Canadian Journal of Fisheries and Aquatic Sciences
Genetic structure and congeneric range overlap among sharpnose sharks (Genus Rhizoprionodon) in the northwest Atlantic Ocean
Journal: Canadian Journal of Fisheries and Aquatic Sciences
Manuscript ID cjfas-2018-0019.R3
Manuscript Type: Article
Date Submitted by the 10-Sep-2018 Author:
Complete List of Authors: Davis, Matthew; Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute Suarez-Moo,Draft Pablo; Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional, Unidad de Genómica Avanzada (Langebio) Daly-Engel, Toby; Florida Institute of Technology, Biological Sciences
PHYLOGEOGRAPHY < General, SHARKS < Organisms, MOLECULAR Keyword: ECOLOGY < General, Rhizoprionodon, stock structure
Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? :
https://mc06.manuscriptcentral.com/cjfas-pubs Page 1 of 33 Canadian Journal of Fisheries and Aquatic Sciences
Genetic Structure in Rhizoprionodon
1 Genetic structure and congeneric range overlap among sharpnose sharks (Genus
2 Rhizoprionodon) in the northwest Atlantic Ocean
3 Matthew M. Davis1*,#1, Pablo de Jesus Suárez-Moo2, and Toby S. Daly-Engel3
4 1Department of Biology, University of West Florida, Pensacola, Florida, United States of
5 America
6 2Unidad de Genómica Avanzada (Langebio), Centro de Investigación y de Estudios Avanzados
7 del Instituto Politécnico Nacional, Irapuato, Guanajuato, Mexico
8 3Department of Biological Sciences, Florida Institute of Technology, Melbourne, Florida, United
9 States of America Draft
10 *Corresponding author
11 Email: [email protected]
#1 New Address: Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission, Cedar Key, Florida, United States of America
Corresponding author contact: [email protected] https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 2 of 33
12 Abstract
13 Sharpnose sharks (Genus: Rhizoprionodon) experience extensive fishing pressure
14 throughout their ranges in the Atlantic Ocean, and as such it is important to understand the
15 degree to which intraspecific populations interact across a spatial gradient. The Atlantic
16 sharpnose shark Rhizoprionodon terraenovae and Caribbean sharpnose shark R. porosus share
17 similar appearance and spatial presence within the Gulf of Mexico (GOM), though previously
18 only R. terraenovae has been observed north of the Bahamas. We assessed the population
19 structure of R. terraenovae using the mitochondrial control region (650 bp). Our results indicate
20 significant genetic structure (FST = 0.049, P < 0.001; ΦST = 0.017, P = 0.008) between the GOM 21 and the rest of the Atlantic. In addition, Draftwe observed R. porosus outside their known range in 22 South Carolina, Virginia, and northern Florida. Given the overlapping range with R. terraenovae,
23 we assessed the potential for congeneric hybridization with the addition of the nuclear ribosomal
24 Internal Transcribed Spacer-2 gene (1260 bp). Results designate these specimens to be true R.
25 porosus specimens, indicating the need for reevaluation of this species’ range.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 3 of 33 Canadian Journal of Fisheries and Aquatic Sciences
26 Introduction
27 Elasmobranchs undergo direct development, allowing for dispersal at multiple life stages.
28 Though many large-bodied marine taxa such as sharks and billfishes have circumglobal
29 distributions and long-distance dispersal capabilities, research has shown many species can
30 exhibit genetic differentiation between small regional populations (Hellberg 2009; Clarke et al.
31 2015; Bernard et al. 2016; Williams et al. 2016). This is particularly evident in smaller coastal
32 sharks, such as the bonnethead Sphyrna tiburo (Fields et al. 2016), leopard shark Triakis
33 semifasciata (Barker et al. 2015), and blacknose shark Carcharhinus acronotus (Portnoy et al.
34 2014), where vagility is limited by body size (Musick et al. 2004). Population separation can be 35 attributed to a number of factors such asDraft strong surface currents, absence of continuous suitable 36 habitat, and geographic barriers, particularly between the Gulf of Mexico (GOM) and
37 northwestern Atlantic (Avise 1992; Portnoy et al. 2014; Portnoy et al. 2016). Additionally, many
38 sharks exhibit philopatry, relying on shallow coastal nursery habitat for parturition and
39 protection of neonates from larger predators (Holland et al. 1993; Carrier et al. 2004; Daly-Engel
40 et al. 2012). Species that exhibit natal philopatry and/or small home ranges may be more
41 vulnerable to local exploitation (Hueter et al. 2004), particularly if genetic subdivision between
42 populations is present but unaccounted for by management (Begg et al. 1999).
43 Members of the genus Rhizoprionodon are known for their ability to grow rapidly and
44 mature quickly (Loefer and Sedberry 2002). All Rhizoprionodon species are classified at the
45 level of “Least Concern” or “Data Deficient” by the International Union for the Conservation of
46 Nature (Cortés 2009). The Atlantic sharpnose shark Rhizoprionodon terraenovae is one of three
47 congeneric species in the western Atlantic Ocean, and the only one thought to occur north of the
48 Bahamas and Antilles, along the east coast of North America up to the Bay of Fundy, Canada
3 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 4 of 33
49 (Compagno 1984; Mendonça et al. 2011). The southern range of R. terraenovae overlaps in the
50 Bahamas with the northern range of its congener, the Caribbean sharpnose shark Rhizoprionodon
51 porosus (Mendonça et al. 2011). These two species are often mistaken for each other, as the only
52 known significant morphological difference is pre-caudal vertebral counts (R. terraenovae: 58-
53 66, R. porosus: 66-75; Springer 1964); however, molecular studies on mitochondrial and nuclear
54 DNA confirm that they are two distinct species (Mendonça et al. 2011).
55 Due to heavy prevalence of R. terraenovae in northwestern Atlantic ecosystems and
56 artisanal fisheries, several studies have examined its life history characteristics, such as
57 reproductive biology (Parsons 1983; Loefer and Sedberry 2002), age and growth (Parsons 1985;
58 Branstetter 1987; Loefer and Sedberry 2002; Frazier et al. 2015), and temporal changes in
59 distribution and abundance (Marquez-FaríDraftas and Castillo-Geniz 1998; Parsons and Hoffmayer
60 2005). Parsons and Hoffmayer (2005) assessed populations in the northern Gulf of Mexico from
61 March to October from 1998 to 2000, noting that the ratio of mature males to mature females
62 caught within the Mississippi Sound was immensely skewed (80:1), indicating that mature
63 females may predominantly remain nearshore or offshore. Additionally, a large decrease in
64 abundance of mature males during summer months was observed within Mississippi Sound,
65 possibly due to bioenergetically unfavorable conditions and/or migration to mate with females
66 (Parsons and Hoffmayer 2005). Similarly, no gravid females were caught inshore despite
67 consistent collection of neonate R. terraenovae with open umbilical scars, indicating that females
68 may give birth in nearshore waters, after which pups navigate to nursery grounds, an uncommon
69 trait in elasmobranchs (Parsons and Hoffmayer 2005). Given the stark segregation between sexes
70 and reliance of the pups on inshore nursery habitat, small-scale genetic structure in this
71 population may result from sex-biased dispersal.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 5 of 33 Canadian Journal of Fisheries and Aquatic Sciences
72 In addition to life history, several studies have focused on R. terraenovae molecular
73 ecology and large-scale genetic stock structure: Heist et al. (1996) first assessed the population
74 structure of R. terraenovae between Texas and Veracruz, Mexico, in the Gulf of Mexico and the
75 mid-Atlantic Bight using restriction fragment length polymorphisms (RFLPs), finding genetic
76 homogeneity between sites. Todd et al. (2004) investigated R. terraenovae genetic structure
77 between the southeast Atlantic and northern and southern Gulf of Mexico using single-stranded
78 conformational polymorphisms (SSCPs) from the mitochondrial genome, again finding no
79 significant genetic separation between sites. More recently, Suárez-Moo et al. (2013) amassed
80 samples from three proximate sites in the southeastern Gulf of Mexico, this time utilizing
81 amplified fragment length polymorphisms (AFLPs) to compare genetic structure; once again,
82 results indicated no significant populationDraft subdivision. Though these previous studies have not
83 shown genetic partitioning, we hypothesize that the use of highly polymorphic mtDNA
84 sequencing and large sample numbers from a variety of widely-separated locations could
85 uncover previously-unobserved genetic subdivision within or between biogeographic regions for
86 R. terraenovae, and possibly its congener R. porosus.
87 In recent years, observed range shifts for organisms in coastal ecosystems have increased
88 in frequency, possibly due to rising water temperatures (Perry et al. 2005; Stewart et al. 2014).
