DOCSLIB.ORG

Wo2018/191558

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Wo2018/191558 (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/191558 Al 18 October 2018 (18.10.2018) W !P O PCT (51) International Patent Classification: (72) Inventors; and C12N 5/071 (2010.01) C12Q 1/6813 (2018.01) (71) Applicants: RAJAGOPAL, Jayaraj [US/US]; C/o 55 C12N 5/079 (2010.01) C12Q 1/6881 (2018.01) Fruit Street, Boston, MA 021 14 (US). REGEV, Aviv C12Q 1/68 (2018.01) G01N 33/53 (2006.01) [US/US]; C/o 415 Main Street, Cambridge, MA 02142 (US). BITON, Moshe [US/US]; C/o 55 Fruit Street, (21) International Application Number: Boston, MA 021 14 (US). HABER, Adam [US/US]; CI PCT/US2018/027388 o 415 Main Street, Cambridge, MA 02142 (US). MON- (22) International Filing Date: TORO, Daniel [US/US]; C/o 55 Fruit Street, Boston, MA 12 April 2018 (12.04.2018) 021 14 (US). XAVIER, Ramnik [US/US]; C/o 55 Fruit Street, Boston, MA 021 14 (US). (25) Filing Language: English (74) Agent: SCHER, Michael, B.; Johnson, Marcou & Isaacs, (26) Publication Language: English LLC, P.O. Box 6 1, Hoschton, GA 30548 (US). (30) Priority Data: (81) Designated States (unless otherwise indicated, for every 62/484,746 12 April 2017 (12.04.2017) US kind of national protection available): AE, AG, AL, AM, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 415 Main Street, Cambridge, MA 02142 (US). CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, MASSACHUSETTS INSTITUTE OF TECHNOLO¬ DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, GY [US/US]; 77 Massachusetts Avenue, Cambridge, MA HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 02139 (US). THE GENERAL HOSPITAL CORPO¬ KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, RATION [US/US]; 55 Fruit Street, Boston, MA 021 14 MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (US). OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY,TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (54) Title: MODULATION OF EPITHELIAL CELL DIFFERENTIATION, MAINTENANCE AND/OR FUNCTION THROUGH T CELL ACTION, AND MARKERS AND METHODS OF USE THEREOF (57) Abstract: An atlas of intestinal epithelial cells, intestinal ep ithelial stem cells and intestinal immune cells identifies new cell populations, markers, networks, and responses to stimuli. Intestinal epithelial cell sub-types are also found in the trachea. Accordingly, disclosed are methods of modulating epithelial cell differentiation, maintenance and/or function, related methods for the treatment of disease, including IBD and asthma. Also disclosed are methods and kits for identifying cell types, their differentiation, homeostasis and activation. CD3r 3 ' 00 FIG. 1A 00 o [Continued on nextpage] WO 2018/191558 Al llll II II 11III II I I llll III I I 11III II I II (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Published: — with international search report (Art. 21(3)) — with sequence listing part of description (Rule 5.2(a)) MODULATION OF EPITHELIAL CELL DIFFERENTIATION, MAINTENANCE AND/OR FUNCTION THROUGH T CELL ACTION, AND MARKERS AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No. 62/484,746, filed April 12, 2017. The entire contents of the above-identified application is hereby fully incorporated herein by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH [0002] This invention was made with government support under Grant Nos. OD020839, DKl 14784, DK043351 and DK097485 awarded by the National Institutes of Health. The government has certain rights in the invention. TECHNICAL FIELD [0003] The subject matter disclosed herein is generally directed to compositions and methods for modulating, controlling or otherwise influencing epithelial cell differentiation, homeostasis and activation in the gut and respiratory system. This invention also relates generally to identifying and exploiting target genes and/or target gene products that modulate, control or otherwise influence epithelial cell differentiation, homeostasis and activation in a variety of therapeutic and/or diagnostic indications. This invention also relates generally to a gut and trachea atlas identifying novel cell types and markers for detecting, quantitating and isolating said cell types. BACKGROUND [0004] The functional balance between the epithelium and the constituents within the lumen plays a central role in both maintaining the normal mucosa and in disease. Intestinal epithelial cells (IECs) of the small intestinal epithelium comprise two major lineages - absorptive and secretory 1 - reflecting its dual roles to absorb nutrients and form a flexible barrier, monitoring and titrating responses to a variety of noxious substances or