade 444 Clostridium bolteae clade 408 Clostridium symbiosum clade 408 Faecalibacterium prausnitzii clade 478 US 9,585,921 B2 89 90 TABLE GF-continued OTUS and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay OTU1 Clade1 OTU2 Clade2 OTU3 Clade3 Results Clostridium bolteae clade 408 Clostridium symbiosum clade 408 Lachnospiraceae clade 260 bacterium 5157FAA Clostridium bolteae clade 408 Faecalibacterium prausnitzii clade 478 Blautia producta clade 309 ------Clostridium bolteae clade 408 Faecalibacterium prausnitzii clade 478 Eubacterium rectale clade 444 Clostridium bolteae clade 408 Faecalibacterium prausnitzii clade 478 Lachnospiraceae clade 260 ------bacterium 5157FAA Clostridium bolteae clade 408 Lachnospiraceae clade 260 Blautia producta clade 309 ------bacterium 5157FAA Clostridium bolteae clade 408 Lachnospiraceae clade 260 Eubacterium rectale clade 444 -- bacterium 5157FAA Clostridium symbiosum clade 408 Blautia producta clade 309 Eubacterium rectale clade 444 ------Clostridium symbiosum clade 408 Faecalibacterium prausnitzii clade 478 Blautia producta clade 309 ------Clostridium symbiosum clade 408 Faecalibacterium prausnitzii clade 478 Eubacterium rectale clade 444 Clostridium symbiosum clade 408 Faecalibacterium prausnitzii clade 478 Lachnospiraceae clade 260 -- bacterium 5157FAA Clostridium symbiosum clade 408 Lachnospiraceae clade 260 Blautia producta clade 309 ------bacterium 5157FAA Clostridium symbiosum clade 408 Lachnospiraceae clade 260 Eubacterium rectale clade 444 bacterium 5157FAA Collinsella aerofaciens clade 553 Blautia producta clade 309 Eubacterium rectale clade 444 ------Collinsella aerofaciens clade 553 Clostridium bolteae clade 408 Blautia producta clade 309 ------Collinsella aerofaciens clade 553 Clostridium bolteae clade 408 Clostridium symbiosum clade 408 ------Collinsella aerofaciens clade 553 Clostridium bolteae clade 408 Eubacterium rectale clade 444 ------Collinsella aerofaciens clade 553 Clostridium bolteae clade 408 Faecalibacterium prausnitzii clade 478 ------Collinsella aerofaciens clade 553 Clostridium bolteae clade 408 Lachnospiraceae clade 260 ------bacterium 5157FAA Collinsella aerofaciens clade 553 Clostridium symbiosum clade 408 Blautia producta clade 309 ------Collinsella aerofaciens clade 553 Clostridium symbiosum clade 408 Eubacterium rectale clade 444 Collinsella aerofaciens clade 553 Clostridium symbiosum clade 408 Faecalibacterium prausnitzii clade 478 Collinsella aerofaciens clade 553 Clostridium symbiosum clade 408 Lachnospiraceae clade 260 -- bacterium 5157FAA Collinsella aerofaciens clade 553 Coprococcus comes clade 262 Blautia producta clade 309 ------Collinsella aerofaciens clade 553 Coprococcus comes clade 262 Clostridium bolteae clade 408 ------Collinsella aerofaciens clade 553 Coprococcus comes clade 262 Clostridium Symbiosum clade 408 ------Collinsella aerofaciens clade 553 Coprococcus comes clade 262 Eubacterium rectale clade 444 ------Collinsella aerofaciens clade 553 Coprococcus comes clade 262 Faecalibacterium prausnitzii clade 478 ------Collinsella aerofaciens clade 553 Coprococcus comes clade 262 Lachnospiraceae clade 260 ------bacterium 5157FAA Collinsella aerofaciens clade 553 Faecalibacterium prausnitzii clade 478 Blautia producta clade 309 ------Collinsella aerofaciens clade 553 Faecalibacterium prausnitzii clade 478 Eubacterium rectale clade 444 ------Collinsella aerofaciens ade 553 Faecalibacterium prausnitzii clade 478 Lachnospiraceae ade 260 ------bacterium 5157FAA Collinsella aerofaciens clade 553 Lachnospiraceae clade 260 Blautia producta clade 309 ------bacterium 5157FAA Collinsella aerofaciens clade 553 Lachnospiraceae clade 260 Eubacterium rectale clade 444 ------bacterium 5157FAA Coprococcus comes clade 262 Blautia producta clade 309 Eubacterium rectale clade 444 ------Coprococcus comes clade 262 Clostridium bolteae clade 408 Blautia producta clade 309 ------Coprococcus comes clade 262 Clostridium bolteae clade 408 Clostridium symbiosum clade 408 Coprococcus comes clade 262 Clostridium bolteae clade 408 Eubacterium rectale clade 444 Coprococcus comes clade 262 Clostridium bolteae clade 408 Faecalibacterium prausnitzii clade 478 ------Coprococcus comes clade 262 Clostridium bolteae clade 408 Lachnospiraceae clade 260 ------bacterium 5157FAA Coprococcus comes clade 262 Clostridium symbiosum clade 408 Blautia producta clade 309 ------Coprococcus comes clade 262 Clostridium symbiosum clade 408 Eubacterium rectale clade 444 Coprococcus comes clade 262 Clostridium symbiosum clade 408 Faecalibacterium prausnitzii clade 478 Coprococcus comes clade 262 Clostridium symbiosum clade 408 Lachnospiraceae clade 260 bacterium 5157FAA Coprococcus comes ade 262 Faecalibacterium prausnitzii clade 478 Blautia producta ade 309 ------Coprococcus comes ade 262 Faecalibacterium prausnitzii clade 478 Eubacterium rectale ade 444 Coprococcus comes ade 262 Faecalibacterium prausnitzii clade 478 Lachnospiraceae ade 260 bacterium 5157FAA Coprococcus comes clade 262 Lachnospiraceae clade 260 Blautia producta clade 309 ------bacterium 5157FAA Coprococcus comes clade 262 Lachnospiraceae clade 260 Eubacterium rectale clade 444 bacterium 5157FAA Faecalibacterium prausnitzii clade 478 Blautia producta ade 309 Eubacterium rectale ade 444 ------Faecalibacterium prausnitzii clade 478 Lachnospiraceae ade 260 Blautia producta ade 309 ------bacterium 5157FAA Faecalibacterium prausnitzii clade 478 Lachnospiraceae clade 260 Eubacterium rectale clade 444 bacterium 5157FAA Lachnospiraceae clade 260 Blautia producta clade 309 Eubacterium rectale clade 444 ------bacterium 5157FAA US 9,585,921 B2 91 92 The CivSim shows that many ternary combinations 0 with approximately 10 spores of Clostridium difficile inhibit C. difficile. 39 of 56 combinations show inhibition (ATCC 43255) via oral gavage. Mortality for C. difficile with a confidence interval >80%; 36 of 56 with a C.I.>90%; challenged animals was assessed every day from Day 0 to 36 of 56 with a C.I.>95%; 29 of 56 with a C.I. of >99%. Day 6 and the weight and Subsequent weight change of the Non-limiting but exemplary ternary combinations include animal was assessed with weight loss being associated with those with mean log reduction greater than 0.171, e.g. any C. difficile infection. Mortality and reduced weight loss of combination shown in Table 6 with a score of ++++. Such as the test article compared to the empty vehicle was used to Colinsella aerofaciens, Coprococcus comes, and Blautia assess the Success of the test article. producta. Equally important, the CivSim assay describes ternary combinations that do not effectively inhibit C. dif 10 ficile. 5 of 56 combinations promote growth with >80% TABLE ZA confidence; 2 of 56 promote growth with >90% confidence: Microbial compositions administered via oral gavage 1 of 56, Coprococcus comes, Clostridium symbiosum and on Day -1 Eubacterium rectale, promote growth with >95% confi dence. 12 of 56 combinations are neutral in the assay, 15 OTU Clade meaning they neither promote nor inhibit C. difficile growth to the limit of measurement. Microbial Clostridium butyricum clade 252 It is straightforward for one of skill in the art to use the Composition 1 CivSim method to determine efficacious subsets of the Core Clostridium disporicum clade 253 Clostridium hylemonae clade 260 Ecology derived from the ethanol treated spore fraction Clostridium orbiscindens clade 494 shown to be efficacious in treating C. difficile in humans. Clostridium symbiosum clade 408 Collinsella aerofaciens clade 553 Example AAZA Coprococcus comes clade 262 Lachnospiraceae bacterium 5 1 57FAA clade 260 Bacterial Compositions Populating the Gut in a 25 Ruminococcus bromii clade 537 Mouse Model Blautia producta clade 309 Clostridium bolteae clade 408 Two bacterial compositions were evaluated in a mouse Clostridium innocuum clade 351 model to demonstrate the ability to populate the gastroin Clostridium mayombei clade 354 testinal tract. Bacteria were grown as described in 30 Clostridium tertium clade 252 ***Example 14. Compositions were pre-made under Ruminococcus gnavus clade 360 anaerobic conditions and suspended in PBS+15% glycerol Microbial Clostridium disporicum clade 253 and stored at -70° C. prior to Composition 2 Groups of mice (10 females/group; 5 per cage) were Clostridium orbiscindens clade 494 pre-treated on Days -14 to -5 with an antibiotic cocktail 35 Clostridium symbiosum clade 408 consisting of 10% glucose, kanamycin (0.5 mg/ml), gen Collinsella aerofaciens clade 553 tamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronida Eubacterium rectale clade 444 Zole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), amplicillin Lachnospiraceae bacterium 5 1 57FAA clade 260 (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drinking Blautia producta clade 309 Clostridium innocuum clade 351 water. On Day -3 they received 10 mg/kg. Clindamycin by 40 oral gavage. On Day -1, they were dosed with a microbial Clostridium mayombei clade 354 compositions by oral gavage in a volume of 0.2 mL (Table ZA). Microbial compositions comprised approximately Fecal samples were processed by isolating and sequenc equal numbers of each OTU and were dosed at approxi ing DNA according to ***Example 11 and 12. The OTU mately 1x10, 1x10 and 1x107 per OTU for each compo 45 sition (e.g. microbial composition 1, comprising 15 Strains, assignment of fecal samples from Days -1, 2, 3 and 4 was was dosed at approximately 1.5x10', 1.5x10, and 1.5x10 determined by analyzing 16S-V4 sequence reads and assign total CFU). Fecal samples were collected from each cage on ing OTUs as described in ***Example 11. Clades were Day -1 (approximately 1 hour before dosing) and on Days assigned as described in ***Example 11. Total read counts 2, 3 and 4 post-dosing. Feces were stored frozen prior to 50 were determined for each OTU or each clade by summing processing and sequencing. Weight gain of mice treated with the results from cages of the same experimental group. either microbial compositions was similar to that of naive, Samples with 10 or fewer sequence reads for a given OTU control mice. or clade were considered to be below background and were In parallel, groups of animals treated with the same not included in the Summation process. Results are shown by microbial compositions on Day -1 were challenged on Day OTU (Table TAB) and by clade (Table TAC). TABLE TAB Population of OTUs on Days 2, 3 and 4 following dosing with Microbial Compositions x 10 per OTU x 10 per OTU x 10 per OTU -1 2 3 4 -1 2 3 4 -1 2 3 4 Microbial comp 1 Cl butyricum O 106 51 32 O 10 O 34 195 O O O Cl disporicum 10 1746 1190 887 O 1746 769 1011 201 1117S 1531 1152 US 9,585,921 B2 93 94 TABLE TAB-continued Population of OTUS on Days 2, 3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU 1 x 10 per OTU 1 x 10 per OTU -1 2 3 4 -1 2 3 4 -1 2 3 4 Cl hylemonae O 258 258 84 O 2O3 164 77 O 26S 214 90 Corbiscindens O 188 192 471 O 188 138 276 O 221 174 341 Cl Symbiosum O 485 482 486 O 444 379 447 O S62 427 775 Co aerofaciens O O O O O O O O O O O O C comes O O O O O O O O O O O O L bacterium 5157FAA O 341 336 3S4 O 351 182 356 O 2S6 240 300 R bromii O O O O O O O O O O O O B producta O O O O O O O O O O O O Cl bolteae O O O O O O O O O O O O Cl innocuum O O O O O O O O O O O O Cl mayombei O O O O O O O O O O O O Cl tertium O O O O O O O O O O O O Rignavus O O O O O O O O O O O O Microbial comp 2 Cl disporicum 29 11810 10948. 14672 O 11349 13978 3942 O 11995 700S 6268 Corbiscindens O 510 408 764 O 332 545 544 O 310 319 432 Cl Symbiosum O 559 SO8 375 O 665 494 450 O 396 639 650 Co aerofaciens O O O O O O 1172 O O O 247 O Erectale O O O O O O O 12 O O O 261 L bacterium 5157FAA O 972 8O1 596 O 860 962 844 O 636 1901 1269 B producta O O O O O O O O O O O O Cl innocuum O O O O O O O O O O O O Cl mayombei O O O O O O O O O O O O TABLE TAC Population of Clades on Days 2, 3 and 4 following dosing with Microbial Compositions 1 x 10" Der OTU 1 x 10 per OTU 1 x 10 per OTU -1 2 3 4 -1 2 3 4 -1 2 3 4 Microbial comp 1 clade 252 O 444 252 87 O 198 122 12S 209 394 231 88 clade 253 10 1746 1190 887 O 1746 769 1011 201 11175 1531 1152 clade 260 O 599 594 438 O 554 346 433 O 521 454 390 clade 262 O 14 151 51 O O O O O 12 21 57 clade 309 O 11093 97SO 4023 O 9991 S2O8 S145 19 9311 6369 4951 clade 351 O 9064 10647 7751 O 6528 7259 8213 O 8903 1.0049 8701 clade 354 O O O O O O O 31, 173 O O O clade 360 O 143OO 10220 11036 O 12553. 12989 6889 O 93O8 13483 9292 clade 408 13 8892 12985 12101 23 3952 7260 10652 43 4079 8581. 