Silencing of ZNF217 Gene Influences the Biological Behavior of a Human Ovarian Cancer Cell Line
Total Page:16
File Type:pdf, Size:1020Kb
1065-1071 5/4/08 14:33 Page 1065 INTERNATIONAL JOURNAL OF ONCOLOGY 32: 1065-1071, 2008 Silencing of ZNF217 gene influences the biological behavior of a human ovarian cancer cell line GUIQIN SUN1, JUN ZHOU2, AILAN YIN1, YANQING DING2 and MEI ZHONG1 1Department of Obstetrics and Gynecology, Nanfang Hospital, 2Department of Pathology, Southern Medical University, Guangzhou 510515, Guangdong Province, P.R. China Received January 7, 2008; Accepted February 22, 2008 Abstract. Zinc-finger protein 217 (ZNF217), a candidate and environmental factors, but its pathogenesis is still unclear. oncogene on 20q13.2, can lead cultured human ovarian and Most cancer development including ovarian cancer could mammary epithelial cells to immortalization, which indicates attribute to an accumulation of genetic and/or epigenetic selective expression of ZNF217 affecting 20q13 ampli- changes (2). fication during critical early stages of cancer progression. Zinc-finger protein 217 (ZNF217), recently cloned by In this study, we tested the hypothesis that ZNF217 is a key positional cloning, is thought as one of the strong candidate factor in regulating ovarian cancer proliferation and pro- oncogenes at 20q13.2 in breast cancer (3). Its amplification gression. We examined the effect of the inhibition of ZNF217 at 20q13.2 has also been frequently found in ovarian cancer expression on proliferation and invasion by establishing and other tumors (4-6) associated with aggressive tumor the ZNF217 knockdown ovarian cancer cell line using RNA behavior (7). Additionally, ZNF217 is presumed to encode interference (RNAi). Our results showed that silencing of alternately spliced, Kruppel-like transcription factors of ZNF217 resulted in the effective inhibition of ovarian cancer 1,062 and 1,108 aa, each having a DNA-binding domain cell growth and invasive ability. The results suggested that (eight C2H2 zinc fingers) and a proline-rich transcription ZNF217 might play a crucial role in the proliferation and activation domain (3). Furthermore, ZNF217 can be function invasion of ovarian cancer. as a transcriptional repressor and bind to C-terminal binding protein 2 (CtBP2) through a Pro-X-Asp-Leu-Ser (PXDLS) Introduction motif and Arg-Arg-Thr (RRT) domain to repress transcription of a variety of genes (8). Ovarian cancer causes the highest mortality of the gyneco- In further study of breast cancer, ZNF217 immortalized logic cancers; the majority of ovarian cancers are diagnosed human mammary epithelial cells (HMEC) when it is over- in stages III or IV. In these advanced stages, 5-year-survival expressed (9). Similarly, in four independent experiments rate is only 5-25% after surgery and chemotherapy (1). transducing the gene into finite life span HMEC, ZNF217- Ovarian cancer is a heterogeneous disease with respect to transduced cultures were found to give rise to immortalized histopathology, molecular biology and clinical outcome. In cells (10). In a prostate cancer xenograft, using combined cyto- recent studies, the etiology and susceptibility of ovarian genesis, array-based comparative genomic hybridization cancer showed that the mechanism of carcinogenesis and (CGH) and expression analyses, ZNF217 was found to be cancer development is associated with genetic, epigenetic, significantly overexpressed in the prostate cancer (6). It is reasonable to assume that an amplicon at 20q13.2 is likely to harbour one or more putative oncogenes relevant to _________________________________________ gastric carcinogenesis, for which ZNF217 is one of the candidates (11). Correspondence to: Dr Mei Zhong, Department of Obstetrics and The frequency of ZNF217 amplification is high in colon Gynecology, Nanfang Hospital, Southern Medical University, cancer and the extent of its amplification varies markedly Guangzhou 510515, Guangdong Province, P.R. China between tumors (12). Furthermore, poorer survival in patients E-mail: [email protected] is associated with either gain or loss of ZNF217. Huang et al Dr Yanqing Ding, Department of Pathology, Southern Medical (13) also reported that ZNF217 can immortalize HMEC. University, Guangzhou 510515, Guangdong Province, P.R. China Additionally, it may play a role in both early- and late-stage E-mail: [email protected] breast cancers. In gastric cancer (14), ZNF217 may be associated with specific tumor types or subtypes (8). Abbreviations: ZNF217, Zinc-finger protein 217; RNAi, RNA It is suggested that ZNF217, as an ovarian oncogene, is interference detrimental to senescing normal ovarian surface epithelial cells but contributes to neoplastic progression in ovarian sur- Key words: Zinc-finger protein 217, oncogene, RNAi, ovarian face epithelial with inactivated p53/RB (15). Moreover, cancer, proliferation ZNF217 and its associated proteins in a novel pathway may have profound effects on cancer progression (16). 