DOCSLIB.ORG

JCI Suppli Fig1 Revised Ver1のコピー

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
JCI Suppli Fig1 Revised Ver1のコピー Supplemental Figure 1 A Ptf1a-CreER; KrasG12D; Brg1f/f B Ptf1a-CreER; KrasG12D; Brg1f/f Brg1-positive PanIN Brg1-negative PanIN Brg1-positive PanIN Brg1-negative PanIN Alcian blue Alcian blue / / Brg1 Brg1 p16 p53 Supplemental Figure 1. The tumor suppressor genes p16 and p53 are down-regulated in BRG1-depleted PanINs. (A) Immunohistochemistry of serial sections for BRG1 and p16 in Ptf1a-CreER; KrasG12D; Brg1f/f mice. Arrowheads indicated p16-positive cells. Scale bars: 50μm. (B) Immunohistochemistry of serial sections for BRG1 and p53 in Ptf1a-CreER; KrasG12D; Brg1f/f mice. Scale bars: 50μm. A Supplemental Figure 2 ER Ptf1a Cre Ptf1a CreER Brg1 Brg1 Brg1 Brg1 G12D +Tam Brg1 Kras STOP Kras Kras KrasG12D R172H R172H p53 STOP Trp53 p53 Trp53 STOP d0 6m STOP Tam Sacrifice B R172H f/+ Brg1 ; Trp53 G12D ; Kras ER f/f Brg1 Ptf1a-Cre H&E Brg1 pERK Ki67 C d-14 d0 4m Tam Caerulein Sacrifice ; f/f G12D ;Brg1 ; Kras ER R172H Trp53 Ptf1a-Cre H&E Brg1 pERK Ki67 Supplemental Figure 2. Acinar-specific ablation of Brg1 attenuates PDA formation in the background of oncogenic KRAS and mutant p53. (A) The genetic strategy used to delete Brg1 and activate oncogenic Kras and mutant p53 in adult pancreatic acinar cells, in addition to experimental design for tamoxifen administration and analysis. (B) H&E staining and immunohistochemistry for BRG1, phospho-ERK and Ki67 of PDAs in Ptf1a-CreER; KrasG12D; Trp53R172H; Brg1f/f mice and littermate controls. Scale bars: 50μm. (C) Upper: Experimental design for tamoxifen administration, caerulein acute pancreatitis and analysis. Lower: H&E staining and immunohistochemistry for BRG1, phospho-ERK and Ki67 of PDAs in caerulein treated Ptf1a-CreER; KrasG12D; Trp53R172H; Brg1f/f mice. Scale bars: 50μm. Supplemental Figure 3 A B * ** 2 WT Ptf1a-Cre; 30 Brg1f/f 1.5 WT ****** * *** 20 1 f/f (% of ADM) +Tgf-α 10 0.5 0 0 Tgf-α - + - + Relative expression of mRNA Ptf1a-Cre; Brg1 WT Ptf1a-Cre; Brg1f/f acinar duct progenitor marker marker marker C D KrasG12D; Brg1f/f / KrasG12D 50 *** 2 40 Acvr2b Clu Rfx3 Sox4 Glis3 Foxo1 Ptpn6 Insr Invs Igf1r Bglap2 Il6ra Nkx2-2 Xbp1 Sox9 Ptf1a Eif2ak3 Selt Smad2 Kras 30 1 Pdx1 20 Pde3b Ad-Cre f/f 1/2 Onecut2 (% of ADM) 10 1/4 0 Kras; Brg1 Kras Kras; Brg1f/f Microarray mRNA fold change 1/8 Supplemental Figure 3. Primary acinar cell culture reveals that Brg1 promotes Sox9 expression. (A) Left: Brightfield images of acinar cell clusters from WT and Ptf1a-Cre; Brg1f/f mice after 5 days of culture in collagen gel with TGF-α. Scale bars: 50μm. Right: Quantification of cystic ductal strictures in 3D-cultured acinar cell clusters from WT and Ptf1a-Cre; Brg1f/f mice after 5 days of culture in collagen gel with or without TGF-α. n=3 per genotype; means ± SEM