89 Given the similar external morphology in conjunction with overlapping ranges and life history
90 characteristics between R. terraenovae and R. porosus, landing records in the Atlantic may not
91 accurately reflect the true fishing trends in areas where more than one species resides unless
92 vertebral counts (Springer 1964) or molecular analyses (Mendonça et al. 2011) are conducted.
93 Further, given the close relatedness and physical similarity between R. terraenovae and R.
94 porosus, the most genetically similar species pair in genus, the possibility for hybridization with
5 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 6 of 33
95 range overlap is real. Confamilial species blacktip sharks (Carcharhinus spp.; Morgan et al.
96 2012) and smooth-hound sharks (Mustelus spp.; Marino et al. 2015) have displayed varying
97 levels of hybridization, and so it is plausible that interspecific mating may also occur between
98 members of Rhizoprionodon. The objectives of this study are to characterize the genetic
99 population structure of R. terraenovae in the northwestern Atlantic Ocean, and to address the
100 possibility for congeneric range overlap or hybridization with R. porosus.
101 Materials and Methods
102 Study Sites and Collection
103 Sampling for this study was largely nonlethal, so vertebral counts were not performed to
104 verify species identity. Apart from R. porosusDraft collected from the Bahamas, all animals were
105 assumed by collectors to be R. terraenovae because of their catch location (outside of the
106 Caribbean). We therefore included nuclear DNA sequencing in our analysis, which is inherited
107 biparentally and subject to recombination, in order to compare with mtDNA and assess the
108 occurrence of previously-unrecognized congeneric range overlap or possible hybridization via
109 mitochondrial-nuclear discordance. Tissue samples for genetic analyses were collected through
110 direct sampling and via collaboration with governmental and academic fishery-independent
111 surveys from January 2015 through December 2016. Rhizoprionodon terraenovae samples were
112 grouped into 15 sites (Fig 1): nine sites in the Gulf of Mexico (Alabama; Big Bend Region, FL;
113 Florida Keys, FL; Louisiana; Celestún, Mexico; Mississippi; Panama City [henceforth
114 “Northwest Florida”]; Sarasota, FL; and Galveston Bay, TX: n = 188), and six sites in the
115 Atlantic (Andros Island, Bahamas; Cape Canaveral, FL; Jacksonville, FL; South Carolina;
116 Virginia; and Rhode Island: n = 156). Twelve R. porosus tissue samples were collected in Belize
117 for molecular research, summing to 356 samples in total. Approximately 1 cm3 of tissue from a
https://mc06.manuscriptcentral.com/cjfas-pubs Page 7 of 33 Canadian Journal of Fisheries and Aquatic Sciences
118 paired fin was collected from each individual, and stored in 2 mL vials of >70% ethanol or NaCl-
119 saturated dimethyl sulfoxide (DMSO) buffer for storage prior to extraction.
120 DNA Extraction and Amplification
121 DNA extraction was performed via the salting-out method adapted from Sunnucks and
122 Hales (1996), or using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). To
123 confirm our DNA extraction methods gave identical results, 40 random samples were extracted
124 using both methods and produced interchangeable results. For phylogeographic analysis, we
125 used the displacement loop (D-Loop) section of the control region (CR), a highly polymorphic
126 mitochondrial marker. Amplification of 650 base pairs (bp) for R. terraenovae (n = 344) of D-
127 Loop was performed by Polymerase Chain Reaction (PCR) on a BIORAD C1000 Touch
128 Thermal Cycler (Biorad, Hercules, CA),Draft which consisted of 5μL 2x MyTaq Red mix (Bioline;
129 London, UK), purified ddH2O, 1μM forward primer (5’ - CTC CCA AAG CCA AGA TTC TG -
130 3’) and reverse primer (5’ - GGC TTA GCA AGG TGT CTT CTT GG - 3’) designed using
131 BLAST in Genbank (Madden 2002) from R. terraenovae sequences submitted by Mendonça et
132 al. (2011), and approximately 3 ng of template DNA. Amplification reactions were comprised of
133 initial denaturation at 95°C for three minutes, followed by 39 cycles of 30 seconds at 95°C, 30
134 seconds at the optimal annealing temperature of 56.5°C, 48 seconds at 72°C, and a final
135 extension at 72°C for five minutes. After PCR amplification, samples were purified with FastAp
136 Thermosensitive Alkaline Phosphatase (Thermo Fisher Scientific, Waltham, Massachusetts) and
137 Exonuclease I. PCR products were sequenced at the University of Arizona Genetics Core on an
138 Applied Biosystems 3730XL DNA Analyzer, and then edited in Geneious v9.1.4 (Kearse et al.
139 2012).
140 For nuclear DNA, we utilized a non-coding nuclear ribosomal gene, the Internal
7 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 8 of 33
141 Transcribed Spacer-2 (ITS2), to describe all samples found north of the Bahamas in Virginia,
142 South Carolina, and northern Florida which displayed an R. porosus haplotype as a means to
143 assess the presence of Caribbean sharpnose sharks in the northwest Atlantic. PCR reactions
144 consisted of 5μL 2x MyTaq Red Mix (Bioline; London, UK), ddH2O, 1μM each of ITS2
145 universal primers FISH5.8SF and FISH28SR (Pank et al. 2001), 1μM of species-specific forward
146 primer for either R. terraenovae (Rter-946 ITS2: 5’ - TGTGAATAGGGGCAGCCGACA - 3’)
147 or R. porosus (Rpor-1260 ITS2: 5’ -GCGAGGCACACCTCGGCAC - 3’) identified by Pinhal et
148 al. (2012), and template DNA. Amplification reactions were comprised of initial denaturation at
149 95°C for three minutes, followed by 39 cycles of 30 seconds at 95°C, 30 seconds of optimal
150 annealing at 56.5°C, 48 seconds at 72°C, and a final annealing step of 72°C for 5 minutes. Each
151 sample was sequenced with each speciesDraft-specific primer for Internal Transcribed Spacer-2 (Rter-
152 946 ITS2 and Rpor-1260 ITS2) to determine which returned higher quality product (Pinhal et al.
153 2012). After PCR amplification, samples were run on gel electrophoresis, then purified and
154 sequenced similarly to the phylogeographic samples using the species-specific primer that gave
155 the greatest yield. Sequences were trimmed to a uniform 1,265 bp.
156 Genetic Analyses
157 Control region sequences of R. terraenovae were aligned in MAFFT v7 (Katoh 2013).
158 Bayesian phylogenetic trees were constructed using MrBayes (Huelsenbeck and Ronquist 2001)
159 through a plugin in Geneious. Maximum likelihood phylogenetic trees were constructed and
160 average percent genetic identity calculated in PhyML v.3.0 (Guindon et al. 2010) with 10,000
161 bootstrap iterations. Arlequin v3.5.2.2 (Excoffier and Lischer 2010) was employed to calculate
162 F-statistics (FST and ΦST), measures of genetic divergence between populations, as well as
163 nucleotide and haplotype diversities, while pairwise and global Jost’s D were calculated in
https://mc06.manuscriptcentral.com/cjfas-pubs Page 9 of 33 Canadian Journal of Fisheries and Aquatic Sciences
164 GenoDive (Meirmans and Van Tienderen 2004). Jost’s D measures the fraction of allelic
165 variation between populations and does particularly well when comparing two populations with
166 high mutation rates (Kane 2011). However, Jost’s D is specific to the locus that is being
167 measured and does not account for population demographics; thus it may not be as useful an
168 estimator for population genetic processes as F-statistics (Whitlock 2011). FST and ΦST are two
169 types of fixation indices, wherein the genetic variance among subpopulations can be compared
170 relative to the total variance within the population. While FST measures allelic distance under the
171 assumption that all alleles are equidistant to each other, ΦST takes mutational distance among
172 alleles being measured into consideration. Pairwise FST and ΦST values and analysis of
173 molecular variance (AMOVA) between sampling sites were calculated using 20,000
174 permutations. To control for false discoveryDraft rate (FDR), we utilize a modified procedure by
175 Benjamini and Yekutieli (2001) to calculate alpha (α), which will be referred to as the B-Y
176 method. In addition, Arlequin was used to calculate Fu’s F (Fu 1997), a statistical estimator of
177 historic population expansion and contraction.