14929 clade 494 O 226 227 565 O 188 184 411 O 221 2OO 351 clade 537 O O 68 225 O O O O O O O 55 clade 553 O O O O O O O O O O O O Microbial comp 2 clade 253 29 11810 10948. 14672 O 11349 13978 3942 O 11995 700S 6268 clade 260 O 1125 1312 854 O 1049 1295 12SO O 792 2121 1637 clade 309 S4 12S13 13731 7849 O 11610 12004 12672 O 7407 14111 10858 clade 351 O 7651 9939 S936 O 849S 9724 92O7 O 6005 9833 7655 clade 354 149 O 127 429 O O O 39 12 O O O clade 408 18 2242 4989 10480 12 1688 SS80 3789 O 1068 1561 6281 clade 444 41 O 49 2O2 O 18 O 12 O 14 82 1578 clade 494 O 510 46S 1054 O 332 565 596 O 310 319 476 clade 553 O O O O O O 1172 O O O 247 O Upon examining the OTU data in Table TAB, several OTUs such as Co. aerofaciens, C. comes, R. bromii, B. patterns emerge. First, there are a group of OTUs with no producta, Cl. bolteae, Cl. mayombei, Cl, innocuum, Cl. sequence reads on Day -1 that show Subsequent and large 60 tertium and R. gnavus which are not detectable at the OTU numbers of sequence reads on Days 2, 3, or 4; this group level in either the Day -1 sample or in Subsequent samples. includes Cl. butyricum, Cl. hylemonae, Cl. Orbiscindens, Cl. In composition 2, Co. aerofaciens is detected transiently on symbiosum, and L. bacterium 5 157 FAA. Cl. disporicum Day 2 in the 1x10 and 1x107 dose groups: E. rectale in the is comparable to this group as it has sequence reads on Day same experimental groups is detected on Day 3, Suggesting -1 that are very close to background (10 and 29 in compo- 65 a possible relationship between transient population by Co. sitions 1 and 2, respectively), which Subsequently increase aerofaciens followed by E. rectale in these groups of mice. by as much as 1000-fold on Days 2, 3 or 4. Second, there are A striking observation is that the observed number of OTU US 9,585,921 B2 95 96 sequence reads is not highly dose dependent. Overall, the Science Translational Medicine, 2012). In recent years, the data is consistent with a model whereby OTUs populate numbers of infections caused by organisms such as methi rapidly following oral administration. cillin-resistant Staphylococcus aureus, carbapenem-resistant The clade-based analysis in Table TAC was performed to Enterobacteriaceae, Vancomycin-resistant Enterococcus more thoroughly evaluate the population of the GI tract. (VRE), and Clostridium difficile have increased markedly, Clade-based analysis obscures some of the details afforded and many of these strains are acquiring resistance to the few by an OTU analysis. For instance, Cl. tertium and Cl. remaining active antibiotics. Most infections produced by butyricum are members of the same clade and thus a highly antibiotic-resistant bacteria are acquired during hos clade-based analysis cannot distinguish the dynamics of pitalizations, and preventing patient-to-patient transmission these individual OTUs. However, clade-based analysis has the compensatory benefit that it is sensitive to measuring 10 of these pathogens is one of the major challenges confront population changes that can be missed by an OTU-based ing hospitals and clinics. Most highly antibiotic-resistant analysis. The ability of 16S-V4 OTU identification to assign bacterial strains belong to genera that colonize mucosal an OTU as a specific species depends in part on the resolving Surfaces, usually at low densities. The highly complex power of the 16S-V4 region for a particular species or group microbiota that normally colonizes mucosal Surfaces inhib of species. Both the density of available reference 16S 15 its expansion of and domination by bacteria Such as Entero sequences for different regions of the tree as well as the bacteriaceae and Enterococcaceae. Destruction of the nor inherent variability in the 16S gene between different spe mal flora by antibiotic administration, however, cies will determine the definitiveness of a taxonomic anno disinhibition antibiotic-resistant members of these bacterial tation. So in Some cases, the population of a species can be families, leading to their expansion to very high densities followed using clade-based assignments when OTU based (Ubeda et al Journal of Clinical Investigation 2010). High detection is insensitive in a complex population. For density colonization by these organisms can be calamitous instance, the clade-based analysis in Table 2B supports the for the Susceptible patient, resulting in bacteremia and sepsis case that R. bromii, B. producta, Cl. innocuum, and R. (Taur et al. Clinical Infectious Disease, 2012). gnavus were able to populate since each OTU is a sole To test prophylactic use and treatment of a bacterial member of a clade in the microbial compositions and 25 composition test article e.g. spore population, a VRE infec sequence reads went from undetectable on Day -1 to well tion mouse model is used as previously described (Ubeda et above background on Days 2, 3 or 4. 16S V4 sequencing and al, Infectious Immunity 2013, Ubeda et al., Journal of clinical clade-based analysis could not determine whether Cl. ter investigation, 2010). Briefly, experiments are done with tium or Cl. bolteae populated due to the fact that other 7-week-old C57BL/6J female mice purchased from Jackson members of their clades (Cl. butyricum and Cl. Symbiosum, 30 Laboratory, housed with irradiated food, and provided with respectively) were present and shown to populate at the acidified water. Mice are individually housed to avoid con OTU level in the mice. tamination between mice due to coprophagia. For experi In the mice challenged in parallel with C. difficile, animals mental infections with VRE, mice are treated with amplicillin were significantly protected as shown in Table TAD. Mice (0.5 g/liter) in their drinking water, which is changed every gavaged with vehicle (phosphate buffered saline) experi 35 3 days. enced 100% mortality while microbial compositions 1 and 2 In the treatment model, on day 1, mice are infected by protected at all dose levels with between 0 and 10% mor means of oral gavage with 10 CFU of the Vancomycin tality by Day 6, the last day of the experiment. In addition, resistant Enterococcus faecium strain purchased from ATCC weight loss in animals treated with microbial compositions (ATCC 700221). One day after infection (day 1), antibiotic 1 and 2 was minimal compared to animals receiving the 40 treatment is stopped and VRE levels are determined at vehicle gavage. These data confirm that population of the different time points by plating serial dilutions of fecal gastrointestinal tract with microbial compositions confers a pellets on Enterococcosel agar plates (Difico) with Vanco clinical benefit by restoring a state of dysbiosis so that mycin (8 ug/ml. Sigma). VRE colonies are identified by animals can resist infection by a pathogen. appearance and confirmed by Gram staining or other meth 45 ods previously described (e.g. see example 1, 2 and 3). In TABLE TAD addition, as previously described (Ubeda et al Journal of Clinical Investigation 2010), PCR of the VanA gene, which Mortality by experimental group in mice challenged confers resistance to Vancomycin, confirms the presence of with 10' C. difficile spores on Day 0 VRE in infected mice. The test article e.g. bacterial com 50 position, or ethanol treated, gradient purified spore prepa Group Dose (CFU per OTU) Deaths (% mortality) ration (as described herein), fecal Suspension, or antibiotic Vehicle control NA 10 (100%) treatment is delivered in PBS on days 1-3 while the negative Microbial composition 1 109 1 (10%) 108 1 (10%) control contains only PBS and is also delivered on days 1-3 107 0 (0%) by oral gavage. Fresh fecal stool pellets are obtained daily Microbial composition 2 109 0 (0%) 55 for the duration of the experiment from days -7 to day 10. 108 1 (10%) The samples are immediately frozen and stored at -80° C. 107 1 (10%) DNA was extracted using standard techniques and analyzed with 16S or comparable methods (e.g. see example 2 and 3). In the colonization model, amplicillin is administered as Example 36 60 described above for day -7 to day 1, treatment with the test article or vehicle control is administered on day 0-2 and the Prophylactic Use and Treatment in a Mouse Model VRE resistant bacteria at 10 CFU are administered on day of Vancomycin Resistant Enterococcus (VRE) 14. Fecal samples are taken throughout the experiment daily Colonization from -7 to day 21 and submitted for 16S sequencing as 65 previously described (e.g. see examples 2 and 3). The emergence and spread of highly antibiotic-resistant In both models titers of VRE in feces are used to evaluate bacteria represent a major clinical challenge (Snitkin et al the Success of the test article versus the negative control. US 9,585,921 B2 97 98 Furthermore, microbiota composition is assessed for the administration of KPC-Kp in order to measure the concen ability of the test article to induce a healthy microbiome. tration of carbapenem-resistant K. pneumoniae. Stool samples (100 mg diluted in 800 ml of PBS) are plated onto Example 37 MacConkey agar with and without 0.5 ug/ml of imipenem, and the number of CFU per gram of stool was determined. Prophylactic Use and Treatment of a Mouse Model Alternatively other methods may be used to measure the of Carbapenem Resistant Klebsiella (CRKB) levels of carbapenem-resistant K. pneumoniae e.g. per, anti Colonization gen testing, as one who's skilled in the art could perform. Stool samples were collected after 5 days of treatment to The emergence of Klebsiella pneumoniae strains with 10 assess the effects of the antibiotics on the stool microflora decreased Susceptibility to carbapenems is a significant and to measure antibiotic levels in stool. To assess the effects threat to hospitalized patients. Resistance to carbapenems in on the microflora, fresh stool samples as previously these organisms is most frequently mediated by K. pneu described (e.g. see examples 2 and 3). Additional experi moniae carbapenemase (KPC), a class Abeta-lactamase that ments are performed to examine whether the administration also confers resistance to broad-spectrum cephalosporins 15 the test article e.g. bacterial composition resulted in the and commercially available beta-lactam/beta-lactamase elimination or persistence of colonization with KPC-Kp inhibitor combinations (Queenan et al. Clinical Microbiol VA-367. ogy Review, 2007). KPC-producing K. pneumoniae (KPC Mice are treated with subcutaneous clindamycin to reduce Kp) strains often harbor resistance determinants against the normal intestinal flora 1 day before receiving 10 CFU several other classes of antimicrobials, including aminogly of KPC-Kp VA-367 by oral gavage, and the mice continued cosides and fluoroquinolones, resulting in truly multidrug to receive subcutaneous clindamycin every other day for 7 resistant (MDR) organisms (Hirsch et al., Journal of Anti days. Concurrently, for 7 days after oral gavage with KPC microbial Chemotherapy, 2009). Considering the limited Kp, mice received oral gavage of normal saline (control antimicrobial options, infections caused by KPC-Kp pose a group), or the bacterial composition as specified. An addi tremendous therapeutic challenge and are associated with 25 tional dose of Subcutaneous clindamycin was administered poor clinical outcomes 20 days after the administration of KPC-Kp VA-367 to A treatment protocol in a mouse model as previously assess whether low levels of carbapenem-resistant K. pneu described (e.g. Perez et al. Antimicrobial Agents Chemo moniae were present that could be augmented by the elimi therapy, 2011) is used to evaluate the test article e.g. nation of the anaerobic microflora. Stool samples were bacterial composition for treating carbapenem resistant 30 collected at baseline and at 3, 6, 8, 11, 16, and 21 days after Klebsiella and reducing carriage in the GI tract. Female CF1 KPC-Kp VA-367 was given by gavage. The bacterial com mice (Harlan Sprague-Dawley, Indianapolis, Ind.) are used position will be examined by the reduction of CRKB in and are individually housed and weighed between 25 and 30 feces. 