are shown. * P < 0.05, Student’s t test. (B) RT-PCR analysis of isolated acini from WT and Ptf1a-Cre; Brg1f/f mice. Genes important for pancreatic development and maintenance of pancreatic lineages are examined. n=3 per genotype; means ± SEM are shown. * P < 0.05, ** P < 0.01, and *** P < 0.001, Student’s t test. (C) Left: Brightfield images of acinar cell clusters from KrasG12D and KrasG12D; Brg1f/f mice after 5 days of culture in collagen gel. Cells were infected with Ad-Cre on day 0. Scale bars: 50μm. Right: Quantification of cystic ductal strictures in 3D-cultured acinar cell clusters from Ad-Cre-infected KrasG12D and KrasG12D; Brg1f/f acini after 5 days of culture in collagen gel. n=3 per genotype; means ± SEM are shown. *** P < 0.001, Student’s t test. (D) Fold changes in the expression of genes implicated in pancreas development and maintenance of pancreatic differentiation for Ad-Cre-infected KrasG12D; Brg1f/f acini after 24h of culture relative to control Ad-Cre-infected KrasG12D acini after 24h of culture. Supplemental Figure 4 A WT 1.6 Ptf1a-Cre; Brg1f/f 1.4 1.2 1 0.8 0.6 0.4 0.2 0 (Relative expression of mRNA) Supplemental Figure 4. Expression of upstream regulators of Sox9 in the pancreas is not significantly changed in Brg1-depleted acinar cells (A) RT-PCR analysis of Sox9 upstream regulators in isolated acini from WT and Ptf1a-Cre; Brg1f/f mice. n=3 per genotype; means ± SEM are shown. Student’s t test. Supplemental Figure 5 A Ptf1a-CreER; KrasG12D; Sox9OE; Brg1f/f Alcian blue / Brg1 Brg1-positive PanIN Brg1-negative PanIN B 185-fold change 267-fold change * 8 * 15 7 6 10 5 4 3 5 BRG1-positive BRG1-negative 2 1 Alcian blue positive area (%) 0 Alcian blue positive area (%) 0 Ptf1a-CreER; Ptf1a-CreER; Ptf1a-CreER; Ptf1a-CreER; Kras; Brg1f/f Kras; Sox9OE; Kras; Brg1f/f Kras; Sox9OE; Brg1f/f Brg1f/f Supplemental Figure 5. Sox9 overexpression accelerates KRAS-driven PanIN formation in mice. (A) Immunohistochemistry for BRG1 and alcian blue staining of Ptf1a-CreER; KrasG12D; Sox9OE; Brg1f/f mice. Representative BRG1-positive and BRG1-negative PanINs from the same sample are shown. Scale bars: 50μm. (B) Quantification of BRG1-positive and BRG1-negative PanINs in Ptf1a-CreER; KrasG12D; Brg1f/f mice and Ptf1a-CreER; KrasG12D; Sox9OE; Brg1f/f mice. n=3-4 mice per genotype; means ± SEM are shown. * P<0.05, Student’s t test. Supplemental Figure 6 A (8-16w old) day0 day3 Tam Sacrifice B Pdx1-FLP; FSFKrasG12D Pdx1-FLP; FSFKrasG12D; FSF-R26CAG-CreERT2; Brg1f/f 2.5 * 2 1.5 CC3 1 0.5 CC3 positive cells / PanIN 0 Pdx1-FLP; FSFKrasG12D Pdx1-FLP; FSFKrasG12D; FSF-R26CAG-CreERT2; Brg1f/f Supplemental Figure 6. Loss of BRG1 in established PanIN results in its apoptosis. (A) Experimental design for tamoxifen administration and analysis. (B) Immunohistochemistry for cleaved caspase 3 (CC3) in Pdx1-Flp; FSF-KrasG12D and