sign in sign up
<<
Home , Mycoplasma genitalium

JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 1991, p. 46-50 Vol. 29, No. 1 0095-1137/91/010046-05$02.00/0 Copyright X) 1991, American Society for Microbiology Polymerase Chain Reaction for Detection of genitalium in Clinical Samples J. SKOV JENSEN,'* S. A. ULDUM,1 J. S0NDERGARD-ANDERSEN,1 JENS VUUST,2 AND KLAUS LIND' Mycoplasma Laboratory' and Department of Treponematoses,2 Statens Seruminstitut, Artillerivej 5, DK-2300 Copenhagen S, Denmark Received 4 June 1990/Accepted 8 October 1990

We have used the polymerase chain reaction to detect Mycoplasma genitalium in artificially seeded throat swab samples as well as in clinical material. On the basis of the published nucleotide sequence of the M. genitalium 140-kDa adhesin , primers were chosen to produce an amplified fragment of 281 bp. Five different previously isolated strains, including the type strain of M. genitalium, could all be detected by the polymerase chain reaction, and from other mycoplasmal and bacterial species yielded negative results. The detection limits were estimated to be approximately 50 by inspection of ethidium bromide- stained agarose gels and 4 organisms when a biotinylated oligonucleotide probe was used in filter hybridization. The amplified DNA fragments were subjected to restriction enzyme analysis. DNAs from the five different isolates all possessed EcoRI, SspI, AluI, Sau3AI, and DdeI restriction sites, as predicted from the published sequence. A total of 150 urogenital swabs collected from 100 patients for culturing of Chiamydia trachomatis were tested for the presence of M. genitalium DNA. Ten samples from eight patients were found positive. The amplified DNA fragments from all of our clinical samples possessed the AluI, Sau3AI, and DdeI restriction sites, but three samples from two patients did not contain the SspI site and none of the samples contained the EcoRI site.

In 1980, a new mycoplasma species distinct from all other simulated positive specimens and demonstrates its use with known was isolated from urethral specimens clinical material. from two men with nongonococcal (12, 13). Be- cause of its derivation, it was named Mycoplasma genital- ium (13). This mycoplasma has several properties in com- MATERIALS AND METHODS mon with the well-known human respiratory M. Organisms and growth conditions. M. genitalium G-37T pneumoniae. Both species share traits of pathogenic myco- and four M. genitalium isolates from the human respiratory plasmas, and both possess a terminal tip structure and the tract, designated R 32 G, Tw 10-6 G, Tw 10-5 G, and Tw 48-5 capability to adhere to erythrocytes, various tissue cells, G (kindly provided by J. G. Tully), were grown at 37°C in 150 glass, and plastic surfaces. Furthermore, M. genitalium and ml of SP-4 medium (14) in 800-ml NUNCLON disposable M. pneumoniae share antigens, giving rise to extensive polystyrene culture flasks (NUNC AIS, Roskilde, Den- cross-reactions in most serological tests (5). mark). Adherent mycoplasmas were harvested by centrifu- Although M. genitalium was originally isolated from uro- gation in the late log phase. The following species (strains) genital tract specimens, no other isolates have been reported were grown in modified Hayflick's medium (5) and harvested from this site. A serological indication that M. genitalium by centrifugation in the late log phase: M. pneumoniae (FH, could be involved in pelvic inflammatory disease has been Mac, M129-B8, M129-B170, and five clinical isolates), M. controversial (4, 7). Despite experimental data indicating hominis (PG21, H34, H27, and three clinical isolates), M. that M. genitalium could induce genital tract in salivarium (PG 20), M. buccale (CH 20247), M. orale (Patt nonhuman primates (11), direct evidence linking M. genital- and one clinical isolate), M. fermentans (G, S38, and one ium to human urethritis is lacking. On the other hand, a clinical isolate), M. faucium (DC 333), M. primatum (Navel), DNA probe hybridization assay has indicated that M. geni- M. pirum (HRC70-159 and one tissue culture isolate), M. talium might be present in urogenital specimens collected arginini (G230), M. hyorhinis (BTS-7 and GDL), M. arthri- from as many as 60% of male homosexual patients with tidis (S16), M. pulmonis (PG 34), and Acholeplasma laid- recurrent or persistent nongonococcal urethritis and in 22% lawii (A). (serotypes I [F. Black 7] of heterosexual men with recurrent urethritis, compared and VIII [F. Black 960]) was grown in U10C medium (8). In with 9% of men without urethritis (3). addition, the following , including some species The recent observation that M. genitalium could be found shown to be related to the , were investigated: in respiratory tract specimens from patients with pneumonia subtilis, Bacteroidesfragilis, Bacteroides melanino- and isolated from a mixture with M. pneumoniae (1) has genicus, innocuum, Clostridium ramosum, raised new, interesting questions as to the main tissue , faecalis, Erysipelo- tropism and the possible pathogenicity of M. genitalium. thrix rhusiopathiae, Gardnerella vaginalis, Haemophilus This report describes the use of the polymerase chain influenzae, Klebsiella pneumoniae, Lactobacillus species, reaction (PCR) (9) for the detection of M. genitalium DNA in anaerobius, Pseudomonas aeruginosa, agalactiae, Streptococcus cremoris, and . Clinical specimens. For the evaluation of sensitivity and * Corresponding author. specificity, throat swab samples from 20 healthy persons 46 VOL. 29, 1991 PCR FOR DETECTION OF M. GENITALIUM 47

TABLE 1. Sequences of oligonucleotide primers and probes Namea Sequence Use MgPa-1 5'AGTTGATGAAACCTTAACCCC7TGG3' Forward primer MgPa-2 5'GACCATCAAGGTATTTCTCAACAGC3' Probe or reverse primer MgPa-3 5'CCGTTGAGGGGTTTTCCATTTTTGC3' Reverse primer a MgPa-1 corresponds to the sequence of bases 179 to 206 of the coding strand of the gene coding for the 140-kDa adhesin of M. genitalium (2). MgPa-2 is complementary to bases 348 to 373 and MgPa-3 is complementary to bases 435 to 460 of the same sequence. were collected in 1.8 ml of 100 mM NaCi-10 mM Tris 60 min, the proteinase was inactivated at 95°C for 10 min, hydrochloride (pH 8.0)-i mM EDTA. Urogenital samples and the tubes were centrifuged at 10,000 x g for 10 s. were randomly chosen from samples submitted for culturing The simulated positive samples were prepared either by of C. trachomatis. They were collected in 1.8 ml of a adding 10-fold dilutions of M. genitalium in SP4 broth (14) medium containing 0.2 M sucrose in 0.02 M phosphate buffer before centrifugation or by adding purified M. genitalium (pH 7.2), 10% heat-treated fetal calf serum, vancomycin (25 DNA after centrifugation. The stock suspension of M. jig/mI), gentamicin (20 ,ug/ml), and amphotericin B (2.5 genitalium cells from which the dilutions were prepared was ,ug/ml). The samples were frozen at -80°C within 24 h and filtered through a 0.45-jim-pore-size filter to yield single thawed within 1 week for culturing of C. trachomatis. The cells, and the dilutions were plated onto SP4 agar for PCR analysis was performed on refrozen samples within 14 counting of colonies. days. We have no clinical information about the patients. Amplification. The PCR was performed with thermostable DNA extraction. Mycoplasma cells from 300 ml of culture Taq DNA polymerase (Amplitaq; Perkin Elmer Cetus, Nor- were resuspended in 0.75 ml of phosphate-buffered saline, walk, Conn.) in