9. Unless otherwise indicated, all numbers expressing quan The thoroughly characterized strain of K. pneumoniae, 35 tities of ingredients, reaction conditions, and so forth used in VA-367 (8, 9, 25) is used in this study. This clinical isolate the specification, including claims, are to be understood as is genetically related to the KPC-Kp strain circulating in the being modified in all instances by the term “about.” Accord Eastern United States. Characterization of the resistance ingly, unless otherwise indicated to the contrary, the numeri mechanisms in K. pneumoniae VA-367 with PCR and DNA cal parameters are approximations and may vary depending sequence analysis revealed the presence of blas, bla, 40 upon the desired properties sought to be obtained. At the 1, blast 11, and blast 12 as well as qnrB19 and aacC6')-lb. very least, and not as an attempt to limit the application of Additionally, PCR and DNA sequencing revealed disrup the doctrine of equivalents to the scope of the claims, each tions in the coding sequences of the following outer mem numerical parameter should be construed in light of the brane protein genes: ompK35, ompK36, and ompK37. Anti number of significant digits and ordinary rounding biotic susceptibility testing (AST) was performed with the 45 approaches. agar dilution method and interpreted according to current Unless otherwise indicated, the term “at least preceding recommendations from the Clinical and Laboratory Stan a series of elements is to be understood to refer to every dards Institute (CLSI). A modified Hodge test was per element in the series. formed, according to a method described previously (e.g. While the invention has been particularly shown and see Anderson et al., Journal of Clinical Microbiology, 2007) 50 described with reference to a preferred embodiment and with ertapenem, meropenem, and imipenem. Tigecycline various alternate embodiments, it will be understood by and polymyxin E were evaluated by Etest susceptibility persons skilled in the relevant art that various changes in assays (AB bioMerieux, Solna, Sweden). Results for tige form and details can be made therein without departing from cycline were interpreted as suggested by the U.S. Food and the spirit and scope of the invention. Drug Administration (FDA) and according to CLSI recom 55 All references, issued patents and patent applications mendations (criteria for Pseudomonas) for polymyxin E. cited within the body of the instant specification are hereby Mice (10 per group) are assigned to either a test article incorporated by reference in their entirety, for all purposes. e.g. bacterial composition, ethanol treated, spore preparation (e.g. see example 6), antibiotic clindamycin, piperacillin ADDITIONAL TABLES taZobactam, tigecycline, ertapenem, cefepime, ciprofloxa 60 cin, or combination thereof or control group receiving only Table 1: List of Operational Taxonomic Units (OTU) with the vehicle. They are administered the test article daily from Taxonomic Assignments Made to Genus, Species, and Phy day -10 to day 0. On day 0, 10 CFU of KPC-Kp VA-367 logenetic Clade diluted in 0.5 ml phosphate-buffered saline (PBS) was Clade membership of bacterial OTUs is based on 16S administered by oral gavage using a stainless-steel feeding 65 sequence data. Clades are defined based on the topology of tube (Perfektum; Popper & Sons, New Hyde Park, N.Y.). a phylogenetic tree that is constructed from full-length 16S Stool samples were collected 1, 4, 6, and 11 days after the sequences using maximum likelihood methods familiar to US 9,585,921 B2 99 100 individuals with ordinary skill in the art of phylogenetics. species with another from the same clade are likely to have Clades are constructed to ensure that all OTUs in a given conserved ecological function and therefore are useful in the clade are: (i) within a specified number of bootstrap Sup- present invention. All OTUs are denoted as to their putative ported nodes from one another, and (ii) within 5% genetic capacity to form spores and whether they are a Pathogen or similarity. OTUs that are within the same clade can be s distinguished as genetically and phylogenetically distinct Pathobiont (see Definitions for description of “Pathobiont'). from OTUs in a different clade based on 16S-V4 sequence NIAID Priority Pathogens are denoted as Category-A, data, while OTUs falling within the same clade are closely Category-B, or Category-C,& YYYY and Opportunistic Patho related. OTUs falling within the same clade are evolution- gens are denoted as OP. OTUs that are not pathogenic or arily closely related and may or may not be distinguishable to for which their ability to exist as a pathogen is unknown a from one another using 16S V4 sequence data. Members of denoted as N.The SEQID Number denotes the identifier the same clade, due to their evolutionary relatedness, play of the OTU in the Sequence Listing File and Public DB similar functional roles in a microbial ecology Such as that Accession denotes the identifier of the OTU in a public found in the human gut. Compositions Substituting one sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Eubacterium saburreun 858 ABS25414 clade 178 Y N Etibacterium sp. oral clone 866 AY3493.76 clade 178 Y N IROO9 Lachnospiraceae bacterium 1061 HQ616401 clade 178 Y N ICM62 Lachnospiraceae bacterium 1062 HQ616384 clade 178 Y N MSX33 Lachnospiraceae bacterium 1063 ADDSO1000069 clade 178 Y N oral taxon 107 Alicyclobacilius acidocaidarius 122 NR 074721 clade 179 Y N Cliostridium barrati 555 NR 029229 clade 223 Y N Cliostridium coicanis 576 FJ95.7863 clade 223 Y N Clostridium paraputrificum 611 ABS36771 clade 223 Y N Cliostridium Sardiniense 621 NR 041006 clade 223 Y N Eubacterium budayi 837 NR 024682 clade 223 Y N Eubacterium moniiforme 851 HF558373 clade 223 Y N Eubacterium multiforme 852 NR 024683 clade 223 Y N Eubacterium nitritogenes 853 NR 024684 clade 223 Y N Anoxybacilius flavithermus 173 NR 074667 clade 238 Y N Bacilius aerophilus 196 NR 042339 clade 238 Y N Bacilius aestuarii 197 GQ980243 clade 238 Y N Bacilius amyloiquefaciens 199 NR 075005 clade 238 Y N Bacilius anthracis 200 AAENO1000020 clade 238 Y Category-A Bacilius atrophaeus 201 NR 075016 clade 238 Y OP Bacilius badius 202 NR 036893 clade 238 Y OP Bacilius cereus 203 ABDJO1000015 clade 238 Y OP Bacilius circuians 204 AB271747 clade 238 Y OP Bacilius firmus 207 NR 025842 clade 238 Y OP Bacilius flexus 208 NR 024691 clade 238 Y OP Bacilius fordii 209 NR 025786 clade 238 Y OP Bacilius haimapalus 211 NR 026144 clade 238 Y OP Bacilius herbersteinensis 213 NR 042286 clade 238 Y OP Bacilius idriensis 215 NR 043268 clade 238 Y OP Bacilius ienius 216 NR 040792 clade 238 Y OP Bacilius licheniformis 217 NC OO6270 clade 238 Y OP Bacilius negaterium 218 GU2S2124 clade 238 Y OP Bacilius neaisonii 219 NR 044546 clade 238 Y OP Bacilius niabensis 220 NR 043334 clade 238 Y OP Bacilius niacini 221 NR 024.695 clade 238 Y OP Bacilius pocheonensis 222 NR 041377 clade 238 Y OP Bacilius pumilus 223 NR 074977 clade 238 Y OP Bacilius Safensis 224 JQ624766 clade 238 Y OP Bacilius simplex 225 NR 042136 clade 238 Y OP Bacilius Sonorensis 226 NR 025130 clade 238 Y OP Bacilius Sp. 10403023 227 CAETO1000089 clade 238 Y OP MM10403.188 Bacilius sp. 2. A 57 CT2 230 ACWDO1000095 clade 238 Y OP Bacilius Sb. 2008724.126 228 GU2S2108 clade 238 Y OP Bacilius Sb. 2008724139 229 GU2S2111 clade 238 Y OP Bacilius sp. 7 16AIA 231 FN397518 clade 238 Y OP Bacilius sp. AP8 233 JX101689 clade 238 Y OP Bacillus sp. B27(2008) 234 EU362173 clade 238 Y OP Bacilius Sp. BT1B CT2 235 ACWCO1000034 clade 238 Y OP Bacilius sp. GB1.1 236 FT897765 clade 238 Y OP Bacilius sp. GB9 237 FT897766 clade 238 Y OP Bacilius sp. HU19.1 238 FT897769 clade 238 Y OP Bacilius Sp. HU29 239 FJ897771 clade 238 Y OP Bacilius sp. HU33.1 240 FT897772 clade 238 Y OP Bacilius sp. JC6 241 JF8248OO clade 238 Y OP Bacilius sp. oral taxon F79 248 HMO99654 clade 238 Y OP US 9,585,921 B2 101 102 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Bacilius sp. SRC DSF1 243 GU797.283 clade 238 Y OP Bacilius sp. SRC DSF10 242 GU797.292 clade 238 Y OP Bacilius sp. SRC DSF2 244 GU797284 clade 238 Y OP Bacilius sp. SRC DSF6 24S GU797.288 clade 238 Y OP Bacilius sp. tc09 249 HQ844242 clade 238 Y OP Bacilius sp. zh168 2SO FJ851424 clade 238 Y OP Bacilius Sphaericits 251 DQ286318 clade 238 Y OP Bacilius sporothermodurans 252 NR 026010 clade 238 Y OP Bacilius subtiis 253 EU627588 clade 238 Y OP Bacilius thermoamylovorans 254 NR 029151 clade 238 Y OP Bacilius thuringiensis 255 NC O08600 clade 238 Y OP Bacilius weihenstephanensis 256 NR 074926 clade 238 Y OP Geobacilius kaustophilus 933 NR 074989 clade 238 Y N Geobacilius 936 NR 040794 clade 238 Y N Stearothermophilus Geobacilius 938 NR 074976 clade 238 Y N thermodenitrificans Geobacilius 939 NR 043022 clade 238 Y N thermoglucosidasius Lysinibacilius sphaericits 1193 NR 074883 clade 238 Y N Clostridiales sp. SS3 4 543 AY305316 clade 246 Y N Clostridium beijerinckii 557 NR 074,434 clade 252 Y N Cliostridium bointinum 560 NC 01.0723 clade 252 Y Category-A Clostridium butyricum 561 ABDTO1000017 clade 252 Y N Cliostridium chauvoei 568 EU106372 clade 252 Y N Clost ridium favososportin 582 X76749 clade 252 Y N Clostridium histolyticum 592 HF558362 clade 252 Y N Cliostridium isatidis 597 NR 026347 clade 252 Y N Cliostridium inosum 602 FR870444 clade 252 Y N Clostridium Santagoforme 622 NR 026490 clade 252 Y N Clostridium septicum 624 NR 026020 clade 252 Y N Clostridium sp. 7. 2 43FAA 626 ACDKO1000101 clade 252 Y N Clost ridium sporogenes 645 ABKWO2000003 clade 252 Y N Clost ridium tertium 653 Y18174 clade 252 Y N Cliostridium carnis 564 NR 044716 clade 253 Y N Cliostridium ceiatum S6S X77844 clade 253 Y N Clostridium disporicum 579 NR 026491 clade 253 Y N Clost ridium gasigenes 585 NR 024945 clade 253 Y N Clostridium quinii 616 NR 026149 clade 253 Y N Clostridium hyiemonae 593 ABO23973 clade 260 Y N Cliostridium Scindens 623 AF262238 clade 260 Y N Lachnospiraceae bacterium 1054 ACTRO1000020 clade 260 Y N 5 1 57FAA Clostridium glycyrrhizinilyticum 588 AB233O29 clade 262 Y N Cliostridium nexile 6O7 X73443 clade 262 Y N Coprococci is comes 674 ABVRO1000038 clade 262 Y N Lachnospiraceae bacterium 1048 ACTMO1000065 clade 262 Y N 1 1 57FAA Lachnospiraceae bacterium 1049 ACTNO1000028 clade 262 Y N 1 4 56FAA Lachnospiraceae bacterium 1057 ACWQ01000079 clade 262 Y N 8 1 57FAA Ruminococcus lactaris 1663 ABOUO2000049 clade 262 Y N Raiminococci is torques 1670 AAVPO2OOOOO2 clade 262 Y N Paenibacilius iaitius 1397 NR 04.0882 clade 270 Y N Paenibacilius polymyxa 1399 NR 037006 clade 270 Y N Paenibacilius sp. HGF5 1402 AEXSO1000095 clade 270 Y N Paenibacilius sp. HGF7 1403 AFDHO1000147 clade 270 Y N Etibacterium sp. oral clone 868 AY3493.79 clade 298 Y N JIO12 Alicyclobacilius contaminans 124 NR 041475 clade 301 Y N Alicyclobacilius herbarius 126 NR 024.753 clade 301 Y N Alicyclobacilius pomorum 127 NR 024801 clade 301 Y N Bialitia coccoides 373 ABS71656 clade 309 Y N Bialitia glicerasea 3.74 ABS88O23 clade 309 Y N Bialitia glicerasei 375 AB439724 clade 309 Y N Biatitia hansenii 376 ABYUO2OOOO37 clade 309 Y N Biatitia initi 378 AB691576 clade 309 Y N Bialitia producia 379 AB600998 clade 309 Y N Biatitia schinki 380 NR 026312 clade 309 Y N Blautia sp. M25 381 HM626178 clade 309 Y N Biatitia stercoris 382 HM626177 clade 309 Y N Bialitia welerae 383 EFO36467 clade 309 Y N Bryantella formatexigens 439 ACCLO2000018 clade 309 Y N Cliostridium coccoides 573 EFO25906 clade 309 Y N Eubacterium ceiliuliosolvens 839 AY178842 clade 309 Y N US 9,585,921 B2 103 104 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Lachnospiraceae bacterium 1056 ACTWO1000014 clade 309 Y N 6 1 63FAA Ruminococcus hansenii 1662 M59114 clade 309 Y N Ruminococcus obeim 1664 AY169419 ade 309 Y N Raiminococci is sp. 1666 ACIIO1 OOO172 clade 309 Y N 5 1 39BFAA Raiminococci is sp. K. 1 1669 AB2222O8 clade 309 Y N Syntrophococci is sucronitians 1911 NR 036869 clade 309 Y N Bacilius alcalophilus 198 X76436 clade 327 Y N Bacilius clausii 205 FN397477 clade 327 Y OP Bacilius gelatini 210 NR 025595 clade 327 Y OP Bacilius halodurans 212 AY144582 clade 327 Y OP Bacilius sp. oral taxon F26 246 HMO99642 clade 327 Y OP Cliostridium innocuum 595 M23732 clade 351 Y N Clostridium sp. HGF2 628 AENWO1000022 clade 351 Y N Clostridium perfingens 612 ABDWO1000023 clade 353 Y Category-B Sarcina ventriciti 1687 NR 026146 clade 353 Y N Cliostridium bartietti 556 ABEZO2000012 clade 354 Y N Clostridium bifermenians 558 X73437 clade 354 Y N Clostridium ghonii 586 ABS42933 clade 354 Y N Clostridium glycolicum 587 FJ384385 clade 354 Y N Clostridium mayombei 60S FR733682 clade 354 Y N Cliostridium Sordeli 625 AB448946 clade 354 Y N Clostridium sp. MT4 E 635 FJ159523 clade 354 Y N Eubacterium tenue 872 M591.18 clade 354 Y N Clostridium argentinense 553 NR 029232 clade 355 Y N Clostridium sp. JC122 630 CAEVO1OOO127 clade 355 Y N Clostridium sp. NMBHI 1 636 JNO93130 clade 355 Y N Cliostridium subterminaie 650 NR 041795 clade 355 Y N Clostridium sulfidigenes 651 NR 044161 clade 355 Y N Dorea formicigenerans 773 AO2OOOOO6 clade 360 Y N Dorea longicatena 774 A132842 clade 360 Y N Lachnospiraceae bacterium 1050 ADLBO1000035 clade 360 Y N 2 1 46FAA Lachnospiraceae bacterium 1051 ACTOO1000052 clade 360 Y N 2 1 58FAA Lachnospiraceae bacterium 1053 ADCRO1000030 clade 360 Y N 4. 