Advance View Proofs

M&E Papers in Press. Published online on July 13, 2010 doi:10.1264/jsme2.ME10108

1 Revised ME10108

3 Molecular Characterization of Fungal Communities in Non-Tilled, Cover-Cropped

4 Upland Rice Field Soils

1†‡* 1† 1, 2 6 TOMOYASU NISHIZAWA , ZHAORIGETU , MASAKAZU KOMATSUZAKI , YOSHINORI

2 3 1, 2 7 SATO , NOBUHIRO KANEKO , and HIROYUKI OHTA

9 1Ibaraki University College of Agriculture, 3-21-1 Chuou, Ami-machi, Ibaraki 300-0393, Japan;

10 2Institute for Global Change Adaptation Science, Ibaraki University, 2-1-1 Bunkyo, Mito,

11 Ibaraki 310-8512, Japan; and 3Graduate School of Environment and Information Science,

12 Yokohama National University, 79-7 Tokiwadai, Hdogaya-ku, Yokohama,Proofs Kanagawa 240-8501,

13 Japan 14 View 15 (Received February 4, 2010 – Accepted June 16, 2010)

17 * Corresponding author. E-mail: [email protected]; Tel: +81–29–888–8684; Fax: 18 +81–29–888–8525.Advance 19 † T.N. and Z. contributed equally to this study.

20 ‡ Present address: Department of Applied Biological Chemistry, Graduate School of Agricultural

21 and Life Sciences, The University of Tokyo, 1–1–1, Yayoi, Bunkyo-ku, Tokyo 113–8657, Japan

23 Running headline: Soil Fungal Community in Upland Rice Field

27 This study aimed to characterize soil fungal communities in upland rice fields

28 managed with tillage/non-tillage and winter cover-cropping (hairy vetch and cereal rye)

29 practices, using PCR-based molecular methods. The study plots were maintained as

30 upland fields for 5 years and the soils sampled in the second and fifth years were

31 analyzed using T-RFLP (terminal restriction fragment length polymorphism) profiling

32 and clone libraries with the internal transcribed spacer (ITS) region and domain 1 (D1)

33 of the fungal large-subunit (fLSU) rRNA (D1fLSU) as the target DNA sequence. From

34 the 2nd-year-sample, 372 cloned sequences of fungal ITS-D1fLSU were obtained and

35 clustered into 80 nonredundant fungal OTUs (operational taxonomic units) in 4 fungal 36 phyla. The T-RFLP profiling was performed with the 2nd- andProofs 5th-year-samples and the 37 major T-RFs (terminal restriction fragments) were identified using a theoretical

38 fragment analysis of the ITS-D1fLSU clones. These molecular analyses showed that the

39 fungal community was influenced more stronglyView by the cover-cropping than tillage

40 practices. Moreover, the non-tilled, cover-cropped soil was characterized by a

41 predominance of Cryptococcus sp. in the phylum Basidiomycota. We provided a genetic

42 database of the fungal ITS-D1fLSUs in the differently managed soils of upland rice fields.

43 Advance

44 Key words: clone library, Cryptococcus, soil fungal community, T-RFLP, ribosomal

45 RNA gene

49 Agricultural management practices of non-tillage and cover-cropping have a great

50 influence on soil carbon and nitrogen dynamics through soil microbial activity (15, 40).

51 In most well-aerated, upland fields, fungi account for the majority of the total microbial

52 population (3). In addition to the saprophytic property, evidence of fungal nitrous

53 oxide-producing denitrification has been revealed in grassland soil using a combination

54 of the substrate-induced respiration inhibition method and labeling with a stable isotope

55 of nitrogen (18). Chemical inhibitors of fungi and bacteria decreased the flux of nitrous

56 oxide by 89% and 23%, respectively, suggesting that the fungal community was

57 involved in the nitrous oxide production. Prior to this finding, experiments in vivo had 58 shown that nitrous oxide was the main end product of fungal denitrificationProofs (30, 36). 59 Recently, Zhaorigetu et al. (40) reported a positive relationship between fungal biomass

60 and nitrous oxide emissions in an upland rice field. It was also shown that the fungal

61 biomass in the surface soil (0-10 cm) incrVieweased with the adoption of conservation

62 management systems such as non-tilled fallow and cover-cropping (hairy vetch and rye)

63 practices. However, the soil fungal community associated with the production of nitrous

64 oxide still remains indistinct in upland rice field soil.

65 To assessAdvance microbial diversify, small-s ubunit (SSU) and/or large-subunit (LSU) rRNA

66 genes are often used as markers (1). Sequencing of either LSU-rRNA or internal

67 transcribed spacer (ITS) regions has been used for the identification of fungal species

68 (12, 28, 29, 32). Molecular methods such as fungal rRNA gene and ITS region-based

69 clone library and phylogenetic analyses were utilized for identifying the dominant fungi

70 and elucidating the diversity of fungal communities in environmental samples (2, 24, 25,

71 27, 37). Terminal-restriction fragment length polymorphism (T-RFLP) profiling (19, 21)

73 powerful tool for monitoring the diversity in microbial communities (5, 7, 10, 11, 14, 23,

74 27, 31).

75 The objective of this study was to characterize the fungal community of nitrogen

76 oxide-production-enhanced upland soils maintained with cover-cropped and non-tillage

77 practices in comparison with those of conventional tillage soils. PCR-based T-RFLP

78 profiling and a clone library based on the fungal ITS–LSU-rRNA region in upland rice

79 fields were used.