pathogens2. Enterocytes of the absorptive lineage comprise approximately 80% of the epithelium and are specialized for digestion and transport of nutrients3. The secretory lineage comprises five further terminally differentiated types of IECs: goblet, Paneth, enteroendocrine, tuft and microfold (M) cells4 6 - each with distinct and specialized sensory and effector functions. [0005] The epithelium is organized in a repeating structure of villi, which project toward the lumen, and nearby crypts (Fig. la). The crypts of the small intestine are the proliferative part of the epithelium, in which intestinal stem cells (ISCs) and progenitors, termed transit- amplifying cells (TAs), reside6 7. In contrast, only fully differentiated cells are found on the villi2 7. The crypt also contains Paneth cells, which secrete anti-microbial peptides (AMPs), such as defensins and lysozyme, into the lumen to keep the microbiota in check8 9. The highly proliferative TA cells migrate along the crypt-villus axis and differentiate into functionally distinct epithelial cell types that subsequently reach the tip of the villus, where mature cells undergo apoptosis and shed to the lumen 1. [0006] Epithelial tissue turns over rapidly (~5 days)8, allowing it to dynamically shift its composition in response to stress or pathogens. For example, parasitic infection typically induces hyperplasia of goblet cells, which produce and secrete mucins to prevent pathogen attachment, strengthening the epithelial barrier and facilitating parasite expulsion 10 . Rare (0.5-1%) enteroendocrine cells (EECs) secrete over 20 individual hormones and are key mediators of intestinal response to nutrients 11 12 by directly detecting fluctuations in luminal nutrient concentrations via G-protein-coupled receptors (GPCRs) 11. Finally, IECs communicate with immune cells to initiate either inflammatory responses or tolerance in response to lumen signals2 13 . Tuft cells5, a rare IEC population, promote type-2 immunity in response to intestinal parasites by expressing interleukin-25 (1125), which in turn mediates the recruitment of group 2 of innate lymphoid cells (ILC2s) that initiate the expansion of T- helper type 2 (Th2) cells upon parasite infection 14 16. M cells, which reside exclusively in follicle-associated epithelia (FAE) 17, play an important role in immune sensing by transporting luminal content to immune cells found directly below them 18 in Peyer's patches, gut associated lymphoid follicles. Disruption in any of the major innate immune sensors and proximity effector functions of IECs may result in increased antigenic load through weakening of the epithelial barrier, and may lead to the onset of acute or chronic inflammation. [0007] Despite this extensive knowledge, given the complexity of the epithelial cellular ecosystem, many questions remain open. First, do we know all the discrete epithelial cell types of the gut, or are there additional types, or new sub-types that have eluded previous studies. Second, what are the molecular characteristics of each type. For example, mapping the GPCRs and hormones expressed by EECs has important therapeutic applications; charting known and new specific cell surface markers would provide handles for specific cell isolation, and help assess the validity of legacy ones; and finding differentially expressed transcription factors (TFs) will open the way to study the molecular processes that accompany the differentiation of IECs, such as tuft or enteroendocrine cells. Third, we still know little about the response of individual cell populations to pathogenic insult, both in terms of changes in cellular proportions and cell-intrinsic responses. [0008] A systematic atlas of single-cell RNA profiles can help address these questions, as the gene-expression program of a given cell closely reflects both its identity and function 19 20 . Most previous studies have examined the gene-expression profiles of IECs, but relied on known markers to purify cell populations6 15'2 1 22, which may isolate either a mixed population if marker expression is more promiscuous than assumed, or a subset of a larger group if overly specific. They may further fail to detect rare cellular populations or intermediate, transient states on a continuum. A recent study23 attempted to overcome these limitations using single-cell RNAseq (scRNA-seq), but analyzed only several hundred single cells, which may be insufficient to address the diversity of IECs, especially for subtypes that occur at a frequency of less than 0.1% '12 . Additional, studies53'30'145 also attempted to overcome these limitations using single-cell RNAseq (scRNA-seq).
