The Effect of Expression of Estrus at Artificial Insemination on Target Genes in the Endometrium, Conceptus and Corpus Luteum of Beef Cows

Home , Artificial insemination, IGLL1

THE EFFECT OF EXPRESSION OF ESTRUS AT ARTIFICIAL INSEMINATION ON TARGET GENES IN THE ENDOMETRIUM, CONCEPTUS AND CORPUS LUTEUM OF BEEF COWS

Saeideh Davoodi

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

The Faculty of Graduate and Postdoctoral Studies

(Applied Animal Biology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

April 2015

The aim of this study was to test the effect of expression of estrus at artificial insemination (AI) on the endometrium, conceptus and corpus luteum (CL) gene expression. Twenty-three multiparous non-lactating Nelore cows were enrolled on an estradiol (E2) and progesterone (P4) based timed-AI protocol (AI = d 0), then slaughtered for endometrium, CL and conceptus collection on d 19. Body condition score (BCS), blood samples and ultrasound examination was performed on d 0, 7 and 18 of the experiment followed by RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of 58 target genes. Data was checked for normality and analysed by ANOVA for repeated measures using proc GLM, MIXED and UNIVARIATE. Estrous expression had no correlation with parameters such as BCS, pre-ovulatory follicle and CL diameter, P4 concentration in plasma on d 7 and 18 after AI and IFN-tau concentration in the uterine flushing (P > 0.05); however, a significant increase was observed in conceptus size (P = 0.02; 38.3 ± 2.8 vs 28.2 ± 2.9). The majority of transcripts affected by estrous expression in the endometrium belong to the immune system and adhesion molecule family (MX1, MX2, MYL12A, MMP19, CXCL10, IGLL1 and SLPI) (P ≤ 0.05). Genes related to apoptosis, P4 synthesis and prostaglandin receptor were down-regulated (CYP11A, BAX and PGF2α receptor) (P < 0.05) in the CL tissue of cows in estrus. In addition, four genes were identified as differentially expressed in the 19 old conceptus from cows observed in estrous (ISG15, PLAU, BMP15 and EEF1A1; P<0.05). There was also a significant effect of P4/d7 mainly affecting immune system, adhesion molecules and wnt signaling pathway of endometrium (IGLL1, MX2, SLPI, TRD, APC, WNT2,

GLYCAM1 and MYL12A) (P<0.05). A significant interaction between estrus expression and P4 concentration on d 7 was more pronounced in immune system genes (MX1, MX2, TRD, SLPI and IGLL1;

P<0.05). This study demonstrated that estrous expression at the time of AI, in spite of ovulation being

ii induced by E2, could alter the gene expression profile in reproductive tissues during the pre- implantation phase.

iii

Preface

The animal part of the study and sample collection was conducted from January to March

(Summer) at a commercial cow–calf operation located in Mineiros, Goias, Brazil and was part of the study in the university of Sauo Paulo. The animals used herein were cared for in accordance with the practices outlined in the Guide for the Care and Use of Agricultural Animals in Agricultural Research and

Teaching (Curtis and Nimz, 2010). Animal Care (CCAC) / National Institutional Animal User Training

(NIAUT) Program was obtained under this certificate #6570-14. I was responsible for gene expression studies ( performed at the University of British Columbia’s Dairy Education and Research Centre in

Agassiz, BC) and at Dr. Suzanne Clee’s laboratory for Diabetes Research Group at the Life Science Centre, as wells as data analysis.

Table of Contents Abstract ...... ii Preface ...... iv Table of Contents ...... v List of Tables ...... vii List of Figures ...... viii List of Abbreviations ...... ix Acknowledgements ...... xiii Dedication ...... xiv 1 Literature review ...... 1 1.1 Overview of subfertility in cattle ...... 1 1.2 Estrus cycle ...... 3 1.3 Pregnancy establishment ...... 5 1.3.1 The role of the corpus luteum during pregnancy ...... 5 1.3.2 Endometrium remodelling and embryo development ...... 7 1.4 Role of steroids during pregnancy establishment ...... 9 1.4.1 Progesterone function ...... 9 1.4.2 Estradiol function ...... 10 1.5 Effect of proestrus length on pregnancy maintenance ...... 14 1.6 Interferon, pregnancy stimulated genes in reproductive tissue ...... 15 1.6.1 Genes involved in endometrium receptivity ...... 16 1.6.2 Apoptosis, steroid synthesis and angiogenesis in CL ...... 38 1.6.3 Developmental and immune related genes in the conceptus ...... 42 2 Impact of estrus exposure on gene expression of the endometrium, corpus luteum and conceptus of beef cows ...... 50 2.1 Hypothesis and objectives of the dissertation ...... 50 2.2 Material and methods ...... 50 2.2.1 Animals, housing and grouping ...... 51 2.2.2 Blood samples and ultrasound examinations ...... 52 2.2.3 Slaughter and tissue collection ...... 52 2.2.4 RNA extraction ...... 53 2.2.5 Primer design ...... 53 2.2.6 Complementary DNA synthesis ...... 53 2.2.7 Quantitative real time PCR ...... 54

2.2.8 Statistical analysis...... 55 2.3 Results ...... 55 2.3.1 Expression of genes in the endometrium ...... 55 2.3.2 Expression of genes in the corpus luteum affected by estrus expression ...... 56 2.3.3 Gene expression in the embryo ...... 57 2.3.4 Ovarian and embryo parameters ...... 57 2.3.5 Effect of P4 concentration on day 7 on animal variables, embryo genes, endometrium gene expression and estrus outcome ...... 57 2.3.6 Effect of embryo size on animal variables and embryo gene expression ...... 58 2.4 Discussion...... 58 3 General discussion ...... 82 3.1 Summary ...... 82 3.2 Limitations ...... 83 3.3 Future direction ...... 84 3.4 Conclusions ...... 84 References ...... 86

List of Tables

Table 1: Primer sequences for gene transcription analysis performed for endometrium, CL, and embryo

...... 66

Table 2: Flowchart of gene function ...... 72

Table 3 : Descriptive statistics of reproductive parameters collected on days 7 and 18 of pregnancy in cows detected estrous and not detected estrous at the time of AI ...... 73

vii

List of Figures

Figure 1: Diagram of study ...... 65

Figure 2: Effect of estrus expression on endometrium gene expression ...... 74

Figure 3: Genes not affected by estrous expression in the endometrium tissue ...... 75

Figure 4 : Effect of estrus expression on corpus luteum genes involved in steroidogenesis. Angiogenesis and apoptosis ...... 77

Figure 5 : Effect of estrus expression on embryo genes involved in morphogenesis, immune system, and protein synthesis ...... 78

Figure 6: Effect of P4 concentration in day 7 on endometrium gene expression ...... 79

Figure 7: Interaction between P4 and estrous expression and its effect on endometrium gene expression

...... 80

Figure 8: Effect of embryo size on embryo gene expression ...... 81

viii

List of Abbreviations

AI - Artificial insemination

APC - Adenomatous polyposis coli

Bax - BCL2 associated X protein

BCL2 - B cell lymphoma

BMP - Bone morphogenic inhibitor

BMP15 - Bone morphogenetic protein 15

CIDR - Controlled internal drug-releasing insert

CL - Corpus Luteum

CLD4 - Claudin 4

COX-2 - Cyclooxygenase-2

CXCL10 - C-X-C motif chemokine 10

CYP11A - Cholesterol side chain cleavage enzyme

DKK - Dickkopf-related proteins

E2 - Estrogen

EB - Estradiol benzoate

ECM - Extracellular matrix

ECP - Estradiol cypionate eCG - Equine Chrionic gonadotropin

EMMPRIN - Extracellular matrix metalloproteinase inducer eNOS - Endothelial nitric oxide synthase

ESR1- Estrogen receptor 1

FGF2 - Fibroblast growth factor

FSH - Follicle-stimulating hormone

FTH1 - Ferritin, heavy polypeptide 1

GE - Glandular Epithelium

GH - Growth hormone

GLYCAM1 - Glycosylation-dependent cell adhesion molecule 1

GnRH - Gonadotropin-releasing hormone

GPX4 - Glutathione peroxidase 4

GSK3 - Glycogen synthase kinase 3

HOXB7 - Homebox protein 7

3βHSD - 3 beta-hydroxysteroid dehydrogenase

IDO - Indoleamine 2, 3-dioxygenase

IFNT - Interferon-tau

IGHG1 -Immunoglobulin heavy chain gamma

IGLL1 - Immunoglobulin lambda-like 1

IL-6 - Interleukin 6 iNOS - Inducible nitric oxide synthase

Interlukin 10 - IL-10

ISG15 - Interferon stimulated gene 15

LE - Luminal epithelium

LEF - Lymphoid enhancer factor

LGALS3BP - Lectin galactoside soluble 3 binding protein

LH - Luteinizing hormone

LIFR - Leukemia inhibitory factor receptor

LPS - Lipopolysaccharide

LRP6 - Low-density lipoprotein receptor related protein 6

MHC - Major Histocompatibility Complex

MMP2 - Matrix metalloproteinase-2

MMP19 - Matrix metalloproteinase 19

MSX1 - Msh homeboxe 1

MYL12A - Myosin light chain

MYH9 - Myosin heavy chain 9

MYH10 - Myosin heavy chain 10

NF-KB - Nuclear factor kappa-light-chain-enhancer of activated B cells

NK - Naturl killer

NM II - Non-muscle myosin family

NO - Nitric oxide nNOS - Neuronal nitric oxide synthase

NOS - Nitric oxide synthase

OGP - Estradiol-dependent glycoprotein

OT - Oxytocin

OTR - Oxytocin receptor

P4 - Progesterone

P450scc - Cytochrome P450 sidechain cleavage

PA - Plasminogen activator

PGF2α - Prostaglandin F2α

PGR – Progesterone receptor

PLAU - Plasminogen activator urokinase

PTX3 - Pentraxin 3 qPCR – quantitative polymerase chain reaction

RLC - Non-muscle regulatory light chain

RT-PCR – Reverse transcription polymerase chain reaction

SERPINA14 - Serine peptidase inhibitors 14

SLPI - Secretory leukocyte protease inhibitor

SPP1 - Secreted Phosphoprotein 1

StAR - Steroidogenic acute regulatory

TCF - T cell factor

TIMP -2- Tissue inhibitor of metalloproteinases

Th2 - T helper 2

TRD - T cell receptor delta

UGKO - Uterine gland knock-out

UP -Urokinase-type plasminogen activator

xii

Acknowledgements

First, and foremost, I am very grateful to my supervisor Dr. Ronaldo Cerri for guiding and supporting me through my Masters. He has been a great mentor to me and given me the opportunity and freedom to grow and think as a researcher. I would like to thank members of Dr. Cerri’s group for giving me a warm environment and support during my time in the laboratory. Next, my sincere thanks to my supervisory committee members Dr. Kimberly Cheng and Dr. Xiaonan Lu for overseeing my research progress and providing valuable time and effort to make this dissertation a success. Special thanks to Dr. Suzanne Clee and Shuba Karunakaran for providing me the space for my experiments at the Life Science Centre. I am extremely thankful to my parents, for their love and support and always being by my side no matter the distance. I would like to express my deepest appreciation and gratitude for my amazing friends: Najmeh Tavassoli and Mahsa Imani, it would not be possible to complete this dissertation without their incredible friendship, kindness, and encouragement.

xiii

Dedication

To my beloved parents

xiv

1 Literature review

1.1 Overview of subfertility in cattle

Conception rate reported for beef cows range from 48 to 58% using timed artificial insemination

(AI) systems (Geary et al., 2001; Lamb et al., 2001); this number is relatively low considering that fertilization rates following AI in beef cows is approximately 90% (Diskin and Sreenan, 1980; Smith et al.,

1982). Embryonic mortality is accounted as one of the main causes of economic loss in the cattle industry. One common example of fertility problems in cows experiencing timed-AI is the inability to control follicular development when synchronizing estrus with gonadotropin releasing hormone (GnRH) based programs (Geary et al., 2000). This often leads to ovulation of small follicles with reduced fertility

(Lamb et al., 2001; Perry et al., 2003). The ovulation of small follicles reduced pre-ovulatory concentrations of estradiol (E2) in plasma and consequently a corpus luteum (CL) which produces lesser concentrations of progesterone (P4) (Perry et al., 2005).

Steroid hormones are responsible to prepare the uterus to become a suitable environment for embryo growth and development. Studies by Miller and Moore have shown that changing the consecutive exposure to steroids or limiting the concentrations of E2 or P4 interrupts proper uterine function and results in its inability to sustain conceptus development and survival (Miller and Moore,

1976; Miller and Moore, 1983). The same problem has been observed in lactating dairy cows in which the inability of the uterus to support embryonic development is a major contributor to infertility (Sartori et al., 2006). One steroid hormone critical to pregnancy establishment is P4, with a role in conceptus elongation, an associated increase in interferon-tau (IFNT) production and greater conception rate in cattle (G.E. Mann and Lamming, 2001; Inskeep, 2004).

Another steroid hormone, E2, also acts in favour of pregnancy establishment in cattle by coordinating different processes like the expression of estrus (Asdell et al., 1945), sperm transport within the uterus and oviduct (Hawk and Cooper, 1975), preparation of follicular cells for luteinization and secretion of P4 (McNatty and Sawers, 1975; Welsh et al., 1983), induction of the pre-ovulatory

GnRH surge (Kesner et al., 1981) and induction of endometrial E2 and P4 receptors (Ing and Tornesi,

1997; Xiao and Goff, 1999). The observed reduction in circulating ovarian steroids, namely E2 and P4 and particularly in lactating dairy cows, have been associated with insufficient uterine support observed in pregnancy failure. In addition to the negative effects on the uterus, the compromise of oocyte quality also plays an important role in the fertility loss observed in dairy and beef cattle. Sartori (Sartori et al.,

2002) reported that oocyte quality is reduced in lactating dairy cows compared with heifers and nonlactating cows. Others report of in vitro experiments (Rizos et al., 2005) observed no difference in cleavage rate or blastocyst yield between lactating cows and nulliparous heifers.

Similar physiological abnormalities observed in dairy cows could also be found in beef cows

(Lucy, 2001). In both, beef and lactating dairy cows, several studies have found that a reduction in pre- ovulatory E2 and mid-luteal P4 concentrations have extensive associations with infertility (Vasconcelos et al., 2001; Sartori et al., 2002; Peters and Pursley, 2003; Sartori et al., 2004; Wolfenson et al., 2004).

Reduced steroid concentrations in lactating dairy cows could be the result of increased steroid catabolism caused by the great increase in feed intake and liver blood flow (Sangsritavong et al., 2002;

Vasconcelos et al., 2003). Studies utilizing embryo transfer and early pregnancy diagnosis indicate that less than 50% of the viable embryos could establish pregnancy by 27–30 days after ovulation in lactating dairy cows (Moreira et al., 2002; Sartori et al., 2006). Embryo survival and overall fertility are, in fact, significantly better in beef cattle, but it is important to emphasize that reductions in conception rates previously observed are partly explained by the imbalances in P4 and E2 concentrations at key periods of the estrus cycle.

1.2 Estrus cycle

Similar to other domestic mammals, cattle exhibit regular cyclic changes in reproductive organs and sexual behaviour. The estrus cycle is about 21 days in cattle, with a range of 18 to 24 days (Hafez and Hafez, 2000). The estrus cycle in cows, similar to other animals, is controlled by the reproductive hormones secreted by the hypothalamic-pituitary-gonadal axis with the role of regulating development and regression of ovarian follicles and CL. Two gonadotropins are secreted from gonadotrophs of the anterior pituitary: luteinizing hormone (LH), and follicle-stimulating hormone (FSH). In the hypothalamus, GnRH secretes and induces secretion of LH from gonadotrope cells of the anterior pituitary (Schally et al., 1971). LH pulses have a correlation with the GnRH secretions from hypothalamus neurons, which have been shown in sheep (Clarke and Cummins, 1982) and cattle (Rodriguez and Wise,

1989). In a study by Clarke (Clarke et al., 1984) in ovariectomized ewes with hypothalamo-pituitary disconnection, it was shown that amplitudes of the LH pulses are dependent on the GnRH pulse frequency. Similar results have been obtained by inducing arcuate nucleus lesions in rhesus monkeys

(Wildt et al., 1981). Their results show that as the frequency of GnRH pulses increases (1 pulse/h), mx1plasma LH baselines increase but LH pulse amplitudes decrease, whereas low-frequency GnRH pulses (1 pulse/4 h) induce high LH pulse amplitudes and low LH baselines.

There are four phases in a typical estrus cycle: estrus, metestrus, diestrus and proestrus.

Proestrus occurs immediately after the lysis of the CL around day 17-19 of the estrus cycle and lasts until the beginning of the behavioural expression of estrus. During proestrus, the ovaries produce E2 and the pre-ovulatory follicle reaches its final stages of development in a low P4 environment (Shearer, 2003).

Estrus is the phase were cattle are sexually receptive and this period begins with the acceptance of the male and normally lasts less than 24 h (Hafez and Hafez, 2000). Estrus length varies considerably depending on age (Gwazdauskas et al., 1983), breed (Anderson, 2009), ambient temperature

(Pennington et al., 1985) and floor conditions (Vailes and Britt, 1990). Cows in estrus express different behavioural and physiological signs. Signs of estrus include: standing to be mounted by other cows or a bull, producition of clear, glassy mucus from the vulva, restlessness, swelling and reddening of the vulval mucosa, and slight reductions of feed intake and milk yield (Ball and Peters, 2004). The metestrus phase lasts for about 3 days after ovulation and begins approximately 24 to 30 h after the onset of estrus.

Diestrus is the lengthiest phase and lies between metestrus and proestrus. In this phase, the CL is fully functional and produces elevated levels of P4. If pregnancy occurs, the CL will be maintained throughout the pregnancy period, but if not, the uterus will initiate the process of luteolysis and the CL will then regress at approximatly day 17-19 of the estrus cycle (Shearer, 2003).

In beef cattle operations in North America, the use of bulls is still the standard practice during the breeding season. The strategy to use timed-AI programs in beef cows is growing and has its advantages such as the non-dependency on estrous detection, faster genetic improvement and shorter breeding seasons (Bridges et al., 2010). Since the adoption of such programs, knowledge of the physiology, etiology of common reproductive pathologies and new drugs has dramatically improved.

Within this new influx of information was reports showing that even relatively fertile beef cows can suffer significant declines in fertility if not exposed to the optimal levels of P4 and E2 during the estrus cycle associated with AI.

Common timed-AI protocols used in beef and dairy cows around the world are those based on

GnRH and prostaglandin F2α (PGF2α), such as Ovsynch (Pursley et al., 1997) and CO-Synch, and those based on progestagens and estrogens. Briefly, the GnRH induces ovulation with relatively great precision, which gives control over initiation of a new follicular wave as well as optimum timing for AI.

The success of GnRH to induce follicle turnover is dependent, in part, upon the day of the estrus cycle the GnRH is administered (Vasconcelos et al., 1999; Moreira et al., 2000; Cartmill et al., 2001) as it has

4 been demonstrated that the initial injection of GnRH was only effective in inducing ovulation in 66% of beef (Geary et al., 2000) and 64% of dairy cattle (Vasconcelos et al., 1999). One interesting point observed by many researchers is that when beef cows are induced to ovulate from follicles of lesser diameter using an estrus synchronization program there was a decrease in conception rates (Lamb et al.,

2001; Perry et al., 2005). Another study (Peters and Pursley, 2003) has demonstrated that decreasing the interval from PGF2α to GnRH-induced ovulation in an Ovsynch protocol also resulted in a decreased conception rate. In addition, it was observed that cows with a shorter proestrus prior to the induced ovulation from a large follicle had lesser conception rates and smaller concentrations of E2 during the pre-ovulatory period than those with a longer proestrus (Bridges et al., 2010).

1.3 Pregnancy establishment

In order to establish a successful pregnancy, the reproductive system, particularly the uterus, needs to be prepared and in synchrony with the newly formed embryo to adequately support the fast growth observed in the early embryonic stage. Another key event is the prompt response by the endometrium to the maternal recognition of pregnancy signal (released by the conceptus) in order to halt luteolysis and maintain P4 secretion. Collectively, the endometrium, CL and embryo contribute towards the pregnancy maintenance.

1.3.1 The role of the corpus luteum during pregnancy

The CL is a temporary endocrine gland that contains different types of cells such as endothelial cells, steroidogenic large and small luteal cells, fibroblasts, smooth muscle cells and immune cells

(O’Shea et al., 1989). There are two hormones produced by this gland, the major one is P4 and the other one is oxytocin (OT), which is produced in a lesser amount. Large steroidogenic cells store OT in their secretory granules (McCracken et al., 1999). The P4 plays a critical role in the establishment and

5 maintenance of pregnancy as it induces the inactive stage in the endometrium (Csapo and Pulkkinen,

1978) to prevent the maternal immune response to fetal antigens (Szekeres-Bartho, 1992). During early pregnancy, P4 is mainly secreted by the CL. In ruminants, the main hormone necessary for promoting the growth of the CL and P4 production is LH (McCracken et al., 1999). It is interesting to note that during the early stages of CL development, the major factor influencing P4 secretion is growth hormone

(GH)(Miyamoto et al., 1998; Kobayashi et al., 2001). Growth rate of the CL is very rapid, and two days after ovulation, a significant increase in its mass has been recorded (Fields and Fields, 1996). The heterogenous populations of cells inside the CL such as steroidogenic cells, endothelial cells, and fibroblasts undergo repeated mitosis, while on the other hand, hypertrophy of granulosa and theca cells occurs; overall all these processes lead to an increase in CL mass (McCracken et al., 1999; Acosta and

Miyamoto, 2004).

The CL consists of at least two different types of steroidogenic cells, large and small luteal cells.

The large cells originate from the granulosa and the small ones from theca cells when the follicle ruptures at ovulation (Lei et al., 1991). As vascular angiogenesis occurs inside CL, macrophages and endothelial cells infiltrate in the CL (Reynolds and Redmer, 1999). A range of steroids, growth factors, cytokines and protein hormones have been shown to be produced by CL components and they also participate in CL establishment (Reynolds and Redmer, 1999; Berisha and Schams, 2005). During luteal regression, P4 decreases along with the loss of LH receptors and the reduction of blood flow (Niswender et al., 1976). In case pregnancy does not occur, the CL undergoes lutelolysis, which is necessary for a new estrus cycle and to prepare for a subsequent ovulation. Generally, luteolysis is initiated by PGF2α released from the endometrium (McCracken et al., 1999). In mammals, luteolysis has two stages, functional luteolysis and structural luteolysis. In the functional stage of CL regression, P4 production decreases quickly (McCracken et al., 1999). In the structural luteolysis, apoptosis occurs in CL cells which

6 have been described by morphological and biochemical parameters in ruminants (Juengel et al., 1993;

Rueda et al., 1995; Rueda et al., 1997).

1.3.2 Endometrium remodelling and embryo development

The uterus has different roles during the receptive phase of the endometrium including regulation of the estrus cycle, transport and capacitation of spermatozoa, early embryo development, implantation and support of pregnancy throughout gestation. Growth and development of the conceptus is controlled, to some extent, by the maternal uterine environment (Wilmut and Sales, 1981;

Lawson et al., 1983; Garrett et al., 1988). Steroid hormones, cytokines and growth factors have been shown to control endometrial differentiation and proliferation during the period of pre- and post- implantation (Chen et al., 1999). Uterine glands in the endometrium secrete factors for survival and elongation of the embryo (Gray et al., 2002). In order to investigate the role of the endometrium on embryonic survival, a gland knock-out (UGKO) ovine model has been developed. In ewes, neonatal exposure to norgestomet, a P4 analogue, leads to the UGKO phenotype. The UGKO ewes are diagnosed with recurrent early pregnancy loss due to failure in conceptus elongation and survival between day 12 and 14 post-estrus, which is similar to a phenotype also present when control embryos were transferred into UGKO recipients (Gray et al., 2002). Using microarray analysis comparing cyclic and UGKO ewes has revealed 23 differentially expressed genes in the endometrium which most of them belong to immunoglobulin genes, likely because of the large numbers of immune cells present in the tissue (Gray et al., 2006).

In order to establish a successful pregnancy, the conceptus communicates and attaches to the endometrium by elongating from a hatched blastocyst. The outer layer of the blastocyst consists of trophectoderm cells which undergo three stages: apposition, attachment and penetration into the uterine luminal epithelium (LE); this process is called implantation (Gharib-Hamrouche et al., 1993;

Chavatte-Palmer and Guillomot, 2007). In the first stage, characterized by a weak connection, the trophectoderm cells are apposed to the uterine LE. Then, in order to make the association stronger and avoid dislocation of the blastocyst by flushing of the uterine lumen, adhesion occurs. In the final penetration stage, a protease secreted from the embryo degrades the LE and decidualization starts by differentiation of stromal cells into decidual cells (Enders and Schlafke, 1969). All these fundamental events lead to an attached embryo with three body layers and elementary organs, as well as extra embryonic membranes by the end of the third week (Berg et al., 2010). In ruminants, the embryo expresses and secretes IFNT from trophectoderm cells to communicate with the endometrium LE and modulate a cascade of events that promote embryo survival. IFNT is encoded by multiple genes (Roberts et al., 1990; Ealy et al., 2001). In one study by (Stojkovic et al. (1995), the highest secretion of IFNT by bovine blastocysts in vivo was demonstrated to be between days 15 and 17 of the estrous cycle, whereas in a specific culture system for bovine trophoblastic vesicles, increasing IFNT secretion was observed for a longer period (up to day 23 after fertilization).

Based on experiments comparing the effects of intrauterine and systemic application of recombinant IFNT in sheep, IFNT reduces the expression of uterine E2 and OT receptors, and these effects are likely via paracrine mechanisms. Consequently, IFNT will prevent OT-induced pulsatile secretion of PGF2α, thereby inhibiting luteolysis (Spencer et al., 1999). In the uterus, IFNT initiates a signal transduction cascade that involves signal transducer and activator of transcriptions (STAT) and interferon regulatory factors (IRF). Upon activity of IFNT on LE cells of the endometrium, STATs1, 2, 3,

5a/b and 6 are tyrosine-phosphorylated within 30 min and translocated into the nucleus. Upon longer exposure to IFNs, STATs3, 5a/b, and 6 are rapidly dephosphorylated. IFNT induces homodimerization of

STAT1 to form the transcription factor GAF (gamma-activated factor) as well as heterodimerization of

STAT1 and STAT2. This heterodimer associates with IRF-9, forming the transcription factor complex

ISGF3 (IFNT-stimulated gene factor 3)(Stewart et al., 2001). Early embryonic loss and pregnancy failure

8 likely occur in situations which inadequate reaction of the endometrium to IFNT or insufficient secretion of IFNT by the conceptus exists. The level of IFNT secretion has been suggested to be used as a parameter for the assessment of embryo quality (Hernandez-Ledezma et al., 1993).

1.4 Role of steroids during pregnancy establishment

Ovarian steroids such as E2 and P4 are the main factors contributing to uterine receptivity. It has been reported that in mice and rats successful implantation depends on proper concentrations of P4 and E2 (Mccormack and Greenwald, 1974). However, in some mammals including in pigs, guinea pigs

(Heap and Deanesly, 1967), rabbits (Kwun and Emmens, 1974), and hamsters (Harper et al., 1969), ovarian E2 is not necessary (Psychoyos, 1973; Heap et al., 1981) .

1.4.1 Progesterone function

It has been established that for maintaining a proper uterine environment to support conceptus growth and survival, an adequate post-ovulatory increase in P4 concentration is necessary. Based on

Diskin and Dunne studies in cattle and sheep, increasing P4 in the period of post-ovulation leads to a progressive conceptus elongation (Dunne et al., 2000; Diskin et al., 2006; Diskin and Morris, 2008). Early studies demonstrated that increasing conceptus elongation resulted in increased concentrations of IFN in the uterine lumen (Northey and French, 1980; Humblot, 2001) and is further related to improvements in conception rates (Betteridge et al., 1980; Ruéda et al., 1993; Sreenan, 2001). It seems that the influence of P4 on embryo development is indirect (Short et al., 1991) through the modification of the transcriptome of the uterine LE and consequently the uterine luminal fluid (ULF) composition (Schmitt et al., 1993; Johnson et al., 1999; Austin et al., 2004) .

Reports in ewes (Satterfield et al., 2006; Satterfield et al., 2010) and cows (Forde et al., 2009;

Forde et al., 2010) show that during early gestation increases in P4 contribute to conceptus

9 development indirectly by increasing the down-regulation of PGF2α receptors in the uterine endometrium, elevating the level of uterine histotrophic secretion. The mechanisms by which P4 facilitates conceptus survival have been investigated in the pregnant ewe. Various amino acid (i.e. arginine, serine, glutamine, and lysine) and glucose concentrations increase in the uterine histotroph when exogenous P4 was administered (Satterfield et al., 2010). In another study by the same group, P4 supplementation in early gestation in ewes could result in reducing tight junction-associated proteins of

LE and a consequent increase in serum or stromal derived molecules to enter the uterine lumen

(Satterfield et al., 2007). Similar results have been published regarding P4 supplementation in cows and its effect on modification of endometrial expression of genes related to histotroph production (Forde et al., 2009; Forde et al., 2011). A study by Atkins (Atkins et al., 2013) highlighted that in embryo recipient beef cows, P4 concentration on day 7 was a reliable factor to predict the probability of a successful pregnancy on day 27 of gestation. Other studies have also demonstrated that non-pregnant cows had a lower level of P4 at different stages of the estrous cycle pre and post-AI compared with those diagnosed pregnant (Lukaszewska and Hansel, 1980; Shelton et al., 1990; Mann et al., 1995; Kerbler et al., 1997;

G.E. Mann and Lamming, 2001; Hommeida et al., 2004; Perry et al., 2005; Forde et al., 2009; Forde et al.,

2011). In another recent report, cows with P4 concentrations lower than 5 ng/mL on day 14 were more likely to lose pregnancy from day 28 to 63 of gestation (Kenyon et al., 2013).

1.4.2 Estradiol function

During estrus, elevated E2 concentrations increase epithelial cell height in the fimbria (Murray,

1996) and ampulla (Murray, 1995), and increase ciliation of the LE cells of the fimbria (Murray, 1996). In addition to this, E2 induces maturation of oviductal secretory organelles and stimulates production and release of granules from the non-ciliated epithelial cells until day 3 after fertilization (Murray, 1995). An estradiol-dependent glycoprotein (OGP) is secreted from the oviduct of both cows (King and Killian,

1994) and sows (Buhi and Alvarez, 2003) at estrus and during early gestation. E2 administration, either in vitro or in vivo, leads to the synthesis and secretion of OGP by non-ciliated cells of the ovine ampulla at estrus and on days 1.5, 2, and 3 after fertilization; however, this change was not observed in the isthmus portion of the oviduct (Murray, 1992; Murray, 1993).

According to literature, in both cattle (Kimmins and MacLaren, 2001; Meikle et al., 2001;

Robinson et al., 2001) and sheep (Spencer and Bazer, 1995; Ing et al., 1996; Kimmins and MacLaren,

2001; Meikle et al., 2001; Robinson et al., 2001; Ing and Zhang, 2004), the pre-ovulatory increase in E2 up-regulates gene expression of both P4 and E2 receptors in the uterine endometrium. The pre- ovulatory increase in circulating E2 concentration increases its own receptor expression in the endometrium by stabilizing E2 receptor mRNA (Ing et al., 1996; Ing and Ott, 1999) until concentrations of P4 present during the mid-luteal phase decrease the gene expression of both the P4 and E2 receptors

(Spencer and Bazer, 1995; Meikle et al., 2001; Robinson et al., 2001). It seems that E2-induced up- regulation of the P4 receptor is a key physiological process that allows for proper endometrial gland secretions to support embryo survival in response to increased mid-luteal P4 concentrations (Ing and

Zhang, 2004).

Concentrations of E2 during proestrus are also critical in determining the lifespan of the CL

(Garcia-Winder et al., 1986; Mann and Lamming, 2000; Kieborz-Loos et al., 2003), as lesser pre-ovulatory

E2 concentrations may alter the normal cyclic expression of P4 and E2 receptors (Mann and Lamming,

1995; Robinson et al., 2001), resulting in elevated gene expression of OT receptors and the release of

PGF2α. In addition, other functions of pre-ovulatory E2 are to increase insulin-like growth factor-1 (IGF-

1) mRNA in the uterus (Robinson et al., 2000) and oviduct (Pushpakumara et al., 2002) during fertilization and early embryo development.

Overictomized ewes have been extensively used as models to study the effect of E2 on pregnancy establishment. Ewes that did not receive exogenous E2, similar to those obtained upon estrus, failed to deliver a normal embryo after 21 days of gestation induced by synchronous embryo transfer (Miller and Moore, 1976). Eliminating E2 lead to a decrease in the rate of uterine protein synthesis, the ratio of total RNA to total DNA and also uterine weight reduction in comparison with those animals that received adequate amounts of exogenous E2 (Moore and Miller, 1976). In another study, ovariectomized cows that did not receive E2 could maintain pregnancy until day 21 in a similar proportion to those that received either estradiol cypionate (ECP) or estradiol benzoate (EB) to simulate the pre-ovulatory period. However, by day 29 of gestation the group with no E2 supplementation had a decreased pregnancy rate compared with the other groups (Roberts et al., 2012). Several studies have reported the correlation between E2 concentration, ovulation and pregnancy success in beef and dairy cattle (Vasconcelos et al., 2001; Perry et al., 2005; Lopes et al., 2007).

Another factor associated with greater pregnancy rates in beef cows is the pre-ovulatory follicle diameter (Souto, 2010; Pohler et al., 2012; Vasconcelos et al., 2013). Follicular diameter and follicular E2 production seem to have a positive correlation (Ireland and Roche, 1982; Kruip and

Dieleman, 1985) as E2 availability during the pre-ovulatory period is one of the determining factors associated with a successful pregnancy. The pre-ovulatory follicle circulating concentrations of E2 before ovulation also affect P4 concentrations in the following estrus cycle (Vasconcelos et al., 2001; Perry et al., 2005; Bridges et al., 2010), which is a contributing factor to embryonic survival. In order to investigate different factors related to the ovarian follicle on pregnancy failure, different animal models have been introduced during the past years. Some models altered the functional status, diameter, and age of pre-ovulatory follicle (Mussard et al., 2003; Mussard et al., 2007), whereas others varied the length of proestrus and E2 concentrations while maintaining follicle age and diameter constant (Bridges et al., 2010; Bridges et al., 2012).

In addition, the deleterious effects on pregnancy rate of a reduced proestrus duration can still be observed when embryo transfer is used instead of AI (Mussard et al., 2003). The group from Ohio

State University summarized (Bridges et al., 2013) their results regarding E2 and proestrus length as following: 1) The sub-fertility related to immature follicles is mostly related with the steroidogenic capacity of the follicle during proestrus and the subsequent CL, whereas the age or diameter of the follicle has a lesser degree of importance and, 2) an improper hormonal environment (lower P4 and E2) results in a reduced ability of the uterus to support the embryo. In two recent studies, the effect of pre- ovulatory E2 concentration on fertility reduction has been investigated using a single ovulation reciprocal embryo transfer protocol (Atkins et al., 2013; Jinks et al., 2013). Atkin observed an increase in pregnancy maintenance from day 7 to 27 of gestation induced by increased serum E2 concentration on day 0 and P4 concentration on day 7 of the recipient cow. In the same studies, it was observed that concentrations of E2 of the donor cows played a critical role in fertilization rates whereas the E2 concentration of the embryo recipient cow at the time of ovulation used was key to maintain the pregnancy (Atkins et al., 2013). In a retrospective study, the authors categorized the embryo donor and embryo recipient cows each into two groups of low E2 (< 8.4 pg/mL) or high E2 (≥ 8.4 pg/mL) based on serum concentrations of E2 at induced ovulation (Jinks et al., 2013). Their conclusions showed that ovulation of small dominant follicles induced by GnRH was associated with reduced serum E2 concentrations, fertilization rate (donor cows), and pregnancy establishment (recipient cows).

Furthermore, ECP supplementation during the pre-ovulatory period has a positive effect on pregnancy rate of cows with smaller dominant follicles. Other indirect effects of manipulating the pre-ovulatory E2 include the alteration of gene expression of oxytocin receptors (OTR) and cyclooxygenase-2 (COX-2) in the uterine endometrium on day 5 of the estrus cycle (Bridges et al., 2005). In another study, the pre- ovulatory concentrations of E2 were assessed on gene expression of OTR and proenkephalin on days 5 and 10 of the subsequent estrus cycle. The OTR expression decreased from day 5 to 10 in both high and

13 low E2 treatments. On the other hand, proenkephalin expression showed no difference between treatments on day 5 but expression increased from day 5 to 10 only in high E2 cows, which led the authors to conclude that cows with decreased concentrations of E2 prior to ovulation may be influenced by changes in uterine protein and receptor expression (Perry et al., 2009). In contrast, Schiefelbein found no significant change by pre-ovulatory concentrations of E2 on uterine expression of OTR, estradiol receptor , or nuclear progesterone receptor on days 0 and 16 of the subsequent estrus cycle

(Schiefelbein et al., 2008).

In an evaluation of the transcriptome profile in the bovine endometrium, the term

“decidualization” was more abundant among E2 responsive genes, and although decidualization does not occur in cattle, it may add to the evidence for the role of E2 in programming the endometrium for conceptus attachment (Shimizu et al., 2010).

1.5 Effect of proestrus length on pregnancy maintenance

In Bos taurus beef cows, the premature induction of an LH surge when the follicle diameter reached 10 mm resulted in reduced fertility compared with cows that allowed to proceed to spontaneous estrus and ovulation (Mussard et al., 2007). It was observed that by early treatment with

PGF2α during an E2/P4 based timed-AI protocol fertility was improved by increasing duration of proestrous and reducing P4 close to AI (Pereira et al., 2013). In the same study, when two completely different timed-AI protocols were tested (E2/P4 protocol vs. 5-day Cosynch protocol) it was observed that a lengthier proestrus improved conception rates (Pereira et al., 2013). Based on previous reports by

Vasconcelos and Perry (2001 and 2005), ovulation of small follicles is associated with a reduction in conception rates and E2 concentration in plasma, but also an increase in the incidence of short luteal phases (Vasconcelos et al., 2001), and increased pregnancy loss (Perry et al., 2005).

Regarding P4 concentration and proestrus length, it is reported that a short proestrus interval reduces pregnancy rate after fixed-time AI in beef cattle by inducing the ovulation of a small follicle, and less functional CL. However, cows with lower P4 concentration during the growth of the ovulatory follicle had an increase in their pre-ovulatory follicle diameter and subsequent CL diameter and function

(Dadarwal et al., 2013). Administration of ECP 24 hours before AI increased pregnancy rates in cows induced to ovulate a small dominant follicle (< 12.2 mm)(Jinks et al., 2013). The capability of P4 for regulating frequency of LH pulses is dependent on a progressive concentration of P4. If P4 concentration falls below a certain level (above basal level), LH pulse frequency increases and it has the ability to stimulate growth of the dominant follicle, on the other hand, sub-luteal concentrations of P4 inhibit ovulation (Kinder et al., 1996). From these results, they have concluded that during estrus synchronization, lower concentrations of P4 during the period of progestin treatment can accelerate maturity of the dominant follicle upon estrus, therefore, increasing E2 concentration with positive impacts on fertility.