an automated DNA thermal cycler (PHC-1; lysed by the addition of 30 jil of 25% sodium dodecyl sulfate Techne Ltd., Cambridge, United Kingdom). The 50-jil sam- (SDS), and incubated with 50 jig of RNase A (Boehringer ple to be analyzed was adjusted to a total volume of 100 jil in GmbH, Mannheim, Federal Republic of Germany) for 30 lx PCR buffer containing final concentrations of 125 jiM min at 37°C. After the addition of EDTA (pH 8.0) (final each dATP, dCTP, dTTP, and dGTP; 0.2 jiM each primer; concentration, 50 mM) and proteinase K (Boehringer) (final and 1 U of Taq polymerase per 100 jil. Each sample was concentration, 50 jig/ml), the mixture was incubated for 45 overlaid with 4 drops of mineral oil to prevent evaporation. min at 37°C. The preparation was made 1 M in sodium Samples were denatured at 95°C for 1 min, and primers perchlorate by the addition of a 5 M solution and extracted were annealed at 65°C for 1 min and extended at 72°C for 1 three times with chloroform-isoamyl alcohol (24:1). The min. A total of 35 cycles were performed. In the 35th cycle, DNA was precipitated with ethanol and resuspended in 10 the extension time was increased to 6 min. mM Tris hydrochloride (pH 8.0)-i mM EDTA. Analysis of amplified samples. Amplified samples (20 jIl) Synthesis of oligonucleotides. On the basis of the published were analyzed on a composite agarose gel consisting of 1% nucleotide sequence of the M. genitalium 140-kDa adhesion SeaKem agarose and 2% NuSieve agarose (both from FMC, protein gene (2), three 25-mer oligonucleotides were synthe- Rockland, Maine) in 0.5x Tris-borate-EDTA buffer (6) con- sized on a Biosearch 8750 DNA synthesizer: MgPa-1 was taining 5 jig of ethidium bromide per ml. The DNA was complementary to the coding strand, and MgPa-2 and visualized by UV fluorescence. Samples (5 jil) containing a MgPa-3 were complementary to the noncoding strand; thus, band of the expected size were subjected to digestion for 2 h MgPa-2 could be used either as a probe or as a reverse at 37°C with 5 U of EcoRI, SspI, DdeI, AluI, or Sau3AI primer (Table 1 and Fig. 1). The MgPa-2 oligonucleotide was (Bethesda Research Laboratories, Gaithersburg, Md.) (Fig. labeled with Bio-11-dUTP and terminal deoxynucleotide 1), each in a final volume of 20 jil of 1 x buffer recommended transferase (terminal labeling kit from Enzo Diagnostics, by the supplier. As an internal control, a small amount of the Inc., New York, N.Y.) in accordance with the manufactur- 145-bp product amplified with primers MgPa-1 and MgPa-2 er's instructions, except that purification was not performed. on M. genitalium G-37T was added to each of the samples Preparation of samples. Throat swab samples or urogenital before digestion. The restriction digests were analyzed by samples (150 to 200 jil) were concentrated by centrifugation gel electrophoresis. Capillary transfer of DNA was carried and subsequent resuspension in 50 jil of lysis buffer consis- out by the Southern method (10) on the genital samples for ting of 1 x PCR buffer (50 mM KCl-10 mM Tris hydrochlo- further verification by hybridization analysis. ride [pH 8.3] at 25°C-4.5 mM MgCl2-0.01% gelatin) contain- Nonradioactive hybridization. Following electrophoresis, ing 0.45% Nonidet P-40, 0.45% Tween 20, and 200 jig of the gel was soaked in a solution containing 0.4 M NaOH and proteinase K per ml. The samples were incubated at 55°C for 0.6 M NaCl for 30 min to denature the DNA. Capillary

Sau3A I Ssp I Eco RI Alu I Dde I 256 297 315 415 432 179 I I

373 460 FIG. 1. Positions of primers for the M. genitalium PCR and cleavage sites for the restriction enzymes used. Numbers correspond to the base positions of the published sequence (2). 48 JENSEN ET AL. J. CLIN. MICROBIOL.

