DOCSLIB.ORG

Material & Methods.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Material & Methods.Pdf Supplementary Materials and methods Yeast strains Yeast strains harboring an endogenous GFP tag at the C-end of CTF19, OKP1, MCM21, AME1, NNF1, DSN1, MTW1, NSL1, SPC105, or YFR046C were made by PCR amplifying the 65 65 GFP(S T)-TADH1-HIS3MX6 cassette from plasmid pFA6a-GFP(S T)-HIS3MX6 (Longtine et al. 1998) followed by transformation and selection on complete supplement mixture (CSM) minus histidine (Qbiogene). Expression of the tag was confirmed by microscopy. Spindle pole bodies and chromosomes were tagged as previously described (He et al. 2001). NDC80 was C- terminally tagged with GFP in stains AMC52 and AMC48 as described previously (He et al. 2001). For strain AMC49, a 500bp C-terminal fragment was PCR amplified and GFP linked at the C-terminus in the integrative vector pRS306 (pAMC55). The endogenous gene was replaced in a one-step integration. Yeast strains containing a C-terminal TEV-ProA tag (TEV cleavage site and protein A) at CTF19, MCM21, OKP1, AME1, MTW1, NSL1, DSN1, NNF1, MCM22 or NKP1 were made by PCR amplification of the TEV-ProA-TADH1-KANMX6 cassette from plasmid pYM8 (Knop et al. 1999), followed by transformation and G418 (200µg/ml, Sigma)-based selection. Yeast strains containing a C-terminal 3FLAG tag at OKP1, AME1, MTW1, NNF1 or MCM21, were constructed by PCR-based amplification of the 3FLAG-TADH1-KANMX6 cassette from plasmid pDam278 (D'Amours and Jackson 2001) followed by transformation and G418- based selection for integration. Correct integrations were confirmed by PCR using a gene- specific primer and a primer specific for the KANMX6 sequence. Yeast strains containing a C- terminal TAP tag (calmodulin binding peptide, TEV cleavage site, and protein A in tandem) were made either by cloning the entire open reading frame (MCM21, AME1, NDC80, and CSE4) into the GatewayTM (Invitrogen) entry vector pDONOR201 followed by an in vitro recombination of the open reading frame into plasmid pAMC11, which contains a TAP tag. 1 Alternatively, the CTF19, OKP1, SLK19, and STU2 open reading frames were cloned into pRS305, which contains the TAP, tag. The endogenous gene was replaced with a one-step integration and correct integrants confirmed by anti-PAP western blotting against protein A. Ame1p-TAP or Ame1p-GFP tagged yeast strains deleted in CTF19 or MCM21 were made by PCR amplifying the ctf19::KANMX6 or mcm21::KANMX6 open reading frames from deletion strains BY2810 and BY3677 (Research Genetics), followed by transformation of the deletion fragments, and G418-based selection for integration. The Ame1p-TAP tagged yeast strain deleted in NKP1 was constructed by amplifying the PTEF-KANMX6-TTEF cassette from plasmid pFA6a-KANMX6 (Longtine et al. 1998) followed by transformation and G418-based selection. Deletion strains were confirmed by PCR using two primers that flank the open reading frames. Proteomic analysis For LC-MS/MS data a Pearl program was written that subtracted the no-tag purification data from the bait data. Single-peptide hits and multi-peptide hits with protein coverage below 10% and known ribosomal proteins (plus other common contaminants (Ho et al. 2002)) were subtracted from the dataset. This filtered dataset was then analyzed using the Yeast Genome project (http://www.yeastgenome.org) and the Yeast Bioknowledge Library (http://www.incyte.com) to identify enriched proteins (see Supplementary Table 2). Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) of GFP- or ProA-tagged proteins was performed as previously described with some modifications (He et al. 2001). Specifically, formaldehyde crosslinking was done for 20 min at 24oC, and quenched with glycine (final 125mM) for 5 min at 24oC. Following cell breakage, extracts were sonicated (3x10sec), centrifuged (20 min; 13,000 2 rpm), and 200 µl of the clarified extract then used in each immunoprecipitation (IP) and 20 µl used as an INPUT. For ProA-based ChIP, 100µl of a 50% slurry of IgG-sepharose (Amersham Biosciences) was used for each IP. IPs were incubated for 2 h at 4oC. Primers 5’- CACCGCCAAGCTTCCAATATCACG-3’ and 5’-GGAGGCATTATGGCTTTGTTACGC-3’ were used to amplify a 400bp product 0.6kb from the TG repeat of telomere VI-R (Martin et al. 1999). Primers 5’-GCGCAAGCTTGCAAAAGGTCACATG-3’ and 5’- CGAATTCATTTTGGCCGCTCCTAGGTA-3’ were used to amplify a 200 bp fragment from CENIV (He et al. 2001). Primers 5’-GGCTGTGGTTTCAGGGTCCATAAAGC-3’ and 5’- CTGGGCAATTTCATGTTTCTTCAACACC-3’ were used to amplify a 200bp fragment of URA3 which is 35kb from the centromere of chromosome V. Microscopy and image Analysis Microscopy and image analyses were carried out on a 3D Deltavision deconvolution microscope as previously described with some modifications. (He et al. 2001; Rines et al. 2002; Rines et al. 2003). For live cell movies a 3D image stack (20 sections of 0.2µm spacing and 0.04 second exposure) was taken every 5 seconds for a total time of 300 seconds. GFP spots were tracked as described in (Thomann et al. 2002) and graphs assembled in MatLab 6.5. Size-exclusion chromatography Size-exclusion chromatography was performed with a 150 ml HiPrepTM 16/60 SephacrylTM S-500 HR column (Amersham Biosciences) that was run (0.3ml/min) at 4°C in connection with the ÄKTAFPLCTM system (Amersham Biosciences). The running buffer was composed of 150mM KCl, 10mM EDTA, 50mM β-glycerophosphate, and 100mM bis-tris-propane pH7.5. To determine the diffusion coefficients of epitope-tagged kinetochore proteins, a calibration curve 3 (R2: 0.91) was generated by plotting the elution volumes (Ve, ml) of a set of standard proteins against the reverse of the diffusion constant (1/D) of each standard protein (High Molecular Weight Gel Filtration Kit, Amersham Biosciences; Boeghringer Mannheim): bovine thyroglobulin (molecular mass: 669 kDa, Stokes radius a: 82.55 Angstrom, D: 2.49x10-7cm2s-1), equine ferritin (440 kDa, 61.8 Angstrom, 3.61x10-7cm2s-1), bovine catalase (240 kDa, 52 Angstrom, 4.1x10-7cm2s-1), rabbit aldolase (158 kDa, 46.15 Angstrom, 4.63x10-7cm2s-1), and bovine serum albumin (68 kDa, 34.6 Angstrom, 6.8x10-7cm2s-1). The diffusion coefficients of the standard proteins (Horiike et al. 1983; Salmon et al. 1984) represent values determined in water at 20°C. Cell extracts of protein-tagged yeast strains were made from cells grown in YPD until an OD600 of 1.0-1.2. The cells were spun down and grinded in liquid nitrogen with mortar and pestle. The protein concentration of each extract was measured using the Bradford assay, and 0.5-1.0mg of total protein was loaded onto the size-exclusion column. The overnight elution was monitored by absorbance at 280nm, and 1ml fractions were collected (FRAC-900 system). The proteins in each fraction were then precipitated with 1M of trichloroacetic acid (TCA) and rinsed with acetone. The protein pellets were finally resuspended in SDS-loading buffer and analyzed using SDS PAGE. Western blotting against the tagged protein ultimately revealed its elution position, and consequently its diffusion constant. Glycerol-density gradient ultracentrifugation Glycerol-density gradients (2ml) ranging from 5 to 40% glycerol were prepared in 11x34 mm Ultra-ClearTM tubes (Beckman Instruments) by gradually layering eight 250µl aliquots of gradient buffer (150mM KCl, 10mM EDTA, 50mM β-glycerophosphate, and 100mM bis-tris- propane pH7.5) containing decreasing concentrations of glycerol. After layering, the gradients were equilibrated in stationary mode at 4°C for 4h. Cell extracts expressing an epitope-tagged 4 protein were obtained by grinding as described above, and 150µg of total protein was loaded onto the gradients, which were spun for 13h (55.000 rpm, 4°C) in a TLS-55 swinging bucket rotor (Beckman Instruments). The gradients were then fractionated by removing 20 equal fractions from top to bottom. The proteins present in each fraction were precipitated with TCA (final 1M), rinsed with acetone and resuspended in SDS-loading buffer for SDS