The Protein Interactions and Functions of Transient Receptor Potential Melastatin 7 (TRPM7) Ion Channel
by
Danny Chan
A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Cell and System Biology University of Toronto
© Copyright by Danny Chan (2009)
The Protein Interactions and Functions of Transient Receptor Potential Melastatin 7 (TRPM7) Ion Channel
An abstract of a thesis submitted in conformity with the
requirements for the degree of Master of Science
Graduate Department of Cell and System Biology
University of Toronto
Danny Chan 2009
Ion channels are proteins that facilitate ion diffusion across cell membrane.
Nevertheless, various groups of ion channels can act as surface receptors and play important roles in signal transduction. Transient Receptor Potential Melastatin 7
(TRPM7) ion channel has been implicated in diverse cellular functions including actomyosin cytoskeletal remodeling and anoxic neuronal death. However the mechanisms behind TRPM7’s physiological roles remain undetermined. TRPM7 possesses unusually long intracellular domains and a functional C-terminal alpha kinase domain that may contribute to regulation of channel activity and signal transduction. We therefore identified proteins that interact with TRPM7 C-terminus. Pull-down assays coupled with LC-MS/MS revealed that cytoskeletal proteins (actin and tubulin) and synaptic vesicle proteins (VAMP2 and SNAP25) associate with the TRPM7. In addition, we further found that TRPM7 does not directly bind microtubules or single dimeric tubulin subunits. Thus one or more microtubule binding proteins is involved in the association between TRPM7 and microtubules.
ii
Acknowledgements
I would firstly be grateful for the opportunity to study and learn in the University of Toronto Scarborough for the past few years. The learning experience has made me a well-rounded individual. I would like to extend my gratitude to my graduate supervisor,
Dr. Michelle Aarts. She has given me an excellent environment for learning and experimenting. Her guidance and expertise provided during the development of this thesis has assisted me to overcome many encountered research problems and difficulties.
I would also like to thank Dr. Rene Harrison and Dr. Joan Nash for serving on my committee and for providing resourceful advice and constructive criticism at committee meetings.
I am grateful to my lab members and colleagues for their friendship and advice.
Special thanks to Karen, Colin and Melanie for their helps in the lab, as well as their spiritual support. We had some good laughs and fun times, and we have encouraged each other along the way. I am also indebted to Dr. Ari Chow and Dr. Shelley Brunt for sharing their scientific knowledge and research experience and insight. Thank you to my friends in the old and the new science building, Paul, Rashida, Esther, Chris, Sherri,
Edward, Krissy and Patti for making my stay at UTSC a pleasant and memorable experience. Finally I would like to thank my family and Shirley for the love and en
iii Table of Contents
Sections: 1. Introduction Page 1.1 Transient Receptor Potential (TRP) Channels 1 1.1.1 Structural features of TRP Channels 7 1.1.2 Physiological Roles of TRP channels 10 1.2 The TRPM Channels 11 1.3 Characteristics and Domains of TRPM7 15 1.3.1 The N-terminus of TRPM7 18 1.3.2 The TRP Domain and Coiled-coil Domain of TRPM7 19 1.3.3 The Atypical Alpha-kinase Domain of TRPM7 20 1.4 The Potential Physiological Roles of TRPM7 25 1.4.1 TRPM7 and Mg2+ Homeostasis 25 1.4.2 The Critical Role of TRPM7 in Cell Survival/Death 27 1.4.3 TRPM7/ Cytoskeletal Protein Interactions: Diverse 29 Cytoskeletal Related Functions of TRPM7 1.5 Objectives and Goals of Thesis Project 32
2. Materials and Methods 2.1 Cloning 34 2.1.1 Conventional Cloning Methods 34 2.1.1.1 Restriction Digest 34 2.1.1.2 DNA Blunting 34 2.1.1.3 Dephosphorylation 36 2.1.1.4 DNA Ligation 36 2.1.1.5 Bacterial Transformation 36 2.1.1.6 Agarose Gel Electrophoresis 37 2.1.1.7 DNA Gel Extraction 37 2.1.1.8 Plasmid DNA Isolation 37 2.1.2 Polymerase Chain Reaction (PCR) Cloning 38
iv
2.2 GST Fusion Protein Induction and Purification 43 2.3 Pull-Down Assay 43 2.4 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) 44 2.5 Coomassie Gel Staining and Destaining 44 2.6 Western Blot 45 2.7 Brain Homogenization 45 2.8 In-gel Tryptic Digest 46 2.9 Co-Immunoprecipitation 47 2.10 Microtubule Binding Protein Assay 47 2.11 In vitro Interaction Assay 48
3. Results 3.1 Generation of GST Fusion Constructs 49 3.2 Pull-Down Assays and Identification of TRPM7 Interacting Proteins 57 3.2.1 Matrix-assisted Laser Desorption/Ionisation - Time of Flight 57 Mass Spectrometry (MALDI-TOP MS) Analysis 3.2.2 Liquid Chromatography Mass Spectrometry (LC-MS/MS) 62 3.3 Confirmation of TRPM7 Specific Interactions Using Co- 66 Immunoprecipitation 3.4 Examination of Tubulin Association with TRPM7 69 3.4.1 The Microtubule Binding Protein Assay 69 3.4.2 In vitro Protein Interaction Assay 70
4. Discussion 4.1 Identification of TRPM7 Associating Proteins 77 4.1.1 Limitation of LC-MS/MS Affects Detection of TRPM7 81 Associating Proteins 4.2 Potential Model of TRPM7 Functions in Cytoskeletal Remodeling and 83 Shear Stress Response 4.2.1 Future Studies of TRPM7 Shear Stress Response 8
v
4.3 Potential Model of TRPM7 Functions in Synaptic Vesicle Release 90 4.3.1 Future Studies of TRPM7 Associated Synaptic Vesicle 96 Release 5. Summary 98 6. References 100 Appendix 1 121 Appendix 2 124
vi List of Figures
Figure # Title Page Figure 1 TRP channels vs Voltage-gated Potassium (K+) channels 5 Figure 2 Structures of TRP Channels 9 Figure 3 Predicted and confirmed protein interaction domains and 17 consensus motifs of TRPM7 Figure 4 TRPM7 cDNA regions selected to generate TRPM7-GST 41 fusion proteins Figure 5 Restriction Digest of GST Fusion Constructs 52 Figure 6 Expression of GST-Fusion proteins in BL21 Escherichia coli 55 Figure 7 1-D SDS-PAGE gel analysis of Pull-Down samples 60 Figure 8 Co-Immunoprecipitation of TRPM7 68 Figure 9 Examination for Direction Interaction between TRPM7 and 72 - 73 Microtubule using Microtubule Binding Protein Assay
Figure 10 Examination of Direction Interaction between TRPM7 and 75 - 76 Microtubule using in vitro Protein Interaction Assay
Figure 11 Proposed Model of TRPM7 Function in Endothelial Shear 87 - 88 Stress Response
Figure 12 Proposed Model of TRPM7 Function in Synaptic Vesicle 91 Release
vii List of Tables
Table # Title Page
Table 1 TRP Channel Subfamilies and Their Related Diseases 6
Table 2 Generation of Fusion Constructs Using Conventional Cloning 35
Table 3 Generation of Fusion Construct Using Polymerase Chain 42 Reaction Cloning
Table 4 Restriction Digest of GST Fusion Constructs 53
Table 5 Predicted Molecular Weights of TRPM7- GST Fusion Proteins 56
Table 6 TRPM7 Interacting Proteins Identified by MALDI-TOF MS 61
Table 7 LCMS/MS Analysis on TRPM7 Associating Proteins in Pull- 64 - 65 Down Assay
viii Thesis
1. Introduction
1.1 Transient Receptor Potential (TRP) Channels
Ion channels are multimeric membrane protein complexes that facilitate diffusion
of ions across the cell membrane. The basic function of ion channels is important for
many cellular processes such as maintenance of membrane potential and the propagation
of action potentials. Nevertheless, ion channels are more than simply pore proteins on
the surface of cells; various groups of ion channels act as cell surface receptors and play
important physiological roles in cellular signal transduction. Activation of these channels
allows further amplification of the initial signal. Transient Receptor Potential (TRP)
channels are a superfamily of ion channels that carry out diverse physiological functions;
they act as important receptors and signal transducers in multi-cellular organisms
including fruit flies, zebrafish, mice and humans (Venkatachalam and Montell, 2007). In
terms of structure (Figure 1) TRP family channels possess a six transmembrane domain
pore region and intracellular N- and C-terminal tails giving them a predicted topology similar to voltage gated potassium (K+) channels (Clapham et al., 2001; Yellen, 2002).
However unlike voltage gated channels the majority of TRP channels are constitutively
active, non-selective cation channels that display little sensitivity to membrane potential.
TRP channels are however regulated by changes in the extra and intracellular
environment and more recent evidence indicates they may be regulated by protein
binding on intracellular domains (Clark et al., 2006).
TRP channels were first discovered in Drosophila, functioning as light sensing
proteins that are required for phospholipase C (PLC)-dependent light response in the
1 photoreceptor cells of Drosophila eyes (Montell and Rubin, 1989). The mammalian TRP
superfamily, now containing 28 identified members, is broadly divided into group 1 and
2 and further separated into six subfamilies. Group 1 TRP channels are segregated from
Group 2 TRPs based on sequence and topological differences. The four subfamilies of
Group 1 TRPs: TRPC, TRPV, TRPM and TRPA possess great sequence homology to the first identified member, Drosophila TRP, whereas the two subfamilies that comprise
group 2 TRP channels, TRPP and TRPML share little sequence homology with TRP
(Montell and Rubin, 1989). Unlike most ion channels, TRP channels are identified by their protein sequence homology rather than by selectivity or function. The first identified mammalian TRP, Transient Receptor Potential Canonical 1 (TRPC1) (Wes et al., 1995), together with all mammalian TRPC proteins appear to be analogous to the Drosophila
TRPs (Clapham, 2003). Over the years, more TRP members have been identified. The identity of Transient Receptor Potential Vanilloid subfamily (TRPV1) was revealed by using expression cloning to isolate a functional cDNA encoding a vanilloid receptor that is activated by capsaicin (Caterina et al., 1997; Jordt and Julius, 2002), and the Transient
Receptor Potential Melastatin (TRPM) subfamily proteins bear homology to Melastatin
(TRPM1) which was first identified as a prognostic marker for metastasis of melanoma
(Duncan et al., 1998; Ramsey et al., 2006). The first TRPA (Ankyrin) protein, human
TRPA1, was identified as a gene product containing sequential ankyrin repeats that was down-regulated following oncogenic transformation of fibroblasts (Jaquemar et al.,
1999). As the name implies, Transient Receptor Potential Polycystin (TRPP) channels, which belong to Group 2 TRPs, were named after the disease Polycystic Kidney Disease
2, and its first member (TRPP1, previously known as PKD2) was discovered as a mutated
2 protein causing Polycystic Kidney Disease 2 (Mochizuki et al., 1996). TRPML1, the
founding member of the Transient Receptor Potential Mucolipin subfamily, was
identified as a protein in which its mutated version is responsible for the lysosomal
storage disorder mucolipidosis IV. Such disease is characterized as a severe
neurodegeneration disease.
Due to their diverse physiological roles TRP channels have become targets of intensive research, especially the TRPC channels which were originally thought to
mediate "store operated calcium entry", and TRPV channels which are readily activated
and now appear to be the main mediators of temperature and perception by sensory
neurons. The mammalian TRP channels are non-selectively permeable to cations such as
Ca2+ and Na+ and are generally thought to be important sensory receptors and transducers
that respond to changes in the intracellular state as well as extracellular stimuli including
light, temperature, pH, alcohol, pressure and mechanical stresses (Venkatachalam and
Montell, 2007). In addition, many of the TRP channels have been implicated as disease
associated proteins. Genetic mutations in some TRP members can lead to consequences beyond the cellular level, affecting the whole organism (Table 1). Of particular interest
are two members of the TRPM subfamily, TRPM2 and TRPM7, which are implicated in
governing cell death following anoxic injury (Aarts and Tymianski, 2005a; Aarts and
Tymianski, 2005b; Fonfria et al., 2004; Fonfria et al., 2005; Hara et al., 2002)}. However,
the mechanism of cell death regulation is not well understood and further investigation is required in order to reveal how these channels contribute to cell viability.
3
Figure 1. TRP channels vs Voltage-gated Potassium (K+) channels
TRP channels and voltage-gated potassium channels have similar pore forming structure
(between transmembrane segment 5 and segment 6) and both possess long intracellular domains.