Pdx1-Flp; FSF-KrasG12D; FSF-R26CAG-CreERT2; Brg1f/f mice 3 days after tamoxifen injection. Scale bars: 200μm. Right bar graphs are quantification for CC3 positive cells per PanIN lesion. n=3 per genotype; means ± SEM are shown. *P<0.05, Student’s t test. Supplemental Figure 7 A B PDA_2 PDA_3 PDA_1 PDA_2 PDA_3 PDA_4 PDA_5 ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ●● ● TP53 Nonsense mutation ● ● ●●● ● ● ● ●●● ● ● ● ● ●● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ●● ● ● ● ●●● ● ● ●●● ● ●● ● ●●● ● ●●● ●● ● ●● ● ●●● ● ● ●● ● ● ● ● total CN KRAS Frameshift insertion/deletion total CN 0 2 4 CDKN2A Missense mutation 0 2 4 TGFBR2 Multiple mutation hetero hetero BRG1 Homozygous deletion SNPs SNPs Deletion ● ● ● ● ●● ●●● ● ● ●● ● ● ● ●● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ●● ● ● ●● ● ● Loss of heterozygosity ● ● ● ●●● ●● ● ●● ●●● ● ● ● AsCN ● AsCN 0 1 2 0 1 2 C * 5000 ● 4000 3000 BRG1 Deletion Diploid 2000 Relative expression 1000 ● 0 Deletion Diploid BRG1 Supplemental Figure 7 Result of targeted sequence of BRG1-low human PDA samples (A) Mutational landscape of BRG1-low human PDA samples. KRAS, TP53, CDKN2A and TGFBR2 are shown as quality controls. Deletion of BRG1 is detected in 2 of 5 BRG1-low human PDA samples. (B) Detail of loss of chromosome 19p in PDA_2 and PDA_3. Total copy number (total CN) and allele specific copy number (AsCN) are shown. Copy number abnormalities are shown as black bar. Red triangle shows where BRG1 is located on. (C) Relationship between deletion of BRG1 and BRG1 mRNA expression from a cohort of 76 high purity samples in the TCGA data set. In the box-and-whisker plots, horizontal bars indicate the medians, boxes indicate 25th to 75th percentiles, and whiskers indicate minimum to maximum without outlier. *P<0.05, Mann-Whitney U test. Supplemental Figure 8 A B 8 9 SOX9 7.5 *** * 7 8 6.5 7 6 5.5 r=0.303 6 5 5 4.5 Relative mRNA expression 4 4 Relative mRNA expression of 5.5 6 6.5 7 7.5 Relative mRNA expression of BRG1 High Low High Low BRG1 BRG1 BRG1 BRG1 BRG1 SOX9 Supplemental Figure 8 BRG1 expression correlates with SOX9 expression in human PDAs. (A) Plots of mRNA expression of BRG1 and SOX9 from a cohort of 96 patients in QCMG data set. (B) The box-and-whisker plot demonstrates the differential expression for SOX9 between the BRG1-high (n =71, the higher 75%) and BRG1-low groups (n = 25, the lower 25%) from a cohort of 96 patients in the QCMG data set. In the box-and-whisker plots, horizontal bars indicate the medians, boxes indicate 25th to 75th percentiles, and whiskers indicate minimum to maximum without outlier. * P < 0.05 and *** P < 0.001, Student’s t test. Supplemental Table 1: Differently expressed genes in Kras G12D vs. Brg1 f/f acinar cell explants up down gene symbol fold change (log) gene symbol fold change (log) S100a6 3.7695728 G6pc2 -4.3786884 Krtap16-1 3.4862444 Fgl1 -3.9309574 Pecam1 3.46082 Lgals4 -3.1478798 Plvap 3.3369914 Ncor1 -3.1447362 Vaultrc5 2.9253636 Csrnp1 -3.12215 D8Ertd158e 2.8899298 Pdyn -3.1156846 Sprr1a 2.8063721 Espn -3.0293398 Cfb 2.7875106 Scg2 -2.9722324 Pxdn 2.7104712 Cyp2s1 -2.9414282 Zdhhc1 2.7012344 Slc39a10 -2.9306106 Ruvbl2 2.6697236 Zfp207 -2.9113906 Col1a1 2.549479 Rbm25 -2.8066914 Cxxc4 2.5407706 Hif3a -2.775671 Sprr2b 2.5220404 Ins1 -2.7639676 C5ar2 2.5090246 Ctsc -2.7582578 Parp3 2.5035262 Cib1 -2.7560214 Crhr1 2.4913382 Nnat -2.7315292 Tbc1d21 2.4566574 Fxyd3 -2.7256318 Oasl1 2.4398156 Nol3 -2.6992188 Sox15 2.411714 Kif5c -2.669723 Ecscr 2.3602772 Ins2 -2.6675257 Pglyrp1 2.3591118 Cyp2b10 -2.6431714 Vim 2.3278822 Crem -2.6197104 Atp1a3 2.317926 Hnrnpu -2.5793944 Rnase4 2.3134738 Smarca4 -2.5635176 Fhl2 2.3066534 Slco2b1 -2.5530882 Tiam1 2.303306 Espn -2.5276976 Fut4 2.302178 9530006C21Rik -2.5276084 Flna 2.2909526 Spock2 -2.5149002 Col4a2 2.283824 Gpr161 -2.507926 Cfb 2.246233 Rlf -2.5061864 Olfr700 2.237329 Ptprn -2.4990774 Sprr2k 2.2317066 Camta1 -2.4960784 Zmynd10 2.229248 Spaca6 -2.4613834 Ubash3b 2.21154 Oas1b -2.4521666 Stk10 2.1982666 Mrpl24 -2.4520208
Load more

Recommended publications
  • Integrative Analysis of Phenomic, Genomic, and Transcriptomic To
    bioRxiv preprint doi: https://doi.org/10.1101/2020.11.29.392167; this version posted November 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Integrative Analysis of Phenomic, Genomic, and Transcriptomic to Identify Potential Functional Genes of Yaks in Plain and Plateau Jiabo Wang1,2, §, Jiuqiang Guan3, §, Kangzhu Yixi1,2,Tao Shu1, Zhixin Chai1,2, Jikun Wang1,2, Hui Wang1,2, Zhijuan Wu1,2, Xin Cai1,2, Jincheng Zhong1,2*,Xiaolin Luo3* 1. Key Laboratory of Qinghai-Tibetan Plateau Animal Genetic Resource Reservation and Utilization (Southwest Minzu University), Ministry of Education，Chengdu, Sichuan, China; 2. Qinghai-Tibetan Plateau Animal Genetic Resource Reservation and Utilization Key Laboratory of Sichuan Province, Chengdu, Sichuan, China; 3. Sichuan Academy of Grassland Sciences, Chengdu, Sichuan, China; §These authors contributed equally to this work. *Correspondences should be addressed to JZ ([email protected]) and XL ([email protected]) bioRxiv preprint doi: https://doi.org/10.1101/2020.11.29.392167; this version posted November 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Background: The yak is an important source of livelihood for the people living in the Qinghai-Tibet Plateau. Most genetics detection studies have focused on the comparison between different tissues of different breeds, both living in the Plateau and in the plains. The genetic background and complex regulatory relationship have frequently puzzled researchers. In this study, we divided a population of 10 yaks into two subgroups, namely Plateau (living in the Plateau) and Plain (living in the plains).