In some studies, the effect of exogenous gonadotropins on follicular maturity has been reported. Tribulo et al. (2002) noted that beef cows treated with equine chrionic gonadotropin (eCG) on the 5th day of an 8-day E2 program resulted in increased pregnancy rates in embryo transfer recipients

(Tribulo et al., 2002). Some other studies also reported an increase in ovulatory follicle diameter and timed-AI pregnancy rate by using exogenous eCG at the start of proestrus in an E2-based protocol

(Baruselli et al., 2004; Dias et al., 2009; Peres et al., 2009) .

1.6 Interferon, pregnancy stimulated genes in reproductive tissue

The pre-implantation phase is a critical period in which modifications are made and the environment of the endometrium becomes capable of receiving the embryo for elongation and implantation. On the other hand, by the time the embryo reaches the site of implantation, it starts

15 sending recognition signals to the endometrium in order to block luteolysis and sustain the secretion of

P4. Different changes related to suppression of immune system, morphogenesis and development, and attachment are involved in the process of endometrium receptivity.

1.6.1 Genes involved in endometrium receptivity

1.6.1.1 Immune-related genes

Immunologically, the fetal tissue is considered an allograph (foreign) to the maternal environment, thus the endometrium is required to build mechanisms to favour immune-tolerance, which includes the modification of immune-modulatory gene expression.

CXCL10 (C-X-C motif chemokine 10)

Chemokine family contains small secreted polypeptides which specifically act towards attraction of leukocyte subsets through binding to cell-surface receptors. Members of this family have been reported to participate in reproductive events such as embryo implantation, parturition, ovulation, and also in pathological conditions like preterm delivery, endometriosis and the ovarian hyper-stimulation syndrome (Lusso, 2006). In the apposition phase of embryonic implantation, blastocysts-endometrium communication depend on presence of soluble mediators like cytokines, chemokines and some factors which produced to act in a bidirectional way (Dominguez et al., 2003). There is a report of more than 11- fold up-regulation of CXCL10 in pregnant cows compared with non-pregnant cows (Cerri et al., 2012).

Studies in ewe showed CXCL10 mRNA localization to monocytes in the sub-epithelial stroma of uteri in pregnant ewes. In the ovine uterus, they observed the CXCL10 expression on day 17 in the uterine lumen, and the chemokine receptor 3 was localized to trophectoderm (Nagaoka et al., 2003; Imakawa et al., 2006).

There is evidence that CXCL10 enhanced the cytotoxicity of T cells and stimulate the production of pro-inflammatory cytokines in mice (Cappello et al., 2004; Nakayama et al., 2004; Kim et al., 2005).

Experiments performed in cows showed that CXCL10 and CXCL11 were down-regulated in the sub-fertile cows (Walker et al., 2012). They are usually up-regulated upon pregnancy and act to attract immune tolerance-promoting uterine natural killer cells to the site of implantation in humans (Dominguez et al.,

2003; Cox et al., 2008; Dominguez et al., 2008; Li et al., 2010). Additionally, they attract the trophoblast to the endometrium, and CXCL10 promotes adhesive activity of the trophoblast through stimulation of integrin expression in ruminant species (Nagaoka et al., 2003a; Nagaoka et al., 2003b; Imakawa et al.,

2005; Imakawa et al., 2006; Spencer et al., 2008).

PTX3 (Pentraxin 3)

PTX3 is the prototypic long member of pentraxin family and its first observation goes back to

1990’s when it was reported as a cytokine-inducible gene in endothelial cells and fibroblasts. The original discovery of PTX3 indicated its role as early induced protein in response to pro-inflammatory stimuli and also a soluble pattern recognition molecule involved in the innate immune-response

(Garlanda et al., 2005). It was observed an up-regulation of PTX3 in pregnant cows specifically in the caruncles’ area of the endometrium (Walker et al., 2010a), but other have also found this up-regulation in the inter-caruncular tissue (Cerri et al., 2012). When PTX3 binds to the c1q, it leads to the activation or inhibition of the classical complement pathway (Nauta et al., 2003; Popovici et al., 2008). There is also an association between greater level of PTX3 and pre-eclampsia, a condition in which endothelial cells become dysfunctional (Cetin et al., 2006; Rovere-Querini et al., 2006; Akolekar et al., 2009; Castiglioni et al., 2009; Cetin et al., 2009) and produce pro-inflammatory factors (TNFα, IL-1, and IL-10) which induce

PTX3 synthesis (Wisniewski and Vilcek, 2004; Nauta et al., 2005; Doni et al., 2006). PTX3 deficiency has been reported in mice infertility (Tranguch et al., 2007). Some common cells which express PTX3 are

17 amniotic epithelium, chorionic mesoderm, trophoblast terminal villi, and perivascular stroma of placentas, and increases throughout pregnancy with a peak at delivery (Rovere-Querini et al., 2006).

TRD (T cell receptor delta)

The T-lymphocyte antigen recognition mechanism mimics the one used by B-cells to produce immunoglobulins. Mature T-cells are classified by expressing either alpha and beta (αβ) or gamma and delta (γδ) chains. The T-cell receptor chains are bound to membrane and they need a cell-cell contact for activation. One of the γδ T cell features is that they may recognize antigens directly without major histocompatibility complex (MHC) presentation. The genes that encode for T-cell receptor delta chain are grouped within the T-cell receptor alpha chain locus on chromosome 14 ( Janeway et al., 2001). TRD gene has been reported as an important cell regulating the embryo–maternal relationship (Szekeres-

Bartho et al., 2001). There is a greater number of γδ T cells present in the uterus of pregnant mice compared with non-pregnant ones (Heyborne et al., 1992). As previously noted, γδ T cells, unlike the αβ

T cells, are not restricted to MHC presentation by antigens and have the ability to recognize unprocessed antigens; thus, γδ T cells are likely to interact with the conceptus during pregnancy because

γδ T cells need the conceptus for activation.

In humans, there is an association between γδ T cells and the production of Interlukin 10 ( IL-10) and transforming growth factor β1 (Nagaeva et al., 2002; Mincheva-Nilsson, 2003), classical immunosuppressive molecules that emphasize the importance of γδ T cells as immuno-modulatory molecules during pregnancy. One report did not find a significant change in endometrium TRD gene expression caused by pregnancy on day 17 of gestation, however, a two-fold increase caused by lactation was observed (Cerri et al., 2012). It is believed that the most abundant lymphocyte population in the sheep’s endometrium during all but early pregnancy is the γδ T cell. Endometrial γδ T cells in sheep showed anti-bacterial and immune-regulatory behavior (LEE et al., 1992; Nasar et al., 2002).

Depletion of specific subtypes of γδ T cells in mouse resulted in abortion and unsuccessful delivery which is indicative of feto-protective and abortogenic characteristics of γδ T cells, which the former is more abundant in pregnancy (Arck et al., 1997).

IL-10 (Interlukin 10)

IL-10 is an immune-suppressive cytokine and originally thought to be produced only by T helper

2 (Th2) cells (Fiorentino et al., 1989). In case inflammation occurs by pathogens, IL-10 inhibits some pro- inflammatory responses from innate and adaptive immune system and plays a critical role during the resolution phase of inflammation (Moore et al., 1990). Development of inflammatory bowel disease has been reported in mice by blocking the IL-10 pathway. Up-regulation of IL-10 expression has been associated with many chronic bacterial and viral infections. Interestingly, some viruses have the potential to produce their own version of IL-10 (vIL-10) and directly suppress the immune responses of the host (O’Garra and Vieira, 2007; Trinchieri, 2007; Gabrysová et al., 2009). In humans during gestation, placenta produces IL-10 and its concentration decreases just at parturition (Paradowska et al., 1997;

Simpson et al., 1998). Groebner reported a significantly greater gene expression of IL-10 in the endometrium of pregnant animals on Day 18 (Groebner et al., 2011a) probably plays an important role protecting the developing embryo (Imakawa et al., 2005). As IL-10 is an anti-inflammatory cytokine, one function in the early pregnant uterus could be the regulation of the embryo induced local inflammatory reaction (Pomini et al., 1999; Hanna et al., 2006). It could also function as a regulator of MMP-9 activity as has been shown in early pregnant women (Meisser et al., 1999).

IDO (Indoleamine 2, 3-dioxygenase)

Indoleamine 2,3-dioxygenase (IDO) which participate in tryptophan catabolism is widely distributed in various mammalian tissues (Hirata and Hayaishi, 1972; Cook et al., 1980; Yoshida et al.,

1980; Yamazaki et al., 1985). IDO become activated in response to some pathological conditions such as

19 viral infection (Yoshida et al., 1979) and tumors (Yoshida et al., 1988), resulting in accelerated degradation of tryptophan in infected and tumor cells. In a study by Munn, they found that inhibiting

IDO function resulted in enhanced T-cell responses against allogeneic conception and pregnant mice recognized embryo as an foreign tissue to be rejected (Munn et al., 1998). Groebner also showed an 18- fold increase in IDO mRNA on day 18 of pregnancy in heifers and was confirmed by a decrease in endometrial l-tryptophan and an increase in l-kynurenine observed from day 12 to 18 in pregnant heifers (Groebner et al., 2011b).

LIFR (Leukemia inhibitory factor receptor)

Leukemia inhibitory factor (LIF) belongs to the interleukin-6 family cytokine and is actually a pleiotropic cytokine. A variety of cells express LIF receptors such as neurons, megakaryocytes, macrophages, adipocytes, hepatocytes, osteoblasts, myoblasts, and kidney and breast epithelial cells, as well some tumor cell lines derived from these tissues (Hilton, 1992). LIF acts by binding to the LIF cell- surface receptor complex. The LIF receptor complex comprises the LIF receptor (LIFR) chain and the gp130 receptor chain (Gearing et al., 1992; Hirano et al., 1994). Evidence have detected LIF and LIFR in the rabbit pre-implantation uteri and blastocysts, therefore highlighting its role in feto-maternal crosstalk (Lei et al., 2004). In other species like mouse embryo (Nichols et al., 1996), bovine embryos

(Eckert and Niemann, 1998) and human embryos (Chen et al., 1999) these ligand and its receptor have been reported . In human species, the importance of LIFR presence on trophoblast cells is for its growth, differentiation and modification of the intrauterine environment for Th2 cells predominance (Hoey and

Levine, 1988; Kojima et al., 1995; Piccinni et al., 1998), critical for conceptus survival (Kwak-Kim et al.,

2005). Various studies in sheep indicated an abundancy for LIF mRNA between days 16 and 20 of gestation. Immunohistochemistry studies also showed this protein is more present in the caruncular and

20 intercaruncular LE, but was also present in Glandular Epithelium (GE) and inter-caruncular stromal cells, as well as in the trophoblast cells of day 17 conceptuses (Vogiagis et al., 1997).

MX1 & MX2 (Myxoviruses)

Myxoviruses (MX1 and MX2) which are recognized as intracellular antiviral proteins belong to dynamin large GTPase family and they are involved in vesicle formation, intracellular trafficking and cytokinesis, all related to defense against viruses (Horisberger et al., 1983; Haller and Kochs, 2002;

Racicot et al., 2008). Studies performed in cattle have indicated the importance of these genes in the uterus during pre-implantation in response to IFNT. The MX1 and MX2 molecules do increase in the uterine endometrium of ewes (Charleston and Stewart, 1993; Ott et al., 1998) and cows (Hicks et al.,

2003) in response to IFNT during pregnancy. Ott observed a 10-fold increase in MX1 expression in pregnant ewes compared to cyclic animals and this expression was between day 13 and day 19 detected in LE, GE, stroma and myometrium (Ott et al., 1998). Similarly, another report indicated a 15-fold increase between day 12 to 15 of the cycle in pregnant cows compared with cyclic cows (Hicks et al.,

2003). MX1 expression was also detected on day 17 of pregnancy in uterine fluid of sheep (Toyokawa et al., 2007). In peripheral blood samples of pregnant ewes, MX2 expression had an increase about 48-72 hours after the conceptus started to elongate and produce IFNT (Yankey et al., 2001). Another function related to MX1 is to facilitate the release of some secretory proteins like ISG15 from the GE during embryo elongation (Toyokawa et al., 2007). Studies in cows showed that MX2 mRNA is detectable earlier than MX1 in peripheral blood lymphocyte of pregnant animals and was also more expressed by day 16 in pregnant compared with non-pregnant cows. In contrast, MX1 was not different between pregnancy classifications until day 20 (Gifford et al., 2007). In dairy cows, a comparison between pregnant and non-pregnant cows showed a greater expression of MX2 in pregnant cows on day 18 and

20 compared with day 14 and 16 after AI (Green et al., 2010).

SLPI (Secretory leukocyte protease inhibitor)

Secretory leukocyte protease inhibitor (SLPI) has been associated with mucosal surfaces, e.g. lung and cervix (Franken et al., 1989) and is produced by neutrophils (Böhm et al., 1992), macrophages

(Jin et al., 1997) and epithelial cells (Abe et al., 1991). It also shows antibacterial activity against gram- negative and gram-positive bacteria (Hiemstra et al., 1996), antiviral (McNeely et al., 1995) and antifungal (Tomee et al., 1997) as well as inhibitory effect on lipopolysaccharide (LPS)(Jin et al., 1997).

Presence of SLPI has also been observed in the reproductive system such as in human cervical mucosa

(Casslén et al., 1981), term decidua (Denison, 1999) and seminal plasma (Franken et al., 1989). Glandular and luminal localization of SLPI has been shown in epithelial cells of pig endometrium (Reed, 1996). In cow and horse endometrium, SLPI has also been found during pregnancy (Badinga et al., 1994). Studies by King have indicated that SLPI is produced by endometrial GE cells at the period of uterine receptivity and P4 increase its expression ( King et al., 2000; King et al., 2003) . Ace and Okulize have also noted up- regulation of SLPI during the implanatation phase (days 17–23)(Okulicz and Ace, 2003).

IGHG1 (Immunoglobulin heavy chain gamma)

Immunoglobulin (Ig) [gamma]-1 chain C region (IGHG1), or immunoglobulin heavy chain

[gamma], is one of immunoglubolins isoforms produced by immune system and is the most important functional isoforms. It has 3 heavy chain constant region domains named CH1, CH2, and CH3

(Deisenhofer, 1981). The CH2 or CH3 domains bind to Fc-[gamma] receptor on the surface of many effector cells, such as neutrophilic granulocytes, macrophages, monocytes, and natural killer (NK) cell which induce the antibody-dependent cell-mediated cytotoxicity (Iannello and Ahmad, 2005; Schaedel and Reiter, 2006) . In a study by Cerri, he has reported that an upregulation in mRNA expression of

IGHG1 by lactation in pregnant cows. According to their interpretation, this gene showed a possible increase in B lymphocyte activity or an increase in the endometrial B-lymphocyte population in lactating

22 dairy cows (Cerri et al., 2012) which could be important in regulating the immune system of embryo during implantation.

IGLL1 (Immunoglobulin lambda-like 1)

The human immunoglobulin lambda-like (IGLL) genes participate in B cell development and are only expressed in B cells (Bauer et al., 1993). B cell deficiency agammaglobulinemia could be arise by a mutation in this gene. Agammaglobulinemia is an autosomal recessive disease in which production of gamma globulins or antibodies are decreased or inhibited (Minegishi et al., 1998). Proteins encoded by

IGLL genes bring the mu chain to the cell surface (Melchers et al., 1993; Lassoued et al., 1996), and they have been estimated if the re-arrenged mu chain could effectively bind to light chains. Effect of up- regulation of IGLLL1 was also investigated in a study by Cerri who showed approximately 2- to 8-fold increase by lactation in his study emphasizing the effect of lactation on the normal mechanism of early embryonic development (Cerri et al., 2012).

1.6.1.2 Genes involved in the PGF2α cascade

OTR (Oxytocin receptor)

Oxytocin, a neurohypophyseal peptide hormone is synthesized in the hypothalamus and is transported to the posterior pituitary. By the time, a stimulus exists, then oxytocin is released into circulation. In ruminants, as part of an endocrine positive feedback loop luteal oxytocin is synthesized and with contribution of endometrial prostaglandin is thought to regulate luteolysis (Flint et al., 1994).

Studies on the expression of oxytocin during pregnancy showed that there is a significant decline in concentration of luteal oxytocin and oxytocin mRNA within the first days of pregnancy (Ivell et al., 1985;

Jones and Flint, 1988; Ivell et al., 1990), however, oxytocin peptide is detectable at low levels in the first trimester. In cows and ewes`s CL, Oxytocin is present in high concentrations (Wathes and Swann, 1982).

During the luteal phase of estrous cycle, oxytocin is secreted with P4 in a pulsatile pattern (Walters et al., 1984). It has been observed that injection of exogenous oxytocin stimulates release of uterus P4 in cows (Newcomb et al., 1977). To initiate luteolysis in ruminants, the endometrial OTRs need to be upregulated (McCracken et al., 1999). It starts with binding of oxytocin to endometrial OTR and initiation of pulsatile secretion of PGF2α which results in luteal regression (Flint and Sheldrick, 1983). In cattle, there is an increase in OTR concentration preceding luteolysis which occurs between days 15 and 17

(Jenner et al., 1991; Robinson et al., 1999).

COX-2 (Cyclooxygenase-2)

COX1 and COX2 are two isoforms encoded separately by COX gene. These two isoforms are also known as prostaglandin endoperoxide H synthases 1 and 2 (Smith et al., 2000). The reaction catalyzed by COX is the conversion of arachidonic acid into prostaglandin 2. Unlike COX1 which is widely expressed in a variety of tissues , COX2 is induced in response to cytokines or tumor promoters (Sirois and

Richards, 1992). Endometrial COX2 expression in cows and sheep has been found to be induced when luteolysis is expected which is almost late diestrus, on the other hand, COX1 expression was constant in sheep and hard to detect in cows during the estrous cycle (Charpigny et al., 1997; Arosh, 2002).

Generating COX2 deficient female mice has created infertile mice which are also suffering some abnormalities in ovulation, fertilization, implantation, and decidualization (Dinchuk et al., 1995;

Langenbach et al., 1995; Lim et al., 1999). COX-2 is also responsible for prostaglandins presence in different form of inflammation which is inhibited by glucocorticoid hormones (O’Banion et al., 1992;

Herschman, 1996).

COX2 is required for normal blastocyst implantation and decidualization in mice as product of this enzyme contributes for angiopoietin signaling that influence uterine vascular permeability and angiogenesis (Lim et al., 1999; Matsumoto et al., 2002; Parent et al., 2003). Studies by Parent et al. have

24 demonstrated the correlation of prostaglandins production with COX2 in bovine endometrium as increase in prostaglandin production modulate the PGE2/PGF2α ratio and improve the pregnancy establishment (Parent et al., 2003).

StAR (Steroidogenic acute regulatory)

One of the important regulator of steroid hormone biosynthesis is steroidogenic acute regulatory protein (stAR) (Clark and Stocco, 1997; Stocco, 1997). Cholesterol, the substrate of steroid biosynthesis needs to be translocated from intra-mitochondrial to the cytochrome p450 side chain cleavage enzyme, for this purpose stAR protein is needed (Clark et al., 1994). Different species have reported to express stAR in their ovaries such as mouse (Clark et al., 1995), rat (Sandhoff and McLean,

1996), rabbit (Townson et al., 1996), human (Sugawara et al., 1995), sheep (Juengel et al., 1995), cow

(Hartung et al., 1995; Pescador, 1996), and pig (Pilon et al., 1997). stAR acts towards the regulation of steroid production in the CL. Studies have showed that there were a high expression of stAR when CL is functional ,however, by the time Cl regress, stAR expression is reduced (LaVoie et al., 1997; Pollack et al., 1997). It has been shown that cAMP (Clark and Stocco, 1997) and PGF2α (Juengel et al., 1995;

Pescador et al., 1996; Sandhoff and McLean, 1996a), could affect stAR expression.

3βHSD (3 Beta-hydroxysteroid dehydrogenase)

Another gene, which is responsible for encoding the steroidogenic enzyme 3p3-hydroxysteroid dehydrogenase/A5 -A4 isomerase, is called 3βHSD and participate in oxidation and isomerization of the precursor pregnenolone to synthesize P4. 3βHSD has shown high activity in the CL (Caffrey et al., 1979).

It has been investigated that hCG has positively contributed to the up-regulation of mRNA coding 3βHSD in porcine granulosa cells (Chedrese et al., 1990). In the bovine CL, quantity of 3βHSD mRNA were reported low on days 18-20 of the estrous cycle (Couët et al., 1990).

PGF2α receptor

In ruminants, uterus release PGF2α and it reaches CL when luteal regression is occurring and it happens through a countercurrent system between uterine vein and ovarian artery. Rapid decline in P4 secretion and degeneration of vasculature and apoptosis of steroidogenic cells are specific features in luteolysis (Niswender et al., 2000). In cow, the major luteotropic factor in luteal function is LH, whereas the primary inducer of luteolysis is PGF2α. PGF2α acts on target cells by a specific plasma membrane- associate receptor, PGF2α receptor. PGF2α receptor presence was detected on steroidogenic luteal cells

(Balapure et al., 1989; Gadsby et al., 1990; Sakamoto et al., 1995). Studies in porcine CL regression (Bacci et al., 1996) has indicated that cloprostenol (a PGF2α synthetic analogue) could induce apoptosis in luteal endothelial cells then apoptosis of steroidogenic cells which shows CL regression begins with early response of endothelial cells to PGF2α. An evidence supporting this study also showed PGF2α receptor expression in bovine endothelial cells derived from CL (Mamluk et al., 1998).

1.6.1.3 Adhesion molecules

LGALS3BP (Lectin galactoside soluble 3 binding protein)

LGALS3BP is an IFN-stimulated gene which codes for an adhesion protein of extracellular matrix

(ECM) and also it has the self-assembly ability and binds b1 integrins, collagens and fibronectin (Sasaki et al. 1998). In situ hybridisation revealed that LGALS3BP had significant expression in LE area and they suggest a role for this protein regarding adhesion of conceptus (Walker et al., 2010b). In Okumu study, they detected LGALS9 and LGALS3BP expression at low levels in both pregnant and non-pregnant endometria until day 13, however, On day 16, their expression significantly increased only in the pregnant heifers (Okumu et al., 2011). LGALS3BP also can bind to Galectin -1, -3 and -7, which could promote cell-cell adhesion through bridging between galectin molecules bound to ECM components (Inohara et al., 1996; Sasaki et al., 1998) .

TIMP-2 (Tissue inhibitor of metalloproteinases)

TIMP-2 is a proteinase inhibitor and regulates extracellular matrix integrity by controlling the activity of matrix metalloproteinases. There are 4 different TIMPS (Brew and Nagase, 2010). TIMP2 has the unique ability to activate matrix metalloproteinase-2 (MMP2) by formation of a tri-molecular complex with pro-MMP2 and membrane type 1 MMP (Strongin et al., 1995). Ledgard has reported an elevated expression of all TIMP-2 transcripts in the bovine endometrium between Days 13–19, of the oestrous cycle (Ledgard et al., 2009) and it was in agreement with the up-regulation seen in the cow and sheep in previous studies (Salamonsen, 1999; Bauersachs et al., 2005). By the mid-luteal phase TIMP2 increases extensively and if its abundancy was at the interface of epithelial and stromal cell, this increase could lead to the activation of MMP2 by the TIMP2/MMP14/pro-MMP2 complex at the cell surface into the extracellular space (Curry and Osteen, 2003). Consequently, TIMP2 causes stimulation of MMP2 which mediate releasing of growth factors for facilitating endometrium receptivity by the time of conceptus elongation.

CDH1 (E-cadherin)

Cell-cell adhesion molecules contain CDH1 which plays an essential role in the maintenance of cell differentiation and the normal architecture of epithelial tissues. E-cadherin function rely on a proper interaction with the catenin– cytoskeleton complex in the cytoplasmic space and the E-cadherin dimers between neighbouring cells in the intercellular space (Takeichi, 1995). Experiment in mice with CDH1 mutation showed severe abnormalities at the transition from compacted morula to blastocyst because they could not develop correct adhesion junctions in the trophectoderm and die around the periimplantation period (Larue et al., 1994; Riethmacher et al., 1995) . Reardon reported that CDH1 is one of the critical regulators of uterine formation and development. These authors came up with different role for CDH1 by their results. First, loss of CDH1 in the neonatal uterus resulted in endometrial glands

27 ablation and causes infertility as a result of abnormal implantation and decidualization. Second, they recognized an ability for CDH1 to control cell fate by altering directional cell proliferation and apoptosis.

They developed a model in which they could deplete both CDH1 and Trp53 in the uterus on a conditional basis way, CDH1 loss interrupted cell cycle regulation leads to abnormal uterine development (Reardon et al., 2012). CDH1 expression is distributed within the cytoplasm of trophoblast bi-nucleate cells in the bovine placentome. Hence, the loss of CDH1 as conceptus attachment to luminal epithelium may play a role in the transition in gene expression required for the successful progression from implantation to placentation (Nakano et al., 2005).

CLD4 (Claudin 4)

Claudins are major cell adhesion molecules in tight junctions involved in intercellular sealing in simple and multilayer epithelia. CLDN4 is more likely to be involved in cell adhesion between epithelial cells of the endometrium regulating for example, permeability of the epithelium (Tsukita and Furuse,

2002). Studies in bovine showed up-regulation of CLD4 in the endometrium during early pregnancy

(Bauersachs et al., 2006) and during the luteal phase of the estrous cycle (Mitko et al., 2008). Other microarray studies in human endometrium also noted an increase in CLDN4 mRNA expression at the window-of-implantation (Carson et al., 2002; Kao et al., 2002; Borthwick et al., 2003; Riesewijk et al.,

2003).

EMMPRIN (Extracellular matrix metalloproteinase inducer)

Extracellular matrix metalloproteinase inducer (EMMPRIN) which is a cell surface glycoprotein has two extracellular domain structures, extracellular domain-I and -II (Miyauchi et al., 1990; Miyauchi et al., 1991). It has been established an association between MMPs regulation and domain I (Sato et al.,

2009). EMMPRIN participate in different biological activities such as tumor metastasis (Muramatsu and

Miyauchi, 2003), ovulation (Smedts and Curry, 2005), the menstrual cycle (Noguchi et al., 2003) and

28 embryo implantation and placentation (Kuno et al., 1998; Chen et al., 2007; Mishra et al., 2010). In some studies, EMMPRIN has been thought to exert its effect by activating the expression of several MMPs but with no effect on TIMPs expression (Caudroy et al., 2002; Chen et al., 2009; Gibson et al., 2011), in order to favor MMP production and activation. Expression of EMMPRIN at the feto-maternal interface in the bovine endometrium has been reported which supports the idea for its role in embryo implantation and placentogenesis (Mishra et al., 2010; Mishra et al., 2012).

GLYCAM-1 (Glycosylation-dependent cell adhesion molecule 1)

Glycosylation-dependent cell adhesion molecule 1 (GlyCAM-1) which is a sulfated mucin-like glycoprotein that secretes into endothelial venules of peripheral and mesenteric lymph nodes (Lasky et al., 1992). In lymph nodes, GlyCAM-1 acts as a ligand for the leukocyte cell surface adhesion molecule, L- selectin. A classic cascade starts by binding of GlyCAM-1 to L-selectin and activation of β1 and β2 integrins, consequently a firm adhesion establishes between integrin and fibronectin for extravasation of blood-borne lymphocytes into secondary lymph (Rosen, 1993; Hwang, 1996; Giblin et al., 1997; Dwir et al., 2001). A temporal and spatial patterns of expression of GLYCAM-1 has been reported which indicate a possible mediatory role in implantation regulated by P4 (Spencer, 1999). In pregnant ewes, different pattern of GLYCAM-1 expression has been observed in uterine flushings, low on days 11 and 13 but abundant on days 15 and 17 (Spencer et al., 2004).

L-selectin (SELL)

SELL is an extracellular binding protein which is expressed by Neutrophils. SELL has a weak interaction with endothelial cell wall and allow the neutrophil to “roll” down along the wall to monitor for any possible local infection. Once the signal received by neutrophil, SELL, in response to these signals, leaves the surface of the neutrophil and allow other adhesive molecules to express on its surface. These molecules essentially enhance the attachment of the neutrophil within the blood vessel

29 adjacent to the site of infection (Lawrence and Springer, 1991). An immunohistochemistry analysis of L- selectin ligand in human uterus samples using MECA-79 and HECA-452 antibodies found that they were widely on LE and GE in the human uterus (Lai et al., 2005; Shamonki et al., 2006). Genbacev showed these antigens are up-regulated in the human endometrium during the receptivity period for embryo implantation. They concluded that interactions between L-selectin on human blastocysts and oligosaccharide ligands on endometrial epithelia is important for initial adhesion of embryo for implantation (Fukuda and Sugihara, 2007).

SPP1 (Secreted Phosphoprotein 1)

SPP1 belongs to the small integrin binding ligand and a glycoprotein which is mostly activated in process such as bone mineralization, cancer metastasis, cell-mediated immune responses, inflammation, and angiogenesis (Butler et al., 1996; Weber and Cantor, 1996; Giachelli and Steitz, 2000; Denhardt et al., 2001). SPP1 binds to cell surface integrin receptors, including αvβ3 (ITGAVB3) (Senger et al., 1994),

α5β1 (ITGA5B1) (Barry et al., 2000), αvβ1 (ITGAVB1) (Hu et al., 1995), αvβ5 (ITGAVB5) (Hu et al., 1995),

αvβ6 (ITGAVB6) (Yokosaki et al., 2005), and α8β1 (ITGA8B1) (Denda et al., 1998). SPP1 Binding to these various receptors mostly affects the adhesion ability of cells including cell to cell contact , cell-to-ECM adhesion, leukocyte, smooth muscle cell, endothelial cell chemotaxis, endothelial and epithelial cell survival, macrophage, and tumor cell migration (Singh et al., 1990; Senger et al., 1994; Hu et al., 1995;

Liaw et al., 1995; Smith et al., 1996; Denda et al., 1998; Katagiri et al., 1999). Experiments in ewes have indicated that SPP1 is critical for embryo implantation and is one of important component of uterine histotroph regulated by P4 (Johnson et al., 2000). In UGKO ewes, SPP1 is absent (Gray et al., 2002).

Gabler indicated that SPP1 is secreted by oviductal cells, however, they have been suggested that P4 is not responsible for oviductal secretion (Gabler et al., 2003). One of the main function attributed to SPP1 is to bind to the αvβ3 integrins present on the LE and trophectoderm of the conceptus (Johnson et al.,

2001). SPP1 is present by day 16 of pregnancy, but the cellular localization of the αvβ3 integrin is different in cows compared with sheep (Kimmins et al., 2004).

MMP19 (Matrix metalloproteinases 19)

Matrix metalloproteinases (MMPs) are considered zinc-dependent endopeptidases and they participate in ECM degradation by degrading extracellular molecules, so by involving in these activities, they play important role in regulating normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in cell proliferation, migration, differentiation, angiogenesis, apoptosis and host defenses (Visse and Nagase, 2003). MMP19 is also a member of MMPs family which is expressed in different human tissues such as mammary gland, placenta, lung, pancreas, ovarian, and other tissues (Pendás et al., 1997). MMP19 also promotes proliferation, migration, and cell adhesion of keratinocytes (Hägglund et al., 1999; Mysliwy et al., 2006). Because theca and granulosa cells also express MMP19, it has been suggested that it is functional during follicular growth, ovulation, and luteal regression (Murray, 1995; Sadowski et al., 2003; Jo and Curry, 2004) .

At the time of embryo implantation, MMPs are critical for the basement membrane and ECM degradation which is important as trophoblast cells invade the endometrium (Curry and Osteen, 2003).

Studies in bovine endometrium reveled that MMP19 is important for the regulation of conceptus attachment (Bauersachs et al., 2008). Mamo demonstrated that the genes of MMP-2, MMP-13, MMP-19 and FURIN, among others genes are up-regulated between the 16th and 19th day of pregnancy in the cow, which suggests a role in maternal recognition and initiation of implantation (Mamo et al., 2011).

SERPINA14 (Serine peptidase inhibitors 14)

Serpins which are composing the largest and widely distributed superfamily of protease inhibitors and based on phylogenetic studies, eukaryotic serpins have classified into 16 'clades' (Irving et

31 al., 2000; Rawlings et al., 2004). Different functions have been offered for serpins sucha as DNA binding and chromatin condensation in chicken erythrocytes (Grigoryev and Woodcock, 1998; Irving et al.,

2002), dorsal-ventral axis formation and immunoregulation in Drosophila and other insects (Levashina,

1999; Ligoxygakis et al., 2003), embryo development in nematodes (Pak et al., 2004) and control of apoptosis (Ray et al., 1992). As a mechanism to prevent antibody-mediated actions against the conceptus semi-allograft, it has been shown that Ovine SERPINA14 form complexes with immunoglobulin A and M (Hansen and Newton, 1988). Gene expression analyses in bovine endometrium indicated that SERPINA14 mRNA had a greater levels at estrus in the presence of high levels of E2 compared with the period of P4 dominated diestrus phase (Bauersachs et al., 2005; Mitko et al., 2008b). On the other hand, when pregnant and non-pregnant cows were compared at day 18,

SERPINA14 mRNA was up-regulated during the pre-implantation phase although equal levels of P4 was predominant (Klein et al., 2006). By effect of P4, endometrium secretes SERPINA14 in bovine, ovine and in porcine (Ing et al., 1989; Mathialagan and Hansen, 1996; Tekin et al., 2005). As conceptus starts to grow, SERPINA14 provides direct nutrition to it, and also controls growth, proteolytic activities and suppression of the maternal immune system for sustaining pregnancy. SERPINA14 involves in inhibition of lymphocyte proliferation in ovine (Ulbrich et al., 2009) during the estrous cycle (days 13-15) and in pregnancy (days 15-50). SERPINA14 has also been reported to be important on day 25 of pregnancy in goat (Stewart et al., 2000).

MYH9 & MYH10 (Myosin heavy chain)

Myosin heavy chain contains three different protein myosin IIA, IIB, and IIC which are encoded by MYH9, MYH10, and MYH14 genes, respectively (Saez et al., 1990; Simons et al., 1991;Leal et al.,

2003). Myosin II motor proteins are present in almost every tissue and show 64–89% similarity in the amino acid sequences of their heavy chains (Golomb et al., 2004), although they have different ability in

32 their motor activities, molecular interactions, cellular and tissue distributions (Kolega, 1998; Wylie and

Chantler, 2001; Sandquist et al., 2006; Zhou and Wang, 2008; Vicente-Manzanares et al., 2009). MYH10 expression is required for contributing in the outgrowth of the neuritic processes and the role of MYH9 is also important in mediating neurite retraction (Wylie et al., 1998; Bridgman et al., 2001; Wylie and

Chantler, 2001). MYH10 drives also exocytosis, an essential cellular process known to secrete signaling molecules at the leading edge of migrating mammalian cells (Mochida et al., 1994; Takagishi et al.,

2005). MYH9 helps chemokine receptor 4 endocytosis in migrating T lymphocytes (Rey et al., 2007).

From Betapudi Studies, MYH9 and MYH10 have been shown to participate in extending lamellipodia, a critical step in the initiation of cell invasion, spreading and migration (Betapudi et al., 2006).

MYL12A (Myosin light chain)

MYL12A which is another member of myosin II family encodes a non-sarcomeric myosin complex component with calcium ion binding regulatory functions that found to be important in signal transduction mechanisms, cytoskeleton formation, cell division and chromosome partitioning (Maglott et al., 2011). There are three member of myosin family which have light chain and are as follows: myosin light chain 12A regulatory (MYL12A), myosin light chain 12B regulatory (MYL12B) and myosin light polypeptide 9 regulatory (MYL9)(Grant et al., 1990). The mammalian orthologues of MYL12A and

MYL12B have been considered to be non-muscle regulatory light chain (RLC) genes (Grant et al., 1990).

In Park study, they have reported that at the cellular level, RLCs encoded by MYL12A and MYL12B are critical for the stability of MHC IIs and essential light chain, including complexes involving MYH9, MYH10 and MYL6, in fibroblasts studied using short interfering RNA-mediated knockdown (Park et al., 2011).

1.6.1.4 Growth and developmental genes

Wnt signaling pathway

One of the main and critical signaling pathway being activated during embryogenesis and development is called wnt signaling which directs cell polarity, cell proliferation and cell fate determination (Logan and Nusse, 2004). It has been shown that mutation in wnt signaling pathway can cause birth defects, cancer and other disease (Clevers, 2006). Canonical wnt signaling which is the focus of this thesis functions by regulating the amount of the transcriptional co-activator β-catenin that controls key developmental gene expression programs. When wnt ligands are not available, wnt signaling is inhibited by degrading β-catenin for controlling cell proliferation. Degrading complex consists of scaffolding protein Axin, the tumor suppressor adenomatous polyposis coli gene product (APC), casein kinase 1 , and glycogen synthase kinase 3 (GSK3)(He et al., 2004).

So by continuous elimination of β-catenin, it is inhibited to reach the nucleous, consequently, wnt target genes are suppressed by the DNA-bound T cell factor/lymphoid enhancer factor (TCF/LEF) family of proteins. Once Wnt/β-catenin pathway become activated signals transduces by binding a wnt ligand to a seven-pass transmembrane Frizzled (Fz) receptor and its co-receptor, low-density lipoprotein receptor related protein 6 (LRP6) or its close relative LRP5. The formation of a likely Wnt-Fz-LRP6 complex and involving the scaffolding protein Dishevelled (Dvl) results in LRP6 phosphorylation, activation, and the recruitment of the Axin complex to the receptors. These events compete with Axin- mediated β-catenin phosphorylation. β-catenin then accumulates and travels to the nucleus to form complexes with TCF/LEF and activates Wnt target gene expression.

Dickkopf-related proteins (DKKs) are wnt signaling inhibitors. DKK1 and DKK2 members of this family bind to 5/6 with high affinity to initiate the inhibition (Bafico et al., 2001; Mao et al., 2001;

Semënov et al., 2001). DKK1 initially has been recognized as a gene which confers Spemann’s head

34 organizer activity in Xenopus embryos. DKK1 is specifically expressed in the anterior mesendoderm and co-expression of it with bone morphogenic inhibitor (BMP) inhibitors induces entire ectopic heads

(Glinka et al., 1998). In zebrafish, DKK1 acts in organization part of gastrulating embryos (Hashimoto et al., 2000; Shinya et al., 2000) and promotes, when overexpressed, anterior neural development. Studies by Dkk1 heterozygous mice have shown that they are normal and fertile, however, mice double heterozygous for DKK1 and the BMP inhibitor Noggin show head defects similar to those of DKK1 homozygous mutants (del Barco Barrantes et al., 2003), therefore it emphasize the importance of BMP and Wnt signals inhibition for head development (Glinka et al., 1997).