81 Materials and Methods 82 Field management and soil sampling Proofs 83 The study plots were located at the Field Science Center of Ibaraki University

84 College of Agriculture, Ibaraki, Japan. The soil at the sites was a humic allophane soil

85 (Haludands, Haplic Andosols). The experimeViewnt was conducted over a period of 5 years,

86 from October 2003 until October 2007. Hairy vetch (Vicia villosa Roth.) and cereal rye

87 (Secale cereale L.) were planted every October from 2003 to 2007. Seeds of field rice

88 (Oryza sativa L.) were planted with a drill in April of each year. A detailed explanation

89 of the Advanceexperimental plots has been given previously (23, 40). In the present study, four

90 soils were used: plow-tilled fallow (PF), non-tilled fallow (NF), non-tilled hairy

91 vetch-cover cropped (NH), and non-tilled rye-cover cropped (NR) soil. Soil samples

92 were taken on May 14, 2004 and May 15, 2007. Five sub-samples (10 g fresh weight

93 per sub-sample) per depth of between 0 and 10 cm were collected from three plots using

94 sterile implements and then thoroughly mixed. The 50 g of soil was kept at -20˚C in

95 darkness before the genetic analysis.

97 DNA extraction and manipulation

98 Total DNA from soil samples (0.5–1.0 g wet weight) was isolated using an Isoil for

99 Beads Beating kit (Nippon Gene, Tokyo, Japan) with skim milk powder (Wako, Osaka,

100 Japan) as described previously (23). Escherichia coli DH5α (Takara Bio, Otsu, Japan)

101 was used as a host for recombinant plasmids and grown at 37˚C in Luria-Bertani’s (LB)

102 broth or LB agar. As an antibiotic, ampicillin sodium salt was added at a final

103 concentration of 75 µg mL-1 when necessary. The pGEM-T-Easy vector system

104 (Promega, Madison, WI, USA) was used for cloning according to instructions.

105 106 PCR amplification of the internal transcribed spacer (ITS) sequenceProofs and domain 1 (D1) 107 of the large-subunit (LSU) rRNA gene

108 The fungal ITS-D1fLSU rRNA region in soil DNA (0.1 µg) was amplified using ITS1

109 (5’- TCCGTAGGTGAACCTGCGG -3’)View and LR21 (5’- ACTTCAAGCGTTTCCCTTT

110 -3’, position 424-393 in Saccharomyces cerevisiae large subunit rRNA). The reactions

111 were performed in a Takara PCR thermal cycler Personal (Takara Bio) with Ex Taq 112 (TakaraAdvance Bio) under the following conditions: 2 min at 95˚C, followed by 30 cycles of 113 95˚C (30 s), 54˚C (45 s), and 72˚C (1.5 min), with a final cycle of 72˚C for 3 min.

114 For the construction of the clone library, the ITS-D1fLSU rRNA gene region amplified

115 using DNA of PF, NF, NH, and NR soils sampled in 2004 was cloned and the PCR

116 DNA fragments were ligated into the pGEM-T-easy vector.

117

118 Sequencing of the ITS region and computer analysis of DNA sequences

119 Nucleotide sequences were determined with a BigDye Terminator Cycle Sequencing

121 instructions supplied and with a PE Applied Biosystems Automated DNA Sequencer

122 (model 3130xl, Applied Biosystems). The double-stranded DNA sequences were

123 assembled and analyzed using Genetyx (version 11.0) and Genetyx-ATSQ (version 4.0)

124 software (Genetyx, Tokyo, Japan), respectively, and compared with similar DNA

125 sequences retrieved from the DDBJ/EMBL/GenBank databases using the

126 NCBI-BLAST and DDBJ-BLAST programs. The phylogenetic analysis was carried out

127 using the multiple-sequence alignment tool from Clustal W (35).

128

129 Terminal-restriction fragment length polymorphism (T-RFLP)-based profiling 130 The ITS regions were amplified by PCR from the total genomicProofs soil DNA with the 131 primers QLR21 (5’- CACTTCAAGCGTTTCCCTTT -3’), labeled with quenching

132 fluorescence, and ITS1. The 5’-end fluorescence-labeled primer (16) was purchased

133 from J–Bio21 (Tsukuba, Japan). The PCRView mixture (30 µL) was prepared by combining

134 0.1 µg of template soil DNA, 1.0 µL of 10 pmol µL-1 primers, Takara Ex Taq, dNTPs,

135 and 3 µL of optimized 10×Ex buffer (Takara Bio Inc.) in a PCR cycler. The PCR of ITS 136 for T-RFLPAdvance profiling was carried out under the following conditions: 2 min at 95˚C, 137 followed by 30 cycles of 95˚C (30 s), 54˚C (45 s), and 72˚C (1.5 min).

138 T-RFLP was carried out as described previously (23). Aliquots (5 µL) of the

139 amplified ITS-D1fLSU fragment were separately digested with AluI, HaeIII, MboI, MspI,

140 and Sau3AI (Takara Bio) according to the manufacturer’s instructions. The precise

141 lengths of T-RFs (terminal restriction fragments) from the amplified ITS-D1fLSU

142 fragments were determined on a 3130xl PE DNA Sequencer (Applied Biosystems). The

143 purified T-RF DNA (2 µL) was mixed with 15 µL of Hi-Di formamide and 0.1 µL of

145 then denatured at 96˚C for 2 min and immediately chilled on ice prior to electrophoresis

146 with the automated DNA sequencer in the GeneScan mode. The lengths of fluorescently

147 labeled T-RFs were determined by comparison with internal standards using

148 GeneMapper software (version 3.7; Applied Biosystems). T-RFLP profiling of the

149 fungal community structure in soil samples was obtained with peaks ranging from 50

150 bases to 650 bases. The definition of T-RFs was peaks with a fluorescence threshold of

151 more than 30.