178 To assess the nuclear DNA in selected specimens to confirm congeneric range overlap or
179 hybridization between sharpnose species, we created ITS2 template sequences for both R.
180 terraenovae and R. porosus, using ten confirmed R. terraenovae samples, and ten confirmed R.
181 porosus samples obtained from Belize. A single genotype was observed for each species using
182 these specimens, and matched previously observed genotypes (GenBank accession numbers
183 JN008718 and JN008720). These template sequences and samples identified as R. porosus via
184 mtDNA from regions outside the species’ known range were aligned using MAFFT. Bayesian
185 and maximum likelihood phylogenetic trees were constructed using the MrBayes (Huelsenbeck
186 and Ronquist 2001) and PhyML v3.5.2.2 (Excoffier and Lischer 2010) plugins in Geneious, and
9 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 10 of 33
187 PhyML were used to calculate genetic distances and percent divergence among specimens.
188 Results
189 Population Structure
190 Samples obtained from R. porosus were rare in our collections (n = 12), and thus we did
191 not perform analysis of genetic structure here. These individuals were excluded from analysis of
192 population structure for R. terraenovae. Genetic analysis of R. terraenovae (n = 344) revealed a
193 total of 58 novel haplotypes across all sites, 10 of which were exclusive to the Atlantic and 36 to
194 the Gulf of Mexico (GenBank accession numbers MGS655089 - MGS655146; Figs 2 and 3,
195 Supplementary Fig 1). Several haplotypes were shared between the Atlantic and Gulf of Mexico, 196 with the most frequent haplotype appearingDraft in 98 of the 344 specimens (MGS655089). 197 Excluding sites where n<10, average haplotype diversity (h) and nucleotide diversity (π)
198 were relatively high in R. terraenovae (h = 0.0894 and π = 0.00492; Table 1). Estimates of Fu’s
199 F showed significant negative values (α = 0.05) at Alabama (F = -10.871, P < 0.001), Big Bend
200 (F = -9.183, P < 0.001), Mexico (F = -3.518, P = 0.024), Mississippi (F = -9.354, P < 0.001),
201 Northwest Florida (F = -6.366, P = 0.002), Sarasota (F = -2.897, P = 0.023), and Texas (F = -
202 6.167, P = 0.003), indicating likely genetic population expansion (Table 1). When sites were
203 grouped by ocean basin (Atlantic vs. Gulf of Mexico), both the Atlantic (F = -6.854, P = 0.039)
204 and Gulf of Mexico (F = -26.182, P < 0.001) had significantly negative estimates for Fu’s F,
205 indicating departure from neutrality due to expansion. Estimates of pairwise FST between sites
206 within in the Atlantic varied widely (FST = -0.035 – 0.287), with no apparent or consistent
207 patterns of structure observed (Table 2). Tests of structure with the exclusion of sites containing
208 low sample sizes (Andros Island, n = 12; Rhode Island: n = 5) resulted in a lack of congruent
209 structure. Estimates of ΦST for sites in the Atlantic support these observations, showing no intra-
https://mc06.manuscriptcentral.com/cjfas-pubs Page 11 of 33 Canadian Journal of Fisheries and Aquatic Sciences
210 regional structure except for Andros Island (Table 2). Within the Gulf of Mexico pairwise FST
211 and ΦST estimates revealed significant structure separating Sarasota and the Florida Keys from
212 several other sites (Table 2), though these sites contain low sample sizes (n = 10 and n = 6,
213 respectively). Upon removal of these sites, tests of structure found no observable differences
214 present between sites within the Gulf of Mexico. Pairwise estimates of samples from both the
215 Atlantic and Gulf basins grouped together found that the greatest magnitude genetic structure
216 separated Andros Island from all other sites (Table 2). All other structure observed was
217 inconsistent between FST and ΦST, though FST did show intermittent structure between Virginia
218 and South Carolina from several Gulf sites. Finally, sites were grouped by ocean basin (Atlantic
219 vs. Gulf) and pairwise F-statistics indicated low but significant structure (FST = 0.049, P < 0.001;
220 ΦST = 0.017, P = 0.008). An AMOVA testDraft of structure between sites supported our pairwise
221 results, showing significant separation (FST = 0.052, P < 0.001; Table 3). In addition, we ran
222 Jost’s D at 10,000 permutations, the results of which supported the fixation indices (pairwise Dest
223 = 0.016, P = 0.011; global Dest = 0.002, 97.5% CI ± 0.006). AMOVA values for the Atlantic and
224 Gulf when sites with low sample size were excluded resulted in a similar FST value as obtained
225 previously (FST = 0.050, P < 0.001; Supplementary Table 1).
226 Nuclear DNA
227 Samples identified as R. porosus using mtDNA, but which were located north of the
228 known Caribbean range for this species (Virginia samples 5, 6, and 10, South Carolina samples
229 8, 13, and 81, Jacksonville sample 23, Panama City sample 5, and Andros Island samples 47, 67,
230 68 and 83), displayed three new haplotypes (GenBank accession numbers MGS655086 –
231 MGS655088). These samples were sequenced using the ITS2 streamlined protocol designed by
232 Pinhal et al. (2012). Samples displayed higher sequence product and fewer ambiguities when
11 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 12 of 33
233 using the R. porosus species-specific primer as opposed to R. terraenovae, and were thus
234 sequenced using primer Rpor-1260. Within these samples, two genotypes were observed: Andros
235 Island 47 and 68 displayed the same ITS2 genotype as the R. porosus template, and all other
236 samples shared a unique, previously unobserved genotype in either R. terraenovae or R. porosus
237 (GenBank accession number MG655085). Percent divergence was also employed in an attempt
238 to discern species identification of the alleged R. porosus samples. The R. terraenovae and R.
239 porosus templates show five nucleotide substitutions (0.395% divergence) from each other.
240 Andros Island 47 and 68 shared the same ITS2 sequence with the R. porosus template, while all
241 other alleged R. porosus samples showed one nucleotide substitution (0.068%) from the R.
242 porosus template, and four nucleotide substitutions (0.316%) from the R. terraenovae template.
243 Given the CR and ITS2 results for theseDraft samples, in conjunction with the consistent observation
244 of electrophoretic amplicons when using the R. porosus species-specific primer and lack of
245 nuclear-mitochondrial discordance, we conclude that these are most likely R. porosus, though of
246 a genetic type not previously observed. This is the first time this species has been found north of
247 the Bahamas and Antilles.