AXIN as an important member in destruction complex targets β-catenin for degradation in case wnt ligand is not present. It has two homolog, each acting in different way, AXIN1 and AXIN2. AXIN1 depletion in mouse results in early embryonic loss due to deformities induced by duplication of the anterior–posterior body axis, a consequence of excess activity of the canonical Wnt pathway

(Gluecksohn-Schoenheimer, 1949; Zeng and Schultz, 2003). AXIN2 has also a regulatory role in wnt signaling (Behrens et al., 1998). Although Axin1 shows a ubiquitous expression, AXIN2 expression is induced by canonical Wnt signaling and its expression pattern highlights cells with active wnt signaling

(Jho et al., 2002; Lustig et al., 2002). AXIN2 has also the ability to inhibit wnt signaling. Studies in AXIN2 null mice have indicated tissue-specific increase in wnt signaling leading to defects in skull formation (Yu et al., 2005) and tooth development (Lammi et al., 2004). Wnts are secreted glycoproteins that have roles in tissue differentiation and organogenesis (Cadigan and Nusse, 1997). WNT3 expression has been reported in discrete dorsal and lateral regions of the diencephalon and the dorsal spinal cord of mid- gestation mouse embryos and in the adult brain (Roelink and Nusse, 1991; Parr et al., 1993). In Liu studies, they have concluded by detecting WNT3 expression in gastrulation stage of mouse embryogenesis that WNT3 has role in the formation of early streak and also production of mesoderm and endoderm (Liu et al., 1999).

Different wnt ligands usually have different receptors to pass signals and each of them has the ability to activate specific interactions during development. WNT3 can transduce signal with FZD7 ligand and their interaction has been reported in human, chicken and Xenopus (Medina et al., 2000; Swain et al., 2001). In Chicken and Xenopus, FZD7 orthologs induce β-catenin–TCF/LEF signaling cascade activation during neural crest induction (Sumanas et al., 2002; Lewis et al., 2004; Abu-Elmagd et al.,

2006). In Human liver cancer, WNT3 signal transduction through FZD7 activates the β-catenin–TCF/LEF signaling cascade (Kim et al., 2008).

Another wnt ligand studied in this thesis is WNT2 which has been known to have interaction with FZD4 in rat granulosa cells (Ricken et al., 2002). Direct binding of WNT2 to FZD4 derived from hepatic sinusoidal endothelial cells has also been indicated (Klein et al., 2008). Another receptor for

WNT2 which has been studied is FZD8 and studies by Bravo has indicated FZD8 activation by WNT2 ligand in non-small cell lung cancer (Bravo et al., 2013).

MSX1 (Msh homeboxe 1)

There are different types of developmental regulatory genes that encode transcriptional repressors. Murine homeobox gene MSX1 encodes a homeodomain-containing protein that functions as a transcriptional repressor (Catron et al., 1993; Catron et al., 1995). MSX1 has been reported to be expressed in different parts of the embryo like the neural tube, the limb buds, and derivatives of the cranial neural crest (Hill et al., 1989; Robert et al., 1989; Robert et al., 1991; Lyons et al., 1992). All these diverse regions have something in common which is being involved in epithelial-mesenchymal interactions, indicating that MSX1 may be involved in inductive influences between these tissues (Wang and Sassoon, 1995). Targeted disruption of MSX1 leads to a range of developmental abnormalities which the most deleterious are craniofacial structures (Satokata and Maas, 1994). It seems that there is a high expression of MSX1 in adult mouse uterine epithelium which after embryonic implantation

36 decreases in order to regulate uterine epithelial morphology and also maintain the adult uterus in situation being responsive to both morphogenetical and developmental endometrium re-constructure

(Pavlova et al., 1994). Ishiwata also detected MSX1 in lower level in endometrium and placentomes particularly after 60 days of gestation in cows (Ishiwata et al., 2003). MSX1 suppression has also lead to the deficiency in oocyte maturation, embryo cleavage rate and also impact the expression of several genes which indicate its role in the development of pre-implantation embryo and oocyte (Tesfaye et al.,

2010).

RELN

RELN which is involved in mammals embryonic development is first detectable in the mouse embryonic brain on day 9.5 (Ikeda and Terashima, 1997). Its concentration is high up to early postnatal days and then declines in adults. Cajal-Retzius neurons produces RELN and they are transient neurons acting as path-finders and they become more active upon early laminar organization of cortex

(D’Arcangelo et al., 1995; Ogawa et al., 1995). RELN also participate in a variety of embryonic sites such as embryonic spinal cord (Yip et al., 2000), subpial granular layer of fetal human cortex (Meyer and

Wahle, 1999) and developing rat striatum. Mutation in RELN gene produces an ataxic and reeling gait in the affected mice. Mice bearing this mutation are prone to develop a number of abnormalities during their development such as inverted cortical lamination, abnormal positioning of neurons and aberrant orientation of cell bodies and fibers (Falconer, 1951; Early and Defect, 1979).

In human, RELN mutations cause lissencephaly and malformations of the cerebellum (Hong et al., 2000). In a study by Cerri, they reported a decrease in RELN expression in lactating pregnant cows to about half of what was observed in lactating non-pregnant cows which they assume is a cause of developing an immature embryo and pregnancy failure (Cerri et al., 2012).

1.6.2 Apoptosis, steroid synthesis and angiogenesis in CL

The CL is a transient tissue in the ovary, which goes under intensive cellular changes during pregnancy to support the developing embryo. Steroid biosynthesis, apoptosis, and angiogenesis are among the main events occurring in CL. A huge and intense vascularization spot in the body is CL (Bruce and Moor, 1976; Reynolds et al., 1994). During luteal phase and formation of CL, building a micro- vascularization network is necessary for providing hormones and lipoprotein bound cholesterol (Davis et al., 2003).

NOS2 & NOS3 (Nitric oxide synthase)

Nitric oxide (NO), an inorganic free radical gas is synthesized from L-arginine with an oxygen and

NADPH dependent reaction which yields NO and L-citrulline (Bush et al., 1992; Wu and Morris, 1998).

NO synthesis depends on NO synthase (NOS) that has three isoforms including neuronal (nNOS), endothelial (eNOS) and inducible (iNOS) nitric oxide synthase. nNOS and eNOS have been proposed to be responsible for basal release of NO, but iNOS is activated once inflammatory cytokines and LPS are released (Morris and Billiar, 1994). NO proved to have different function in the body such as vasodilation, controlling apoptosis, neurotransmitter, inhibiting platelet aggregation, neutrophil adhesion to endothelial cells, reducing smooth-muscle cell proliferation and migration and establishing endothelial cell barrier function (Rosselli et al., 1998). As NO participated in different part of reproductive system, it is believed that NO is important in regulating different reproduction process

(Dixit and Parvizi, 2001). Studies in bovine luteal cells showed that by increasing NO activity in these cells, P4 secretion is inhibited (Skarzynski and Okuda, 2000), and also inhibiting the ovarian NOS in cow could prolong the duration of the estrous cycle (Skarzynski et al., 2003). The current gene symbols for nNOS, iNOS and eNOS are NOS1, NOS2 and NOS3, respectively (Michel and Feron, 1997). One of NO function is in the regulation of CL formation and function. Based on different studies, it is believed that

38 function of NO depends on CL stage of development. NO helps CL maintenance by stimulating glutathione and P4 production (Motta et al., 2001). Other studies show that NO also acts on controlling luteal vascularization (Reynolds et al., 2000) and proteolytic process (Hurwitz et al., 1997). NO role during early luteal development of CL has been observed in mares, because at this stage, vascular networking is high demanding (Ferreira-Dias et al., 2011).

However, in cattle, negative effect of NO or its effect on CL regression has been reported. NO stimulates the synthesis of PGF2α, which in turn increases NOS activity, thus activating a positive feedback mechanism between PGF2α and NO to ensure luteal regression and consequently, P4 production decrease (Skarzynski, 2000; Jaroszewski et al., 2003). Studies in rats and mice have shown the presence of NOS2 and NOS3 in granulosa cells (Van Voorhis et al., 1995; Matsumi et al., 1998), in blood vessels, stroma, theca and luteal cells (Zackrisson et al., 1996). However in mice both NOS2 and

NOS3 were more localized in in oocyte, theca and granulosa cells (Nishikimi et al., 2001; Mitchell et al.,

2004; Huo et al., 2005). In cattle, the presence of NOS2 and NOS3 is different according to the existing data in the literature but some believed that these two proteins were not detected in granulosa cells

(Grazul-Bilska et al., 2007; Herath et al., 2007), and other studies indicated that NOS were present in ovarian cells (Tesfaye et al., 2006; Pires et al., 2009; Tessaro et al., 2011). In rats, as CL ages, NOS2 decreases its expression (Motta et al., 1997), and the same reduction for NOS2 was observed in the rabbit (Gobbetti et al., 1999; Boiti et al., 2002) and sheep (Reynolds et al., 2000). In bovine CL, both

NOS2 and NOS3 were observed in endothelial and luteal cells. Skarzynski Showed in the cow that the levels of NOS3 and NOS2 were increased from the early to late luteal phase of the estrous cycle and in the luteal phase, they start to decrease their expression as CL regresses (Skarzynski et al., 2003).

FGF2 (Fibroblast growth factor)

FGF2 is a mitogenic agent for endothelial cells (Gospodarowicz et al., 1986) in CL and also luteal cells in culture (Grazul-Bilska et al., 1995), it also increases P4 secretion when infuses into bovine CL

(Liebermann et al., 1996). Studies by Berisha showed a different pattern for FGF2 localization during CL formation and lutelolysis, it was more localized to endothelial cells and pericytes of the theca layer prior to the LH surge, but afterwards and in the collapsed follicle, FGF2 protein was found predominantly in the luteinising granulosa cell layer (Berisha et al., 2006). There were also a high level of FGF2 protein expression during the follicular–luteal transition in the early bovine CL (Robinson et al., 2007). FGF2 seems to be important for establishing endothelial cell connection as by suppressing its receptor, angiogenesis was inhibited in the cow CL (Robinson et al., 2009). FGF2 has also been observed that increases during the initial stage of luteal formation, and emphasized its critical role when compared with vascular endothelial growth factor in promoting endothelial cell formation (Woad et al., 2009).

FGF2 expression can be affected by PGF2α as study in cow (day 4) showed that luteolytic PGF2α strongly increased FGF2 expression (mRNA and protein)(Zalman et al., 2012).

Bax & BCL2

Luteolysis in bovine CL starts with surges of PGF2α and followed by two different regression stages called functional and structural. Functional regression characterized by inhibition of P4 release and production (Schallenberger et al., 1984) which results in structural regression (Juengel et al., 1993;

Pate, 1994). During luteolysis, programmed cell death or apoptosis occurs which basically controls tissue size, cell numbers and generally balance the hemostasis of the tissue. Apoptosis mainly divides by two mechanisms: intrinsic and extrinsic. B cell lymphoma (BCL2) family proteins belong to intrinsic pathway and thought to be activated by intracellular stimuli such as certain drugs, radiation, or growth factor

40 withdrawal. These events lead to change in mitochondrial permeability which works by modifying the ratio of BAX to BCL2 proteins (Adams and Cory, 1998). BCL2 associated X protein (Bax) mechanism to induce cell death is by binding to, sequestering, and antagonizing the cell survival functions of BCL2

(Oltvai et al., 1993) which considers as a direct way for apoptosis induction (Chao and Korsmeyer, 1998).

During cattle luteolysis, mRNA encoding BAX is increased, however, mRNA levels of BCL2 remains unchanged (Rueda et al., 1997), which increases the ratio of BAX to BCL2, which is called a BAX- mediated apoptosis. BAX and caspases have been shown to be responsible in structural luteolysis in vivo and also in vitro in bovine luteal cells (Rueda et al., 1997;Yadav et al., 2004; Liszewska et al., 2005).

BCL2 is an anti-apoptotic protein and it has been shown during menstrual cycle in human CL,

BCL2-mRNA levels are at the highest point at mid-luteal phase and lowest during CL regression. On the other side, BAX which is a pro-apoptotic protein and a member of BCL2 family accelerates cell death

(Williams and Smith, 1993; Tilly, 1996; Sugino et al., 2000). Studies have indicated a high expression of

BAX mRNA levels in the regressing CL (Sugino et al., 2000). Based on Rueda (Rueda et al., 1997) studies, he indicated that significant increase in BAX mRNA expression was positively associated with increase in apoptosis of the regressed bovine CL when he compared it with that in the functional CL.

CYP11A (Cholesterol side chain cleavage enzyme)

The initial step for P4 biosynthesis requires conversion of cholesterol to pregnenolone by cytochrome P450 sidechain cleavage (P450scc). Then, pregnenolone is converted to P4 by 3- hydroxysteroid dehydrogenase. Based on previous studies, it has been reported that the levels of

P450scc and 3βHSD mRNA expressed in the macaque and human CL change during the luteal phase of the menstrual cycle or after chorionic gonadotropin treatment (Doody et al., 1990; Bassett et al., 1991;

Ravindranath et al., 1992; Benyo et al., 1993). P450scc has been shown to be critical for fetal and postnatal glucocorticoid, mineralocorticoid, and sex steroid biosynthesis as disruption of these early

41 steroideogenic pathways results in cholesterol accumulation in the adrenal cortex, causing congenital lipoid adrenal hyperplasia (Bose et al., 1996). In this deficiency, conversion of cholesterol to pregnenolone is impaired in both adrenals and gonads in utero and postnatally, resulting in salt wasting and lack of virilisation. CYP11A1 encodes P450scc and contains a heme binding site which is highly conserved (Morohashi et al., 1987). Tissue specific P450 aromatase is a member of P450 superfamily which converts androgen to E2. In contrast to other steroidogenic enzymes which are associated with the adrenal and gonads, these enzymes have been found in the cardiovascular and nervous system which shows their potential for behaving in an autocrine or paracrine system (Payne and Hales, 2004).

CYP11A has been found in different parts of adrenals, the theca interna and granulosa cells of ovulatory follicles, testes, placenta, central and peripheral nervous systems, and in the human and rodent heart

(Kayes-Wandover and White, 2000; Young et al., 2001).

1.6.3 Developmental and immune related genes in the conceptus

As embryo starts its growth and attachment to the endometrium, it needs to activate some developmentally and morphogenetically important genes to proceed with its survival. In addition to this, conceptus needs to inform its presence to endometrium to inhibit production of some luteolytic factors which regress CL and negatively affects embryo survival.

IFNT (Interferon tau)

In a study in which pregnant and non-pregnant cows were treated with intrauterine injections of either ovine or bovine recombinant or native IFNT, estrogen receptor 1 (ESR1) and OTR mRNAs was either silenced or the receptors were not responsive to E2 and OT in endometria (Thatcher et al., 1989;

Meyer et al., 1995). IFNT also inhibit the expression of ESR1 as E2 will increase ESR1 in uterine epithelia during pregnancy. Bovine IFNT is secreted from trophoblast cells of conceptus between days 12 and 38 of pregnancy. IFNT is also called maternal recognition pregnancy signal and it acts in a paracrine manner 42 on the endometrium to prevent endometrial luteolytic mechanism necessary for pulsatile release of

PGF2α, so the CL will remain functional during pregnancy (Thatcher et al., 1989; Minegishi et al., 1998; T

E Spencer et al., 2007). In addition to this, IFNT stimulates transcription of a number of genes and activities of several enzymes in a cell-specific manner within the endometrium that all acts toward the establishment and maintenance of pregnancy and conceptus implantation (Hansen et al., 1999; T E

Spencer et al., 2007).

ISG15 (Interferon stimulated gene 15)

IFNT is up-regulated during early pregnancy in bovine and this interferon which is secreted by conceptus trophectoderm cells acts as an primary signal for informing the presence of embryo (Roberts et al., 2008). Based on Austin studies, endometrial ISG15 and conjugated proteins are detected on day

17 of pregnancy, their peak levels are between days 18-23 and then decline to low levels by day 45 in bovine. They have also not been detected in endometria after day 50 of pregnancy or in non-pregnant cows (Austin et al., 2004). ISG15 in its mature stage is generated from a precursor by a cleavage which is common among ubiquitin-like proteins (Potter et al., 1999). ISG15 was originally identified as an interferon stimulated protein in response to endotoxin LPS and interferon induction (Haas et al., 1987;

Manthey et al., 1998) and some studies have reported its secretion from human monocytes and lymphocytes, emphasizing its properties as an interferon-induced cytokine (D’Cunha et al., 1996).

Bovine ISG15 conjugates to a variety of uterine cytosolic proteins during early pregnancy, suggesting that ISG15 may play a key role in establishment and maintenance of pregnancy (Johnson et al., 1998). ISG15 has the potential to alter the function of different proteins through conjugating itself to these target proteins which are involved in many activities such as transcription, DNA repair, signal transduction, autophagy and cell-cycle control (Kerscher et al., 2006).

ISG15 has been studied regarding its activation by IFNT during early pregnancy in establishment and maintenance of pregnancy and it has been more studied and identified in the endometrium and decidual cells. Because ISG15 expression profile in the embryo has not been very popular in reproduction research, in this thesis, I have checked its expression in embryo tissue because according to literature ISG15 conjugated proteins are important in inducing some downstream pathways necessary for cytokine signaling, protease inhibition and development. One other suggestion is that it is likely that ISG15 can regulate innate immunity of embryonic cells. The studies about ISG15 are mainly focused on its role in reproductive biology. The expression of ISG15 is up-regulated at endometrium in response to conceptus-secreted IFNT during early pregnancy (Hansen et al., 1997). In this study, they treated fetal bovine lung cells with poly I:C or LPS and ISG15 was induced in these cells (Liu et al., 2009).

They found that these lung cells could be infected by viruses which are capable of infecting cattle

(Gonda et al., 1990).

The significance of ISGylation has been observed to be impaired in cells infected with influenza B virus (Yuan and Krug, 2001). Five cellular proteins are reported to be ISG15 targets: serpin 2a, Jak1,

Stat1, PLC 1 and Erk1/2 (Hamerman et al., 2002; Malakhov et al., 2003). Jak1 and Stat1 are directly involved in signal transduction of IFN and other cytokines (Darnell et al., 1994). Serpin 2a which is a member of the serpin family was the first protein reported to be modified by ISG15. Serpin 2a expression was highly activated in macrophages once they experienced bacterial infection in addition to the induction of ISG15 expression (Hamerman et al., 2002). PLC 1 hydrolyzes phosphatidylinositol biphosphate to inositol triphosphate and diacylglycerol (Rhee, 2001).

Inositol triphosphate and diacylglycerol are involved in the regulation of calcium release from the endoplasmic reticulum and the activation of Protein Kinase C, respectively (Rebecchi and Pentyala,

2000). PLC 1 is important for normal growth and development (Ji et al., 1998). ERK1/2 belongs to protein

44 kinases that regulate the activity of many target proteins in response to signals from growth factors and environmental stimulation (Chang et al., 2003) .

GPX4 (Glutathione peroxidase 4)

Phospholipid hydroperoxide glutathione peroxidase (phGPx or GPx4) is an intracellular antioxidant enzyme (Imai and Nakagawa, 2003) that directly reduces peroxidised phospholipids (Ursini and Bindoli, 1987; Thomas et al., 1990; Sattler et al., 1994). Different function have been attributed to this enzyme such as sperm maturation (Ursini et al., 1999; Roveri et al., 2002) and murine embryogenesis (Imai and Nakagawa, 2003; Yant et al., 2003). Studies in GPx4 −/− embryos mice has shown that this enzyme is important in organogenesis as those mice lacking GPX4 are not viable and they die in utero at mid-gestation (Borchert et al., 2006; Schneider et al., 2006).

Studies performed using GPX4 knock out mice showed that compared to other GPX isoenzymes, all GPX4 knock out mice were not able to produce viable homozygous offspring (Imai and Nakagawa,

2003; Yant et al., 2003). As anti-apoptotic activity is one of GPX4 feature, studies by Schnabel showed that GPX4 expression correlates with areas of reduced apoptosis in developing limbs (Schnabel et al.,

2006) and it was confirmed by increased DNA fragmentation as an indicator of increased apoptotic cell death (Imai and Nakagawa, 2003; Borchert et al., 2006). GPX4 expression has also been detected in developing brain of embryonic mice and rats (Schweizer et al., 2004). GPX4 mRNA and protein expression have been detected in different area of brain like pyramidal neurons of the frontal and entorhinal cortex, dentate granule cells and CA pyramidal neurons in the hippocampus of embryonic rat brains but not in glial cells (Savaskan et al., 2007).

EEFA1 (Eukaryotic elongation factor 1A)

The effect of eEFA1 on cell cycle has been studied by its phosphorylation at ser300 by type I transforming growth factor-β receptor which inhibits the protein synthesis and cell proliferation (Lin et al., 2010). In Lin`s study, they reported that eEFA1 and Ser300 mutants of eEFA1 are important for transition of cells through the phases of the cell cycle (Lin and Souchelnytskyi, 2010). eEFA1 has been recognized with different functions such as interacting with tRNA in protein synthesis (Mateyak and

Kinzy, 2010), regulation of cytoskeletal dynamics (Liu et al., 1996; Gross and Kinzy, 2005), protein degradation (Chuang et al., 2005), and protection against apoptosis (Ruest et al., 2002; Chang and

Wang, 2007). eEFA1 is identified as two individually encoded variants in vertebrates named as eEFA1 and eEFA2 (Kahns et al., 1998; Kristensen et al., 1998).

Studies in mice have shown that eEFA1 is present throughout embryonic development in muscle but is reduced in neonatal muscle and then shut down by 21 days after birth (Lee et al., 1993; Chambers et al., 1998; Khalyfa et al., 2001). In neurons of mice and rats, eEFA1 is expressed during embryonic development (Pan et al., 2004).

PLAU (Plasminogen activator urokinase)

Plasminogen activator (PA), particularly the urokinase-type PA (PLAU), is probably involved in proteinase activities during embryo implantation. PA converts the inactive plasminogen into serine protease plasmin (Danø et al., 1985). During embryo implantation into uterine, ECM adhesion and proteolysis play important roles and they facilitate trophoblast cells invasion as the initial step in placentation (Armant, 2005). Different proteolytic enzymes have been identified in trophoblast invasion of the endometrium, including the PA/plasmin system (Strickland et al., 1976; Sappino, 1989; Teesalu et al., 1996; Zhang, 1996), MMPs (Peters et al., 1999), cathepsins (Afonso et al., 1997), and implantation- specific serine proteinases (Tang and Rancourt, 2005). In mice embryo at implantation stage, the major

46 proteinases secreted are PLAU (Strickland et al., 1976; Zhang, 1996) and MMP9 (Behrendtsen et al.,

1992).

PLAU and MMP9 are expressed in primary trophoblast cells both in vitro and in vivo (Sappino,

1989; Reponen et al., 1995; Das et al., 1997). Plau knockout mice are fertile, but they suffer from low implantation rates (Aflalo et al., 2004; Aflalo et al., 2007). Axelrod indicated that in embryos of homozygous tw73 mouse mutant, failure of implantation is associated with reduced PA expression

(Axelrod, 1985). PLAU proteolytic activity starts with binding with high affinity to a specific cell surface glycosylphosphatidylinositol-anchored receptor (Rijken and Lijnen, 2009) which consequently promotes efficient plasminogen activation and plasmin formation (Stahl, 1995;Castellino and Ploplis, 2005).

Binding of PLAU to its receptor also can stimulate cell proliferation, migration, and invasion (Alfano et al., 2005; Cáceres et al., 2008).

HOXB7 (Homebox protein 7)

Genes belong to homebox protein family are characterized with regulatory functions in a wide variety of organisms (Akam, 1987; Levine and Hoey, 1988). Some of these genes act through transcriptional activatory of the growth hormone and prolactin genes in the pituitary (Herr et al., 1988;

Robertson, 1988). Some other evidence also showed their role as transcription factors regulating the expression of other genes and homedomain binding sites (Beachy et al., 1988; Hoey and Levine, 1988).

HOXB7 has also been reported to be part of the developmental regulatory system that enable cells to establish the anterior-posterior axis. This gene is important in morphogenesis in different multicellular organisms. Study by Simeone has shown that HOXB7 participates in a range of developmental process

(Simeone et al., 1987). It has also been shown in pre- and post-implantation developmental stages of bovine embryos, HOXB7 expression reduced as embryo develops to higher stages as it was observed from (511-fold) in two-cell stage to 1-fold level in the sixteen-cell stage (Ponce-barajas, 2006).

FTH1 (Ferritin, heavy polypeptide 1)

Ferritin is a protein which regulate iron sequestration (Torti and Torti, 2002). Two main type of ferritin have been reported : heavy (FTH) and light chain (Harrison et al., 1998; Harrison and Adams,

2002). FTH1 is responsible for iron homeostasis (Theil, 2003), it has the ability to help oxidation of toxic

Fe (II) to Fe(III), which is less cytotoxic (Levi et al., 1989a; Levi et al., 1989b; Quintana et al., 2004). As embryo grows, Ferritin presence is needed as Fth(-/-) mutant mice die between E3.5-E9.5 (Ferreira et al., 2000). FTH1 can induce its anti-apoptotic effect by protecting hepatocytes and endothelial cells against some apoptotic inducers (Theil, 1987; Cairo et al., 1995).

Up-regulation of FTH during B-lymphocyte differentiation results in decrease in free iron levels as well as increases resistance to oxidative damage (Epsztejn et al., 1999; Cozzi et al., 2000), however

FTH1 down-regulation indicated an increase in free iron levels and apoptosis (Yang et al., 2002).

Overexpression of FTH1 leads to slight increase in the Primary ciliary dyskinesia in the chick embryo

(Gibson et al., 2011). In another study which they were using a transcriptome survey of bovine embryo between blastocyst and implantation period, FTH1 was also one of the most prevalent genes which exists in most stages (Mamo et al., 2012).

BMP15 (Bone morphogenetic protein 15)

Bone morphogenetic protein 15 (BMP15) belongs to the transforming growth factor superfamily. Mutation in BMP15 results in reducing ovarian functionality (Galloway et al., 2000). It has been demonstrated that BMP15 can activate the Smad1/5/8 pathway (Mottershead et al., 2012). During early Xenopus embryogenesis, BMP15 functions as an inhibitor of the Smad1/5/8 and the wnt pathway.

Experiments regarding gain and loss of BMP15 function have demonstrated its role in head formation and neural induction. It seems that BMP15 is necessary and sufficient for the specification of dorso- anterior structures (Di Pasquale and Brivanlou, 2009).There are some evidence for expression of BMP15

48 during very early murine, ovine and bovine embryogenesis (Zeng and Schultz, 2003; Pennetier et al.,

2004; McNatty et al., 2005). BMP15 has a similar structure as lefty proteins which is a missing cysteine in the mature domain, these lefty proteins has been indicated to inhibit wnt pathway (Branford and Yost,

2002).

IL-6 (Interleukin 6)

Interleukin 6 (IL-6) is an interleukin which acts in two different position: one as a pro- inflammatory cytokine and also an anti-inflammatory myokine. In humans, it is encoded by the IL6 gene.

IL-6 is secreted by T cells and macrophages to stimulate immune response (Ferguson-Smith et al., 1988).

IL-6 is also produced by ovine and bovine trophoblasts (Mathialagan et al., 1992). One of IL-6 characteristics is to stimulate the production of proteases and complement inhibitors, which are critical in the synepithelial chorionic placentation. In study by Maruo, they have reported that IL-6 significantly increases the permeability of endothelial cells (Maruo et al., 1992), as this is one of requirements for the development of uterine and trophoblast permeability in early pregnancy.

From murine to ruminants, they are some evidence for murine, porcine, ovine and bovine which their pre-implantation embryos express IL6 mRNA prior to implantation (Mathialagan et al., 1992;

Murray, 1996). Mouse embryos have also shown an increase in blastocyst cell number which was promoted by IL6 (Desai et al., 1999). The proposed mechanism for IL-6 survival-enhancing actions is through induction of microRNA- 21 expression (Shen et al., 2009).

2 Impact of estrus exposure on gene expression of the endometrium, corpus luteum and conceptus of beef cows 2.1 Hypothesis and objectives of the dissertation

Early embryonic loss, which mainly occurs in the first four weeks of gestation, is a major component of the sub-standard fertility problems that can affect both beef and dairy cows. During these initial weeks of gestation, key steps necessary for the maintenance of gestation occur, 1) IFNT from the conceptus is released to block luteolysis and trigger endometrium tissue remodeling, 2) the implantation process between the developing embryo and the endometrium starts and, 3) the embryo goes through extensive growth and differentiation from a zygote to almost full embryo organogenesis. It is important to note that modifications for optimal embryo development start before ovulation and AI. Major steroid hormones such as P4 and E2 are critical to prepare a receptive endometrium for embryo implantation.

The focus of this thesis is directed towards the effects of behavioural expression of estrus at the time of

AI on gene expression levels of target transcripts in the endometrium, CL and conceptus on day 19 of gestation. The expression of estrus has been associated with better fertility (lower embryonic loss), which could suggest a complete exposure to proper E2 levels, both in concentration and length, compared with cows bred in the absence of estrus as it commonly happens in timed-AI programs. The hypothesis is that the expression of estrous behavior in beef cows relates to the full benefit of E2 and proestrus on subsequent fertility. This effect is assessed by measuring the gene expression of key transcripts in the endometrium, CL and embryo samples collected on day 19 of gestation from beef cows.

2.2 Material and methods

This experiment was conducted from January to March (summer) at a commercial cow–calf operation located in Mineiros, Goias, Brazil. The animals used herein were cared for in accordance with

50 the practices outlined in the Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching (Curtis and Nimz, 2010). The cDNA synthesis was performed at the University of British

Columbia’s Dairy Education and Research Centre in Agassiz, BC. The RNA extraction and qPCR analysis were performed at Dr. Suzanne Clee’s lab for Diabetes Research Group at the Life Science Centre, UBC.

2.2.1 Animals, housing and grouping

Twenty-three non-lactating multiparous Nellore cows (BCS = 5.46 ± 0.05;(Wagner et al., 1988)) were assigned to an estrus synchronization plus timed-AI protocol (Meneghetti et al., 2009). Cows were enrolled onto a synchronization protocol that was carried out as follows: 2 mg injection of estradiol benzoate (Estrogin; Farmavet, São Paulo, SP, Brazil) and a second-use intravaginal progesterone releasing device (CIDR®, originally containing 1.9 g of progesterone; Zoetis, São Paulo, Brazil) on day −

11, a 12.5 mg injection of PGF2α (Lutalyse; Zoetis) on day − 4, CIDR removal in addition to 0.6 mg of estradiol cypionate (ECP; Zoetis) and 300 IU of eCG (Novormon, Schering-Plough Co., São Paulo, Brazil) on day −2, and timed-AI on day 0. All cows were inseminated on day 0 by the same technician, using semen from the same bull and batch. Cows were maintained in a single Brachiaria brizanta pasture (10 ha) with ad libitum access to forage and water. All animals received a 100 g of a protein-mineral mix +

100 g of ground corn per cow daily (on an as-fed basis).

Cows were observed for behavioural expression of estrus by visual observation two times a day for 30 min each from the administration of the PGF2α injection until timed-AI. Cows were visually observed for mounting activity and secondary signs of estrus (e.g. chin rest, following, vaginal mucus, swollen vulva), then clustered in two different groups 1) Estrus (n = 12), when cows expressed evident signs of estrus the day before and/or the day of AI, and 2) Control (n = 11), for cows that did not show any signs of estrus.

2.2.2 Blood samples and ultrasound examinations

Blood samples were collected immediately prior to AI (day 0), and on day 7 and 18 of the experiment via jugular venipuncture into commercial blood collection tubes (Vacutainer, 10 mL; Becton

Dickinson, Franklin Lakes, NJ) containing 158 USP units of freeze-dried sodium heparin. After collection, blood samples were placed immediately on ice, centrifuged (2,500 × g for 30 min; 4°C) for plasma harvest, and stored at -20°C on the same day of collection. Transrectal ultrasonography (7.5-MHz transducer; 500V, Aloka, Wallingford, CT) was performed concurrently with blood sampling on days 0, 7, and 18 to verify ovulation and CL development. CL volume was calculated using the formula for volume of a sphere; Volume = 4/3π × (D/2)3, where D is the maximum luteal diameter. Only animals with a pre- ovulatory follicle with the absence of a CL on day 0, confirmed ovulation on day 7 (presence of a CL in the ipsi-lateral ovary of the pre-ovulatory follicle observed on day 0) and a CL greater than 0.38 cm3 in volume on day 7 and 18 continued in the study and were included in the analysis.

2.2.3 Slaughter and tissue collection

Cows were slaughtered on day 19 after timed-AI and reproductive tracts were immediately collected, placed on ice, and processed for collection of the conceptus, uterine luminal flushing, and tissue samples from the CL and endometrium based on the procedures described by Bilby (Bilby et al.,

2004). More specifically, the uterine horn ipsilateral to the CL was isolated from the reproductive tract, and the ovary containing the CL was removed. The CL was incised with a scalpel for collection of luteal tissue. Subsequently, 20 mL of saline were injected into the utero-tuberal junction of the selected uterine horn, massaged gently, and exited through an incision at the tip of the uterine horn. Uterine luminal flushing media and the conceptus were recovered in a sterile 100 by 15 mm petri dish. The conceptus was measured for length and weight, whereas the uterine luminal flushing was stored in a 15- mL sterile conical tube (Corning Life Sciences, Tewksbury, MA). The selected uterine horn was then cut along the mesometrial border, and samples of the endometrium were collected. After collection, the

52 conceptus, as well as luteal and endometrial samples, were stored in 5-mL sterile cryogenic tubes (CRAL

Artigos para Laboratórios, Cotia, SP) containing 2 mL of RNA stabilization solution (RNAlater; Ambion

Inc., Austin, TX), maintained at 4°C for 24 h, and stored at –20°C until further processing.

2.2.4 RNA extraction

Total RNA was extracted from samples using TRIzol® Plus RNA Purification Kit (Invitrogen,

Carlsbad, CA). The tissue:Trizol ratio (mg:mL) was 100:1 for all sample (1 ml TRIzol per 50-100 mg tissue). Quantity and quality of isolated RNA were assessed via Nano drop (Nano drop 2000; UV-Vis spectrophotometer; Thermo scientific, Wilmington, DE). Extracted total RNA was stored at -80°C until further processing.

2.2.5 Primer design

All forward and reverse primers were designed from bovine mRNA sequences (NCBI) using

PrimerQuest PCR Design Tool (Integrated DNA Technologies, Coralville, Iowa). The primer sequence, fragment size and gene accession number are provided in Table 1.

2.2.6 Complementary DNA synthesis

Following extraction, reverse transcription reactions were performed by following the kit manufacturer’s protocol. A total RNA sample of 2500 ng was treated with 1 ul DNase (New England Bio

Labs, Ipswich, MA) to digest any DNA left from the RNA extraction and were incubated for 10 min at 75

°C. Next, to prevent DNAse I activity by chelating the divalent cations that it requires (Mg++ and Ca++), and also to prevent cation-related RNA cleavage, 0.25 ul EDTA, ultra pure 0.5 M, PH 8.0 (Life technologies, Burlington, ON) was added to each sample and incubated for 10 min at 37 °C. When

DNase treatment finished, a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster

City, CA) was used to synthesize cDNA from RNA. To proceed for reverse transcription polymerase chain reaction (RT-PCR) master mix, 5 ul of DNase treated RNA were mixed with a 5 ul reaction mixture containing 1ul of 10X random primers, 0.4 ul of 0.8 mM deoxyribonucleoside triphosphate mixture, 1 ul of 10X buffer, 0.5 ul of 50 U/ul of reverse transcriptase , 0.25 ul of 40,000 U/mL of RNase inhibitor (New

England Bio Labs, Ipswich, MA) and 1.85 ul of nuclease free water (provided in the kit). Then, the mixture was centrifuged at 2000 rpm for 2 min at 4 OC. The conditions used for RT-PCR was set as follows: 37 oC for 30 min, 75 oC for 15 min and 4 oC for the final step. Finally, products were stored at -

20°C until the quantification polymerase chain reaction (qPCR) was performed.

2.2.7 Quantitative real time PCR

In order to perform transcription analysis and gene expression of reproductive tissues, 58 genes in total were selected based on evidence in the literature showing their impact on endometrium remodelling and embryo survival: 39 genes for endometrium ( IGLL1, MX1, MX2, IGHG1, SLPI, CXCL10,

TRD, PTX3, IDO, IL-10, LIFR, CTNNB1, WNT2, DKK1, AXIN1, AXIN2, APC, FZD7, FZD4, GSK3β, FZD8, WNT3,

SELL, MMP19, CLD4, GLYCAM1, TIMP2, SPP1, LAGALSBP3, SERPINA14, EMMPRIN, CDH1, MYH9, MYH10,

MYL12A, RELN, MSX1, OXYTOCIN and COX-2), 10 genes for CL (CYP11A, StAR, PGF2α receptors, 3ΒHSD,

OXYTOCIN, BCL2, BAX, NOS2, NOS3 and FGF2), and 9 genes for embryo ( ISG15, IFNT, PLAU, HOXB7,

GPX4, BMP15, EEF1A1, FTH1 and IL-10). Genes studied in this thesis have been grouped based on their role during endometrium preparation, embryo and CL development (Table 2).

Transcript abundance was compared for a set of genes in the endometrium, CL, and embryonic tissue with two replicates per sample using quantitative real time PCR (qPCR). The qPCR analysis was performed using the Rotor Gene Q real time cycler (Qiagen, Hilden, Germany), SYBR Green Master Mix

(QuantiFast SYBR® Green PCR Kit, Qiagen, Toronto, ON) and gene specific primers (Table 1). For each sample the qPCR reaction consisted of 1.2 uL of cDNA, 0.2 uM of each forward and reverse primer, 7.5 ul

54 of 2 X SYBR green master mix and 5.7 ul of RNase free water in a final volume of 15 ul per reaction.

Reaction conditions included an initial step of 95°C (10 min), followed by 45 cycles of 95°C (15 sec) and

60°C (45 sec). Data on qRT-PCR (Ct values) were analyzed using the 2-ΔΔct method (Livak and

Schmittgen, 2001). First, expression values (Ct values) were adjusted according to corresponding GAPDH control/housekeeping gene expression values (Ct values). Later, the relative abundances of the mRNAs were calculated by dividing each pool expression value by the baseline value. Oligonucleotide sequences used to amplify segments of each gene tested are listed in Table 1. Only cycle thresholds smaller than 35 were used for analysis.

2.2.8 Statistical analysis

The qRT-PCR results were analyzed using the mean threshold cycle (Ct) for each transcript. The

Ct was calculated and normalized for the housekeeping gene GAPDH to generate delta (Δ) Ct values.

Changes in relative abundance of specific transcripts were calculated by using the delta delta (ΔΔ) Ct method (Cooke et al., 2009). Differences between cows that expressed estrus and those that did not express estrus at the time of AI were analyzed using the PROC MIXED procedure of SAS software

(version 9.2; SAS Institute Inc., Cary, NC), with the model including the effects of BCS, CL size, P4 concentration, embryo length, follicle size and IFNT concentration.