PAGE analysis. Subsequent Western blotting against the affinity tags revealed the gradient fraction position of the tagged protein. In parallel, a mixture of standard proteins (3µg each, Boeghringer Mannheim) consisting of cytochrome C (12.5 kDA monomer, Svedberg sedimentation constant S: 1.9x10-13s), chymotrypsinogen A (25 kDa monomer, 2.58S), hen egg albumin (45 kDa monomer, 3.55S), bovine serum albumin (68 kDa monomer, 4.22S), aldolase (158 kDa tetramer, 7.4S), and catalase (240 kDa tetramer, 11.3S) was run, fractionated, precipitated and resuspended as described above. After analysis on 12% SDS PAGE followed by coomassie staining, the position of each standard protein was plotted against its Svedberg constant, yielding a calibration curve (R2: 0.97) that gives the sedimentation constant for a given protein based on its position within the gradient. Hydrodynamic calculations The diffusion coefficient D (107cm-2s) for a kinetochore protein was derived from the calibration curve (R2: 0.91) between the elution volume (Ve, ml) of the protein and the reverse of its diffusion constant 1/D. The Svedberg sedimentation coefficient (S, 10-13s) of a protein was calculated from the relationship (R2: 0.97) between the gradient fraction in which the protein was identified and its Svedberg sedimentation coefficient S. The molecular mass “M” (kDa, 103g mol-1) of a protein was calculated using the equation M = RTS/D(1-νρ), where R is the ideal gas 5 constant 8.314 J K-1mol-1;T the absolute temperature 295.15K (20°C); S the Svedberg sedimentation coefficient; D the diffusion coefficient, ν; the partial specific volume 0.71 cm3g-1; and ρ the solvent density 0.998gcm-3. The Stokes radius “a” (Angstrom, 10-8cm) was calculated from the calibration curve (R2: 0.91) between the elution volume of the standard proteins (see above) and their Stokes radii. The friction coefficient f/fo was calculated from the equation: f/fo= a/[(3νM/4πN)]1/3, where a is the Stokes radius, and N Avogadro’s number 6.022x1023 mol-1.
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • The MIS12 Complex Is a Protein Interaction Hub for Outer Kinetochore Assembly
    JCB: Article The MIS12 complex is a protein interaction hub for outer kinetochore assembly Arsen Petrovic,1 Sebastiano Pasqualato,1 Prakash Dube,3 Veronica Krenn,1 Stefano Santaguida,1 Davide Cittaro,4 Silvia Monzani,1 Lucia Massimiliano,1 Jenny Keller,1 Aldo Tarricone,1 Alessio Maiolica,1 Holger Stark,3 and Andrea Musacchio1,2 1Department of Experimental Oncology, European Institute of Oncology (IEO) and 2Research Unit of the Italian Institute of Technology, Italian Foundation for Cancer Research Institute of Molecular Oncology–IEO Campus, I-20139 Milan, Italy 33D Electron Cryomicroscopy Group, Max Planck Institute for Biophysical Chemistry, and Göttingen Center for Microbiology, University of Göttingen, 37077 Göttingen, Germany 4Consortium for Genomic Technologies, I-20139 Milan, Italy inetochores are nucleoprotein assemblies responsi­ axis of 22 nm. Through biochemical analysis, cross- ble for the attachment of chromosomes to spindle linking–based methods, and negative-stain electron mi­ K microtubules during mitosis. The KMN network, croscopy, we investigated the reciprocal organization of a crucial constituent of the outer kinetochore, creates an the subunits of the MIS12 complex and their contacts with interface that connects microtubules to centromeric chro­ the rest of the KMN network. A highlight of our findings matin. The NDC80, MIS12, and KNL1 complexes form the is the identification of the NSL1 subunit as a scaffold core of the KMN network. We recently reported the struc­ supporting interactions of the MIS12 complex with the tural organization of the human NDC80 complex. In this NDC80 and KNL1 complexes. Our analysis has important study, we extend our analysis to the human MIS12 com­ implications for understanding kinetochore organization in plex and show that it has an elongated structure with a long different organisms.