152

153 Analysis of the diversity of data sets 154 Diversity was analyzed using different definitions of operationalProofs taxonomic units 155 (OTUs). The conventional affiliation of a fungal species (OTU) was based o the

156 ITS-D1fLSU rRNA sequence within the GenBank database. Due to the computational

157 challenges associated with estimating diversViewity indices in a previous study (23), the

158 observed richness and diversity were calculated with the Chao1 (6) and

159 Shannon-Wiener indices utilizing the web-based bioinformatics platform, FastGroupII

160 (39) as a group with 97% identity in ITS-D1fLSU rRNA region sequence, respectively.

161 StatisticalAdvance calculations were made with Microsoft Excel using the two-sided, unpaired

162 Student's t-test. The similarity of data sets (relative abundance of the peak height and

163 fragment length) of T-RFs profiles was examined using nonmetric multidimensional

164 scaling (NMDS) based on the free software package ‘R’ (version 2.8.0) (26).

165

166

168 All cloned sequences were deposited in the DNA Database of Japan (DDBJ) under

169 accession numbers AB520238 to AB520609.

170

171 Results

172 Cloning of the ITS and D1 domain of the large subunit rRNA gene

173 To investigate the fungal community structure, the primer pair ITS1/LR21 was used

174 to amplify a long DNA fragment (850-950 bp) comprising the whole ITS region and

175 approximately 300 bp of the fungus LSU rRNA gene containing the domain 1 (D1)

176 region (D1fLSU) (Fig. 1). Simultaneous amplification of both the conserved and variable 177 regions makes it possible to infer the phylogenetic position ofProofs the fungus at a higher 178 taxonomic level. Tedersoo et al. (33) described that additional sequencing of the LSU

179 rRNA genes could improve the determination of some unknown species, at least at the

180 family or order level. View

181 We observed an unexpected irregular peak in the T-RFLP profile when total DNA of

182 the fungal wild-type strain was used for amplification with the fluorescence

183 labeled-ITS1F/ITS4 (9, 38) (data not shown). We therefore decided to utilize the

184 ITS1/LR21Advance as a stable primer set to avoid irregular peaks as a result of amplification

185 with the ITS4 primer (Fig. 1).

186 The fungal diversity in samples from four differently managed soils was evaluated by

187 including the ITS and D1fLSU (ITS- D1fLSU) libraries for each soil type. PCR

188 amplifications were successfully performed for samples of four differently managed

189 soils. A total of 372 clones (PF, 86 clones; NF, 98; NH, 93; NR, 95) were sequenced. To

190 identify the closest match of cloned sequences, an NCBI-BLAST search was carried out

192 analysis revealed that most sequences could be assigned to 4 phyla or

193 unclassified/uncultured fungal clones of soil samples that were unevenly distributed

194 throughout the PF, NF, NH, and NR plots. According to this result, the ITS-D1fLSU

195 rRNA region was suitable for characterization of the assemblage of soil fungi. From the

196 appearance rates of clones, it was suggested that the diversity of fungi in the soil was

197 dependent on the soil management practices (Table 1). In PF soil, 54.7% of the cloned

198 sequences were identified in unculturable fungal clones. Ascomycota accounted for

199 26.7% of the total PF clone library. In NF soil, unculturable fungal clones and

200 Basidiomycota cloned sequences accounted for 45.9% and 33.7% of the total, 201 respectively. On the other hand, the NH and NR soil samples Proofstaken from plots with 202 cover-cropping management consisted primarily of Basidiomycota (NH, 49.4%; NR,

203 68.4%). Moreover, in NH soil, Ascomycota accounted for 34.4% of the clones. The

204 uncultured clones (IU-FSC Fun71 and Fun66)View were found in the four libraries. The ratio

205 of Basidiomycota was increased by the non-tilled fallow management. In particular,

206 sequences of the non-mycorrhizal fungal species, the Cryptococcus sp. (OTUs: IU-FSC

207 Fun22 to Fun28) of the phylum Basidiomycota, were predominant in the clone libraries

208 of the AdvanceNF, NH, and NR soils (Table S1). It was also confirmed that Basidiomycota was

209 predominant in non-tilled, cover-cropped soils and uncultured fungal clones dominated

210 in the fallow-treated soil.

211

212 Diversity of identified sequences

213 In order to analyze the fungal diversity associated with the different soil management

214 practices, the proportion of eukaryotic microbial diversity represented by the clone

216 diversity of the ITS-D1fLSU sequences was analyzed using the FastGroupII

217 bioinformatics tool (Fig. 2). Although the rarefaction curves from all soils failed to

218 plateau, the rarefaction analyses showed that the NF soil had greater fungal richness

219 than the other soils (Fig. 2). In contrast to the results above for the soils subjected to

220 different management practices, the comparative rarefaction results were corroborated

221 by nonparametric-based estimates of total richness and diversity. The Chao1 total

222 richness estimate for the PF soil was 63 ribotypes (OTUs). The Chao1 estimate for the

223 NF soil showed the highest diversity with 87 OTUs, whereas the NH and NR soil

224 samples had total richness values of 65 and 81 OTUs, respectively. The coverage of the 225 number of OTUs analyzed relative to the expected maximum Proofsnumber of ribotypes for 226 ITS-D1fLSU ranged from 38% to 57%. Additionally, the Shannon-Wiener index, a

227 measurement of biodiversity used to estimate the number of species and their

228 homogeneity across a given plot values, wereView very similar for the four differently

229 managed soils (PF, 2.9; NH, 2.6; NR, 2.7), with the exception of 3.6 with the NF library.

230 These molecular analyses clarified that non-tilled fallow soil had remarkable fungal

231 diversity.