2.3 Results

2.3.1 Expression of genes in the endometrium

Results from endometrium gene transcription analysis showed that genes related to the immune system, IGLL1, CXCL10, MX1, MX2 and SLPI had significant fold differences when comparing

Estrus with Non-Estrus cows. MX1, MX2 and SLPI showed 1.6, 2.14 and 2 fold increases, respectively (P =

0.02, 0.03 and 0.01). Additionally within this category, IGLL1 and CXCL10 had tendency for a 1.8 and 1.4

55 fold increase, respectively (P = 0.1). From the adhesion category, MMP19 and MYL12A were up- regulated with a 1.5 (P = 0.05) and 1.3 (P = 0.1) fold increase, respectively. Oxytocin and COX-2, which belong to the steroid biosynthesis group, showed a 0.6 and 0.4 fold down-regulation in gene expression, respectively, when comparing the Estrus group with the Non-Estrus group. The fold change differences of genes in the endometrium are shown in Figures 2 and 3. The mRNA expression levels of developmentally important genes that mostly belong to the wnt signaling pathway (AXIN1, APC, FZD7,

CTNNB1, WNT2, DKK1, GSK3B, FZD8, FZD4, WNT3, AXIN2) did not show a difference between Estrus and

Non-Estrous cows (P > 0.05)(Figure 3-C). RELN and MSX1, which are important in embryo brain development and neural tube formation, did not show any difference between Estrus and Non-Estrus cows as well (Figure 3-C).

Genes related with adhesion CLDD4, GLYCAM1, TIMP2, SPP1, LGALSBP3, SERPINA14, EMMPRIN,

MYH9 and MYH10, showed no significant difference between Non-Estrus and Estrus cows in their mRNA levels (Figure 3-B). Transcript levels of some immune system-related genes (PTX3, TRD, IL-10, IDO,

IGHG1, and LIFR) quantified from the endometrium were also not statistically significant (P >0.05;

(Figure 3-A).

2.3.2 Expression of genes in the corpus luteum affected by estrus expression

As the CL is considered a transient endocrine organ, many genes were classified as for steroid biosynthesis; among them PGF2α receptors and CYP11A showed a significant down regulation, where both PGF2α receptors (P = 0.05) and CYP11A (P = 0.01) had a 0.7 fold difference of mRNA expression.

However, only BAX showed a significant difference within Estrus cows (0.76 fold increase; P=0.05).

Among genes of the CL, there was no significant difference in mRNA levels of NOS2, NOS3, and FGF2, which belong to the angiogenesis group (Figure 4).

2.3.3 Gene expression in the embryo

In the embryos collected from cows in the Estrous and Non-Estrous groups, down-regulation in two different groups was observed. From maternal recognition pregnancy group, ISG15, showed a significant difference within Estrus cows (0.56 fold decrease; P=0.05). eFF1A1 (P=0.09) and PLAU

(P=0.01) which belong to morphogenesis group were also statistically significant comparing Non-Estrus and Estrus cows (Fold difference=0.81 and 0.74, respectively). A fold difference of 0.19 was also observed for BMP15, which was down-regulated in Estrus cows compared with Non-Estrus cows (P=0.1))

(Figure 5).

2.3.4 Ovarian and embryo parameters

Estrous expression affects the dimensional development of the embryo (P = 0.02). Embryo size was 10 cm longer on average from cows with the Estrus group (Table 3). The IFNT concentration within the uterine flushing media was not different between the Estrus and Non-Estrus groups (P = 0.47).

Follicle size was not affected by estrus expression as well (Table 3; P = 0.89). The CL was smaller (P = 0.1) although concentrations of P4 were not statistically significant comparing Estrus and Non-Estrus cows on day 7 (P = 0.34) for cows within the Estrus group (Table 3). By day 18, the volume of the CL was not different between groups (P = 0.45). There was a tendency to be significant in BCS between the Estrus and Non-Estrus groups (P=0.1) (Table 3).

2.3.5 Effect of P4 concentration on day 7 on animal variables, embryo genes, endometrium gene expression and estrus outcome

Effect of P4 concentration (High and Low) on day 7 as a main factor affecting gene expression was analysed. Gene expression in the endometrium was affected by P4 concentration. Immune-related genes within the endometrium such as: TRD, IGLL1, MX2 and SLPI showed a significant up-regulation

57 when comparing the High and Low P4 concentrations (P < 0.05) (Figure 6). Other groups of genes which showed up-regulation belong to adhesion molecules, GLYCAM1 (P = 0.003) and MYL12A (P = 0.02). APC

(P = 0.001) and WNT2 (P = 0.01) genes from the wnt signaling pathway were significantly affected by P4 concentration. IL-10 (P = 0.09), CXCL10 (P = 0.07), MX1 (P = 0.07) and CDH1 (P = 0.9) showed also a slight up-regulation when we compared High and Low P4 concentrations. According to our results, animal factors such as: IFNT concentration, CL volume on day 7/18, P4 concentration on day 7/18, follicle size and BCS were not affected by P4 concentration. Embryo gene expression was also not affected by P4 concentration. The interaction between estrous effect and P4 concentration on day 7 and their synergistic effect on endometrium gene expression were significant for immune-related genes such as

MX1 (P = 0.003), MX2 (P = 0.04), TRD (P = 0.05) and SLPI (P = 0.003). GLYCAM1 (P = 0.04) and APC (P =

0.01) showed also a significant up-regulation. A slight up-regulation was resulted from this interaction for IGLL1 (P=0.08; Figure 7).

2.3.6 Effect of embryo size on animal variables and embryo gene expression

Animal variables and embryo gene expression were analyzed against embryo size (Large and

Small). Embryo size did not affect IFNT concentration, CL volume on day 7/18, P4 concentration on day

7/18, follicle size and BCS. Among all reproductive tissues studied here, there were just embryo genes that were affected by embryo size. From morphogenesis group, BMP15 (P = 0.005) and GPX4 (P = 0.05) were significantly up-regulated (fold difference =0.05 and 0.81, respectively) (Figure 8).

2.4 Discussion

The aim of this study was to investigate the association of estrus expression at the time of AI with expression of critical genes in the endometrium, CL and embryo during pre-implantation period. In addition, the difference in estrous expression was evaluated for animal phenotypical parameters such as

BCS, CL volume, conceptus size, P4 concentration in plasma, and follicle diameter. Evidence from this study supports our hypothesis that estrous expression positively influences the expression of target genes. Cows that expressed behavior of estrus at AI had a significant fold increase in the expression of endometrium genes critical for suppressing the local maternal immune system and adhesion between endometrium epithelial cells and conceptus, as well as inhibiting the PGF2α cascade. Genes related to immune system and adhesion group in the endometrium were also significantly affected by P4 concentration on day 7. Results from the gene analysis of the CL also confirmed down-regulation of cellular pathways associated with apoptosis and PGF2α synthesis which favours the CL maintenance, P4 secretion and key to sustain pregnancy. Understanding of temporal changes that occur in the transcriptome of the bovine uterine endometrium in early pregnancy has been increased (Forde et al.,

2009; Forde et al., 2011). Large transcriptome analysis of gene expression has been performed on 7 day embryos in cows (Misirlioglu et al., 2006; Kues et al., 2008). However, the literature on embryonic development in cattle lacks information on the effect of estrous expression on the pattern of gene expression during the pre-implantation period. The reason is partly due to the use of ovulation synchronization protocols and timed AI in most experiments with little or no attention given to the expression of estrus near AI. The early embryonic development until implantation is arguably the most important period that define a successful pregnancy and a significant proportion of all embryonic losses in lactating cows occurs between days 8 and 21 of pregnancy (Diskin and Morris, 2008). Results from this study emphasizes the role of steroids during pre-implantation to prepare a receptive endometrium.

Because of operational limitations, it was not possible to check for length of dominance or P4 levels during the growth of the pre-ovulatory follicle. However, because the experiment was performed using an ovulation synchronization program and induced ovulation with an estrogen (ECP), it is likely that the differences found in gene expression in reproductive tissues were caused by the complete development of the pre-ovulatory follicle and endometrium exposure to an ideal environment to further receive the

59 embryo. The expression of estrus can potentially affect the endometrium remodelling especially by influencing the immune system and adhesion related genes, it did translate into larger conceptuses, as well as down-regulating cellular pathways leading to luteolysis.

The up-regulation of immune system-related genes involved in endometrium receptivity (MX1,

MX2, IGLL1, SLPI and CXCL10) were in agreement with previous studies (Livak and Schmittgen, 2001;

Cerri et al., 2012; Forde et al., 2012; Bauersachs and Wolf, 2013a). The CXCL10 acts to attract trophoblasts to the endometrium, and promote adhesive activity in ruminant species (Nagaoka et al.,

2003; Imakawa et al., 2006). It has also been shown to have more than a 11-fold up-regulation in pregnant cows (Cerri et al., 2012). In a study by Walker et al. (2012), CXCL10 was down-regulated in subfertile dairy cows compared with fertile cows (Walker et al., 2012). Myoxiviruses are integral components of the innate immune system and has been even identified in blood leukocytes as a potential tool for pregnancy diagnosis in dairy heifers (Stevenson et al., 2007). Hicks et al. (2003) indicated a 15-fold increase in MX1 and MX2 between day 12 to 15 post-AI in pregnant cows compared with non-pregnant cows, whereas others have indicated a temporal difference in the expression of these genes as indicated by higher expression of MX2 on day 18 and 20 compared with day 14 and 16 of pregnancy (Green et al., 2010). The IGLL1 expression positively impacts B cells development which are critical members of the innate immunity (Bauer et al., 1993) and can indirectly enhance the MX1 and

MX2 activity. Expression of pro-inflammatory genes such as IL-8 and TNFa in LPS-activated monocytic cells, class switch recombination in activated B cells, are mediated by NF-kB which are both inhibited by

SLPI (Taggart et al., 2005; Xu et al., 2007). SLPI has the ability to interrupt the activation of transcription factor NF-kB and possibly cause a reduction in the COX-2 expression, which favours CL maintenance particularly during the maternal recognition of pregnancy. Some studies showed that hypoxia-induced

COX-2 expression also happens through NF-kB pathway (Schmedtje et al., 1997; Lukiw et al., 2003).

The up-regulation of adhesion molecules (MMP19 and MYL12A) is supported by previous studies where MMP19 has been shown to be important for the regulation of conceptus attachment in bovine endometrium (Bauersachs et al., 2008). The extensive molecular and structural changes taking place during the pre-implantation stage in the endometrium is necessary for the reorganization of GE

(Wathes and Wooding, 1980). MYL12A expression is important for the regulation of protrusion and adhesion-generated signalling (Cai et al., 2006; Vicente-Manzanares et al., 2007) and also is required for cadherin clustering (Shewan et al., 2005; Ivanov et al., 2007) and the stability of the cell–cell junction.

In the current study there was a decrease in the expression of OTR in the endometrium in the

Estrus group. Studies on the expression of OTR demonstrate that it is greatly impacted by P4 and E2 concentrations (Spencer et al., 2007; Bazer et al., 2008) and key for the synthesis of PGF2α and consequent maintenance of the CL (Spencer et al., 2007; Bauersachs et al., 2008; Bazer et al., 2010;

Dorniak et al., 2011). Along the same rationale is the down regulation of COX2, a major enzyme necessary for the synthesis of PGF2α, which is probably a product of the lower expression of OTR after a cow have expressed estrus at the end of the previous estrous cycle. Combined, the reduction in the expression of OTR and COX2 signals, an ideal endometrium capable of moderating PGF2α secretion around day 18 of the estrous cycle (maternal recognition of pregnancy) only appears when a complete estrous cycle, including the proper expression of estrus, is allowed.

Results from our study regarding the role of the wnt signalling pathway showed no significant difference in gene expression between animals that did or did not express estrus at the time of AI.

Literature review indicates that the influence of the wnt signalling pathway could be dependent on the stage of embryo development, as activation of wnt signalling in bovine embryos, by inhibitors of GSK3β, either block or increase development to the blastocyst stage (Aparicio et al., 2010). It is known that at morula stage, the embryo undergoes major genome activation (Memili and First, 1999). One suggestion

61 could be that by the time samples were collected (day 19 post AI), the wnt signalling may have been deactivated as the embryo is almost in the elongation phase.

Analysis of target genes in the CL showed significant decrease in genes related to apoptosis,

PGF2α and P4 synthesis. Down-regulation of BAX, may be due to the anti-luteolytic effects of IFNT or

COX2 as they inhibit CL luteolysis. Sugino et al. (2000) reported high BCL2 and low BAX expression in the

CL during mid-luteal phase and early pregnancy in humans, whereas low BCL2 and high BAX expression were found in the regressing CL demonstrating the importance of BCL2/BAX in controlling the fate of the

CL (Sugino et al., 2000). In the CL, the PGF2α receptors are required to interact with PGF2α released from uterus at the time of luteal regression (Tomac et al., 2011), but during pregnancy, number of

PGF2α receptors in CL is reduced to allow CL maintenance. The PGF2α synthesis is indirectly regulated by COX2 (Parent et al., 2003), and endometrial COX2 expression has been found during luteolysis

(Charpigny et al., 1997; Arosh, 2002). Our data also confirms a decrease of COX2 expression in the endometrium which is in support of CL maintenance during pregnancy.

The gene expression of the conceptus had a significant reduction in ISG15 and PLAU expression in cows within the Estrus group. Additionally, eEF1A1 and BMP15 showed a tendency for down- regulation. ISG15 synthesis is stimulated by IFNT secretion from conceptus. According to Austin et al.

(2004), endometrial ISG15 and conjugated proteins are detected on day 17 of pregnancy, their peak levels are between day 18 to 23 and then decline to baseline levels by day 45 in cows (Austin et al.,

2004). However, we did not observe a significant difference between Estrus and Non-Estrus cows regarding IFNT concentration on 18 day conceptus tissue, but only conceptus size was indeed larger for the Estrus group. The possible benefit of a larger conceptus is likely the physical occupation of the lumen and increase the likelihood of promoting IFNT-driven changes in as much endometrium tissue as possible. PLAU reduction within the Estrus group could be rationalized by the status of embryo and the

62 stage of genome activation the embryo was collected. Studies on rat embryos have shown that

Urokinase (uPA) genes are first expressed at the 2-cell stage (Zhang et al., 1994) and at the blastocyst stage in mice. During implantation, in days 5.5 to 8.5, PLAU transcripts (Sappino et al., 1989) are localized on trophoblast cells, ectoplacental cone cells and their derivatives. We also observed a reduction in BMP15 expression of cows in the Estrus group which possibly relates to the tempo-spatial genome activation of the embryo. In a study by Pennetier et al. (2004), they found BMP15 transcripts until the five- to eight-cell stage, but trace levels in the morulae stage (Pennetier et al., 2004). Similarly, the eEFA1 had its expression reduced in the Estrus group in the current study. The eEFA1 plays an important role in protein synthesis as it is involved in interacting with tRNA in protein synthesis

(Mateyak and Kinzy, 2010), regulation of cytoskeletal dynamics (Liu et al., 1996; Gross and Kinzy, 2005), protein degradation (Chuang et al., 2005), and protection against apoptosis (Ruest et al., 2002; Chang and Wang, 2007). A complete reprograming pattern of protein synthesis was observed at the 8-16 cell stage of development in pre-implantation bovine embryos (Frei et al., 1989), and at 15 hours after the first cleavage division, with most changes occurring at the 2-cell stage, in mice embryos (Latham et al.,

1991). According to our results, cows with smaller embryo size had greater expression of BMP15 and

GPX4 in Estrus versus Non-Estrus cows and could be likely correlated with the effect of expression of estrus on embryo gene expression. There was no correlation between embryo size and other animal variables. Although in some studies, they have reported a correlation between IFNT secretion and embryo size (Robinson et al., 2006), they have not observed a relationship between IFNT concentration or embryo size and IFNT mRNA expression.

Ultimately, the current study found a correlation between P4 concentration and endometrial gene expression, which was mainly pronounced in immune system-related genes (IL-10, MX1, SLPI, MX2,

TRD, CXCL10 and IGLL1), adhesion molecules (GLYCAM1, CDH1 and MYL12A) and wnt signaling (APC and

WNT2). Other variables such as embryo gene expression or animal physiological factors were not

63 affected by P4 concentration on day 7 of gestation. There was an interaction between estrous expression and P4 concentration which could significantly affect expression of genes in the endometrium, specifically when the combination of estrous expression and low P4 concentration is in place. More specifically, it seems that low P4 concentration is in favour of up-regulation of critical groups of genes in the endometrium. According to other studies, the major changes required to drive conceptus elongation and uterine receptivity for implantation occurs between days 7 and 13 in response to ovarian P4 which is independent of an existing and appropriately developed embryo or conceptus

(Forde et al., 2009; Forde et al., 2011; Niamh Forde et al., 2012; Forde and Lonergan, 2012). Thus, between day 7 and day 19 (tissue collection), the interaction between estrous expression and P4 concentration would induce the changes in the gene expression of the endometrium critical for endometrium receptivity or conceptus development.

The expression of estrus can affect the reproductive tissue gene expression during the pre- implantation period by modifying the critical cellular pathways related to suppression of maternal immune system, attachment between conceptus and endometrium and CL maintenance during pregnancy. Moreover, cows in the Estrus group yielded larger conceptuses which generally promotes better chances for survivability. The estrus effects appear to have correlation with P4 concentration on day 7 in a way that could positively influence endometrium receptivity and embryo development.

Figure 1: Diagram of study

Cows received a 2 mg injection of estradiol benzoate (Estrogin; Farmavet, São Paulo, SP, Brazil) and a second-use intravaginal progesterone releasing device (CIDR®, originally containing 1.9 g of progesterone; Zoetis, São Paulo, Brazil) on day − 11, a 12.5 mg injection of prostaglandin F2α (Lutalyse;

Zoetis) on day −4, CIDR removal in addition to 0.6 mg of estradiol cypionate (ECP; Zoetis) and 300 IU of eCG (Novormon, Schering-Plough Co., São Paulo, Brazil) on day −2, and FTAI on day 0. BS= blood sample,

US= ultrasonographic examination of ovaries, TC= tissue collection and P4= progesterone analysis.

Table 1: Primer sequences for gene transcription analysis performed for endometrium, CL, and embryo

Sequences of primers used for qPCR analysis of endometrium tissue Product Gene Symbol Accession Primer Primer Sequence Length (bp) GAPDH NM_001034034.2 F GAG ATC CTG CCA ACA TCA A 83 R CTT CTC CAT GGT AGT GAA GAC LGALSBP3 NM_001046316.2 F CTC TGT CTC CTG GTC TTT 127 R GGG ATT GGA CTT GGA GTA SERPINA14 NM_174821.2 F GAC AGA GTC ACC TCA GAT A 91 R CAT CGA GAA TAC CTC CTT TC CLD4 NM_001014391.2 F CCC TCA TCG TCA TCT GTA T 99 R CCT TGG AGC TCT CAT CAT IDO NM_001101866.2 F AGC TAT GGT CTC CTT GAG 121 R GCC TCC AGT TCC TCT ATT MSX1 NM_174798.2 F AAG CAG TAC CTG TCC ATC 88 R GGT TCT GAA ACC AGA TCT TC SPP1 NM_174178.2 F GGA CTT CAC ATC ACA CAT AG 97 R CTC GCT ACT GTT GGT TTC IL-10 NM_174088.1 F GCT CAG CAC TAC TCT GTT 97 R GTT GGC AAG TGG ATA CAG AXIN1 NM_001191398.1 F GCC ATC TAC CGC AAA TAC 93 R CGA GAT GCA GTC CTT TAT G IGLL1 NM_001083800.1 F GGA AGC AGC ACG AAT ATC 99 R GGG TCG ATA CTT ATC TTC ATA G

Sequences of primers used forqPCR analysis of endometrium tissue Product Gene Symbol Accession Primer Primer Sequence Length (bp) TIMP2 NM_174472.4 F GGT CAC GGA GAA GAA CAT 126 R TCC TCG ATG TCC AGA AAC MX2 NM_173941.2 F CCA ATC AGA TCC CGT TCA 115 R TGA AGC AGC CAG GAA TAG TRD XM_603355.3 F GTC GCT TGT TTG GTG AAG 104 R CCA GGT GAG ATG GCA ATA CDH1 NM_001002763.1 F CTG AGA ACG AGG CTA ATG T 132 R GGT CTG TGA CGA CGA TAA A RELN NM_001206458.1 F GGG TGT GCC AAT CAA TTC 100 R CTG GGT AAC AGC CTT CTT EMMPRIN NM_001075371.2 F GGT CAC CAT CAT CTT CAT CTA 73 R AGA GCC TAT GTC TTC ATC ATC LIFR NM_001192263.1 F GCT CTT GGA ATG GGA AAT AG 98 R CCA GAC TGA GAT GAG TTA CA SLPI NM_001098865.2 F GCC TTG GAG ATG AGA AAC 96 R GGT CCA GAC ATT CAG TTC MYL12A NM_001015640.2 F CAC CAT TCA GGA GGA TTA C 100 R GTC AAT AGG TGC TTC TCT G MYH10 NM_174834.1 F GAC TAC CAG CGT GAA TTA G 115 R CCT GCA ACT GAA GGA TTT

Sequences of primers used forqPCR analysis of endometrium tissue Product Prime Gene Symbol Accession Primer Sequence Length r (bp) MYH9 NM_001192762.1 F GAC AAG AGT GGC TTT GAG 96 R GTT CAC CTT CAC CTT CTT C IGHG1 DQ452014.1 F GAC CCT CTG TCT TCA TCT 146 R GTT TAC CTC CAC GTT GTC FDZ4 NM_001206269.1 F GTT CCA TCT GGT GGG TTA TTC 106 R GCT GCG ATG TGG AAA TAA GA FZD8 XM_005214320.1 F CCT ATA TGC CCA ACC AGT TC 122 R CAT GCT GCA CAG GAA GAA WNT3 NM_001206024.1 F AGA AGC GGA AGG AGA AGT 83 R CAC GTC ATA GAT GCG GAT AC AXIN2 NM_001192299.1 F GGA GAA ATG CGT GGA TAC TT 103 R GTA GAT CGC TTT GGC TAC TC GSK3B NM_001101310.1 F GGG TCA TTT GGT GTC GTG TAT C 97 R GAT CTG GAG CTC TCG GTT CTT A GLYCAM1 NM_174828.2 F CCT CTG CTC AGT TCA TCA GG 97 TCT GAT CAC AAT TTG CTC TTT R GG SELL NM_001076141.1 F GGT GGG AAC CAA CAA ATC 86 R CAC AGT CCT CCT TAC TCT TC WNT2 NM_001013001.1 F TCC TGT GAC CCA AAG AAG 98 R GCA AAC TTG ATC CCA TAG TC

Sequences of primers used forqPCR analysis of endometrium tissue Product Gene Symbol Accession Primer Primer Sequence Length (bp) CXCL10 NM_001046551.2 F GTG TAC CTC TCT CTA GGA ATA C 107 R GGA TTG ACT TGC AGG AAT G PTX3 NM_001076259.2 F CGC TGA TGC TGT GAT TTC 101 R CCA CCG AGT CAC CAT TTA DKK1 NM_001205544.1 F CCA TGG GCT GGA GAT ATT 100 R GTG AAG CCT GGA AGA ATT AC MMP19 NM_001075983.1 F ATC TTG AAC CTA CCG TCT AC 83 R GCC ACA TTG CTC CAA TAC APC NM_001075986.2 F GAG CCC TTC ACA GAA TGA 118 R CTC AGG ATA CAC GGG ATA AG FZD7 NM_001144091.1 F GGG TGT GCC AAT CAA TTC 138 R CTG GGT AAC AGC CTT CTT CTNNB1 NM_001076141.1 F CCC TTT GTC CAG CAA ATC 119 R CTG TGT TCC ACC CAT AGA MX1 NM_1733940.2 F AGT CCA TCC GAC TAC ATT TC 102 R CTT CTT CTG CCT CCT TCT C COX-2 NM_174445 F AGGTGTATGTATGAGTGTAGGA 484 R GTGCTGGGCAAAGAATGCAA

Sequences of primers used forqPCR analysis of CL tissue Product Gene Symbol Accession Primer Primer Sequence Length (bp) BAX NM_173894.1 F TCT GAC GGC AAC TTC AAC TG 98 R CCA TGA TGG TCC TGA TCA ACT C CYP11A1 NM_176644.2 F GAA TTA CCC AGG CAT CCT CTA C 97 R TCT CCG TAA TAT TGG CCT TGA C BCL-2 NM_001166486.1 F ATC GTG GCC TTC TTT GAG TTC 104 R TCA GGT ACT CGG TCA TCC AC NOS2 NM_001076799.1 F GAG CTT CTA CCT CAA GCT ATC G 94 R TCT ATC TCC TTT GTT ACT GCT TCC NOS3 NM_181037.3 F GAT GGT CAA CTA CAT CCT GTC C 100 R GGT CTT CTT CCT GGT GAT GC FGF2 NM_174056.3 F CAA CAG AAG ACC TAG GGA AGA C 124 R ACA GCC AAC TCC TAA CAT CC sTAR NM_174189.2 F TAC ACC ATG TGG AAT GTC AGG 104 R CCT GTG TCA GTT GTA CAG TCT C 3BHSD NM_174343.3 F GGT AAC GTG GCC TGG ATG 123 R CTT GTA GGG CGA GTT GTC ATA G PGF2α D17395 F TTAGAAGTCAGCAGCACAG 98 receptors R ACTATCTGGGTGAGGGCTGATT OXYTOCIN M25648.1 F GTCTGCACCATGGCAGGTT 125 R CAGGGGGCAGTTCTGAATGT

Sequences of primers used forqPCR analysis of embryo tissue Product Gene Symbol Accession Primer Primer Sequence Length (bp) PLAU NM_174147.2 F CTA GGG AGA AAG AAG AGT TCC 125 R TCG ATG CCT CCT GTA GAT HOXB7 NM_174342.2 F ACC TAC ACC CGC TAT CA 118 R TGA TCT GTC TTT CTG TGA GG FTH1 NM_174062.3 F AGG TGG AAG CCA TCA AAG 102 R GGG TGT GCT TGT CAA AGA EEF1A1 NM_174535.1 F CTG GAA GAT GGC CCT AAA T 102 R GGG AGG ATA ATC AGA GAA GC GPX4 NM_174770.3 F GCT GGC TAT AAC GTC AAA TTC 91 R GCT GGA CTT TCA TCC ATT TC ISG15 NM_174366.1 F GTA CAA GCA GAC CAG TTC 84

IL-6 NM_173923.2 F CTT CAA ACG AGT GGG TAA AG 97 R TAC TTC ATC CGA ATA GCT CTC BMP15 NM_001031752.1 F CAT ACA GAC CCT GGA CTT TC 108 R GAG AGG TGG GAA TGA GTT AG IFN-tau AF238612 F GCCCTGGTGCTGGTCAGCTA 102 R CTT CAT GAG GCC GTA TTC

Table 2: Flowchart of gene function

In this table, all genes studied in this thesis have been grouped according to their function in the encometrium preparation, CL, and embryo development

Endometrium Corpus Luteum Embryo Adhesion Immune Growth and Apoptosis Angiogenesis Steroid Morphogenesis Maternal molecules system development biosynthesis recognition of pregnancy MMP19 IGLL1 CTNNB1 BCL2 NOS2 STAR PLAU IFNT CLD4 SELL WNT2 BAX NOS3 PGF2α HOXB7 ISG15 receptors GLYCAM1 CXCL10 DKK1 FGF2 3βHSD BMP15 TIMP2 PTX3 AXIN1 OXYTOCIN GPX4 SPP1 TRD AXIN2 CYP11A EEF1A1 LGALSBP3 MX2 APC IL-6 SERPINN MX1 FZD7 FTH1 EMMPRIN IL-10 GSK3β CDH1 IDO MSX1 MYH9 LIFR RELN MYH10 IGHG1 FZD8 MYL12A SLPI WNT3 Steroid biosynthesis FZD4 COX2 OXYTOCIN

Table 3 : Descriptive statistics of reproductive parameters collected on days 7 and 18 of pregnancy in cows detected estrous and not detected estrous at the time of AI

Parameteres Estrus cows Non-Estrus cows P-value

BCS 3.30 ± 0.10 3.45 ± 0.10 0.10

Follicle size (mm) 14.00 ± 0.98 14.2 ± 1.02 0.89

P4 on day 7 (ng/ml) 3.80 ± 0.90 5.20 ± 1.00 0.34

P4 on day 18 (ng/ml) 3.89 ± 0.74 4.43 ± 0.78 0.62

CL size on day 7 (cm) 6.96 ± 0.82 8.82 ± 0.86 0.10

CL size on day 18(cm) 10.5 ± 0.98 9.42 ± 1.05 0.45

Embryo size (cm) 38.3 0 ± 2.82 28.20 ± 2.96 0.02

IFN concentration (pg/ml) 8.3 0 ± 1.73 10.20 ± 1.91 0.47

Figure 2: Effect of estrus expression on endometrium gene expression

Significant fold difference based on estrous expression referent has been shown for genes with significant pattern of expression in endometrium tissue. For this graph, the asterisks (*), (**), (***) and

(+) refer to P-value=0.0.5, ≤0.01 ≤0.001 and ≤ 0.1 respectively.

COX2 *

OXYTOCIN +

MMP19 *

MYL12A +

SLPI **

MX1 *

MX2 *

CXCL10 +

IGLL1 +

-1 -0.5 0 0.5 1 1.5 2 2.5 Fold difference (Estrus referent)

Figure 3: Genes not affected by estrous expression in the endometrium tissue

Non- significant expression of genes based on estrous expression have been shown in this figure. A), B), and C) sections refer to immune system related, adhesion, and growth/developmental genes, respectively.

A) TRD

IL-10

IDO

LIFR

IGHG1

-1.5 -1 -0.5 0 0.5 1 1.5 2 Fold difference (Estrus referent)

B) MYH9 MYH10 CDH1 EMPRINN SEPING14 LGALSBP3 SPP1 TIMP2 CLD4 SELL GLYCAM1

-1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 3 Fold difference (Estrus referent)

C) DKK1 CTNNB1 WNT2 FZD7 APC GSK3β FZD8 FZD4 WNT3 AXIN1 AXIN2 MSX1 RELN -1.5 -1 -0.5 0 0.5 1 1.5 2 Fold differnece (Estrus referent)

Figure 4 : Effect of estrus expression on corpus luteum genes involved in steroidogenesis. Angiogenesis and apoptosis

Significant fold difference based on estrous expression referent has been shown for genes with significant pattern of expression in corpus luteum tissue. For this graph, the asterisks (*) and (**) refer to P-value ≤0.0.5, ≤0.01 respectively.

FGF2

NOS2 OXYTOCIN

3βHSD

PGF2α receptor *

STAR

CYP11A **

BCL2 BAX *

-1.5 -1 -0.5 0 0.5 1 1.5 Fold difference (Estrus referent)

Figure 5 : Effect of estrus expression on embryo genes involved in morphogenesis, immune system, and protein synthesis

Significant fold difference based on estrous expression referent has been shown for genes with significant pattern of expression in embryo tissue. For this graph, the asterisks (*) and (+) refer to P- value ≤0.0.5, and ≤0.1 respectively.

IFNT

BMP15 +

PLAU **

HOXB7

FTH1

GPX4

EEF1A1 +

IL-6

ISG15 *

-1.5 -1 -0.5 0 0.5 1 1.5 Fold difference (Estrus referent)

Figure 6: Effect of P4 concentration in day 7 on endometrium gene expression

Effect of P4 concentration on day 7 has been shown for endometrium gene expression. For this graph, the asterisks (*), (**), (***) and (+) refer to P-value ≤0.0.5, ≤0.01 ≤0.001 and ≤0.1 respectively.

MYL12A * CDH1 + WNT2** APC***

TRD** MX2 * SLPI ** MX1 +

IL-10 +

IGLL1 * CXCL10 +

-0.5 0 0.5 1 1.5 2 2.5 3 Fold difference (Low P4/day 7 Referent)

Figure 7: Interaction between P4 and estrous expression and its effect on endometrium gene expression

For this graph, the asterisks (*), (**) and (+) refer to P-value ≤0.0.5, ≤0.01 and ≤0.1 respectively and they belong to each three group of bars.

IGLL1 +

APC **

TRD *

MX2 * Estrous-Low P4 Estrous-High P4 SLPI ** No Estrous-High P4

MX1 **

-2.0 -1.0 0.0 1.0 2.0 3.0 4.0 Fold difference (No Estrous-Low P4 referent)

Figure 8: Effect of embryo size on embryo gene expression

Effect of embryo size difference on embryo genes expression has been evaluated and just those, which showed a significant up- regulation, have been shown in this table. For this figure, the asterisks (*) and

(**) refers to P-value ≤0.05 and ≤0.01 repectively.

* BMP15

** * GPX4

-1 -0.5 0 0.5 1 Fold differrence ( Large embryo size referent)

3 General discussion 3.1 Summary

The reproductive success of dairy and beef farms is directly dependent upon conception rates and detection of estrus. Pregnancy loss, on the other hand, can have destructive effects on long term management conditions and economic output from these operations. Early embryonic loss in dairy cattle for example has been recorded as one of the critical fertility issues in this industry.

There are a number of studies in the literature regarding the effect of P4 or E2 on modulation of fertility, both large field trials and basic studies aiming for gene expression patterns in embryo-maternal crosstalk. In spite of a significat body of knowledge, the changes in the endometrium transcriptome of the pre-implantation phase caused by the expression of estrus near AI was relatively unknown.

Identifying cows in estrus is a critical stage to proceed for a successful AI. In this study, I investigated the effect of estrous expression of beef cattle on the ovarian dynamics, conceptus parameters and expression of genes important in conceptus-maternal cross-talk. Results from our study showed that estrous expression had no correlation with parameters such as: BCS, pre-ovulatory follicle diameter, concentration of P4 on days 7 and 18 post-AI and concentration of IFNT in the uterine flush. However, we could see a significant increase in conceptus length from cows that showed estrus compared with those did not. We analyzed the expression of genes related to immune system, adhesion and attachment, wnt signaling, steroids synthesis, apoptosis, embryo growth and development in the endometrium, CL, and embryonic tissues. The most affected genes by estrous expression in the endometrium belong to the immune system family and adhesion molecules. No significant difference between the two groups was found for wnt signaling-related genes. This lack of difference for the wnt signaling pathway could be explained by a possible temporal factor. Regarding the gene expression pattern observed for CL, there was a down-regulation of genes related to apoptosis, synthesis of P4 and

82 luteolysis in cows that expressed estrus at AI. There was a numerical, although not significant, decrease in the concentration of P4 in plasma on days 7 and 18 that is possibly correlated with this gene down- regulation. We could explain this down-regulation for P4 synthesis as it correlates with non-significant but numerically lower amount of P4 concentration on days 7 and 18. The reduction of BAX and PGF2α receptor are in line with the initial hypothesis that estrus expression could improve the gene expression profile in favour of CL maintenance. We also observed a pool of nine genes in the embryonic tissue, but only four of them had its expression modulated by expression of estrus. All four genes were down- regulated, but no clear pattern of gene functions was found. We believe that embryo genomic activation could have played a role and that most changes likely occurred earlier, possibly up until the morula stage. Further studies are warranted to prove this hypothesis.

3.2 Limitations

One limitation of this study was the time point of collecting samples. Ideally, we could have measured embryo and ovaryan dynamics in two different days (7 and 18 of gestation). Measurement of

E2 concentrations during the proestrus and a more thorough following of follicular dynamics would probably be ideal to remove any confounding factors. A major challenge regarding the points above cited is the operational limitations related to working with Nelore cows in a beef cattle farm. For example, the lack of differences observed for wnt signalling genes could be answered by a sequential collection of tissues during early gestation (Aparicio et al., 2010). A similar pattern was observed for ISG- stimulated genes expression in the endometrium as we observed some adhesion related genes not affected by estrous expression. Thus collecting samples at different time points during pregnancy, especially the first three weeks of gestation, could give us an understanding of the temporal profile of target genes affected by estrous expression. Regarding embryo development and genome activation, there is also some evidence that each is activated in a specific stage. The BMP15, for example, showed

83 temporary and weak reactivation between the four and eight-cell stages in a study of global expression evolution in mouse pre-implantation development (Hamatani et al., 2004). IFNT synthesis and secretion occurs between days 10 and 25 with maximum production on days 14 to 16 (Bazer, 1992; Roberts et al.,

1999) in sheep. It could be concluded that by the day 19 of gestation, IFNT concentration had already been reduced and does not necessarily reflect the IFNT synthesis potential. This possibility if further corrobated by the fact that cows in the Estrus group yielded significantly larger conceptus.

3.3 Future direction

Although this thesis main focus was on the effect of estrous exposure on reproductive gene expression, considering P4 concentration as an important contributing factor in CL maintenance and embryo development during pregnancy will be noteworthy. Some follow up studies such as testing protein expression of those statiscally significant genes could explain if these genes have consistent up- regulation pattern after post-translational modifications. Additionally, as I discussed in limitation section, determination of IFNT concentration in different time-points of pregnancy will help to unveil if it is affected by estrous expression more accurately. In addition, a follow up study to investigate different concentrations of P4 during follicle growth in cows expressing estrus could provide a more precise relationship between lower concentration of P4 and estrous expression.

3.4 Conclusions

Early embryonic loss in dairy industry has gained more attention over past years and recent studies have focused on possible mechanisms related with this abnormality. Expression of estrus at the time of AI was a major contributing factor related to changes of the transcriptome in reproductive tissues. This thesis demonstrated that a complete E2 exposure during proestrus and estrous expression at the time of AI could actively affect the gene expression of reproductive tissues during pre-

84 implantation phase. The effects on the reproductive tissue transcriptome were more pronounced in the endometrium as the main site of dynamic remodelling to prepare a receptive site for embryo implantation. Furthermore, the immune system, adhesion molecules and the PGF2α cascade likely coordinate the major changes in the endometrium transcriptome affected by the expression of estrus.

References

Abe, T., N. Kobayashi, K. Yoshimura, B. C. Trapnell, H. Kim, R. C. Hubbard, M. T. Brewer, R. C. Thompson, and R. G. Crystal. 1991. Expression of the secretory leukoprotease inhibitor gene in epithelial cells. The Journal of clinical investigation 87:2207–15.

Abu-Elmagd, M., C. Garcia-Morales, and G. N. Wheeler. 2006. Frizzled7 mediates canonical Wnt signaling in neural crest induction. Developmental biology 298:285–98.

Acosta, T. J., and A. Miyamoto. 2004. Vascular control of ovarian function: ovulation, corpus luteum formation and regression. Animal reproduction science 82-83:127–40.

Adams, J. M., and S. Cory. 1998. The Bcl-2 protein family: arbiters of cell survival. Science (New York, N.Y.) 281:1322–6.

Aflalo, E. D., U. A. Sod-Moriah, G. Potashnik, and I. Har-Vardi. 2004. Differences in the implantation rates of rat embryos developed in vivo and in vitro: possible role for plasminogen activators. Fertility and sterility 81 Suppl 1:780–5.

Aflalo, E. D., U. A. Sod-Moriah, G. Potashnik, and I. Har-Vardi. 2007. EGF increases expression and activity of PAs in preimplantation rat embryos and their implantation rate. Reproductive biology and endocrinology : RB&E 5:4.

Afonso, S., L. Romagnano, and B. Babiarz. 1997. The expression and function of cystatin C and cathepsin B and cathepsin L during mouse embryo implantation and placentation. Development 124:3415–3425.

Akam, M. 1987. The molecular basis for metameric pattern in the Drosophila embryo. Development (Cambridge, England) 101:1–22.