    [Show full text]
  • COX10 (NM 001303) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119292 COX10 (NM_001303) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COX10 (NM_001303) Human Untagged Clone Tag: Tag Free Symbol: COX10 Synonyms: MC4DN3 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_001303, the custom clone sequence may differ by one or more nucleotides ATGGCCGCATCTCCGCACACTCTCTCCTCACGCCTCCTGACAGGTTGCGTAGGAGGCTCTGTCTGGTATC TTGAAAGAAGAACTATACAGGACTCCCCTCACAAGTTCTTACATCTTCTCAGGAATGTCAATAAGCAGTG GATTACATTTCAGCACTTTAGCTTCCTCAAACGCATGTATGTCACACAGCTGAACAGAAGCCACAACCAG CAAGTAAGACCCAAGCCAGAACCAGTAGCATCTCCTTTCCTTGAAAAAACATCTTCAGGTCAAGCCAAAG CAGAAATATATGAGATGAGACCTCTCTCACCGCCCAGCCTATCTTTGTCCAGAAAGCCAAATGAAAAGGA ATTGATAGAACTAGAGCCAGACTCAGTAATTGAAGACTCAATAGATGTAGGGAAAGAGACAAAAGAGGAA AAGCGGTGGAAAGAGATGAAGCTGCAAGTGTATGATTTGCCAGGAATTTTGGCTCGACTATCCAAAATCA AACTCACAGCTCTGGTTGTAAGTACCACTGCAGCTGGATTTGCATTGGCTCCGGGCCCTTTTGACTGGCC CTGTTTCCTGCTTACTTCTGTTGGGACAGGCCTTGCATCCTGTGCTGCCAACTCCATCAATCAGTTTTTT GAGGTGCCATTTGACTCAAACATGAATAGGACAAAGAACAGACCGCTGGTTCGTGGACAGATCAGCCCAT TGCTAGCTGTGTCCTTTGCCACTTGTTGTGCTGTTCCGGGAGTTGCCATTCTGACCTTGGGGGTGAATCC ACTCACAGGAGCCCTGGGGCTCTTCAACATTTTCCTGTATACCTGCTGCTACACACCACTGAAAAGGATC AGCATTGCCAACACATGGGTCGGAGCTGTGGTTGGGGCCATCCCGCCTGTCATGGGCTGGACAGCGGCCA CGGGCAGCCTCGATGCTGGCGCATTTCTCCTGGGAGGAATCCTCTACTCCTGGCAGTTTCCTCATTTCAA
    [Show full text]
  • Role of DCP1-DCP2 Complex Regulated by Viral and Host Micrornas in DNA Virus Infection T
    Fish and Shellfish Immunology 92 (2019) 21–30 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Role of DCP1-DCP2 complex regulated by viral and host microRNAs in DNA virus infection T ∗ Yuechao Sun, Xiaobo Zhang College of Life Sciences and Laboratory for Marine Biology and Biotechnology of Qingdao National Laboratory for Marine Science and Technology, Zhejiang University, Hangzhou, 310058, People's Republic of China ARTICLE INFO ABSTRACT Keywords: The DCP1-DCP2 complex can regulate the antiviral immunity of animals by the decapping of retrovirus RNAs DCP1-DCP2 complex and the suppression of RNAi during RNA virus infection. However, the influence of DCP1-DCP2 complex on DNA miRNA virus infection and the regulation of DCP1-DCP2 complex by microRNAs (miRNAs) remain unclear. In this study, DNA virus infection the role of miRNA-regulated DCP1-DCP2 complex in DNA virus infection was characterized. Our results showed that the DCP1-DCP2 complex played a positive role in the infection of white spot syndrome virus (WSSV), a DNA virus of shrimp. In the DCP1-DCP2 complex, the N-terminal regulatory domain of DCP2 was interacted with the EVH1 domain of DCP1. Furthermore, shrimp miRNA miR-87 inhibited WSSV infection by targeting the host DCP2 gene and viral miRNA WSSV-miR-N46 took a negative effect on WSSV replication by targeting the host DCP1 gene. Therefore, our study provided novel insights into the underlying mechanism of DCP1-DCP2 complex and its regulation by miRNAs in virus-host interactions. Importance: During RNA virus infection, the DCP1-DCP2 complex can play important roles in the animal anti- viral immunity by decapping retrovirus RNAs and suppressing RNAi.