1 37FAA Lachnospiraceae bacterium 1058 ACTXO1000023 clade 360 Y N 9 1. 43BFAA Raiminococcus gnavus 1661 X94967 clade 360 Y N Ruminococcus sp. ID8 1668 AY960S64 clade 360 Y N Bialitia hydrogenotrophica 377 ACBZO1000217 clade 368 Y N Lactonifactor longovifornis 1147 DQ100449 clade 368 Y N Robinsoniella peoriensis 1633 AF44S258 clade 368 Y N Eubacterium infirmum 849 U13039 clade 384 Y N Eubacterium sp. WAL 14571 864 FJ687606 clade 384 Y N Erysipelotrichaceae bacterium 823 ACZWO1000054 clade 385 Y N 5 2 54FAA Eubacterium biforme 835 ABYTO1OOOOO2 clade 385 Y N Eubacterium cylindroides 842 FP929O41 clade 385 Y N Eubacterium doichum 844 L34682 clade 385 Y N Eubacterium sp. 3. 1 31 861 ACTLO1000045 clade 385 Y N Eubacterium tortuosum 873 NR 044648 clade 385 Y N Buileidia extricia 441 ADFRO1000011 clade 388 Y N Soiobacterium moorei 1739 AECQ01000039 clade 388 Y N Coprococci is catus 673 EU266552 clade 393 Y N Lachnospiraceae bacterium 1064 HMO99641 clade 393 Y N oral taxon F15 Cliostridium cochlearium 574 NR 044717 clade 395 Y N Cliostridium maienominatium 604 FR749893 clade 395 Y N Cliostridium tetani 654 NC OO4557 clade 395 Y N Acetivibrio ethanolgignens 6 FR749897 clade 396 Y N Anaerosporobacter mobilis 161 NR 042953 clade 396 Y N Bacteroidespectinophilus 288 ABVQ0100.0036 clade 396 Y N Cliostridium aminovaiericum 551 NR 029245 clade 396 Y N Clostridium phytofermenians 613 NR 074652 clade 396 Y N Eubacterium hai 848 L34621 clade 396 Y N Eubacterium yianophilum 875 L34628 clade 396 Y N Ruminococcus Caidius 1658 NR 029160 clade 406 Y N Riminococcits 1659 FP929052 clade 406 Y N champanellensis Ruminococcus sp. 18P13 166S AJS15913 clade 406 Y N Ruminococcus sp. 9SE51 1667 FM954974 clade 406 Y N Anaerostipes caccae 162 ABAXO3000023 clade 408 Y N Anaerostipes sp. 3 2 56FAA 163 ACWBO1000002 clade 408 Y N US 9,585,921 B2 105 106 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Cliostridiaies bacterium 541 ABQRO1000074 clade 408 Y N 1 7 47FAA Clostridiales sp. SM4 1 542 FP929060 clade 408 Y N Clostridiales sp. SSC 2 544 FP929061 clade 408 Y N Cliostridium aerotoierans S46 X761.63 clade 408 Y N Cliostridium aidenense 547 NR 043680 clade 408 Y N Clostridium algidiyianolyticum 550 NR 028726 clade 408 Y N Clostridium amygdalinum 552 AY353957 clade 408 Y N Clost ridium asparagiforme 554 ACCJO1000522 clade 408 Y N Cliostridium boiteae 559 ABCCO2000039 clade 408 Y N Cliostridium celerecrescens 566 JQ246092 clade 408 Y N Cliostridium citroniae 569 ADLO1OOOOS9 clade 408 Y N Clostridium clostridiiformes 571 M59089 clade 408 Y N Clostridium clostridioforme 572 NR 044715 clade 408 Y N Clostridium hathewayi 590 AY552788 clade 408 Y N Cliostridium indois 594 AFO28351 clade 408 Y N Cliostridium iavaiense 600 EF564277 clade 408 Y N Clostridium saccharolyticum 620 CPOO2109 clade 408 Y N Clostridium sp. M62 1 633 ACFXO2000046 clade 408 Y N Clostridium sp. SS2 1 638 ABGCO3OOOO41 clade 408 Y N Clostridium sphenoides 643 X73449 clade 408 Y N Clostridium symbiosum 652 ADLQ01000114 clade 408 Y N Clostridium xylanolyticum 658 NR 037068 clade 408 Y N Eubacterium had run 847 FR749933 clade 408 Y N Lachnospiraceae bacterium 1052 ACTPO10001.24 clade 408 Y N 3 1 57FAA CT1 Lachnospiraceae bacterium 1OSS ACTSO1OOOO81 clade 408 Y N 5 1 63FAA Lachnospiraceae bacterium A4 1059 DQ789118 clade 408 Y N Lachnospiraceae bacterium 1060 EU728771 clade 408 Y N DJF VP30 Lachnospiraceae genomosp. 106S AY2786.18 clade 408 Y N C1 Clostridium difficile 578 NC 013315 clade 409 Y OP Eubacterium sp. AS15b 862 HQ616364 clade 428 Y N Eubacterium sp. OBRC9 863 HQ616354 clade 428 Y N Etibacterium sp. oral clone 871 AY947497 clade 428 Y N OH3A Eubacterium yuri 876 AEESO1 OOOO73 clade 428 Y N Clostridium acetobutyllicum 545 NR 074511 clade 430 Y N Clostridium algidicarnis 549 NR 041746 clade 430 Y N Cliostridium cadaveris S62 ABS42932 clade 430 Y N Cliostridium carboxidivorans 563 FR733710 clade 430 Y N Cliostridium esteriheticum 580 NR 042153 clade 430 Y N Clostridium fallax 581 NR 044714 clade 430 Y N Clostridium feisineum 583 AF2705O2 clade 430 Y N Clostridium frigidicarnis 584 NR 024919 clade 430 Y N Clostridium kluyveri 598 NR 0741.65 clade 430 Y N Clostridium magnum 603 X77835 clade 430 Y N Clostridium putrefaciens 615 NR 024995 clade 430 Y N Clostridium sp. HPB 46 629 AY862516 clade 430 Y N Clostridium tyrobutyricum 656 NR 044718 clade 430 Y N Sutterella parvirubra 1899 AB3OO989 clade 432 Y N Acetanaerobacterium 4 NR 042930 clade 439 Y N elongatum Cliostridium cellulosi 567 NR 044624 clade 439 Y N Ethanoligenens harbinense 832 AY675965 clade 439 Y N Eubacterium reciaie 856 FP929.042 clade 444 Y N Etibacterium sp. oral clone 865 AY349374 clade 444 Y N GIO38 Lachnobacterium bovis 1O4S GU324.407 clade 444 Y N Roseburia Cecicoia 1634 GU233441 clade 444 Y N Roseburia faecalis 1635 AY804149 clade 444 Y N Roseburia faecis 1636 AY305310 clade 444 Y N Roseburia hominis 1637 A270482 clade 444 Y N Roseburia intestina is 1638 FP929OSO clade 444 Y N Roseburia intinivorans 1639 A270473 clade 444 Y N Brevibacilius brevis 410 NR 041524 clade 448 Y N Brevibacilius laterosporus 414 NR 037005 clade 448 Y N Bacilius coagulans 206 DQ297928 clade 451 Y OP Sporolactobacilius inulinus 1752 NR 040962 clade 451 Y N Kochiria palustris 1041 EU333884 clade 453 Y N Nocardia farcinica 1353 NC OO6361 clade 455 Y N Bacilius sp. oral taxon F28 247 HMO996SO clade 456 Y OP Catenibacterium mitsuokai 495 ABO3O224 clade 469 Y N Clostridium sp. TM 40 640 AB249652 clade 469 Y N US 9,585,921 B2 107 108 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Coprobacilius cateniformis 670 ABO3O218 clade 469 Y N Coprobacilius sp. 29 1 671 ADKXO1000057 clade 469 Y N Cliostridium recium 618 NR 029271 clade 470 Y N Eubacterium nodatum 854 U13O41 clade 476 Y N Etibacterium saphentin 859 NR 026.031 clade 476 Y N Etibacterium sp. oral clone 867 AY349373 clade 476 Y N JHO12 Etibacterium sp. oral clone 870 AY3493.78 clade 476 Y N JSOO1 Faecalibacterium prausnitzi 880 ACOPO2000011 clade 478 Y N Gemmiger formicilis 932 GUS 62446 clade 478 Y N Subdoigranulum variabile 1896 AJS18869 clade 478 Y N Clostridiaceae bacterium JC13 532 JF824.807 clade 479 Y N Clostridium sp. MLG055 634 AF30443S clade 479 Y N Erysipelotrichaceae bacterium 822 ACTUO1000113 clade 479 Y N 3 1. 53 Cliostridium cocieatum 575 NR 026495 clade 481 Y N Cliostridium ranostin 617 M23731 clade 481 Y N Clostridium saccharogumia 619 DQ100445 clade 481 Y N Clostridium spiroforme 644 X73441 clade 481 Y N Coprobacilius sp. D7 672 ACDTO1000199 clade 481 Y N Cliostridiaies bacterium 535 AB477431 clade 482 Y N SY8519 Clostridium sp. SY8519 639 APO12212 clade 482 Y N Eubacterium ramitius 855 AJO11522 clade 482 Y N Erysipeiothrix inopinata 819 NR 025594 clade 485 Y N Erysipeiothrix rhusiopathiae 820 ACLKO1000021 clade 485 Y N Erysipeiothrix tonsillarum 821 NR 040871 clade 485 Y N Holdemania filiformis 1004 Y11466 clade 485 Y N Mollicutes bacterium p ACH93 1258 AY297808 clade 485 Y N Coxieia burnetii 736 CPOOO890 clade 486 Y Category-B Cliostridium hiranonis 591 ABO23970 clade 487 Y N Clostridium in regulare 596 NR 029249 clade 487 Y N Clost ridium orbiscindens 609 Y18187 clade 494 Y N Clostridium sp. NML 04A032 637 EU815224 clade 494 Y N Flavonifactor plautii 886 AY724678 clade 494 Y N Pseudoflavonifactor capiliosus 1591 AY136666 clade 494 Y N Ruminococcaceae bacterium 1655 ADDXO1000083 clade 494 Y N D16 Acetivibrio cellulolyticus 5 NR 025917 clade 495 Y N Cliostridium aidrichi 548 NR 026,099 clade 495 Y N Clostridium clarifiavum 570 NR 041235 clade 495 Y N Cliostridium Stercorarium 647 NR 025 100 clade 495 Y N Cliostridium straminisolvens 649 NR 024829 clade 495 Y N Cliostridium thermocelium 655 NR 074629 clade 495 Y N Fusobacterium nucleatum 901 ADVKO1000034 clade 497 Y N Eubacterium barkeri 834 NR 044661 clade 512 Y N Eubacterium caiianderi 838 NR 026330 clade 512 Y N Eubacterium inosum 850 CPOO2273 clade 512 Y N Anaerotruncus coihominis 164 ABGDO2000021 clade 516 Y N Clostridium methylpentosum 606 ACECO1000059 clade 516 Y N Clostridium sp. YIT 12070 642 AB4912O8 clade 516 Y N Hydrogenoanaerobacterium 1005 NR 044.425 clade 516 Y N Saccharov'Orans Ruminococcus albus 1656 AY4456OO clade 516 Y N Raiminococci is fiavefaciens 1660 NR 025931 clade 516 Y N Clostridium haemolyticum 589 NR 024749 clade 517 Y N Clostridium novyi 608 NR 074343 clade 517 Y N Clostridium sp. LMG 16094 632 X95274 clade 517 Y N Eubacterium ventriosum 874 L34421 clade 519 Y N Bacteroides galactatronicus 280 DQ497994 clade 522 Y N Etibacterium eigens 845 CPOO1104 clade 522 Y N Lachnospira multipara 1046 FR733699 clade 522 Y N Lachnospira pectinoschiza 1047 L14675 clade 522 Y N Lactobacilius rogosae 1114 GU269544 clade 522 Y N Bacilius horii 214 NR 036860 clade 527 Y OP Bacilius sp. 9 3AIA 232 FN397519 clade 527 Y OP Eubacterium brachy 836 U13038 clade 533 Y N Filifactor alocis 881 CPOO2390 clade 533 Y N Filifactor villosus 882 NR 041928 clade 533 Y N Clostridium leptum 6O1 AJ3OS238 clade 537 Y N Clostridium sp. YIT 12069 641 AB4912O7 clade 537 Y N Clost ridium sporosphaeroides 646 NR 044835 clade 537 Y N Eubacterium 841 HMO37995 clade 537 Y N coprostanoligenes Ruminococcus bromii 1657 EU266549 clade 537 Y N US 9,585,921 B2 109 110 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Eubacterium Siraeum 860 ABCAO3000054 clade 538 Y N Cliostridium viride 657 NR 026.204 clade 540 Y N Oscillibacter sp. G2 1386 HM626173 clade 540 Y N Oscillibacter valericigenes 1387 NR 074793 clade 540 Y N Oscillospira guilliermondii 1388 ABO40495 clade 540 Y N Butyrivibrio crossotus 455 ABWNO1000012 clade 543 Y N Clostridium sp. L2 50 631 AAYWO2000018 clade 543 Y N Coprococci is entiactus 675 EFO31543 clade 543 Y N Coprococcus sp. ART55 1 676 AY3SO746 clade 543 Y N Eubacterium ruminantium 857 NR 024661 clade 543 Y N Collinseila aerofaciens 659 AAVNO2000007 clade 553 Y N Alkaliphilus metalliredigenes 137 AY137848 clade 554 Y N Alkaliphilus oremlandii 138 NR 043674 clade 554 Y N Cliostridium Stickiandi 648 LO4167 clade 554 Y N Turicibacter sanguinis 1965 AF349724 clade 555 Y N Fulvimonas sp. NML 060897 892 EF589680 clade 557 Y N Desulfitobacterium frappieri 753 AJ276701 clade 560 Y N Desulfitobacterium hafniense 754 NR 074996 clade 560 Y N Desulfotomaculum nigrificans 756 NR 044832 clade 560 Y N Lutiispora thermophila 1191 NR 041236 clade 564 Y N Brachyspira pilosicoli 405 NR 075.069 clade 565 Y N Eggerihelia lenia 778 AF292375 clade 566 Y N Streptomyces albits 1888 A697941 clade 566 Y N Chlamydiales bacterium NS11 SOS JN606O74 clade 567 Y N Anaerofustis stercorihominis 159 ABILO2000005 clade 570 Y N Butyricicocci is pullicaecorum 453 HEHA93440 clade 572 Y N Eubacterium desmoians 843 NR 044644 clade 572 Y N Papillibacter cinnamivorans 1415 NR 025.025 clade 572 Y N Sporobacter termitidis 1751 NR 044972 clade 572 Y N Deferribacteres sp. oral clone 744 AY349371 clade 575 Y N JVOO6 Cliostridium coinum 577 NR 026151 clade 576 Y N Clostridium lactatifermenians 599 NR 025651 clade 576 Y N Clostridium piliforme 614 D14639 clade 576 Y N Saccharomonospora viridis 1671 XS4286 clade 579 Y N Thermobifida fisca 1921 NC 007333 clade 579 Y N Leptospira iicerasiae 1164 EF612284 clade 585 Y OP Moorelia thermoacetica 1259 NR 075001 clade 590 Y N Thermoanaerobacter 1920 CPOOO924 clade 590 Y N pseudeihanolicits Flexistipes sinusarabici 888 NR 074881 clade 591 Y N Gioeobacter violiaceus 942 NR 074282 clade 596 Y N Etibacterium sp. oral clone 869 AY349377 clade 90 Y N JNO88 Cliostridium oroticum 610 FR749922 clade 96 Y N Clostridium sp. D5 627 ADBGO1000142 clade 96 Y N Eubacterium contorium 840 FR749946 clade 96 Y N Etibacterium fissicatena 846 FR74993S clade 96 Y N Corynebacterium coyleae 692 X96497 clade 100 N N Corynebacterium mucifaciens 711 NR 0263.96 clade 100 N N Corynebacterium 733 AM397636 clade 100 N N itreicelerivorans Corynebacterium appendicis 684 NR 028951 clade 102 N N Corynebacterium genitalium 698 ACLJO1000031 clade 102 N N Corynebacterium glauctim 699 NR 028971 clade 102 N N Corynebacterium imitans 703 AF537597 clade 102 N N Corynebacterium riegelii 719 EU848548 clade 102 N N Corynebacterium sp. 723 HE575405 clade 102 N N L 2012475 Corynebacterium sp. NML 724 GU2384.09 clade 102 N N 93 0481 Corynebacterium 728 YO9655 clade 102 N N Sundsvallense Corynebacterium tuscaniae 730 AY677186 clade 102 N N Prevoteia maculosa 1504 AGEKO1000035 clade 104 N N Prevoteia oris 1513 ADDVO1000091 clade 104 N N Prevoteiia Saivae 1517 AB108826 clade 104 N N Prevotella sp. ICM55 1521 HQ616399 clade 104 N N Prevoteila sp. oral clone 1528 AYOO5057 clade 104 N N AAO2O Prevoteila sp. oral clone GIO32 1538 AY349396 clade 104 N N Prevoteila sp. oral taxon G70 1558 GU4321.79 clade 104 N N Prevoteila corporis 1491 L164.65 clade 105 N N Bacteroides sp. 4 1 36 312 ACTCO1000133 clade 110 N N Bacteroides sp. AR20 31S AF139524 clade 110 N N Bacteroides sp. D20 319 ACPTO1OOOOS2 clade 110 N N US 9,585,921 B2 111 112 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Bacteroides sp. F 4 322 AB470322 10 Bacteroides uniformis 329 ABOSO110 10 Prevoteia nanceiensis 510 JN867228 27 Prevoteila sp. oral taxon 299 S48 ACWZO1 OOOO26 27 Prevoteila bergensis 485 ACKSO1 OOO1 OO 28 Prevoteia buccais 489 JN867261 29 Prevoteia timonensis S64 ADEFO1 OOOO12 29 Prevoteia orais 512 AEPEO1 OOOO21 30 Prevotella sp. SEQ072 525 JN867238 30 LeticonoStoc Carnostin 177 NR 040811 35 Leticonostoc gasicomitatin 179 FN822744 35 Leticonostoc inhae 18O NR O25204 35 Leuconostoc kimchii 181 NR O75O14 35 Edwardsielia tarda 777 CPOO2154 39 Photorhabdus asymbiotica 466 Z76752 39 Psychrobacter arcticus 607 CPOOOO82 41 Psychrobacter cibarius 608 HQ698586 41 Psychrobacter cryohaiolentis 609 CPOOO323 41 Psychrobacter faecalis 610 HQ698566 41 Psychrobacter nivimaris 611 HQ698587 41 Psychrobacter pulmonis 612 HQ698.582 41 Pseudomonas aeruginosa 592 AABQ07000001 S4 Pseudomonas sp. 2. 