232 Advance

233 Identification of the predominant T-RFs combined with in silico T-RFs

234 To investigate the fungal community in the soils managed with non-tillage and

235 cover-cropping practices in the upland field, fungal ITS-D1fLSU PCR-based T-RFLP

236 analyses were carried out (Fig. S1). It seemed that the fungal T-RFLP profiles had their

237 own characteristic pattern of restriction enzyme-digested ITS-D1fLSUs. The size of the

238 experimental T-RFs (T-RFexps) on T-RFLP profiling was determined by the in silico

240 the dominant T-RFexps, we used the database of T-RFseqs shown in Table S1, which was

241 determined by an analysis of the clone libraries. This database included OTUs chosen

242 from more than 5 cloned sequences from the PF, NF, NH, and NR soils (Table S1).

243 In our previous study, a terminal restriction fragment length method utilizing a

244 quenching fluorescence primer was developed and its accuracy was confirmed (23). The

245 112-base and 143-base AluI T-RFexps were contained in T-RF profiles of four differently

246 managed soils (data not shown). This result was consistent with the results for in silico

247 AluI T-RFseq (Table S1), indicating that AluI is not suitable for comparing soil fungal

248 communities. Four HaeIII T-RFexps [102-, 258-, 298-, and 445-base] were mainly 249 observed in the four soils sampled in 2004 (Fig. S1A). The dominantProofs HaeIII 102-base 250 T-RF exp was shown to correspond precisely to the IU-FSC of the phylum Ascomycota 251 and IU-FSC Fun63 and Fun70 of unculturedView fungus (Table S1). The HaeIII 258-base 252 and 298-base T-RFexps were consistent with the HaeIII 259-base and 299-base T-RFseqs

253 of IU-FSC Fun29 and Fun39, respectively. The HaeIII 445-base T-RFexp corresponded

254 to the HaeIII 447-base T-RFseq of IU-FSC Fun66b. In the MboI/Sau3AI-digested

255 T-RFLP profiles, the MboI/Sau3AI 68/69-base and 425/426-base T-RFexps were

256 identifiedAdvance in the 04PF (PF soil sampled in 2004), 04NF, and 04NH soils, respectively

257 (Fig. S1B). According to the clone library analysis, the dominant MboI/Sau3AI

258 68/69-base T-RFexp corresponded to the 72-base T-RFseq of IU-FSC Fun04, Fun07,

259 Fun09, and Fun13 among the phylum Ascomycota and IU-FSC Fun63 and Fun70 of

260 uncultured fungal clones. The dominant MboI/Sau3AI 425/426-base T-RFexp was shown

261 to correspond to the T-RFseq of IU-FSC Fun59, Fun66ab, and Fun71. The dominant

262 MspI 103-base T-RFexps were identified as the 104-base T-RFseq of IU-FSC Fun07 and

264 199-base T-RFseq of IU-FSC Fun70. In the case of 04NH soil, two T-RFexps [190- and

265 505/507-base] were observed and similar to the T-RFseq of IU-FSC Fun24, Fun25a,

266 Fun28b, and Fun38a and IU-FSC Fun04 and Fun09ab, respectively (Fig. S1C and Table

267 S1). According to these results, the in silico analysis of clone libraries enabled us to

268 determine the major T-RFs in the fungal T-RFLP profiling.

269

270 Comparisons of T-RFLP profiling

271 The soil fungal community structure was assessed in the soils treated with different

272 management practices between 2004 and 2007 based on the identification of major 273 T-RF exps using the 2004 data from T-RFLP profiling. The HaeProofsIII, MboI/Sau3AI and 274 MspI-digested T-RFLP profiles showed the change in diversity of the fungal community

275 among the different soil conditions from 2004 to 2007 as judged with the two-sided,

276 unpaired Student's t-test (P≤0.05) (Table View2). Continuous non-tillage fallow rye

277 cover-cropping decreased the number of T-RFexps in the soil fungal community

278 compared to non-tillage fallow hairy vetch cover-cropping.

279 In the HaeIII T-RFLP profiling, the fungal community apparently differed in T-RFs of

280 aroundAdvance 400- and 600-bases between 04NH and 07NH (NH soil sampled in 2007) (Fig.

281 S1A). In the detailed comparison of MboI/Sau3AI T-RFLP profiles, two MboI/Sau3AI

282 T-RF exps [356/357- and 425-base] mainly appeared in the T-RFLP profiles of the 07PF,

283 07NF, 07NH, and 07NR soils. Likewise, the dominant MboI/Sau3AI 428/430-base

284 T-RF exp appeared in the 04NR soil. The major T-RFexp cluster consisted of around 420

285 bases in the 2004 soil. However, another T-RFexp cluster of around 350 bases occurred

286 in the 2007 soil. A change in the fungal community structure was very likely from the

288 the MspI T-RFLP profiling, around 190- and 510-base MspI T-RFexps were clustered in

289 the 04NH and 04 NR soils. In particular, a convergence of 190-base T-RFexps occurred

290 in the 04NH and 04NR soils (Fig. S1C and Table 2). The occurrence of 190-base

291 MspI-T-RFexp remained until 2007.

292

293 Discussion

294 In the present study, the fungal T-RFLP profiles showed a characteristic pattern of

295 restriction enzyme-digested ITS-D1fLSUs and the ITS-D1fLSU rRNA-based clone library

296 analysis elucidated the predominant T-RFs in T-RFLP profiling. Additionally, a 297 comparative analysis using the data of T-RF profiles in samplesProofs of 2004 and 2007 298 revealed that continuous soil management practices resulted in a change in diversity of

299 the fungal community (Fig. S1 and Table 2). To estimate the similarity in fungal

300 communities among the differently managedView soils, NMDS was performed based on the

301 results of T-RFLP profiling and clone libraries. First of all, a HaeIII-, MboI/Sau3AI-, or

