M&E Papers in Press. Published online on July 13, 2010 doi:10.1264/jsme2.ME10108 1 Revised ME10108 2 3 Molecular Characterization of Fungal Communities in Non-Tilled, Cover-Cropped 4 Upland Rice Field Soils 5 1†‡* 1† 1, 2 6 TOMOYASU NISHIZAWA , ZHAORIGETU , MASAKAZU KOMATSUZAKI , YOSHINORI 2 3 1, 2 7 SATO , NOBUHIRO KANEKO , and HIROYUKI OHTA 8 9 1Ibaraki University College of Agriculture, 3-21-1 Chuou, Ami-machi, Ibaraki 300-0393, Japan; 10 2Institute for Global Change Adaptation Science, Ibaraki University, 2-1-1 Bunkyo, Mito, 11 Ibaraki 310-8512, Japan; and 3Graduate School of Environment and Information Science, 12 Yokohama National University, 79-7 Tokiwadai, Hdogaya-ku, Yokohama,Proofs Kanagawa 240-8501, 13 Japan 14 View 15 (Received February 4, 2010 – Accepted June 16, 2010) 16 17 * Corresponding author. E-mail: [email protected]; Tel: +81–29–888–8684; Fax: 18 +81–29–888–8525.Advance 19 † T.N. and Z. contributed equally to this study. 20 ‡ Present address: Department of Applied Biological Chemistry, Graduate School of Agricultural 21 and Life Sciences, The University of Tokyo, 1–1–1, Yayoi, Bunkyo-ku, Tokyo 113–8657, Japan 22 23 Running headline: Soil Fungal Community in Upland Rice Field 24 25 1 Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 26 Abstract 27 This study aimed to characterize soil fungal communities in upland rice fields 28 managed with tillage/non-tillage and winter cover-cropping (hairy vetch and cereal rye) 29 practices, using PCR-based molecular methods. The study plots were maintained as 30 upland fields for 5 years and the soils sampled in the second and fifth years were 31 analyzed using T-RFLP (terminal restriction fragment length polymorphism) profiling 32 and clone libraries with the internal transcribed spacer (ITS) region and domain 1 (D1) 33 of the fungal large-subunit (fLSU) rRNA (D1fLSU) as the target DNA sequence. From 34 the 2nd-year-sample, 372 cloned sequences of fungal ITS-D1fLSU were obtained and 35 clustered into 80 nonredundant fungal OTUs (operational taxonomic units) in 4 fungal 36 phyla. The T-RFLP profiling was performed with the 2nd- andProofs 5th-year-samples and the 37 major T-RFs (terminal restriction fragments) were identified using a theoretical 38 fragment analysis of the ITS-D1fLSU clones. These molecular analyses showed that the 39 fungal community was influenced more stronglyView by the cover-cropping than tillage 40 practices. Moreover, the non-tilled, cover-cropped soil was characterized by a 41 predominance of Cryptococcus sp. in the phylum Basidiomycota. We provided a genetic 42 database of the fungal ITS-D1fLSUs in the differently managed soils of upland rice fields. 43 Advance 44 Key words: clone library, Cryptococcus, soil fungal community, T-RFLP, ribosomal 45 RNA gene 46 47 2 Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 48 Introduction 49 Agricultural management practices of non-tillage and cover-cropping have a great 50 influence on soil carbon and nitrogen dynamics through soil microbial activity (15, 40). 51 In most well-aerated, upland fields, fungi account for the majority of the total microbial 52 population (3). In addition to the saprophytic property, evidence of fungal nitrous 53 oxide-producing denitrification has been revealed in grassland soil using a combination 54 of the substrate-induced respiration inhibition method and labeling with a stable isotope 55 of nitrogen (18). Chemical inhibitors of fungi and bacteria decreased the flux of nitrous 56 oxide by 89% and 23%, respectively, suggesting that the fungal community was 57 involved in the nitrous oxide production. Prior to this finding, experiments in vivo had 58 shown that nitrous oxide was the main end product of fungal denitrificationProofs (30, 36). 59 Recently, Zhaorigetu et al. (40) reported a positive relationship between fungal biomass 60 and nitrous oxide emissions in an upland rice field. It was also shown that the fungal 61 biomass in the surface soil (0-10 cm) incrVieweased with the adoption of conservation 62 management systems such as non-tilled fallow and cover-cropping (hairy vetch and rye) 63 practices. However, the soil fungal community associated with the production of nitrous 64 oxide still remains indistinct in upland rice field soil. 65 To assessAdvance microbial diversify, small-s ubunit (SSU) and/or large-subunit (LSU) rRNA 66 genes are often used as markers (1). Sequencing of either LSU-rRNA or internal 67 transcribed spacer (ITS) regions has been used for the identification of fungal species 68 (12, 28, 29, 32). Molecular methods such as fungal rRNA gene and ITS region-based 69 clone library and phylogenetic analyses were utilized for identifying the dominant fungi 70 and elucidating the diversity of fungal communities in environmental samples (2, 24, 25, 71 27, 37). Terminal-restriction fragment length polymorphism (T-RFLP) profiling (19, 21) 3 Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 72 using an automated DNA sequencer with fluorescence-labeling nucleotides is a 73 powerful tool for monitoring the diversity in microbial communities (5, 7, 10, 11, 14, 23, 74 27, 31). 