4
5
Table 1. TRP Channel Subfamilies and Their Related Diseases. The 6 subfamilies of TRP channels, with the exception of TRPAs, are found to be disease associated due to genetic variations. TRP channel Associated Diseases subfamilies TRPC (canonical) TRPC6 - Focal segmental glomerulosclerosis (Reiser et al., 2005) TRPV (vanilloid) TRPV5- Renal Ca2+ disorder (Gkika et al., 2006; Renkema et al., 2005) TRPA (ankyrin) ------TRPM (melastatin) TRPM6- Hypomagnesemia with secondary hypocalcemia (Schlingmann et al., 2002; Walder et al., 2002) TRPP (polycystin) TRPP2- Polycystic kidney disease (Kimberling et al., 1988; Peters and Sandkuijl, 1992; Wu and Somlo, 2000) TRPML (mucolipin) TRPML1- Mucolipidosis type IV (Zeevi et al., 2007; Zeevi et al., 2009)
6 1.1.1 Structural features of TRP Channels
All TRP members contain six transmembrane segments with the pore loop positioned between the fifth and sixth transmembrane domains which together form the cation permeable pore (Figure 2) (Schindl and Romanin, 2007; Venkatachalam and
Montell, 2007). Other than the pore forming region, TRP family channels also possess intracellular N- and C-terminal tails giving them a structure similar to voltage gated potassium (K+) channels (Clapham et al., 2001; Yellen, 2002). Group 2 TRP proteins are differentiated by an extra segment that forms a large extracellular loop separating the first and second transmembrane segments. Group 1 TRP channels, with the exception of the
TRPM subfamily, have multiple intracellular, N-terminal ankyrin repeats (Gaudet, 2008).
These repeats are protein-protein interaction motifs that can be found in a large variety of proteins involved in transcription, cell-cycle regulation and ion transport (Mosavi et al.,
2004). In addition, TRPCs, TRPMs and the non-mammalian TRPN members contain a
C-terminal TRP domain situated on the intracellular tail in close proximity to the sixth transmembrane domain but lacks a known function. The most conserved portions of the
TRP domain are the two “TRP boxes” flanking the border of the TRP region
(Venkatachalam and Montell, 2007). “TRP box 1” presents no sequence variation in
TRPC channels but slight differences in TRPM and TRPN channels. “TRP box 2” is a proline-rich region that has higher sequence variation relative to “TRP box 1” among all three subfamilies.
7
Figure 2. Structures of TRP Channels
TRP Channels are divided into 2 groups based on sequence homology.
(Left) Subfamilies of Group 1 TRPs: TRPC (canonical), TRPV (vanilloid), TRPA
(ankyrin) and TRPM (melastatin).
(Right) Subfamilies of Group 2 TRPs: TRPP (polycystin) and TRPML (mucolipin).
The following domains are indicated: ankyrin repeats (A); coiled-coil domain (CC); protein kinase domain (K); TRP domain (TRP). Pore loop (P), allowing influx of cations
(+++), between the 5th and the 6th transmembrane segments are also shown in this figure.
8
9 1.1.2 Physiological Roles of TRP channels
The channels within the TRP superfamily have diverse functions in vertebrates.
Some TRPC members are found to be important for modulating neurite extension
(TRPC5) and both vasoconstriction and vasodilation (TRRC3, C4 and C6) (Clapham et
al., 2001; Clapham, 2003). Interestingly, all mammalian TRPC proteins are activated by
Phospholipase C (PLC) (Montell, 2005b), and several members of TRPC may be Ca2+ store-operated (Wes et al., 1995); they can be activated by depletion of Ca2+ from internal
stores.
One of the most important documented physiological roles of TRP channels is in
mediating sensation. TRP channels respond to a large range of external sensory
modalities such as hearing, taste, olfaction, vision, thermal and mechanotransduction
(Clapham, 2003; Venkatachalam and Montell, 2007). Several mammalian TRP channels
are thought to be crucial for chemosensation including TRPM5 and TRPV1. TRPM5 is
required for the taste modality and the responses to sweet and bitter are greatly reduced in
TRPM5 knockout mice (Montell, 2005b; Nelson et al., 2001; Talavera et al., 2005a);
whereas TRPV1 is activated by capsaicin, the inflammatory vanilloid compound that
gives spicy foods their hot sensation (Caterina et al., 1997). Furthermore, TRPV1
responds to many other chemicals, such as piperine (McNamara et al., 2005) from black
pepper and allicin from garlic (MacPherson et al., 2005).
Mammalian thermal sensation to a large range of temperatures can be attributed to
multiple TRP channels that are activated by temperature changes. Some TRP members,
including TRPV1 and TRPV2, respond to uncomfortable heat levels (> 43oC) (Caterina
et al., 1997) and very hot (> 52oC) (Caterina et al., 1999), respectively, while other TRP
10 channels such as TRPV3 (30 – 39oC) (Watanabe et al., 2002) and TRPV4 (25 – 34oC)
(Smith et al., 2002; Xu et al., 2002) account for the perception of moderate temperatures.
TRPM8 (23 – 28oC) and TRPA1 (< 18oC) are activated in the cool temperature range and
in addition are activated by coolness evoking compounds, such as menthol and icilin
(Clapham, 2003; McKemy et al., 2002; Peier et al., 2002). Some members of the TRP
superfamily also display activation by mechanotransduction and TRPM3 and TRPV4 can
act as osmosensors. TRPM3 currents are enhanced by hypotonic extracellular solutions
and cell swelling (Grimm et al., 2003), whereas TRPV4 is activated in vitro by
hypotonicity and TRPV4 knock-out mice exhibit defects in osmotic regulation (Liedtke
et al., 2000; Liedtke et al., 2003). TRPP1/TRPP2 heteromeric channels have been shown
to function as a mechanosensor in the cilia of renal epithelial cells (Woudenberg-Vrenken
et al., 2009).
1.2 The TRPM Channels
The functionally diverse subfamily of TRPM channels is comprised of eight
members and subdivided into 3 different groups based on sequence homology: TRPM1/3,
TRPM4/5, and TRPM6/7. TRPM2 and TRPM8 are not placed in any subset due to low
sequence similarities (Clapham, 2003; Fleig and Penner, 2004; Venkatachalam and
Montell, 2007). TRPM2, TRPM6 and TRPM7 channels have a very unusual architecture
and are termed chanzymes due to the fact that they are channels that possess functional
enzymatic domains on their C - terminal ends. As mentioned in Section 1.1, the TRPM
subfamily proteins was first identified as a prognostic marker for metastasis of melanoma
(Duncan et al., 1998; Ramsey et al., 2006). Instead of the N-terminal ankyrin repeats that
11 other group 1 TRP members carry, the TRPM proteins contain a highly conserved coiled-
coil (CC) region in the C-terminus, following the sixth transmembrane segment. Coiled-
coil domains are protein interaction domains that allow multimerization of up to four
individual proteins with similar CCs. The TRPM CC is thought to act as a general self-
assembly domain for TRPM channels. Tsuruda et al. has demonstrated with gel filtration
experiments that the isolated, recombinant coiled-coils from several TRPM subunits
(TRPM2 – 3 and TRPM6 – 8) are capable of self-assembly (Tsuruda et al., 2006).
Although TRPM1 is the first identified member of TRPM subfamily, it is still
enigmatic; its function or channel activity have not been well studied. In addition to the full length protein channel (TRPM1-L), TRPM1 has a splice variant (TRPM1-S) which interacts with the functional TRPM1-L and prevent its translocation to the plasma membrane therefore down-regulating the activity of TRPM1 (Xu et al., 2001). Studies in
TRPM3 have demonstrated that its channel activity is up-modulated in response to hypotonic extracellular solution and cell swelling. Alternatively, TRPM3 can be activated by store depletion (Lee et al., 2003) or sphingolipids (Grimm et al., 2005). Alternative splicing can be a way to change the properties of channels such as conductance and ion permeability. TRPM3α1 and TRPMα2 are splice variants with altered ionic selectivity due to changes in the pore region (Oberwinkler et al., 2005). TRPM3α1 channels are monovalent cation selective, whereas TRPM3α2 channels are well permeated by Ca2+ and Mg2+ but inhibited by extracellular monovalent cations. Other TRPM3 isoforms have
also been reported but their functions are unclear (Lee et al., 2003).
TRPM4 and TRPM5 appear to be unique among all TRP channels due to their
monovalent-cation selectivity and voltage-modulated properties (Hofmann et al., 2003;
12 Launay et al., 2002; Liu and Liman, 2003; Nilius et al., 2003; Prawitt et al., 2003; Ullrich
et al., 2005). Both of these channels exhibit prominent voltage-dependent inactivation at
negative membrane potentials (Barr et al., 2001; Clapham, 2003). Similar to many other
TRP channels, both TRPM4 and TRPM5 channel activities are enhanced by
2+ phosphatidylinositol-4,5-bisphosphate (PIP2) and Ca (Liu and Liman, 2003; Nilius et
al., 2006; Zhang et al., 2005).The TRPM5 channel also has dual functions in sensation as
it is responsible for sensing temperature in the range of 15-35oC (Talavera et al., 2005b)
and involved in sweet taste transduction (Talavera et al., 2008). The presence of quinine
inhibits TRPM5 current resulting in the suppression of sweet taste and evoking bitterness.
TRPM8 is a thermally regulated channel that is activated by cool temperatures
and coolness evoking compounds such as menthol (McKemy et al., 2002; Peier et al.,
2002). TRPM8 activity is also regulated by PIP2, as depletion of PIP2 reduces activity enhanced by menthol or thermal cool (Liu and Qin, 2005).
TRPM2 forms a non-selective cation channel permeable to Ca2+ that is activated
by intracellular Ca2+ and adenosine diphosphophate ribose (ADPR). TRPM2 possesses a
C-terminal ADP pyrophosphatase domain (homologous to NUDT9 ADP-ribose
hydrolyase domain) that is critical to the activation of TRPM2 (Perraud et al., 2001; Sano
et al., 2001; Wehage et al., 2002). However it is the binding of ADPR to the TRPM2
ADP-ribosylase rather than the enzymatic activity, which is unconfirmed, that regulates
TRPM2 conductance (Perraud et al., 2001; Sano et al., 2001; Wehage et al., 2002).
Second messengers including nicotinamide adenine dinucleotide (NAD) (Sano et al.,
2001), cyclic adenosine diphosphoribose (cADPR) (Kolisek et al., 2005) and arachidonic
acid (Hara et al., 2002) also display positive modulation of TRPM2 function.
13 Furthermore, the TRPM2 channel can be activated by oxidative and nitrosative stresses
such as hydrogen peroxide (H2O2) (Hara et al., 2002).
TRPM6 and TRPM7 are unique channels that possess both ion channel and
protein kinase activities (Schlingmann et al., 2002). The C-terminal kinase domain bears
little sequence homology to conventional protein kinases (e.g., PKA) but is instead homologous to the atypical alpha-kinase family including myosin heavy chain kinase A
(MHCK A) from Dictyostelium (Cote et al., 1997; Futey et al., 1995) and mammalian elongation factor 2 kinase (eEF2 kinase). Alpha kinases are structurally homologous to other catalytically active protein kinases except for the inclusion of a zinc-finger domain
(Liu and Qin, 2005; Ryazanova et al., 2004; Yamaguchi et al., 2001). Both TRPM6 and
TRPM7 channels are permeable to divalent cations which include Mg2+ and Ca2+. In addition, they share important biophysical features with endogenous magnesium inhibited currents (MIC) to provide an effective mode of feedback regulation to maintain intracellular Mg2+ level (Liu and Qin, 2005; Nadler et al., 2001; Schlingmann et al.,
2007; Schmitz et al., 2003; Voets et al., 2004; Yamaguchi et al., 2001).
With the exception of TRPM7 several alternate isoforms arisen by RNA splicing have been identified for each of the TRPM family proteins (Murakami et al., 2003;
Oancea et al., 2009; Uemura et al., 2005). Changes in coding sequences due to alternative
splicing can have profound consequences on the regulation and activity of channels.
Several TRPM channel isoforms with N-terminal splicing display dominant negative
effect (TRPM2/4) (Murakami et al., 2003; Zhang et al., 2003) or become either non- functional (TRPM6) (Chubanov et al., 2004) or constitutively active (TRPM3) (Lee et al.,
2003). The change of channel functions is possibly caused by removal of a potential
14 regulatory region which determines subunit interaction and channel formation (Vazquez
and Valverde, 2006).
1.3 Characteristics and Domains of TRPM7
TRPM7 is a non-selective cation channel, which is permeable to mono- and
divalent cations, specifically to Mg2+ and Ca2+, as well as trace metals such as Zn2+, Mn2+
and Ni2+ (Monteilh-Zoller et al., 2003; Nadler et al., 2001; Penner and Fleig, 2007).
TRPM7 is ubiquitously expressed but with highest mRNA levels detected in heart, kidney and brain tissues (Montell, 2005a; Nadler et al., 2001; Runnels et al., 2001;
Takezawa et al., 2004). To date, the detailed physiological mechanism for TRPM7
2+ activation is unclear, however TRPM7 appears to be sensitive to changes in [Mg ]i and
2+ [Ca ]e (Nadler et al., 2001) and may be activated by metabolic stress as hydrogen
peroxide (H2O2) has been shown to markedly enhance inward TRPM7 current (Aarts et
al., 2003). In addition, TRPM7 is reportedly regulated by Src-family kinases (Jiang et al.,
2003), and PIP2 levels have been shown by several groups to be important for TRPM7
channel activation. It remains controversial whether the receptor-mediated activation of
PLC, leading to the hydrolysis of PIP2, results in activation or deactivation of the TRPM7
channel (Langeslag et al., 2007; Runnels et al., 2002). Other research has also shown that
TRPM7 currents are activated following a decrease in extracellular pH from
physiological pH (7.4) to pH 4.0 (Jiang et al., 2005; Venkatachalam and Montell, 2007).