248 DISCUSSION
249 Population Structure
250 The mitochondrial control region (CR) has a higher rate of molecular evolution in fishes
251 than most other regions of mtDNA (Clayton 2000). Estimates of haplotype diversity and
252 nucleotide diversity of R. terraenovae CR were relatively similar to other species from the same
253 region, such as the blacktip shark Carcharhinus limbatus (h = 0.843 ± 0.02, π =
254 0.00413 ± 0.00226) and bonnethead shark S. tiburo (h = 0.8127 ± 0.13, π = 0.00368 ± 0.00287;
255 Keeney & Heist 2006; Fields 2016). Our low estimates of genetic diversity for Andros Island and
https://mc06.manuscriptcentral.com/cjfas-pubs Page 13 of 33 Canadian Journal of Fisheries and Aquatic Sciences
256 the Florida Keys are likely due to small sample numbers, and probably do not accurately reflect
257 the full genetic diversity at either site. It should also be noted that while estimates of haplotype
258 and nucleotide diversity for Rhode Island and Sarasota are similar to those seen at other sites,
259 these estimates may reflect only partial genetic diversity due to lower sample number (Rhode
260 Island: n = 5, h = 0.900 ± 0.16, π = 0.004; Sarasota: n = 10, h = 0.956 ± 0.06, π = 0.005).
261 Haplotypes predominantly differed by only a single or couple mutations, explaining the low
262 posterior probabilities and bootstrap values in our Bayesian and Maximum Likelihood trees.
263 In a study by Carlson et al. (2008), authors observed R. terraenovae pups utilizing
264 multiple nursery habitats, with one juvenile traveling >150 km over several months. Other tag
265 and recapture studies have shown adults moving 600-750 km, however this behavior is rarely
266 observed, and as with most smaller species,Draft R. terraenovae often displays low vagility (Kohler et
267 al. 1998; Compagno 2004; Parsons and Hoffmayer 2005; Carlson et al. 2008). For example, in
268 the same Carlson et al. (2008) study authors found evidence of site fidelity in Crooked Island
269 Sound, Florida using acoustic tagging, where authors calculated 50% kernel juvenile home range
270 estimates ranging from 0.88 km2 - 1.64 km2 from 2004-2006, with several individuals recaptured
271 within the study area after 3-1,816 days at liberty. The varying degrees of dispersal and site
272 fidelity observed within this species is likely the product of contemporary barriers to gene flow
273 that isolate populations, such as strong surface currents or freshwater inflow from large
274 watersheds along the southeastern coast of the US. Several life history characteristics of R.
275 terraenovae, such as rapid maturation time (2-3 years) and annual reproduction cycles compared
276 with biennial in most other Carcharhinids, provide biological evidence to support estimates of a
277 high intrinsic growth rate in the species (Marquez-Farías and Castillo-Geniz 1998; Loefer &
278 Sedberry 2002; NMFS 2007).
13 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 14 of 33
279 Previous studies of Atlantic sharpnose sharks have shown a lack of statistically
280 significant population structure between and within the Atlantic and Gulf of Mexico basins
281 (Heist et al. 1996; Todd et al. 2004; Mendonça et al. 2009; Mendonça et al. 2011; Súarez-Moo et
282 al. 2013). However, pairwise and AMOVA F-statistics from this study indicate statistically
283 significant structure between, but not within, the Gulf and rest of the northwest Atlantic. The
284 lack of geographic barriers to gene flow within both the Atlantic Ocean and Gulf of Mexico
285 appear to have resulted in large-scale but not rangewide genetic homogeneity. The small body
286 size of R. terraenovae, in addition to physical barriers such as strong surface currents and a lack
287 of continuous coastal habitat around the southern tip of Florida, could explain the lack of
288 complete genetic homogeneity between basins. This pattern of genetic structure between the
289 Gulf and Atlantic has been observed in Draftother elasmobranchs, such as the similarly-sized S.
290 tiburo, which displays significant genetic differences between the Florida Gulf coast, Florida
291 Atlantic coast, and southwestern Gulf of Mexico (Escatel-Luna et al. 2015). In addition, larger
292 species such as C. limbatus have also shown structure between several nurseries within these
293 regions, using both nuclear microsatellite and mitochondrial DNA (Keeney et al. 2006).
294 The genetic evidence shown here supports known demographic data, where adult R.
295 terraenovae are thought to sexually segregate (Parsons and Hoffmayer 2005). In 2005, Parsons
296 and Hoffmayer observed that R. terraenovae numbers within the Mississippi Sound decreased
297 during the hottest summer months, and speculated that adults migrate to deeper habitat to escape
298 from increasing environmental stressors. Additionally, the timing of this observed drop coincides
299 with mating season, so it is plausible that these movements are a means of finding
300 nearshore/offshore females with whom to mate (Marquez-Farías and Castillo-Geniz 1998;
301 Parsons and Hoffmayer 2005; Suárez-Moo et al. 2013). This mating may occur between
https://mc06.manuscriptcentral.com/cjfas-pubs Page 15 of 33 Canadian Journal of Fisheries and Aquatic Sciences
302 individuals from mixed geographic origins, further blending the genetic stock and resulting in
303 within-region panmixia, despite potential site fidelity (Parsons and Hoffmayer 2005; Suárez-
304 Moo et al. 2013). The lack of observed philopatry and the likelihood that mature females pup
305 offshore, leaving offspring to migrate to a variety of possible coastal sites rather than a single
306 discrete nursery area, further supports our finding of within-basin panmixia.
307 While Andros Island showed significant genetic differentiation from other sites within
308 the Atlantic, and both the Florida Keys and Sarasota from other sites in the Gulf, these
309 differences could be due to the low sample size at each site. Further sampling efforts are needed
310 to differentiate these populations from other sites within each basin. Additionally, it should be
311 noted that a study by Todd et al. (2004) using single-stranded conformational polymorphisms
312 (SSCPs) showed that there could possiblyDraft be some degree of structure present between the
313 northern and southern Gulf. While there was no observed distinction between Mexico and other
314 Gulf sites in this study, this could also be due to the somewhat small sample size (Celestún: n =
315 15) and the lack of geographic representation across Mexico in this study, as all samples were
316 from one general location.
317 Evidence of historic population expansion was detected in Alabama, Big Bend Florida,
318 Celestún, Mexico, Mississippi, Northwest Florida, Sarasota Florida, and northern Texas. When
319 we grouped the populations into their respective basins, the Atlantic and Gulf both showed
320 significant population expansion (F = -6.854, P = 0.039 and F = -26.182, P < 0.001,
321 respectively). Estimates of recent population expansion have been observed in several
322 elasmobranch species in the Gulf such as the blacknose shark C. acronotus and the scalloped
323 hammerhead shark Sphyrna lewini (Portnoy et al. 2014; Spaet et al. 2015), and in the case of R.
324 terraenovae, may be evidence for recent expansion from an ancestral bottleneck.
15 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 16 of 33
325 Congeneric Range Overlap
326 The nuclear Internal Transcribed Spacer-2 gene is relatively conserved and therefore
327 well-suited for most cases of species delineation, and has been employed for taxonomic
328 identification in elasmobranchs (Pank et al. 2001; Chapman et al. 2003; Pinhal et al. 2012).
329 Given that, genetics aside, pre-caudal vertebral number is the sole known disparity between R.
330 terraenovae and R. porosus (Springer 1964), visual misidentification between species is likely
331 where ranges overlap, whereas genetic analysis can avoid this bias. We utilized both nuclear and
332 mitochondrial genes to address species identification, and from here were able to address the
333 possibility of greater congeneric range overlap, as well as to check for hybridization. While these
334 results do not support the hypothesis of extensive hybridization between R. terraenovae and R.
335 porosus, they do show that R. porosus canDraft be observed, at least to some degree, north of the
336 Bahamas and Antilles. While it is possible that previous home range evaluations of
337 Rhizoprionodon species were inaccurate due to the visual misidentification of R. terraenovae and
338 R. porosus, further research is needed to confirm the residence of R. porosus along the Southeast
339 US and northern GOM.
340 Future Directions
341 Further research into habitat use and dispersal by R. terraenovae is needed, and efforts to
342 monitor this species’ sustainability may need to focus more on seasonal angling rather than
343 identification and protection of reproductive habitat. In addition, our data indicate that the
344 northern range of R. porosus may extend further north into the Atlantic and Gulf of Mexico than
345 previously thought, though this presence is indicated by only 12 samples here. Similar
346 morphology complicates management for these species, and findings of greater congeneric range
347 overlap highlight the need for a reevaluation of R. porosus stocks to confirm its presence north of
https://mc06.manuscriptcentral.com/cjfas-pubs Page 17 of 33 Canadian Journal of Fisheries and Aquatic Sciences
348 the Bahamas and Antilles. Further efforts to collect, identify, and monitor sharks of the genus
349 Rhizoprionodon in the northwestern Atlantic and Gulf of Mexico, particularly in areas where
350 sample sizes here were limited (i.e., West Central Florida, Florida Keys, Rhode Island), could
351 vastly improve our understanding of their spatial distribution and habitat use, especially as sea
352 surface temperatures continue to rise. Given the increasing range overlap and genetic similarity
353 between Rhizoprionodon species, opportunities for hybridization may increase as ranges expand.