    [Show full text]
  • Roles of the CSE1L-Mediated Nuclear Import Pathway in Epigenetic
    Roles of the CSE1L-mediated nuclear import pathway PNAS PLUS in epigenetic silencing Qiang Donga,b,c, Xiang Lia,b,c, Cheng-Zhi Wangb, Shaohua Xuc, Gang Yuanc, Wei Shaoc, Baodong Liud, Yong Zhengb, Hailin Wangd, Xiaoguang Leic,e,f, Zhuqiang Zhangb,1, and Bing Zhua,b,g,1 aGraduate Program, Peking Union Medical College and Chinese Academy of Medical Sciences, 100730 Beijing, China; bNational Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 100101 Beijing, China; cNational Institute of Biological Sciences, 102206 Beijing, China; dThe State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, 100085 Beijing, China; eBeijing National Laboratory for Molecular Sciences, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, China; fPeking-Tsinghua Center for Life Sciences, Peking University, 100871 Beijing, China; and gCollege of Life Sciences, University of Chinese Academy of Sciences, 100049 Beijing, China Edited by Arthur D. Riggs, Beckman Research Institute of City of Hope, Duarte, CA, and approved March 21, 2018 (received for review January 17, 2018) Epigenetic silencing can be mediated by various mechanisms, CSE1L, a key player in the nuclear import pathway, as an es- and many regulators remain to be identified. Here, we report a sential factor for maintaining the repression of many methyl- genome-wide siRNA screening to identify regulators essential for ated genes. Mechanistically, CSE1L functions by facilitating maintaining gene repression of a CMV promoter silenced by DNA the nuclear import of certain cargo proteins that are essential methylation.
    [Show full text]
  • Aquaporin Channels in the Heart—Physiology and Pathophysiology
    International Journal of Molecular Sciences Review Aquaporin Channels in the Heart—Physiology and Pathophysiology Arie O. Verkerk 1,2,* , Elisabeth M. Lodder 2 and Ronald Wilders 1 1 Department of Medical Biology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] 2 Department of Experimental Cardiology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-20-5664670 Received: 29 March 2019; Accepted: 23 April 2019; Published: 25 April 2019 Abstract: Mammalian aquaporins (AQPs) are transmembrane channels expressed in a large variety of cells and tissues throughout the body. They are known as water channels, but they also facilitate the transport of small solutes, gasses, and monovalent cations. To date, 13 different AQPs, encoded by the genes AQP0–AQP12, have been identified in mammals, which regulate various important biological functions in kidney, brain, lung, digestive system, eye, and skin. Consequently, dysfunction of AQPs is involved in a wide variety of disorders. AQPs are also present in the heart, even with a specific distribution pattern in cardiomyocytes, but whether their presence is essential for proper (electro)physiological cardiac function has not intensively been studied. This review summarizes recent findings and highlights the involvement of AQPs in normal and pathological cardiac function. We conclude that AQPs are at least implicated in proper cardiac water homeostasis and energy balance as well as heart failure and arsenic cardiotoxicity. However, this review also demonstrates that many effects of cardiac AQPs, especially on excitation-contraction coupling processes, are virtually unexplored.
    [Show full text]
  • Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
    BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Human Transcription Factor Protein-Protein Interactions in Health and Disease
    HELKA GÖÖS GÖÖS HELKA Recent Publications in this Series 45/2019 Mgbeahuruike Eunice Ego Evaluation of the Medicinal Uses and Antimicrobial Activity of Piper guineense (Schumach & Thonn) 46/2019 Suvi Koskinen AND DISEASE IN HEALTH INTERACTIONS PROTEIN-PROTEIN FACTOR HUMAN TRANSCRIPTION Near-Occlusive Atherosclerotic Carotid Artery Disease: Study with Computed Tomography Angiography 47/2019 Flavia Fontana DISSERTATIONES SCHOLAE DOCTORALIS AD SANITATEM INVESTIGANDAM Biohybrid Cloaked Nanovaccines for Cancer Immunotherapy UNIVERSITATIS HELSINKIENSIS 48/2019 Marie Mennesson Kainate Receptor Auxiliary Subunits Neto1 and Neto2 in Anxiety and Fear-Related Behaviors 49/2019 Zehua Liu