Load more

Recommended publications
  • Downloaded from the National Database for Autism Research (NDAR)
    International Journal of Molecular Sciences Article Phenotypic Subtyping and Re-Analysis of Existing Methylation Data from Autistic Probands in Simplex Families Reveal ASD Subtype-Associated Differentially Methylated Genes and Biological Functions Elizabeth C. Lee y and Valerie W. Hu * Department of Biochemistry and Molecular Medicine, The George Washington University, School of Medicine and Health Sciences, Washington, DC 20037, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-202-994-8431 Current address: W. Harry Feinstone Department of Molecular Microbiology and Immunology, y Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205, USA. Received: 25 August 2020; Accepted: 17 September 2020; Published: 19 September 2020 Abstract: Autism spectrum disorder (ASD) describes a group of neurodevelopmental disorders with core deficits in social communication and manifestation of restricted, repetitive, and stereotyped behaviors. Despite the core symptomatology, ASD is extremely heterogeneous with respect to the severity of symptoms and behaviors. This heterogeneity presents an inherent challenge to all large-scale genome-wide omics analyses. In the present study, we address this heterogeneity by stratifying ASD probands from simplex families according to the severity of behavioral scores on the Autism Diagnostic Interview-Revised diagnostic instrument, followed by re-analysis of existing DNA methylation data from individuals in three ASD subphenotypes in comparison to that of their respective unaffected siblings. We demonstrate that subphenotyping of cases enables the identification of over 1.6 times the number of statistically significant differentially methylated regions (DMR) and DMR-associated genes (DAGs) between cases and controls, compared to that identified when all cases are combined. Our analyses also reveal ASD-related neurological functions and comorbidities that are enriched among DAGs in each phenotypic subgroup but not in the combined case group.
    [Show full text]
  • Ccdc80 and Ccdc80-L1: Identification and Functional Analysis of Two Novel Genes Involved in Zebrafish (Danio Rerio) Development
    UNIVERSITÀ DEGLI STUDI DI MILANO SCUOLA DI DOTTORATO IN SCIENZE BIOLOGICHE E MOLECOLARI DIPARTIMENTO DI BIOLOGIA DOTTORATO DI RICERCA IN BIOLOGIA CELLULARE E MOLECOLARE XXIV CICLO ccdc80 and ccdc80-l1: Identification and Functional Analysis of Two Novel Genes Involved in Zebrafish (Danio rerio) Development settori scientifico/disciplinari: BIO/06; BIO/11 Tesi di dottorato di Chiara Brusegan R08215 TUTOR: prof. Franco Cotelli COORDINATORE DEL DOTTORATO: prof. Martino Bolognesi A.A. 2010/2011 Index Part I 1. Abstract 1 2. State of the art 2 2.1 Motility of the zebrafish embryo 2 2.2 Muscle formation 3 2.3 Neural differentiation 6 2.4 Identification of zebrafish ccdc80 genes 9 3. Aim of the project 13 4. Materials and Methods 14 4.1 Zebrafish lines and maintenance 14 4.2 Sequence analysis 14 4.3 RT-PCR 15 4.4 Synthesis of probes for whole mount in situ hybridization (WISH) 16 4.5 Whole-mount in situ hybridization 17 4.6 Immunohistochemistry 17 4.7 Histological sections 18 4.8 Injections 18 4.9 Cyclopamine treatment 19 4.10 Statistical analysis 19 5. Results 20 5.1 Identification of ccdc80 homologs in the genome of zebrafish 20 5.2.1 ccdc80 expression profiling 22 5.2.2 ccdc80-loss- and gain-of-function affects somitogenesis in vivo 23 5.2.3 ccdc80 is involved in somitogenesis, but not in the development of the notochord 25 5.2.4 ccdc80 is positively regulated by the Hedgehog pathway 26 5.3.1 ccdc80-l1 expression profiling 27 5.3.2 ccdc80-l1 knocked-down embryos displayed impaired motility 29 5.3.3 ccdc80-l1 loss of function does not affect somitogenesis nor muscle pioneers and adaxial cells formation 30 5.3.4 analysis of neurogenesis of primary motoneurons in ccdc80-l1 morphants 32 5.3.5 Also ccdc80-l1 expression is positively regulated by the Hedgehog pathway 35 5.4.1 ccdc80 expression is not regulated by ccdc80-l1, nor vice versa 37 6.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point