302 MspI-T-RFLP profiling based-NMDS was carried out (data not shown). NMDS of the

303 MboI/Sau3AI-T-RFLP profiling showed that the four fungal communities were highly

304 similar,Advance indicating that it was quite difficult to understand the similarity or dissimilarity

305 of fungal community. Therefore, NMDS analysis of the combined HaeIII- and

-3 306 MspI-T-RFexp profiles was performed (stress value, 8.0×10 ) (Fig. 3A). NMDS

307 combined with T-RFexps profiles showed that the effect of tillage and non-tillage

308 management practices was minor because of the close distance among the profiles of PF

309 and NF from 2004 to 2007. Regarding the NR soil, a significant effect of rye

310 cover-cropping practice on the soil fungal community structure was clearly confirmed

312 wheat straw residue in soil had almost no influence on fungal community structure

313 according to a statistical analysis of fungal ITS-based DNA fingerprints (4). Likewise,

314 as for the clone library, T-RFseq data (fragment lengths and ratio of clone number) after

315 digestion by HaeIII and MspI in silico were used for NMDS. A similar fungal

316 community structure between hairy vetch- and rye-cover cropped soils appeared in the

317 NMDS analysis (stress value, 1.1×10-14; Fig. 3B). Our results indicated the cover crop

318 residue, especially rye straw residue, on non-tilled fallow soil might strongly influence

319 the fungal community at the surface of soil.

320 A total of 152 cloned sequences of the phylum Basidiomycota were found in the four 321 clone libraries of soil sampled in 2004. Some 95 clones were Proofsrelated to the genus 322 Cryptococcus, indicating that OTUs belonging to the phylum Basidiomycota,

323 Cryptococcus predominated in the non-tilled soils. A detailed search of IU-FSC

324 Fun22-Fun29 was carried out using the GenBaViewnk database. Eight OTUs were divided

325 into three clades: 1) IU-FSC Fun24, Fun26, Fun27, and Fun28 were Basidiomycota,

326 Agaricomycotina, Tremellomycetes, Tremellales, mitosporic Tremellales, Cryptococcus; 327 2) IU-FSCAdvance Fun23 and Fun29 were Basidiomycota, Agaricomycotina, Tremellomycetes, 328 Cystofilobasidiales, mitosporic Cystofilobasidiales, Cryptococcus; 3) IU-FSC Fun22

329 and Fun25 were Basidiomycota, Agaricomycotina, Tremellomycetes, Filobasidiales,

330 mitosporic Filobasidiales, Cryptococcus; respectively. In particular, IU-FSC Fun28 (41

331 clones), with a similar sequence to Cryptococcus victoriae (34), was dominant in the

332 non-tilled fallow and non-tilled cover-cropping soil. Based on the T-RFLP profiling of

333 NR soils sampled in 2004 and 2007, the characteristic pattern of HaeIII-MboI-MspI

334 [(428/430)-(429/430)-(190/191)] T-RFexps corresponding to IU-FSC Fun28b (40 clones)

336 cover-cropping of rye enhanced this trend. The clade Tremellales is well-known to be

337 made up of human pathogenic strains such as C. neoformans, C. albidus, and C.

338 laurentii (8, 32). Therefore, a phylogenetic tree was constructed among Tremellales, and

339 Cryptococcus containing the OTUs IU-FSC Fun24, 26, 27, and 28 (Fig. 4).

340 Phylogenetic analysis based on the neighbor-joining method using CLUSTAL W

341 showed that three of the four OTUs (i.e., all except for IU-FSC Fun24) were integrated

342 into one group. Obviously, these clones were distinguished from the human pathogenic

343 Cryptococcus strains (Fig. 4). The clones of the putative Cryptococcus sp. strains

344 (IU-FSC Fun24, 26, 27, and 28) were almost identical with those of Cryptococcus sp. 345 from soils (13, 17, 20, 22, 27). This suggests that clones of soilProofs Cryptococcus sp. are 346 widespread throughout the world. However, the role of Cryptococcus in soil has not

347 been clarified yet. With respect to nitrous oxide-producing activity in Cryptococcus

348 strains of Basidiomycota, Cryptococcus gastricusView JCM 3691 in the clade Filobasidiales

349 did not produce nitrous oxide or nitric oxide in pure cultures (36). The isolation of

350 Cryptococcus strains from the NR soil is now in progress in our laboratory.

351 In conclusion, our results showed the diversity of soil-surface fungal communities in

352 uplandAdvance rice field by a combination of T-RFLP profiling and clone library analysis based

353 on fungal ITS-D1fLSU sequences and revealed that soil management techniques such as

354 non-tilling and cover-cropping were involved in determining the diversity and dynamics

355 of the soil-surface fungal community. Furthermore, we provided a genetic database of

356 the fungal ITS-D1fLSUs in the different agricultural soils of the upland rice field.

357

358

360 This work was supported by a grant from the Global Environment Research Fund of the

361 Ministry of the Environment, Japan (F-073) and in part by MEXT through Special

362 Coordination Funds for Promoting Science and Technology as a part of the “Sustainable

363 Agriculture Practices to Mitigate and Adapt to Global Warming” project undertaken by

364 the Institute for Global Change Adaptation Science, Ibaraki University.

365

366 References

367 1. Amann, R., and W., Ludwig. 2000. Ribosomal RNA-targeted nucleic acid probes

368 for studies in microbial ecology. FEMS Microbiol. Rev. 24:555–565. 369 2. Anderson. I.C., B.A. Bastias, D.R. Genney, P.I. Parkin, andProofs J.W.G. Cairney. 2007. 370 Basidiomycete fungal communities in Australian sclerophyll forest soil are altered

371 by repeated prescribed burning. Mycol. Res. 111:482–486.