    [Show full text]
  • Identification of Conserved Genes Triggering Puberty in European Sea
    Blázquez et al. BMC Genomics (2017) 18:441 DOI 10.1186/s12864-017-3823-2 RESEARCHARTICLE Open Access Identification of conserved genes triggering puberty in European sea bass males (Dicentrarchus labrax) by microarray expression profiling Mercedes Blázquez1,2* , Paula Medina1,2,3, Berta Crespo1,4, Ana Gómez1 and Silvia Zanuy1* Abstract Background: Spermatogenesisisacomplexprocesscharacterized by the activation and/or repression of a number of genes in a spatio-temporal manner. Pubertal development in males starts with the onset of the first spermatogenesis and implies the division of primary spermatogonia and their subsequent entry into meiosis. This study is aimed at the characterization of genes involved in the onset of puberty in European sea bass, and constitutes the first transcriptomic approach focused on meiosis in this species. Results: European sea bass testes collected at the onset of puberty (first successful reproduction) were grouped in stage I (resting stage), and stage II (proliferative stage). Transition from stage I to stage II was marked by an increase of 11ketotestosterone (11KT), the main fish androgen, whereas the transcriptomic study resulted in 315 genes differentially expressed between the two stages. The onset of puberty induced 1) an up-regulation of genes involved in cell proliferation, cell cycle and meiosis progression, 2) changes in genes related with reproduction and growth, and 3) a down-regulation of genes included in the retinoic acid (RA) signalling pathway. The analysis of GO-terms and biological pathways showed that cell cycle, cell division, cellular metabolic processes, and reproduction were affected, consistent with the early events that occur during the onset of puberty.
    [Show full text]
  • Reconstructing Cell Cycle Pseudo Time-Series Via Single-Cell Transcriptome Data—Supplement
    School of Natural Sciences and Mathematics Reconstructing Cell Cycle Pseudo Time-Series Via Single-Cell Transcriptome Data—Supplement UT Dallas Author(s): Michael Q. Zhang Rights: CC BY 4.0 (Attribution) ©2017 The Authors Citation: Liu, Zehua, Huazhe Lou, Kaikun Xie, Hao Wang, et al. 2017. "Reconstructing cell cycle pseudo time-series via single-cell transcriptome data." Nature Communications 8, doi:10.1038/s41467-017-00039-z This document is being made freely available by the Eugene McDermott Library of the University of Texas at Dallas with permission of the copyright owner. All rights are reserved under United States copyright law unless specified otherwise. File name: Supplementary Information Description: Supplementary figures, supplementary tables, supplementary notes, supplementary methods and supplementary references. CCNE1 CCNE1 CCNE1 CCNE1 36 40 32 34 32 35 30 32 28 30 30 28 28 26 24 25 Normalized Expression Normalized Expression Normalized Expression Normalized Expression 26 G1 S G2/M G1 S G2/M G1 S G2/M G1 S G2/M Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage CCNE1 CCNE1 CCNE1 CCNE1 40 32 40 40 35 30 38 30 30 28 36 25 26 20 20 34 Normalized Expression Normalized Expression Normalized Expression 24 Normalized Expression G1 S G2/M G1 S G2/M G1 S G2/M G1 S G2/M Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Supplementary Figure 1 | High stochasticity of single-cell gene expression means, as demonstrated by relative expression levels of gene Ccne1 using the mESC-SMARTer data. For every panel, 20 sample cells were randomly selected for each of the three stages, followed by plotting the mean expression levels at each stage.