    [Show full text]
  • Upregulation of Peroxisome Proliferator-Activated Receptor-Α And
    Upregulation of peroxisome proliferator-activated receptor-α and the lipid metabolism pathway promotes carcinogenesis of ampullary cancer Chih-Yang Wang, Ying-Jui Chao, Yi-Ling Chen, Tzu-Wen Wang, Nam Nhut Phan, Hui-Ping Hsu, Yan-Shen Shan, Ming-Derg Lai 1 Supplementary Table 1. Demographics and clinical outcomes of five patients with ampullary cancer Time of Tumor Time to Age Differentia survival/ Sex Staging size Morphology Recurrence recurrence Condition (years) tion expired (cm) (months) (months) T2N0, 51 F 211 Polypoid Unknown No -- Survived 193 stage Ib T2N0, 2.41.5 58 F Mixed Good Yes 14 Expired 17 stage Ib 0.6 T3N0, 4.53.5 68 M Polypoid Good No -- Survived 162 stage IIA 1.2 T3N0, 66 M 110.8 Ulcerative Good Yes 64 Expired 227 stage IIA T3N0, 60 M 21.81 Mixed Moderate Yes 5.6 Expired 16.7 stage IIA 2 Supplementary Table 2. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of an ampullary cancer microarray using the Database for Annotation, Visualization and Integrated Discovery (DAVID). This table contains only pathways with p values that ranged 0.0001~0.05. KEGG Pathway p value Genes Pentose and 1.50E-04 UGT1A6, CRYL1, UGT1A8, AKR1B1, UGT2B11, UGT2A3, glucuronate UGT2B10, UGT2B7, XYLB interconversions Drug metabolism 1.63E-04 CYP3A4, XDH, UGT1A6, CYP3A5, CES2, CYP3A7, UGT1A8, NAT2, UGT2B11, DPYD, UGT2A3, UGT2B10, UGT2B7 Maturity-onset 2.43E-04 HNF1A, HNF4A, SLC2A2, PKLR, NEUROD1, HNF4G, diabetes of the PDX1, NR5A2, NKX2-2 young Starch and sucrose 6.03E-04 GBA3, UGT1A6, G6PC, UGT1A8, ENPP3, MGAM, SI, metabolism
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2006/0110428A1 De Juan Et Al
    US 200601 10428A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0110428A1 de Juan et al. (43) Pub. Date: May 25, 2006 (54) METHODS AND DEVICES FOR THE Publication Classification TREATMENT OF OCULAR CONDITIONS (51) Int. Cl. (76) Inventors: Eugene de Juan, LaCanada, CA (US); A6F 2/00 (2006.01) Signe E. Varner, Los Angeles, CA (52) U.S. Cl. .............................................................. 424/427 (US); Laurie R. Lawin, New Brighton, MN (US) (57) ABSTRACT Correspondence Address: Featured is a method for instilling one or more bioactive SCOTT PRIBNOW agents into ocular tissue within an eye of a patient for the Kagan Binder, PLLC treatment of an ocular condition, the method comprising Suite 200 concurrently using at least two of the following bioactive 221 Main Street North agent delivery methods (A)-(C): Stillwater, MN 55082 (US) (A) implanting a Sustained release delivery device com (21) Appl. No.: 11/175,850 prising one or more bioactive agents in a posterior region of the eye so that it delivers the one or more (22) Filed: Jul. 5, 2005 bioactive agents into the vitreous humor of the eye; (B) instilling (e.g., injecting or implanting) one or more Related U.S. Application Data bioactive agents Subretinally; and (60) Provisional application No. 60/585,236, filed on Jul. (C) instilling (e.g., injecting or delivering by ocular ion 2, 2004. Provisional application No. 60/669,701, filed tophoresis) one or more bioactive agents into the Vit on Apr. 8, 2005. reous humor of the eye. Patent Application Publication May 25, 2006 Sheet 1 of 22 US 2006/0110428A1 R 2 2 C.6 Fig.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Review CCR5 Antagonists: Host-Targeted Antivirals for the Treatment of HIV Infection