Akolekar, R., D. Casagrandi, P. Livanos, A. Tetteh, and K. H. Nicolaides. 2009. Maternal plasma pentraxin 3 at 11 to 13 weeks of gestation in hypertensive disorders of pregnancy. Prenatal diagnosis 29:934–8.

Alfano, D., P. Franco, I. Vocca, N. Gambi, V. Pisa, A. Mancini, M. Caputi, M. V. Carriero, I. Iaccarino, and M. P. Stoppelli. 2005. The urokinase plasminogen activator and its receptor: role in cell growth and apoptosis. Thrombosis and haemostasis 93:205–11.

Anderson, J. 2009. The periodicity and duration of oestrus in zebu and grade cattle. The Journal of Agricultural Science 34:57.

Aparicio, I. M., M. Garcia-Herreros, T. Fair, and P. Lonergan. 2010. Identification and regulation of glycogen synthase kinase-3 during bovine embryo development. Reproduction (Cambridge, England) 140:83–92.

Arck, P. C., D. A. Ferrick, D. Steele-Norwood, K. Croitoru, and D. A. Clark. 1997. Murine T cell determination of pregnancy outcome: I. Effects of strain, alphabeta T cell receptor, gammadelta T cell

86 receptor, and gammadelta T cell subsets. American journal of reproductive immunology (New York, N.Y. : 1989) 37:492–502.

Armant, D. R. 2005. Blastocysts don’t go it alone. Extrinsic signals fine-tune the intrinsic developmental program of trophoblast cells. Developmental biology 280:260–80.

Arosh, J. A. 2002. Expression of Cyclooxygenases 1 and 2 and Prostaglandin E Synthase in Bovine Endometrial Tissue During the Estrous Cycle. Biology of Reproduction 67:161–169.

Asdell, S. A., J. de Alba, and J. S. Roberts. 1945. The Levels of Ovarian Hormones Required to Induce Heat and Other Reactions in the Ovariectomized Cow. Journal of Animal Science 4:277–284.

Atkins, J. A., M. F. Smith, M. D. MacNeil, E. M. Jinks, F. M. Abreu, L. J. Alexander, and T. W. Geary. 2013. Pregnancy establishment and maintenance in cattle. Journal of animal science 91:722–33.

Austin, K. J., A. L. Carr, J. K. Pru, C. E. Hearne, E. L. George, E. L. Belden, and T. R. Hansen. 2004. Localization of ISG15 and conjugated proteins in bovine endometrium using immunohistochemistry and electron microscopy. Endocrinology 145:967–75.

Axelrod, H. R. 1985. Altered trophoblast functions in implantation-defective mouse embryos. Developmental biology 108:185–90.

Bacci, M. L., A. M. Barazzoni, M. Forni, and G. L. Costerbosa. 1996. In situ detection of apoptosis in regressing corpus luteum of pregnant sow: evidence of an early presence of DNA fragmentation. Domestic animal endocrinology 13:361–72.

Badinga, L., F. J. Michel, M. J. Fields, D. C. Sharp, and R. C. Simmen. 1994. Pregnancy-associated endometrial expression of antileukoproteinase gene is correlated with epitheliochorial placentation. Molecular reproduction and development 38:357–63.

Bafico, A., G. Liu, A. Yaniv, A. Gazit, and S. A. Aaronson. 2001. Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. Nature cell biology 3:683–6.

Balapure, A. K., I. C. Caicedo, K. Kawada, D. S. Watt, C. E. Rexroad, and T. A. Fitz. 1989. Multiple classes of prostaglandin F2 alpha binding sites in subpopulations of ovine luteal cells. Biology of reproduction 41:385–92.

Ball, P. J. H., and A. R. Peters, eds. 2004. Reproduction in Cattle. Blackwell Publishing Ltd, Oxford, UK.

Del Barco Barrantes, I., G. Davidson, H.-J. Gröne, H. Westphal, and C. Niehrs. 2003. Dkk1 and noggin cooperate in mammalian head induction. Genes & development 17:2239–44.

Barry, S. T., S. B. Ludbrook, E. Murrison, and C. M. Horgan. 2000. A regulated interaction between alpha5beta1 integrin and osteopontin. Biochemical and biophysical research communications 267:764–9.

Baruselli, P. S., E. L. Reis, M. O. Marques, L. F. Nasser, and G. A. Bó. 2004. The use of hormonal treatments to improve reproductive performance of anestrous beef cattle in tropical climates. Animal reproduction science 82-83:479–86.

Bassett, S. G., L. L. Little-Ihrig, J. I. Mason, and A. J. Zeleznik. 1991. Expression of messenger ribonucleic acids that encode for 3 beta-hydroxysteroid dehydrogenase and cholesterol side-chain cleavage enzyme throughout the luteal phase of the macaque menstrual cycle. The Journal of clinical endocrinology and metabolism 72:362–6.

Bauer, T. R., H. E. McDermid, M. L. Budarf, M. L. Van Keuren, and B. B. Blomberg. 1993. Physical location of the human immunoglobulin lambda-like genes, 14.1, 16.1, and 16.2. Immunogenetics 38:387–99.

Bauersachs, S., K. Mitko, S. E. Ulbrich, H. Blum, and E. Wolf. 2008. Transcriptome studies of bovine endometrium reveal molecular profiles characteristic for specific stages of estrous cycle and early pregnancy. Experimental and clinical endocrinology & diabetes : official journal, German Society of Endocrinology [and] German Diabetes Association 116:371–84.

Bauersachs, S., S. E. Ulbrich, K. Gross, S. E. M. Schmidt, H. H. D. Meyer, R. Einspanier, H. Wenigerkind, M. Vermehren, H. Blum, F. Sinowatz, and E. Wolf. 2005. Gene expression profiling of bovine endometrium during the oestrous cycle: detection of molecular pathways involved in functional changes. Journal of molecular endocrinology 34:889–908.

Bauersachs, S., S. E. Ulbrich, K. Gross, S. E. M. Schmidt, H. H. D. Meyer, H. Wenigerkind, M. Vermehren, F. Sinowatz, H. Blum, and E. Wolf. 2006. Embryo-induced transcriptome changes in bovine endometrium reveal species-specific and common molecular markers of uterine receptivity. Reproduction (Cambridge, England) 132:319–31.

Bauersachs, S., and E. Wolf. 2013. Immune aspects of embryo-maternal cross-talk in the bovine uterus. Journal of reproductive immunology 97:20–6.

Bazer, F. W., R. C. Burghardt, G. A. Johnson, T. E. Spencer, and G. Wu. 2008. Interferons and progesterone for establishment and maintenance of pregnancy: interactions among novel cell signaling pathways1 1The content of the paper was presented at the V Jubilee Congress of the Society for Reproductive Biology in Wrocław, Poland (. Reproductive Biology 8:179–211.

Bazer, F. W., G. Wu, T. E. Spencer, G. A. Johnson, R. C. Burghardt, and K. Bayless. 2010. Novel pathways for implantation and establishment and maintenance of pregnancy in mammals. Molecular human reproduction 16:135–52.

Bazer, F. W. 1992. Mediators of maternal recognition of pregnancy in mammals. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine (New York, N.Y.) 199:373–84.

Beachy, P. A., M. A. Krasnow, E. R. Gavis, and D. S. Hogness. 1988. An Ultrabithorax protein binds sequences near its own and the Antennapedia P1 promoters. Cell 55:1069–81.

Behrendtsen, O., C. Alexander, and Z. Werb. 1992. Metalloproteinases mediate extracellular matrix degradation by cells from mouse blastocyst outgrowths. Development 114:447–456.

Behrens, J., B. A. Jerchow, M. Würtele, J. Grimm, C. Asbrand, R. Wirtz, M. Kühl, D. Wedlich, and W. Birchmeier. 1998. Functional interaction of an axin homolog, conductin, with beta-catenin, APC, and GSK3beta. Science (New York, N.Y.) 280:596–9.

Benyo, D. F., L. Little-Ihrig, and A. J. Zeleznik. 1993. Noncoordinated expression of luteal cell messenger ribonucleic acids during human chorionic gonadotropin stimulation of the primate corpus luteum. Endocrinology 133:699–704.

Berg, D. K., J. van Leeuwen, S. Beaumont, M. Berg, and P. L. Pfeffer. 2010. Embryo loss in cattle between Days 7 and 16 of pregnancy. Theriogenology 73:250–60.

Berisha, B., and D. Schams. 2005. Ovarian function in ruminants. Domestic animal endocrinology 29:305–17.

Berisha, B., M. Steffl, W. Amselgruber, and D. Schams. 2006. Changes in fibroblast growth factor 2 and its receptors in bovine follicles before and after GnRH application and after ovulation. Reproduction (Cambridge, England) 131:319–29.

Betapudi, V., L. S. Licate, and T. T. Egelhoff. 2006. Distinct roles of nonmuscle myosin II isoforms in the regulation of MDA-MB-231 breast cancer cell spreading and migration. Cancer research 66:4725–33.

Betteridge, K. J., M. D. Eaglesome, G. C. Randall, and D. Mitchell. 1980. Collection, description and transfer of embryos from cattle 10--16 days after oestrus. Journal of reproduction and fertility 59:205–16.

Bilby, T. R., A. Guzeloglu, S. Kamimura, S. M. Pancarci, F. Michel, H. H. Head, and W. W. Thatcher. 2004. Pregnancy and bovine somatotropin in nonlactating dairy cows: I. Ovarian, conceptus, and insulin-like growth factor system responses. Journal of dairy science 87:3256–67.

Bogacka, I., and M. Bogacki. 2011. The quantitative expression of peroxisome proliferator activated receptor (PPAR) genes in porcine endometrium through the estrous cycle and early pregnancy. Journal of physiology and pharmacology : an official journal of the Polish Physiological Society 62:559– 65.

Böhm, B., T. Aigner, R. Kinne, and H. Burkhardt. 1992. The serine-protease inhibitor of cartilage matrix is not a chondrocytic gene product. European journal of biochemistry / FEBS 207:773–9.

Boiti, C., D. Zampini, G. Guelfi, F. Paolocci, M. Zerani, and A. Gobbetti. 2002. Expression patterns of endothelial and inducible nitric oxide synthase isoforms in corpora lutea of pseudopregnant rabbits at different luteal stages. The Journal of endocrinology 173:285–96.

Borchert, A., C. C. Wang, C. Ufer, H. Schiebel, N. E. Savaskan, and H. Kuhn. 2006. The role of phospholipid hydroperoxide glutathione peroxidase isoforms in murine embryogenesis. The Journal of biological chemistry 281:19655–64.

Borthwick, J. M., D. S. Charnock-Jones, B. D. Tom, M. L. Hull, R. Teirney, S. C. Phillips, and S. K. Smith. 2003. Determination of the transcript profile of human endometrium. Molecular human reproduction 9:19–33.

Bose, H. S., T. Sugawara, J. F. Strauss, and W. L. Miller. 1996. The pathophysiology and genetics of congenital lipoid adrenal hyperplasia. The New England journal of medicine 335:1870–8.

Branford, W. W., and H. J. Yost. 2002. Lefty-dependent inhibition of Nodal- and Wnt- responsive organizer gene expression is essential for normal gastrulation. Current biology : CB 12:2136– 41.

Bravo, D. T., Y.-L. Yang, K. Kuchenbecker, M.-S. Hung, Z. Xu, D. M. Jablons, and L. You. 2013. Frizzled-8 receptor is activated by the Wnt-2 ligand in non-small cell lung cancer. BMC cancer 13:316.

Brew, K., and H. Nagase. 2010. The tissue inhibitors of metalloproteinases (TIMPs): an ancient family with structural and functional diversity. Biochimica et biophysica acta 1803:55–71.

Bridges, G. a, M. L. Day, T. W. Geary, and L. H. Cruppe. 2013. Deficiencies in the uterine environment and failure to support embryonic development. Journal of animal science.

Bridges, G. a, M. L. Mussard, C. R. Burke, and M. L. Day. 2010. Influence of the length of proestrus on fertility and endocrine function in female cattle. Animal reproduction science 117:208–15.

Bridges, G. a, M. L. Mussard, J. L. Pate, T. L. Ott, T. R. Hansen, and M. L. Day. 2012. Impact of preovulatory estradiol concentrations on conceptus development and uterine gene expression. Animal reproduction science 133:16–26.

Bridges, G. a, M. L. Mussard, J. Winkler, C. Gasser, D. Grumm, J. L. Pate, and M. L. Day. Influence of duration of proestrus on preovulatory estradiol concentrations and uterine gene expression following induced ovulation in cattle.

Bridgman, P. C., S. Dave, C. F. Asnes, A. N. Tullio, and R. S. Adelstein. 2001. Myosin IIB is required for growth cone motility. The Journal of neuroscience : the official journal of the Society for Neuroscience 21:6159–69.

Bruce, N. W., and R. M. Moor. 1976. Capillary blood flow to ovarian follicles, stroma and corpora lutea of anaesthetized sheep. Journal of reproduction and fertility 46:299–304.

Buhi, W. C., and I. M. Alvarez. 2003. Identification, characterization and localization of three proteins expressed by the porcine oviduct. Theriogenology 60:225–38.

Bush, P. A., N. E. Gonzalez, J. M. Griscavage, and L. J. Ignarro. 1992. Nitric oxide synthase from cerebellum catalyzes the formation of equimolar quantities of nitric oxide and citrulline from L-arginine. Biochemical and biophysical research communications 185:960–6.

Butler, W., A. Ridall, and M. McKee. 1996. Osteopontin. In Principles of Bone Biology. In: p. 167–181.

Cáceres, M., N. Tobar, J. Guerrero, P. C. Smith, and J. Martínez. 2008. c-jun-NH2JNK mediates invasive potential and EGFR activation by regulating the expression of HB-EGF in a urokinase-stimulated pathway. Journal of cellular biochemistry 103:986–93.

Cadigan, K. M., and R. Nusse. 1997. Wnt signaling: a common theme in animal development. Genes & Development 11:3286–3305.

Caffrey, J. L., T. M. Nett, J. H. Abel, and G. D. Niswender. 1979. Activity of 3beta-hydroxy- delta5-steroid dehydrogenase/delta5-delta4-isomerase in the ovine corpus luteum. Biology of reproduction 20:279–87.

Cai, Y., N. Biais, G. Giannone, M. Tanase, G. Jiang, J. M. Hofman, C. H. Wiggins, P. Silberzan, A. Buguin, B. Ladoux, and M. P. Sheetz. 2006. Nonmuscle myosin IIA-dependent force inhibits cell spreading and drives F-actin flow. Biophysical journal 91:3907–20.

Cairo, G., L. Tacchini, G. Pogliaghi, E. Anzon, A. Tomasi, and A. Bernelli-Zazzera. 1995. Induction of ferritin synthesis by oxidative stress. Transcriptional and post-transcriptional regulation by expansion of the “free” iron pool. The Journal of biological chemistry 270:700–3.

Cappello, P., C. Caorsi, M. Bosticardo, S. De Angelis, F. Novelli, G. Forni, and M. Giovarelli. 2004. CCL16/LEC powerfully triggers effector and antigen-presenting functions of macrophages and enhances T cell cytotoxicity. Journal of leukocyte biology 75:135–42.

Carson, D. D., E. Lagow, A. Thathiah, R. Al-Shami, M. C. Farach-Carson, M. Vernon, L. Yuan, M. A. Fritz, and B. Lessey. 2002. Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. Molecular human reproduction 8:871–9.

Cartmill, J. A., S. Z. El-Zarkouny, B. A. Hensley, G. C. Lamb, and J. S. Stevenson. 2001. Stage of cycle, incidence, and timing of ovulation, and pregnancy rates in dairy cattle after three timed breeding protocols. Journal of dairy science 84:1051–9.

Casslén, B., M. Rosengren, and K. Ohlsson. 1981. Localization and quantitation of a low molecular weight proteinase inhibitor, antileukoprotease, in the human uterus. Hoppe-Seyler’s Zeitschrift für physiologische Chemie 362:953–61.

Castellino, F. J., and V. A. Ploplis. 2005. Structure and function of the plasminogen/plasmin system. Thrombosis and haemostasis 93:647–54.

Castiglioni, M. T., M. Scavini, R. Cavallin, F. Pasi, S. Rosa, M. G. Sabbadini, and P. Rovere- Querini. 2009. Elevation of plasma levels of the long pentraxin 3 precedes preeclampsia in pregnant patients with type 1 diabetes. Autoimmunity 42:296–8.

Catron, K. M., N. Iler, and C. Abate. 1993. Nucleotides flanking a conserved TAAT core dictate the DNA binding specificity of three murine homeodomain proteins. Molecular and cellular biology 13:2354–65.

Catron, K. M., H. Zhang, S. C. Marshall, J. A. Inostroza, J. M. Wilson, and C. Abate. 1995. Transcriptional repression by Msx-1 does not require homeodomain DNA-binding sites. Molecular and cellular biology 15:861–71.

Caudroy, S., M. Polette, B. Nawrocki-Raby, J. Cao, B. P. Toole, S. Zucker, and P. Birembaut. 2002. EMMPRIN-mediated MMP regulation in tumor and endothelial cells. Clinical & experimental metastasis 19:697–702.

Cerri, R. L. a, I. M. Thompson, I. H. Kim, a D. Ealy, P. J. Hansen, C. R. Staples, J. L. Li, J. E. P. Santos, and W. W. Thatcher. 2012. Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at day 17 of the estrous cycle or pregnancy. Journal of dairy science 95:5657–75.

Cetin, I., V. Cozzi, A. T. Papageorghiou, V. Maina, A. Montanelli, C. Garlanda, and B. Thilaganathan. 2009. First trimester PTX3 levels in women who subsequently develop preeclampsia and fetal growth restriction. Acta obstetricia et gynecologica Scandinavica 88:846–9.

Cetin, I., V. Cozzi, F. Pasqualini, M. Nebuloni, C. Garlanda, L. Vago, G. Pardi, and A. Mantovani. 2006. Elevated maternal levels of the long pentraxin 3 (PTX3) in preeclampsia and intrauterine growth restriction. American journal of obstetrics and gynecology 194:1347–53.

Chambers, D. M., J. Peters, and C. M. Abbott. 1998. The lethal mutation of the mouse wasted (wst) is a deletion that abolishes expression of a tissue-specific isoform of translation elongation factor 1alpha, encoded by the Eef1a2 gene. Proceedings of the National Academy of Sciences of the United States of America 95:4463–8.

Chang, F., L. S. Steelman, J. T. Lee, J. G. Shelton, P. M. Navolanic, W. L. Blalock, R. A. Franklin, and J. A. McCubrey. 2003. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia 17:1263–93.

Chang, R., and E. Wang. 2007. Mouse translation elongation factor eEF1A-2 interacts with Prdx-I to protect cells against apoptotic death induced by oxidative stress. Journal of cellular biochemistry 100:267–78.

Chao, D. T., and S. J. Korsmeyer. 1998. BCL-2 family: regulators of cell death. Annual review of immunology 16:395–419.

Charles A Janeway, J., P. Travers, M. Walport, and M. J. Shlomchik. 2001. Immunobiology.

Charleston, B., and H. J. Stewart. 1993. An interferon-induced Mx protein: cDNA sequence and high-level expression in the endometrium of pregnant sheep. Gene 137:327–31.

Charpigny, G., P. Reinaud, J. P. Tamby, C. Créminon, J. Martal, J. Maclouf, and M. Guillomot. 1997. Expression of cyclooxygenase-1 and -2 in ovine endometrium during the estrous cycle and early pregnancy. Endocrinology 138:2163–71.

Chavatte-Palmer, P., and M. Guillomot. 2007. Comparative implantation and placentation. Gynecologic and obstetric investigation 64:166–74.

Chedrese, P. J., V. Luu The, F. Labrie, A. V Juorio, and B. D. Murphy. 1990. Evidence for the regulation of 3 beta-hydroxysteroid dehydrogenase messenger RNA by human chorionic gonadotrophin in luteinized porcine granulosa cells. Endocrinology 126:2228–30.

Chen, H. F., J. Y. Shew, H. N. Ho, W. L. Hsu, and Y. S. Yang. 1999. Expression of leukemia inhibitory factor and its receptor in preimplantation embryos. Fertility and sterility 72:713–9.

Chen, L., R. J. Belton, and R. A. Nowak. 2009. Basigin-mediated gene expression changes in mouse uterine stromal cells during implantation. Endocrinology 150:966–76.

Chen, L., M. Nakai, R. J. Belton, and R. A. Nowak. 2007. Expression of extracellular matrix metalloproteinase inducer and matrix metalloproteinases during mouse embryonic development. Reproduction (Cambridge, England) 133:405–14.

Chuang, S.-M., L. Chen, D. Lambertson, M. Anand, T. G. Kinzy, and K. Madura. 2005. Proteasome-mediated degradation of cotranslationally damaged proteins involves translation elongation factor 1A. Molecular and cellular biology 25:403–13.

Clark, B. J., S. C. Soo, K. M. Caron, Y. Ikeda, K. L. Parker, and D. M. Stocco. 1995. Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Molecular endocrinology (Baltimore, Md.) 9:1346–55.

Clark, B. J., and D. M. Stocco. 1997. Steroidogenic acute regulatory protein: the StAR still shines brightly. Molecular and cellular endocrinology 134:1–8.

Clark, B. J., J. Wells, S. R. King, and D. M. Stocco. 1994. The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). The Journal of biological chemistry 269:28314–22.

Clarke, I. J., J. T. Cummins, J. K. Findlay, K. J. Burman, and B. W. Doughton. 1984. Effects on plasma luteinizing hormone and follicle-stimulating hormone of varying the frequency and amplitude of gonadotropin-releasing hormone pulses in ovariectomized ewes with hypothalamo-pituitary disconnection. Neuroendocrinology 39:214–21.

Clarke, I. J., and J. T. Cummins. 1982. The temporal relationship between gonadotropin releasing hormone (GnRH) and luteinizing hormone (LH) secretion in ovariectomized ewes. Endocrinology 111:1737–9.

Clevers, H. 2006. Wnt/beta-catenin signaling in development and disease. Cell 127:469–80.

Cook, J. S., C. I. Pogson, and S. A. Smith. 1980. Indoleamine 2,3-dioxygenase. A new, rapid, sensitive radiometric assay and its application to the study of the enzyme in rat tissues. The Biochemical journal 189:461–6.

Cooke, F. N. T., K. A. Pennington, Q. Yang, and A. D. Ealy. 2009. Several fibroblast growth factors are expressed during pre-attachment bovine conceptus development and regulate interferon- tau expression from trophectoderm. Reproduction (Cambridge, England) 137:259–69.

Couët, J., C. Martel, E. Dupont, V. Luu-The, M. A. Sirard, H. F. Zhao, G. Pelletier, and F. Labrie. 1990. Changes in 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4 isomerase messenger ribonucleic acid, activity and protein levels during the estrous cycle in the bovine ovary. Endocrinology 127:2141–8.

Cox, J. H., R. A. Dean, C. R. Roberts, and C. M. Overall. 2008. Matrix metalloproteinase processing of CXCL11/I-TAC results in loss of chemoattractant activity and altered glycosaminoglycan binding. The Journal of biological chemistry 283:19389–99.

Cozzi, A., B. Corsi, S. Levi, P. Santambrogio, A. Albertini, and P. Arosio. 2000. Overexpression of wild type and mutated human ferritin H-chain in HeLa cells: in vivo role of ferritin ferroxidase activity. The Journal of biological chemistry 275:25122–9.

Cruppe, L. H. THE EFFECT OF PREOVULATORY CONCENTRATION OF ESTRADIOL AND LENGTH OF PROESTRUS ON FERTILITY IN BEEF CATTLE.

Csapo, A. I., and M. Pulkkinen. 1978. Indispensability of the human corpus luteum in the maintenance of early pregnancy. Luteectomy evidence. Obstetrical & gynecological survey 33:69–81.

Curry, T. E., and K. G. Osteen. 2003. The matrix metalloproteinase system: changes, regulation, and impact throughout the ovarian and uterine reproductive cycle. Endocrine reviews 24:428–65.

Curtis, S., and C. Nimz. 2010. Guide for the care and use of agricultural animals in agricultural research and teaching.

D’Arcangelo, G., G. G. Miao, S. C. Chen, H. D. Soares, J. I. Morgan, and T. Curran. 1995. A protein related to extracellular matrix proteins deleted in the mouse mutant reeler. Nature 374:719–23.

D’Cunha, J., S. Ramanujam, R. J. Wagner, P. L. Witt, E. Knight, and E. C. Borden. 1996. In vitro and in vivo secretion of human ISG15, an IFN-induced immunomodulatory cytokine. Journal of immunology (Baltimore, Md. : 1950) 157:4100–8.

Dadarwal, D., R. J. Mapletoft, G. P. Adams, L. F. M. Pfeifer, C. Creelman, and J. Singh. 2013. Effect of progesterone concentration and duration of proestrus on fertility in beef cattle after fixed-time artificial insemination. Theriogenology 79:859–66.

Danø, K., P. A. Andreasen, J. Grøndahl-Hansen, P. Kristensen, L. S. Nielsen, and L. Skriver. 1985. Plasminogen activators, tissue degradation, and cancer. Advances in cancer research 44:139–266.

Darnell, J. E., I. M. Kerr, and G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science (New York, N.Y.) 264:1415–21.

Das, S. K., S. Yano, J. Wang, D. R. Edwards, H. Nagase, and S. K. Dey. 1997. Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in the mouse uterus during the periimplantation period. Developmental genetics 21:44–54.

Davis, J. S., B. R. Rueda, and K. Spanel-Borowski. 2003. Microvascular endothelial cells of the corpus luteum. Reproductive biology and endocrinology : RB&E 1:89.

Deisenhofer, J. 1981. Crystallographic refinement and atomic models of a human Fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2.8-.ANG. resolution. Biochemistry 20:2361–2370.

Denda, S., L. F. Reichardt, and U. Müller. 1998. Identification of osteopontin as a novel ligand for the integrin alpha8 beta1 and potential roles for this integrin-ligand interaction in kidney morphogenesis. Molecular biology of the cell 9:1425–35.

Denhardt, D. T., M. Noda, A. W. O’Regan, D. Pavlin, and J. S. Berman. 2001. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. The Journal of clinical investigation 107:1055–61.

Denison, F. 1999. Secretory leukocyte protease inhibitor concentration increases in amniotic fluid with the onset of labour in women: characterization of sites of release within the uterus. Journal of Endocrinology 161:299–306.

Desai, N., M. Scarrow, J. Lawson, D. Kinzer, and J. Goldfarb. 1999. Evaluation of the effect of interleukin-6 and human extracellullar matrix on embryonic development. Human reproduction (Oxford, England) 14:1588–92.

Dias, C. C., F. S. Wechsler, M. L. Day, and J. L. M. Vasconcelos. 2009. Progesterone concentrations, exogenous equine chorionic gonadotropin, and timing of prostaglandin F(2alpha) treatment affect fertility in postpuberal Nelore heifers. Theriogenology 72:378–85.

Dinchuk, J. E., B. D. Car, R. J. Focht, J. J. Johnston, B. D. Jaffee, M. B. Covington, N. R. Contel, V. M. Eng, R. J. Collins, and P. M. Czerniak. 1995. Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II. Nature 378:406–9.

Diskin, M. G., and D. G. Morris. 2008. Embryonic and early foetal losses in cattle and other ruminants. Reproduction in domestic animals = Zuchthygiene 43 Suppl 2:260–7.

Diskin, M. G., J. J. Murphy, and J. M. Sreenan. 2006. Embryo survival in dairy cows managed under pastoral conditions. Animal reproduction science 96:297–311.

Diskin, M. G., and J. M. Sreenan. 1980. Fertilization and embryonic mortality rates in beef heifers after artificial insemination. Journal of reproduction and fertility 59:463–8.

Dixit, V. D., and N. Parvizi. 2001. Nitric oxide and the control of reproduction. Animal Reproduction Science 65:1–16.

Dominguez, F., S. Martínez, A. Quiñonero, F. Loro, J. A. Horcajadas, A. Pellicer, and C. Simón. 2008. CXCL10 and IL-6 induce chemotaxis in human trophoblast cell lines. Molecular human reproduction 14:423–30.

Dominguez, F., A. Pellicer, and C. Simon. 2003. The chemokine connection: hormonal and embryonic regulation at the human maternal-embryonic interface--a review. Placenta 24 Suppl B:S48– 55.

Doni, A., M. Michela, B. Bottazzi, G. Peri, S. Valentino, N. Polentarutti, C. Garlanda, and A. Mantovani. 2006. Regulation of PTX3, a key component of humoral innate immunity in human dendritic cells: stimulation by IL-10 and inhibition by IFN-gamma. Journal of leukocyte biology 79:797–802.

Doody, K. J., M. C. Lorence, J. I. Mason, and E. R. Simpson. 1990. Expression of messenger ribonucleic acid species encoding steroidogenic enzymes in human follicles and corpora lutea throughout the menstrual cycle. The Journal of clinical endocrinology and metabolism 70:1041–5.

Dorniak, P., F. W. Bazer, and T. E. Spencer. 2011. Prostaglandins regulate conceptus elongation and mediate effects of interferon tau on the ovine uterine endometrium. Biology of reproduction 84:1119–27.

Drost, M., J. D. Ambrose, M. J. Thatcher, C. K. Cantrell, K. E. Wolfsdorf, J. F. Hasler, and W. W. Thatcher. 1999. Conception rates after artificial insemination or embryo transfer in lactating dairy cows during summer in Florida. Theriogenology 52:1161–7.

Dunne, L. ., M. . Diskin, and J. . Sreenan. 2000. Embryo and foetal loss in beef heifers between day 14 of gestation and full term. Animal Reproduction Science 58:39–44.

Dwir, O., G. S. Kansas, and R. Alon. 2001. Cytoplasmic anchorage of L-selectin controls leukocyte capture and rolling by increasing the mechanical stability of the selectin tether. The Journal of cell biology 155:145–56.

Ealy, A. D., S. F. Larson, L. Liu, A. P. Alexenko, G. L. Winkelman, H. M. Kubisch, J. A. Bixby, and R. M. Roberts. 2001. Polymorphic forms of expressed bovine interferon-tau genes: relative transcript abundance during early placental development, promoter sequences of genes and biological activity of protein products. Endocrinology 142:2906–15.

Early, A., and D. Defect. 1979. Anatomy and Embryology An Early Developmental Defect in the Cerebral Cortex of the Reeler Mouse. 216:205–216.

Eckert, J., and H. Niemann. 1998. mRNA expression of leukaemia inhibitory factor (LIF) and its receptor subunits glycoprotein 130 and LIF-receptor-beta in bovine embryos derived in vitro or in vivo. Molecular human reproduction 4:957–65.

Enders, A. C., and S. Schlafke. 1969. Cytological aspects of trophoblast-uterine interaction in early implantation. The American journal of anatomy 125:1–29.

Epsztejn, S., H. Glickstein, V. Picard, I. N. Slotki, W. Breuer, C. Beaumont, and Z. I. Cabantchik. 1999. H-ferritin subunit overexpression in erythroid cells reduces the oxidative stress response and induces multidrug resistance properties. Blood 94:3593–603.

Falconer, D. S. 1951. Two new mutants, “trembler” and “reeler”, with neurological actions in the house mouse (Mus musculus L.). Journal of Genetics 50:192–205.

Ferguson-Smith, A. C., Y. F. Chen, M. S. Newman, L. T. May, P. B. Sehgal, and F. H. Ruddle. 1988. Regional localization of the interferon-beta 2/B-cell stimulatory factor 2/hepatocyte stimulating factor gene to human chromosome 7p15-p21. Genomics 2:203–8.

Ferreira, C., D. Bucchini, M. E. Martin, S. Levi, P. Arosio, B. Grandchamp, and C. Beaumont. 2000. Early embryonic lethality of H ferritin gene deletion in mice. The Journal of biological chemistry 275:3021–4.

Ferreira-Dias, G., A. S. Costa, L. Mateus, A. J. Korzekwa, A. Galvão, D. A. Redmer, K. Lukasik, A. Z. Szóstek, I. Woclawek-Potocka, and D. J. Skarzynski. 2011. Nitric oxide stimulates progesterone and prostaglandin E2 secretion as well as angiogenic activity in the equine corpus luteum. Domestic animal endocrinology 40:1–9.

Fields, M. J., and P. A. Fields. 1996. Morphological characteristics of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 45:1295–325.

Fiorentino, D. F., M. W. Bond, and T. R. Mosmann. 1989. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. The Journal of experimental medicine 170:2081–95.

Flint, A. P., G. E. Lamming, H. J. Stewart, and D. R. Abayasekara. 1994. The role of the endometrial oxytocin receptor in determining the length of the sterile oestrous cycle and ensuring maintenance of luteal function in early pregnancy in ruminants. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 344:291–304.

Flint, A. P., and E. L. Sheldrick. 1983. Evidence for a systemic role for ovarian oxytocin in luteal regression in sheep. Journal of reproduction and fertility 67:215–25.

Forde, N., M. E. Beltman, G. B. Duffy, P. Duffy, J. P. Mehta, P. O’Gaora, J. F. Roche, P. Lonergan, and M. A. Crowe. 2011. Changes in the endometrial transcriptome during the bovine estrous cycle: effect of low circulating progesterone and consequences for conceptus elongation. Biology of reproduction 84:266–78.

Forde, N., F. Carter, T. Fair, M. a Crowe, a C. O. Evans, T. E. Spencer, F. W. Bazer, R. McBride, M. P. Boland, P. O’Gaora, P. Lonergan, and J. F. Roche. 2009. Progesterone-regulated changes in endometrial gene expression contribute to advanced conceptus development in cattle. Biology of reproduction 81:784–94.

Forde, N., G. B. Duffy, P. A. McGettigan, J. A. Browne, J. P. Mehta, A. K. Kelly, N. Mansouri- Attia, O. Sandra, B. J. Loftus, M. A. Crowe, T. Fair, J. F. Roche, P. Lonergan, and A. C. O. Evans. 2012. Evidence for an early endometrial response to pregnancy in cattle: both dependent upon and independent of interferon tau. Physiological genomics 44:799–810.

Forde, N., and P. Lonergan. 2012. Transcriptomic analysis of the bovine endometrium: What is required to establish uterine receptivity to implantation in cattle? The Journal of reproduction and development 58:189–95.

Forde, N., J. P. Mehta, M. Minten, M. A. Crowe, J. F. Roche, T. E. Spencer, and P. Lonergan. 2012. Effects of low progesterone on the endometrial transcriptome in cattle. Biology of reproduction 87:124.

Forde, N., T. E. Spencer, F. W. Bazer, G. Song, J. F. Roche, and P. Lonergan. 2010. Effect of pregnancy and progesterone concentration on expression of genes encoding for transporters or secreted proteins in the bovine endometrium. Physiological genomics 41:53–62.

Franken, C., C. J. Meijer, and J. H. Dijkman. 1989. Tissue distribution of antileukoprotease and lysozyme in humans. Journal of Histochemistry & Cytochemistry 37:493–498.

Frei, R. E., G. A. Schultz, and R. B. Church. 1989. Qualitative and quantitative changes in protein synthesis occur at the 8-16-cell stage of embryogenesis in the cow. Journal of reproduction and fertility 86:637–41.

Fukuda, M. N., and K. Sugihara. 2007. Signal transduction in human embryo implantation. Cell cycle (Georgetown, Tex.) 6:1153–6.

Gabler, C., D. Chapman, and G. Killian. 2003. Expression and presence of osteopontin and integrins in the bovine oviduct during the oestrous cycle. Reproduction 126:721–729.

Gabrysová, L., K. S. Nicolson, H. B. Streeter, J. Verhagen, C. A. Sabatos-Peyton, D. J. Morgan, and D. C. Wraith. 2009. Negative feedback control of the autoimmune response through antigen- induced differentiation of IL-10-secreting Th1 cells. The Journal of experimental medicine 206:1755–67.

Gadsby, J. E., A. K. Balapure, J. H. Britt, and T. A. Fitz. 1990. Prostaglandin F2 alpha receptors on enzyme-dissociated pig luteal cells throughout the estrous cycle. Endocrinology 126:787–95.

Galloway, S. M., K. P. McNatty, L. M. Cambridge, M. P. Laitinen, J. L. Juengel, T. S. Jokiranta, R. J. McLaren, K. Luiro, K. G. Dodds, G. W. Montgomery, A. E. Beattie, G. H. Davis, and O. Ritvos. 2000. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature genetics 25:279–83.

Garcia-Winder, M., P. E. Lewis, D. R. Deaver, V. G. Smith, G. S. Lewis, and E. K. Inskeep. 1986. Endocrine profiles associated with life span of induced corpora lutea in postpartum beef cows. Journal of animal science 62:1353–62.

Garlanda, C., B. Bottazzi, A. Bastone, and A. Mantovani. 2005. Pentraxins at the crossroads between innate immunity, inflammation, matrix deposition, and female fertility. Annual review of immunology 23:337–66.

Garrett, J. E., R. D. Geisert, M. T. Zavy, and G. L. Morgan. 1988. Evidence for maternal regulation of early conceptus growth and development in beef cattle. Journal of reproduction and fertility 84:437–46.

Gearing, D. P., M. R. Comeau, D. J. Friend, S. D. Gimpel, C. J. Thut, J. McGourty, K. K. Brasher, J. A. King, S. Gillis, and B. Mosley. 1992. The IL-6 signal transducer, gp130: an oncostatin M receptor and affinity converter for the LIF receptor. Science (New York, N.Y.) 255:1434–7.

Geary, T. W., E. R. Downing, J. E. Bruemmer, and J. C. Whittier. 2000. Ovarian and Estrous Response of Suckled Beef Cows to the Select Synch Estrous Synchronization Protocol. Professional Animal Scientist 16:1–5.

Geary, T. W., J. C. Whittier, D. M. Hallford, and M. D. MacNeil. 2001. Calf removal improves conception rates to the Ovsynch and CO-Synch protocols. Journal of animal science 79:1–4.

Gharib-Hamrouche, N., N. Chêne, M. Guillomot, and J. Martal. 1993. Localization and characterization of EGF/TGF-alpha receptors on peri-implantation trophoblast in sheep. Journal of reproduction and fertility 98:385–92.

Giachelli, C. M., and S. Steitz. 2000. Osteopontin: a versatile regulator of inflammation and biomineralization. Matrix biology : journal of the International Society for Matrix Biology 19:615–22.

Giblin, P. A., S. T. Hwang, T. R. Katsumoto, and S. D. Rosen. 1997. Ligation of L-selectin on T lymphocytes activates beta1 integrins and promotes adhesion to fibronectin. Journal of immunology (Baltimore, Md. : 1950) 159:3498–507.

Gibson, A., N. Robinson, A. Streit, G. Sheng, and C. D. Stern. 2011. Regulation of programmed cell death during neural induction in the chick embryo. The International journal of developmental biology 55:33–43.

Gifford, C. A., K. Racicot, D. S. Clark, K. J. Austin, T. R. Hansen, M. C. Lucy, C. J. Davies, and T. L. Ott. 2007. Regulation of interferon-stimulated genes in peripheral blood leukocytes in pregnant and bred, nonpregnant dairy cows. Journal of dairy science 90:274–80.

Glinka, A., W. Wu, H. Delius, A. P. Monaghan, C. Blumenstock, and C. Niehrs. 1998. Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391:357–62.