    [Show full text]
  • Assigning Function to Yeast Proteins by Integration of Technologies
    Molecular Cell, Vol. 12, 1353–1365, December, 2003, Copyright 2003 by Cell Press Assigning Function to Yeast Proteins by Integration of Technologies Tony R. Hazbun,1,2 Lars Malmstro¨ m,3 Scott Anderson,4 proaches (Ito et al., 2001; Uetz et al., 2000); and many Beth J. Graczyk,3 Bethany Fox,3 Michael Riffle,3 of the proteins have been localized by indirect immuno- Bryan A. Sundin,3 J. Derringer Aranda,2 fluorescence or by fusion to green fluorescent protein W. Hayes McDonald,4 Chun-Hwei Chiu,3 (GFP) (Huh et al., 2003; Kumar et al., 2002; Ross-Mac- Brian E. Snydsman,3 Phillip Bradley,3 donald et al., 1999). Despite these large-scale studies, Eric G.D. Muller,3 Stanley Fields,1,2 David Baker,1,3 as well as numerous small-scale analyses, approxi- John R. Yates III,4 and Trisha N. Davis3,* mately one-third of the ORFs have not been assigned to 1Howard Hughes Medical Institute a functional category, indicating that large-scale studies 2 Departments of Genome Sciences and Medicine yield incomplete data sets and small-scale, focused 3 Department of Biochemistry studies tend to be biased toward specific areas of biol- University of Washington ogy. We focus here on an important subset of these Seattle, Washington 98195 uncharacterized ORFs, those that are essential for 4 Department of Cell Biology yeast viability. Scripps Research Institute Complete analysis of the yeast proteome requires La Jolla, California 92037 characterization of proteins refractory to analysis in pre- vious studies. We started with 100 ORFs that were known to be essential for viability but carried out un- Summary known functions.
    [Show full text]
  • Massively Parallel Disruption of Enhancers Active During Human Corticogenesis
    bioRxiv preprint doi: https://doi.org/10.1101/852673; this version posted December 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Title: Massively parallel disruption of enhancers active during human corticogenesis Authors: Evan Geller1, Jake Gockley1§, Deena Emera1‡, Severin Uebbing1, Justin Cotney1+, James P. Noonan1,2,3* Affiliations: 1. Department of Genetics, Yale School of Medicine, New Haven, CT, 06510, USA. 2. Department of Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA. 3. Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA §Present address: Sage Bionetworks, Seattle, WA 98121, USA. +Present address: Department of Genetics and Genome Science, University of Connecticut Health, Farmington, CT 06030, USA ‡Present address: Center for Female Reproductive Longevity and Equality, Buck Institute for Research on Aging, Novato, CA 94945, USA *Corresponding author: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/852673; this version posted December 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Abstract: Changes in gene regulation have been linked to the expansion of the human cerebral cortex and to neurodevelopmental disorders. However, the biological effects of genetic variation within developmental regulatory elements on human corticogenesis are not well understood.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Proteinnsl1 Homolog, Chromosome 1 Open Reading Frame 48, C1orf48, MIS14
    DATA SHEET NSL1 Human Recombinant Item Number rAP-3986 Synonyms NSL1 MIS12 Kinetochore Complex Component, NSL1 MIND Kinetochore Complex Component Homolog (S. Cerevisiae), Kinetochore-Associated ProteinNSL1 Homolog, Chromosome 1 Open Reading Frame 48, C1orf48, MIS14. Description NSL1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 304 amino acids (1-281) and having a molecular mass of 34.6kDa.NSL1 is fused to a 23 amino acid His- tag at N-terminus & purified by proprietary chromatographic techniques. Uniprot Accesion Number Q96IY1 Amino Acid Sequence MGSSHHHHHH SSGLVPRGSH MGSMAGSPEL VVLDPPWDKE LAAGTESQAL VSATPREDFR VRCTSKRAVT EMLQLCGRFV QKLGDALPEE IREPALRDAQ WTFESAVQEN ISINGQAWQE AS- DNCFMDSD IKVLEDQFDE IIVDIATKRK QYPRKILECV IKTIKAKQEI LKQYHPVVHP LDLKYDPDPA PHMENLKCRG ETVAKEISEA MKSLPALIEQ GEGFSQVLRM QPVIHLQRIH QEVFSSCHRK PDAKPEN- FIT QIETTPTETA SRKTSDMVLK RKQTKDCPQR KWYPLRPKKI NLDT Source Escherichia Coli. Physical Appearance Sterile Filtered clear solution. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C and Stability for longer periods of time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles. Formulation and Purity The NSL1 solution (1mg/ml) contains 20mM Tris-HCl buffer (pH 8.0), 0.4M Urea and 10% glycerol. Greater than 85% as determined by SDS-PAGE. Application Solubility Biological Activity Shipping Format and Condition Lyophilized powder at room temperature. Optimal dilutions should be determined by each laboratory for each application. The listed dilutions are for recommendation only and the final condi- tions should be optimized by the ender users! This product is sold for Research Use Only Angio-Proteomie | 11 Park Drive, Suite 12 Boston, MA 02215, USA | Tel: 001‐617‐549‐2665 | Fax: 001‐480‐247‐4337 | Email： [email protected] .