15
Figure 3. Predicted and confirmed protein interaction domains and consensus motifs of TRPM7
TRPM7 contains a N-terminal that is highly conserved among all TRPM subfamily members. The snapin binding sequence (87-326) is also located within this region. The transmembrane domain (TM) of TRPM7 forms the ion channel. The α-kinase domain, coiled-coil region and TRP box are located in the C-terminal domain of TRPM7. In addition, the C-terminal autophospholyation region (P) that may be important for substrate binding is also shown.
16
17 1.3.1 The N-terminus of TRPM7
TRPM7 possesses long intracellular domains as do other members of the TRP
superfamily (Figure 1), however the role of these intracellular domains in channel
function and physiology is poorly defined. Work to date shows that the truncation of the
TRPM N-terminal sequence (Murakami et al., 2003) or the expression of the N-terminus
alone (Zhang et al., 2003) can produce a dominant negative effect that inhibits the
activities of full-length, functional TRPM channels, indicating the presence of regulatory
sites in this highly conserved N-terminal region. A recently published paper used
confocal microscopy and immunprecipitation to demonstrate that TRPM7 resides on the synaptic vesicle member of sympathetic neurons and forms molecular complexes with synaptic vesicle proteins including synapsin I, synaptotagmin I and Snapin, a synaptic
vesicle protein whose role is important for vesicle docking. More importantly, using an in vitro binding assay, recombinant snapin (AA. 43-68) was found to directly interact with a region on the recombinant TRPM7 N-terminus (AA 87- 327) (Figure 3). Further studies using TRPM7 knockdown by siRNA and expression of a TRPM7 pore mutant revealed the interaction between TRPM7 and Snapin, as well as the channel activity, are critical for vesicle fusion events and neurotransmitter (acetylcholine secreting synaptic vesicles) release in sympathetic neurons (Brauchi et al., 2008; Krapivinsky et al., 2006).
18 1.3.2 The TRP Domain and Coiled-coil Domain of TRPM7
TRPM channels have diverse C-terminal domains but share a common C-terminal
cytoplasmic TRP domain and a coiled-coil domain (Figure 3). As mentioned previously in Section 1.1.1, two TRP boxes located within the TRP domain possess great sequence homology among the members of TRPC, TRPM, and TRPN subfamilies (Venkatachalam and Montell, 2007). The coiled-coil domain is a widespread protein-protein interaction structural motif that is found in a variety of protein classes including motor proteins,
fibrous proteins and membrane fusion proteins (Fujiwara and Minor, Jr., 2008; Lupas and
Gruber, 2005; Woolfson, 2005). Using gel filtration, Tsuruda et al. demonstrated that
recombinant proteins containing the putative coiled-coils from TRPM channels are
capable to self-assemble into multimers. Furthermore, a TRPM8 coiled-coil deletion
mutant was shown to be unresponsive to TRPM8 stimuli, indicating that TRPM8 coiled- coil is required for the proper channel formation and to carry out its function for thermal
sensation and response to chemical stimuli such as menthol (Tsuruda et al., 2006).
Similarly, another research using site mutagenesis by Erler et al. demonstrated that a
single site mutation in the TRPM8 coiled-coil region can disrupt multimeric channel
assembly which leads to non-functional channels, confirming that coiled-coil domain
interactions are required for proper channel maturation (Erler et al., 2006). A recent study
using X-ray crystallography also demonstrated that recombinant TRPM7 coiled-coils
self-assemble into a four-stranded antiparallel architecture, forming functional
homologous as well as heterologous interactions with TRPM6 subunits whose coiled-coil
domain possesses great sequence similarity to TRPM7’s (Fujiwara and Minor, Jr., 2008).
19 1.3.3 The Atypical Alpha-kinase Domain of TRPM7
A sub-group of the TRPM protein family has been designated as “chanzymes” due to the unique feature of being a functional ion channel with an integrated enzymatic domain at the C-terminus. TRPM6 and TRPM7 contain an atypical functional kinase known as the alpha-kinase. The first member of the alpha-kinase family reported was the myosin heavy chain kinase A (MHCK A) from Dictyostelium (Cote et al., 1997; Futey et al., 1995), whereas the elongation factor 2 kinase (eEF-2 kinase) was the first mammalian alpha-kinase identified (Ryazanov et al., 1997). Three additional mammalian alpha- kinases have now been reported: the lymphocyte alpha-kinase (Hs LAK), muscle alpha- kinase (Hs MAK) and heart alpha-kinase (Hs HAK) (Ryazanov et al., 1997; Ryazanova et al., 2004). Despite the lack of detectable sequence homology to conventional protein kinases (CPKs) such as Protein Kinase A (PKA) (Yamaguchi et al., 2001), the majority of the structure, sequence motifs, and the position of amino acids important for enzymatic activity appear to be very similar between CPKs and alpha-kinases (Drennan and
Ryazanov, 2004). One main structural difference between these two kinase families is that the C-terminal lobe of alpha-kinases includes a highly conserved zinc-finger that is not present in the structure of CPKs. The purpose of this zinc-finger domain remains unclear though it may play a secondary role unnecessary for kinase function that involves stabilization and positioning of substrates, similar to other zinc-fingers that bind nucleic acids, proteins or small ligands (Drennan and Ryazanov, 2004; Yamaguchi et al., 2001).
In addition to structural differences, the region of phosphorylation in substrate targets of the two kinase families shows dissimilarities. As the name implies, alpha-kinase tends to phosphorylate amino acids located within alpha-helices (Ryazanov et al., 1999) while
20 CPKs phosphorylate amino acids within loops, turns or irregular structures (Drennan and
Ryazanov, 2004; Pinna and Ruzzene, 1996).
Currently the functions and regulation of TRPM7 alpha-kinase domain are not well understood. According to one study the kinase activity is essential for channel function (Runnels et al., 2001). However, other groups of researchers including Schmitz et al. (2003) and Matsushita et al. (2005) have used mutation and deletion of C-terminal kinase domain to demonstrate that the TRPM7 channel is functionally independent of its alpha-kinase. Yet changes in kinase activity may alter the sensitivity of the channel to
Mg2+ inhibition (Matsushita et al., 2005; Schmitz et al., 2003). In a study using truncation
mutants and site mutations, Yamaguchi et al. showed that TRPM7 alpha-kinase dimer
formation plays a critical role in regulating enzyme activity. The TRPM7 alpha-kinase
assembles into a dimer through the exchange of an N-terminal segment near the kinase
domain that extends from residue 1551 to residue 1577 (Yamaguchi et al., 2001). This N-
terminal segment can be divided into 2 sections; an “activation sequence”, encompassing
resides 1553-1562, that is important for kinase activity and a “dimerization sequence”,
residing on amino acids 1563-1570, that is critical for both dimerization and channel
activity of TRPM7 (Crawley and Cote, 2009). A few proteins have been reported to bind
the TRPM7 kinase domain including phospholipase C (PLC), annexin I, myosin II heavy
chain A-C and tropomodulin (Clark et al., 2006; Dorovkov et al., 2008; Dorovkov and
Ryazanov, 2004; Nadler et al., 2001). These data may provide insight in TRPM7 kinase
functions and the mechanisms to regulate kinase activity.
Phospholipids C (PLC) is a well studied enzyme that is particularly important for
signal transduction. PLC cleaves phosphatidylinositol 4,5-bisphosphate (PIP2) to generate
21 diacyl glycerol (DAG) and inositol 1,4,5-triphosphate (IP3). Once released IP3 diffuses
through the cytosol to bind to IP3 receptors on the endoplasmic reticulum (ER) membrane
causing the release of Ca2+ from intracellular stores. In 2001 Runnel et al. first identified
TRPM7 with yeast two-hybrid screening by using the C2 domain of PLC as bait
(Runnels et al., 2001). Later research by the same group found that PLC was co-
immunoprecipitated from cell lysates containing both PLCβ and recombinant full-length
TRPM7 proteins, but not from cell lysates containing PLCβ and recombinant TRPM7
proteins lacking the kinase domain. Results from these two studies together confirm
association between TRPM7 alpha-kinase domain and the C2 domain of PLC (Runnels
et al., 2002). Runnels et al. also suggested that PLC is a potential regulator of TRPM7
through direct interaction with the alpha-kinase domain even with no further
experimental analysis and data to confirm or support this idea.
Recent research into TRPM7 alpha-kinase function has revealed that all three
non-muscle isoforms of the myosin II heavy chain (IIA, IIB and IIC) are target substrates
of TRPM7 kinase. Myosin II protein interacts with actin and form bipolar filaments
through electrostatic interactions of the myosin heavy chain (MHC) tail (Hostetter et al.,
2004). Interactions with actin and the formation of MHC filaments are important for actin stability (Clark et al., 2006). In vitro kinase assays were used to show that TRPM7 wild type C-terminal fusion protein but not the kinase dead version phosphorylates the helical portion of different MHCII proteins (Clark et al., 2006). In addition, binding and phosphorylation of MHCII by TRPM7 is Ca2+ and kinase dependent; the addition of
bradykinin, a PLC coupled receptor agonist, induces Ca2+ influx and activates TRPM7
alpha-kinase, promoting its interaction with myosin II heavy chain (Clark et al., 2006;
22 Clark et al., 2008b). More importantly TRPM7 kinase autophosphorlyation is critical for
its subsequent substrate-level phosphorylation. Kinase-dead mutants or deletion of the
autophosphorylation sites located upstream of the kinase domain (Figure 3) completely
abolished the phosporylation of myosin II heavy chain (Clark et al., 2008c; Clark et al.,
2008a). Furthermore it has been demonstrated by using an artificial substrate that TRPM7
kinase activity remains unchanged between the fully autophosphorylated and incomplete
autophosphorylated state. As an indication, the massive autophosphorylation of the
Ser/Thr- rich domain controls substrate phosphorylation of TRPM7 alpha-kinase not by
enhancing enzymatic activity but by securing the position of the substrate and providing
access to the enzymatic domain (Clark et al., 2008c). The evidence of myosin II heavy
chain as a substrate of TRPM7 kinase suggests a role in the regulation of the actomyosin
cytoskeleton similar to the myosin II heavy chain kinase (MHCK A) present in the
Dictyostelium. Phosphorylation of the myosin II heavy chain results in disassembly of
myosin II bipolar filaments and potentially inhibits myosin II-dependent contractile
events or allows cytoskeleton remodeling (Cote and Bukiejko, 1987; Luck-Vielmetter et al., 1990; Steimle et al., 2001). Similar examination of TRPM7 kinase substrates has uncovered TRPM7 phosphorylation sites in the N-terminal functional domain of tropomodulin. Tropomodulin is an actin binding protein that also interacts with tropomyosin. The actin-capping ability of tropomodulin allows it to cap the pointed end
(for disassembly) of actin filament to prevent disassembly of beta-actin subunits.
Association with tropomyosin and actin promotes inhibition of actin depolymerization, which stabilizes the structure of actin cytoskeleton (Kostyukova et al., 2005; Kostyukova et al., 2007; Kostyukova and Hitchcock-Degregori, 2004). Further analysis in
23 tropomodulin phosphorylation revealed that mutations mimicking N-terminal phosphorylation of tropomodulin caused a loss of the capping ability of tropomodulin
with no effect on the ability of the N-terminal tropomodulin domains to bind
tropomyosin. Once again, this indicates a potential role in the regulation of the dynamics of actin filaments by TRPM7 alpha-kinase domain (Dorovkov et al., 2008).
TRPM7 is also implicated in regulating cytoskeletal dynamics by its association with annexin I. Using an in vitro kinase assay Dorovkov et al. found that annexin I is a substrate of TRPM7 alpha-kinase which is phosphorylated at a conserved serine residue
(Ser5), located within the N-terminal amphipathic-helix of annexin I (Dorovkov and
Ryazanov, 2004). Similar to myosin II, annexin I phosphorylation is stimulated by increased [Ca2+]. Considering both annexin I and TRPM7 have been implicated in
regulating cell proliferation (Gerke et al., 2005; Hanano et al., 2004) and cell death (Aarts
et al., 2003; Arur et al., 2003), it is highly possible that phosphorlyation of annexin I by
the TRPM7 kinase has a crucial role in cell survival/death regulation and signal
transduction (Dorovkov and Ryazanov, 2004).
24 1.4 The Potential Physiological Roles of TRPM7
The physiological role of TRPM7 is not fully understood. However it has been implicated in widespread functions including Mg2+ homeostasis, regulation of cell
survival and cell morphology.
1.4.1 TRPM7 and Mg2+ Homeostasis
Initially, the TRPM7 channel was identified in parallel by two separate research
groups; one found TRPM7 as a PLC interacting protein using yeast two-hybrid screening
and a bifunctional protein with kinase and ion channel activities (Runnels et al., 2001), while the other group was searching for the channel responsible for MIC (magnesium inhibited current) (Nadler et al., 2001). According to Nadler et al., the first electrophysiological analysis of TRPM7 over-expression in HEK-293 cells showed large currents regulated by millimolar levels of intracellular Mg-ATP and with the permeation properties of a divalent cation influx pathway (Nadler et al., 2001). TRPM7 and its closely related homologue TRPM6 have since been characterized as ion channels essential for cellular magnesium transport and homeostasis. Both channels are divalent
cation permeable, preferably to Mg2+ and Ca2+ (Venkatachalam and Montell, 2007).