transfer to a modified nylon membrane (GeneScreen Plus; 1 2 3 4 5 6 7 8 9 1011121314151617 Du Pont) was performed overnight with the denaturing solution as a transfer buffer. Following transfer, the mem- A brane was neutralized in 0.5 M Tris hydrochloride (pH 7.5)-1.0 M NaCl. Prehybridization (1 h) was carried out in 0.5 M sodium phosphate buffer (pH 7.2)-i mM EDTA-7% SDS at 52°C. Hybridization was conducted overnight at 52°C 396 - in the same mixture but containing 1.2 pmol of the biotiny- 281 - lated MgPa-2 oligonucleotide per ml. After hybridization, 220 - the filters were washed at 52°C four times in 0.04 M sodium 154 - phosphate (pH 7.2)-1% SDS (15 min each) and once in 0.02 M sodium phosphate-0.5% SDS (15 min). 75 - Detection of the hybridized probe was done after the membrane was washed for 5 min at room temperature in buffer 1(100 mM Tris hydrochloride [pH 7.5], 150 mM NaCl, 0.05% Tween 20) and blocked for 1 h at 37°C in buffer 1 plus B 5% nonfat dry milk (buffer 2). After a short wash in buffer 1, the membrane was incubated with alkaline phosphatase- labeled streptavidin (DAKO D 396; Dakopatts A/S, Glos- trup, Denmark) diluted 1:1,000 in buffer 1 for 15 min at room temperature and washed twice in buffer 1 (15 min each) and 163 once in buffer 3 (100 mM Tris hydrochloride [pH 9.5], 100 mM NaCl, 50 mM MgCl2) (10 min). Color was developed by incubating the membrane in buffer 3 containing 5-bromo-4- chloro-3-indolylphosphate (150 ng/ml) and Nitro Blue Tetra- zolium (325 ng/ml) for 30 to 90 min in the dark. The color reaction was stopped by rinsing in distilled water, and the membrane was dried. FIG. 2. (A) Electrophoretic analysis of the PCR products ob- tained with different isolates of M. genitalium before and after RESULTS digestion with SspI (lanes 2 to 11) and with decreasing amounts of M. genitalium DNA (lanes 13 to 16). Lanes 1 and 17, Molecular Sensitivity of the PCR assay. In preliminary studies, am- weight standards (pBR322 digested with both HindlIl and Hinfl). plifications were carried out with MgPa-1 and MgPa-3 as The numbers at the left are sizes in base pairs. Lanes 2 and 3, G-37T primers and purified DNA from M. genitalium G-37T, giving before and after digestion with SspI, respectively. Lanes 4 to 11, rise to the expected 281-bp fragment. On inspection of Respiratory isolates before and after digestion, respectively, with ethidium bromide-stained gels, a single fragment was visible SspI: R 32 G (lanes 4 and 5), Tw 10-6 G (lanes 6 and 7), Tw 10-5 G (lanes 8 and 9), and Tw 48-5 G (lanes 10 and 11). Lane 12 is blank. when 7 fg of M. genitalium template DNA, equivalent to Lanes 13 to 16 show the sensitivity of the PCR for M. genitalium: eight genome copies, assuming a of 840 kbp, lane 13, 70 pg of DNA (80,000 organisms); lane 14, 0.7 pg of DNA was used (Fig. 2). When purified DNA was added to 25 (800 organisms); lane 15, 7 fg of DNA (8 organisms); and lane 16, no PCR-negative urogenital specimens and 20 throat swabs DNA. (B) Southern analysis of the gel shown in panel A with from healthy persons, the sensitivity was approximately biotinylated MgPa-2. sixfold lower, allowing 50 copies to be detected consistently by gel inspection; hybridization with the internal probe revealed DNA equivalent to four organisms. There was no significant sample-to-sample variability at the sensitivity None of these organisms gave rise to amplified DNA frag- level. ments in the 180- to 400-bp range, although a 160-bp frag- When serially diluted, broth-grown M. genitalium cells ment was seen when DNA from H. influenzae was used. were added to five throat swabs from healthy persons and Throat swabs from 20 healthy persons were also PCR five PCR-negative urogenital specimens, fewer than 20 CFU negative. were consistently detectable on ethidium bromide-stained Amplification of DNA in genital samples. A total of 150 agarose gels. There was no significant sample-to-sample swabs collected from the or the cervix for culturing variability at the sensitivity level. of C. trachomatis were tested for the presence of M. Specificity of the PCR assay. Amplifications conducted genitalium DNA. The swabs originated from 100 patients (26 with DNA from M. genitalium G-37T and the four respira- male and 74 female). In each of 10 samples from eight tory isolates all yielded the predicted 281-bp fragment. patients (three male and five female), we detected a very Digestion with EcoRI gave rise to fragments of 136 and 145 distinct band at a position corresponding to that of the bp, and the MgPa-2 probe hybridized to the 145-bp fragment, 281-bp fragment, but in 1 sample, the position corresponded as expected (Fig. 1). Digestions with AluI, DdeI, Sau3AI, to that of an approximately 10-bp-longer fragment (Fig. 3). and SspI all gave rise to fragments of sizes predicted from The MgPa-2 probe hybridized strongly to all 10 amplified the published sequence (Fig. 1). fragments, and when the samples were retested with MgPa-1 Amplifications carried out with the other mycoplasmas and MgPa-2 as primers, a strong signal was observed for all mentioned in Materials and Methods did not yield any band. samples. Digestions with AluI, DdeI, and Sau3AI yielded Further control experiments were performed with DNAs fragments of the predicted sizes. EcoRI was unable to cut from a variety of bacteria known to be related to the the amplified DNA in our clinical samples, and SspI did not mollicutes or to be common in the human microbial flora. digest three of the samples from two patients (Fig. 3). The These microorganisms are listed in Materials and Methods. sample with the 291-bp fragment that was amplified when VOL. 29, 1991 PCR FOR DETECTION OF M. GENITALIUM 49

variety of bacteria did not yield amplified 281-bp DNA 1 2 3 4 5 6 7 8 9 10111213141516 fragments. A In the urogenital specimens examined, M. genitalium DNA was detected in 10 of 150 samples (6.7%) from 8 of 100 patients (3 male [12%] and 5 female [7%]). This result is in 396 accordance with the 11% overall prevalence in a heterosex- 281 ual male population found in a previous study (3) with a 220 probe prepared from total M. genitalium DNA. 154 The DNA amplified in the urogenital specimens in our study did not possess the EcoRI site present in the type 75 strain and in the respiratory isolates examined, and one of the amplified DNA fragments was approximately 10 bp longer than expected. On the other hand, all the amplified fragments hybridized strongly to the MgPa-2 probe and possessed DdeI, AluI, and Sau3AI restriction enzyme cleav- B age sites, precluding the possibility that the band was a result of nonspecific amplification. The loss of the restriction enzyme cleavage site may have been due to a point muta- tion, perhaps reflecting a geographic variation of the M. genitalium strains or a variability in the adhesion protein 163 - gene between positions 297 and 348. The findings that one of the specimens contained M. genitalium DNA with an appar- ent insertion in this area and had lost the EcoRI site at position 315 and that some of the specimens had lost the SspI site at position 297 raise questions as to the conserved nature of the genomic material in this part of the adhesion protein gene and call for a more thorough investigation of the FIG. 3. (A) Electrophoretic analysis of the PCR products ob- variations among different isolates. Although the variability tained from urogenital samples submitted for culturing of C. tracho- in the sequences seems to be prevalent in the region between matis. Lanes 1 and 16, Molecular weight standards (pBR322 di- positions 297 and 348, outside the priming region, the gested with both HindlIl and Hinfl). The numbers at the left are possibility that some samples could carry in the sizes in base pairs. Lanes 2, 4, 6, 8, 10, 12, and 14, Amplified priming region cannot be excluded. Mutations in the fragments without restriction enzyme analysis. Lanes 3, 5, 7, 9, 11, 3' end 13, and 15, Same fragments after digestion of samples with SspI. of the primers would preclude efficient amplification, giving Note that the fragments in lanes 2 and 4 do not possess the SspI site. rise to false-negatives. The final documentation that the The fragments in lanes 2 and 4 were amplified in a urethral swab and variability in the amplified sequences is not due to a lack of a cervical swab, respectively, from the same patient. Lanes 8 and 9 specificity must await the isolation of M. genitalium by contain a fragment carrying an insertion (see the text). (B) Southern culturing. blot of the gel shown in panel A with biotinylated MgPa-2 as a probe. A detailed examination of many different isolates of M. genitalium has hitherto been impossible because