    [Show full text]
  • NSL1 (NM 001042549) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC311349 NSL1 (NM_001042549) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: NSL1 (NM_001042549) Human Untagged Clone Tag: Tag Free Symbol: NSL1 Synonyms: C1orf48; DC8; MIS14 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001042549, the custom clone sequence may differ by one or more nucleotides ATGGCGGGGTCTCCTGAGTTGGTGGTCCTTGACCCTCCATGGGACAAGGAGCTCGCGGCTGGCACAGAGA GCCAGGCCTTGGTCTCCGCCACTCCCCGAGAAGACTTTCGGGTGCGCTGCACCTCGAAGCGGGCTGTGAC CGAAATGCTACAACTGTGCGGCCGCTTCGTGCAAAAGCTCGGGGACGCTCTGCCGGAGGAGATTCGGGAG CCCGCTCTGCGAGATGCGCAGTGGACTTTTGAATCAGCTGTGCAAGAGAATATCAGCATTAATGGGCAAG CATGGCAGGAAGCTTCAGATAATTGTTTTATGGATTCTGACATCAAAGTACTTGAAGATCAGTTTGATGA AATCATAGTAGATATAGCCACAAAACGTAAGCAGTATCCCAGAAAGATCCTGGAATGTGTCATCAAAACC ATAAAAGCAAAACAAGAAATTCTGAAGCAGTACCACCCTGTTGTACATCCACTGGACCTAAAATATGACC CTGATCCAGTTCTCAACGGGAATGCTTTCAACTTTTCCCCATTCAACATGATGTTGGCTGTGGATTTGTC ATATATGGTTTTTATTACTTCGAGCCCCTCATATGGAAAATTTGAAATGCAGAGGGGAAACAGTAGCAAA GGAGATCAGTGA Restriction Sites: SgfI-MluI ACCN: NM_001042549 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this
    [Show full text]
  • Phenotypic and Genotypic Characterization of Families With
    www.nature.com/scientificreports OPEN Phenotypic and genotypic characterization of families with complex intellectual disability identifed pathogenic genetic variations in known and novel disease genes Hossein Darvish1,2, Luis J. Azcona3,4, Abbas Tafakhori5, Roxana Mesias3,6, Azadeh Ahmadifard7, Elena Sanchez3, Arman Habibi5, Elham Alehabib7, Amir Hossein Johari7, Babak Emamalizadeh8, Faezeh Jamali7, Marjan Chapi7, Javad Jamshidi9,10, Yuji Kajiwara11,12 & Coro Paisán-Ruiz4,12,13,14,15* Intellectual disability (ID), which presents itself during childhood, belongs to a group of neurodevelopmental disorders (NDDs) that are clinically widely heterogeneous and highly heritable, often being caused by single gene defects. Indeed, NDDs can be attributed to mutations at over 1000 loci, and all type of mutations, ranging from single nucleotide variations (SNVs) to large, complex copy number variations (CNVs), have been reported in patients with ID and other related NDDs. In this study, we recruited seven diferent recessive NDD families with comorbidities to perform a detailed clinical characterization and a complete genomic analysis that consisted of a combination of high throughput SNP-based genotyping and whole-genome sequencing (WGS). Diferent disease-associated loci and pathogenic gene mutations were identifed in each family, including known (n = 4) and novel (n = 2) mutations in known genes (NAGLU, SLC5A2, POLR3B, VPS13A, SYN1, SPG11), and the identifcation of a novel disease gene (n = 1; NSL1). Functional analyses were additionally performed in a gene associated with autism-like symptoms and epileptic seizures for further proof of pathogenicity. Lastly, detailed genotype-phenotype correlations were carried out to assist with the diagnosis of prospective families and to determine genomic variation with clinical relevance.