Porous Silicon-Based On-Demand Nanohybrids for Biomedical Applications 50/2019 Veer Singh Marwah Strategies to Improve Standardization and Robustness of Toxicogenomics Data Analysis HELKA GÖÖS 51/2019 Iryna Hlushchenko Actin Regulation in Dendritic Spines: From Synaptic Plasticity to Animal Behavior and Human HUMAN TRANSCRIPTION FACTOR PROTEIN-PROTEIN Neurodevelopmental Disorders 52/2019 Heini Liimatta INTERACTIONS IN HEALTH AND DISEASE Efectiveness of Preventive Home Visits among Community-Dwelling Older People 53/2019 Helena Karppinen Older People´s Views Related to Their End of Life: Will-to-Live, Wellbeing and Functioning 54/2019 Jenni Laitila Elucidating Nebulin Expression and Function in Health and Disease 55/2019 Katarzyna Ciuba Regulation of Contractile Actin Structures in Non-Muscle Cells 56/2019 Sami Blom Spatial Characterisation of Prostate Cancer by Multiplex
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Clinicopathological and Molecular Genetic Analysis of Low-Grade Glioma in Adults
    A CLINICOPATHOLOGICAL AND MOLECULAR GENETIC ANALYSIS OF LOW-GRADE GLIOMA IN ADULTS Presented by ANUSHREE SINGH MSc A thesis submitted in partial fulfilment of the requirements of the University of Wolverhampton for the degree of Doctor of Philosophy Brain Tumour Research Centre Research Institute in Healthcare Sciences Faculty of Science and Engineering University of Wolverhampton November 2014 i DECLARATION This work or any part thereof has not previously been presented in any form to the University or to any other body whether for the purposes of assessment, publication or for any other purpose (unless otherwise indicated). Save for any express acknowledgments, references and/or bibliographies cited in the work, I confirm that the intellectual content of the work is the result of my own efforts and of no other person. The right of Anushree Singh to be identified as author of this work is asserted in accordance with ss.77 and 78 of the Copyright, Designs and Patents Act 1988. At this date copyright is owned by the author. Signature: Anushree Date: 30th November 2014 ii ABSTRACT The aim of the study was to identify molecular markers that can determine progression of low grade glioma. This was done using various approaches such as IDH1 and IDH2 mutation analysis, MGMT methylation analysis, copy number analysis using array comparative genomic hybridisation and identification of differentially expressed miRNAs using miRNA microarray analysis. IDH1 mutation was present at a frequency of 71% in low grade glioma and was identified as an independent marker for improved OS in a multivariate analysis, which confirms the previous findings in low grade glioma studies.
    [Show full text]
  • Functional Screening of Alzheimer Risk Loci Identifies PTK2B
    OPEN Molecular Psychiatry (2017) 22, 874–883 www.nature.com/mp ORIGINAL ARTICLE Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology P Dourlen1,2,3, FJ Fernandez-Gomez4,5,6, C Dupont1,2,3, B Grenier-Boley1,2,3, C Bellenguez1,2,3, H Obriot4,5,6, R Caillierez4,5,6, Y Sottejeau1,2,3, J Chapuis1,2,3, A Bretteville1,2,3, F Abdelfettah1,2,3, C Delay1,2,3, N Malmanche1,2,3, H Soininen7, M Hiltunen7,8, M-C Galas4,5,6, P Amouyel1,2,3,9, N Sergeant4,5,6, L Buée4,5,6, J-C Lambert1,2,3,11 and B Dermaut1,2,3,10,11 A recent genome-wide association meta-analysis for Alzheimer’s disease (AD) identified 19 risk loci (in addition to APOE) in which the functional genes are unknown. Using Drosophila, we screened 296 constructs targeting orthologs of 54 candidate risk genes within these loci for their ability to modify Tau neurotoxicity by quantifying the size of 46000 eyes. Besides Drosophila Amph (ortholog of BIN1), which we previously implicated in Tau pathology, we identified p130CAS (CASS4), Eph (EPHA1), Fak (PTK2B) and Rab3-GEF (MADD) as Tau toxicity modulators. Of these, the focal adhesion kinase Fak behaved as a strong Tau toxicity suppressor in both the eye and an independent focal adhesion-related wing blister assay. Accordingly, the human Tau and PTK2B proteins biochemically interacted in vitro and PTK2B co-localized with hyperphosphorylated and oligomeric Tau in progressive pathological stages in the brains of AD patients and transgenic Tau mice.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]