Glinka, A., W. Wu, D. Onichtchouk, C. Blumenstock, and C. Niehrs. 1997. Head induction by simultaneous repression of Bmp and Wnt signalling in Xenopus. Nature 389:517–9.

Gluecksohn-Schoenheimer, S. 1949. The effects of a lethal mutation responsible for duplications and twinning in mouse embryos. Journal of Experimental Zoology 110:47–76.

Gobbetti, A., C. Boiti, C. Canali, and M. Zerani. 1999. Nitric oxide synthase acutely regulates progesterone production by in vitro cultured rabbit corpora lutea. The Journal of endocrinology 160:275–83.

Golomb, E., X. Ma, S. S. Jana, Y. A. Preston, S. Kawamoto, N. G. Shoham, E. Goldin, M. A. Conti, J. R. Sellers, and R. S. Adelstein. 2004. Identification and characterization of nonmuscle myosin II-C, a new member of the myosin II family. The Journal of biological chemistry 279:2800–8.

Gonda, M. A., M. S. Oberste, K. J. Garvey, L. A. Pallansch, J. K. Battles, D. Y. Pifat, J. W. Bess, and K. Nagashima. 1990. Development of the bovine immunodeficiency-like virus as a model of lentivirus disease. Developments in biological standardization 72:97–110.

Gospodarowicz, D., S. Massoglia, J. Cheng, and D. K. Fujii. 1986. Effect of fibroblast growth factor and lipoproteins on the proliferation of endothelial cells derived from bovine adrenal cortex, brain cortex, and corpus luteum capillaries. Journal of cellular physiology 127:121–36.

Grant, J. W., M. B. Taubman, S. L. Church, R. L. Johnson, and B. Nadal-Ginard. 1990. Mammalian nonsarcomeric myosin regulatory light chains are encoded by two differentially regulated and linked genes. The Journal of cell biology 111:1127–35.

Grant, J. W., R. Q. Zhong, P. M. McEwen, and S. L. Church. 1990. Human nonsarcomeric 20,000 Da myosin regulatory light chain cDNA. Nucleic acids research 18:5892.

Gray, C. a, R. C. Burghardt, G. a Johnson, F. W. Bazer, and T. E. Spencer. 2002. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction (Cambridge, England) 124:289–300.

Gray, C. A., C. A. Abbey, P. D. Beremand, Y. Choi, J. L. Farmer, D. L. Adelson, T. L. Thomas, F. W. Bazer, and T. E. Spencer. 2006. Identification of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biology of reproduction 74:383–94.

Grazul-Bilska, A. T., C. Navanukraw, M. L. Johnson, K. A. Vonnahme, S. P. Ford, L. P. Reynolds, and D. A. Redmer. 2007. Vascularity and expression of angiogenic factors in bovine dominant follicles of the first follicular wave. Journal of animal science 85:1914–22.

Grazul-Bilska, A. T., D. A. Redmer, A. Jablonka-Shariff, M. E. Biondini, and L. P. Reynolds. 1995. Proliferation and progesterone production of ovine luteal cells from several stages of the estrous cycle: effects of fibroblast growth factors and luteinizing hormone. Canadian journal of physiology and pharmacology 73:491–500.

Green, J. C., C. S. Okamura, S. E. Poock, and M. C. Lucy. 2010. Measurement of interferon-tau (IFN-tau) stimulated gene expression in blood leukocytes for pregnancy diagnosis within 18-20d after insemination in dairy cattle. Animal reproduction science 121:24–33.

100

Grigoryev, S. A., and C. L. Woodcock. 1998. Chromatin structure in granulocytes. A link between tight compaction and accumulation of a heterochromatin-associated protein (MENT). The Journal of biological chemistry 273:3082–9.

Groebner, A. E., K. Schulke, J. C. Schefold, G. Fusch, F. Sinowatz, H. D. Reichenbach, E. Wolf, H. H. D. Meyer, and S. E. Ulbrich. 2011a. Immunological mechanisms to establish embryo tolerance in early bovine pregnancy. Reproduction, fertility, and development 23:619–32.

Groebner, A. E., K. Schulke, J. C. Schefold, G. Fusch, F. Sinowatz, H. D. Reichenbach, E. Wolf, H. H. D. Meyer, and S. E. Ulbrich. 2011b. Immunological mechanisms to establish embryo tolerance in early bovine pregnancy. Reproduction, fertility, and development 23:619–32.

Gross, S. R., and T. G. Kinzy. 2005. Translation elongation factor 1A is essential for regulation of the actin cytoskeleton and cell morphology. Nature structural & molecular biology 12:772–8.

Gwazdauskas, F. C., J. A. Lineweaver, and M. L. McGilliard. 1983. Environmental and management factors affecting estrous activity in dairy cattle. Journal of dairy science 66:1510–4.

Haas, A., P. Ahrens, P. Bright, and H. Ankel. 1987. Interferon induces a 15-kilodalton protein exhibiting marked homology to ubiquitin. J. Biol. Chem. 262:11315–11323.

Hafez, E., and B. Hafez. Reproduction in farm animals.

Hägglund, A. C., A. Ny, G. Leonardsson, and T. Ny. 1999. Regulation and localization of matrix metalloproteinases and tissue inhibitors of metalloproteinases in the mouse ovary during gonadotropin- induced ovulation. Endocrinology 140:4351–8.

Haller, O., and G. Kochs. 2002. Interferon-induced mx proteins: dynamin-like GTPases with antiviral activity. Traffic (Copenhagen, Denmark) 3:710–7.

Hamatani, T., M. G. Carter, A. A. Sharov, and M. S. H. Ko. 2004. Dynamics of global gene expression changes during mouse preimplantation development. Developmental cell 6:117–31.

Hamerman, J. A., F. Hayashi, L. A. Schroeder, S. P. Gygi, A. L. Haas, L. Hampson, P. Coughlin, R. Aebersold, and A. Aderem. 2002. Serpin 2a is induced in activated macrophages and conjugates to a ubiquitin homolog. Journal of immunology (Baltimore, Md. : 1950) 168:2415–23.

Hanna, N., L. Bonifacio, B. Weinberger, P. Reddy, S. Murphy, R. Romero, and S. Sharma. 2006. Evidence for interleukin-10-mediated inhibition of cyclooxygenase-2 expression and prostaglandin production in preterm human placenta. American journal of reproductive immunology (New York, N.Y. : 1989) 55:19–27.

Hansen, P. J., and G. R. Newton. 1988. Binding of immunoglobulins to the major progesterone- induced proteins secreted by the sheep uterus. Archives of biochemistry and biophysics 260:208–17.

Hansen, T. R., K. J. Austin, and G. A. Johnson. 1997. Transient ubiquitin cross-reactive protein gene expression in the bovine endometrium. Endocrinology 138:5079–82.

101

Hansen, T. R., K. J. Austin, D. J. Perry, J. K. Pru, M. G. Teixeira, and G. A. Johnson. 1999. Mechanism of action of interferon-tau in the uterus during early pregnancy. Journal of reproduction and fertility. Supplement 54:329–39.

Harper, M. J., D. Dowd, and A. S. Elliott. 1969. Implantation and embryonic development in the ovariectomized-adrenalectomized hamster. Biology of reproduction 1:253–7.

Harrison, H., and P. C. Adams. 2002. Hemochromatosis. Common genes, uncommon illness? Canadian family physician Médecin de famille canadien 48:1326–33.

Harrison, P. M., P. D. Hempstead, P. J. Artymiuk, and S. C. Andrews. 1998. Structure-function relationships in the ferritins. Metal ions in biological systems 35:435–77.

Hartung, S., W. Rust, M. Balvers, and R. Ivell. 1995. Molecular cloning and in vivo expression of the bovine steroidogenic acute regulatory protein. Biochemical and biophysical research communications 215:646–53.

Hashimoto, H., M. Itoh, Y. Yamanaka, S. Yamashita, T. Shimizu, L. Solnica-Krezel, M. Hibi, and T. Hirano. 2000. Zebrafish Dkk1 functions in forebrain specification and axial mesendoderm formation. Developmental biology 217:138–52.

Hawk, H. W., and B. S. Cooper. 1975. Improvement of sperm transport by the administration of estradiol to estrous ewes. Journal of animal science 41:1400–6.

Hayashi, K., R. C. Burghardt, F. W. Bazer, and T. E. Spencer. 2007. WNTs in the ovine uterus: potential regulation of periimplantation ovine conceptus development. Endocrinology 148:3496–506.

He, X., M. Semenov, K. Tamai, and X. Zeng. 2004. LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development (Cambridge, England) 131:1663–77.

Heap, R. B., and R. Deanesly. 1967. The increase in plasma progesterone levels in the pregnant guinea-pig and its possible significance. Journal of reproduction and fertility 14:339–41.

Heap, R. B., A. P. Flint, P. E. Hartmann, J. E. Gadsby, L. D. Staples, N. Ackland, and M. Hamon. 1981. Oestrogen production in early pregnancy. The Journal of endocrinology 89 Suppl:77P–94P.

Herath, S., E. J. Williams, S. T. Lilly, R. O. Gilbert, H. Dobson, C. E. Bryant, and I. M. Sheldon. 2007. Ovarian follicular cells have innate immune capabilities that modulate their endocrine function. Reproduction (Cambridge, England) 134:683–93.

Hernandez-Ledezma, J. J., N. Mathialagan, C. Villanueva, J. D. Sikes, and R. M. Roberts. 1993. Expression of bovine trophoblast interferons by in vitro-derived blastocysts is correlated with their morphological quality and stage of development. Molecular reproduction and development 36:1–6.

Herr, W., R. A. Sturm, R. G. Clerc, L. M. Corcoran, D. Baltimore, P. A. Sharp, H. A. Ingraham, M. G. Rosenfeld, M. Finney, and G. Ruvkun. 1988. The POU domain: a large conserved region in the

102 mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans unc-86 gene products. Genes & development 2:1513–6.

Herrler, A., U. von Rango, and H. M. Beier. 2003a. Embryo-maternal signalling: how the embryo starts talking to its mother to accomplish implantation. Reproductive BioMedicine Online 6:244–256.

Herrler, A., U. von Rango, and H. M. Beier. 2003b. Embryo-maternal signalling: how the embryo starts talking to its mother to accomplish implantation. Reproductive BioMedicine Online 6:244–256.

Herschman, H. R. 1996. Prostaglandin synthase 2. Biochimica et biophysica acta 1299:125–40.

Heyborne, K. D., R. L. Cranfill, S. R. Carding, W. K. Born, and R. L. O’Brien. 1992. Characterization of gamma delta T lymphocytes at the maternal-fetal interface. Journal of immunology (Baltimore, Md. : 1950) 149:2872–8.

Hicks, B. A., S. J. Etter, K. G. Carnahan, M. M. Joyce, A. A. Assiri, S. J. Carling, K. Kodali, G. A. Johnson, T. R. Hansen, M. A. Mirando, G. L. Woods, D. K. Vanderwall, and T. L. Ott. 2003. Expression of the uterine Mx protein in cyclic and pregnant cows, gilts, and mares. Journal of animal science 81:1552– 61.

Hiemstra, P., R. Maassen, J. Stolk, R. Heinzel-Wieland, G. Steffens, and J. Dijkman. 1996. Antibacterial activity of antileukoprotease. Infect. Immun. 64:4520–4524.

Hill, R. E., P. F. Jones, A. R. Rees, C. M. Sime, M. J. Justice, N. G. Copeland, N. A. Jenkins, E. Graham, and D. R. Davidson. 1989. A new family of mouse homeo box-containing genes: molecular structure, chromosomal location, and developmental expression of Hox-7.1. Genes & development 3:26–37.

Hilton, D. J. 1992. LIF: lots of interesting functions. Trends in biochemical sciences 17:72–6.

Hirano, T., T. Matsuda, and K. Nakajima. 1994. Signal transduction through gp130 that is shared among the receptors for the interleukin 6 related cytokine subfamily. Stem cells (Dayton, Ohio) 12:262–77.

Hirata, F., and O. Hayaishi. 1972. New degradative routes of 5-hydroxytryptophan and serotonin by intestinal tryptophan 2,3-dioxygenase. Biochemical and biophysical research communications 47:1112–9.

Hoey, T., and M. Levine. 1988. Divergent homeo box proteins recognize similar DNA sequences in Drosophila. Nature 332:858–61.

Hommeida, A., T. Nakao, and H. Kubota. 2004. Luteal function and conception in lactating cows and some factors influencing luteal function after first insemination. Theriogenology 62:217–25.

103

Hong, S. E., Y. Y. Shugart, D. T. Huang, S. A. Shahwan, P. E. Grant, J. O. Hourihane, N. D. Martin, and C. A. Walsh. 2000. Autosomal recessive lissencephaly with cerebellar hypoplasia is associated with human RELN mutations. Nature genetics 26:93–6.

Horisberger, M. A., P. Staeheli, and O. Haller. 1983. Interferon induces a unique protein in mouse cells bearing a gene for resistance to influenza virus. Proceedings of the National Academy of Sciences of the United States of America 80:1910–4.

Hu, D. D., E. C. Lin, N. L. Kovach, J. R. Hoyer, and J. W. Smith. 1995. A biochemical characterization of the binding of osteopontin to integrins alpha v beta 1 and alpha v beta 5. The Journal of biological chemistry 270:26232–8.

Humblot, P. 2001. Use of pregnancy specific proteins and progesterone assays to monitor pregnancy and determine the timing, frequencies and sources of embryonic mortality in ruminants. Theriogenology 56:1417–33.

Huo, L.-J., C.-G. Liang, L.-Z. Yu, Z.-S. Zhong, Z.-M. Yang, H.-Y. Fan, D.-Y. Chen, and Q.-Y. Sun. 2005. Inducible nitric oxide synthase-derived nitric oxide regulates germinal vesicle breakdown and first polar body emission in the mouse oocyte. Reproduction (Cambridge, England) 129:403–9.

Hurwitz, a, Z. Finci-Yeheskel, a Milwidsky, S. Yagel, E. Y. Adashi, N. Laufer, and M. Mayer. 1997. In-vitro modulation of plasminogen activator activity, prostaglandin E and nitric oxide production by interleukin-1 in pregnant mare serum gonadotrophin-primed theca-interstitial cells. Human reproduction (Oxford, England) 12:774–9.

Hwang, S. T. 1996. GlyCAM-1, a physiologic ligand for L-selectin, activates beta 2 integrins on naive peripheral lymphocytes. Journal of Experimental Medicine 184:1343–1348.

Iannello, A., and A. Ahmad. 2005. Role of antibody-dependent cell-mediated cytotoxicity in the efficacy of therapeutic anti-cancer monoclonal antibodies. Cancer metastasis reviews 24:487–99.

Ikeda, Y., and T. Terashima. 1997. Expression of reelin, the gene responsible for the reeler mutation, in embryonic development and adulthood in the mouse. Developmental dynamics : an official publication of the American Association of Anatomists 210:157–72.

Imai, H., and Y. Nakagawa. 2003. Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells. Free radical biology & medicine 34:145–69.

Imakawa, K., M. Imai, A. Sakai, M. Suzuki, K. Nagaoka, S. Sakai, S.-R. Lee, K.-T. Chang, S. E. Echternkamp, and R. K. Christenson. 2006. Regulation of conceptus adhesion by endometrial CXC chemokines during the implantation period in sheep. Molecular reproduction and development 73:850– 8.

Imakawa, K., K. Nagaoka, H. Nojima, Y. Hara, and R. K. Christenson. 2005. Changes in immune cell distribution and IL-10 production are regulated through endometrial IP-10 expression in the goat uterus. American journal of reproductive immunology (New York, N.Y. : 1989) 53:54–64.

104

Ing, N. H., H. Francis, J. J. McDonnell, J. F. Amann, and R. M. Roberts. 1989. Progesterone induction of the uterine milk proteins: major secretory proteins of sheep endometrium. Biology of reproduction 41:643–54.

Ing, N. H., and T. L. Ott. 1999. Estradiol up-regulates estrogen receptor-alpha messenger ribonucleic acid in sheep endometrium by increasing its stability. Biology of reproduction 60:134–9.

Ing, N. H., T. E. Spencer, and F. W. Bazer. 1996. Estrogen enhances endometrial estrogen receptor gene expression by a posttranscriptional mechanism in the ovariectomized ewe. Biology of reproduction 54:591–9.

Ing, N. H., and M. B. Tornesi. 1997. Estradiol up-regulates estrogen receptor and progesterone receptor gene expression in specific ovine uterine cells. Biology of reproduction 56:1205–15.

Ing, N. H., and Y. Zhang. 2004. Cell-specific expression of estrogen-responsive genes in the uteri of cyclic, early pregnant and ovariectomized ewes. Theriogenology 62:403–14.

Inohara, H., S. Akahani, K. Koths, and A. Raz. 1996. Interactions between galectin-3 and Mac-2- binding protein mediate cell-cell adhesion. Cancer research 56:4530–4.

Inskeep, E. K. 2004. Preovulatory, postovulatory, and postmaternal recognition effects of concentrations of progesterone on embryonic survival in the cow. J Anim Sci 82:E24–39.

Ireland, J. J., and J. F. Roche. 1982. Development of antral follicles in cattle after prostaglandin- induced luteolysis: changes in serum hormones, steroids in follicular fluid, and gonadotropin receptors. Endocrinology 111:2077–86.

Irving, J. A., R. N. Pike, A. M. Lesk, and J. C. Whisstock. 2000. Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function. Genome research 10:1845–64.

Irving, J. A., S. S. Shushanov, R. N. Pike, E. Y. Popova, D. Brömme, T. H. T. Coetzer, S. P. Bottomley, I. A. Boulynko, S. A. Grigoryev, and J. C. Whisstock. 2002. Inhibitory activity of a heterochromatin-associated serpin (MENT) against papain-like cysteine proteinases affects chromatin structure and blocks cell proliferation. The Journal of biological chemistry 277:13192–201.

Ishiwata, H., S. Katsuma, K. Kizaki, O. V Patel, H. Nakano, T. Takahashi, K. Imai, A. Hirasawa, S. Shiojima, H. Ikawa, Y. Suzuki, G. Tsujimoto, Y. Izaike, J. Todoroki, and K. Hashizume. 2003. Characterization of gene expression profiles in early bovine pregnancy using a custom cDNA microarray. Molecular reproduction and development 65:9–18.

Ivanov, A. I., M. Bachar, B. A. Babbin, R. S. Adelstein, A. Nusrat, and C. A. Parkos. 2007. A unique role for nonmuscle myosin heavy chain IIA in regulation of epithelial apical junctions. PloS one 2:e658.

Ivell, R., K. H. Brackett, M. J. Fields, and D. Richter. 1985. Ovulation triggers oxytocin gene expression in the bovine ovary. FEBS Letters 190:263–267.

105

Ivell, R., N. Hunt, N. Abend, B. Brackman, D. Nollmeyer, J. C. Lamsa, and J. A. McCracken. 1990. Structure and ovarian expression of the oxytocin gene in sheep. Reproduction, fertility, and development 2:703–11.

Jaroszewski, J. J., D. J. Skarzynski, and W. Hansel. 2003. Nitric oxide as a local mediator of prostaglandin F2alpha-induced regression in bovine corpus luteum: an in vivo study. Experimental biology and medicine (Maywood, N.J.) 228:1057–62.

Jenner, L. J., T. J. Parkinson, and G. E. Lamming. 1991. Uterine oxytocin receptors in cyclic and pregnant cows. Journal of reproduction and fertility 91:49–58.

Jho, E., T. Zhang, C. Domon, C.-K. Joo, J.-N. Freund, and F. Costantini. 2002. Wnt/beta- catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Molecular and cellular biology 22:1172–83.

Ji, Q. S., S. Ermini, J. Baulida, F. L. Sun, and G. Carpenter. 1998. Epidermal growth factor signaling and mitogenesis in Plcg1 null mouse embryonic fibroblasts. Molecular biology of the cell 9:749–57.

Jin, F. Y., C. Nathan, D. Radzioch, and A. Ding. 1997. Secretory leukocyte protease inhibitor: a macrophage product induced by and antagonistic to bacterial lipopolysaccharide. Cell 88:417–26.

Jinks, E. M., M. F. Smith, J. A. Atkins, K. G. Pohler, G. A. Perry, M. D. Macneil, A. J. Roberts, R. C. Waterman, L. J. Alexander, and T. W. Geary. 2013. Preovulatory estradiol and the establishment and maintenance of pregnancy in suckled beef cows. Journal of animal science 91:1176–85.

Jo, M., and T. E. Curry. 2004. Regulation of matrix metalloproteinase-19 messenger RNA expression in the rat ovary. Biology of reproduction 71:1796–806.

Johnson, G. A., K. J. Austin, A. M. Collins, W. J. Murdoch, and T. R. Hansen. 1999. Endometrial ISG17 mRNA and a related mRNA are induced by interferon-tau and localized to glandular epithelial and stromal cells from pregnant cows. Endocrine 10:243–52.

Johnson, G. A., K. J. Austin, E. A. Van Kirk, and T. R. Hansen. 1998. Pregnancy and interferon- tau induce conjugation of bovine ubiquitin cross-reactive protein to cytosolic uterine proteins. Biology of reproduction 58:898–904.

Johnson, G. A., F. W. Bazer, L. A. Jaeger, H. Ka, J. E. Garlow, C. Pfarrer, T. E. Spencer, and R. C. Burghardt. 2001. Muc-1, integrin, and osteopontin expression during the implantation cascade in sheep. Biology of reproduction 65:820–8.

Johnson, G. A., T. E. Spencer, R. C. Burghardt, M. M. Joyce, and F. W. Bazer. 2000. Interferon- tau and progesterone regulate ubiquitin cross-reactive protein expression in the ovine uterus. Biology of reproduction 62:622–7.

106

Jones, D. S., and A. P. Flint. 1988. Concentrations of oxytocin-neurophysin prohormone mRNA in corpora lutea of sheep during the oestrous cycle and in early pregnancy. The Journal of endocrinology 117:409–14.

Juengel, J. L., H. A. Garverick, A. L. Johnson, R. S. Youngquist, and M. F. Smith. 1993. Apoptosis during luteal regression in cattle. Endocrinology 132:249–54.

Juengel, J. L., B. M. Meberg, A. M. Turzillo, T. M. Nett, and G. D. Niswender. 1995. Hormonal regulation of messenger ribonucleic acid encoding steroidogenic acute regulatory protein in ovine corpora lutea. Endocrinology 136:5423–9.

Kahns, S., A. Lund, P. Kristensen, C. R. Knudsen, B. F. Clark, J. Cavallius, and W. C. Merrick. 1998. The elongation factor 1 A-2 isoform from rabbit: cloning of the cDNA and characterization of the protein. Nucleic acids research 26:1884–90.

Kao, L. C., S. Tulac, S. Lobo, B. Imani, J. P. Yang, A. Germeyer, K. Osteen, R. N. Taylor, B. A. Lessey, and L. C. Giudice. 2002. Global gene profiling in human endometrium during the window of implantation. Endocrinology 143:2119–38.

Katagiri, Y. U., J. Sleeman, H. Fujii, P. Herrlich, H. Hotta, K. Tanaka, S. Chikuma, H. Yagita, K. Okumura, M. Murakami, I. Saiki, A. F. Chambers, and T. Uede. 1999. CD44 variants but not CD44s cooperate with beta1-containing integrins to permit cells to bind to osteopontin independently of arginine-glycine-aspartic acid, thereby stimulating cell motility and chemotaxis. Cancer research 59:219– 26.

Kayes-Wandover, K. M., and P. C. White. 2000. Steroidogenic enzyme gene expression in the human heart. The Journal of clinical endocrinology and metabolism 85:2519–25.

Kenyon, A. G., L. G. D. Mendonça, G. Lopes, J. R. Lima, J. E. P. Santos, and R. C. Chebel. 2013. Minimal progesterone concentration required for embryo survival after embryo transfer in lactating Holstein cows. Animal reproduction science 136:223–30.

Kerbler, T. L., M. M. Buhr, L. T. Jordan, K. E. Leslie, and J. S. Walton. 1997. Relationship between maternal plasma progesterone concentration and interferon-tau synthesis by the conceptus in cattle. Theriogenology 47:703–14.

Kerscher, O., R. Felberbaum, and M. Hochstrasser. 2006. Modification of proteins by ubiquitin and ubiquitin-like proteins. Annual review of cell and developmental biology 22:159–80.

Kesner, J. S., E. M. Convey, and C. R. Anderson. 1981. Evidence that estradiol induces the preovulatory LH surge in cattle by increasing pituitary sensitivity to LHRH and then increasing LHRH release. Endocrinology 108:1386–91.

Khalyfa, A., D. Bourbeau, E. Chen, E. Petroulakis, J. Pan, S. Xu, and E. Wang. 2001. Characterization of elongation factor-1A (eEF1A-1) and eEF1A-2/S1 protein expression in normal and wasted mice. The Journal of biological chemistry 276:22915–22.

107

Kieborz-Loos, K. R., H. A. Garverick, D. H. Keisler, S. A. Hamilton, B. E. Salfen, R. S. Youngquist, and M. F. Smith. 2003. Oxytocin-induced secretion of prostaglandin F2alpha in postpartum beef cows: effects of progesterone and estradiol-17beta treatment. Journal of animal science 81:1830–6.

Kim, I. S., S.-W. Jang, H. J. Sung, J.-S. Lee, and J. Ko. 2005. Differential CCR1-mediated chemotaxis signaling induced by human CC chemokine HCC-4/CCL16 in HOS cells. FEBS letters 579:6044–8.

Kim, M., H. C. Lee, O. Tsedensodnom, R. Hartley, Y.-S. Lim, E. Yu, P. Merle, and J. R. Wands. 2008. Functional interaction between Wnt3 and Frizzled-7 leads to activation of the Wnt/beta-catenin signaling pathway in hepatocellular carcinoma cells. Journal of hepatology 48:780–91.

Kimmins, S., H. C. Lim, and L. A. MacLaren. 2004. Immunohistochemical localization of integrin alpha V beta 3 and osteopontin suggests that they do not interact during embryo implantation in ruminants. Reproductive biology and endocrinology : RB&E 2:19.

Kimmins, S., and L. A. MacLaren. 2001. Oestrous cycle and pregnancy effects on the distribution of oestrogen and progesterone receptors in bovine endometrium. Placenta 22:742–8.

Kinder, J. E., F. N. Kojima, E. G. Bergfeld, M. E. Wehrman, and K. E. Fike. 1996. Progestin and estrogen regulation of pulsatile LH release and development of persistent ovarian follicles in cattle. Journal of animal science 74:1424–40.

King, A. E., H. O. D. Critchley, and R. W. Kelly. 2003. Innate immune defences in the human endometrium. Reproductive biology and endocrinology : RB&E 1:116.

King, A. E., H. O. Critchley, and R. W. Kelly. 2000. Presence of secretory leukocyte protease inhibitor in human endometrium and first trimester decidua suggests an antibacterial protective role. Molecular human reproduction 6:191–6.

King, R. S., and G. J. Killian. 1994. Purification of bovine estrus-associated protein and localization of binding on sperm. Biology of reproduction 51:34–42.

Klein, C., S. Bauersachs, S. E. Ulbrich, R. Einspanier, H. H. D. Meyer, S. E. M. Schmidt, H.-D. Reichenbach, M. Vermehren, F. Sinowatz, H. Blum, and E. Wolf. 2006. Monozygotic twin model reveals novel embryo-induced transcriptome changes of bovine endometrium in the preattachment period. Biology of reproduction 74:253–64.

Klein, D., A. Demory, F. Peyre, J. Kroll, H. G. Augustin, W. Helfrich, J. Kzhyshkowska, K. Schledzewski, B. Arnold, and S. Goerdt. 2008. Wnt2 acts as a cell type-specific, autocrine growth factor in rat hepatic sinusoidal endothelial cells cross-stimulating the VEGF pathway. Hepatology (Baltimore, Md.) 47:1018–31.

Kobayashi, S., a Miyamoto, B. Berisha, and D. Schams. 2001. Growth hormone, but not luteinizing hormone, acts with luteal peptides on prostaglandin F2alpha and progesterone secretion by bovine corpora lutea in vitro. Prostaglandins & other lipid mediators 63:79–92.

108

Kojima, K., H. Kanzaki, M. Iwai, H. Hatayama, M. Fujimoto, S. Narukawa, T. Higuchi, Y. Kaneko, T. Mori, and J. Fujita. 1995. Expression of leukaemia inhibitory factor (LIF) receptor in human placenta: a possible role for LIF in the growth and differentiation of trophoblasts. Human reproduction (Oxford, England) 10:1907–11.

Kolega, J. 1998. Cytoplasmic dynamics of myosin IIA and IIB: spatial “sorting” of isoforms in locomoting cells. Journal of cell science 111 ( Pt 1:2085–95.

Kristensen, P., A. Lund, B. F. Clark, J. Cavallius, and W. C. Merrick. 1998. Purification and characterisation of a tissue specific elongation factor 1 alpha (EF-1 alpha 2) from rabbit muscle. Biochemical and biophysical research communications 245:810–4.

Kruip, T. A., and S. J. Dieleman. 1985. Steroid hormone concentrations in the fluid of bovine follicles relative to size, quality and stage of the oestrus cycle. Theriogenology 24:395–408.

Kues, W. A., S. Sudheer, D. Herrmann, J. W. Carnwath, V. Havlicek, U. Besenfelder, H. Lehrach, J. Adjaye, and H. Niemann. 2008. Genome-wide expression profiling reveals distinct clusters of transcriptional regulation during bovine preimplantation development in vivo. Proceedings of the National Academy of Sciences of the United States of America 105:19768–73.

Kuno, N., K. Kadomatsu, Q. W. Fan, M. Hagihara, T. Senda, S. Mizutani, and T. Muramatsu. 1998. Female sterility in mice lacking the basigin gene, which encodes a transmembrane glycoprotein belonging to the immunoglobulin superfamily. FEBS letters 425:191–4.

Kwak-Kim, J. Y. H., A. Gilman-Sachs, and C. E. Kim. 2005. T helper 1 and 2 immune responses in relationship to pregnancy, nonpregnancy, recurrent spontaneous abortions and infertility of repeated implantation failures. Chemical immunology and allergy 88:64–79.

Kwun, J. K., and C. W. Emmens. 1974. Hormonal requirements for implantation and pregnancy in the ovariectomized rabbit. Australian journal of biological sciences 27:275–83.

Lai, T.-H., I.-M. Shih, N. Vlahos, C.-L. Ho, E. Wallach, and Y. Zhao. 2005. Differential expression of L-selectin ligand in the endometrium during the menstrual cycle. Fertility and sterility 83 Suppl 1:1297–302.

Lamb, G., J. S. Stevenson, D. J. Kesler, H. A. Garverick, D. R. Brown, and B. E. Salfen. 2001. Inclusion of an intravaginal progesterone insert plus GnRH and prostaglandin F2alpha for ovulation control in postpartum suckled beef cows. Journal of animal science 79:2253–9.

Lammi, L., S. Arte, M. Somer, H. Jarvinen, P. Lahermo, I. Thesleff, S. Pirinen, and P. Nieminen. 2004. Mutations in AXIN2 cause familial tooth agenesis and predispose to colorectal cancer. American journal of human genetics 74:1043–50.

Langenbach, R., S. G. Morham, H. F. Tiano, C. D. Loftin, B. I. Ghanayem, P. C. Chulada, J. F. Mahler, C. A. Lee, E. H. Goulding, K. D. Kluckman, H. S. Kim, and O. Smithies. 1995. Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin- induced gastric ulceration. Cell 83:483–92.

109

Larue, L., M. Ohsugi, J. Hirchenhain, and R. Kemler. 1994. E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proceedings of the National Academy of Sciences of the United States of America 91:8263–7.

Lasky, L. A., M. S. Singer, D. Dowbenko, Y. Imai, W. J. Henzel, C. Grimley, C. Fennie, N. Gillett, S. R. Watson, and S. D. Rosen. 1992. An endothelial ligand for L-selectin is a novel mucin-like molecule. Cell 69:927–38.

Lassoued, K., H. Illges, K. Benlagha, and M. D. Cooper. 1996. Fate of surrogate light chains in B lineage cells. The Journal of experimental medicine 183:421–9.

Latham, K. E., J. I. Garrels, C. Chang, and D. Solter. 1991. Quantitative analysis of protein synthesis in mouse embryos. I. Extensive reprogramming at the one- and two-cell stages. Development (Cambridge, England) 112:921–32.

LaVoie, H. A., A. M. Benoit, J. C. Garmey, R. A. Dailey, D. J. Wright, and J. D. Veldhuis. 1997. Coordinate developmental expression of genes regulating sterol economy and cholesterol side-chain cleavage in the porcine ovary. Biology of reproduction 57:402–7.

Lawrence, M. B., and T. A. Springer. 1991. Leukocytes roll on a selectin at physiologic flow rates: Distinction from and prerequisite for adhesion through integrins. Cell 65:859–873.

Lawson, R. A., R. A. Parr, and L. P. Cahill. 1983. Evidence for maternal control of blastocyst growth after asynchronous transfer of embryos to the uterus of the ewe. Journal of reproduction and fertility 67:477–83.

Leal, A., S. Endele, C. Stengel, K. Huehne, J. Loetterle, R. Barrantes, A. Winterpacht, and B. Rautenstrauss. 2003. A novel myosin heavy chain gene in human chromosome 19q13.3. Gene 312:165– 71.

Ledgard, A. M., R. S.-F. Lee, and A. J. Peterson. 2009. Bovine endometrial legumain and TIMP-2 regulation in response to presence of a conceptus. Molecular reproduction and development 76:65–74.

LEE, C. S., E. MEEUSEN, K. GOGOLIN-EWENS, and M. R. BRANDON. 1992. Quantitative and Qualitative Changes in the Intraepithelial Lymphocyte Population in the Uterus of Nonpregnant and Pregnant Sheep. American Journal of Reproductive Immunology 28:90–96.

Lee, S., L. A. Wolfraim, and E. Wang. 1993. Differential expression of S1 and elongation factor-1 alpha during rat development. The Journal of biological chemistry 268:24453–9.

Lei, T., Z. Q. Yang, T. Xia, L. Gan, X. D. Chen, J. H. Yuan, and Y. Zhu. 2004. Stage-specific expression of leukaemia inhibitory factor and its receptor in rabbit pre-implantation embryo and uterine epithelium during early pregnancy. Reproduction in domestic animals = Zuchthygiene 39:13–8.

Lei, Z. M., N. Chegini, and C. V Rao. 1991. Quantitative cell composition of human and bovine corpora lutea from various reproductive states. Biology of reproduction 44:1148–56.

110

Leung, S. T., K. Derecka, G. E. Mann, a P. Flint, and D. C. Wathes. 2000. Uterine lymphocyte distribution and interleukin expression during early pregnancy in cows. Journal of reproduction and fertility 119:25–33.

Levashina, E. A. 1999. Constitutive Activation of Toll-Mediated Antifungal Defense in Serpin- Deficient Drosophila. Science 285:1917–1919.

Levi, S., A. Luzzago, F. Franceschinelli, P. Santambrogio, G. Cesareni, and P. Arosio. 1989. Mutational analysis of the channel and loop sequences of human ferritin H-chain. The Biochemical journal 264:381–8.

Levi, S., J. Salfeld, F. Franceschinelli, A. Cozzi, M. H. Dorner, and P. Arosio. 1989. Expression and structural and functional properties of human ferritin L-chain from Escherichia coli. Biochemistry 28:5179–5184.

Levine, M., and T. Hoey. 1988. Homeobox proteins as sequence-specific transcription factors. Cell 55:537–40.

Lewis, J. L., J. Bonner, M. Modrell, J. W. Ragland, R. T. Moon, R. I. Dorsky, and D. W. Raible. 2004. Reiterated Wnt signaling during zebrafish neural crest development. Development (Cambridge, England) 131:1299–308.

Li, B., W. Xu, L. Xu, Z. Jiang, Z. Wen, K. Li, and S. Xiong. 2010. I-TAC is a dominant chemokine in controlling skin intragraft inflammation via recruiting CXCR3+ cells into the graft. Cellular immunology 260:83–91.

Liaw, L., V. Lindner, S. M. Schwartz, A. F. Chambers, and C. M. Giachelli. 1995. Osteopontin and beta 3 integrin are coordinately expressed in regenerating endothelium in vivo and stimulate Arg-Gly- Asp-dependent endothelial migration in vitro. Circulation research 77:665–72.

Liebermann, J., D. Schams, and A. Miyamoto. 1996. Effects of local growth factors on the secretory function of bovine corpus luteum during the oestrous cycle and pregnancy in vitro. Reproduction, fertility, and development 8:1003–11.

Ligoxygakis, P., S. Roth, and J.-M. Reichhart. 2003. A serpin regulates dorsal-ventral axis formation in the Drosophila embryo. Current biology : CB 13:2097–102.

Lim, H., R. A. Gupta, W. G. Ma, B. C. Paria, D. E. Moller, J. D. Morrow, R. N. DuBois, J. M. Trzaskos, and S. K. Dey. 1999. Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta. Genes & development 13:1561–74.

Lim, H., B. C. Paria, S. K. Das, J. E. Dinchuk, R. Langenbach, J. M. Trzaskos, and S. K. Dey. 1997. Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91:197–208.

Lin, K. W., and S. Souchelnytskyi. 2010. Eukaryotic elongation factor eEF1A1 promotes and Ser300 mutants of eEF1A1 inhibit transition through the S and G2 / M phases of the cell cycle. 8:125– 130.

111

Lin, K. W., I. Yakymovych, M. Jia, M. Yakymovych, and S. Souchelnytskyi. 2010. Phosphorylation of eEF1A1 at Ser300 by TβR-I results in inhibition of mRNA translation. Current biology : CB 20:1615–25.

Liszewska, E., R. Rekawiecki, and J. Kotwica. 2005. Effect of progesterone on the expression of bax and bcl-2 and on caspase activity in bovine luteal cells. Prostaglandins & other lipid mediators 78:67–81.

Liu, C., R. Chang, X. Yao, W. T. Qiao, and Y. Q. Geng. 2009. ISG15 expression in response to double-stranded RNA or LPS in cultured Fetal bovine lung (FBL) cells. Veterinary research communications 33:723–33.

Liu, G., J. Tang, B. T. Edmonds, J. Murray, S. Levin, and J. Condeelis. 1996. F-actin sequesters elongation factor 1alpha from interaction with aminoacyl-tRNA in a pH-dependent reaction. The Journal of cell biology 135:953–63.

Liu, P., M. Wakamiya, M. J. Shea, U. Albrecht, R. R. Behringer, and A. Bradley. 1999. Requirement for Wnt3 in vertebrate axis formation. Nature genetics 22:361–5.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) 25:402–8.

Llewellyn, S., R. Fitzpatrick, D. A. Kenny, J. Patton, and D. C. Wathes. 2008. Endometrial expression of the insulin-like growth factor system during uterine involution in the postpartum dairy cow. Domestic Animal Endocrinology 34:391–402.

Logan, C. Y., and R. Nusse. 2004. The Wnt signaling pathway in development and disease. Annual review of cell and developmental biology 20:781–810.

Lopes, A. S., S. T. Butler, R. O. Gilbert, and W. R. Butler. 2007. Relationship of pre-ovulatory follicle size, estradiol concentrations and season to pregnancy outcome in dairy cows. Animal reproduction science 99:34–43.