    [Show full text]
  • Regulation of Outer Kinetochore Ndc80 Complex-Based Microtubule
    Regulation of outer kinetochore Ndc80 complex-based PNAS PLUS microtubule attachments by the central kinetochore Mis12/MIND complex Emily M. Kudalkara,1, Emily A. Scarborougha, Neil T. Umbreita,2, Alex Zeltera, Daniel R. Gestauta,3, Michael Rifflea, Richard S. Johnsonb, Michael J. MacCossb, Charles L. Asburyc, and Trisha N. Davisa,4 aDepartment of Biochemistry, University of Washington, Seattle, WA 98195; bDepartment of Genome Sciences, University of Washington, Seattle, WA 98195; and cDepartment of Physiology and Biophysics, University of Washington, Seattle, WA 98195 Edited by Edward D. Korn, National Heart, Lung and Blood Institute, Bethesda, MD, and approved August 26, 2015 (received for review July 15, 2015) Multiple protein subcomplexes of the kinetochore cooperate as a Spc105, Mis12/MIND (Mtw1, Nsl1, Nnf1, Dsn1) complex, and cohesive molecular unit that forms load-bearing microtubule attach- Ndc80 (Ndc80, Nuf2, Spc24, Spc25) complex (5). In C. elegans, ments that drive mitotic chromosome movements. There is intriguing the 4-protein Ndc80 complex and Knl1 bind directly to micro- evidence suggesting that central kinetochore components influence tubules, but MIND does not. Instead, MIND serves as a struc- kinetochore–microtubule attachment, but the mechanism remains tural linker that connects DNA-binding components with the unclear. Here, we find that the conserved Mis12/MIND (Mtw1, microtubule-binding complexes (6, 7). The KMN complex binds Nsl1, Nnf1, Dsn1) and Ndc80 (Ndc80, Nuf2, Spc24, Spc25) com- microtubules with a higher affinity than Ndc80 complex or Knl1 plexes are connected by an extensive network of contacts, each alone, demonstrating that MIND can facilitate the synergistic essential for viability in cells, and collectively able to withstand sub- binding of outer kinetochore complexes.
    [Show full text]
  • Spatiotemporal Dynamics of Spc105 Regulates the Assembly of the Drosophila Kinetochore Rsob.Royalsocietypublishing.Org Zsolt Venkei1,4, Marcin R
    Spatiotemporal dynamics of Spc105 regulates the assembly of the Drosophila kinetochore rsob.royalsocietypublishing.org Zsolt Venkei1,4, Marcin R. Przewloka1, Yaseen Ladak1,3, Shahad Albadri1,†, Alex Sossick2, Gabor Juhasz4,Be´la Nova´k3 Research and David M. Glover1 Cite this article: Venkei Z, Przewloka MR, 1Department of Genetics, University of Cambridge, Cambridge CB2 3EH, UK Ladak Y, Albadri S, Sossick A, Juhasz G, Nova´k 2Wellcome Trust/Cancer Research UK Gurdon Institute, Cambridge CB2 1QN, UK B, Glover DM. 2012 Spatiotemporal dynamics 3Oxford Centre for Integrative Systems Biology, Department of Biochemistry, University of Spc105 regulates the assembly of the of Oxford, Oxford OX1 3QU, UK Drosophila kinetochore. Open Biol 2: 110032. 4Department of Anatomy, Cell and Developmental Biology, Eotvos Lorand University, http://dx.doi.org/10.1098/rsob.110032 Budapest 1117, Hungary Received: 24 November 2011 1. Summary Accepted: 17 January 2012 The formation of kinetochores shortly before each cell division is a prerequisite for proper chromosome segregation. The synchronous mitoses of Drosophila syncytial embryos have provided an ideal in vivo system to follow kinetochore assembly kinetics and so address the question of how kinetochore formation is regulated. We found that the nuclear exclusion of the Spc105/KNL1 protein Subject Area: during interphase prevents precocious assembly of the Mis12 complex. The cellular biology/molecular biology/genetics nuclear import of Spc105 in early prophase and its immediate association with the Mis12 complex on centromeres are thus the first steps in kinetochore Keywords: assembly. The cumulative kinetochore levels of Spc105 and Mis12 complex centromere, chromosomes, KMN network, then determine the rate of Ndc80 complex recruitment commencing only Mis12 complex, mitosis after nuclear envelope breakdown.
    [Show full text]