354 Acknowledgements
355 The authors thank Douglas Adams, Dana Bates, Wally Bubly, Chloe Dean, Marcus
356 Drymon, Bryan Frazier, Jayne Gardiner, James Gelsleichter, Dean Grubbs, Simon Gulak, Kristin 357 Hannan, Jill Hendon, Eric Hoffmayer, CamillaDraft McCandless, Jack Morris, Pablo de Jesus Suárez- 358 Moo, and Kevin Weng for their help in collecting sharpnose specimens. We also extend thanks
359 to Mariah Pfleger, Ariel Egan, Margaret McClain, and Cody Nash, along with many other
360 students and volunteers, for their help in field collection. We also thank Jeff Eble, Erika Stanish,
361 and Justin Jones for lab support, as well as Jane Caffrey and Eric Hoffmayer for help with
362 analyses and advice on the manuscript. Finally, we thank the editor and reviewers for their
363 invaluable input in bringing this manuscript to its current state.
17 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 18 of 33
364 References
365 Avise, J.C. 1992. Molecular population structure and the biogeographic history of a regional
366 fauna: a case history with lessons for conservation biology. Oikos 63(1): 62-76. doi:
367 10.2307/3545516.
368 Barker, A.M., Nosal, A.P., Lewallen, E.A., and Burton, R.S. 2015. Genetic structure of leopard
369 shark (Triakis semifasciata) populations along the Pacific coast of North America.
370 Journal of Experimental Marine Biology and Ecology 472: 151-157. Available from
371 https://doi.org/10.1016/j.jembe.2015.06.020 [accessed 25 November 2017].
372 Begg, G.A., Friedland, K.D., and Pearce, J.B. 1999. Stock Identification and its role in stock 373 assessment and fisheries management:Draft an overview. Fisheries Research 43: 1-8. 374 Available from https://doi.org/10.1016/S0165-7836(99)00062-4 [accessed 12 November
375 2017].
376 Benjamini, Y., and Yekutieli, D. 2001. The control of the false discovery rate in multiple testing
377 under dependency. The Annals of Statistics 29(4): 1165-1188.
378 doi:10.1214/aos/1013699998.
379 Bernard, A.M., Feldheim, K.A., Heithaus, M.R., Witner, S.P., Wetherbee, B.M., and Shivji, M.S.
380 2016. Global population genetic dynamics of a highly migratory, apex predator shark.
381 Molecular Ecology 25(21): 5312-5329. Available from
382 https://doi.org/10.1111/mec.13845 [accessed 9 August 2017].
383 Branstetter, S. 1987. Age and growth validation of newborn sharks held in laboratory aquaria,
384 with comments on the life history of the Atlantic sharpnose shark, Rhizoprionodon
385 terraenovae. Copeia 1987(2): 291–300. doi:10.2307/1445764.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 19 of 33 Canadian Journal of Fisheries and Aquatic Sciences
386 Carlson, J.K., Heupel, M.R., Bethea, D.M., and Hollensead, L.D. 2008. Coastal habitat use and
387 residency of juvenile Atlantic sharpnose sharks (Rhizoprionodon terraenovae).
388 Estuaries and Coasts 31:931-940. Available from http://www.jstor.org/stable/40663488
389 [accessed 9 August 2017].
390 Carrier, J.C., Pratt, H.L., and Castro, J.I. 2004. Reproductive Biology of Elasmobranchs. In:
391 Carrier JC, Musick JA, Heithaus MR, editors. Biology of sharks and their relatives.
392 CRC Press, Boca Raton, FL.
393 Chapman, D.D., Abercrombie, D.L., Douady, C.J., Pikitch, E.K., and Stanhope, M.J. 2003. A
394 streamlined, bi-organelle, multiplex PCR approach to species identification: Application
395 to global conservation and trade monitoring of the great white shark, Carcharodon
396 carcharias. Conservation GeneticsDraft 4(4): 415-425. Available from
397 https://doi.org/10.1023/A:1024771215616 [accessed 19 July 2017].
398 Chapman, D.D., Feldheim, K.A., Papastamatiou, Y.P., and Hueter, R.E. 2015. There and
399 back again: a review of residency and return migrations in sharks, with implications for
400 population structure and management. Annual Review of Marine Science 7:547-570.
401 Available from https://doi.org/10.1146/annurev-marine-010814-015730 [accessed 10
402 June 2017].
403 Clarke, C.R., Karl, S.A., & Horn, R.L. 2015. Global mitochondrial DNA phylogeography and
404 population structure of the silky shark, Carcharhinus falciformis. Marine Biology 162(5):
405 945-955. Available from https://doi.org/10.1007/s00227-015-2636-6 [accessed 1 July
406 2017].
19 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 20 of 33
407 Clayton, D.A. 2000. Transcription and Replication of mitochondrial DNA. Human
408 Reproduction 15(2): 11-17. Available from https://academic.oup.com/humrep/article-
409 abstract/15/suppl_2/11/619764 [accessed 24 June 2017].
410 Compagno, L.J.V. 1984. FAO species catalogue. Vol. 4. Shark of the World. An Annotated
411 and illustrated catalogue of shark species known to date. Part 2 – Carcharhiniformes.
412 FAO Fish Synopsis, Rome pp. 251-655.
413 Cortés, E. 2009. Rhizoprionodon terraenovae. The IUCN Red List of Threatened Species 2009:
414 e.T39382A10225086. Available from http://dx.doi.org/10.2305/IUCN.UK.2009-
415 2.RLTS.T39382A10225086.en [accessed 20 December 2016].
416 Daly-Engel, T.S., Seraphin, K.D., Holland, K.N., Coffey, J.P., Nance, H.A., Toonen, R.J., and
417 Bowen, B.W. 2012. Global phylogeographyDraft with mixed-marker analysis reveals male-
418 mediated dispersal in the endangered scalloped hammerhead shark (Sphyrna lewini).
419 PLoS ONE 7(1): e29986. doi:10.1371/journal.pone.0029986.
420 Excoffier, L., and Lischer, H.E. 2010. Arlequin suite ver 3.5: a new series of programs to
421 perform population genetics analyses under Linux and Windows. Molecular Ecology
422 Resources 10(3): 564-567. doi:10.1111/j.1755-0998.2010.02847.x.
423 Escatel-Luna, E., Adams, D.H., Uribe-Alcocer, M., Islas-Villanueva, V., and Díaz-Jaimes, P.
424 2015. Population genetic structure of the bonnethead shark, Sphyrna tiburo, from the
425 western North Atlantic Ocean based on mtDNA Sequences. Journal of Heredity 106(4):
426 355-365. doi:10.1093/jhered/esv030.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 21 of 33 Canadian Journal of Fisheries and Aquatic Sciences
427 Fields, A.T., Feldheim, K.A., Gelsleichter, J., Pfoertner, C., and Chapman, D.D. 2016.
428 Population structure and cryptic speciation in bonnethead sharks Sphyrna tiburo in the
429 south-eastern U.S.A. and Caribbean. Journal of Fish Biology 89(5): 2219-2233. doi:
430 10.1111/jfb.13025.
431 Frazier, B.S., Driggers III, W.B., and Ulrich, G.F. 2015. Longevity of Atlantic sharpnose sharks
432 Rhizoprionodon terraenovae and blacknose sharks Carcharhinus acronotus in the
433 western North Atlantic Ocean based on tag-recapture data and direct age estimates
434 [version 2; referees: 2 approved]. doi:10.12688/f1000research.4767.2.