TRPM7 is characterized as Mg2+ and Ca2+ selective and like many non-selective cation
channels may flux a variety of mono and divalent cations. TRPM7 and TRPM6 are
unique in that they have a relatively higher conductance for Mg2+ than Ca2+ (Monteilh-
Zoller et al., 2003; Penner and Fleig, 2007). Original publications described TRPM7 as an outwardly rectifying channel with a conductance of 40 – 108pS (Nadler et al., 2001).
However TRPM7 channel function varies significantly depending on cell type (Chubanov et al., 2004; Monteilh-Zoller et al., 2003). TRPM7 is considered to be a significant
25 regulator of Mg2+ in that RNA interference or deletion of TRPM7 results in a significant
2+ decrease in intracellular magnesium concentrations ([Mg ]i), growth arrest (smooth
muscle cells) and eventually cell death in rapidly dividing cell types such as DT-40 B
lymphocytes and gastric cancer cells (Hanano et al., 2004; Nadler et al., 2001).
Moreover, supplementation of extracellular Mg2+ was able to restore proliferation and
rescue TRPM7-deficient cells (Montell, 2003; Schmitz et al., 2003). Inhibition of
2+ TRPM7 channel activity or cation conductance can be achieved by increasing [Mg ]i and intracellular Mg-ATP. Similarly reduction of the intracellular levels of these regulators leads to activation of TRPM7-like currents with outward rectification due to divalent influx at physiologically negative voltages and monovalent outward fluxes at positive voltages (Penner and Fleig, 2007). A recent study focusing in TRPM7 expression revealed a potential mechanism to regulate TRPM7 expression. Osteoblasts pre-exposed to conditions of reduced extracellular Mg2+ and Ca2+ levels showed a significant increase
in TRPM7 channel expression, whereas the expression of TRPM6 remained stable, suggesting compensatory mechanisms afforded by TRPM7 in order to maintain intracellular ion homeostasis. In addition pre-incubation of cells in reduced extracellular
Mg2+ conditions led to up-regulation of TRPM7 channel activity, specifically to an
increase in Ca2+ and Mg2+ influx. Reduction of TRPM7 expression by siRNA prevented corresponded Ca2+ and Mg2+ influx and inhibited cell proliferation (Abed and Moreau,
2007). Beginning from the initial research of TRPM7, the physiological role of this channel in controlling cellular Mg2+ level has been extensively studied. Compiled
research shows that TRPM7 acts as Mg2+ sensor, maintains cellular [Mg2+], and its
26 channel activity and expression are modulated by intracellular and extracellular Mg2+ availability, suggesting and confirming the vital role of TRPM7 in Mg2+ homeostasis.
1.4.2 The Critical Role of TRPM7 in Cell Survival/Death
Aside from its role in Mg2+ homeostasis, TRPM7 has also been implicated to be a
critical player in cell growth, proliferation and anoxic cell death. As a regulator of cell
survival/death, TRPM7 was suggested to be a potential target for the pharmacological
treatment of gastric cancer (Kim et al., 2008). Research in human gastric cancer cells has shown that blockade of TRPM7 channels or suppression of TRPM7 expression by siRNA inhibited cancer cell growth and induced the death of these cancer cells.
TRPM7 may represent the only ion channel known that is essential for cell
viability (Penner and Fleig, 2007), however the underlying mechanism of cell
survival/death regulation by TRPM7 is unknown. Down-modulation of TRPM7 with
siRNA silencing in retinoblastoma cells resulted in decelerated cell proliferation and
arrest in cell progression (Hanano et al., 2004). Similar knock-out experiment with
hairpin RNA in primary human lung mast cells reduced TRPM7 non-selective cationic
current and induced cell death (Wykes et al., 2007). Surprisingly, the consequences of
both TRPM7 knock-out experiments could not be rescued by extracellular Mg2+ supplementation, implying such effects from TRPM7 depletion were not Mg2+ dependent. Another study showed that melanophores from TRPM7 – mutant zebra fish were deleted during animal development from necrotic but not apoptotic cell death. In addition, melanin synthesis facilitated the death of these cells, indicating that melanophores may require TRPM7 to detoxify and prevent accumulation of cytotoxic
27 intermediates of melanin synthesis (McNeill et al., 2007). TRPM7 may play a role in metabolite detoxification in other cell types as well and it has been predicted that failure of TRPM7 expression may cause accumulation of cytotoxic intermediates that lead to eventual cell death.
Recent research directed into ischemic neuronal injury has provided new insight into the physiological role of TRPM7, and yet, increased the complexity of the potential roles that TRPM7 plays in cell survival and cell death. An in vitro stroke model, initially established by Choi and colleagues, uses oxygen-glucose deprivation (OGD) treatment to mimic ischemic conditions (Choi et al., 1987; Choi et al., 1988; Goldberg et al., 1987).
Under OGD, primary murine cortical neurons treated with glutamate receptor (GluR) antagonists can survive up to 1 hour however the GluR antagonism becomes ineffective for prolonged OGD exposure (> 1.5 hours) (Aarts and Tymianski, 2005b; Choi et al.,
1987). This observation led to the identification of a neuronal Ca2+ accumulation and a
2+ detectable cation current, IOGD, with the properties of a Ca permeable and non-selective
3+ cation conductance. Surprisingly, inhibition of IOGD by Gd , a general calcium channel blocker, successfully prevented neuronal death under prolonged OGD exposure. IOGD was later confirmed to be mediated by TRPM7 and blocking IOGD or suppressing TRPM7 expression blocked TRPM7-like currents, anoxic Ca2+ uptake, reactive oxygen species
(ROS) production, and anoxic death of cortical neurons. TRPM7 suppression eliminated the need for glutamate receptor antagonists and permitted the survival of neurons destined to anoxic death (Aarts et al., 2003; Aarts and Tymianski, 2005b). This study demonstrated another key role of TRPM7 in regulating anoxic cell death but also led to
28 ambiguity as to whether TRPM7 channel function is required for cell viability or is
responsible for cell death in certain diseases or cell injuries.
1.4.3 TRPM7/ Cytoskeletal Protein Interactions: Diverse Cytoskeletal Related
Functions of TRPM7
Recent studies of TRPM7 function have shown that TRPM7 channel activity,
kinase function or both are important for shear-stress cellular response, cell morphology
regulation and vesicular transport. TRPM7 is expressed in vascular smooth muscle cells
and its cell surface expression has been shown to increase following fluid flow across the membrane. In particular shear force induced by fluid flow causes localized insertion of
TRPM7 into the plasma membrane. Furthermore, TRPM7 vesicular insertion and
TRPM7 currents are correlated to the amount of force generated by fluid flow indicating a potential role in physiological or pathological response to vessel wall injury (Oancea et al., 2006b).
As previously described in Section 1.3.3., the protein kinase domain of TRPM7 phosphorlyates two actin interacting proteins: myosin II and tropomoduolin (Clark et al.,
2006; Clark et al., 2008b; Dorovkov et al., 2008). Interaction with these cytoskeletal accessory proteins suggests TRPM7 kinase-dependent activity might alter the stability of actomyosin filament and influence cytoskeletal remodeling. Phosphorylation of myosin II leads to disassembly of the myosin bipolar filament (Clark et al., 2006; Dulyaninova et al., 2005; Oancea et al., 2006a), and tropomodulin in its phosphorylated state results in actin filament destabilization due to the loss of actin-capping ability of tropmodulin
(Dorovkov et al., 2008). Channel activity of TRPM7 is also thought to be important for
29 cell morphology. Studies in Flp-In T-Rex 293 cells and HEK-293 cells show that TRPM7
over-expression causes cell rounding associated with a loss of cell adhesion that depends
upon the cation activity of the TRPM7 channel (Nadler et al., 2001; Su et al., 2006). In
addition, down-modulation of TRPM7 with shRNA exhibits the opposite effect; cells
become more spread and adhesive. Contrarily, another group of researchers, Clark et al.
found that TRPM7 over-expressing neuroblastoma cells display enhanced spreading and
cell-matrix adhesion (Clark et al., 2006). In spite of the controversy, it has been proposed
that Ca2+ influx via the TRPM7 channel may be important for activation of the alpha-
2+ kinase and subsequent MHCII phosphorylation. Moreover, Ca may act directly at the
level of integrin activation, which leads to the remodeling of the actomyosin cytoskeleton
2+ to promote cell spreading (DeMali et al., 2003). Ca is an important second messenger in
actin remodeling including polymerization, severing of filaments and F-actin–membrane
interactions (Forscher, 1989; Sun et al., 1999).
Synaptic vesicles mediate the release of neurotransmitters into the synaptic cleft
in response to action potentials. The TRPM7 channel has recently been shown to play a
critical role in cholinergic synaptic vesicle priming and release of transmitter from
peripheral sympathetic neurons. Knockdown of TRPM7 protein using siRNA substantially decreased the frequency of the acetylcholine vesicle (ASVs) fusion events.
Similarly, expression of a dominant negative TRPM7 (dnTRPM7) pore mutant
dramatically decreased the frequency of the spontaneous fusion events (Brauchi et al.,
2008). Instead of regulating fusion activity, the kinase domain of TRPM7 was shown to
control the speed of vesicular transport. TRPM7 kinase-dead mutant expression increased
vesicle mobility (Brauchi et al., 2008). Multiple experiments have demonstrated that
30 synaptic vesicles and juxtamembrane secretory vesicles are mobile and that inhibition of
protein phosphorylation alters synaptic vesicle mobility (Gaffield et al., 2006;
Guatimosim et al., 2002; Li and Murthy, 2001; Takahashi et al., 2003). It is possible that
TRPM7 complexes with synaptic vesicle proteins and microtubule interacting proteins
while the alpha-kinase domain phosphorylates these proteins, which allows the control of the motility of vesicles along microtubules.
31 1.5 Objectives and Goals of Thesis Project
TRPM7 is a relatively new cation channel protein that potentially dictates cell
proliferation, survival and morphology and has become the subject of intense
investigation by a small number of diverse research groups. Its functions and the
underlying mechanisms behind its physiological roles are as yet not well understood.
Moreover, the machinery involved in TRPM7 activation and functions remain
undetermined. The TRPM7 channel is thought to function independently from its
intrinsic kinase however both the channel and kinase activities are required for certain
cellular functions such as synaptic vesicle release. Conflicting reports on many aspects of
TRPM7 function and physiology have made the regulatory mechanism of TRPM7 harder
to explain. In addition to the atypical alpha-kinase domain, TRPM7 possesses unusually
long intracellular tails, and so far, the N-terminus contains no recognized consensus
motif. Researches into other ion channels that also possess long intracellular domains
have shown that protein-channel domain interaction is important for regulation of
channel formation and functions, as well as downstream signal transduction. The voltage
gated potassium channel, Kv7, is structurally similar to TRPM7, and the long
intracellular C-terminal region of Kv7 is critical for channel tetramerization and
trafficking (Kanki et al., 2004; Maljevic et al., 2003; Schmitt et al., 2000; Schwake et al.,
2003). Moreover, calmodulin interaction with its C-terminal domain is also required for
proper channel assembly and function; calmodulin binding enhances Kv7 channel
activity (Wen and Levitan, 2002; Yus-Najera et al., 2002). N-methyl D-aspartate receptor
(NMDAR) is a specific type of ionotropic glutamate receptor. Its co-activation by glutamate and glycine triggers Ca2+ influx into the cells. The long intracellular C-terminal
32 domain of NR1 subunit of NMDAR provide competitive binding site for alpha-actinin
and calmodulin. Binding of calmodulin reduces channel opening time, whereas channel
closing time is decreased when alpha-actinin interacts with the C-terminus of NR1
subunit (Rycroft and Gibb, 2002; Rycroft and Gibb, 2004; Wyszynski et al., 1997). More
importantly, binding of calmodulin and alpha-actinin provide modulation of NMDAR
channel activity, indirectly regulate activation of second messager (Ca2+) signaling
pathways. Similarly, I hypothesize that the intracellular domains of TRPM7 serve as key
structural protein binding regions or TRPM7 regulatory sites so that protein interactions
may alter channel function and kinase activity, which is important for TRPM7 regulatory
functions in cell morphology and cell death. The main objective of this project is to
identify proteins that interact with the intracellular domains of TRPM7 and more
specifically the C-terminal domain.
TRPM7 protein interactions will be investigated by pull down with fusion
proteins containing discrete TRPM7 domains and motifs such as the alpha-kinase.
Purified TRPM7 fusion proteins will be incubated with mouse brain lysate, a tissue with
relatively high endogenous TRPM7 expression, and interacting proteins identified using
mass spectrophotometry. Identified interactions will be confirmed by co-
immunoprecipitation and direct binding assays. Interacting proteins will also be
compared to known interactions and physiological roles for TRPM7 as a mean to evaluate experimental validality and result consistency. Both confirmation of published
TRPM7 interactions in an endogenous system (mouse brain) and the identification of
novel interactions will be useful to aid postulating new models to explain the concealed
mechanisms for potential physiological roles of TRPM7.