372 3. Anderson, J.P.E., and K.H. Domsch. View1975. Measurement of bacterial and fungal

373 contributions to respiration of selected agricultural and forest soils. Can. J.

374 Microbiol. 21:314–322.

375 4. Bastian, F., L. Bouziri, B. Nicolardot, and L. Ranjard. 2009. Impact of wheat straw

376 decompositionAdvance on successional patterns of soil microbial community structure. Soil

377 Biol. Biochem. 41:262–275.

378 5. Brodie, E., S. Edwards, and N. Clipson. 2003. Soil fungal community structure in a

379 temperate upland grassland soil. FEMS Microbiol. Ecol. 45:105–114.

380 6. Chao, A. 1984. Non-parametric estimation of the number of classes in a population.

381 Scand. J. Statist. 11:783–791.

382 7. Euringer, K., and T. Lueders. 2008. An optimised PCR/T-RFLP fingerprinting

384 environments. J. Microbiol. Methods 75:262–268.

385 8. Fonseca, A., G. Scorzetti, and J.W. Fell. 2000. Diversity in the yeast Cryptococcus

386 albidus and related species as revealed by ribosomal DNA sequence analysis. Can.

387 J. Microbiol. 46:7–27.

388 9. Gardes, M., and T.D. Bruns. 1993. ITS primers with enhanced specificity for

389 basidiomycetes-application to the identification of mycorrhizae and rusts. Mol.

390 Ecol. 2:113–118.

391 10. Hartmann, M., and F. Widmer. 2006. Community structure analyses are more

392 sensitive to differences in soil bacterial communities than anonymous diversity 393 indices. Appl. Environ. Microbiol. 72:7804–7812. Proofs 394 11. Hartmann, M., and F. Widmer. 2008. Reliability for detecting composition and

395 changes of microbial communities by T-RFLP genetic profiling. FEMS Microbiol.

396 Ecol. 63:249–260. View

397 12. Horton, T.R., and T.D. Bruns. 2001. The molecular revolution in ectomycorrhizal

398 ecology: peeking into the black-box. Mol. Ecol. 10:1855–1871.

399 13. Hoshino, Y.T., and N. Matsumoto. 2007. Changes in fungal community structure in

400 bulkAdvance soil and spinach rhizosphere soil after chemical fumigation as revealed by 18S

401 rDNA PCR-DGGE. Soil Sci. Plant Nutr. 53:40–55.

402 14. Kasel, S., L.T. Bennett, and J. Tibbits. 2008. Land use influences soil fungal

403 community composition across central Victoria, south-eastern Australia. Soil Biol.

404 Biochem. 40:1724–1732.

405 15. Komatsuzaki, M., and H. Ohta. 2007. Soil management practices for sustainable

406 agro-ecosystems. Sustain. Sci. 2:103–120.

408 R. Kurane. 2001. Fluorescent quenching-based quantitative detection of specific

409 DNA/RNA using a BODIPY® FL-labeled probe or primer. Nucleic Acids Res.

410 29:e34.

411 17. Landeweert, R., P. Leeflang, T.W. Kuyper, E. Hoffland, A. Rosling, K. Wernars, and

412 E. Smit. 2003. Molecular identification of ectomycorrhizal mycelium in soil

413 horizons. Appl. Environ. Microbiol. 69:327–333.

414 18. Laughlin, R.J., and R.J. Stevens. 2002. Evidence for fungal dominance of

415 denitrification and codenitrification in a grassland soil. Soil Sci. Soc. Am. J.

416 66:1540–1548. 417 19. Liu, W.-T., T.L. Marsh, H. Cheng, and L.J. Forney. 1997. ProofsCharacterization of 418 microbial diversity by determining terminal restriction fragment length

419 polymorphism of genes encoding 16S rRNA. Appl. Environ. Microbiol.

420 63:4516–4522. View

421 20. Lynch, M.D.J., and R.G. Thorn. 2006. Diversity of basidiomycetes in Michigan

422 agricultural soils. Appl. Environ. Microbiol. 72:7050–7056.

423 21. Marsh, T.L. 1999. Terminal restriction fragment length polymorphism (T-RFLP):

424 AnAdvance emerging method for characterizing diversity among homologous populations

425 of amplification products. Cur. Opin. Microbiol. 2:323–327.

426 22. Midgley, D.J., J.A. Saleeba, M.I. Stewart, A.E. Simpson, and P.A. McGee. 2007.

427 Molecular diversity of soil basidiomycete communities in northern-central New

428 South Wales, Australia. Mycol. Res. 111:370–378.

429 23. Nishizawa, T., M. Komatsuzaki, N. Kaneko, and H. Ohta. 2008. Archaeal diversity

430 of upland rice field soils assessed by the terminal restriction fragment length

432 library analysis. Microbes Environ. 23:237–243.

433 24. O’Brien, H.E., J.L. Parrent, J.A. Jackson, J.-M. Moncalvo, and R.Vilgalys. 2005.

434 Fungal community analysis by large-scale sequencing of environmental samples.

435 Appl. Environ. Microbiol. 71:5544–5550.

436 25. Porter, T.M., C.W. Schadt, L. Rizvi, A.P. Martin, S.K. Schmidt, L. Scott-Denton, R.

437 Vilgalys, and J.M. Moncalvo. 2008. Widespread occurrence and phylogenetic

438 placement of a soil clone group adds a prominent new branch to the fungal tree of

439 life. Mol. Phylogenet. Evol. 46:635–644.

440 26. R Development Core Team. 2008. R: A language and environment for statistical 441 computing. R Foundation for Statistical Computing, Vienna,Proofs Austria. ISBN 442 3-900051-07-0, URL http://www.R-project.org.

443 27. Robinson, C.H., T.M. Szaro, A.D. Izzo, I.C. Anderson, P.I. Parkin, and T.D. Bruns.