1065-1071 5/4/08 14:33 Page 1066 1066 SUN et al: ZNF217 GENE IN OVARIAN CANCER CELL LINE Table I. Oligonucleotide sequences of ZNF217 specific and in the test groups (ZNF2171 and ZNF2172) respectively. negative control siRNA. In the above three groups, the cells were all transfected with ––––––––––––––––––––––––––––––––––––––––––––––––– the mixture of plasmid and Lipofectamine™ 2000 (1:2) in Name Target sequence 100 μl serum-free medium. At 6-h post-transfection, 500 μl –––––––––––––––––––––––––––––––––––––––––––––––––––––– normal medium containing 10% FBS was added. At 48 h pGensil-1/ZNF2171 GGATGCCTTGTCAATGAAA after cultivation, the medium was replaced by normal medium pGensil-1/ZNF2172 AAATGTCATCCAAATCGAGGG containing 10% FBS and 1000 μg/ml G-418 up to selected pGensil-1/Neg GACTTCATAAGGCGCATGC for stable clones. There were viable cells and discrete G-418 ––––––––––––––––––––––––––––––––––––––––––––––––– resistance colonies, after 14 days of exposure to G-418. Real-time reverse transcription polymerase chain reaction (PCR) analysis for ZNF217. cDNA was synthesized by oligo The role of ZNF217 amplification in ovarian cancer is dT primed reverse transcription from 2 μg of total RNA using still unknown. We investigated the mechanism of ZNF217 in an access reverse transcription system (Promega, Madison, regulating ovarian cancer proliferation and invasion in this WI). Real-time PCR was performed using Mx3000P Real- study by using ZNF217 knockdown ovarian cancer cell line. Time PCR System (Stratagene, La Jolla, CA) and Brilliant Our results showed that silencing of ZNF217 resulted in the SYBR Green QPCR Master Mix kit (Stratagene), following effective inhibition of ovarian cancer cell growth and the the manufacturer's protocol. Briefly, the reaction mixture invasive ability. (total volume 25 μl) contained 500 ng of cDNA, the forward primer 5'-GAGAAGCGAATGGTGAAAGC-3', and the Materials and methods reverse primer 5'-CAGCGCTCAAGTATGCAAAA-3' to amplify human ZNF217 at a final concentration of 250 nM Cell line. The human ovarian cancer cell line ZNF217K and with 12.5 μl of 2x SYBR Green QPCR Master Mix kit. D/clone2 was established from metastatic ovarian cancer Thermal cycling conditions were as follows: 94˚C for 2 min cell line HO-8910 cells which were obtained from ascites of and 50 cycles at 94˚C for 30 sec, followed by 55˚C for 30 sec serous cystadenocarcinoma patients by transfection with and 72˚C for 30 sec. Experiments were performed in triplicate pGensil-1/ZNF217 plasmid. ZNF217KD/clone2 cells were in the same reaction. Human ß-actin gene was amplified cultured in RPMI-1640 medium (Gibco, Grand Island, NY) as internal control. Target genes and ß-actin gene were supplemented with 10% fetal bovine serum (FBS) at 37˚C amplified in the same reaction. Comparative quantification -ΔΔCt in a humidified atmosphere of 95% air and 5% CO2. is determined using the 2 method (17). Design of shRNA and plasmid preparation. Plasmid vector Western blot analysis. Cells were washed twice with cold pGenesil-1 was purchased from Wuhan Genesil Biotech- phosphate-buffered saline (PBS) and lysed on ice in RIPA nology Co., Ltd. Two different targeted sequences were buffer 1x PBS, 1% NP 40, 0.1% sodium dodecyl sulfate designed to be homologous to the ZNF217 mRNA consensus (SDS), 5 mM EDTA, 0.5% sodium deoxycholate, and 1 mM sequence (GeneBank NM_006526.2). A negative control sodium orthovanadate with protease inhibitors. Protein lysates sequence was also designed as the same process, which had were resolved on 6% SDS polyacrylamide gel, electrotrans- no homology with human beings or mice. The comple- ferred to polyvinylidene fluoride membranes (Immobilon P; mentary oligonucleotides encoded a hairpin structure with a Millipore, Bedford, MA), and blocked in 5% non-fat dry 21-mer stem and a 9-bp loop. The stem was derived from the milk in Tris-buffered saline, pH 7.5 (100 mM NaCl, 50 mM mRNA target site. The loop sequence separated the two Tris and 0.1% Tween-20). Membranes were immunoblotted complementary domains. All the sequences were transcribed overnight at 4˚C with anti-ZNF217 polyclonal antibody with DNA polymerase III U6 promoter in plasmid pGensil-1. (Abcam Biotechnology, USA), and anti-ß-actin antibody These two ZNF217 plasmids were named pGensil-1/ (Santa Cruz Biotechnology), followed by their respective ZNF2171 and pGensil-1/ZNF2172 respectively. The negative horseradish peroxidase-conjugated secondary antibodies. control plasmid was named pGenesil-1/Neg (Table I). The Signals were detected by enhanced chemiluminescence transformation of these plasmids into competent cells DH5α (Pierce, Rockford, IL). and extraction of plasmids followed the routine processes.