435 Fu, Y-X. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking
436 and background selection. Genetics 147(2): 915-925. Available from
437 https://www.ncbi.nlm.nih.gov/pubmed/9335623Draft [accessed 3 March 2017].
438 Guindon, S., Dufayard, J.F., and Lefort, V. 2010. New algorithms and methods to estimate
439 maximum-likelihood phylogenies: assessing the performance of PhyML 3.0.
440 Systematic Biology 59(3): 307-321. doi:10.1093/sysbio/syq010.
441 Heist, E.J., Musick, J.A., and Graves, J.E. 1996. Mitochondrial DNA diversity and divergence
442 among sharpnose sharks, Rhizoprionodon terraenovae, from the Gulf of Mexico and
443 Mid-Atlantic Bight. Fishery Bulletin 94: 664-668. Available from
444 https://spo.nmfs.noaa.gov/sites/default/files/pdf-content/1996/944/heist.pdf [accessed 20
445 December 2016].
446 Hellberg, M.E. 2009. Gene flow and isolation among populations of marine animals. Annual
447 Review of Ecology, Evolution, and Systematics 40: 291-310. Available from
448 https://doi.org/10.1146/annurev.ecolsys.110308.120223 [accessed 13 March 2017].
21 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 22 of 33
449 Holland, K.N., Wetherbee, B.M., Peterson, J.D., and Lowe, C.G. 1993. Movements and
450 distribution of hammerhead shark pups on their natal grounds. Copeia 2: 495-502. doi:
451 10.2307/1447150.
452 Huelsenbeck, J.P., and Ronquist, F. 2001. MRBAYES: Bayesian inference of phylogenetic trees.
453 Bioinformatics 17(8): 754-755. Available from
454 https://doi.org/10.1093/bioinformatics/17.8.754 [accessed 29 November 2016].
455 Hueter, R.E., Heupel, M., Heist, E.J., and Keeney, D.B. 2004. Evidence of philopatry in sharks
456 and implications for the management of shark fisheries. e-Journal of Northwest Fishery
457 Science 35: 235-247. doi:10.2960/J.v35.m493
458 Kane, N. 2011. Should I use Fst, G’st, or D? Available from http://www.moleculare cologist.co
459 m/2011/03/should-i-use-fst-gst-or-d-2/Draft [accessed 07 December 2016].
460 Katoh, S. 2013. MAFFT multiple sequence alignment software version 7: improvements in
461 performance and usability. Molecular Biology and Evolution 30(4): 772-780. doi:
462 10.1093/molbev/mst010.
463 Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S.,
464 Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., and
465 Drummond, A. 2012. Geneious Basic: an integrated and extendable desktop software
466 platform for the organization and analysis of sequence data. Bioinformatics 28(12):
467 1647-1649. doi:10.1093/bioinformatics/bts199.
468 Keeney, D.B., Heist, E.J. 2006. Worldwide phylogeography of the blacktip shark (Carcharhinus
469 limbatus) inferred from mitochondrial DNA reveals isolation of western Atlantic
470 populations coupled with recent Pacific dispersal. Molecular Ecology 15(12): 3669-
471 3679. doi.1111/j.1365-294X.2006.03036.x.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 23 of 33 Canadian Journal of Fisheries and Aquatic Sciences
472 Kohler, N.E., Casey, J.G., and Turner, P.A. 1998. Fishery biology and demography of the
473 Atlantic sharpnose shark, Rhizoprionodon terraenovae, in the southern Gulf of Mexico.
474 Fisheries Resources 39(2): 183-198. Available from https://doi.org/10.1016/S0165-
475 7836(98)00182-9 [accessed April 10 2017].
476 Loefer, J.K., and Sedberry, G.R. 2002. Life history of the Atlantic sharpnose shark
477 (Rhizoprionodon terraenovae) (Richardson, 1836) off the southeastern United States.
478 Fish Bulletin 101: 75-88. Available from: http://hdl.handle.net/10827/10559
479 [accessed 3 December 2016].
480 Madden T. The BLAST Sequence Analysis Tool. 2002. Oct 9 [Updated 2003 Aug 13]. In:
481 McEntyre J, Ostell J, editors. The NCBI Handbook [Internet]. Bethesda (MD): National
482 Center for Biotechnology InformationDraft (US); 2002-. Chapter 16. Available from
483 http://www.ncbi.nlm.nih.gov/books/NBK21097/ [accessed 15 November 2016].
484 Marino, I.A.M., Riginella, E., Gristina, M., Rasotto, M.B., Zane, L., and Mazzoldi, C. 2015.
485 Multiple paternity and hybridization in two smooth-hound sharks. Scientific Reports 5,
486 12919. doi:10.1038/srep12919.
487 Marquez-Farías, J., and Castillo-Geniz, J. 1998. Fishery biology and demography of the Atlantic
488 sharpnose shark, Rhizoprionodon terraenovae, in the southern Gulf of Mexico. Fisheries
489 Research 39(2): 183-198. Available from https://doi.org/10.1016/S0165-7836(98)00182-
490 9 [accessed January 27 2017].
491 Mendonça, F.F., Oliviera, C., Gadig, O.B.F., and Foresti, F. 2009. Populations analysis of the
492 Brazilian sharpnose shark Rhizoprionodon lalandii (Chondrichthyes: Carcharhinidae)
493 on the São Paulo coast, Southern Brazil: inferences from mtDNA sequences. Neotropical
494 Ichthyology 7(2): 213-216. doi:http://dx.doi.org/10.1590/S1679-62252009000200012.
23 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 24 of 33
495 Mendonça, F.F., Oliviera, C., Burgess, G., Coelho, R., Piercy, A., Gadig, O.B.F., and Foresti, F.
496 2011. Species delimitation in sharpnose sharks (genus Rhizoprionodon) in the western
497 Atlantic Ocean using mitochondrial DNA. Conservation Genetics 12(1): 193-200.
498 Available from https://doi.org/10.1007/s10592-010-0132-6 [accessed 2 August 2017].
499 Meirmans, P.G., and Van Tienderen, P.H. 2004. GENOTYPE and GENODIVE: two programs
500 for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4:
501 792-794. Available from https://doi.org/10.1111/j.1471-8286.2004.00770.x [accessed 15
502 May 2017].
503 Morgan, J.A.T., Harry, A.V., Welch, D.J., Street, R., White, J., Geraghty, P.T., Macbeth, W.G.,
504 Tobin, A., Simpfendorfer, C.A., and Ovenden, J.R. 2012. Detection of interspecies
505 hybridization in Chondrichthyes:Draft hybrids and hybrid offspring between Australian
506 (Carcharhinus tilstoni) and common (C. limbatus) blacktip shark found in an Australian
507 fishery. Conservation Genetics 13(2): 455-463. Available from
508 https://doi.org/10.1007/s10592-011-0298-6 [accessed 11 January 2018].
509 Musick, J.A., Harbin, M.M., and Compagno, L.J.V.. Historical zoogeography of the Selachii. In
510 Biology of sharks and their relatives. Edited by J.C. Carrier, J.A. Musick, and M.R.
511 Heithaus. CRC Press, pp. 33-78.
512 SEDAR. 2007. SEDAR 13 - Small coastal shark complex, Atlantic sharpnose, blacknose,
513 bonnethead, and finetooth shark stock assessment report. SEDAR, North Charleston,
514 SC. Available fromhttp://www.sefsc.noaa.gov/sedar/download/SAR_complete_2.pdf?id
515 =DOCUMENT [accessed 22 February 2017].
https://mc06.manuscriptcentral.com/cjfas-pubs Page 25 of 33 Canadian Journal of Fisheries and Aquatic Sciences
516 Pank, M., Stanhope, M., Natanson, L., Kohler, N., and Shivji, M. 2001. Rapid and simultaneous
517 identification of body parts from the morphologically similar sharks Carcharhinus
518 obscures and Carcharhinus plumbeus (Carcharhinidae) using multiplex PCR. Marine
519 Biotechnology 3(3): 231-240. doi:10.1007/s101260000071.
520 Parsons, G.R. 1983. The reproductive biology of the Atlantic sharpnose shark, Rhizoprionodon
521 terraenovae. Fisheries Bulletin 88: 61–73.