33 2. Materials and Methods:
2.1 Cloning
2.1.1 Conventional Cloning Methods
Conventional Sub-Cloning usually involves techniques of restriction digest,
dephosphorylation, DNA blunting, DNA ligation, agarose gel electrophoresis, bacterial
transformation, plasmid isolation and DNA sequencing. Restriction enzyme sites chosen
on both mouse TRPM7 cDNA (Figure 4), FLAG-TRPM7 pcDNA4/TO template and GE
Health Care pGEX-5X® system plasmids (vector) are listed in Table 2.
2.1.1.1 Restriction Digest
Restriction digest was performed with commercial 10X buffers and restriction enzymes, each in 1/10 of final volume. Digests were incubated at the optimal temperature indicated for maximal enzymatic activity for a duration of one to sixteen hours.
2.1.1.2 DNA Blunting
DNA blunting was used to remove 3’ overhang or fill in 5’ overhangs on cDNA restriction fragments that were required for blunt-end ligation. The blunting enzyme, T4
DNA polymerase of Quick Blunting Kit (New England Biolabs) was used to completely fill in 5’ overhangs of linearized DNA by addition of dNTPs to complementary strand for all TRPM7 insertion fragments listed in Table 1. Reactions were carried out in 1X
Blunting Buffer (100mM Tris-HCl, 50mM NaCl, 10mM MgCl2, 0.025% Triton X-100
and 5mM dithiothreitol) for one hour at 37 oC. Blunting enzyme was heat-inactivated at
70oC for 10 minutes.
34
Table 2. Generation of Fusion Constructs Using Conventional Cloning Clone Name of Fusion Restriction Blunting of pGEX-5X-(#) Restriction # Construct Enzyme sites TRPM7 Insert Enzyme sites for TRPM7 Required for pGEX Bluescript (Y/N)? plasmid 1 α kinase EcoNI (5’) + Y 1 SmaI BsaBI (3’) 4 C-terminus-N BsrGI (5’) + Y 2 SmaI BsaBI (3’) 5 C-terminus-C BsrGI (5’) + Y (before NotI 2 SmaI / NotI NotI (3’) digestion) 6 Coiled-coil BbvCI (5’) + Y 3 SmaI AlwNI (3’) 7 Long coiled-coil BsrGI (5’) + Y (before SalI 2 SmaI / XhoI SalI (3’) digestion)
35 2.1.1.3 Dephosphorylation
Linearized pGEX-5X® vector was dephosphorylated to prevent re-circularization
and re-ligation of empty vectors. Dephosphorylation was carried out using 5g linearized vector, 1 L (10U) calf intestinal alkaline phosphatase (New England Biolabs) in 1X
NEBuffer 3 (100mM NaCl, 50mM Tris-HCl, 10mM MgCl2 and 1mM dithiothreitol) for 1
hour at 37 oC. The phosphatase was heat-inactivated at 70oC for 10 minutes.
2.1.1.4 DNA Ligation
The pGEX-5X plasmid system (GE Health Care) was used as vectors to carry
insert DNA. Phosphoryl-ester bonds were formed with the help of DNA ligase
(Fermentas Rapid DNA Ligation Kit) to attach insert DNA to the linearized plasmid
DNA vector in 1X Ligation buffer. Ligation was performed with approximately 1 vector:
5 inserts ratio to achieve optimal ligation efficiency.
2.1.1.5 Bacterial Transformation
Chemically competent bacterial cells, DH5-α Escherichia coli (sub-cloning efficiency), 10-beta E.coli (high efficiency), and BL21 (DE3)pLysSE. coli were used for purification of plasmids, ligation product transformation, and protein expression, respectively. In general, 2 – 5L (100-300ng) of DNA was mixed with 50L of thawed
chemically competent bacterial cells and incubated on ice for 30 minutes. Bacteria were
heat-shocked on 42oC water bath for 45 seconds and placed on ice for 2 minutes. Bacteria
were grown in 950ul of LB medium [1% peptone, 0.5% Yeast Extract, 0.5% NaCl] at
37oC shaker (~200rpm) for 1 to 1.5 hours, allowing the recovery of bacteria and
36 expression of antibiotic resistance proteins. Only the transformation with 10-beta
Escherichia coli required 10-fold dilution in the growing medium prior plating. Aliquots
of the bacteria were plated onto Agar plates [1% tryptone, 1% agar, 0.5% NaCl] containing 100g/ml ampicillin, and plates were incubated at 37 oC overnight.
2.1.1.6 Agarose Gel Electrophoresis
DNA was separated by size on 1% agarose gels containing 0.5µg/ml ethidium
bromide in 1X TAE (0.04M Tris – Acetate, 0.001M EDTA). DNA samples were mixed
with 1/5 volume of Fermentas 6X loading dye and run at 80V against a DNA laddar
(Fermentas, DNA Ladder Plus). DNA was visualized under UV light and sizes of DNA
fragments were estimated by comparison to molecular weight of DNA ladder standards.
2.1.1.7 DNA Gel Extraction
Following agarose gel electrophoresis (see section 2.1.1.6), DNA bands were
excised and purified from the agarose using the Qiagen- QIAquick Gel Extraction Kit
(Qiagen). Agarose gel was dissolved in solution provided by manufacture, at 50oC for 10
minutes to release DNA embedded in agarose gel. DNA was then captured with binding
columns and excess salt was removed with washing buffer. DNA was eluted off the
column.
2.1.1.8 Plasmid DNA Isolation
For small scale plasmid isolation (Mini-prep) bacterial cells were grown in 5mL
LB medium with appropriate antibiotics at 37oC, overnight in a shaking incubator.
37 Bacteria were pelleted from 3mL of cell suspension by centrifugation at 8000g for 5
minutes at room temperature. The bacterial pellet was then prepared according to
manufacturer’s instructions for plasmid isolation using the QIAprep® Mini-prep Kit
(Qiagen). Bacterial cells were first lyzed with SDS and NaOH containing solution and chromosomal DNA was precipitated with acetic acid, whereas plasmid DNA remains in solution and captured with DNA binding columns provided. Plasmid DNA was further
washed and eluted off the column.
2.1.2 Polymerase Chain Reaction (PCR) Cloning
PCR was used to amplify the desired TRPM7 insert DNA from the full-length
FLAG-TRPM7 pcDNA4/TO template DNA.
The forward primer: GAATTC4697CACAGAGTATTCCCTTCGTTCCTGT4719 and reverse primer: CTCGAGGGCCCTCTAGTTCTATAACATCAGACGAAend and
forward primer: GAATTC4427GCTGCTGGATATAGTGAATGTTGTAAGACT4456 and reverse primer: CTCGAGGGCCCTCTAGTTCTATAACATCAGACGend were used to
amplify the segments of interest for Clone 2 and Clone 3 (Table 3 and Figure 4),
respectively. PCR was performed using the Phusion High-Fidelity DNA Polymerase
(New England Biolabs) with final concentrations of 1X Phusion HF Buffer, 200µM dNTPs, 1uM primer mix, 2ng/ul Template and Phusion DNA Polymerase 0.02U/µl. An initial denaturation step occurred at 98oC for 1 minute, with subsequent denaturation
periods of 10 seconds at 98oC. PCR reactions were allowed to cycle with 68oC annealing
temperature for 15 seconds and elongation at 72oC for 25 seconds.
38 Following PCR, electrophoresis was used to confirm PCR product sizes.
Amplifed DNA segments were ligated to PCR II-Blunt-TOPO vector (Invitrogen) as
described in section 2.1.1.4 for 10 minutes. Ligation products were used to transform
DH5-α Escherichia coli cells as mentioned previously in section 2.1.1.5, and plated on
Agar/ Kanamycin (50g/mL) plates. Five colonies for each clone were selected and grown in 5mL LB/ Kanamycin (50g/ml) overnight at 37ºC. Plasmid DNA was isolated from bacterial cells (section 2.1.1.7), restriction digested with 10U each of EcoRI and
XhoI (section 2.1.1.1) and run on a 1% agarose gel to confirm the presence of the
TRPM7 insert. Insert DNA was excised, purified with Qiagen- QIAquick Gel Extraction
Kit (Qiagen) and ligated into the appropriate pGEX-5X vector according to Table 3,
which was linearized with EcoRI / XhoI and gel purified. Ligation products were
transformed into 10-beta Escherichia coli as described in 2.1.1.5. Six bacterial colonies
were chosen for screening; restriction digest analysis and DNA sequencing were used to
confirm construct identities.
39
Figure 4. cDNA regions selected to generate TRPM7-GST fusion proteins.
Recombinant DNA constructs encoding TRPM7-GST fusion proteins were generated by conventional cloning (Clone #1, 4-7) and PCR cloning (Clone #2-3) (refer to section
2.1.1 and 2.1.2 and Appendix 1 for details). The targeted regions for sub-cloning, including the α-kinase domain, the coiled-coil domain and the autophosphorylation region are all located on the C-terminus of TRPM7 cDNA.
40
41
Table 3 Generation of Fusion Construct Using Polymerase Chain Reaction Cloning Clone Name of Fusion Restriction Enzyme pGEX-5X-(#) Restriction Enzyme # Construct Sites Added sites for pGEX plasmid 2 α kinase- C Forward : EcoRI 1 EcoRI / XhoI Reverse: XhoI 3 Long α kinase- C Forward : EcoRI 2 EcoRI / XhoI Reverse: XhoI
42 2.2 Glutathione S- transferase (GST) Fusion Protein Induction and Purification
BL21(DE3)pLysS Escherichia coli containing GST-TRPM7 fusion constructs were grown in 2X YT medium [1.6% peptone, 1% Yeast Extract, 0.5% NaCl] with
100ug/ml ampicillin at 37oC overnight. An aliquot of BL21 cells for each construct was
transferred to 10X volume fresh 2X YT medium + 100ug/ml ampicillin and incubated at
o 37 C for approximately 2 hours until the O.D. 600 was 0.6 – 0.8. GST fusion protein
expression was induced with the addition of 2mM of IPTG for 1.5 hours. Bacteria were
washed and re-suspended in ice-cold glutathione S- transferase (GST) Lysis Buffer-
[50mM Tris, pH 7.5, 300mM NaCl, 1.5mM MgCl2, 0.2mM ethylenediaminetetraacetic
acid (EDTA), 0.5mM DTT, 1% Triton X-100 and protease inhibitors] (Clark et al.,
2006). Bacteria were lysed with ultra-sonication for 5 times of 10 second pulse. Insoluble
materials were removed by centrifugation at 11000xg and lysates were filtered through
0.45um syringe filters. The supernatant was transferred to a fresh tube and incubated with
Glutathione–Sepharose 4B beads (GE Health-care) for 2 hours at 4°C. The beads were
washed 3 times with GST lysis buffer. GST fusion proteins immobilized on Glutathione–
Sepharose beads were directly used for Pull-Down Assay.
2.3 Pull-Down Assay
GST fusion proteins, purified on Glutathione–Sepharose beads, were incubated
with mouse brain lysate (refer to Brain Homogenization, section 2.7) for 2 hours at 4oC
with constant vertical rotations. Beads were washed three timeswith 1X PBS [137mM
NaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.47mM KH2PO4]. Interacting proteins bound to
43 GST-TRPM7 fusion proteins were processed for mass spectrophotometry analysis by either MALDI-TOF or LC-MS/MS. Proteins processed for MALDI-TOF were removed from glutathione-sepharose beads by heating in 2X sample buffer [0.125M Tris, 2% SDS,
5% β-mercaptoethanol, 20% glycerol, 0/01% bromphenol blue] (Laemmli et al., 1970).
Proteins were separated by size using denaturing 1D SDS-PAGE and the gels were post- stained with Coomassie Brilliant Blue dye. TRPM7 interacting proteins, processed for
LC-MS/MS, were eluted from glutathione–Sepharose beads with Elution Buffer [50mM
Tris-HCl pH 8.0, 10mM reduced glutathione].
2.4 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
Protein samples denatured in sample buffer were loaded into well and separated in
4% acrylamide stacking gel and 10% acrylamide separating gel at 120V for 1.5 hours using the standard Laemmli buffer system (Laemmli et al., 1970).
2.5 Coomassie Gel Staining and Destaining
Following electrophoresis, polyacrylamide gels are stained with Coomassie
Brilliant Blue R250 [0.25% in 50% methanol, 10% acetic acid] for 1 hour and destained with Destaining Buffer (4 parts methanol: 1 part acetic acid: 5 parts water) overnight with constant agitation.
44 2.6 Western Blot
Following SDS-PAGE, proteins were transferred to nitrocellulose membranes in
1X transfer buffer [25mM Tris, 192mM glycine, 20% methanol] at 100V for 1 hour. To
visualize protein bands, nitrocellulose blots were stained with Ponceas S. Membranes
were blocked with blocking buffer - 5% non-fat + 1X TBST [150mM NaCl, 10mM Tris,
0.1% Tween-20] at room temperature for an hour. Blots were then probed with Anti-GST
HRP conjugated antibodies in 1:10,000 dilutions, in blocking buffer for 1 hour. Non- specific antibody binding was removed by a 15-min TBST wash and three 5-min TBST washes. HRP-labeled secondary antibody binding was detected using chemiluminescent substrate (Pierce) and exposure to film (Kodak).