444 2009. Spatial distribution of fungal communitieViews in a coastal grassland soil. Soil

445 Biol. Biochem. 41:414–416.

446 28. Schadt, C.W., A.P. Martin, D.A. Lipson, and S.K. Schmidt. 2003. Seasonal

447 dynamics of previously unknown fungal lineages in tundra soils. Science

448 301:1359–1361.Advance

449 29. Scorzetti, G., J.W. Fell, A. Fonseca, and A. Statzell-Tallman. 2003. Systematics of

450 basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal

451 transcribed spacer rDNA regions. FEMS Yeast Res. 2:495–517.

452 30. Shoun, H., D.-H. Kim, H. Uchiyama, and J. Sugiyama. 1992. Denitrification by

453 fungi. FEMS Microbiol. Lett. 94:277–282.

454 31. Singh, B.K., L. Nazaries, S. Munro, I.C. Anderson, and C.D. Campbell. 2006. Use

456 simultaneous analysis of different components of the soil microbial community.

457 Appl. Environ. Microbiol. 72:7278–7285.

458 32. Sugita, T., and A. Nishikawa. 2004. Molecular taxonomy and identification of

459 pathogenic fungi based on DNA sequence analysis. Jpn. J. Med. Mycol. 45:55–58

460 (in Japanese).

461 33. Tedersoo, L., U. Kõljalg, N. Hallenberg, and K.-H. Larsson. 2003. Fine scale

462 distribution of ectomycorrhizal fungi and roots across substrate layers including

463 coarse woody debris in a mixed forest. New Phytol. 159:153–165.

464 34. Thomas-Hall, S., K. Watson, and G. Scorzetti. 2002. Cryptococcus statzelliae sp. 465 nov. and three novel strains of Cryptococcus victoriae, yeastsProofs isolated form 466 Antarctic soils. Int. J. Syst. Evol. Microbiol. 52:2303–2308.

467 35. Thompson, J.D., D.G. Higgins, and T.J. Gibson. 1994. CLUSTAL W: Improving the

468 sensitivity of progressive multiple sequeViewnce alignment through sequence weighting,

469 position specific gap penalties and weight matrix choice. Nucleic Acids Res.

470 22:4673–4680.

471 36. Tsuruta, S., N. Takaya, L. Zhang, H. Shoun, K. Kimura, M. Hamamoto, and T.

472 Nakase.Advance 1998. Denitrification by yeasts and occurrence of cytochrome P450nor in

473 Trichosporon cutaneum. FEMS Microbiol. Lett. 168:105–110.

474 37. Weber, S.D., A. Hofmann, M. Pilhofer, G. Wanner, R. Agerer, W. Ludwig, K.-H.

475 Schleifer, and J. Fried. 2009. The diversity of fungi in aerobic sewage granules

476 assessed by 18S rRNA gene and ITS sequence analyses. FEMS Microbiol. Ecol.

477 68:246–254.

478 38. White, T.J., T.D. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct

480 White, J.J. Sninsky, D.H. Gelfand, and M.A. Innin (ed.), PCR Protocols a Guide to

481 Methods and Applications Academic Press, San Diego, USA.

482 39. Yu, Y., M. Breitbart, P. McNairnie, and F. Rohwer. 2006. FastGroupII: A web-based

483 bioinformatics platform for analyses of large 16S rDNA libraries. BMC

484 Bioinformatics 7:57.

485 40. Zhaorigetu, M. Komatsuzaki, Y. Sato, and H. Ohta. 2008. Relationships between

486 fungal biomass and nitrous oxide emission in upland rice soils under no tillage and

487 cover-cropping systems. Microbes Environ. 23:201–208.

488 489 Proofs View

Advance

491 Fig. 1. Representation of the primer position in a eukaryotic (yeast and filamentous

492 fungi) ribosomal RNA gene. The loci and direction of the primers are indicated by

493 arrows. ITS, internal transcribed spacer; LSU, large-subunit rRNA; SSU, small-subunit

494 rRNA. The plus (+) and minus (–) signs indicate a successful and unsuccessful analysis,

495 respectively. Primer positions of ITS1, LR21, QLR21, QITS1F (nucleotides sequence:

496 5’- CTTGGTCATTTAGAGGAAGTAA -3’) and ITS4 (5’-

497 TCCTCCGCTTATTGATATGC-3’) used for T-RFLP show in the ribosomal RNA gene

498 region.

499 500 Fig. 2. Rarefaction curves of the diversity of the ITS-D1fLSU regionProofs obtained for soil 501 management. Operational taxonomic units (OTUs) were assigned using a 3%

502 dissimilarity cut-off with sequence data of the ITS-D1fLSU region clone library. PF,

503 plow-tilled fallow; NF, non-tilled fallow; ViewNH, non-tilled fallow cover crop (hairy

504 vetch); NR, non-tilled fallow cover crop (rye).

505

506 Fig. 3. Nonmetric multidimensional scaling (NMDS) of terminal-restriction fragments

507 of T-RFLPAdvance profiling (A) and fungal clone libraries (B) from study sites. NMDS was

508 preformed using T-RFexps and T-RFseqs profiles combined HaeIII and MspI enzymes,

509 respectively. The two-dimensional stress values were 1.1×10-14 (A) and 8.0×10-3 (B),

510 respectively. PF, plow-tilled fallow (circle); NF, non-tilled fallow (triangle); NH,

511 non-tilled fallow cover crop of hairy vetch (rhombus); NR, non-tilled fallow cover crop

512 of rye (square). Years 2004 and 2007 are represented as 04 and 07, respectively. Closed

513 and open marks indicate the years 2004 and 2007, respectively. Dotted arrows indicate

515

516 Fig. 4. Phylogenetic relationship of the fungal internal transcribed spacer sequence of

517 the characterized clone library of non-tilled fallow managed soils. The method of

518 neighbor-joining was carried out using the package Clustal W (35). The sequences

519 obtained in the present study are shown in bold. Bootstrap values greater than 50 are

520 shown at branch points. Cystofilobasidium bisporidii CBS 6347 was used as an

521 out-group. The scale bar indicates 10% sequence divergence. The accession number

522 deposited in GenBank database is indicated in parentheses.