1 26 600 ACWUO1 OOO2S7 S4 Corynebacterium confusum 691 S886 58 Corynebacterium propinquium 712 R 037038 58 Corynebacterium 713 84258 58 pseudodiphtheriticum Bartonella baciliiformis 338 C 008783 59 Bartonella grahamii 339 POO1562 59 Bartoneia henseiae 340 C OO5956 59 Bartonelia quintana 341 X8977OO 59 Bartoneia tamiae 342 F672728 59 Bartoneia washoensis 343 719017 59 Bricelia aborints 430 CBJO1000075 59 Category-B Bruceiia canis 431 R 044652 59 Category-B Bruceiia ceii 432 CJDO1 OOOOO6 59 Category-B Bruceiia neitensis 433 EOO9462 59 Category-B Bruceiia microti 434 R 042549 59 Category-B Bruceiia ovis 435 C OO9504 59 Category-B Brucella sp. 83 13 436 CBQ01000040 59 Category-B Brucella sp. BO1 437 UO532O7 59 Category-B Bruceiia Suis 438 ACBKO1OOOO34 59 Category-B Ochrobactrum anthropi 360 NC 009667 59 Ochrobactrum intermedium 361 ACQAO1000001 59 Ochrobactrum 362 DQ365921 59 pseudintermedium Prevoteila genomosp. C2 496 AY278625 8. 64 Prevoteia multisaccharivorax 509 FJEO1OOOO16 8. 64 Prevoteia sp. oral clone 543 Y55.0997 8. e 64 IDR CEC OO55 Prevoteia sp. oral taxon 292 547 Q422735 64 Prevoteia sp. oral taxon 300 549 U4O9549 64 Prevoteia marshii 505 EEIO1OOOO70 66 Prevoteia sp. oral clone IKO53 544 Y3494O1 66 Prevoteia sp. oral taxon 781 554 Q422744 66 Prevoteia sterCorea S62 B244774 66 Prevoteia brevis 487 R 041954 67 Prevoteia ruminicoia S16 POO2006 67 Prevoteila sp. sp24 S60 BOO3384 67 Prevoteila sp. sp34 S61 BOO338S 67 Prevoteia aibensis 483 R O25300 68 Prevoteila copri 490 CBXO2OOOO14 68 Prevoteia ottiorum S14 6472 68 Prevoteia sp. BI 42 S18 S81354 68 Prevoteia sp. oral clone S46 Y2O7050 68 P4PB 83 P2 Prevoteia sp. oral taxon G60 557 U4321.33 68 Prevoteia annii 484 B547670 69 Bacteroides caccae 268 U1366.86 70 Bacteroides finegoidii 277 B222699 70 Bacteroides intestina is 283 BLO2OOOOO6 71 Bacteroides sp. XB44A 326 AM230649 71 Bifidobacteriaceae genomosp. 345 AY278612 72 C1 Bifidobacterium adolescentis 346 AAXDO2OOOO18 8. 72 Bifidobacterium angulatum 347 ABYSO2OOOOO4 72 N N US 9,585,921 B2 113 114 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Bifidobacterium animalis 348 CPOO1606 clade 172 N N Bifidobacterium breve 350 CPOO2743 clade 172 N N Bifidobacterium catenulatum 351 ABXYO1000019 clade 172 N N Bifidobacterium dentium 352 CPOO1750 clade 172 N OP Bifidobacterium gallicum 353 ABXB03000004 clade 172 N N Bifidobacterium infantis 354 AY151398 clade 172 N N Bifidobacterium 355 AB491757 clade 172 N N kashiwanohense Bifidobacterium longum 356 ABQQ01000041 clade 172 N N Bifidobacterium 357 ABXXO2000002 clade 172 N N pseudocatentiatin Bifidobacterium pseudolongtim 358 NR 043442 clade 172 N N Bifidobacterium scardovii 359 AJ307OOS clade 172 N N Bifidobacterium sp. HM2 360 AB42S276 clade 172 N N Bifidobacterium sp. HMLN12 361 JFS19685 clade 172 N N Bifidobacterium sp. M45 362 HM626176 clade 172 N N Bifidobacterium sp. MSX5B 363 HQ616382 clade 172 N N Bifidobacterium sp. TM 7 364 AB218.972 clade 172 N N Bifidobacterium thermophilum 365 DQ340557 clade 172 N N LeticonoStoc Citretin 1178 AM1574.44 clade 175 N N Leticonostoc lactis 1182 NR 040823 clade 175 N N Alicyclobacilius acidoterrestris 123 NR 040844 clade 179 N N Alicyclobacilius 125 NR 024754 clade 179 N N cycloheptanicus Acinetobacter battmannii 27 ACYQ01000014 clade 181 N N Acinetobacter Caicoaceticits 28 AM157426 clade 181 N N Acinetobacter genomosp. C1 29 AY278.636 clade 181 N N Acinetobacter haemolyticus 30 ADMTO1000017 clade 181 N N Acinetobacter johnsonii 31 ACPLO1000162 clade 181 N N Acinetobacteriinii 32 ACPMO1000135 clade 181 N N Acinetobacter twofi 33 ACPNO1000204 clade 181 N N Acinetobacter parvus 34 AIEBO1000124 clade 181 N N Acinetobacter schindlieri 36 NR 025412 clade 181 N N Acinetobacter sp. 56A1 37 GQ178049 clade 181 N N Acinetobacter sp. CIP 101934 38 JQ638573 clade 181 N N Acinetobacter sp. CIP 102143 39 JQ638578 clade 181 N N Acinetobacter sp. M16 22 41 HM366447 clade 181 N N Acinetobacter sp. RUH2624 42 ACQFO1000094 clade 181 N N Acinetobacter sp. SH024 43 ADCHO100.0068 clade 181 N N Lactobacilius iensenii 092 ACQD01000066 clade 182 N N Alcaligenes faecalis 119 AB68O368 clade 183 N N Alcaligenes sp. CO14 120 DQ643040 clade 183 N N Alcaligenes sp. S3 121 HQ262549 clade 183 N N Oigella ureolytica 366 NR 041998 clade 183 N N Oigella urethralis 367 NR 041753 clade 183 N N Eikeneia corrodens 784 ACEAO1000028 clade 185 N N Kingeila denitrificans O19 AEWVO1000047 clade 185 N N Kingeila genomosp. P1 oral 020 DQ003616 clade 185 N N cone MB2 C20 Kingeila kingae O21 AFHSO1000073 clade 185 N N Kingeila oralis 022 ACJWO2000005 clade 185 N N Kingeila sp. oral clone ID059 O23 AY349381 clade 185 N N Neisseria elongata 330 ADBFO1000003 clade 185 N N Neisseria genomosp. P2 oral 332 DQ003630 clade 185 N N clone MBS. P15 Neisseria sp. oral clone JC012 345 AY349388 clade 185 N N Neisseria sp. SMC A9199 342 FTT63637 clade 185 N N Simonsieia mieieri 731 ADCYO1OOO105 clade 185 N N Corynebacterium 700 ABYPO1000081 clade 193 N N glucuronolytictim Corynebacterium 716 FJ185225 clade 193 N N pyruviciproducers Rothia aeria 1649 DQ673320 clade 194 N N Rothia dentocariosa 1650 ADDWO1000024 clade 194 N N Rothia sp. oral taxon 188 1653 GU470892 clade 194 N N Corynebacterium accolens 681 ACGD01000048 clade 195 N N Corynebacterium macginleyi 707 AB3593.93 clade 195 N N Corynebacterium 714 ABYQ01000237 clade 195 N N pseudogenitalium Corynebacterium 729 ACVPO1000009 clade 195 N N tubercutioStearicum Lactobacilius casei 1074 CPOOO423 clade 198 N N Lactobacilius paracasei 1106 ABQVO1000067 clade 198 N N Lactobacilius zeae 1143 NR 037122 clade 198 N N Prevoteia denia is 1492 ABS47678 clade 205 N N Prevoteila sp. oral clone 1529 AY923148 clade 206 N N US 9,585,921 B2 115 116 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status ASCG10 Prevoteila sp. oral clone 1541 AY349399 clade 206 N N HFOSO Prevoteila sp. oral clone ID019 1542 AY3494OO clade 206 N N Prevoteila sp. oral clone IK062 1545 AY3494O2 clade 206 N N Prevoteila genomosp. P9 oral 1499 DQ003633 clade 207 N N clone MB7 G16 Prevoteila sp. oral clone 1531 AYOOSO62 clade 207 N N AUO69 Prevoteila sp. oral clone 1532 AYOOSO63 clade 207 N N CYOO6 Prevoteila sp. oral clone FLO19 1534 AY349392 clade 207 N N Actinomyces genomosp. C1 S6 AY27861 O clade 212 N N Actinomyces genomosp. C2 57 AY278611 clade 212 N N Actinomyces genomosp. P1 58 DQ003632 clade 212 N N oral clone MB6 CO3 Actinomyces georgiae S9 GUS 61319 clade 212 N N Actinomyces israeli 60 AF47927O clade 212 N N Actinomyces massiliensis 61 ABS45934 clade 212 N N Actinomyces meyeri 62 GUS 61321 clade 212 N N Actinomyces Odontolyticits 66 ACYTO1000123 clade 212 N N Actinomyces orihominis 68 AJS751.86 clade 212 N N Actinomyces sp. CCUG 37290 71 AU234058 clade 212 N N Actinomyces sp. ICM34 75 HQ616391 clade 212 N N Actinomyces sp. ICM41 76 HQ616392 clade 212 N N Actinomyces sp. ICM47 77 HQ616395 clade 212 N N Actinomyces sp. ICM54 78 HQ616398 clade 212 N N Actinomyces sp. oral clone 87 AY349366 clade 212 N N IPO81 Actinomyces sp. oral taxon 91 AEUHO1000060 clade 212 N N 178 Actinomyces sp. oral taxon 92 AEPPO1000041 clade 212 N N 18O Actinomyces sp. TeS 80 GU561315 clade 212 N N Haematobacter sp. BC14248 968 GU396991 clade 213 N N Paracoccus denitrificans 1424 CPOOO490 clade 213 N N Paracoccus marchisi 1425 NR 044922 clade 213 N N Grimonia hoisae 967 ADAQ01000013 clade 216 N N Shewanelia putrefaciens 1723 CPOO2457 clade 216 N N Afipia genomosp. 4 111 EU 117385 clade 217 N N Rhodopseudomonas palustris 1626 CPOOO3O1 clade 217 N N Methyliobacterium extorquens 1223 NC 01.0172 clade 218 N N Methyliobacterium podarium 1224 AY468.363 clade 218 N N Methyliobacterium 122S GU294320 clade 218 N N radiotoierans Methyliobacterium sp. 1Sub 1226 AY468371 clade 218 N N Methyliobacterium sp. MM4 1227 AY468370 clade 218 N N Achromobacter denitrificans 18 NR 042021 clade 224 N N Achromobacter piechaudii 19 ADMSO1OOO149 clade 224 N N Achromobacter xylosoxidans 20 ACRCO1OOOO72 clade 224 N N Bordeteila bronchiseptica 384 NR 025949 clade 224 N OP Bordeteia holmesii 385 AB6831.87 clade 224 N OP Bordeteila parapertissis 386 NR 025950 clade 224 N OP Bordeteila pertissis 387 BX64O418 clade 224 N OP Microbacterium chocolatum 1230 NR 037045 clade 225 N N Microbacterium flavescens 1231 EU714363 clade 225 N N Microbacterium iacticum 1233 EU714351 clade 225 N N Microbacterium oieivorans 1234 EU714381 clade 225 N N Microbacterium oxydans 1235 EU714348 clade 225 N N Microbacterium paraoxydans 1236 AJ491806 clade 225 N N Microbacterium 1237 EU714359 clade 225 N N phyllosphaerae Microbacterium Schleiferi 1238 NR 044936 ade 225 N N Microbacterium sp. 768 1239 EU714378 ade 225 N N Microbacterium sp. oral strain 1240 AF287752 ade 225 N N C24KA Microbacterium testaceum 1241 EU71436S clade 225 N N Corynebacterium atypictim 686 NR 025540 clade 229 N N Corynebacterium mastitidis 708 AB359395 clade 229 N N Corynebacterium sp. NML 72S GU2384.11 clade 229 N N 97 O186 Mycobacterium elephantis 1275 AF3.85898 clade 237 N OP Mycobacterium paraterrae 1288 EU919229 clade 237 N OP Mycobacterium phlei 1289 GU142920 clade 237 N OP Mycobacterium sp. 1776 1293 EU703152 clade 237 N N Mycobacterium sp. 1781 1294 EU703147 clade 237 N N US 9,585,921 B2 117 118 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Mycobacterium sp. AQ1GA4 1297 HM210417 clade 237 N N Mycobacterium sp. GN 10546 1299 FJ497243 clade 237 N N Mycobacterium sp. GN 10827 1300 FJ497247 clade 237 N N Mycobacterium sp. GN 11124 1301 F652846 clade 237 N N Mycobacterium sp. GN 918.8 1302 FJ497240 clade 237 N N Mycobacterium sp. 1303 FJ555.538 clade 237 N N GR 2007 210 Anoxybacilius contaminans 172 NR 029006 clade 238 N N Bacilius aeolitis 195 NR 025557 clade 238 N N Brevibacterium frigoritolerans 422 NR 042639 clade 238 N N Geobacilius sp. E263 934 DQ647387 clade 238 N N Geobacillus sp. WCH70 935 CPOO1638 clade 238 N N Geobacilius thermocatentiatus 937 NR 043020 clade 238 N N Geobacilius thermoleovorans 940 NR 074931 clade 238 N N Lysinibacilius fusiformis 192 FN397522 clade 238 N N Pianonicrobium koreense 468 NR 025O11 clade 238 N N Sporosarcina newyorkensis 754 AFPZO1000142 clade 238 N N Sporosarcina sp. 2681 7SS GU994081 clade 238 N N Ureibacilius composti 968 NR 043746 clade 238 N N Ureibacilius Suwonensis 969 NR 043232 clade 238 N N Ureibacilius terrents 970 NR 025394 clade 238 N N Ureibacilius thermophilus 971 NR 043747 clade 238 N N Ureibacilius thermosphaericus 972 NR 040961 clade 238 N N Prevoteia micans 507 AGWKO1000061 clade 239 N N Prevoteila sp. oral clone 533 AYOO5065 clade 239 N N DAOS8 Prevotella sp. SEQ053 S23 JN867222 clade 239 N N Treponema Socranski 937 NR 024.868 clade 240 N OP Treponema sp. 6:H:D15A 4 938 AYOOSO83 clade 240 N N Treponema sp. oral taxon 265 953 GU4088SO clade 240 N N Treponema sp. oral taxon G85 958 GU432215 clade 240 N N Porphyromonas endodontalis 472 ACNNO1000021 clade 241 N N Porphyromonas sp. oral clone 478 AYOOSO68 clade 241 N N BB134 