• Abstract and Figures
• Public Full-text

Computing with DNA The manipulation of DNA to solve mathematical problems is redefining what is meant by “computation” by Leonard M. Adleman omputer. The word conjures tunately, I had been remarkably unsuc- ated exclusively with the physical sci- up images of keyboards and cessful in communicating my ideas to ences. Biology was now the study of in- C monitors. Terms like “ROM,” the AIDS research community. So, in an formation stored in DNA—strings of “RAM,” “gigabyte” and “megahertz” effort to become a more persuasive ad- four letters: A, T, G and C for the bases come to mind. We have grown accus- vocate, I decided to acquire a deeper adenine, thymine, guanine and cyto- tomed to the idea that computation understanding of the biology of HIV. sine—and of the transformations that takes place using electronic compo- Hence, the molecular biology lab. There, information undergoes in the cell. There nents on a silicon substrate. under the guidance of Nickolas Chelya- was mathematics here! But must it be this way? The comput- pov (now chief scientist in my own lab- Late one evening, while lying in bed er that you are using to read these oratory), I began to learn the methods reading Watson’s text, I came to a de- words bears little resemblance to a PC. of modern biology. scription of DNA polymerase. This is Perhaps our view of computation is too I was fascinated. With my own hands, the king of enzymes—the maker of life. limited. What if computers were ubiq- I was creating DNA that did not exist Under appropriate conditions, given a uitous and could be found in many in nature. And I was introducing it into strand of DNA, DNA polymerase pro- forms? Could a liquid computer exist in bacteria, where it acted as a blueprint for duces a second “Watson-Crick” com- which interacting molecules perform producing proteins that would change plementary strand, in which every C is computations? The answer is yes. This the very nature of the organism. replaced by a G, every G by a C, every is the story of the DNA computer. During this period of intense learn- A by a T and every T by an A. For ex- ing, I began reading the classic text The ample, given a molecule with the se- Rediscovering Biology Molecular Biology of the Gene, co-au- quence CATGTC, DNA polymerase thored by James D. Watson of Watson- will produce a new molecule with the y involvement in this story began Crick fame. My concept of biology was sequence GTACAG. The polymerase Min 1993, when I walked into a being dramatically transformed. Biolo- enables DNA to reproduce, which in molecular biology lab for the first time. gy was no longer the science of things turn allows cells to reproduce and ulti- Although I am a mathematician and that smelled funny in refrigerators (my mately allows you to reproduce. For a computer scientist, I had done a bit of view from undergraduate days in the strict reductionist, the replication of AIDS research, which I believed and still 1960s at the University of California at DNA by DNA polymerase is what life believe to be of importance [see “Bal- Berkeley). The field was undergoing a is all about. anced Immunity,” by John Rennie; Sci- revolution and was rapidly acquiring DNA polymerase is an amazing little entific American, May 1993]. Unfor- the depth and power previously associ- nanomachine, a single molecule that 54 Scientific American August 1998 Computing with DNA Copyright 1998 Scientific American, Inc. DNA MOLECULES—with their sequences of adenine, thymine, guanine and cytosine (repre- sented by the letters A, T, G and C)—can be used to store information and to perform com- putations. The molecule shown here in color, GCAGTCGGACTGGGCTATGTCCGA, en- codes the solution to the sample Hamiltonian Path Problem on the next page. “hops” onto a strand of DNA and slides and a mechanism called a finite control, My initial thinking was to make a along it, “reading” each base it passes which moved along the “input” tape DNA computer in the image of a Tur- and “writing” its complement onto a reading data while simultaneously mov- ing machine, with the finite control re- new, growing DNA strand. While lying ing along the “output” tape reading and placed by an enzyme. Remarkably, es- there admiring this amazing enzyme, I writing other data. The finite control sentially the same idea had been sug- was struck by its similarity to something was programmable with very simple in- gested almost a decade earlier by Charles described in 1936 by Alan M. Turing, structions, and one could easily write a H. Bennet and Rolf Landauer of IBM the famous British mathematician. Tur- program that would read a string of A, [see “The Fundamental Physical Limits ing—and, independently, Kurt