2.7 Brain Homogenization
Each gram of stripped mouse brain (Pel-Freeze® Biologicals) was homogenized in
approximately 3mL of homogenization solution A [0.32M Sucrose, 1mM NaHCO3, 1mM
MgCl2, 0.5mM CaCl2] using a motor-driven (Jacobs Multi Craft & SDS Adaptor)
homogenizer with up and down strokes until no visible, intact brain tissue was observed
(approx 5 strokes per gram of brain). Brain homogenate was centrifuged at 1400xg at
4oC. The supernatant was transferred to a new tube and saved on ice. The pellet was
resuspended in a 10% volume for 10 min of homogenization solution A using 3
additional homogenization strokes, and centrifuged at 1400xg at 4oC for 10 min. The
second supernatant was pooled with previous supernatant and centrifuged at 710xg at 4oC
for 10 min. Supernatant was frozen in dry ice with methanol and stored in -80oC.
45 2.8 In-gel Tryptic Digest
Prior to MALDI-TOF Mass Spectrometry analysis, it is necessary to excise,
destain and extract protein bands from SDS-PAGE gel. Bands of interest were excised
from Coomassie stained gel by using a razor blade and destained with 100mM
(NH4)HCO3 in 50% Acetonitrile for 30 minutes. This step was repeated until colourless
gel pieces were achieved, followed by gel dehydration for 10 min with 100%
Acetonitrile. Gel pieces were dried with speed-vacuum.
Dried gel pieces were re-hydrated with 10mM Dithiothreitol in 25mM
(NH4)HCO3 at 56°C for 1 hour and residual liquid was removed. 50mM iodoacetamide
with 25 mM (NH4)HCO3 solution was added to gel for alkylation, at room temperature
for 45 minutes in the dark. Washing of gel was completed with 50mM (NH4)HCO3 for 10 minutes at room temperature. Gel pieces were rehydrated with 100% Acetonitrile at room temperature for 10 minutes. Alkylation and rehydration were repeated and gel was speed-
Vacuumed to complete dryness.
Rehydration solution, containing a final concentration of 12.5ng/µl trypsin and
50mM (NH4)HCO3 was added to merely cover gel pieces from section 2.8.1 and
incubated for 10 minutes at 4 °C. Rehydration solution was removed and gel pieces were
left overnight at 37°C in 50mM (NH4)HCO3 solution.
Supernatant was transferred to another tube after a spin of 14000rpm at 1 minute.
20mM (NH4)HCO3 was added and incubated for 10 minute at room temperature.
Supernatant was moved to the same tube mention previously. Formic acid extraction was
performed 3 times with 5% formic acid in 50% Acetonitrile for 20 minutes at room
46 temperature. Supernatant was subsequently transferred, pooled and dried with speed-
vacuum after formic acid extraction.
2.9 Co-Immunoprecipitation
Approximately 500l of brain homogenate (1.5g of proteins) was incubated
with 4g of rabbit anti-TRPM7 antibody (Millipore) or normal rabbit IgG (Cell Signaling
Technology®) for 2 hours at 4oC with constant vertical rotations. Incubation was repeated
after addition of Protein-A Sepharose beads (Sigma-Aldrich) to brain/antibody mixture.
Samples were centrifuged at 9000rpm for 1 minute to remove supernatant. Beads were
washed with 1X PBS + 0.5% Trition X-100 for 3 times, with subsequent spinning at
9000rpm to remove washing buffer. Protein-A beads were boiled in same volume of 2X
sample buffer at 70oC for 5 minutes.
2.10 Microtubule Binding Protein Assay
The commercial Microtubule Binding Protein Spin-down Assay Kit from
Cytoskeleton Inc. allows the identification of proteins that will bind to microtubules
(MTs) in vitro. This assay relies on the fact that MTs pellet at high speed centrifugation
(100,000xg). Any proteins that associate with MTs will be also pelleted along with the
MTs.
Purified GST-fusion proteins (see section 2.2) were subjected to this test.
Instructions in the Cytoskeleton Inc. manual of this assay were followed. In general, tubulin subunits were allowed to self-assembly into microtubule in buffer provided at
35oC for 20 minutes. The test proteins (GST-fusion proteins) and microtubules were
47 mixed and incubated for 30 minutes. Samples were subjected for ultra-centrifugation
(100,000xg) for 40 minutes. Supernatant and pellet fractions of samples were collected
separately and screened on SDS-PAGE gel or Western blot.
2.11 In vitro Interaction Assay
GST-fusion protein was purifed and attached to Glutathione–Sepharose beads as
described in section 2.2. Commercially purified tubulin (Cytoskeleton Inc.) in
unpolyermized and polyermized forms were added to GST-fusion protein and allow for 2
hour incubation at 4oC with constant vertical rotations. Beads were washed three times
with 1X PBS. 100ul of supernatant was collected and the rest discarded. Equal volume of
2X sample buffer was added to both supernatant and bead fractions, and then boiled at
100oC for 10 minutes. Samples were subjected to SDS-PAGE analysis.
48 3. Results
3.1 Generation of Glutathione S-Transferase (GST) Fusion Constructs
In order to study protein-protein interactions with the intracellular domains of
TRPM7, seven GST-TRPM7 fusion constructs were generated according to regions of
interest on protein map of TRPM7 shown in Figure 3. TRPM7 fusion proteins were
mainly selected from regions of the C-terminus of TRPM7 due to the fact that several
consensus domains have been previously identified and described. In contrast, the long
N-terminal domain of TRPM7 has no recognized consensus motifs other than being
highly homologous to the N-terminus of other TRPM family members. Regions of
interest were sub-cloned into pGEX-5X® vectors as described in the Materials and
Methods Section. Fusion constructs identities were verified with restriction digest analysis (Figure 4). DNA band patterns of the six restriction-digested constructs (#1-4, and 6-7) observed on 1% agarose gel are consistent with expected sizes (Table 4).
Construct #5, C - terminus – C (refer to Figure 4) was omitted from further experiments due to its redundancy with sequences and motifs found in Constructs #2 and 3. The identities of the fusion constructs were further confirmed with DNA sequencing analysis.
Different GST fusion proteins were expressed in BL21 pLysS E.coli and analyzed on Western blot to examine proper expression of these recombinant proteins in bacteria.
The fusion protein molecular weights (Figure 6), are compared to the estimated GST fusion protein sizes which are predicted based on the length of inserts and the size of
GST tag (Table 5). The gel migration of each of the seven fusion proteins was consistent with the predicted molecular weights. This data provides secondary confirmation of
49 successful in-frame sub-cloning as well as proper expression of fusion proteins in bacterial cells.
50
Figure 5. Restriction Digest of GST Fusion Constructs
Six restriction-digested GST fusion constructs (#1-4, 6-7) (refer to Figure 4) were resolved on 1% agarose gel to examine the DNA fragment patterns. The DNA fragment band sizes after restriction digest (resolved on the gel) were compared to the expected fragment sizes (Table 4) for each DNA constructs.
51
52
Table 4 Restriction Digest of GST Fusion Constructs Clone # Restriction Digest Fragment Sizes (kb) 1 EcoRV 2000, 3800 2 EcoRV 2000, 3860 3 EcoRV 2280, 3860 4 EcoRV/PstI 620, 1600, 2200, 2900 6 EcoRI 620, 5000 7 EcoRV/PstI 260, 780, 1200, 4000
53
Figure 6. Expression of GST-Fusion proteins in BL21 Escherichia coli
GST fusion proteins were over-expressed in BL21 pLysS Escherichia coli cells and later boiled in 2X sample buffer. GST- TRPM7 fusion proteins were detected with GST antibody and observed on Western blot to confirm correct protein expressions. Each lane is labeled as Clone # and compared to the predicted GST fusion protein sizes listed on
Table 5.
54
Clone #
55
Table 5 Predicted Molecular Weights* of TRPM7- GST Fusion Proteins Clone # TRPM7 Construct Name Estimated GST Fusion Protein Size (kD) 1 α-kinase 56 2 α-kinase – C 60 3 Long α-kinase - C 71 4 C terminus - N 111 5 C-terminus - C 116 6 Coiled-coil 50 7 Long coiled-coil 74 *GST fusion protein sizes were estimated based on the length of TRPM7 DNA insert (bp) and size of GST tag (26 kDa).
56 3.2 Pull-Down Assays and Identification of TRPM7 Interacting Proteins
TRPM7-GST fusion proteins or GST alone were overexpressed in BL21LysS
E.coli. The bacteria were pelleted, lysed and the GST proteins were purified from the lysateusing glutathione-sepharose beads. Purified fusion proteins were then used for pull- down experiments to capture and identify TRPM7 interacting proteins in mouse brain homogenate. Two types of mass spectrometry were used to identify the TRPM7
interacting proteins: MALDI-TOF MS and LC-MS/MS.
3.2.1 Matrix-assisted Laser Desorption/Ionisation - Time Of Flight Mass
Spectrometry (MALDI-TOP MS) Analysis
Pull-down samples of Alpha-Kinase - C and Long Alpha-Kinase fusion proteins
(refer to Figure 4) were first analyzed on 1-dimensional (1-D) SDS-PAGE gel. Selection of TRPM7 associating proteins on 1D-SDS PAGE gel was based on the comparison of protein band patterns of to the band patterns of 3 different controls: (i) plain bacterial lysate/ brain control, (ii) empty plasmid (GST tag)/ brain control and (iii) fusion protein control (no brain). Theoretically, any defined protein bands that were not observed in controls could be excised for MALDI-TOF MS analysis, as illustrated in Figure 7a. A total of eight protein bands (arrowed protein bands in Figure 7b) were selected from samples 2(B) and 3(B) through protein pattern comparison with the 3 controls: ((i)the bacterial lysate/ brain control (not shown), (ii) the empty plasmid/ brain control (not shown), and (iii) 2(0) and 3(0) (without brain incubation controls), respectively).
However, with the use of MALDI-TOP MS analysis for the purpose of protein identification, only three TRPM7 interacting proteins were identifiable (excluding the
57 two falsely selected GST tags (#2 ~20 and ~25kD)). Interestingly, among all three
proteins, two are cytoskeletal proteins, beta-actin (#3 ~50kD) and beta-tubulin (#2
~55kD), and one is cytoskeletal associating protein, nebulin-related anchoring protein (#3
~20kD) (shown in Table 6). Beta-actin and beta tubulin are well known subunits that
comprise the polymeric cytoskeleton proteins, F-actin and microtubule, relatively. F-actin
provides structural support and it is crucial for functions including cell motility and
cytokinesis. Microtubules also serve as structural component within cells and are
involved in many cellular processes such as mitosis and vesicle transport. Nebulin-related
anchoring protein (NRAP) is a cytoskeletal interacting proteins that possesses a C-
terminal actin binding site. Its function is not well understood but it has been suggested to
have an anchoring function, linking the terminal actin filaments of myofibrils to protein
complexes located beneath the sarcolemma (Luo et al., 1997b; Luo et al., 1997a). As
indicated in our result, TRPM7 association with cytoskeleton or cytoskeletal interaction
proteins strongly suggests that TRPM7 has a role in cytoskeleton-related functions as proposed by other researches including modulation of cell morphology, regulation of synaptic vesicle transport and fluid induced stress response.
58
Figure 7. 1-D SDS-PAGE gel analysis of Pull-Down samples
a. Hypothetical 1-D SDS-PAGE gel image. Band pattern of pull-down sample is
compared to band patterns of 3 controls: plain bacterial lysate/ brain control,
empty plasmid (GST tag)/ brain control and fusion protein control (no brain).
Distinct protein bands (circled) that do not appear on control lanes are excised.
b. The screening of protein band patterns in pull-down samples. Alpha-Kinase - C
and Long Alpha-Kinase recombinant proteins were used as the baits to identify
TRPM7 interactors from mouse brain lysate and protein samples were resolved on
1D SDS-PAGE gel and detected using Coomassie Brilliant Blue stain. Band
patterns of Alpha-Kinase - C (2(B)) and Long Alpha-Kinase (3(B)) pull down
samples were compared to band patterns of the 3 controls: (i)the bacterial lysate/
brain control (not shown), (ii) the empty plasmid/ brain control (not shown), and
(iii) 2(0) and 3(0) (without brain incubation controls), respectively. Arrowed
protein bands were excised and subjected to MALDI-TOF analysis to reveal their
identities
59
7a
7b
60
Table 6. TRPM7 Interacting Proteins Identified by MALDI-TOF MS Bait Estimated Protein Number of Peaks/ Interactor Size (kD) Identity Recognized Peptide Sequneces 60 N/A N/A GST-Fusion 50 Beta-tubulin 42 Protein #2 25 GST 24 20 GST 40 60 N/A N/A GST-Fusion 50 Beta-actin 28 Protein #3 20 Nebulin-related 54 anchoring protein 12 N/A N/A
61 3.2.2 Liquid Chromatography Mass Spectrometry (LC-MS/MS)
MALDI-TOF MS may only require 1-10µM of purified proteins (peptides) for protein identification but is limited in its dynamic ability to detect proteins such that contaminating proteins or proteins expressed at high concentrations (> 10µM) can overwhelm the detection system. In addition, the sensitivity of MALDI-TOF is significantly reduced when combined with the limited resolving power of 1D gel electrophoresis and visible proteins stains. 1D-SDS PAGE gel separates proteins based on size and what appear to be single bands can often contain multiple proteins. The detection of one or more proteins within the band may be lost or ‘hidden’ if one of the band constituents has a significantly higher concentration. Coomassie Brilliant Blue stain also limits protein detection in that its sensitivity is limited to visible bands that contain
50-100-ng of protein. In addition different proteins with similar gel migration may be excluded if similar bands appear in both control and test lanes. Accordingly we used a second approach to identify proteins interacting with the kinase domain of TRPM7.