Lucy, M. C. 2001. Reproductive loss in high-producing dairy cattle: where will it end? Journal of dairy science 84:1277–93.

Lucy, M. C. 2007. Fertility in high-producing dairy cows: reasons for decline and corrective strategies for sustainable improvement. Society of Reproduction and Fertility supplement 64:237–54.

Lukaszewska, J., and W. Hansel. 1980. Corpus luteum maintenance during early pregnancy in the cow. Journal of reproduction and fertility 59:485–93.

Lukiw, W. J., A. Ottlecz, G. Lambrou, M. Grueninger, J. Finley, H. W. Thompson, and N. G. Bazan. 2003. Coordinate activation of HIF-1 and NF-kappaB DNA binding and COX-2 and VEGF expression in retinal cells by hypoxia. Investigative ophthalmology & visual science 44:4163–70.

Lusso, P. 2006. HIV and the chemokine system: 10 years later. The EMBO journal 25:447–56.

112

Lustig, B., B. Jerchow, M. Sachs, S. Weiler, T. Pietsch, U. Karsten, M. van de Wetering, H. Clevers, P. M. Schlag, W. Birchmeier, and J. Behrens. 2002. Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors. Molecular and cellular biology 22:1184–93.

Lyons, G. E., D. Houzelstein, D. Sassoon, B. Robert, and M. E. Buckingham. 1992. Multiple sites of Hox-7 expression during mouse embryogenesis: comparison with retinoic acid receptor mRNA localization. Molecular reproduction and development 32:303–14.

Maglott, D., J. Ostell, K. D. Pruitt, and T. Tatusova. 2011. Entrez Gene: gene-centered information at NCBI. Nucleic acids research 39:D52–7.

Malakhov, M. P., K. Il Kim, O. A. Malakhova, B. S. Jacobs, E. C. Borden, and D.-E. Zhang. 2003. High-throughput immunoblotting. Ubiquitiin-like protein ISG15 modifies key regulators of signal transduction. The Journal of biological chemistry 278:16608–13.

Mamluk, R., D. Chen, Y. Greber, J. S. Davis, and R. Meidan. 1998. Characterization of messenger ribonucleic acid expression for prostaglandin F2 alpha and luteinizing hormone receptors in various bovine luteal cell types. Biology of reproduction 58:849–56.

Mamo, S., J. P. Mehta, P. McGettigan, T. Fair, T. E. Spencer, F. W. Bazer, and P. Lonergan. 2011. RNA sequencing reveals novel gene clusters in bovine conceptuses associated with maternal recognition of pregnancy and implantation. Biology of reproduction 85:1143–51.

Mamo, S., D. Rizos, and P. Lonergan. 2012. Transcriptomic changes in the bovine conceptus between the blastocyst stage and initiation of implantation. Animal reproduction science 134:56–63.

Mann, G. E., G. E. Lamming, and M. D. Fray. 1995. Plasma oestradiol and progesterone during early pregnancy in the cow and the effects of treatment with buserelin. Animal Reproduction Science 37:121–131.

Mann, G. E., and G. E. Lamming. 1995. Progesterone inhibition of the development of the luteolytic signal in cows. Journal of reproduction and fertility 104:1–5.

Mann, G. E., and G. E. Lamming. 2000. The role of sub-optimal preovulatory oestradiol secretion in the aetiology of premature luteolysis during the short oestrous cycle in the cow. Animal reproduction science 64:171–80.

Mann, G. E., and G. E. Lamming. 2001. Relationship between maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows. Reproduction (Cambridge, England) 121:175–80.

Mann, G., and G. Lamming. 2001. Relationship between maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows. Reproduction 121:175– 180.

113

Manthey, C., S. Wang, S. Kinney, and Z. Yao. 1998. SB202190, a selective inhibitor of p38 mitogen-activated protein kinase, is a powerful regulator of LPS-induced mRNAs in monocytes. J. Leukoc. Biol. 64:409–417.

Mao, B., W. Wu, Y. Li, D. Hoppe, P. Stannek, A. Glinka, and C. Niehrs. 2001. LDL-receptor- related protein 6 is a receptor for Dickkopf proteins. Nature 411:321–5.

Maruo, N., I. Morita, M. Shirao, and S. Murota. 1992. IL-6 increases endothelial permeability in vitro. Endocrinology 131:710–4.

Mateyak, M. K., and T. G. Kinzy. 2010. eEF1A: thinking outside the ribosome. The Journal of biological chemistry 285:21209–13.

Mathialagan, N., J. A. Bixby, and R. M. Roberts. 1992. Expression of interleukin-6 in porcine, ovine, and bovine preimplantation conceptuses. Molecular reproduction and development 32:324–30.

Mathialagan, N., and T. R. Hansen. 1996. Pepsin-inhibitory activity of the uterine serpins. Proceedings of the National Academy of Sciences of the United States of America 93:13653–8.

Matsumi, H., T. Yano, T. Koji, T. Ogura, O. Tsutsumi, Y. Taketani, and H. Esumi. 1998. Expression and localization of inducible nitric oxide synthase in the rat ovary: a possible involvement of nitric oxide in the follicular development. Biochemical and biophysical research communications 243:67–72.

Matsumoto, A. K., A. Melian, D. R. Mandel, H. H. McIlwain, D. Borenstein, P. L. Zhao, C. R. Lines, B. J. Gertz, and S. Curtis. 2002. A randomized, controlled, clinical trial of etoricoxib in the treatment of rheumatoid arthritis. The Journal of rheumatology 29:1623–30.

Mccormack, J. T., and G. S. Greenwald. 1974. OESTRADIOL-17 \ g = b \ LEVELS ON DAY 4 OF PREGNANCY IN THE MOUSE.

McCracken, J. A., E. E. Custer, and J. C. Lamsa. 1999. Luteolysis: a neuroendocrine-mediated event. Physiological reviews 79:263–323.

McNatty, K. P., and R. S. Sawers. 1975. Relationship between the endocrine environment within the Graafian follicle and the subsequent rate of progesterone secretion by human granulosa cells in vitro. The Journal of endocrinology 66:391–400.

McNatty, K. P., P. Smith, L. G. Moore, K. Reader, S. Lun, J. P. Hanrahan, N. P. Groome, M. Laitinen, O. Ritvos, and J. L. Juengel. 2005. Oocyte-expressed genes affecting ovulation rate. Molecular and cellular endocrinology 234:57–66.

McNeely, T. B., M. Dealy, D. J. Dripps, J. M. Orenstein, S. P. Eisenberg, and S. M. Wahl. 1995. Secretory leukocyte protease inhibitor: a human saliva protein exhibiting anti-human immunodeficiency virus 1 activity in vitro. The Journal of clinical investigation 96:456–64.

114

Medina, A., W. Reintsch, and H. Steinbeisser. 2000. Xenopus frizzled 7 can act in canonical and non-canonical Wnt signaling pathways: implications on early patterning and morphogenesis. Mechanisms of development 92:227–37.

Meikle, A., L. Sahlin, A. Ferraris, B. Masironi, J. E. Blanc, M. Rodríguez-Irazoqui, M. Rodríguez- Piñón, H. Kindahl, and M. Forsberg. 2001. Endometrial mRNA expression of oestrogen receptor alpha, progesterone receptor and insulin-like growth factor-I (IGF-I) throughout the bovine oestrous cycle. Animal reproduction science 68:45–56.

Meisser, A., D. Chardonnens, A. Campana, and P. Bischof. 1999. Effects of tumour necrosis factor-alpha, interleukin-1 alpha, macrophage colony stimulating factor and transforming growth factor beta on trophoblastic matrix metalloproteinases. Molecular human reproduction 5:252–60.

Melchers, F., H. Karasuyama, D. Haasner, S. Bauer, A. Kudo, N. Sakaguchi, B. Jameson, and A. Rolink. 1993. The surrogate light chain in B-cell development. Immunology today 14:60–8.

Memili, E., and N. L. First. 1999. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared with other species. Zygote 8:87–96.

Meneghetti, M., O. G. S. Filho, R. F. G. Peres, G. C. Lamb, and J. L. M. Vasconcelos. 2009. Fixed- time artificial insemination with estradiol and progesterone for Bos indicus cows I: Basis for development of protocols. Theriogenology 72:179–189.

Meyer, G., and P. Wahle. 1999. The paleocortical ventricle is the origin of reelin-expressing neurons in the marginal zone of the foetal human neocortex. The European journal of neuroscience 11:3937–44.

Meyer, M. D., P. J. Hansen, W. W. Thatcher, M. Drost, L. Badinga, R. M. Roberts, J. Li, T. L. Ott, and F. W. Bazer. 1995. Extension of corpus luteum lifespan and reduction of uterine secretion of prostaglandin F2 alpha of cows in response to recombinant interferon-tau. Journal of dairy science 78:1921–31.

Michel, T., and O. Feron. 1997. Nitric oxide synthases: which, where, how, and why? The Journal of clinical investigation 100:2146–52.

Miller, B. G., and N. W. Moore. 1976. Effects of progesterone and oestradiol on endometrial metabolism and embryo survival in the ovariectomized ewe. Theriogenology 6:636.

Miller, B. G., and N. W. Moore. 1983. Endometrial protein secretion during early pregnancy in entire and ovariectomized ewes. Journal of reproduction and fertility 68:137–44.

Mincheva-Nilsson, L. 2003. Pregnancy and gamma/delta T cells: taking on the hard questions. Reproductive biology and endocrinology : RB&E 1:120.

Minegishi, Y., E. Coustan-Smith, Y. H. Wang, M. D. Cooper, D. Campana, and M. E. Conley. 1998. Mutations in the human lambda5/14.1 gene result in B cell deficiency and agammaglobulinemia. The Journal of experimental medicine 187:71–7.

115

Mishra, B., K. Kizaki, K. Koshi, K. Ushizawa, T. Takahashi, M. Hosoe, T. Sato, A. Ito, and K. Hashizume. 2010. Expression of extracellular matrix metalloproteinase inducer (EMMPRIN) and its related extracellular matrix degrading enzymes in the endometrium during estrous cycle and early gestation in cattle. Reproductive biology and endocrinology : RB&E 8:60.

Mishra, B., K. Kizaki, K. Koshi, K. Ushizawa, T. Takahashi, M. Hosoe, T. Sato, A. Ito, and K. Hashizume. 2012. Expression of extracellular matrix metalloproteinase inducer (EMMPRIN) and its expected roles in the bovine endometrium during gestation. Domestic animal endocrinology 42:63–73.

Misirlioglu, M., G. P. Page, H. Sagirkaya, A. Kaya, J. J. Parrish, N. L. First, and E. Memili. 2006. Dynamics of global transcriptome in bovine matured oocytes and preimplantation embryos. Proceedings of the National Academy of Sciences of the United States of America 103:18905–10.

Mitchell, L. M., C. R. Kennedy, and G. M. Hartshorne. 2004. Pharmacological manipulation of nitric oxide levels in mouse follicle cultures demonstrates key role of extrafollicular control of ovulation. Human reproduction (Oxford, England) 19:1705–12.

Mitko, K., S. E. Ulbrich, H. Wenigerkind, F. Sinowatz, H. Blum, E. Wolf, and S. Bauersachs. 2008. Dynamic changes in messenger RNA profiles of bovine endometrium during the oestrous cycle. Reproduction (Cambridge, England) 135:225–40.

MIYAMOTO, A., K. TAKEMOTO, T. J. ACOSTA, M. OHTANI, J. YAMADA, and Y. FUKUI. 1998. Comparative Activities of Growth Hormone and Luteinizing Hormone in the Direct Stimulation of Local Release of Progesterone from Microdialyzed Ovine Corpora Lutea In Vivo. Journal of Reproduction and Development 44:273–280.

Miyauchi, T., T. Kanekura, A. Yamaoka, M. Ozawa, S. Miyazawa, and T. Muramatasu. 1990. Basigin, a New, Broadly Distributed Member of the Immunoglobulin Superfamily, Has Strong Homology with Both the Immunoglobulin V Domain and the {beta}-Chain of Major Histocompatibility Complex Class II Antigen. J. Biochem. 107:316–323.

Miyauchi, T., Y. Masuzawa, and T. Muramatsu. 1991. The Basigin Group of the Immunoglobulin Superfamily: Complete Conservation of a Segment in and around Transmembrane Domains of Human and Mouse Basigin and Chicken HT7 Antigen. J. Biochem. 110:770–774.

Mochida, S., H. Kobayashi, Y. Matsuda, Y. Yuda, K. Muramoto, and Y. Nonomura. 1994. Myosin II is involved in transmitter release at synapses formed between rat sympathetic neurons in culture. Neuron 13:1131–1142.

Moore, K. W., P. Vieira, D. F. Fiorentino, M. L. Trounstine, T. A. Khan, and T. R. Mosmann. 1990. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science (New York, N.Y.) 248:1230–4.

Moore, N. W., and B. G. Miller. 1976. Proceedings: Progesterone and oestrogen requirements for the survival of embryos in the ovariectomized ewe. Journal of reproduction and fertility 46:536–7.

116

Moreira, F., L. Badinga, C. Burnley, and W. W. Thatcher. 2002. Bovine somatotropin increases embryonic development in superovulated cows and improves post-transfer pregnancy rates when given to lactating recipient cows. Theriogenology 57:1371–87.

Moreira, F., R. L. de la Sota, T. Diaz, and W. W. Thatcher. 2000. Effect of day of the estrous cycle at the initiation of a timed artificial insemination protocol on reproductive responses in dairy heifers. Journal of animal science 78:1568–76.

Morohashi, K., K. Sogawa, T. Omura, and Y. Fujii-Kuriyama. 1987. Gene structure of human cytochrome P-450(SCC), cholesterol desmolase. Journal of biochemistry 101:879–87.

Morris, S. M., and T. R. Billiar. 1994. New insights into the regulation of inducible nitric oxide synthesis. The American journal of physiology 266:E829–39.

Motta, A. B., A. Estevez, A. Franchi, S. Perez-Martinez, M. Farina, M. L. Ribeiro, A. Lasserre, and M. F. Gimeno. 2001. Regulation of lipid peroxidation by nitric oxide and PGF2alpha during luteal regression in rats. Reproduction (Cambridge, England) 121:631–7.

Motta, A. B., A. M. Franchi, and M. F. Gimeno. 1997. Role of nitric oxide on uterine and ovarian prostaglandin synthesis during luteolysis in the rat. Prostaglandins, leukotrienes, and essential fatty acids 56:265–9.

Mottershead, D. G., L. J. Ritter, and R. B. Gilchrist. 2012. Signalling pathways mediating specific synergistic interactions between GDF9 and BMP15. Molecular human reproduction 18:121–8.

Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarev, S. J. Conway, B. Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science (New York, N.Y.) 281:1191–3.

Muramatsu, T., and T. Miyauchi. 2003. Basigin (CD147): a multifunctional transmembrane protein involved in reproduction, neural function, inflammation and tumor invasion. Histology and histopathology 18:981–7.

Murray, M. K. 1992. Biosynthesis and immunocytochemical localization of an estrogen- dependent glycoprotein and associated morphological alterations in the sheep ampulla oviduct. Biology of reproduction 47:889–902.

Murray, M. K. 1993. An estrogen-dependent glycoprotein is synthesized and released from the oviduct in a temporal- and region-specific manner during early pregnancy in the ewe. Biology of reproduction 48:446–53.

Murray, M. K. 1995. Epithelial lining of the sheep ampulla oviduct undergoes pregnancy- associated morphological changes in secretory status and cell height. Biology of reproduction 53:653– 63.

117

Murray, M. K. 1996. Changes in secretory status, cell height and percentage ciliation of epithelial lining of sheep fimbria oviduct during early pregnancy. Journal of reproduction and fertility 106:173–83.

Mussard, M., C. Burke, and M. Day. 2003. Ovarian follicle maturity at induced ovulation influences fertility in cattle.

Mussard, M. L., C. R. Burke, E. J. Behlke, C. L. Gasser, and M. L. Day. 2007. Influence of premature induction of a luteinizing hormone surge with gonadotropin-releasing hormone on ovulation, luteal function, and fertility in cattle. Journal of animal science 85:937–43.

Mussard, M. L., C. R. Burke, C. Gasser, E. Behlke, K. Colliflower, D. Grum, and M. L. Day. Ovulatory response, luteal function and fertility in cattle induced to ovulate dominant follicles of early or late maturity.

Mysliwy, J., A. J. Dingley, R. Sedlacek, and J. Grötzinger. 2006. Structural characterization and binding properties of the hemopexin-like domain of the matrixmetalloproteinase-19. Protein expression and purification 46:406–13.

Nafee, T. M., W. E. Farrell, W. D. Carroll, a a Fryer, and K. M. K. Ismail. 2008. Epigenetic control of fetal gene expression. BJOG : an international journal of obstetrics and gynaecology 115:158–68.

Nagaeva, O., L. Jonsson, and L. Mincheva-Nilsson. 2002. Dominant IL-10 and TGF-beta mRNA expression in gammadeltaT cells of human early pregnancy decidua suggests immunoregulatory potential. American journal of reproductive immunology (New York, N.Y. : 1989) 48:9–17.

Nagaoka, K., H. Nojima, F. Watanabe, K. Chang, R. Christenson, S. Sakai, and K. Imakawa. 2003. Regulation of blastocyst migration, apposition, and initial adhesion by a chemokine, interferon gamma- inducible protein 10 kDa (IP-10), during early gestation. The Journal of biological chemistry 278:29048– 56.

Nagaoka, K., A. Sakai, H. Nojima, Y. Suda, Y. Yokomizo, K. Imakawa, S. Sakai, and R. K. Christenson. 2003. A chemokine, interferon (IFN)-gamma-inducible protein 10 kDa, is stimulated by IFN- tau and recruits immune cells in the ovine endometrium. Biology of reproduction 68:1413–21.

Nakano, H., A. Shimada, K. Imai, T. Takahashi, and K. Hashizume. 2005. The cytoplasmic expression of E-cadherin and beta-catenin in bovine trophoblasts during binucleate cell differentiation. Placenta 26:393–401.

Nakayama, T., Y. Kato, K. Hieshima, D. Nagakubo, Y. Kunori, T. Fujisawa, and O. Yoshie. 2004. Liver-expressed chemokine/CC chemokine ligand 16 attracts eosinophils by interacting with histamine H4 receptor. Journal of immunology (Baltimore, Md. : 1950) 173:2078–83.

Nasar, A., A. Rahman, E. N. T. Meeusen, and C. S. Lee. 2002. Peri-partum changes in the intraepithelial lymphocyte population of sheep interplacentomal endometrium. American journal of reproductive immunology (New York, N.Y. : 1989) 47:132–41.

118

Nauta, A. J., B. Bottazzi, A. Mantovani, G. Salvatori, U. Kishore, W. J. Schwaeble, A. R. Gingras, S. Tzima, F. Vivanco, J. Egido, O. Tijsma, E. C. Hack, M. R. Daha, and A. Roos. 2003. Biochemical and functional characterization of the interaction between pentraxin 3 and C1q. European journal of immunology 33:465–73.

Nauta, A. J., S. de Haij, B. Bottazzi, A. Mantovani, M. C. Borrias, J. Aten, M. P. Rastaldi, M. R. Daha, C. van Kooten, and A. Roos. 2005. Human renal epithelial cells produce the long pentraxin PTX3. Kidney international 67:543–53.

Newcomb, R., W. D. Booth, and L. E. Rowson. 1977. The effect of oxytocin treatment on the levels of prostaglandin F in the blood of heifers. Journal of reproduction and fertility 49:17–24.

Nichols, J., D. Davidson, T. Taga, K. Yoshida, I. Chambers, and A. Smith. 1996. Complementary tissue-specific expression of LIF and LIF-receptor mRNAs in early mouse embryogenesis. Mechanisms of development 57:123–31.

Nishikimi, A., T. Matsukawa, K. Hoshino, S. Ikeda, Y. Kira, E. F. Sato, M. Inoue, and M. Yamada. 2001. Localization of nitric oxide synthase activity in unfertilized oocytes and fertilized embryos during preimplantation development in mice. Reproduction (Cambridge, England) 122:957–63.

Niswender, G. D., J. L. Juengel, P. J. Silva, M. K. Rollyson, and E. W. McIntush. 2000. Mechanisms controlling the function and life span of the corpus luteum. Physiological reviews 80:1–29.

Niswender, G. D., T. J. Reimers, M. A. Diekman, and T. M. Nett. 1976. Blood flow: a mediator of ovarian function. Biology of reproduction 14:64–81.

Noguchi, Y., T. Sato, M. Hirata, T. Hara, K. Ohama, and A. Ito. 2003. Identification and characterization of extracellular matrix metalloproteinase inducer in human endometrium during the menstrual cycle in vivo and in vitro. The Journal of clinical endocrinology and metabolism 88:6063–72.

Northey, D. L., and L. R. French. 1980. Effect of embryo removal and intrauterine infusion of embryonic homogenates on the lifespan of the bovine corpus luteum. Journal of animal science 50:298– 302.

O’Banion, M. K., V. D. Winn, and D. A. Young. 1992. cDNA cloning and functional activity of a glucocorticoid-regulated inflammatory cyclooxygenase. Proceedings of the National Academy of Sciences of the United States of America 89:4888–92.

O’Garra, A., and P. Vieira. 2007. T(H)1 cells control themselves by producing interleukin-10. Nature reviews. Immunology 7:425–8.

O’Shea, J. D., R. J. Rodgers, and M. J. D’Occhio. 1989. Cellular composition of the cyclic corpus luteum of the cow. Journal of reproduction and fertility 85:483–7.

Ogawa, M., T. Miyata, K. Nakajimat, K. Yagyu, M. Seike, K. Ikenaka, H. Yamamoto, and K. Mikoshibat. 1995. The reeler gene-associated antigen on cajal-retzius neurons is a crucial molecule for laminar organization of cortical neurons. Neuron 14:899–912.

119

Okulicz, W. C., and C. I. Ace. 2003. Temporal regulation of gene expression during the expected window of receptivity in the rhesus monkey endometrium. Biology of reproduction 69:1593–9.

Okumu, L. A., T. Fair, J. Szekeres-Bartho, A. M. O’Doherty, M. A. Crowe, J. F. Roche, P. Lonergan, and N. Forde. 2011. Endometrial expression of progesterone-induced blocking factor and galectins-1, -3, -9, and -3 binding protein in the luteal phase and early pregnancy in cattle. Physiological genomics 43:903–10.

Oltvai, Z. N., C. L. Milliman, and S. J. Korsmeyer. 1993. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74:609–19.

Ott, T. L., J. Yin, A. A. Wiley, H. T. Kim, B. Gerami-Naini, T. E. Spencer, F. F. Bartol, R. C. Burghardt, and F. W. Bazer. 1998. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biology of reproduction 59:784–94.

Pak, S. C., V. Kumar, C. Tsu, C. J. Luke, Y. S. Askew, D. J. Askew, D. R. Mills, D. Brömme, and G. A. Silverman. 2004. SRP-2 is a cross-class inhibitor that participates in postembryonic development of the nematode Caenorhabditis elegans: initial characterization of the clade L serpins. The Journal of biological chemistry 279:15448–59.

Pan, J., L.-B. Ruest, S. Xu, and E. Wang. 2004. Immuno-characterization of the switch of peptide elongation factors eEF1A-1/EF-1alpha and eEF1A-2/S1 in the central nervous system during mouse development. Brain research. Developmental brain research 149:1–8.

Paradowska, E., Z. Blach-Olszewska, and E. Gejdel. 1997. Constitutive and induced cytokine production by human placenta and amniotic membrane at term. Placenta 18:441–6.

Parent, J., C. Villeneuve, and M. A. Fortier. 2003. Evaluation of the contribution of cyclooxygenase 1 and cyclooxygenase 2 to the production of PGE 2 and PGF 2 ␣ in epithelial cells from bovine endometrium. :539–547.

Park, I., C. Han, S. Jin, B. Lee, H. Choi, J. T. Kwon, D. Kim, J. Kim, E. Lifirsu, W. J. Park, Z. Y. Park, D. H. Kim, and C. Cho. 2011. Myosin regulatory light chains are required to maintain the stability of myosin II and cellular integrity. The Biochemical journal 434:171–80.

Parr, B. A., M. J. Shea, G. Vassileva, and A. P. McMahon. 1993. Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development (Cambridge, England) 119:247–61.

Di Pasquale, E., and A. H. Brivanlou. 2009. Bone morphogenetic protein 15 (BMP15) acts as a BMP and Wnt inhibitor during early embryogenesis. The Journal of biological chemistry 284:26127–36.

Pate, J. L. 1994. Cellular components involved in luteolysis. Journal of animal science 72:1884– 90.

Pavlova, A., E. Boutin, G. Cunha, and D. Sassoon. 1994. Msx1 (Hox-7.1) in the adult mouse uterus: cellular interactions underlying regulation of expression. Development 120:335–345.

120

Payne, A. H., and D. B. Hales. 2004. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocrine reviews 25:947–70.

Pendás, A. M., V. Knäuper, X. S. Puente, E. Llano, M. G. Mattei, S. Apte, G. Murphy, and C. López-Otín. 1997. Identification and characterization of a novel human matrix metalloproteinase with unique structural characteristics, chromosomal location, and tissue distribution. The Journal of biological chemistry 272:4281–6.

Pennetier, S., S. Uzbekova, C. Perreau, P. Papillier, P. Mermillod, and R. Dalbiès-Tran. 2004. Spatio-temporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15,andVASA in adult bovine tissues, oocytes, and preimplantation embryos. Biology of reproduction 71:1359–66.

Pennington, J. A., J. L. Albright, M. A. Diekman, and C. J. Callahan. 1985. Sexual activity of Holstein cows: seasonal effects. Journal of dairy science 68:3023–30.

Pereira, M. H. C., A. D. P. Rodrigues, T. Martins, W. V. C. Oliveira, P. S. A. Silveira, M. C. Wiltbank, and J. L. M. Vasconcelos. 2013. Timed artificial insemination programs during the summer in lactating dairy cows: comparison of the 5-d Cosynch protocol with an estrogen/progesterone-based protocol. Journal of dairy science 96:6904–14.

Peres, R. F. G., I. Claro, O. G. Sá Filho, G. P. Nogueira, and J. L. M. Vasconcelos. 2009. Strategies to improve fertility in Bos indicus postpubertal heifers and nonlactating cows submitted to fixed-time artificial insemination. Theriogenology 72:681–9.

Perry, G. A., B. L. Perry, and R. A. Cushman. 2009. Association Between Pre-Ovulatory Concentrations of Estradiol and Expression of Uterine Milk Protein Precursor, Inhibin Beta A, Period 1, Proenkephalin, and Receptors for Oxytocin, Progesterone, and Estradiol. Biol Reprod 81:308–.

Perry, G. A., M. F. Smith, M. C. Lucy, J. A. Green, T. E. Parks, M. D. MacNeil, A. J. Roberts, and T. W. Geary. 2005. Relationship between follicle size at insemination and pregnancy success. Proceedings of the National Academy of Sciences of the United States of America 102:5268–73.

Perry, G. A., M. F. Smith, M. C. Lucy, A. J. Roberts, M. D. MacNeil, and T. W. Geary. 2003. Effect of ovulatory follicle size at time of GnRH injection or standing estrus on pregnancy rates and embryonic/fetal mortality in beef cattle. Proceedings.

Pescador, N., K. Soumano, D. M. Stocco, C. A. Price, and B. D. Murphy. 1996. Steroidogenic acute regulatory protein in bovine corpora lutea. Biology of reproduction 55:485–91.

Pescador, N. 1996. Steroidogenic acute regulatory protein in bovine corpora lutea. Biology of Reproduction 55:485–491.

Peters, M. W., and J. R. Pursley. 2003. Timing of final GnRH of the Ovsynch protocol affects ovulatory follicle size, subsequent luteal function, and fertility in dairy cows. Theriogenology 60:1197– 204.

121

Peters, T. J., A. Albieri, E. Bevilacqua, B. M. Chapman, L. H. Crane, G. P. Hamlin, M. Seiki, and M. J. Soares. 1999. Differentiation-dependent expression of gelatinase B/matrix metalloproteinase-9 in trophoblast cells. Cell and Tissue Research 295:287–296.

Pfaffl, M. W., S. E. Ulbrich, A. E. Groebner, and S. Bauersachs. 2013. Transcriptional profiling to address molecular determinants of endometrial receptivity – Lessons from studies in livestock species. Methods 59:108–115.

Piccinni, M. P., L. Beloni, C. Livi, E. Maggi, G. Scarselli, and S. Romagnani. 1998. Defective production of both leukemia inhibitory factor and type 2 T-helper cytokines by decidual T cells in unexplained recurrent abortions. Nature medicine 4:1020–4.

Pilon, N., I. Daneau, C. Brisson, J. F. Ethier, J. G. Lussier, and D. W. Silversides. 1997. Porcine and bovine steroidogenic acute regulatory protein (StAR) gene expression during gestation. Endocrinology 138:1085–91.

Pires, P. R. L., N. P. Santos, P. R. Adona, M. M. Natori, K. R. L. Schwarz, T. H. C. de Bem, and C. L. V Leal. 2009. Endothelial and inducible nitric oxide synthases in oocytes of cattle. Animal reproduction science 116:233–43.

Pohler, K. G., T. W. Geary, J. A. Atkins, G. A. Perry, E. M. Jinks, and M. F. Smith. 2012. Follicular determinants of pregnancy establishment and maintenance. Cell and tissue research 349:649–64.

Pollack, S. E., E. E. Furth, C. B. Kallen, F. Arakane, M. Kiriakidou, K. F. Kozarsky, and J. F. Strauss. 1997. Localization of the steroidogenic acute regulatory protein in human tissues. The Journal of clinical endocrinology and metabolism 82:4243–51.

Pomini, F., A. Caruso, and J. R. Challis. 1999. Interleukin-10 modifies the effects of interleukin- 1beta and tumor necrosis factor-alpha on the activity and expression of prostaglandin H synthase-2 and the NAD+-dependent 15-hydroxyprostaglandin dehydrogenase in cultured term human villous trophoblast a. The Journal of clinical endocrinology and metabolism 84:4645–51.

Ponce-barajas, P. 2006. Expression analysis of homeobox gene family in bovine pre- and post- implantative developmental stages.

Ponsuksili, S., E. Murani, M. Schwerin, K. Schellander, D. Tesfaye, and K. Wimmers. 2012. Gene expression and DNA-methylation of bovine pretransfer endometrium depending on its receptivity after in vitro-produced embryo transfer. PloS one 7:e42402.

Popovici, R. M., M. S. Krause, J. Jauckus, A. Germeyer, I. S. Brum, C. Garlanda, T. Strowitzki, and M. von Wolff. 2008. The long pentraxin PTX3 in human endometrium: regulation by steroids and trophoblast products. Endocrinology 149:1136–43.

Potter, J. L., J. Narasimhan, L. Mende-Mueller, and A. L. Haas. 1999. Precursor Processing of Pro-ISG15/UCRP, an Interferon- -induced Ubiquitin-like Protein. Journal of Biological Chemistry 274:25061–25068.

122

Pryce, J. E., M. D. Royal, P. C. Garnsworthy, and I. L. Mao. 2004. Fertility in the high-producing dairy cow. Livestock Production Science 86:125–135.

Psychoyos, A. 1973. Hormonal control of ovoimplantation. Vitamins and hormones 31:201–56.

Pursley, J. R., M. C. Wiltbank, J. S. Stevenson, J. S. Ottobre, H. A. Garverick, and L. L. Anderson. 1997. Pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation or synchronized estrus. Journal of dairy science 80:295–300.

Pushpakumara, P. G. a, R. S. Robinson, K. J. Demmers, G. E. Mann, K. D. Sinclair, R. Webb, and D. C. Wathes. 2002. Expression of the insulin-like growth factor (IGF) system in the bovine oviduct at oestrus and during early pregnancy. Reproduction (Cambridge, England) 123:859–68.

Quintana, C., J. M. Cowley, and C. Marhic. 2004. Electron nanodiffraction and high-resolution electron microscopy studies of the structure and composition of physiological and pathological ferritin. Journal of structural biology 147:166–78.

Racicot, K. E., K. Toyokawa, and T. L. Ott. 2008. The Interferon Stimulated Gene, MX1, Interacts with Tubulin {beta} in Ovine Glandular Epithelial Cells and Regulates Cell Proliferation. Biol Reprod 78:172–.

Ravindranath, N., L. Little-Ihrig, D. F. Benyo, and A. J. Zeleznik. 1992. Role of luteinizing hormone in the expression of cholesterol side-chain cleavage cytochrome P450 and 3 beta- hydroxysteroid dehydrogenase, delta 5-4 isomerase messenger ribonucleic acids in the primate corpus luteum. Endocrinology 131:2065–70.

Rawlings, N. D., D. P. Tolle, and A. J. Barrett. 2004. MEROPS: the peptidase database. Nucleic acids research 32:D160–4.

Ray, C. A., R. A. Black, S. R. Kronheim, T. A. Greenstreet, P. R. Sleath, G. S. Salvesen, and D. J. Pickup. 1992. Viral inhibition of inflammation: cowpox virus encodes an inhibitor of the interleukin-1 beta converting enzyme. Cell 69:597–604.

Reardon, S. N., M. L. King, J. A. MacLean, J. L. Mann, F. J. DeMayo, J. P. Lydon, and K. Hayashi. 2012. CDH1 is essential for endometrial differentiation, gland development, and adult function in the mouse uterus. Biology of reproduction 86:141, 1–10.

Rebecchi, M. J., and S. N. Pentyala. 2000. Structure, function, and control of phosphoinositide- specific phospholipase C. Physiological reviews 80:1291–335.

Reed, K. L. 1996. Porcine endometrial glandular epithelial cells in vitro: transcriptional activities of the pregnancy-associated genes encoding antileukoproteinase and uteroferrin. Biology of Reproduction 55:469–477.

Reponen, P., I. Leivo, C. Sahlberg, S. S. Apte, B. R. Olsen, I. Thesleff, and K. Tryggvason. 1995. 92-kDa type IV collagenase and TIMP-3, but not 72-kDa type IV collagenase or TIMP-1 or TIMP-2, are

123 highly expressed during mouse embryo implantation. Developmental dynamics : an official publication of the American Association of Anatomists 202:388–96.

Repping, S., Y. E. M. Koot, G. Teklenburg, M. S. Salker, J. J. Brosens, and N. S. Macklon. 2012. Molecular aspects of implantation failure. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1822:1943–1950.

Rey, M., A. Valenzuela-Fernández, A. Urzainqui, M. Yáñez-Mó, M. Pérez-Martínez, P. Penela, F. Mayor, and F. Sánchez-Madrid. 2007. Myosin IIA is involved in the endocytosis of CXCR4 induced by SDF- 1alpha. Journal of cell science 120:1126–33.

Reynolds, L. P., A. T. Grazul-Bilska, S. D. Killilea, and D. A. Redmer. 1994. Mitogenic factors of corpora lutea. Progress in growth factor research 5:159–75.

Reynolds, L. P., A. T. Grazul-Bilska, and D. A. Redmer. 2000. Angiogenesis in the corpus luteum. Endocrine 12:1–9.

Reynolds, L. P., and D. A. Redmer. 1999. Growth and development of the corpus luteum. Journal of reproduction and fertility. Supplement 54:181–91.

Rhee, S. G. 2001. Regulation of phosphoinositide-specific phospholipase C. Annual review of biochemistry 70:281–312.

Ricken, A., P. Lochhead, M. Kontogiannea, and R. Farookhi. 2002. Wnt signaling in the ovary: identification and compartmentalized expression of wnt-2, wnt-2b, and frizzled-4 mRNAs. Endocrinology 143:2741–9.

Riesewijk, A., J. Martín, R. van Os, J. A. Horcajadas, J. Polman, A. Pellicer, S. Mosselman, and C. Simón. 2003. Gene expression profiling of human endometrial receptivity on days LH+2 versus LH+7 by microarray technology. Molecular human reproduction 9:253–64.

Riethmacher, D., V. Brinkmann, and C. Birchmeier. 1995. A targeted mutation in the mouse E- cadherin gene results in defective preimplantation development. Proceedings of the National Academy of Sciences of the United States of America 92:855–9.

Rijken, D. C., and H. R. Lijnen. 2009. New insights into the molecular mechanisms of the fibrinolytic system. Journal of thrombosis and haemostasis : JTH 7:4–13.

Rizos, D., L. Burke, P. Duffy, M. Wade, J. F. Mee, K. J. O’Farrell, M. Macsiurtain, M. P. Boland, and P. Lonergan. 2005. Comparisons between nulliparous heifers and cows as oocyte donors for embryo production in vitro. Theriogenology 63:939–49.

Robert, B., G. Lyons, B. K. Simandl, A. Kuroiwa, and M. Buckingham. 1991. The apical ectodermal ridge regulates Hox-7 and Hox-8 gene expression in developing chick limb buds. Genes & development 5:2363–74.

124

Robert, B., D. Sassoon, B. Jacq, W. Gehring, and M. Buckingham. 1989. Hox-7, a mouse homeobox gene with a novel pattern of expression during embryogenesis. The EMBO journal 8:91–100.

Roberts, C., G. A. Perry, M. McNeil, M. a Minten, and T. W. Geary. 2012. Effects of preovulatory estradiol concentrations on embryo survival and pregnancy establishment in beef cows.

Roberts, R. M., Y. Chen, T. Ezashi, and A. M. Walker. 2008. Interferons and the maternal- conceptus dialog in mammals. Seminars in cell & developmental biology 19:170–7.

Roberts, R. M., A. D. Ealy, A. P. Alexenko, C. S. Han, and T. Ezashi. 1999. Trophoblast interferons. Placenta 20:259–64.

Roberts, R. M., C. E. Farin, and J. C. Cross. 1990. Trophoblast proteins and maternal recognition of pregnancy. Oxford reviews of reproductive biology 12:147–80.

Robertson, M. 1988. Homoeo boxes, POU proteins and the limits to promiscuity. Nature 336:522–4.

Robinson, G. W., L. Hennighausen, and P. F. Johnson. 2000. Side-branching in the mammary gland: the progesterone-Wnt connection. Genes & Dev. 14:889–894.

Robinson, R. S., M. D. Fray, D. C. Wathes, G. E. Lamming, and G. E. Mann. 2006. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Molecular reproduction and development 73:470–4.

Robinson, R. S., G. E. Mann, G. E. Lamming, and D. C. Wathes. 1999. The effect of pregnancy on the expression of uterine oxytocin, oestrogen and progesterone receptors during early pregnancy in the cow. The Journal of endocrinology 160:21–33.

Robinson, R. S., G. E. Mann, G. E. Lamming, and D. C. Wathes. 2001. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction (Cambridge, England) 122:965–79.

Robinson, R. S., L. T. Nicklin, A. J. Hammond, D. Schams, M. G. Hunter, and G. E. Mann. 2007. Fibroblast growth factor 2 is more dynamic than vascular endothelial growth factor A during the follicle- luteal transition in the cow. Biology of reproduction 77:28–36.

Robinson, R. S., K. J. Woad, A. J. Hammond, M. Laird, M. G. Hunter, and G. E. Mann. 2009. Angiogenesis and vascular function in the ovary. Reproduction (Cambridge, England) 138:869–81.