75 The objective of this study was to characterize the fungal community of nitrogen 76 oxide-production-enhanced upland soils maintained with cover-cropped and non-tillage 77 practices in comparison with those of conventional tillage soils. PCR-based T-RFLP 78 profiling and a clone library based on the fungal ITS–LSU-rRNA region in upland rice 79 fields were used. 80 81 Materials and Methods 82 Field management and soil sampling Proofs 83 The study plots were located at the Field Science Center of Ibaraki University 84 College of Agriculture, Ibaraki, Japan. The soil at the sites was a humic allophane soil 85 (Haludands, Haplic Andosols). The experimeViewnt was conducted over a period of 5 years, 86 from October 2003 until October 2007. Hairy vetch (Vicia villosa Roth.) and cereal rye 87 (Secale cereale L.) were planted every October from 2003 to 2007. Seeds of field rice 88 (Oryza sativa L.) were planted with a drill in April of each year. A detailed explanation 89 of the Advanceexperimental plots has been given previously (23, 40). In the present study, four 90 soils were used: plow-tilled fallow (PF), non-tilled fallow (NF), non-tilled hairy 91 vetch-cover cropped (NH), and non-tilled rye-cover cropped (NR) soil. Soil samples 92 were taken on May 14, 2004 and May 15, 2007. Five sub-samples (10 g fresh weight 93 per sub-sample) per depth of between 0 and 10 cm were collected from three plots using 94 sterile implements and then thoroughly mixed. The 50 g of soil was kept at -20˚C in 95 darkness before the genetic analysis. 4 Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 96 97 DNA extraction and manipulation 98 Total DNA from soil samples (0.5–1.0 g wet weight) was isolated using an Isoil for 99 Beads Beating kit (Nippon Gene, Tokyo, Japan) with skim milk powder (Wako, Osaka, 100 Japan) as described previously (23). Escherichia coli DH5α (Takara Bio, Otsu, Japan) 101 was used as a host for recombinant plasmids and grown at 37˚C in Luria-Bertani’s (LB) 102 broth or LB agar. As an antibiotic, ampicillin sodium salt was added at a final 103 concentration of 75 µg mL-1 when necessary. The pGEM-T-Easy vector system 104 (Promega, Madison, WI, USA) was used for cloning according to instructions. 105 106 PCR amplification of the internal transcribed spacer (ITS) sequenceProofs and domain 1 (D1) 107 of the large-subunit (LSU) rRNA gene 108 The fungal ITS-D1fLSU rRNA region in soil DNA (0.1 µg) was amplified using ITS1 109 (5’- TCCGTAGGTGAACCTGCGG -3’)View and LR21 (5’- ACTTCAAGCGTTTCCCTTT 110 -3’, position 424-393 in Saccharomyces cerevisiae large subunit rRNA). The reactions 111 were performed in a Takara PCR thermal cycler Personal (Takara Bio) with Ex Taq 112 (TakaraAdvance Bio) under the following conditions: 2 min at 95˚C, followed by 30 cycles of 113 95˚C (30 s), 54˚C (45 s), and 72˚C (1.5 min), with a final cycle of 72˚C for 3 min. 114 For the construction of the clone library, the ITS-D1fLSU rRNA gene region amplified 115 using DNA of PF, NF, NH, and NR soils sampled in 2004 was cloned and the PCR 116 DNA fragments were ligated into the pGEM-T-easy vector. 117 118 Sequencing of the ITS region and computer analysis of DNA sequences 119 Nucleotide sequences were determined with a BigDye Terminator Cycle Sequencing 5 Copyright 2010 by the Japanese Society of Microbial Ecology / the Japanese Society of Soil Microbiology 120 Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) according to the 121 instructions supplied and with a PE Applied Biosystems Automated DNA Sequencer 122 (model 3130xl, Applied Biosystems). The double-stranded DNA sequences were 123 assembled and analyzed using Genetyx (version 11.0) and Genetyx-ATSQ (version 4.0) 124 software (Genetyx, Tokyo, Japan), respectively, and compared with similar DNA 125 sequences retrieved from the DDBJ/EMBL/GenBank databases using the 126 NCBI-BLAST and DDBJ-BLAST programs. The phylogenetic analysis was carried out 127 using the multiple-sequence alignment tool from Clustal W (35). 128 129 Terminal-restriction fragment length polymorphism (T-RFLP)-based profiling 130 The ITS regions were amplified by PCR from the total genomicProofs soil DNA with the 131 primers QLR21 (5’- CACTTCAAGCGTTTCCCTTT -3’), labeled with quenching 132 fluorescence, and ITS1. The 5’-end fluorescence-labeled primer (16) was purchased 133 from J–Bio21 (Tsukuba, Japan).