Porphyromonas sp. oral clone 479 AYOOSO69 clade 241 N N FO16 Porphyromonas sp. oral clone 480 AY2O7054 clade 241 N N P2PB 52 P1 Porphyromonas sp. oral clone 481 AY2O7.057 clade 241 N N P4GB 1OOP2 Acidovorax sp. 98 63833 26 AY2S806S clade 245 N N Comamonadaceae bacterium 663 JN5853.35 clade 245 N N NMLOOO13S Comamonadaceae bacterium 664 JNS85331 clade 245 N N NML790751 Comamonadaceae bacterium 665 JN585332 clade 245 N N NML910O3S Comamonadaceae bacterium 666 JNS85333 clade 245 N N NML910O36 Comamonas sp. NSP5 668 ABO76850 clade 245 N N Delfia acidovorans 748 CPOOO884 clade 245 N N Xenophilus aeroiatus 2018 JNS85329 clade 245 N N Oribacterium sp. oral taxon 1380 ACIQ02000009 clade 246 N N O78 Oribacterium sp. oral taxon 1381 GQ422713 clade 246 N N 102 Weisseiia cibaria 2007 NR 036924 clade 247 N N Weissella confisa 2008 NR 040816 clade 247 N N Weisseia heilienica 2009 AB680902 clade 247 N N Weisseila kandieri 2010 NR 044659 clade 247 N N Weisseiia koreensis 2011 NR 075058 clade 247 N N Weissella paramesenteroides 2012 ACKUO1000017 clade 247 N N Weissella sp. KLDS 7.0701 2013 EU600924 clade 247 N N Mobiluncus curtisii 1251. AEPZO1000013 clade 249 N N Enhydrobacter aerosaccus 785 ACYIO1OOOO81 clade 256 N N Moraxeia Osiloensis 1262 JN17S341 clade 256 N N Moraxella sp. GM2 1264 F837191 clade 256 N N Brevibacterium casei 42O JF951998 clade 257 N N Brevibacterium epidermidis 421 NR 029262 clade 257 N N Brevibacterium sanguinis 426 NR 028O16 clade 257 N N Brevibacterium sp. H15 427 AB177640 clade 257 N N Acinetobacter radioresistens 35 ACVRO1000010 clade 261 N N Lactobacilius aimentarius 1068 NR 044701 clade 263 N N Lactobacilius farciminis 1082 NR 044707 clade 263 N N Lactobacilius kimchii 1097 NR 025.045 clade 263 N N Lactobacilius nodensis 1101 NR 041629 clade 263 N N US 9,585,921 B2 119 120 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Lactobacilius iucceti 138 NR 042194 clade 263 N N Pseudomonas mendocina 595 AAULO1000021 clade 265 N N Pseudomonas 598 NR 037000 clade 265 N N pseudoalcaligenes Pseudomonas sp. NP522b 602 EU723211 clade 265 N N Pseudomonas Stutzeri 603 AM905854 clade 265 N N Paenibacilius barcinonensis 390 NR 042272 clade 270 N N Paenibacilius barengoitzii 391 NR 042756 clade 270 N N Paenibacilius chibensis 392 NR 04.0885 clade 270 N N Paenibacilius cooki 393 NR 025372 clade 270 N N Paenibacilius durus 394 NR 037017 clade 270 N N Paenibacilius glucanolyticus 395 D78470 clade 270 N N Paenibacilius iactis 396 NR 025739 clade 270 N N Paenibacilius pabuli 398 NR 040853 clade 270 N N Paenibacilius popiiliae 400 NR 040888 clade 270 N N Paenibacilius sp. CIP 101062 401 HM212646 clade 270 N N Paenibacilius sp. JC66 404 JF824.808 clade 270 N N Paenibacilius sp. R 27413 40S HES86333 clade 270 N N Paenibacilius sp. R 27422 406 HES86.338 clade 270 N N Paenibacilius timonensis 408 NR 042844 clade 270 N N Rothia mucilaginosa 651 ACVOO1000020 clade 271 N N Rothia nasimurium 652 NR 025310 clade 271 N N Prevoteila sp. oral taxon 302 550 ACZKO1000043 clade 280 N N Prevoteila sp. oral taxon F68 SS6 HMO99652 clade 280 N N Prevoteia tannerae S63 ACIJO2OOOO18 clade 280 N N Prevotellaceae bacterium 566 AY207061 clade 280 N N P4P 62 P1 Porphyromonas 471 AENOO1000048 clade 281 N N asaccharolytica Porphyromonas gingivais 473 AEO15924 clade 281 N N Porphyromonas macacae 475 NR 025908 clade 281 N N Porphyromonas sp. UQD 301 477 EUO12301 clade 281 N N Porphyromonas uenonis 482 ACLRO1000152 clade 281 N N Leptotrichia buccalis 165 CPOO1685 clade 282 N N Leptotrichia hofstadii 168 ACVBO2000032 clade 282 N N Leptotrichia sp. oral clone 173 AY349386 clade 282 N N HEO12 Leptotrichia sp. oral taxon 223 176 GU408547 clade 282 N N Bacteroides fluxus 278 AFBNO1000029 clade 285 N N Bacteroides helicogenes 281 CPOO2352 clade 285 N N Parabacteroides johnsonii 419 ABYHO1000014 clade 286 N N Parabacteroides merdae 420 EU136685 clade 286 N N Treponema denticola 926 ADECO1000002 clade 288 N OP Treponema genomosp. P5 oral 929 DQ003624 clade 288 N N clone MB3 P23 Treponema pittidim 935 AJS43428 clade 288 N OP Treponema sp. oral clone 942 AY2O7055 clade 288 N N P2PB 53 P3 Treponema sp. oral taxon 247 949 GU408748 clade 288 N N Treponema sp. oral taxon 250 950 GU408776 clade 288 N N Treponema sp. oral taxon 251 951 GU408781 clade 288 N N Anaerococciis hydrogenais 144 ABXAO1000039 clade 289 N N Anaerococcus sp. 84.04299 148 HMS873.18 clade 289 N N Anaerococci is sp. gpac215 1S6 AM176540 clade 289 N N Anaerococcits vaginalis 158 ACXUO1000016 clade 289 N N Propionibacterium 569 NC O19395 clade 290 N N acidipropionici Propionibacterium avidium 571 AJOO3055 clade 290 N N Propionibacterium granulosum 573 FJT85716 clade 290 N N Propionibacterium jensenii 574 NR 042269 clade 290 N N Propionibacterium propionicum 575 NR 025.277 clade 290 N N Propionibacterium sp. H456 577 AB177643 clade 290 N N Propionibacterium thoenii 581 NR 042270 clade 290 N N Bifidobacterium bifidum 349 ABQPO1000027 clade 293 N N Leticonostoc mesenteroides 183 ACKVO1000113 clade 295 N N LeticonoStoc 184 NR 040814 clade 295 N N pseudomesenteroides Johnsoneila ignava O16 X871S2 ade 298 N N Propionibacterium acnes 570 ADJMO1000010 clade 299 N N Propionibacterium sp. 576 AFILO1 OOOO3S clade 299 N N 434 HC2 Propionibacterium sp. LG 578 AY354921 clade 299 N N Propionibacterium sp. S555a 579 AB264622 clade 299 N N Alicyclobacilius sp. CCUG 128 HE613268 clade 301 N N 53.762 Actinomyces cardiffensis S3 GU470888 clade 303 N N US 9,585,921 B2 121 122 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Actinomyces finkei 55 HQ906497 clade 303 N N Actinomyces sp. HKU31 74 HQ335393 clade 303 N N Actinomyces sp. oral taxon 94 HMO99646 clade 303 N N C55 Kerstersia gyiornim 1018 NR 025669 clade 307 N N Pigmentiphaga daeguiensis 1467 JN585327 clade 307 N N Aeromonas allosaccharophila 104 S39232 clade 308 N N Aeromonas enteropelogenes 1 OS X71121 clade 308 N N Aeromonas hydrophila 106 NC 008570 clade 308 N N Aeromonastiandaei 107 X60413 clade 308 N N Aeromonas Salmonicida 108 NC 009348 clade 308 N N Aeromonas troia 109 X60415 clade 308 N N Aeromonas Veronii 110 NR 044845 clade 308 N N Marvinbryantia formatexigens 196 AJSOS973 clade 309 N N Rhodobacter sp. oral taxon 62O HMO9964.8 clade 310 N N C30 Rhodobacter sphaeroides 621 CPOOO144 clade 310 N N Lactobacilius aniri 071 ACLL01000037 clade 313 N N Lactobacilius coieohominis O76 ACOFO1000030 clade 313 N N Lactobacilius fermentum O83 CPOO2O33 clade 313 N N Lactobacilius gastrict is O85 AICNO1000060 clade 313 N N Lactobacilius mucosae O99 FR693800 clade 313 N N Lactobacilius oris O3 AEKL01000077 clade 313 N N Lactobacilius pontis 11 HM21842O clade 313 N N Lactobacilius rentieri 12 ACGWO2000012 clade 313 N N Lactobacilius sp. KLDS 1.0707 27 EU600911 clade 313 N N Lactobacilius sp. KLDS 1.0709 28 EU6OO913 clade 313 N N Lactobacilius sp. KLDS 1.0711 29 EU6OO915 clade 313 N N Lactobacilius sp. KLDS 1.0713 31 EU600917 clade 313 N N Lactobacilius sp. KLDS 1.0716 32 EU600921 clade 313 N N Lactobacilius sp. KLDS 1.0718 33 EU6OO922 clade 313 N N Lactobacilius sp. oral taxon 37 GQ422710 clade 313 N N 052 Lactobacilius vaginalis 40 ACGVO1000168 clade 313 N N Brevibacterium aurantiacum 419 NR 044854 clade 314 N N Brevibacterium inens 423 AJ315491 clade 314 N N Lactobacilius peniosis O8 JN813103 clade 315 N N Lactobacilius pianiartin 10 ACGZ02000033 clade 315 N N Lactobacilius sp. KLDS 1.0702 23 EU6OO906 clade 315 N N Lactobacilius sp. KLDS 1.0703 24 EU600907 clade 315 N N Lactobacilius sp. KLDS 1.0704 2S EU600908 clade 315 N N Lactobacilius sp. KLDS 1.0705 26 EU600909 clade 315 N N Agrobacterium radiobacter 1S CPOOO628 clade 316 N N Agrobacterium timefaciens 16 AJ389893 clade 316 N N Corynebacterium 685 EF463OSS clade 317 N N argentoratense Corynebacterium diphtheriae 693 NC OO2935 ade 317 N OP Corynebacterium 715 NR 037070 ade 317 N N pseudotuberculosis Corynebacterium renale 717 NR 037069 clade 317 N N Corynebacterium ulcerans 731 NR 074,467 clade 317 N N Atirantimonas Coralicida 191 AYO65627 clade 318 N N A tireimonas aitamirensis 192 FN658986 clade 318 N N Lactobacilius acidipiscis 1066 NR 024718 clade 320 N N Lactobacilius Saivarius 1117 AEBAO1OOO145 clade 32O N N Lactobacilius sp. KLDS 1.0719 1134 EU6OO923 clade 320 N N Lactobacilius butchneri 1073 ACGHO1OOO101 clade 321 N N Lactobacilius genomosp. C1 1086 AY278619 clade 321 N N Lactobacilius genomosp. C2 1087 AY27862O clade 321 N N Lactobacilius hilgardii 1089 ACGPO1OOO2OO clade 321 N N Lactobacilius kefiri 1096 NR 042230 clade 321 N N Lactobacilius parabuchneri 1105 NR 041294 clade 321 N N Lactobacilius parakefiri 1107 NR 029039 clade 321 N N Lactobacilius curvatus 1079 NR 042437 clade 322 N N Lactobacilius Sakei 1116 DQ989236 clade 322 N N Aneurinibacilius aneurinilyticus 167 AB101592 clade 323 N N Aneurinibacilius danicus 168 NR 028657 clade 323 N N Anetirinibacilius mightianis 169 NR 036799 clade 323 N N Aneurinibacilius terranovensis 170 NR 042271 clade 323 N N Staphylococcusatiretts 1757 CPOO2643 clade 325 N Category-B Staphylococcusatiricularis 1758 JQ624774 clade 325 N N Staphylococci is capitis 1759 ACFRO1OOOO29 clade 325 N N Staphylococci is caprae 1760 ACRHO1 OOOO33 clade 325 N N Staphylococci is carnostis 1761 NR 075003 clade 325 N N Staphylococcus cohnii 1762 JN1753.75 clade 325 N N Staphylococcus condimenti 1763 NR 029345 clade 325 N N US 9,585,921 B2 123 124 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Staphylococci is epidermidis 764 ACHEO1000056 clade 325 N N Staphylococci is equtorum 765 NR 027520 clade 325 N N Staphylococciis haemolyticus 767 NC 0071.68 clade 325 N N Staphylococcus hominis 768 AM157418 clade 325 N N Staphylococci is lugdunensis 769 AEQAO1000024 clade 325 N N Staphylococci is pastetiri 770 FJ189773 clade 325 N N Staphylococcits 771 CPOO2439 clade 325 N N pseudintermedius Staphylococcits 772 NR 029158 clade 325 N N Saccharolyticus Staphylococci is saprophyticits 773 NC 007350 clade 325 N N Staphylococci is sp. clone 777 AF467424 clade 325 N N bottae 7 Staphylococcus sp. H292 775 AB177642 clade 325 N N Staphylococcus sp. H780 776 AB177644 clade 325 N N Staphylococci is sticcinits 778 NR 028667 clade 325 N N Staphylococciis warneri 780 ACPZO1000009 clade 325 N N Staphylococci is xylost is 781 AY39SO16 clade 325 N N Cardiobacterium hominis 490 ACKYO1000036 clade 326 N N Cardiobacterium vaivarum 491 NR 028847 clade 326 N N Pseudomonas fittorescens 593 AY622220 clade 326 N N Pseudomonas gessardi 594 FJ943496 clade 326 N N Pseudomonas monteii 596 NR 024910 clade 326 N N Pseudomonas poae 597 GU188951 clade 326 N N Pseudomonas puttida 599 AFO94741 clade 326 N N Pseudomonas sp. G1229 601 DQ910482 clade 326 N N Pseudomonas toiaasi 604 AF320988 clade 326 N N Pseudomonas viridifiava 605 NR 042764 clade 326 N N Listeria gravi 185 ACCRO2000003 clade 328 N OP Listeria innoctia 186 JF96.7625 clade 328 N N Listeria ivanovii 187 X56151 clade 328 N N Listeria monocytogenes 188 CPOO2003 clade 328 N Category-B Listeria weishineri 189 AM2631.98 clade 328 N OP Capnocytophaga sp. oral clone 484 AY923149 clade 333 N N ASCEHOS Capnocytophaga Spittigena 489 ABZVO1000054 clade 333 N N Leptotrichia genomosp. C1 166 AY278621 clade 334 N N Leptotrichia Shahi 169 AYO29806 clade 334 N N Leptotrichia sp. 170 AF189244 clade 334 N N neutropenic Patient Leptotrichia sp. oral clone 171 AY349384 clade 334 N N GTO18 Leptotrichia sp. oral clone 172 AY349385 clade 334 N N GTO2O Bacteroides sp. 20 3 296 ACRQ01000064 clade 335 N N Bacteroides sp. 3 1. 19 307 ADCJO1000062 clade 335 N N Bacteroides sp. 3 2 5 311 ACIBO1 OOOO79 clade 335 N N Parabacteroides distasonis 1416 CPOOO140 clade 335 N N Parabacteroides goldsteinii 1417 AY974O70 clade 335 N N Parabacteroides gordonii 1418 AB470344 clade 335 N N Parabacteroides sp. D13 1421 ACPWO 1000017 clade 335 N N Capnocytophaga genomosp. 