Rodriguez, R. E., and M. E. Wise. 1989. Ontogeny of pulsatile secretion of gonadotropin- releasing hormone in the bull calf during infantile and pubertal development. Endocrinology 124:248– 56.

125

Roelink, H., and R. Nusse. 1991. Expression of two members of the Wnt family during mouse development--restricted temporal and spatial patterns in the developing neural tube. Genes & development 5:381–8.

Rosen, S. D. 1993. Robert Feulgen Lecture 1993. L-selectin and its biological ligands. Histochemistry 100:185–91.

Rosselli, M., P. J. Keller, and R. K. Dubey. 1998. Role of nitric oxide in the biology, physiology and pathophysiology of reproduction. Human reproduction update 4:3–24.

Rovere-Querini, P., S. Antonacci, G. Dell’Antonio, A. Angeli, G. Almirante, E. D. Cin, L. Valsecchi, C. Lanzani, M. G. Sabbadini, C. Doglioni, A. A. Manfredi, and M. T. Castiglioni. 2006. Plasma and tissue expression of the long pentraxin 3 during normal pregnancy and preeclampsia. Obstetrics and gynecology 108:148–55.

Roveri, A., L. Flohé, M. Maiorino, and F. Ursini. 2002. Phospholipid-hydroperoxide glutathione peroxidase in sperm. Methods in enzymology 347:208–12.

Ruéda, B. R., K. A. Naivar, E. M. George, K. J. Austin, H. Francis, and T. R. Hansen. 1993. Recombinant interferon-tau regulates secretion of two bovine endometrial proteins. Journal of interferon research 13:303–9.

Rueda, B. R., K. I. Tilly, I. W. Botros, P. D. Jolly, T. R. Hansen, P. B. Hoyer, and J. L. Tilly. 1997. Increased bax and interleukin-1beta-converting enzyme messenger ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during structural regression. Biology of reproduction 56:186–93.

Rueda, B. R., K. I. Tilly, T. R. Hansen, P. B. Hoyer, and J. L. Tilly. 1995. Expression of superoxide dismutase, catalase and glutathione peroxidase in the bovine corpus luteum: evidence supporting a role for oxidative stress in luteolysis. Endocrine 3:227–32.

Ruest, L.-B., R. Marcotte, and E. Wang. 2002. Peptide elongation factor eEF1A-2/S1 expression in cultured differentiated myotubes and its protective effect against caspase-3-mediated apoptosis. The Journal of biological chemistry 277:5418–25.

Sadowski, T., S. Dietrich, F. Koschinsky, and R. Sedlacek. 2003. Matrix metalloproteinase 19 regulates insulin-like growth factor-mediated proliferation, migration, and adhesion in human keratinocytes through proteolysis of insulin-like growth factor binding protein-3. Molecular biology of the cell 14:4569–80.

Saez, C. G., J. C. Myers, T. B. Shows, and L. A. Leinwand. 1990. Human nonmuscle myosin heavy chain mRNA: generation of diversity through alternative polyadenylylation. Proceedings of the National Academy of Sciences of the United States of America 87:1164–8.

Sakamoto, K., M. Kamimura, S. Kurozumi, and S. Ito. 1995. Prostaglandin F2 alpha receptor. Journal of lipid mediators and cell signalling 12:405–11.

Salamonsen, L. a. 1999. Role of proteases in implantation. Reviews of reproduction 4:11–22.

126

Sandhoff, T. W., and M. P. McLean. 1996. Hormonal regulation of steroidogenic acute regulatory (StAR) protein messenger ribonucleic acid expression in the rat ovary. Endocrine 4:259–67.

Sandquist, J. C., K. I. Swenson, K. A. Demali, K. Burridge, and A. R. Means. 2006. Rho kinase differentially regulates phosphorylation of nonmuscle myosin II isoforms A and B during cell rounding and migration. The Journal of biological chemistry 281:35873–83.

Sangsritavong, S., D. K. Combs, R. Sartori, L. E. Armentano, and M. C. Wiltbank. 2002. High feed intake increases liver blood flow and metabolism of progesterone and estradiol-17beta in dairy cattle. Journal of dairy science 85:2831–42.

Sappino, A. P., J. Huarte, D. Belin, and J. D. Vassalli. 1989. Plasminogen activators in tissue remodeling and invasion: mRNA localization in mouse ovaries and implanting embryos. The Journal of cell biology 109:2471–9.

Sappino, A. P. 1989. Plasminogen activators in tissue remodeling and invasion: mRNA localization in mouse ovaries and implanting embryos. The Journal of Cell Biology 109:2471–2479.

Sartori, R., A. Gümen, J. N. Guenther, A. H. Souza, D. Z. Caraviello, and M. C. Wiltbank. 2006. Comparison of artificial insemination versus embryo transfer in lactating dairy cows. Theriogenology 65:1311–21.

Sartori, R., J. M. Haughian, R. D. Shaver, G. J. M. Rosa, and M. C. Wiltbank. 2004. Comparison of ovarian function and circulating steroids in estrous cycles of Holstein heifers and lactating cows. Journal of dairy science 87:905–20.

Sartori, R., R. Sartor-Bergfelt, S. A. Mertens, J. N. Guenther, J. J. Parrish, and M. C. Wiltbank. 2002. Fertilization and early embryonic development in heifers and lactating cows in summer and lactating and dry cows in winter. Journal of dairy science 85:2803–12.

Sasaki, T., C. Brakebusch, J. Engel, and R. Timpl. 1998. Mac-2 binding protein is a cell-adhesive protein of the extracellular matrix which self-assembles into ring-like structures and binds beta1 integrins, collagens and fibronectin. The EMBO journal 17:1606–13.

Sato, T., T. Ota, M. Watanabe, K. Imada, M. Nomizu, and A. Ito. 2009. Identification of an active site of EMMPRIN for the augmentation of matrix metalloproteinase-1 and -3 expression in a co-culture of human uterine cervical carcinoma cells and fibroblasts. Gynecologic oncology 114:337–42.

Satokata, I., and R. Maas. 1994. Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nature genetics 6:348–56.

Satterfield, M. C., F. W. Bazer, and T. E. Spencer. 2006. Progesterone regulation of preimplantation conceptus growth and galectin 15 (LGALS15) in the ovine uterus. Biology of reproduction 75:289–96.

127

Satterfield, M. C., K. A. Dunlap, K. Hayashi, R. C. Burghardt, T. E. Spencer, and F. W. Bazer. 2007. Tight and adherens junctions in the ovine uterus: differential regulation by pregnancy and progesterone. Endocrinology 148:3922–31.

Satterfield, M. C., H. Gao, X. Li, G. Wu, G. A. Johnson, T. E. Spencer, and F. W. Bazer. 2010. Select nutrients and their associated transporters are increased in the ovine uterus following early progesterone administration. Biology of reproduction 82:224–31.

Sattler, W., M. Maiorino, and R. Stocker. 1994. Reduction of HDL- and LDL-associated cholesterylester and phospholipid hydroperoxides by phospholipid hydroperoxide glutathione peroxidase and Ebselen (PZ 51). Archives of biochemistry and biophysics 309:214–21.

Savaskan, N. E., A. Borchert, A. U. Bräuer, and H. Kuhn. 2007. Role for glutathione peroxidase-4 in brain development and neuronal apoptosis: specific induction of enzyme expression in reactive astrocytes following brain injury. Free radical biology & medicine 43:191–201.

Schaedel, O., and Y. Reiter. 2006. Antibodies and their fragments as anti-cancer agents. Current pharmaceutical design 12:363–78.

Schallenberger, E., D. Schams, B. Bullermann, and D. L. Walters. 1984. Pulsatile secretion of gonadotrophins, ovarian steroids and ovarian oxytocin during prostaglandin-induced regression of the corpus luteum in the cow. Journal of reproduction and fertility 71:493–501.

Schally, A. V, A. Arimura, A. J. Kastin, H. Matsuo, Y. Baba, T. W. Redding, R. M. Nair, L. Debeljuk, and W. F. White. 1971. Gonadotropin-releasing hormone: one polypeptide regulates secretion of luteinizing and follicle-stimulating hormones. Science (New York, N.Y.) 173:1036–8.

Schams, D., and A. Lahlou-Kassi. 1984. Circulating concentrations of oxytocin during pregnancy in ewes. Acta endocrinologica 106:277–81.

Schiefelbein, A. K., B. L. Perry, and G. A. Perry. 2008. Association Between Preovulatory Concentrations of Estradiol and Expression of Uterine Receptors for Oxytocin, Progesterone, and Estradiol. Biol Reprod 78:139–b–.

Schmedtje, J. F., Y. S. Ji, W. L. Liu, R. N. DuBois, and M. S. Runge. 1997. Hypoxia induces cyclooxygenase-2 via the NF-kappaB p65 transcription factor in human vascular endothelial cells. The Journal of biological chemistry 272:601–8.

Schmitt, R. A., R. D. Geisert, M. T. Zavy, E. C. Short, and R. M. Blair. 1993. Uterine cellular changes in 2’,5'-oligoadenylate synthetase during the bovine estrous cycle and early pregnancy. Biology of reproduction 48:460–6.

Schnabel, D., E. Salas-Vidal, V. Narváez, M. del R. Sánchez-Carbente, D. Hernández-García, R. Cuervo, and L. Covarrubias. 2006. Expression and regulation of antioxidant enzymes in the developing limb support a function of ROS in interdigital cell death. Developmental biology 291:291–9.

128

Schneider, M., D. M. Vogt Weisenhorn, A. Seiler, G. W. Bornkamm, M. Brielmeier, and M. Conrad. 2006. Embryonic expression profile of phospholipid hydroperoxide glutathione peroxidase. Gene expression patterns : GEP 6:489–94.

Schweizer, U., A. U. Bräuer, J. Köhrle, R. Nitsch, and N. E. Savaskan. 2004. Selenium and brain function: a poorly recognized liaison. Brain research. Brain research reviews 45:164–78.

Schwenke, M., M. Knöfler, P. Velicky, C. H. E. Weimar, M. Kruse, A. Samalecos, A. Wolf, N. S. Macklon, A.-M. Bamberger, and B. Gellersen. 2013. Control of human endometrial stromal cell motility by PDGF-BB, HB-EGF and trophoblast-secreted factors. PloS one 8:e54336.

Semënov, M. V, K. Tamai, B. K. Brott, M. Kühl, S. Sokol, and X. He. 2001. Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Current biology : CB 11:951–61.

Senger, D. R., C. A. Perruzzi, A. Papadopoulos-Sergiou, and L. Van de Water. 1994. Adhesive properties of osteopontin: regulation by a naturally occurring thrombin-cleavage in close proximity to the GRGDS cell-binding domain. Molecular biology of the cell 5:565–74.

Shamonki, M. I., I. Kligman, J. M. Shamonki, G. L. Schattman, E. Hyjek, S. D. Spandorfer, N. Zaninovic, and Z. Rosenwaks. 2006. Immunohistochemical expression of endometrial L-selectin ligand is higher in donor egg recipients with embryonic implantation. Fertility and sterility 86:1365–75.

Shearer, J. Reproductive anatomy and physiology of dairy cattle.

Shelton, K., M. F. Gayerie De Abreu, M. G. Hunter, T. J. Parkinson, and G. E. Lamming. 1990. Luteal inadequacy during the early luteal phase of subfertile cows. Journal of reproduction and fertility 90:1–10.

Shen, X.-H., Y.-J. Han, D.-X. Zhang, X.-S. Cui, and N.-H. Kim. 2009. A link between the interleukin-6/Stat3 anti-apoptotic pathway and microRNA-21 in preimplantation mouse embryos. Molecular reproduction and development 76:854–62.

Shewan, A. M., M. Maddugoda, A. Kraemer, S. J. Stehbens, S. Verma, E. M. Kovacs, and A. S. Yap. 2005. Myosin 2 is a key Rho kinase target necessary for the local concentration of E-cadherin at cell- cell contacts. Molecular biology of the cell 16:4531–42.

Shimizu, T., S. Krebs, S. Bauersachs, H. Blum, E. Wolf, and A. Miyamoto. 2010. Actions and interactions of progesterone and estrogen on transcriptome profiles of the bovine endometrium. Physiological genomics 42A:290–300.

Shinya, M., C. Eschbach, M. Clark, H. Lehrach, and M. Furutani-Seiki. 2000. Zebrafish Dkk1, induced by the pre-MBT Wnt signaling, is secreted from the prechordal plate and patterns the anterior neural plate. Mechanisms of development 98:3–17.

Short, E. C., R. D. Geisert, S. D. Helmer, M. T. Zavy, and R. W. Fulton. 1991. Expression of antiviral activity and induction of 2’,5'-oligoadenylate synthetase by conceptus secretory proteins enriched in bovine trophoblast protein-1. Biology of reproduction 44:261–8.

129

Simeone, A., F. Mavilio, D. Acampora, A. Giampaolo, A. Faiella, V. Zappavigna, M. D’Esposito, M. Pannese, G. Russo, and E. Boncinelli. 1987. Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development. Proceedings of the National Academy of Sciences of the United States of America 84:4914–8.

Simons, M., M. Wang, O. W. McBride, S. Kawamoto, K. Yamakawa, D. Gdula, R. S. Adelstein, and L. Weir. 1991. Human nonmuscle myosin heavy chains are encoded by two genes located on different chromosomes. Circulation research 69:530–9.

Simpson, K. L., J. A. Keelan, and M. D. Mitchell. 1998. Labor-associated changes in interleukin- 10 production and its regulation by immunomodulators in human choriodecidua. The Journal of clinical endocrinology and metabolism 83:4332–7.

Singh, R. P., R. Patarca, J. Schwartz, P. Singh, and H. Cantor. 1990. Definition of a specific interaction between the early T lymphocyte activation 1 (Eta-1) protein and murine macrophages in vitro and its effect upon macrophages in vivo. The Journal of experimental medicine 171:1931–42.

Sirois, J., and J. S. Richards. 1992. Purification and characterization of a novel, distinct isoform of prostaglandin endoperoxide synthase induced by human chorionic gonadotropin in granulosa cells of rat preovulatory follicles. The Journal of biological chemistry 267:6382–8.

Skarzynski, D. J., J. J. Jaroszewski, M. M. Bah, K. M. Deptula, B. Barszczewska, B. Gawronska, and W. Hansel. 2003. Administration of a nitric oxide synthase inhibitor counteracts prostaglandin F2- induced luteolysis in cattle. Biology of reproduction 68:1674–81.

Skarzynski, D. J., and K. Okuda. 2000. Different actions of noradrenaline and nitric oxide on the output of prostaglandins and progesterone in cultured bovine luteal cells. Prostaglandins & other lipid mediators 60:35–47.

Skarzynski, D. J. 2000. Influence of Nitric Oxide and Noradrenaline on Prostaglandin F2 - Induced Oxytocin Secretion and Intracellular Calcium Mobilization in Cultured Bovine Luteal Cells. Biology of Reproduction 63:1000–1005.

Smedts, A. M., and T. E. Curry. 2005. Expression of basigin, an inducer of matrix metalloproteinases, in the rat ovary. Biology of reproduction 73:80–7.

Smith, L. L., H. K. Cheung, L. E. Ling, J. Chen, D. Sheppard, R. Pytela, and C. M. Giachelli. 1996. Osteopontin N-terminal domain contains a cryptic adhesive sequence recognized by alpha9beta1 integrin. The Journal of biological chemistry 271:28485–91.

Smith, S. P., E. J. Pollak, and G. B. Anderson. 1982. Maternal influences on growth of twin and single calves. Journal of animal science 55:533–42.

Smith, W. L., D. L. DeWitt, and R. M. Garavito. 2000. Cyclooxygenases: structural, cellular, and molecular biology. Annual review of biochemistry 69:145–82.

130

Souto, L. de A. 2010. THE EFFECT OF LENGTH OF THE PREOVULATORY PERIOD ON MECHANISMS REGULATING EMBRYONIC SURVIVAL IN BEEF CATTLE.

Spencer, T. E., and F. W. Bazer. 1995. Temporal and spatial alterations in uterine estrogen receptor and progesterone receptor gene expression during the estrous cycle and early pregnancy in the ewe. Biology of reproduction 53:1527–1543.

Spencer, T. E., G. A. Johnson, F. W. Bazer, R. C. Burghardt, and M. Palmarini. 2007. Pregnancy recognition and conceptus implantation in domestic ruminants: roles of progesterone, interferons and endogenous retroviruses. Reproduction, Fertility and Development 19:65.

Spencer, T. E., G. A. Johnson, F. W. Bazer, and R. C. Burghardt. 2004. Implantation mechanisms: insights from the sheep. Reproduction (Cambridge, England) 128:657–68.

Spencer, T. E., G. A. Johnson, F. W. Bazer, and R. C. Burghardt. 2007. Fetal-maternal interactions during the establishment of pregnancy in ruminants. Society of Reproduction and Fertility supplement 64:379–96.

Spencer, T. E., O. Sandra, and E. Wolf. 2008. Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches. Reproduction (Cambridge, England) 135:165–179.

Spencer, T. E., A. G. Stagg, T. L. Ott, G. A. Johnson, W. S. Ramsey, and F. W. Bazer. 1999. Differential effects of intrauterine and subcutaneous administration of recombinant ovine interferon tau on the endometrium of cyclic ewes. Biology of reproduction 61:464–70.

Spencer, T. E. 1999. Identification and Characterization of Glycosylation-Dependent Cell Adhesion Molecule 1-Like Protein Expression in the Ovine Uterus. Biology of Reproduction 60:241–250.

Sreenan, J. 2001. Embryo survival rate in cattle: a major limitation to the achievement of high fertility. BSAS Occasional ….

Stahl, A. 1995. The urokinase-type plasminogen activator receptor, a GPI-linked protein, is localized in caveolae. The Journal of Cell Biology 129:335–344.

Stevenson, J. L., J. C. Dalton, T. L. Ott, K. E. Racicot, and R. C. Chebel. 2007. Correlation between reproductive status and steady-state messenger ribonucleic acid levels of the Myxovirus resistance gene, MX2, in peripheral blood leukocytes of dairy heifers. Journal of animal science 85:2163– 72.

Stewart, M. D., G. A. Johnson, C. A. Gray, R. C. Burghardt, L. A. Schuler, M. M. Joyce, F. W. Bazer, and T. E. Spencer. 2000. Prolactin receptor and uterine milk protein expression in the ovine endometrium during the estrous cycle and pregnancy. Biology of reproduction 62:1779–89.

Stewart, M. D., D. M. Stewart, G. A. Johnson, C. A. Vyhlidal, R. C. Burghardt, S. H. Safe, L. Y. Yu- Lee, F. W. Bazer, and T. E. Spencer. 2001. Interferon-tau activates multiple signal transducer and

131 activator of transcription proteins and has complex effects on interferon-responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 142:98–107.

Stocco, D. M. 1997. A StAR Search : Implications in Controlling Steroidogenesis ’. 336:328–336.

Stojkovic, M., E. Wolf, M. Büttner, U. Berg, G. Charpigny, A. Schmitt, and G. Brem. 1995. Secretion of biologically active interferon tau by in vitro-derived bovine trophoblastic tissue. Biology of reproduction 53:1500–7.

Strickland, S., E. Reich, and M. I. Sherman. 1976. Plasminogen activator in early embryogenesis: enzyme production by trophoblast and parietal endoderm. Cell 9:231–40.

Strongin, A. Y., I. Collier, G. Bannikov, B. L. Marmer, G. A. Grant, and G. I. Goldberg. 1995. Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. The Journal of biological chemistry 270:5331–8.

Sugawara, T., D. Lin, J. A. Holt, K. O. Martin, N. B. Javitt, W. L. Miller, and J. F. Strauss. 1995. Structure of the human steroidogenic acute regulatory protein (StAR) gene: StAR stimulates mitochondrial cholesterol 27-hydroxylase activity. Biochemistry 34:12506–12.

Sugino, N., T. Suzuki, S. Kashida, A. Karube, S. Takiguchi, and H. Kato. 2000. Expression of Bcl-2 and Bax in the human corpus luteum during the menstrual cycle and in early pregnancy: regulation by human chorionic gonadotropin. The Journal of clinical endocrinology and metabolism 85:4379–86.

Sumanas, S., H. J. Kim, S. B. Hermanson, and S. C. Ekker. 2002. Lateral line, nervous system, and maternal expression of Frizzled 7a during zebrafish embryogenesis. Mechanisms of development 115:107–11.

Swain, R. K., A. Medina, and H. Steinbeisser. 2001. Functional analysis of the Xenopus frizzled 7 protein domains using chimeric receptors. The International journal of developmental biology 45:259– 64.

Szekeres-Bartho, J., A. Barakonyi, E. Miko, B. Polgar, and T. Palkovics. 2001. The role of gamma/delta T cells in the feto-maternal relationship. Seminars in immunology 13:229–33.

Szekeres-Bartho, J. 1992. Immunosuppression by Progesterone in Pregnancy. CRC Press.

Taggart, C. C., S.-A. Cryan, S. Weldon, A. Gibbons, C. M. Greene, E. Kelly, T. B. Low, S. J. O’neill, and N. G. McElvaney. 2005. Secretory leucoprotease inhibitor binds to NF-kappaB binding sites in monocytes and inhibits p65 binding. The Journal of experimental medicine 202:1659–68.

Takagishi, Y., S. Futaki, K. Itoh, E. M. Espreafico, N. Murakami, Y. Murata, and S. Mochida. 2005. Localization of myosin II and V isoforms in cultured rat sympathetic neurones and their potential involvement in presynaptic function. The Journal of physiology 569:195–208.

Takeichi, M. 1995. Morphogenetic roles of classic cadherins. Current opinion in cell biology 7:619–27.

132

Tang, L., and D. E. Rancourt. 2005. Murine implantation serine proteinases 1 and 2: structure, function and evolution. Gene 364:30–6.

Teesalu, T., F. Blasi, and D. Talarico. 1996. Embryo implantation in mouse: fetomaternal coordination in the pattern of expression of uPA, uPAR, PAI-1 and alpha 2MR/LRP genes. Mechanisms of development 56:103–16.

Tekin, S., M. B. Padua, G. R. Newton, and P. J. Hansen. 2005. Identification and cloning of caprine uterine serpin. Molecular reproduction and development 70:262–70.

Tesfaye, D., A. Kadanga, F. Rings, K. Bauch, D. Jennen, K. Nganvongpanit, M. Hölker, E. Tholen, S. Ponsuksili, K. Wimmers, M. Montag, M. Gilles, G. Kirfel, V. Herzog, and K. Schellander. 2006. The effect of nitric oxide inhibition and temporal expression patterns of the mRNA and protein products of nitric oxide synthase genes during in vitro development of bovine pre-implantation embryos. Reproduction in domestic animals = Zuchthygiene 41:501–9.

Tesfaye, D., A. Regassa, F. Rings, N. Ghanem, C. Phatsara, E. Tholen, R. Herwig, C. Un, K. Schellander, and M. Hoelker. 2010. Suppression of the transcription factor MSX1 gene delays bovine preimplantation embryo development in vitro. Reproduction (Cambridge, England) 139:857–70.

Tessaro, I., A. M. Luciano, F. Franciosi, V. Lodde, D. Corbani, and S. C. Modina. 2011. The endothelial nitric oxide synthase/nitric oxide system is involved in the defective quality of bovine oocytes from low mid-antral follicle count ovaries. Journal of animal science 89:2389–96.

Thatcher, W. W., P. J. Hansen, T. S. Gross, S. D. Helmer, C. Plante, and F. W. Bazer. 1989. Antiluteolytic effects of bovine trophoblast protein-1. Journal of reproduction and fertility. Supplement 37:91–9.

Theil, E. C. 1987. Ferritin: structure, gene regulation, and cellular function in animals, plants, and microorganisms. Annual review of biochemistry 56:289–315.

Theil, E. C. 2003. Ferritin: at the crossroads of iron and oxygen metabolism. The Journal of nutrition 133:1549S–53S.

Thomas, J. P., P. G. Geiger, M. Maiorino, F. Ursini, and A. W. Girotti. 1990. Enzymatic reduction of phospholipid and cholesterol hydroperoxides in artificial bilayers and lipoproteins. Biochimica et biophysica acta 1045:252–60.

Tilly, J. L. 1996. Apoptosis and ovarian function. Reviews of reproduction 1:162–72.

TOMAC, J., Đ. CEKINOVIĆ, and J. ARAPOVIĆ. 2011. Biology of the Corpus luteum. Periodicum biologorum 113:43–49.

Tomee, J. F. C., P. S. Hiemstra, R. Heinzel‐Wieland, and H. F. Kauffman. 1997. Antileukoprotease: An Endogenous Protein in the Innate Mucosal Defense against Fungi. The Journal of Infectious Diseases 176:740–747.

133

Torti, F. M., and S. V Torti. 2002. Regulation of ferritin genes and protein. Blood 99:3505–16.

Townson, D. H., X. J. Wang, P. L. Keyes, J. L. Kostyo, and D. M. Stocco. 1996. Expression of the steroidogenic acute regulatory protein in the corpus luteum of the rabbit: dependence upon the luteotropic hormone, estradiol-17 beta. Biology of reproduction 55:868–74.

Toyokawa, K., S. J. Carling, and T. L. Ott. 2007. Cellular localization and function of the antiviral protein, ovine Mx1 (oMx1): I. Ovine Mx1 is secreted by endometrial epithelial cells via an “unconventional” secretory pathway. American journal of reproductive immunology (New York, N.Y. : 1989) 57:13–22.

Tranguch, S., A. Chakrabarty, Y. Guo, H. Wang, and S. K. Dey. 2007. Maternal pentraxin 3 deficiency compromises implantation in mice. Biology of reproduction 77:425–32.

Tribulo, H., D. Moreno, L. Cutaia, G. Gatti, R. Tribulo, M. Caccia, and G. Bo. 2002. Pregnancy rates in embryo recipients treated with progesterone vaginal devices, and eCG and transferred without estrus detection.

Trinchieri, G. 2007. Interleukin-10 production by effector T cells: Th1 cells show self control. The Journal of experimental medicine 204:239–43.

Tsukita, S., and M. Furuse. 2002. Claudin-based barrier in simple and stratified cellular sheets. Current opinion in cell biology 14:531–6.

Ulbrich, S. E., T. Frohlich, K. Schulke, E. Englberger, N. Waldschmitt, G. J. Arnold, H.-D. Reichenbach, M. Reichenbach, E. Wolf, H. H. D. Meyer, and S. Bauersachs. 2009. Evidence for estrogen- dependent uterine serpin (SERPINA14) expression during estrus in the bovine endometrial glandular epithelium and lumen. Biology of reproduction 81:795–805.

Ulbrich, S. E., E. Wolf, and S. Bauersachs. 2012. Hosting the preimplantation embryo: potentials and limitations of different approaches for analysing embryo-endometrium interactions in cattle. Reproduction, fertility, and development 25:62–70.

Ursini, F., and A. Bindoli. 1987. The role of selenium peroxidases in the protection against oxidative damage of membranes. Chemistry and physics of lipids 44:255–76.

Ursini, F., S. Heim, M. Kiess, M. Maiorino, A. Roveri, J. Wissing, and L. Flohé. 1999. Dual function of the selenoprotein PHGPx during sperm maturation. Science (New York, N.Y.) 285:1393–6.

Vailes, L. D., and J. H. Britt. 1990. Influence of footing surface on mounting and other sexual behaviors of estrual Holstein cows. Journal of animal science 68:2333–9.

Vasconcelos, J. L. M., M. H. C. Pereira, M. Meneghetti, C. C. Dias, O. G. S. Filho, and R. F. G. Peres. 2013. Relationships between growth of the preovulatory follicle and gestation success in lactating dairy cows Distribution of cows (%) PGF2α d ay 7 PGF2α d ay 8. :206–214.

134

Vasconcelos, J. L. M., S. Sangsritavong, S. J. Tsai, and M. C. Wiltbank. 2003. Acute reduction in serum progesterone concentrations after feed intake in dairy cows. Theriogenology 60:795–807.

Vasconcelos, J. L., R. Sartori, H. N. Oliveira, J. G. Guenther, and M. C. Wiltbank. 2001. Reduction in size of the ovulatory follicle reduces subsequent luteal size and pregnancy rate. Theriogenology 56:307–14.

Vasconcelos, J. L., R. W. Silcox, G. J. Rosa, J. R. Pursley, and M. C. Wiltbank. 1999. Synchronization rate, size of the ovulatory follicle, and pregnancy rate after synchronization of ovulation beginning on different days of the estrous cycle in lactating dairy cows. Theriogenology 52:1067–78.

Vicente-Manzanares, M., X. Ma, R. S. Adelstein, and A. R. Horwitz. 2009. Non-muscle myosin II takes centre stage in cell adhesion and migration. Nature reviews. Molecular cell biology 10:778–90.

Vicente-Manzanares, M., J. Zareno, L. Whitmore, C. K. Choi, and A. F. Horwitz. 2007. Regulation of protrusion, adhesion dynamics, and polarity by myosins IIA and IIB in migrating cells. The Journal of cell biology 176:573–80.

Visse, R., and H. Nagase. 2003. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circulation research 92:827–39.

Vogiagis, D., R. C. Fry, R. M. Sandeman, and L. A. Salamonsen. 1997. Leukaemia inhibitory factor in endometrium during the oestrous cycle, early pregnancy and in ovariectomized steroid-treated ewes. Reproduction 109:279–288.

Van Voorhis, B. J., K. Moore, P. J. Strijbos, S. Nelson, S. A. Baylis, D. Grzybicki, and C. P. Weiner. 1995. Expression and localization of inducible and endothelial nitric oxide synthase in the rat ovary. Effects of gonadotropin stimulation in vivo. The Journal of clinical investigation 96:2719–26.

Wagner, J. J., K. S. Lusby, J. W. Oltjen, J. Rakestraw, R. P. Wettemann, and L. E. Walters. 1988. Carcass composition in mature Hereford cows: estimation and effect on daily metabolizable energy requirement during winter. Journal of animal science 66:603–12.

Walker, C. G., M. D. Littlejohn, M. D. Mitchell, J. R. Roche, and S. Meier. 2012. Endometrial gene expression during early pregnancy differs between fertile and subfertile dairy cow strains. Physiological genomics 44:47–58.

Walker, C. G., S. Meier, M. D. Littlejohn, K. Lehnert, J. R. Roche, and M. D. Mitchell. 2010a. Modulation of the maternal immune system by the pre-implantation embryo. BMC genomics 11:474.

Walker, C. G., S. Meier, M. D. Littlejohn, K. Lehnert, J. R. Roche, and M. D. Mitchell. 2010b. Modulation of the maternal immune system by the pre-implantation embryo. BMC genomics 11:474.

Walters, D. L., D. Schams, and E. Schallenberger. 1984. Pulsatile secretion of gonadotrophins, ovarian steroids and ovarian oxytocin during the luteal phase of the oestrous cycle in the cow. Journal of reproduction and fertility 71:479–91.

135

Wang, Y., and D. Sassoon. 1995. Ectoderm-mesenchyme and mesenchyme-mesenchyme interactions regulate Msx-1 expression and cellular differentiation in the murine limb bud. Developmental biology 168:374–82.

Wathes, D. C., and R. W. Swann. 1982. Is oxytocin an ovarian hormone? Nature 297:225–227.

Wathes, D. C., and F. B. Wooding. 1980. An electron microscopic study of implantation in the cow. The American journal of anatomy 159:285–306.

Weber, G. F., and H. Cantor. 1996. The immunology of Eta-1/osteopontin. Cytokine & growth factor reviews 7:241–8.

Welsh, T. H., L. Z. Zhuang, and A. J. Hsueh. 1983. Estrogen augmentation of gonadotropin- stimulated progestin biosynthesis in cultured rat granulosa cells. Endocrinology 112:1916–24.

Wildt, L., A. Häusler, G. Marshall, J. S. Hutchison, T. M. Plant, P. E. Belchetz, and E. Knobil. 1981. Frequency and amplitude of gonadotropin-releasing hormone stimulation and gonadotropin secretion in the rhesus monkey. Endocrinology 109:376–85.

Williams, G. T., and C. A. Smith. 1993. Molecular regulation of apoptosis: genetic controls on cell death. Cell 74:777–9.

Wilmut, I., and D. I. Sales. 1981. Effect of an asynchronous environment on embryonic development in sheep. Journal of reproduction and fertility 61:179–84.

Wisniewski, H.-G., and J. Vilcek. 2004. Cytokine-induced gene expression at the crossroads of innate immunity, inflammation and fertility: TSG-6 and PTX3/TSG-14. Cytokine & growth factor reviews 15:129–46.

Woad, K. J., A. J. Hammond, M. Hunter, G. E. Mann, M. G. Hunter, and R. S. Robinson. 2009. FGF2 is crucial for the development of bovine luteal endothelial networks in vitro. Reproduction (Cambridge, England) 138:581–8.

Wolfenson, D., G. Inbar, Z. Roth, M. Kaim, A. Bloch, and R. Braw-Tal. 2004. Follicular dynamics and concentrations of steroids and gonadotropins in lactating cows and nulliparous heifers. Theriogenology 62:1042–55.

Wu, G., and S. M. Morris. 1998. Arginine metabolism: nitric oxide and beyond. The Biochemical journal 336 ( Pt 1:1–17.

Wylie, S. R., and P. D. Chantler. 2001. Separate but linked functions of conventional myosins modulate adhesion and neurite outgrowth. Nature cell biology 3:88–92.

Wylie, S. R., P. J. Wu, H. Patel, and P. D. Chantler. 1998. A conventional myosin motor drives neurite outgrowth. Proceedings of the National Academy of Sciences of the United States of America 95:12967–72.

136

Xiao, C. W., and A. K. Goff. 1999. Hormonal regulation of oestrogen and progesterone receptors in cultured bovine endometrial cells. Journal of reproduction and fertility 115:101–9.

Xu, W., B. He, A. Chiu, A. Chadburn, M. Shan, M. Buldys, A. Ding, D. M. Knowles, P. A. Santini, and A. Cerutti. 2007. Epithelial cells trigger frontline immunoglobulin class switching through a pathway regulated by the inhibitor SLPI. Nature immunology 8:294–303.

Yadav, V., G. Lakshmi, and R. Medhamurthy. 2004. Prostaglandin $F_2_a$-mediated activation of apoptotic signaling cascades in the corpus luteum during apoptosis: Involvement of caspase activated DNase. yj.

Yamamoto, H., S. Kishida, M. Kishida, S. Ikeda, S. Takada, and A. Kikuchi. 1999. Phosphorylation of axin, a Wnt signal negative regulator, by glycogen synthase kinase-3beta regulates its stability. The Journal of biological chemistry 274:10681–4.

Yamazaki, F., T. Kuroiwa, O. Takikawa, and R. Kido. 1985. Human indolylamine 2,3- dioxygenase. Its tissue distribution, and characterization of the placental enzyme. The Biochemical journal 230:635–8.

Yang, D. C., X. Jiang, R. L. Elliott, and J. F. Head. 2002. Antisense ferritin oligonucleotides inhibit growth and induce apoptosis in human breast carcinoma cells. Anticancer research 22:1513–24.

Yankey, S. J., B. A. Hicks, K. G. Carnahan, A. M. Assiri, S. J. Sinor, K. Kodali, J. N. Stellflug, and T. L. Ott. 2001. Expression of the antiviral protein Mx in peripheral blood mononuclear cells of pregnant and bred, non-pregnant ewes. The Journal of endocrinology 170:R7–11.

Yant, L. J., Q. Ran, L. Rao, H. Van Remmen, T. Shibatani, J. G. Belter, L. Motta, A. Richardson, and T. A. Prolla. 2003. The selenoprotein GPX4 is essential for mouse development and protects from radiation and oxidative damage insults. Free radical biology & medicine 34:496–502.

Yip, J. W., Y. P. Yip, K. Nakajima, and C. Capriotti. 2000. Reelin controls position of autonomic neurons in the spinal cord. Proceedings of the National Academy of Sciences of the United States of America 97:8612–6.

Yokosaki, Y., K. Tanaka, F. Higashikawa, K. Yamashita, and A. Eboshida. 2005. Distinct structural requirements for binding of the integrins alphavbeta6, alphavbeta3, alphavbeta5, alpha5beta1 and alpha9beta1 to osteopontin. Matrix biology : journal of the International Society for Matrix Biology 24:418–27.

Yoshida, R., T. Nukiwa, Y. Watanabe, M. Fujiwara, F. Hirata, and O. Hayaishi. 1980. Regulation of indoleamine 2,3-dioxygenase activity in the small intestine and the epididymis of mice. Archives of biochemistry and biophysics 203:343–51.

Yoshida, R., S. W. Park, H. Yasui, and O. Takikawa. 1988. Tryptophan degradation in transplanted tumor cells undergoing rejection. Journal of immunology (Baltimore, Md. : 1950) 141:2819–23.

137

Yoshida, R., Y. Urade, M. Tokuda, and O. Hayaishi. 1979. Induction of indoleamine 2,3- dioxygenase in mouse lung during virus infection. Proceedings of the National Academy of Sciences of the United States of America 76:4084–6.

Young, M. J., C. D. Clyne, T. J. Cole, and J. W. Funder. 2001. Cardiac steroidogenesis in the normal and failing heart. The Journal of clinical endocrinology and metabolism 86:5121–6.

Yu, H.-M. I., B. Jerchow, T.-J. Sheu, B. Liu, F. Costantini, J. E. Puzas, W. Birchmeier, and W. Hsu. 2005. The role of Axin2 in calvarial morphogenesis and craniosynostosis. Development (Cambridge, England) 132:1995–2005.

Yuan, W., and R. M. Krug. 2001. Influenza B virus NS1 protein inhibits conjugation of the interferon (IFN)-induced ubiquitin-like ISG15 protein. The EMBO journal 20:362–71.

Zackrisson, U., M. Mikuni, A. Wallin, D. Delbro, L. Hedin, and M. Brännström. 1996. Cell-specific localization of nitric oxide synthases (NOS) in the rat ovary during follicular development, ovulation and luteal formation. Human reproduction (Oxford, England) 11:2667–73.

Zalman, Y., E. Klipper, S. Farberov, M. Mondal, G. Wee, J. K. Folger, G. W. Smith, and R. Meidan. 2012. Regulation of angiogenesis-related prostaglandin f2alpha-induced genes in the bovine corpus luteum. Biology of reproduction 86:92.

Zeng, F., and R. M. Schultz. 2003. Gene expression in mouse oocytes and preimplantation embryos: use of suppression subtractive hybridization to identify oocyte- and embryo-specific genes. Biology of reproduction 68:31–9.

Zhang, X., G. M. Kidder, C. Zhang, F. Khamsi, and D. T. Armstrong. 1994. Expression of plasminogen activator genes and enzymatic activities in rat preimplantation embryos. Journal of reproduction and fertility 101:235–40.

Zhang, X. 1996. Regulation of urokinase plasminogen activator production in implanting mouse embryo: effect of embryo interaction with extracellular matrix. Biology of Reproduction 54:1052–1058.

Zhou, M., and Y.-L. Wang. 2008. Distinct pathways for the early recruitment of myosin II and actin to the cytokinetic furrow. Molecular biology of the cell 19:318–26.

138