    Antiviral Chemistry & Chemotherapy 16:339–354 Review CCR5 antagonists: host-targeted antivirals for the treatment of HIV infection Mike Westby* and Elna van der Ryst Pfizer Global R&D, Kent, UK *Corresponding author: Tel: +44 1304 649876; Fax: +44 1304 651819; E-mail: [email protected] The human chemokine receptors, CCR5 and suggest that these compounds have a long plasma CXCR4, are potential host targets for exogenous, half-life and/or prolonged CCR5 occupancy, which small-molecule antagonists for the inhibition of may explain the delay in viral rebound observed HIV-1 infection. HIV-1 strains can be categorised by following compound withdrawal in short-term co-receptor tropism – their ability to utilise CCR5 monotherapy studies. A switch from CCR5 to (CCR5-tropic), CXCR4 (CXCR4-tropic) or both (dual- CXCR4 tropism occurs spontaneously in approxi- tropic) as a co-receptor for entry into susceptible mately 50% of HIV-infected patients and has been cells. CCR5 may be the more suitable co-receptor associated with, but is not required for, disease target for small-molecule antagonists because a progression. The possibility of a co-receptor natural deletion in the CCR5 gene preventing its tropism switch occurring under selection pressure expression on the cell surface is not associated by CCR5 antagonists is discussed. The completion with any obvious phenotype, but can confer of ongoing Phase IIb/III studies of maraviroc, resistance to infection by CCR5-tropic strains – the aplaviroc and vicriviroc will provide further insight most frequently sexually-transmitted strains. into co-receptor tropism, HIV pathogenesis and The current leading CCR5 antagonists in clinical the suitability of CCR5 antagonists as a potent development include maraviroc (UK-427,857, new class of antivirals for the treatment of HIV Pfizer), aplaviroc (873140, GlaxoSmithKline) and infection.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • A Single-Cell Transcriptomic Landscape of Primate Arterial Aging
    ARTICLE https://doi.org/10.1038/s41467-020-15997-0 OPEN A single-cell transcriptomic landscape of primate arterial aging Weiqi Zhang 1,2,3,4,5,13, Shu Zhang6,7,13, Pengze Yan3,8,13, Jie Ren7,9,13, Moshi Song3,5,8, Jingyi Li2,3,8, Jinghui Lei4, Huize Pan2,3, Si Wang3,5,8, Xibo Ma3,10, Shuai Ma2,3,8, Hongyu Li2,3, Fei Sun2,3, Haifeng Wan3,5,11, ✉ ✉ ✉ Wei Li 3,5,11, Piu Chan4, Qi Zhou3,5,11, Guang-Hui Liu 2,3,4,5,8 , Fuchou Tang 6,7,9,12 & Jing Qu 3,5,11 Our understanding of how aging affects the cellular and molecular components of the vas- 1234567890():,; culature and contributes to cardiovascular diseases is still limited. Here we report a single-cell transcriptomic survey of aortas and coronary arteries in young and old cynomolgus monkeys. Our data define the molecular signatures of specialized arteries and identify eight markers discriminating aortic and coronary vasculatures. Gene network analyses characterize tran- scriptional landmarks that regulate vascular senility and position FOXO3A, a longevity- associated transcription factor, as a master regulator gene that is downregulated in six subtypes of monkey vascular cells during aging. Targeted inactivation of FOXO3A in human vascular endothelial cells recapitulates the major phenotypic defects observed in aged monkey arteries, verifying FOXO3A loss as a key driver for arterial endothelial aging. Our study provides a critical resource for understanding the principles underlying primate arterial aging and contributes important clues to future treatment of age-associated vascular disorders. 1 CAS Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China.