522 Parsons, G.R. 1985. Growth and age estimation of the Atlantic sharpnose shark,
523 Rhizoprionodon terraenovae: a comparison of techniques. Copeia 1: 1985:80-85. doi:
524 10.2307/1444793.
525 Parsons, G.R., and Hoffmayer, E.R. 2005. Seasonal changes in the distribution and relative
526 abundance of the Atlantic sharpnoseDraft shark Rhizoprionodon terraenovae in the North
527 Central Gulf of Mexico. Copeia 4: 914-920. Available from
528 http://www.jstor.org/stable/4098665 [accessed 27 August 2017].
529 Perry, A.L., Low, P.J., Ellis, J.R., and Reynolds, J.D. 2005. Climate change and distribution
530 shifts in marine fishes. Science 308(5730): 1912-1915. doi:10.1126/science.1111322.
531 Pinhal, D., Shivji, M.S., Nachtigall, P.G., Chapman, D.D., and Martins, C. 2012. A Streamlined
532 DNA Tool for global identification of heavily exploited coastal shark species (Genus
533 Rhizoprionodon). PLoS ONE 7(4): e34797. doi:10.1371/journal.pone.0034797.
534 Portnoy, D.S., Hollenbeck, C.M., Belcher, C.N., Driggers III, W.B., Frazier, B.S., Gelsleichter,
535 J., Grubbs, R.D., and Gold, J.R. 2014. Contemporary population structure and post-
536 glacial genetic demography in a migratory marine species, the blacknose shark,
537 Carcharhinus acronotus. Molecular Ecology 23(22): 5480-5495. Available from
538 https://doi.org/10.1111/mec.12954 [accessed 7 July 2017].
25 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 26 of 33
539 Portnoy, D.S., Hollenbeck, C.M., Bethea, D.M., Frazier, B.S., Gelsleichter, J., and Gould, J.R.
540 2016. Population structure, gene flow, and historical demography of a small coastal
541 shark (Carcharhinus isodon) in US waters of the Western Atlantic Ocean. ICES Journal
542 of Marine Science 73(9): 2322-2332. Available from
543 https://doi.org/10.1093/icesjms/fsw098 [accessed 7 July 2017].
544 Spaet, J.L., Jabado, R.W., Henderson, A.C., Moore, A.B.M., and Berumen, M.L. 2015.
545 Population genetics of four heavily exploited shark species around the Arabian Peninsula.
546 Ecology and Evolution 5(12): 2317-2332. doi:10.1002/ece3.1515.
547 Springer, V.G. 1964. A revision of the carcharhinid shark genera Scoliodon, Loxodon, and
548 Rhizoprionodon. Proceedings of the United Stated National Museum 115(3493): 559-
549 632. Available from https://doi.org/10.5479/si.00963801.115-3493.559Draft [accessed
550 October 19 2017].
551 Stewart, J.S., Hazen, E.L., Bogard, S.J., Byrnes, J.E.K., Foley, D.G., Gilly, W.F., Robison, B.H.,
552 and Field, J.C. 2014. Combined climate- and prey-mediated range expansion of
553 Humboldt squid (Dosidicus gigas), a large marine predator in the California Current
554 System. Global Change Biology 20(6): 1832-1843. Available from
555 https://doi.org/10.1111/gcb.12502 [accessed 20 January 2017].
556 Suárez-Moo, P., Rocha-Olivares, A., Zapata-Perez, O., Quiroz-Moreno, A., & Teyer, L.F.S.
557 2013. High genetic connectivity in the Atlantic sharpnose shark, Rhizoprionodon
558 terraenovae, from the southeast Gulf of Mexico inferred from AFLP fingerprinting.
559 Fisheries Research 147: 338-343. Available from https://doi.org/10.1016/j.fishres.2013.0
560 7.003 [accessed 10 October 2016].
https://mc06.manuscriptcentral.com/cjfas-pubs Page 27 of 33 Canadian Journal of Fisheries and Aquatic Sciences
561 Sunnucks, P., and Hales, D.F. 1996. Numerous transposed sequences of mitochondrial
562 cytochrome oxidase I-II in aphids of the genus Sitobion (Hemiptera: Aphididae).
563 Molecular Biology and Evolution 13(3): 510-524. Available from
564 https://doi.org/10.1093/oxfordjournals.molbev.a025612 [accessed 09 February 2017].
565 Todd, T.N., Waldbeser, L.S., and Ward, R. 2004. Use of single-stranded conformational
566 polymorphisms (SSCP) to detect species relationship and population structure in the
567 Atlantic sharpnose shark (Rhizoprionodon terraenovae) and the Caribbean sharpnose
568 shark (R. porosus). In Proceedings of the Gulf and Caribbean Fisheries Institute, 55,
569 Corpus Christi, TX, 10 January 2014. Gulf and Caribbean Fisheries Institute, Corpus
570 Christi, TX: 294-305.
571 Whitlock, M.C. 2011. G’st and D do notDraft replace Fst. Molecular Ecology 20(6): 1083-1091. doi:
572 10.1111/j.1365-294X.2010.04996.x.
573 Williams, S., Bennett, M., Pepperell, J., Morgan, J., and Ovenden, J. 2016. Spatial genetic
574 subdivision among populations of the highly migratory black marlin Istiompax indica
575 within the central Indo-Pacific. Marine and Freshwater Research 67(8): 1205-1214.
576 Available from http://dx.doi.org/10.1071/MF14370 [accessed 25 July 2017].
27 https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 28 of 33
.1
2 .
3 . 11 4 12 10 9 . 13 ... . 5 14 . 8 . . . 6 .7 Draft.
.15
Figure 1. Map displaying sample sites for Rhizoprionodon terraenovae. Number in parentheses represents corresponding sample sizes.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 29 of 33 Canadian Journal of Fisheries and Aquatic Sciences
9%,,%,,%::%( 7"'8'5'( 4'3'5'(6%0+-(!.(
.#;%,%'3'(
1%2(1*3&-(!.(
<'=*,0#3( 1'+-(>?( /'$',#0'-(!.(
6*"*,0@3-( 9*A%B#( !"#$%&'()*+,-( !.(
Esri, HERE, Garmin, (c) OpenStreetMap contributors, and the GIS user community
/C'$*&(8*0D**3(8',%3,(E(FC%0*( GAB";,%=*(0#(<;"H(E(<$*+(Draft GAB";,%=*(0#(,%0*(E(1"'BI(
FigureFigure 2.2a. Ha Haplotypeplotype map map for for sampling sampling sitessites withinwithin thethe Gulf of Mexico for ! ! RhizoprionodonRhizoprionodon terraenovae.. HaplotypeHaplotype numbernumber is is identified identified within within each each section. section. Size Size of of
eacheach sectionsection represents relative proportionproportion ofof haplotype haplotype at at that that site. site.
! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !
https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 30 of 33
!"#$%&'()*+$&
71081+1*&
,#-."&/*0#)1+*&
9*:;(#+31))%4&56&
/*2%&/*+*3%0*)4&56& Draft Esri, HERE, Garmin, (c) OpenStreetMap contributors, and the GIS user community
,"*0%$&?%.@%%+&?*(1+(&A&B"1.%& <+$0#(&'()*+$4& CD:)-(13%&.#&<.)*+E:&A&F0%G& =*"*>*(& CD:)-(13%&.#&(1.%&A&=)*:;&
Figure 3. Haplotype map for sampling sites within the Northwest Atlantic Ocean for ! Figure 2b. Haplotype map for sampling sites within the Northwest Atlantic Ocean for ! Rhizoprionodon terraenovae. Haplotype number is identified within each section. Size of Rhizoprionodon terraenovae. Haplotype number is identified within each section. Size of each section represents relative proportion of haplotype at that site. each section represents relative proportion of haplotype at that site.