LC/MS-MS is a powerful proteomic approach for analysing complex mixtures of proteins. Although it is not as sensitive as MALDI-TOF, LC-MS/MS is not as easily saturated nor complicated by the limitations of gel electrophoresis. Pull-down samples can be directly subjected to tryptic digest and LC-MS/MS without the need of resolving protein bands on 1D-SDS PAGE gel. Thus mixtures of proteins in different samples were separated with the help of liquid chromatography. Identified proteins in each sample were listed. Proteins in pull-down samples with four different GST fusion proteins (Clone #1 -
4) were compared to proteins in control samples. Protein names that do not appear in control sample lists are possible TRPM7 interactors (Table 7.1 – 7.4).
62 Three cytoskeletal proteins, alpha/beta-tubulin and beta-actin are found to be
attached to #2 - #4 GST-fusion protein/bead complexes (Table 7.2 – 7.4) but not
associating with GST or glutathione beads alone even though GST may be a potential
contaminant due to its abundance in cells. The recombinant alpha-kinase region of
TRPM7 (clone #1) only interacts with microtubule components, alpha/beta-tubulin, but
not beta-actin, which suggests the surrounding sequence of alpha-kinase domain are
required for the binding to actin or actin associating proteins. In addition to cytoskeletal
proteins, synaptosomal components required for synaptic vesicle release, vesicle
associated membrane protein 2 (VAM2) and synaptosomal-associated protein 25
(SNAP25), were also identified as proteins associated with TRPM7 (Long Alpha-Kinase
TRPM7 recombinant protein). The LC-MS/MS results are largely consistent with the
suggested physiological roles of TRPM7 in cell morphology regulation (Clark et al.,
2006; Dulyaninova et al., 2005; Oancea et al., 2006a) and synaptic vesicle release
(Brauchi et al., 2008; Krapivinsky et al., 2006). A Na+/K+ ATPase subunit, alpha-3
subunit, is also detected as a TRPM7 interacting protein (Table 7.2 & 7.4). K+/Na+
ATPase is an abundant protein in neurons and critical for the reuptake of K+ following
action potential firing. Moreover, protein-protein interactions of Na+/K+ ATPase is
important for protein activation (Src family kinase) and mediating signal transduction
(Xie and Cai, 2003). Thus the interaction of TRPM7 with Na+/K+ ATPase may be a
potential mechanism for TRPM7 alpha-kinase regulation or activation.
63 Table 7.1 LC-MS/MS Analysis on TRPM7 Associating Proteins in Pull-Down Assay using Alpha-Kinase Fusion Protein as The Bait
Fusion Protein Identified Interactors Peptide Sequences Confident Recognized Level tubulin, alpha 1C [Mus (R)LISQIVSSITASLR(F) (R)TIQFVDWcPTGFK(V) musculus], > 95% gi|148225011|ref|NP_00109131 (R)AVFVDLEPTVIDEVR(T) 5.1 (R)IHFPLATYAPVISAEK(A) Clone #1 - (R)IHFPLATYAPVISAEK(A) α- Kinase tubulin, beta 2 [Mus (K)NSSYFVEWIPNNVK(T) musculus], (R)YLTVAAIFR(G) > 95% gi|157819845|ref|NP_00110258 9.1
Table 7.2 LC-MS/MS Analysis on TRPM7 Associating Proteins in Pull-Down Assay using Alpha-Kinase - C Fusion Protein as The Bait
Fusion Protein Identified Interactors Peptide Sequences Confident Recognized Level tubulin, alpha 1C [Mus (R)TIQFVDWcPTGFK(V) (R)QLFHPEQLITGKEDAANNYAR(G) musculus], (R)AVFVDLEPTVIDEVR(T) gi|148225011|ref|NP_00109131 (K)VGINYQPPTVVPGGDLAK(V) 5.1 (K)TIGGGDDSFNTFFSETGAGK(H) > 95% (K)TIGGGDDSFNTFFSETGAGK(H) (R)QLFHPEQLITGKEDAANNYAR(G) tubulin, beta 2 [Mus (R)EIVHIQAGQcGNQIGAK(F) (R)SGPFGQIFRPDNFVFGQSGAGN musculus], > 95% NWAK(G) gi|157819845|ref|NP_00110258 (R)INVYYNEAAGNKYVPR(A) 9.1 actin, beta [Mus (R)AVFPSIVGRPR(H) (R)AVFPSIVGRPR(H) musculus], (K)SYELPDGQVITIGNER(F) > 95% Clone #2 - gi|13592133|ref|NP_112406.1 α-kinase - C (R)VAPEEHPVLLTEAPLNPK(A) vesicle associated (R)ADALQAGASQFETSAAK(L) membrane protein 2 80 – 94% [Mus musculus], gi|117616908|gb|ABK42472.1| synaptosomal- (K)AWGNNQDGVVASQPAR(V)
associated protein 25, 80 – 94% isoform CRA_a [Mus musculus] ATPase, Na+/K+ (R)LNIPVSQVNPR(D) (R)QGAIVAVTGDGVNDSPALK(K) transporting, alpha 3 (K)GVGIISEGNETVEDIAAR(L) polypeptide, isoform CRA_a 50 – 79% [Mus musculus], gi|148692349
64 Table 7.3 LC-MS/MS Analysis on TRPM7 Associating Proteins in Pull-Down Assay using Long Alpha-Kinase Fusion Protein as The Bait
Fusion Protein Identified Interactors Peptide Sequences Confident Recognized Level tubulin, alpha 1C [Mus (R)AVFVDLEPTVIDEVR(T) (R)IHFPLATYAPVISAEK(A) musculus], (K)VGINYQPPTVVPGGDLAK(V) gi|148225011|ref|NP_00109131 (R)QLFHPEQLITGKEDAANNYAR(G) > 95% Clone #3 - 5.1 Long α-kinase tubulin, beta 2 [Mus (K)NSSYFVEWIPNNVK(T) (R)EIVHIQAGQcGNQIGAK(F) - C musculus], (R)INVYYNEAAGNKYVPR(A) gi|157819845|ref|NP_00110258 > 95% 9.1
actin, beta [Mus (K)IWHHTFYNELR(V) (K)SYELPDGQVITIGNER(F) musculus], > 95% gi|13592133|ref|NP_112406.1
Table 7.4 LC-MS/MS Analysis on TRPM7 Associating Proteins in Pull-Down Assay using C - Terminus - N Fusion Protein as The Bait
Fusion Protein Identified Interactors Peptide Sequences Confident Recognized Level tubulin, alpha 1C [Mus (R)LISQIVSSITASLR(F) (R)AVFVDLEPTVIDEVR(T) musculus], (R)AVFVDLEPTVIDEVR(T) gi|148225011|ref|NP_00109131 (K)VGINYQPPTVVPGGDLAK(V) 5.1 (K)VGINYQPPTVVPGGDLAK(V) (K)TIGGGDDSFNTFFSETGAGK(H) > 95% (K)TIGGGDDSFNTFFSETGAGK(H) (R)FDGALNVDLTEFQTNLVPYPR(I) tubulin, beta 2 [Mus (K)NSSYFVEWIPNNVK(T) Clone #4 - (R)EIVHIQAGQcGNQIGAK(F) musculus], (R)SGPFGQIFRPDNFVFGQSGAGN > 95% C terminus - N gi|157819845|ref|NP_00110258 NWAK(G) 9.1 (R)SGPFGQIFRPDNFVFGQSGAGN NWAK(G) (R)INVYYNEAAGNKYVPR(A) actin, beta [Mus (R)AVFPSIVGRPR(H) (R)AVFPSIVGRPR(H) musculus], (K)SYELPDGQVITIGNER(F) > 95% gi|13592133|ref|NP_112406.1 (R)VAPEEHPVLLTEAPLNPK(A) ATPase, Na+/K+ (R)QGAIVAVTGDGVNDSPALK(K) transporting, alpha 3 (R)QGAIVAVTGDGVNDSPALK(K) polypeptide, isoform CRA_a (K)GVGIISEGNETVEDIAAR(L) > 95% [Mus musculus], gi|148692349
65 3.3 Confirmation of TRPM7 Specific Interactions Using Co-Immunoprecipitation
Consistent results from both MALDI-TOF and LC-MS/MS analyses represent
good validity of pull-down experiments; however it is insufficient to indicate specific
associations between TRPM7 and cytoskeletal proteins. Due to its abundance in cells,
cytoskeleton may be potential contaminants for pull-down assay and produce non-
specific interaction. To ensure specific associations, TRPM7 antibody was used for co-
immunprecipitation (Co-IP), attempting for co-purification of beta-actin and beta-tubulin
together with TRPM7. Due to the low expression of TRPM7 and different detection
conditions (different TRPM7 antibody used), TRPM7 was detected in mouse brain lysate with beta-tubulin (Figure 8b), but not in the mouse brain lysate in the separated Western blot that also was probed for beta-actin (Figure 8a). Regardless of the detection of
TRPM7 in straight brain lysate, both beta-actin (Figure 8a) and beta-tubulin (Figure 8b)
were co-immunoprecipitated along with TRPM7 using TRPM7 antibody in both co-
immunprecipitation experiments. Neither TRPM7 nor the two associating proteins appear
on the Normal Rabbit IgG control lane; it indicates that beta-actin and beta-tubulin
directly or indirectly interact with TRPM7 but not the IgG proteins.
66
Figure 8. Co-Immunoprecipitation of TRPM7
Specific associations between TRPM7 and interactors were further confirmed using co-
IP. A rabbit anti-TRPM7 antibody (Millipore) or control rabbit IgG were used to
precipitate endogenous TRPM7 and its associated proteins from mouse brain lysate.
Following incubation with brain lysate the antibodies were precipitated from solution
using Protein-A Sepharose and heated in SDS sample buffer. Eluted proteins were
separated by SDS-PAGE, blotted on nitrocellulose and probed with antibodies against
beta-actin or beta-tubulin. Whole mouse brain lysate (Brain) was used as a positive
control to confirm detection of TRPM7, beta-actin or beta-tubulin in the starting material.
Western analysis confirmed that both beta-actin and beta-tubulin are co-
immunoprecipitated with TRPM7 but not control antibody.
67
8a 8b
68 3.4 Examination of Tubulin Association with TRPM7
Both alpha-tubulin and beta-tubulin were identified through LC/MS-MS analysis
(Table 7), and it is possible that TRPM7 interacts with microtubules rather than single
subunits of tubulin heterodimers. To further investigate the association between TRPM7
and cytoskeletal proteins, we examined whether TRPM7 can bind directly to microtubule
and if the binding involves individual microtubule subunits or polymerized microtubules.
Alpha-tubulin and beta-tubulin form the dimeric subunit of microtubules (MTs). Two sets
of experiments (the microtubule binding protein assay and the in vitro protein interaction
assay) were done to test for direct interaction of TRPM7 and MTs.
3.4.1 The Microtubule Binding Protein Assay
The microtubule binding protein assay was used to examine if TRPM7 bound to
MTs directly or indirectly. Purified tubulin can be polymerized into microtubules and
pelleted by high speed centrifugation. Proteins that directly interact with MTs will also be
pelleted. Microtubule associated proteins (MAPs), proteins that bind soluble tubulin
subunits or MTs, were used as a positive control and bovine serum album (BSA) was
used as a negative control for this assay. MAP interacted with MTs and was found in the
pellet fraction, but remained in the supernatant when it was centrifuged without MTs
(Figure 9a), whereas BSA stayed in the supernatant regardless of the presence of MTs.
Possibly due to prolonged storage of purified GST proteins at low termperature, GST
protein formed aggregation hence a small amount of GST was detected as a pellet while
most of it was found in the supernatant fraction. Although majority of the tubulin proteins
formed a pellet during ultra-centrifugation, TRPM7 fusion protein (Long Alpha Kinase),
69 containing partial TRPM7 C-terminus, still remained in the supernatant fraction on the
Coomassie stained SDS-PAGE gel (Figure 9b) and Western blot (Figure 9c). This result
indicates that TRPM7 does not directly interact with polymerized microtubules and may
instead require an accessory or adaptor proteins for cytoskeletal associations.
3.4.2 In vitro Protein Interaction Assay
To further address whether TRPM7 can form direct interactions with polymerized or umpolyermized form of dimeric tubulin subunits, in vitro protein interaction assays was used. Recombinant TRPM7 proteins (Long Alpha-Kinase – Clone #3) were immobilized on glutathione resin and both unpolyermized and polyermized forms of tubulin were allowed to interact with the recombinant protein. Coomassie stained SDS-
PAGE gel and western blot analysis showed that neither polymerized (Figure 10a and
10d) nor unpolymerized (Figure 10c and 10d) forms of tubulin bind TRPM7 recombinant proteins, therefore they remain in the supernatant fraction. This data confirms that TRPM7 does not form a direct protein-protein binding relationship with
MTs or soluble tubulin subunits but requires one or more intermediate proteins to act as linkers between TRPM7 and the microtubule cytoskeleton.