477 AY278613 clade 336 N N C1 Capnocytophaga ochracea 480 AEOHO1000054 clade 336 N N Capnocytophaga sp. GEJ8 481 GUS 61335 ade 336 N N Capnocytophaga sp. oral strain 486 AYOOSO77 clade 336 N N A47ROY Capnocytophaga sp. S1b 482 U42009 clade 336 N N Paraprevoteila clara 1426 AFFYO1000068 clade 336 N N Bacteroides heparinolyticus 282 JN867284 clade 338 N N Prevoteila heparinolytica 1500 GQ422742 clade 338 N N Treponema genomosp. P4 oral 1928 DQ003618 clade 339 N N clone MB2 G19 Treponema genomosp. P6 oral 1930 DQ003625 clade 339 N N clone MB4 G11 Treponema sp. oral taxon 254 1952 GU408803 clade 339 N N Treponema sp. oral taxon 508 1956 GU413616 clade 339 N N Treponema sp. oral taxon 518 1957 GU413640 clade 339 N N Chlamydia muridarum SO2 AEOO2160 clade 341 N OP Chlamydia trachomatis SO4 U68443 clade 341 N OP Chlamydia psittaci 503 NR 036864 clade 342 N Category-B Chlamydophila pneumoniae 509 NC 002179 clade 342 N OP Chlamydophila psittaci 510 D85712 clade 342 N OP Anaerococci is Octavius 146 NR 026360 clade 343 N N Anaerococcus sp. 8405254 149 HMS87319 clade 343 N N Anaerococcus sp. 9401487 150 HMS87322 clade 343 N N US 9,585,921 B2 125 126 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Anaerococcus sp. 9403502 151 HMS873.25 clade 343 N N Gardnerella vaginalis 923. CPOO1849 clade 344 N N Campylobacteriani 466 CPOOO932 clade 346 N OP Anaerobiospirilium 142 NR 026O75 clade 347 N N Sticciniciproducers Anaerobiospirilium thomasii 143 A420985 clade 347 N N Ruminobacter amylophilus 1654 NR 026450 clade 347 N N Sticcinatimonas hippei 1897 AEVOO1000027 clade 347 N N Actinomyces etiropaeus 54 NR 026363 clade 348 N N Actinomyces sp. oral clone 82 AY349.361 clade 348 N N GUOO9 Moraxeia catarrhais 1260 CPOO2OOS clade 349 N N Moraxeia incoini 1261 FR822735 clade 349 N N Moraxella sp. 16285 1263 JF682466 clade 349 N N Psychrobacter sp. 13983 1613 HM2126.68 clade 349 N N Actinobacilium massiae 49 AF487679 clade 350 N N Actinobaculum Schaaiii 50 AY957507 clade 350 N N Actinobaculum sp. BMH 101342 51 AY282578 clade 350 N N Actinobaculum sp. P2P 19 P1 52 AY2O7066 clade 350 N N Actinomyces sp. oral clone 84 AY349363 clade 350 N N IOO76 Actinomyces sp. oral taxon 93 ACUYO1000072 clade 350 N N 848 Actinomyces netti 6S X71862 clade 352 N N Mobiluncus mutieris 252 ACKWO1000035 clade 352 N N Biastomonas natatoria 372 NR 040824 clade 356 N N Novosphingobium 357 AAAVO3OOOOO8 clade 356 N N aromaticivorans Sphingomonas sp. oral clone 745 AY3494.11 clade 356 N N FIO12 Sphingopyxis alasikensis 749 CPOOO356 clade 356 N N Oxalobacter formigenes 389 ACDQ01000020 clade 357 N N Veillonella atypica 974 AEDSO1000059 clade 358 N N Veillonella dispar 975 ACIKO2000021 clade 358 N N Veillonella genomosp. P1 oral 976 DQ003631 clade 358 N N clone MBS P17 Veillonella parvula 978 ADFUO1000009 clade 358 N N Veillonella sp. 3 1. 44 979 ADCVO1000019 clade 358 N N Veillonella sp. 6 1 27 980 ADCWO1000016 clade 358 N N Veillonella sp. ACP1 981 HQ616359 clade 358 N N Veillonella sp. AS16 982 HQ616365 clade 358 N N Veillonella sp. BS32b 983 HQ616368 clade 358 N N Veillonella sp. ICM51a. 984 HQ616396 clade 358 N N Veillonella sp. MSA12 985 HQ616381 clade 358 N N Veillonella sp. NVG 100cf 986 EF108443 clade 358 N N Veillonella sp. OK11 987 JN695650 clade 358 N N Veillonella sp. oral clone 990 AY923.144 clade 358 N N ASCGO1 Veillonella sp. oral clone 991 AY95.3257 clade 358 N N ASCGO2 Veillonella sp. oral clone OH1A 992 AY947495 clade 358 N N Veillonella sp. oral taxon 158 993 AENU01000007 clade 358 N N Kocitria marina 040 GQ260086 clade 365 N N Kocuria rhizophila O42 AYO3O315 clade 365 N N Kochiria rosea O43 X87756 clade 365 N N Kocitria varians O44 AFS42O74 clade 365 N N Clostridiaceae bacterium 531 EF451053 clade 368 N N END 2 Micrococcus antarcticus 242 NR 025285 clade 371 N N Micrococcus initeus 243 NR 075062 clade 371 N N Micrococcus lyiae 244 NR 026,200 clade 371 N N Micrococcus sp. 185 245 EU714334 clade 371 N N Lactobacilius brevis O72 EU194349 clade 372 N N Lactobacilius parabrevis 104 NR 042456 clade 372 N N Pediococcus acidiactici 436 ACXBO1000026 clade 372 N N Pediococci is pentosaceus 437 NR 075052 clade 372 N N Lactobacilius dextrinicus O81 NR 036861 clade 373 N N Lactobacilius peroiens 109 NR 029360 clade 373 N N Lactobacilius rhamnosus 113 ABWJO1000068 clade 373 N N Lactobacilius Saniviri 118 AB6O2S69 clade 373 N N Lactobacilius sp. BT6 121 HQ616370 clade 373 N N Mycobacterium mageritense 282 FR798914 clade 374 N OP Mycobacterium neoaurum 286 AF268445 clade 374 N OP Mycobacterium smegmatis 291 CPOOO480 clade 374 N OP Mycobacterium sp. HE5 3O4 AJO12738 clade 374 N N Dysgonomonasgadei 775 ADLVO1OOOOO1 clade 377 N N US 9,585,921 B2 127 128 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Dysgonomonas mossii 776 ADLWO1OOOO23 clade 377 N N Porphyromonas levi 1474 NR 025907 clade 377 N N Porphyromonas somerae 1476 ABS476.67 clade 377 N N Bacteroides barnesiae 267 NR 041446 clade 378 N N Bacteroides coprocola 272 ABIYO2000050 clade 378 N N Bacteroides coprophilus 273 ACBWO1000012 clade 378 N N Bacteroides doei 274 ABWZO1000093 clade 378 N N Bacteroides massiliensis 284 AB2OO226 clade 378 N N Bacteroides plebeius 289 AB20O218 clade 378 N N Bacteroides sp. 3 1 33FAA 309 ACPSO1000085 clade 378 N N Bacteroides sp. 3 1. 40A 310 ACRTO1000136 clade 378 N N Bacteroides sp. 4 3 47FAA 313 ACDRO2000029 clade 378 N N Bacteroides sp. 9 1 42FAA 314 ACAAO1000096 clade 378 N N Bacteroides sp. NB 8 323 AB11756S clade 378 N N Bacteroides vulgatus 331 CPOOO139 clade 378 N N Bacteroides ovatus 287 ACWHO1OOOO36 clade 38 N N Bacteroides sp. 1 1 30 294 ADCLO1000128 clade 38 N N Bacteroides sp. 2 1 22 297 ACPQ01000117 clade 38 N N Bacteroides sp. 2 2 4 299 ABZZO1000168 clade 38 N N Bacteroides sp. 3 1. 23 308 ACRSO1OOOO81 clade 38 N N Bacteroides sp. D1 318 ACAB02000030 clade 38 N N Bacteroides sp. D2 321 ACGAO1000077 clade 38 N N Bacteroides sp. D22 320 ADCKO1000151 clade 38 N N Bacteroides xvianisolvens 332 ADKPO1000087 clade 38 N N Treponema lecithinolyticum 1931 NR 026247 clade 380 N OP Treponema parvin 1933 AF3O2937 clade 380 N OP Treponema sp. oral clone 1940 AY3494.17 clade 380 N N JUO25 Treponema sp. oral taxon 270 1954 GQ422733 clade 380 N N Parascardovia denticoiens 1428 ADEBO1000020 clade 381 N N Scardovia inopinata 1688 ABO29087 clade 381 N N Scardovia wiggsiae 1689 AY278626 clade 381 N N Cliostridiaies bacterium 533 HM58732O clade 384 N N 940O853 Mogibacterium diversum 1254 NR 027191 clade 384 N N Mogibacterium neglectum 1255 NR 0272O3 clade 384 N N Mogibacterium pumilum 1256 NR 028.608 clade 384 N N Mogibacterium timidum 1257 Z36296 clade 384 N N Borrelia burgdorferi 389 ABGIO1000001 clade 386 N OP Borrelia garinii 392 ABJWO1000001 clade 386 N OP Borrelia sp. NE49 397 AJ224142 clade 386 N OP Caidinonas manganoxidans 457 NR 040787 clade 387 N N Comamonadaceae bacterium 667 HMO99651 clade 387 N N oral taxon F47 Lautropia mirabilis 1149 AEQPO1000026 clade 387 N N Lautropia sp. oral clone AP009 11SO AYOOSO3O clade 387 N N Peptoniphilus asaccharolyticits 1441 D14145 clade 389 N N Peptoniphilus duerdenii 1442 EUS2629O clade 389 N N Peptoniphilus harei 1443 NR 026358 clade 389 N N Peptoniphilus indolicus 1444 AY153431 clade 389 N N Peptoniphilus lacrimalis 1446 ADDOO1000050 clade 389 N N Peptoniphilus sp. gpac077 1450 AM176527 clade 389 N N Peptoniphilus sp. JC140 1447 JF8248O3 clade 389 N N Peptoniphilus sp. oral taxon 1452 ADCSO1000031 clade 389 N N 386 Peptoniphilus sp. oral taxon 1453 AEAAO1000090 clade 389 N N 836 Peptostreptococcaceae 1454 N837.495 clade 389 N N bacterium phl Dialister pneumosinies 765 HM596.297 clade 390 N N Dialister sp. oral taxon 502 767 GQ422739 clade 390 N N Cupriavidus metallidurans 741, GU23O889 clade 391 N N Herbaspirillum seropedicae 1001 CPOO2O39 clade 391 N N Herbaspirillum sp. JC206 10O2 JN657219 clade 391 N N Janthinobacterium sp. SY12 1015 EF455530 clade 391 N N Massilia sp. CCUG 43427A 1197 FR773700 clade 391 N N Ralstonia picketti 1615 NC O10682 clade 391 N N Ralstonia sp. 5. 7 47FAA 1616 ACUFO1000076 clade 391 N N Franciseia novicida 889 ABSSO1000002 clade 392 N N Francisella philomiragia 890 AY928.394 clade 392 N N Franciseia tuiarensis 891 ABAZO1000O82 clade 392 N Category-A Ignatzschineria indica 1009 HQ823562 clade 392 N N Ignatzschineria sp. NML 1010 HQ823.559 clade 392 N N 95 O260 Streptococci is militans 1814 APO106SS ade 394 N N Lactobacilius gasseri 1084 ACOZO1000018 clade 398 N N US 9,585,921 B2 129 130 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Lactobacilius hominis 1090 FR681902 clade 398 N N Lactobacilius iners 1091 AEKJO1000002 clade 398 N N Lactobacilius johnsonii 1093 AEO171.98 clade 398 N N Lactobacilius senioris 1119 AB6O2S70 clade 398 N N Lactobacilius sp. oral clone 1135 AY349.382 clade 398 N N HTOO2 Weisseia beninensis 2006 EU439435 clade 398 N N Sphingomonas echinoides 1744 NR 024700 clade 399 N N Sphingomonas sp. oral taxon 1747 HMO99639 clade 399 N N A09 Sphingomonas sp. oral taxon 1748 HMO99645 clade 399 N N F71 Zymomonas mobilis 2032 NR 074274 clade 399 N N Arcanobacterium 174 NR 025347 clade 400 N N haemolyticum Arcanobacterium pyogenes 175 GU585578 clade 400 N N Trieperella pyogenes 1962 NR 044858 clade 400 N N Lactococci is garvieae 1144 AFO 61005 clade 401 N N Lactococci is lactis 1145 CPOO236S clade 401 N N Brevibacterium mchreineri 424 ADNUO1000076 clade 402 N N Brevibacterium paucivorans 425 EUO86796 clade 402 N N Brevibacterium sp. JC43 428 JF824.806 clade 402 N N Seienomonas artemidis 1692 HMS96274 clade 403 N N Selenomonas sp. FOBRC9 1704 HQ616378 clade 403 N N Selenomonas sp. oral taxon 1715 AENVO1000007 clade 403 N N 137 Desmospora activa 751 AM940019 clade 404 N N Desmospora sp. 8437 752 AFHTO1 OOO143 ade 404 N N Paenibacilius sp. oral taxon 1407 HMO99647 clade 404 N N F45 Corynebacterium 682 ADNSO1000011 clade 405 N N annoniagenes Corynebacterium 687 ACLHO1000041 clade 405 N N airiniiCostin Corynebacterium bovis 688 AFS37590 clade 405 N N Corynebacterium canis 689 GQ871934 clade 405 N N Corynebacterium casei 690 NR 025101 clade 405 N N Corynebacterium durum 694 Z97O69 clade 405 N N Corynebacterium eficiens 695 ACLIO1 OOO121 clade 405 N N Corynebacterium falsenii 696 Y13024 clade 405 N N Corynebacterium flavescens 697 NR 037040 clade 405 N N Corynebacterium glutamicum 701 BAOOOO36 clade 405 N N Corynebacterium jeikeium 704 ACYWO1000001 clade 405 N OP Corynebacterium 705 NR 026380 clade 405 N N kroppenistedtii Corynebacterium 706 ACHJO1000075 clade 405 N N lipophiloflavum Corynebacterium matriuchotii 709 ACSHO2000003 clade 405 N N Corynebacterium 710 X82O64 clade 405 N N minutissini in Corynebacterium resistens 718 ADGNO1000058 clade 405 N N Corynebacterium simulans 720 AFS37604 clade 405 N N Corynebacterium singulare 721 NR 026394 clade 405 N N Corynebacterium sp. 1 ex 722 Y13427 clade 405 N N sheep Corynebacterium sp. NML 726 GU238413 clade 405 N N 99 0018 Corynebacterium striatum 727 ACGEO1000001 clade 405 N OP Corynebacterium urealyticum 732 X81913 clade 405 N OP Corynebacterium variabile 734 NR 025314 clade 405 N N Aerococci is sanguinicola 98 AY837833 clade 407 N N Aerococci is tirinae 99 CPOO2512 clade 407 N N Aerococci is tirinaeequi 100 NR 043443 clade 407 N N Aerococcus viridans 101 ADNTO1000041 clade 407 N N Fusobacterium naviforme 898 HQ223106 clade 408 N N Moryella indoligenes 1268 AF527773 clade 408 N N Selenomonas genomosp. P5 1697 AY34.1820 clade 410 N N Selenomonas sp. oral clone 1710 AY3494.08 clade 410 N N IQ048 Selenomonas spittigena 1717 ACKPO2000033 clade 410 N N Hyphomicrobium sulfonivorans 1007 AY468372 clade 411 N N Methylocella silvestris 1228 NR 074237 clade 411 N N Legionella pneumophila 1153 NC OO2942 clade 412 N OP Lactobacilius coryniformis 1077 NR 044705 clade 413 N N Arthrobacter agilis 178 NR 026198 clade 414 N N Arthrobacter ariaitensis 179 NR 074608 clade 414 N N US 9,585,921 B2 131 132 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Arthrobacter beigerei 180 NR 025612 clade 414 N N Arthrobacter globiformis 181 NR 0261.87 clade 414 N N Arthrobacter nicotianae 182 NR 026190 clade 414 N N Mycobacterium abscessus 269 AGQUO1000002 clade 418 N OP Mycobacterium chelonae 273 ABS4861O clade 418 N OP Bacteroides saianitronis 291 CPOO2530 clade 419 N N Paraprevoteia xylaniphila 427 AFBRO1000011 clade 419 N N Barnesieia intestinihominis 336 AB37O2S1 clade 420 N N Barnesieia viscericoia 337 NR 041508 clade 420 N N Parabacteroides sp. NS31 3 422 JNO29805 clade 420 N N Porphyromonadaceae 47O EF184292 clade 420 N N bacterium NML 06.0648 Tannerella forsythia 913 CPOO3191 clade 420 N N Tannerella sp. 914 ACWXO1000068 clade 420 N N 6 1 58FAA CT1 Mycoplasma amphoriforme 311 AYS31656 clade 421 N N Mycoplasma genitalium 317 L43967 clade 421 N N Mycoplasma pneumoniae 322 NC 000912 clade 421 N N Mycoplasma penetrans 321 NC 004.432 clade 422 N N Ureaplasma parvin 966 AEOO2127 clade 422 N N Ureaplasma tirealytictim 967 AAYNO1000002 clade 422 N N Treponema genomosp. P1 927 AY341822 clade 425 N N Treponema sp. oral taxon 228 943 GU40858O clade 425 N N Treponema sp. oral taxon 230 944 GU408.603 clade 425 N N Treponema sp. oral taxon 231 945 GU408631 clade 425 N N Treponema sp. oral taxon 232 946 GU408.646 clade 425 N N Treponema sp. oral taxon 235 947 GU408673 clade 425 N N Treponema sp. ovine footrot 959 AJO10951 clade 425 N N Treponema vincentii 960 ACYHO1000036 clade 