Gödel, T, C and G on the input tape and write of Computation”; Scientific Ameri- Alonzo Church and S. C. Kleene—had the Watson-Crick complementary string can, July 1985]. Unfortunately, while an begun a rigorous study of the notion of on the output tape. The similarities with enzyme (DNA polymerase) was known “computability.” This purely theoreti- DNA polymerase could hardly have that would make Watson-Crick comple- cal work preceded the advent of actual been more obvious. ments, it seemed unlikely that any exist- computers by about a decade and led to But there was one important piece of ed for other important roles, such as some of the major mathematical results information that made this similarity factoring numbers. of the 20th century [see “Unsolved truly striking: Turing’s toy computer This brings up an important fact Problems in Arithmetic,” by Howard had turned out to be universal—simple about biotechnologists: we are a com- DeLong; Scientific American, March as it was, it could be programmed to munity of thieves. We steal from the 1971; and “Randomness in Arithme- compute anything that was computable cell. We are a long way from being able tic,” by Gregory J. Chaitin; Scientific at all. (This notion is essentially the con- American, July 1988]. tent of the well-known “Church’s the- For his study, Turing had invented a sis.”) In other words, one could program “toy” computer, now referred to as a a Turing machine to produce Watson- Turing machine. This device was not Crick complementary strings, factor intended to be real but rather to be con- numbers, play chess and so on. This re- ceptual, suitable for mathematical in- alization caused me to sit up in bed and vestigation. For this purpose, it had to remark to my wife, Lori, “Jeez, these be extremely simple—and Turing suc- things could compute.” I did not sleep ASHIMA ceeded brilliantly. One version of his the rest of the night, trying to figure out OMO NAR machine consisted of a pair of tapes a way to get DNA to solve problems. T Computing with DNA Scientific American August 1998 55 Copyright 1998 Scientific American, Inc. Hamiltonian Path Problem onsider a map of cities connected by certain nonstop Detroit Cflights (top right). For instance, in the example shown here, it is possible to travel directly from Boston to Detroit but not vice versa. The goal is to determine whether a path exists that will commence at the start city (Atlanta), finish at the end city (De- troit) and pass through each of the remaining cities exactly once. In DNA computation, each city is assigned a DNA sequence Chicago Boston (ACTTGCAG for Atlanta) that can be thought of as a first name (ACTT) followed by a last name (GCAG). DNA flight numbers can then be defined by concatenating the last name of the city of origin with the first name of the city of destination (bottom right). The complementary DNA city names are the Watson-Crick Atlanta complements of the DNA city names in which every C is replaced by a G, every G by a C, every A by a T, and every T by an A. (To sim- CITY DNA NAME COMPLEMENT plify the discussion here, details of the 3′ versus 5′ ends of the DNA molecules have been omitted.) For this particular problem, ATLANTA ACTTGCAG TGAACGTC only one Hamiltonian path exists, BOSTON TCGGACTG AGCCTGAC and it passes through Atlanta, CHICAGO GGCTATGT CCGATACA Boston, Chicago and Detroit in that DETROIT CCGAGCAA GGCTCGTT order. In the computation, this FLIGHT DNA FLIGHT NUMBER path is represented by GCAGTCG- ATLANTA - BOSTON GCAGTCGG END GACTGGGCTATGTCCGA, a DNA se- ATLANTA - DETROIT GCAGCCGA quence of length 24. Shown at the BOSTON - CHICAGO ACTGGGCT START left is the map with seven cities BOSTON - DETROIT ACTGCCGA and 14 nonstop flights used in the BOSTON - ATLANTA ACTGACTT CHICAGO - DETROIT ATGTCCGA actual experiment. —L.M.A. SLIM FILMS to create de novo miraculous molecular were at hand. These tools were essen- weak forces such as hydrogen bonds. If machines such as DNA polymerase. tially the following: a molecule of DNA in solution meets a Fortunately, three or four billion years DNA molecule to which it is not com- of evolution have resulted in cells that 1. Watson-Crick pairing. As stated plementary (and has no long stretches are full of wondrous little machines. It earlier, every strand of DNA has its Wat- of complementarity), then the two mol- is these machines, stolen from the cell, son-Crick complement. As it happens, ecules will not anneal. that make modern biotechnology possi- if a molecule of DNA in solution meets 2. Polymerases. Polymerases copy in- ble. But a molecular machine that would its Watson-Crick complement, then the formation from one molecule into an- play chess has apparently never evolved.

Load more

  8

Copy Link