523 524 Proofs View

Advance

Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 525 Table 1. Appearance rate of sequenced clones in the different soil management 526 practices 527 Soil management methodsa) 528 Phylogenetic relations 04PF 04NF 04NH 04NR 529 Phylum 530 Ascomycota 26.7 % 4.1 % 34.4 % 8.4 % 531 Basidiomycota 10.5 % 33.7 % 49.5 % 68.4 % 532 Chytridiomycota 2.3 % 12.2 % 2.2 % 0 % 533 Glomeromycota 0 % 3.1 % 3.2 % 2.2 % 534 Unclassified fungi 5.8 % 1.0 % 1.0 % 4.2 % 535 Uncultured fungal clone 54.7 % 45.9 % 9.7 % 16.8 % 536 Total sequenced number 86 98 93 95 537 a)PF, plow-tilled fallow; NF, non-tilled fallow; NH, non-tilled with hairy vetch; NR,

538 non-tilled with cereal rye. Years 2004 is represented as 04. 539 Proofs View

Advance

Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 540 Table 2. Number of T-RFs detected by fungal T-RFLP profiling of upland soils under 541 different treatmentsa) 542 Restriction Number of T-RFs (2004, May / 2007, May) 543 enzymes in soil managementb) 544 PF NF* NH* NR* 545 HaeIII 22 / 33 26 / 6 53 / 14 27 / 9 546 MboI/Sau3AI 51 / 39 37 / 9 50 / 14 22 / 8 547 MspI 51 / 35 41 / 9 53 / 9 29 / 4 a) 548 ITS-D1fLSU regions were amplified under 30 cycles using 0.1-µg environmental DNA. 549 The number of T-RFs of between 50 and 650 bases was counted. 550 b)PF, plow-tilled fallow; NF, non-tilled fallow; NH, non-tilled with hairy vetch; NR, 551 non-tilled with cereal rye. 552 Asterisk indicates a significant difference from T-RF numbers in 2004 (P≤0.05). 553 Proofs View

Advance

Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology ITS1 LR21/QLR21Proofs QITS1F ITS4 SSU 5.8S LSU Ribosomal RNA ITS1View ITS2 D1 D2 Primer set T-RFLP profiling QITS1F, ITS4 ITS1, QLR21

Advance Fig. 1. Nishizawa et al.

50 NF

40 PF OTUs NR 30 Proofs NH 20 Number of Number 10

0 View 0 20 40 60 80 100 120 Number of clones analyzed

Advance Fig. 2. Nishizawa et al.

02 NF04 NH04 NMDS axis 2 NMDS axis -2 PF07 NH07 View -0.2 -0.1 -4 3 -0. -6 -4 -2 0 2 4 6 -0.2 0 0.2 0.4 NMDS axis 1 NMDS axis 1

Advance Fig. 3. Nishizawa et al.

Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology Cystofilobasidium bisporidii CBS 6347 (AF444299) 100 Cryptococcus nyarrowii CBS 8804 (AY006481) C116 (NR,2 clones; NH, 6 clones) IU-FSC Fun24 65 Cryptococcus sp. CBS 7743 (AF408419) Cryptococcus allantoinivorans CBS 9604 (AY315664) Cryptococcus aureus G7a (DQ640764) 67 Cryptococcus cellulolyticus CBS 8294 (A(AF444442)F444442) 50 Cryptococcus anemochorus CBS 10258 (DQ830986) 63 Cryptococcus rajasthanensis 15L (AM262325) 68 Cryptococcus laurentii NRRL Y-2536 (FJ153214) 91 Cryptococcus nemorosus VKM Y-2906 (AF472628) 91 Cryptococcus perniciosus VKM Y-2905 (AF472627) 96 98 Cryptococcus heveanensis CBS 569 (AF444301) Cryptococcus bestiolae (AY917101) 87 Cryptococcus dejecticola (AY917103) Cryptococcus flavus CBS 331 (AF444338) 89 Cryptococcus podzolicus CBS 6819 (AF444321) Cryptococcus statzellii 87a (AY029342) 94 100 C087 (NH, 1 clone) IU-FSC Fun26Proofs Cryptococcus surugaensis JCM 11903 (AB100440) 67 63 Cryptococcus luteolus ATCC 32044 (EU252551) 100 Cryptococcus zeae HB1207T (AJ965481) Cryptococcus fagi CBS 9964 (DQ054534) 99 Cryptococcus skinneri CBS 5029 (AF444305) Cryptococcus dimennae ATCC 22024 (EU266559) Cryptococcus taibaiensis AS 2.2444 (AY557601) 76 View Cryptococcus foliicola AS2.2471 (AY557600) 98 74 C053 (NH, 1 clone) IU-FSC Fun27 89 Cryptococc u s tephrensis CBS 8935 (D(DQ000318)Q000318) 95 Cryptococcus carnescens CBS 10755 (EU149786) Cryptococcus victoriae HB1221 (AM160647) 62 D071 (NR, 2 clones) C065 (NF, 1 clone; NH, 9 clones; NR, 25 clones) 50 C104 (NH, 1 clone) IU-FSC Fun28 C122 (NH, 2 clones) C058 (NH, 1 clone) Advance0.1

Fig. 4. Nishizawa et al.