! !! ! ! ! ! ! ! ! ! ! !
https://mc06.manuscriptcentral.com/cjfas-pubs Page 31 of 33 Canadian Journal of Fisheries and Aquatic Sciences
Table 1. Summary statistics by collection site for Rhizoprionodon terraenovae. π h F AL 0.005 0.923 ± 0.04 -10.871* BB 0.005 0.923 ± 0.04 -9.183* BA 0.007 0.524 ± 0.21 3.344 CC 0.005 0.822 ± 0.05 -1.289 FK 0.002 0.533 ± 0.17 2.506 JA 0.005 0.901 ± 0.05 -3.050† LA 0.004 0.886 ± 0.05 -2.050 MS 0.005 0.938 ± 0.02 -9.354* MX 0.005 0.943 ± 0.04 -3.518* NW 0.006 0.948 ± 0.03 -6.366* RI 0.004 0.900 ± 0.16 -0.444 SA 0.005 Draft0.956 ± 0.06 -3.116* SC 0.005 0.800 ± 0.05 -2.897 TX 0.004 0.917 ± 0.04 -6.167* VA 0.006 0.765 ± 0.06 -0.090 ATL 0.004 0.784 ± 0.03 -6.854* GOM 0.005 0.931 ± 0.01 -26.182* Alabama, AL; Big Bed, BB; Andros Island, BA; Cape Canaveral, CC; Florida Keys, FK; Jacksonville, JA; Louisiana, LA; Mississippi, MS; Celestún, MX; Northwest Florida, NW; Rhode Island, RI; Sarasota, SA; South Carolina, SC; Texas, TX; Virginia, VA; combined Atlantic, ATL; combined Gulf, GOM. Nucleotide diversity, π; Haplotype diversity, h; Tajima’s D, D; Fu’s F, F. Significance (P < 0.05) denoted by *, near-significant (P < 0.07) denoted by †.
https://mc06.manuscriptcentral.com/cjfas-pubs Canadian Journal of Fisheries and Aquatic Sciences Page 32 of 33
Table 2. Pairwise ΦST (below diagonal) and FST (above diagonal) values between all sites for Rhizoprionodon terraenovae.
Atlantic Ocean Gulf of Mexico
RI VA SC JA CC BA FK SA BB NW AL MS LA TX MX RI - 0.030 0.045 -0.006 -0.035 0.287* 0.184 -0.057 -0.018 0.006 0.018 0.017 0.031 -0.015 0.037
VA -0.035 - -0.011 0.003 -0.014 0.246* 0.049 0.110* 0.032 0.083* 0.040 0.067* 0.064 0.047 0.069* SC 0.003 -0.016 - -0.004 -0.004 0.233* 0.048 0.098* 0.022 0.069* 0.030 0.060* 0.051 0.032 0.054 JA -0.051 -0.007 0.001 - -0.009 0.224* 0.095 0.027 0.000 0.035 0.016 0.024 0.036 0.019 0.027 CC -0.074 -0.010 0.004 -0.008 - 0.252* 0.078 0.057 0.019 0.061* 0.032 0.053* 0.052 0.039 0.052 Atlantic Ocean BA 0.443* 0.441* 0.472* 0.447* 0.515 - 0.416* 0.242* 0.202* 0.182* 0.204* 0.197* 0.238* 0.211* 0.213* FK 0.377 0.140 0.111 0.209 0.217 0.140* - 0.230* 0.078 0.014* 0.072 0.117* 0.106 0.083 0.114 SA -0.047 0.085 0.110 0.032 0.067 0.453*Draft 0.388* - 0.034 0.030 0.051 0.033 0.062 0.049 0.051 BB -0.042 -0.004 0.002 0.003 -0.001 0.518* 0.140 0.093 - 0.006 -0.013 0.003 -0.002 -0.009 -0.001 NW 0.010 0.001 0.000 0.038 0.024 0.452* 0.062 0.137* 0.006 - 0.014 0.005 -0.017 0.015 0.014 AL 0.041 0.021 0.023 0.034 0.043 0.522* 0.131 0.089 0.008 0.020 - 0.004 -0.011 -0.015 -0.013 MS 0.034 0.023 0.017 0.032 0.043 0.524* 0.116 0.131 -0.001 -0.005 0.000 - 0.000 -0.003 -0.011
Gulf of Mexico LA 0.136 0.037 0.024 0.086 0.085 0.557* 0.053 0.212* -0.031 -0.015 0.007 -0.006 - -0.007 -0.003 TX 0.067 0.007 -0.007 0.034 0.039 0.535* 0.082 0.182* -0.004 -0.008 0.021 -0.009 -0.011 - -0.015 MX -0.023 0.020 0.035 -0.002 0.026 0.473* 0.166 0.039* -0.006 0.037 -0.014 0.015 0.049 0.038 - Rhode Island, RI; Virginia, VA; South Carolina, SC; Jacksonville, JA; Cape Canaveral, CC; Andros Island, BA; Florida Keys, FK;
Sarasota, SA; Big Bend, BB; Northwest Florida, NW; Alabama, AL; Louisiana, LA; Mississippi, MS; Texas, TX; Celestún, MX.
Significance (P < 0.010) denoted by *.
https://mc06.manuscriptcentral.com/cjfas-pubs Page 33 of 33 Canadian Journal of Fisheries and Aquatic Sciences
Table 3. AMOVA results for 650 bp of mtDNA Control Region for Rhizoprionodon terraenovae. d.f. SS %V F P
FCT 1 3.351 0.02 3.44 >0.001*
FSC 13 8.005 0.01 1.86 0.003*
FST 327 141.671 0.43 94.70 >0.001*
Regions are Atlantic (Andros Island, Cape Canaveral, Jacksonville, Rhode Island, South Carolina, Virginia) and Gulf (Alabama, Big Bend, Florida Keys, Louisiana, Mexico, Mississippi, Northwest Florida, Sarasota, Texas). Among groups = FCT, Among sampling sites within groups = FSC; among sampling sites = FST; d.f., degrees of freedom; SS, sum of squares; %V, variance components; F, percentage of variation. Significance (P < 0.005) denoted by *. Draft
https://mc06.manuscriptcentral.com/cjfas-pubs Appendix:
Fig. A1: Hydrograph for river Nausta depicting the period one month before electrofishing (mean daily discharge in m³s-1). The actual date of electrofishing is marked with a black dot.
Fig. A2: Hydrograph for river Surna depicting the period one month before electrofishing (mean daily discharge in m³s-1). The actual date of electrofishing is marked with a black dot.
Fig. A3: Hydrograph for river Stjørdalselva depicting the period one month before electrofishing (mean daily discharge in m³s-1). The actual dates of electrofishing are marked with black dots.
Fig. A4: One of the arenas used in the experiments. The water inlet is on the right side, the water outlet on the left. White tarps are providing shade and overhead protection. The photo depicts the 20 hour acclimatisation period when fish could swim freely around in the sections to choose their preferred habitat, i.e. the deep area close to the outer wall or the shallow area close to the inner wall. The mesh screens (“trap doors”) are therefore in the upper position, suspended over the water surface. The ropes that are used to activate the trap doors are leading to the centre of the whole construction, which is the place the operator will be standing when releasing them and thus ending the 20 hour acclimatisation period.
Fig. A5: One of the arenas during the 20 hours acclimatisation period seen from upstream. White tarps cover about 50% of each section. The "trap doors" are locked in place above the water surface and are ready to get dropped by removing the metal bolts that are attached to ropes.
Fig. A6: Arena during fishing: The tarps are removed and the trap doors are lowered to separate the shallow from the deep area.
Fig. A7: Inside of the arena: Detail of the downward slope from the shallow to the deep area. The metal rail in the middle will hold the trap door in place once lowered. Fine plastic mesh is fastened to a wooden construction separating the sections from each other.