425 N OP Burkholderiales bacterium 452 ADCQ01000066 clade 432 N OP 1 1 47 Parasuttereiia 429 AFBPO1000029 clade 432 N N excrementihominis Parasittierelia Sectinda 430 AB491209 clade 432 N N Sutterelia morbirenis 898 A.J832129 clade 432 N N Stitterelia Sanginus 900 AJ748647 clade 432 N N Sutterella sp. YIT 12072 901 AB491210 clade 432 N N Sutterelia Stercoricanis 902 NR 025600 clade 432 N N Sutterelia wadsworthensis 903 ADMFO1000048 clade 432 N N Propionibacterium 572 NR 036972 clade 433 N N feudenreichii Propionibacterium sp. oral 580 GQ422728 clade 433 N N taxon 192 Tessaracocci is sp. oral taxon 917 HMO99640 clade 433 N N FO4 Peptoniphilus ivorii 44S YO7840 clade 434 N N Peptoniphilus sp. gpac007 448 AM176517 clade 434 N N Peptoniphilus sp. gpac018A 449 AM176519 clade 434 N N Peptoniphilus sp. gpac148 451 AM176535 clade 434 N N Flexispira rappini 887 AY1264.79 clade 436 N N Helicobacter biis 993 ACDNO1000023 clade 436 N N Helicobacter cinaedi 995 ABQTO1000054 clade 436 N N Helicobacter sp. None 998 U44756 clade 436 N N Brevundimonas subvibrioides 429 CPOO2102 clade 438 N N Hyphomonas neptunit in 1008 NR 074092 clade 438 N N Phenyiobacterium zucineum 146S AY628697 clade 438 N N Streptococci is downei 1793 AEKNO1000002 clade 441 N N Streptococcus sp. SHV515 1848 YO76O1 clade 441 N N Acinetobacter sp. CIP 53.82 40 JQ638584 clade 443 N N Halomonas elongata 990 NR 074782 clade 443 N N Halomonasjohnsoniae 991 FR775979 clade 443 N N Butyrivibrio fibrisolvens 456 U41172 clade 444 N N Roseburia sp. 11 SE37 1640 FM954975 clade 444 N N Roseburia sp. 11 SE38 1641 FM954976 clade 444 N N Shuttleworthia satelies 1728 ACIPO2OOOOO4 clade 444 N N Shuttleworthia sp. MSX8B 1729 HQ616383 clade 444 N N Shuttleworthia sp. oral taxon 173O GU432167 clade 444 N N G69 Bdellovibrio sp. MPA 344 AY294215 clade 445 N N Destifobulbus sp. oral clone 755 AYOO5036 ade 445 N N CHO31 Desulfovibrio desulfuricans 757 DQ092636 clade 445 N N Desulfovibrio fairfieldensis 758 U42221 clade 445 N N Desulfovibrio piger 759 AF1921.52 clade 445 N N Desulfovibrio sp. 3 1 syn3 760 ADDRO1000239 clade 445 N N Geobacter hemidjiensis 941 CPOO1124 clade 445 N N US 9,585,921 B2 133 134 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Brachybacterium alimentarium 401 NR 026269 clade 446 N N Brachybacterium 402 ABS37169 clade 446 N N conglomeratin Brachybacterium 403 NR 026272 clade 446 N N tyrofermenians Dernabacter hominis 749 FJ263375 clade 446 N N Aneurinibacilius 171 NR 029303 clade 448 N N thermoaerophilus Brevibacilius agri 409 NR 040983 clade 448 N N Brevibacilius centrosporus 411 NR 043414 clade 448 N N Brevibacilius choshinensis 412 NR 040980 clade 448 N N Brevibacilius invocatus 413 NR 041836 clade 448 N N Brevibacilius parabrevis 415 NR 040981 clade 448 N N Brevibacilius reuszeri 416 NR 040982 clade 448 N N Brevibacilius sp. phR 417 JN837488 clade 448 N N Brevibacilius thermoruber 418 NR 026514 clade 448 N N Lactobacilius mirinus 1100 NR 042231 clade 449 N N Lactobacilius oeni 1102 NR 043095 clade 449 N N Lactobacilius ruminis 1115 ACGSO2000043 clade 449 N N Lactobacilius vini 1141 NR 042196 clade 449 N N Gemella haemolysans 924 ACDZO2000012 clade 450 N N Gemeia morbiorum 925 NR 025904 clade 450 N N Gemeia morbiorum 926 ACRXO1000010 clade 450 N N Gemeila Sangiinis 927 ACRYO1000057 clade 450 N N Gemeila sp. oral clone 929 AY923.133 clade 450 N N ASCEO2 Gemeila sp. oral clone 930 AY923.139 clade 450 N N ASCFO4 Gemeila sp. oral clone 931 AY923143 clade 450 N N ASCF12 Gemella sp. WAL 1945J 928 EU427463 clade 450 N N Sporolactobacilius nakayamae 1753 NR 042247 clade 451 N N Giuconacetobacter entani 945 NR 028909 clade 452 N N Gluconacetobacter europaeus 946 NR 026513 clade 452 N N Giuconacetobacter hansenii 947 NR 026133 clade 452 N N Giuconacetobacter oboediens 949 NR 041295 clade 452 N N Gluconacetobacter xylinus 950 NR 074338 clade 452 N N Attritibacter ignavus 193 FNSS4542 clade 453 N N Dermacoccus sp. Ellin185 750 AEIQ01000090 clade 453 N N Janibacter innosus 1013 NR 026362 clade 453 N N Janibacter meionis 1014 EFO63716 clade 453 N N Acetobacter aceti 7 NR 026121 clade 454 N N Acetobacter fabarum 8 NR 042678 clade 454 N N Acetobacter iovaniensis 9 NR 040832 clade 454 N N Acetobacter maiorum 10 NR 02551.3 clade 454 N N Acetobacter orientalis 11 NR 028625 clade 454 N N Acetobacter pasteuriantis 12 NR 026107 clade 454 N N Acetobacter pomorum 13 NR 042112 clade 454 N N Acetobacter syzygii 14 NR 040868 clade 454 N N Acetobacter tropicalis 15 NR 036881 clade 454 N N Giuconacetobacter 943 NR 028767 clade 454 N N azotocaptains Giuconacetobacter 944 NR 074292 clade 454 N N diazotrophicus Gluconacetobacteriohannae 948 NR 024959 clade 454 N N Nocardia brasiliensis 1351 AIHVO1000038 clade 455 N N Nocardia cyriacigeorgica 1352 HQ0094.86 clade 455 N N Nocardia puris 1354 NR 028994 clade 455 N N Nocardia sp. 01 Je 025 1355 GU574,059 clade 455 N N Rhodococci is equi 1623 ADNWO1000058 clade 455 N N Oceanobacilius caeni 1358 NR 041533 clade 456 N N Oceanobacilius sp. Ndiop 1359 CAERO1000083 clade 456 N N Ornithinibacilius bavariensis 1384 NR 044923 clade 456 N N Ornithinibacilius sp. 7 10AIA 1385 FN397526 clade 456 N N Virgibacilius proomii 2005 NR 0253O8 clade 456 N N Corynebacterium amycolatum 683 ABZUO1000033 clade 457 N OP Corynebacterium hansenii 702 AM946639 clade 457 N N Corynebacterium xerosis 735 FN179330 clade 457 N OP Staphylococcaceae bacterium 1756 AY841362 clade 458 N N NML 92 OO17 Staphylococcus fieuretti 1766 NR 041326 clade 458 N N Staphylococci is Sciuri 1774 NR 025520 clade 458 N N Staphylococciis vitulinus 1779 NR 024670 clade 458 N N Stenotrophomonas maliophilia 1782 AAVZO1000005 clade 459 N N Stenotrophomonas sp. FG 6 1783 EFO17810 clade 459 N N Mycobacterium africanum 1270 AF480605 clade 46 N OP US 9,585,921 B2 135 136 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Mycobacterium alsiensis 271 AU938169 clade 46 N OP Mycobacterium avium 272 CPOOO479 clade 46 N OP Mycobacterium colombiense 274 AMO62764 clade 46 N OP Mycobacterium gordonae 276 GU142930 clade 46 N OP Mycobacterium intracellulare 277 GQ153276 clade 46 N OP Mycobacterium kansasii 278 AF480601 clade 46 N OP Mycobacterium lacus 279 NR 0251.75 clade 46 N OP Mycobacterium leprae 280 FM211.192 clade 46 N OP Mycobacterium lepromatosis 281 EU2O3590 clade 46 N OP Mycobacterium mantenii 283 FJO42897 clade 46 N OP Mycobacterium marinum 284 NC 01.0612 clade 46 N OP Mycobacterium microti 285 NR 025234 clade 46 N OP Mycobacterium 287 ADNWO1000350 clade 46 N OP parascrofitiacetim Mycobacterium Seoulense 290 DQ536403 clade 46 N OP Mycobacterium sp. 1761 292 EU703150 clade 46 N N Mycobacterium sp. 1791 295 EU703148 clade 46 N N Mycobacterium sp. 1797 296 EU703149 clade 46 N N Mycobacterium sp. 298 HQ174245 clade 46 N N B10 07.09.0206 Mycobacterium sp. 305 HM627011 clade 46 N N NLAOO1 OOO736 Mycobacterium sp. W 306 DQ437715 clade 46 N N Mycobacterium tuberculosis 307 CPOO1658 clade 46 N Category-C Mycobacterium ulcerans 308 ABS4872S clade 46 N OP Mycobacterium vulneris 309 EU834OSS clade 46 N OP Xanthomonas campestris 2016 EF101975 clade 461 N N Xanthomonas sp. kmd 489 2017 EU7231.84 clade 461 N N Dietzia natronoimnaea 769 GQ870426 clade 462 N N Dietzia sp. BBDP51 770 DQ337512 clade 462 N N Dietzia sp. CA149 771 GQ870422 clade 462 N N Dietzia imorensis 772 GQ870424 clade 462 N N Gordonia bronchiais 951 NR 027594 clade 463 N N Gordonia polyisoprenivorans 952 DQ385,609 clade 463 N N Gordonia sp. KTR9 953 DQ068383 clade 463 N N Gordonia spitti 954 FJS36304 clade 463 N N Gordonia terrae 955 GQ848239 clade 463 N N Leptotrichia goodfellowii 1167 ADAD01000110 clade 465 N N Leptotrichia sp. oral clone 1174 AY349387 clade 465 N N IKO)40 Leptotrichia sp. oral clone 1175 AY207053 clade 465 N N P2PB 51 P1 Bacteroidales genomosp. P7 264 DQ003623 clade 466 N N oral clone. MB3 P19 Butyricimonas virosa 454 AB443949 clade 466 N N Odoribacterianeus 1363 AB4908OS clade 466 N N Odoribacter spianchinicus 1364 CPOO2S44 clade 466 N N Capnocytophaga gingivais 478 ACLQ01000011 clade 467 N N Capnocytophaga granulosa 479 X97248 clade 467 N N Capnocytophaga sp. oral clone 483 AYOOSO74 clade 467 N N AHO15 Capnocytophaga sp. oral strain 487 AYOO5073 clade 467 N N S3 Capnocytophaga sp. oral taxon 488 AEXXO1000050 clade 467 N N 338 Capnocytophaga Canimorst is 476 CPOO2113 clade 468 N N Capnocytophaga sp. oral clone 485 AY3493.68 clade 468 N N IDO62 Lactobacilius Catena formis 1075 M23729 clade 469 N N Lactobacilius vitatinus 1142 NR 041305 clade 469 N N Cetobacterium somerae SO1 A4381.SS clade 470 N N Fusobacterium gonidia formans 896 ACETO1000043 clade 470 N N Fusobacterium mortiferum 897 ACDBO2000034 clade 470 N N Fusobacterium necrogenes 899 XSS408 clade 470 N N Fusobacterium necrophorum 900 AM905356 clade 470 N N Fusobacterium sp. 12 1B 905 AGWJO1000070 clade 470 N N Fusobacterium sp. 3 1. SR 911 ACDD01000078 clade 470 N N Fusobacterium sp. D12 918 ACDGO2OOOO36 clade 470 N N Fusobacterium ulcerans 921 ACDHO1000090 clade 470 N N Fusobacterium varium 922 ACIEO1 OOOOO9 clade 470 N N Mycoplasma arthritidis 1312 NC 011025 clade 473 N N Mycoplasma faticium 1314 NR 024983 clade 473 N N Mycoplasma hominis 1318 AF443616 clade 473 N N Mycoplasma orale 1319 AY796060 clade 473 N N Mycoplasma Saivarium 1324 M24661 clade 473 N N Mitsuokella jalaludinii 1247 NR 028840 clade 474 N N US 9,585,921 B2 137 138 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Mitsuokeia muitacida 1248 ABWKO2000005 clade 474 N N Mitsuokella sp. oral taxon 521 1249 GU413658 clade 474 N N Mitsuokella sp. oral taxon G68 12SO GU432166 clade 474 N N Selenomonas genomosp. C1 1695 AY278627 clade 474 N N Selenomonas genomosp. P8 1700 DQ003628 clade 474 N N oral clone MBS P06 Selenomonas ruminantium 1703 NR 075026 clade 474 N N Veillonellaceae bacterium oral 1994 GU4O2916 clade 474 N N taxon 131 Alioscardovia omnicolens 139 NR 042583 clade 475 N N Alloscardovia sp. OB7196 140 AB42SO70 clade 475 N N Bifidobacterium urinalis 366 A.J278695 clade 475 N N Prevoteia ioeschei SO3 JN867231 clade 48 N N Prevoteila sp. oral clone 530 DQ272511 clade 48 N N ASCG12 Prevoteila sp. oral clone S40 AY349398 clade 48 N N GUO27 Prevoteila sp. oral taxon 472 553 ACZSO10001.06 clade 48 N N Selenomonas dianae 693 GQ422719 clade 480 N N Selenomonas fitteggei 694 AF2878O3 clade 480 N N Selenomonas genomosp. C2 696 AY278628 clade 480 N N Selenomonas genomosp. P6 698 DQ003636 clade 480 N N oral clone MB3 C41 Selenomonas genomosp. P7 699 DQ003627 clade 480 N N oral clone MBS C08 Selenomonas infelix 701 AF2878O2 clade 480 N N Selenomonas noxia 702 GU470909 clade 480 N N Selenomonas sp. oral clone 70S AY349403 clade 480 N N FTOSO Selenomonas sp. oral clone 706 AY3494.04 clade 480 N N GIO64 Selenomonas sp. oral clone 707 AY3494.OS clade 480 N N GTO10 Selenomonas sp. oral clone 708 AY3494O6 clade 480 N N HUOS1 Selenomonas sp. oral clone 709 AY3494O7 clade 480 N N IKOO4 Selenomonas sp. oral clone 711 AY3494.09 clade 480 N N JIO21 Selenomonas sp. oral clone 712 AY3494.10 clade 480 N N JSO31 Selenomonas sp. oral clone 713 AY947498 clade 480 N N OH4A Selenomonas sp. oral clone 714 AY207052 clade 480 N N P2PA 80 P4 Selenomonas sp. oral taxon 716 AEEJO1 OOOOO7 clade 480 N N 149 Veillonellaceae bacterium oral 995 GU470897 clade 480 N N taxon 155 AgrococcuSienensis 117 NR O26275 clade 484 N N Microbacterium gubbeenense 232 NR 025 098 clade 484 N N Pseudoclavibacter sp. Timone 590 FJ375951 clade 484 N N Tropheryma whippiei 961 BX251412 clade 484 N N Zimmermannella bifida 2O31 ABO12592 clade 484 N N Legionelia hackeiae 151 M36O28 clade 486 N OP Legionelia longbeachae 152 M36O29 clade 486 N OP Legionella sp. D3923 154 JN380999 clade 486 N OP Legionella sp. D4088 1SS JN381 012 clade 486 N OP Legionella sp. H63 1S6 JF831047 clade 486 N OP Legionella sp. NML 93L054 157 GUO627O6 clade 486 N OP Legioneiia Steelei 158 HQ3982O2 clade 486 N OP Taiiockia micdadei 91S M36032 clade 486 N N Helicobacter pullorum 996 ABQUO1000097 clade 489 N N Acetobacteraceae bacterium 16 AGEZO100004-0 clade 490 N N AT 5844 Roseomonas cervica is 643 ADVLO1000363 clade 490 N N Roseomonas inticosa 644 NR 028857 clade 490 N N Roseomonas sp. NML94 O193 645 AF533357 clade 490 N N Roseomonas sp. NML97 0121 646 AFS33359 clade 490 N N Roseomonas sp. NML98 0009 647 AFS33358 clade 490 N N Roseomonas sp. NML98 O157 648 AFS33360 clade 490 N N Rickettsia akari 627 CPOOO847 clade 492 N OP Rickettsia Conorii 628 AEOO8647 clade 492 N OP Rickettsia prowazeki 629 M21789 clade 492 N Category-B Rickettsia rickettsii 630 NC 010263 clade 492 N OP Rickettsia Siovaca 631 L36224 clade 492 N OP