isolation by culturing is extremely difficult, but the PCR may be of some MgPa-1 and MgPa-3 were used as primers had a similar help in these investigations by identifying samples contain- 10-bp-longer fragment that was amplified when MgPa-1 and ing M. genitalium. We have tried to cultivate M. genitalium MgPa-2 were used as primers. Digestion with SspI, which from the PCR-positive specimens but have failed, presum- cuts at position 297 of the published sequence (2), showed ably because the chlamydia transport medium contains that the longer fragment carried the insertion (Fig. 3). This gentamicin, which is inhibitory to M. genitalium. result indicates that the insertion is located between posi- We believe that the PCR method that we have developed tions 297 and 348 in the sequence of the adhesin gene (Fig. for M. genitalium will make it possible to investigate its role 1). in human disease and to obtain new isolates of this interest- ing . The method is easy to perform and lends itself DISCUSSION to routine analysis. We are presently attempting to demon- strate M. genitalium DNA in throat swabs from patients with To make it feasible to investigate the possible pathogenic- pneumonia by this technique. ity of M. genitalium and to aid in the elucidation of its main tissue tropism, we have applied the PCR technique to the REFERENCES detection of M. genitalium DNA in clinical samples. We 1. Baseman, J. B., S. F. Dallo, J. G. Tully, and D. L. Rose. 1988. have chosen to use the previously published DNA sequence Isolation and characterization of Mycoplasma genitalium of the gene for the 140-kDa adhesion protein of M. genital- strains from the human respiratory tract. J. Clin. Microbiol. ium, which is presumably essential for the pathogenicity of 26:2266-2269. this organism. 2. Dallo, S. F., A. Chavoya, C.-J. Su, and J. B. Baseman. 1989. In this communication, we show that the PCR assay is DNA and protein sequence homologies between the adhesins of Mycoplasma genitalium and capable of detecting very few copies of the M. genitalium . Infect. Immun. 57:1059-1065. genome by using type as well as the strain, G-37, four 3. Hooton, T. M., P. L. Roberts, W. E. Stamm, M. C. Roberts, respiratory isolates of M. genitalium. K. K. Holmes, and G. E. Kenny. 1988. Prevalence of Myco- DNA from the closely related M. pneumoniae, DNAs plasma genitalium determined by DNA probe in men with from other human and nonhuman mycoplasmas, both with urethritis. Lancet i:266-268. and without a tip structure, human DNA, and DNAs from a 4. Lind, K., and G. B. Kristensen. 1987. Significance of 50 JENSEN ET AL. J. CLIN. MICROBIOL.

to Mycoplasma genitalium in . Eur. J. Clin. Micro- DNA polymerase. Science 239:487-491. biol. 6:205-207. 10. Southern, E. M. 1975. Detection of specific sequences among 5. Lind, K., B. 0. Lindhardt, H. J. Schutten, J. Blom, and C. DNA fragments separated by gel electrophoresis. J. Mol. Biol. Christiansen. 1984. Serological cross-reactions between Myco- 98:503-517. plasma genitalium and Mycoplasma pneumoniae. J. Clin. Mi- 11. Taylor-Robinson, D., J. G. Tully, and M. F. Barile. 1985. crobiol. 20:1036-1043. Urethral in male chimpanzees-produced experimen- 6. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular tally by Mycoplasma genitalium. Br. J. Exp. Pathol. 66:95-101. cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 12. Tully, J. G., D. Taylor-Robinson, R. M. Cole, and D. L. Rose. 7. M0oler, B. R., D. Taylor-Robinson, and P. M. Furr. 1984. 1981. A newly discovered mycoplasma in the human urogenital Serological evidence implicating Mycoplasma genitalium in tract. Lancet i:1288-1291. pelvic inflammatory disease. Lancet i:1102-1103. 13. Tully, J. G., D. Taylor-Robinson, D. L. Rose, R. M. Cole, and 8. Razin, S., and J. G. Tully (ed.). 1983. Methods in mycoplasmol- J. M. Bove. 1983. Mycoplasma genitalium, a new species from ogy, 1st ed., vol. 1. Academic Press, Inc., New York. the human urogenital tract. Int. J. Syst. Bacteriol. 33:387-396. 9. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, 14. Tully, J. G., R. F. Whitcomb, H. F. Clark, and D. L. Williamson. G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer- 1977. Pathogenic mycoplasmas: cultivation and vertebrate directed enzymatic amplification of DNA with a thermostable pathogenicity of a new spiroplasma. Science 195:892-894.