    [Show full text]
  • Distinctive Gene Expression Signatures in Rheumatoid Arthritis Synovial Tissue Fibroblast Cells: Correlates with Disease Activity
    Genes and Immunity (2007) 8, 480–491 & 2007 Nature Publishing Group All rights reserved 1466-4879/07 $30.00 www.nature.com/gene ORIGINAL ARTICLE Distinctive gene expression signatures in rheumatoid arthritis synovial tissue fibroblast cells: correlates with disease activity CL Galligan1,2, E Baig1,2, V Bykerk3,4, EC Keystone3,4 and EN Fish1,2 1Toronto General Research Institute, University Health Network, Toronto, Ontario, Canada; 2Department of Immunology, University of Toronto, Toronto, Ontario, Canada; 3The Rebecca MacDonald Centre for Arthritis and Autoimmune Diseases, Toronto, Ontario, Canada and 4Department of Medicine, University of Toronto, Toronto, Ontario, Canada Gene expression profiling of rheumatoid arthritis (RA) and osteoarthritis (OA) joint tissue samples provides a unique insight into the gene signatures involved in disease development and progression. Fibroblast-like synovial (FLS) cells were obtained from RA, OA and control trauma joint tissues (non-RA, non-OA) and RNA was analyzed by Affymetrix microarray. Thirty-four genes specific to RA and OA FLS cells were identified (Po0.05). HOXD10, HOXD11, HOXD13, CCL8 and LIM homeobox 2 were highly and exclusively expressed in RA and CLU, sarcoglycan-g, GPR64, POU3F3, peroxisome proliferative activated receptor-g and tripartite motif-containing 2 were expressed only in OA. The data also revealed expression heterogeneity for patients with the same disease. To address disease heterogeneity in RA FLS cells, we examined the effects of clinical disease parameters (Health Assessment Questionnaire (HAQ) score, C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), rheumatoid factor (RF)) and drug therapies (methotrexate/prednisone) on RA FLS cell gene expression. Eight specific and unique correlations were identified: human leukocyte antigen (HLA)-DQA2 with HAQ score; Clec12A with RF; MAB21L2, SIAT7E, HAPLN1 and BAIAP2L1 with CRP level; RGMB and OSAP with ESR.
    [Show full text]
  • Cell-Type–Specific Eqtl of Primary Melanocytes Facilitates Identification of Melanoma Susceptibility Genes
    Downloaded from genome.cshlp.org on November 19, 2018 - Published by Cold Spring Harbor Laboratory Press Research Cell-type–specific eQTL of primary melanocytes facilitates identification of melanoma susceptibility genes Tongwu Zhang,1,7 Jiyeon Choi,1,7 Michael A. Kovacs,1 Jianxin Shi,2 Mai Xu,1 NISC Comparative Sequencing Program,9 Melanoma Meta-Analysis Consortium,10 Alisa M. Goldstein,3 Adam J. Trower,4 D. Timothy Bishop,4 Mark M. Iles,4 David L. Duffy,5 Stuart MacGregor,5 Laufey T. Amundadottir,1 Matthew H. Law,5 Stacie K. Loftus,6 William J. Pavan,6,8 and Kevin M. Brown1,8 1Laboratory of Translational Genomics, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 2Biostatistics Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 3Clinical Genetics Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 4Section of Epidemiology and Biostatistics, Leeds Institute of Cancer and Pathology, University of Leeds, Leeds, LS9 7TF, United Kingdom; 5Statistical Genetics, QIMR Berghofer Medical Research Institute, Brisbane, Queensland, 4006, Australia; 6Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA Most expression quantitative trait locus (eQTL) studies to date have been performed in heterogeneous tissues as opposed to specific cell types. To better understand the cell-type–specific regulatory landscape of human melanocytes, which give rise to melanoma but account for <5% of typical human skin biopsies, we performed an eQTL analysis in primary melanocyte cul- tures from 106 newborn males.
    [Show full text]