70
Figure 9. Examination for Direction Interaction between TRPM7 and Microtubule
using Microtubule Binding Protein Assay.
The Microtubule binding assay was used to test for direct interaction between TRPM7
and microtubules. Purified tubulins were self-assembled into microtubules, which were
later incubated with purified GST fusion protein (Long Alpha Kinase). Following
ultracentrifugation of samples, both pellet (P) and supernatant (S) fractions of were
collected and run on SDS-PAGE gel.
(a) Controls of Microtubule Binding Protein Assay
4 sets of control samples were run on SDS-PAGE gel and proteins were detected with
Coomassie Brilliant Blue stain:
i) Positive control: Microtubule & MAP: (Tub + MAP) ii) Negative control: Microtubule & BSA: (Tub + BSA) iii) MAP control: (MAP) iv) BSA control: (BSA)
(b) & (c) Analysis of TRPM7-Microtubule interaction using Microtubule Binding Protein
Assay
3 sets of test protein samples were run on SDS-PAGE gel and GST fusion proteins were
detected with either (b) Coomassie Brilliant Blue stain or (c) GST antibody on Western
Blot:
i) Long Alpha-Kinase recombinant protein (~5ug) & Microtubule: (#3 – Tub) ii) Long Alpha-Kinase recombinant protein (~2ug) & Microtubule: (#3 (1/2) – Tub) iii) GST & Microtubule: (GST – Tub)
71 9a
9b
72
9c
73
Figure 10. Examination of Direction Interaction between TRPM7 and Microtubule using in vitro Protein Interaction Assay.
Purified tubulin subunits or polymerized tubulins (microtubule) were incubated with purified GST fusion protein (Long Alpha-Kinase – Clone #3) that was pre-attached to glutathione resin. Both supernatant (S) and pellet (P) samples were run on a SDS-PAGE gel and Western blot to test for direction interaction between TRPM7 and polymerized tubulin (microtubules) (a and b) or unpolymerized tubulin monomers (c and d) at the twoindicated salt concentrations.
(a) & (b) Test of interactions between Long Alpha-Kinase recombinant protein and polymerized form of tubulin (microtubule)
2 sets of test protein samples were run on SDS-PAGE gel and proteins were detected with either (a) Coomassie Brilliant Blue stain or (b) GST antibody or tubuline anitbody on Western Blot: i) Alpha-Kinase recombinant protein & Microtule: (#3 – Tub) ii) GST & Tubulin: (GST – Tub)
(c) & (d) Test of interactions between Long Alpha-Kinase recombinant protein and unpolymerized tubulin subunits
2 sets of test protein samples were run on SDS-PAGE gel and proteins were detected with either (a) Coomassie Brilliant Blue stain or (b) GST antibody or tubulin antibody on
Western Blot: i) Alpha-Kinase recombinant protein & Microtule: (#3 – Tub) ii) GST & Tubulin: (GST – Tub)
74 10a
10b
75 10c
10d
76 4. Discussion
4.1 Identification of TRPM7 Associating Proteins
In this study MALDI-TOF MS analysis was used to identify proteins from mouse brain lysate that interact with intracellular C-terminal domains of TRPM7. Distinct fusion proteins, each containing the TRPM7 kinase domain, were shown to interact with the
cytoskeletal protein subunits beta-actin and beta-tubulin as well as nebulin-related
anchoring protein (refer to Figure 4 & Table 6). This result was confirmed in a separate
analysis using LC-MS/MS which identified beta-actin and beta-tubulin as well as alpha-
tubulin as TRPM7 kinase domain binding partners. The use of recombinant TRPM7-GST
fusion proteins as bait for pull down experiments and mass spectrometry was validated
by the reproducible identification of interacting proteins in separate analyses, the high
number of peptide sequences identified for each protein target and the consistency of the
findings reported here and that of published research. A study using TRPM7
immunoprecipitation by Clark et al. (2006) has shown that beta-actin was present in the
TRPM7 precipitant, forming molecular complex with TRPM7 (Clark et al., 2006).
Likewise, our co-immunoprecipitation experiment using a TRPM7 antibody coupled with
immunoblot detection (Figure 8a and 8b) showed similar result that both beta-actin and
beta-tubulin co-precipitated with TRPM7. Together these results confirmed the
interaction between endogenous TRPM7 with beta-actin and beta-tubulin and also suggested a cytoskeletal-related function of TRPM7 dependent on the specific association between TRPM7 and the cytoskeleton.
Beta-actin and alpha/beta-tubulin subunits are the building blocks that compose actin filaments and microtubules, respectively. Association with these cytoskeletal
77 subunits indicates a potential role for TRPM7 in cytoskeletal related functions that
involve interaction with actin filaments and microtubules. A body of evidence, together with our results, now suggests that TRPM7 contributes to cytoskeletal cellular physiology
including stress-induced response, cell morphology regulation, and modulation of cell
adhesion possibly through the regulation of actin disassembly and cytoskeleton
rearrangement (Birukov et al., 2002; Chubanov et al., 2004; Clark et al., 2006; Clark et
al., 2008b; Oancea et al., 2006a; Su et al., 2006). The association of the TRPM7 C-
terminus with actin, as indicated by our result, is consistent with the suggested role of the
alpha-kinase in regulating myosin II-dependent contractile responses and actomyosin
remodeling (Clark et al., 2008a; Clark et al., 2008b). Regulation of actomyosin
contractility is essential to modulate focal adhesion assembly (DeMali and Burridge,
2003; Geiger and Bershadsky, 2002; Linder and Aepfelbacher, 2003), and TRPM7 is
implicated in directing the assembly of focal adhesion by regulating actomyosin
rearrangement through myosin II heavy chain phosphorylation (Chubanov et al., 2004;
Clark et al., 2006; Su et al., 2006). Alternatively, the association with actin may simply
serve to facilitate TRPM7-myosin II interactions. TRPM7 is a membrane embedded
channel and myosin II is a cytosolic protein that travels along actin filament and thus
there may be very low probability for an independent TRPM7-myosin II interaction.
However, TRPM7 association with cytoskeletal elements such as actin filaments may
dramatically increase the likelihood of TRPM7-myosin II interaction.
Spatial reorganization of the cytoskeleton is a critical protective mechanism for
endothelial cells against mechanical stress created by frequent fluid flow, providing
structural support and integrity to cells to resist shear forces induced by increased fluid
78 flow (Galbraith et al., 1998; Malek and Izumo, 1996). In situ morphologic studies reveal the formation of a type of actin structure known as stress fibers. In non-muscle cells, stress fibers are bundles of actin microfilaments whose assembly is involved in actin- myosin interactions and cross-linking by actin associating proteins including α-actinin,
myosin and tropomyosin (Lu et al., 2008a; Lu et al., 2008b). Under the conditions of
increased fluid flow rate, it has been shown that actin stress fibers are formed in a unique
orientation that is parallel to the direction of shear stress vector in endothelial cells, which
contrasts with the random cytoskeletal arrangement of endothelial cells culture grown
under static conditions (Nehls and Drenckhahn, 1991). More importantly, the onset
(within 2 minutes of fluid exposure) of cytoskeletal remodeling under shear stress may
involve the phosphorylation of myosin by myosin light chain kinase (MLCK) and Rho-
associating kinase. The TRPM7 alpha-kinase may play a similar role in facilitating
endothelial cell cytoskeletal arrangement by phosphorylating the myosin II heavy chain
in later stage of shear stress induction. Such a role would explain the observations by
Oancea et al. who observed the insertion and accumulation of TRPM7 channels in
endothelial cells, at membrane regions exposed to shear stress force (Oancea et al.,
2006a).
In addition to cytoskeletal proteins, two components of synaptic vesicle release
were identified by LC- MS/MS analysis as proteins interacting with the c-terminal
domain of TRPM7. Synaptosomal proteins including both the synaptic vesicle-specific
proteins (VAMP2) and the non-vesicular components of the fusion machinery that reside
on the membrane (SNAP25) were found to associate with TRPM7 fusion proteins
containing the alpha-kinase domain (Table 7.2). This data is consistent with the work of
79 Krapivinsky et al. (2006) who found that TRPM7 resides on the membrane of cholinergic vesicles inperipheral sympathetic neurons and forms molecular complexes with synaptic vesicle proteins including synaptotagmin I, synapsin I and snapin (Krapivinsky et al.,
2006). Prior to the release of synaptic vesicles, the components of fusion machinery, such as SNAP 25 and syntaxin, are required for docking and fusion of synaptic vesicles
(Pevsner et al., 1994; Sollner et al., 1993). The identified association with SNAP25 in our data allows us to predict that TRPM7 is involved in the docking process of synaptic vesicles, also a function suggested by Krapivinsky and colleagues (Krapivinsky et al.,
2006). It should be noted that Krapivinsky et al. has found that a discrete region of the
TRPM7 N-terminus directly interacts with the synaptic vesicle protein snapin. However we cannot eliminate the possibility that other domains of TRPM7, such as the C-terminal kinase, may also bind synaptic vesicle proteins. The use of the isolated kinase from the
TRPM7 C-terminus as bait for my pull-down experiments reveals that this region could also contribute to the interaction with synaptic vesicular proteins and the formation of molecular complexes within the synaptic vesicle membrane. This result is pertinent to the finding of Bracuchi and collegues who has shown that the TRPM7 kinase domain provides control to vesicle motility (Brauchi et al., 2008). Potentially, the TRPM7 C- terminal domain interacts with synaptic vesicle proteins to function as a regulator of vesicular transport and to monitor vesicle mobility. Moreover, my identification of tubulin as a TRPM7-interacting protein suggests that TRPM7 may associate with microtubule proteins in order to regulate vesicular transport along microtubules.
However, results from the microtubule binding protein assay (refer to Figure 9b - c) and in vitro protein ineraction assay (refer to Figure 10a - d) indicate that the TRPM7 kinase
80 does not directly interact with tubulin or polymerized tubulin microtubules. Thus
additional microtubule binding or accessory proteins must be involved in the association
between TRPM7 and microtubules.
4.1.1 Limitation of LC-MS/MS Affects Detection of TRPM7 Associating Proteins
LC-MS/MS is a powerful tool suitable for the identification of novel protein
interactions. Protein complexes that associate with the bait protein in pull-down
experiments can be separated through high pressure liquid chromotography, subjected to
tryptic digest in solution and identified using mass spectrometry. The results obtained
from Liquid Chromatography Mass Spectrometry (LC-MS/MS) analysis are consistent
with the physiological role of TRPM7 suggested by other researchers. However, other
components involved in TRPM7 functions seem to be missing. For instance, only
VAMP2 and SNAP25 were detected in TRPM7 protein complexes while other synaptic
vesicular proteins such as synapsin and synaptotagmin were not identified. Thus the
results obtained here may be limited by the sensitivity of LC-MS/MS and the masking
effect exhibited by abundance proteins or polymeric interactions. The sensitivity of LC-
MS/MS is based on the sample component ratio. The signal from a protein with high
number can overwhelm the signal from a low number protein present in the same
mixture, causing a masking effect on lower abundance proteins. Therefore proteins with
higher expression or abundance are more likely to be detected with LC-MS/MS.
Association with multimers or polymers may cause a greater masking effect. Cytoskeletal
proteins are among the most abundant proteins in a cell and the formation of a protein
complex between TRPM7, microtubules and F-actin is very likely to mask the signals
81 given by other TRPM7 associated proteins. More importantly, binding to one molecule of
cytoskeleton may result in the presence of large number of monomers, alpha/beta-tubulin
and beta-actin, in the sample mixtures. Thus a combination of association with high abundance protein and polymers could hide the identity of other TRPM7 associated
proteins in LC-MS/MS analysis. The Na+ / K+ ATPase, as another identified TRPM7
associated protein, was not susceptible to the masking effect by cytoskeletal proteins due
to its abundance in neurons. On the other hand, synaptic vesicle proteins, whose
abundance is dependent on synaptic activities in neurons (Burre et al., 2006), may not be
able to escape the masking effect. The fact that only two synaptic vesicle proteins,
VAMP2 and SNAP25, are weakly detected in the pull-down sample mixtures by LC-
MS/MS may indicate other synaptic vesicle fusion machinery proteins, such as
synatotagmin and syntaxin, were overwhelmed by the abundance of cytoskeletal proteins,
hence undetectable. Therefore, presumably not all TRPM7 associating proteins are
identified in this experiment.
82 4.2 Potential Model of TRPM7 Functions in Cytoskeletal Remodeling and Shear Stress Response
As mentioned previously, TRPM7 channels localize at plasma membrane regions that are under local shear stress induced by fluid flow (Oancea et al., 2006a). Actin stress
fibers also form in a parallel alignment to the stress stress vector, which helps endothelial
cells to resist the shearing force created by blood flow and by collision with red and white blood cells (Nehls and Drenckhahn, 1991). Shear stress-induced changes in cell morphology and the formation of stress fibers in endothelial cells involve rearrangement of the actin filaments (Wagner et al., 2002). Modulation of actin cytoskeleton remodeling may involve covalent modification of Myosin II and tropomyosin/tropomodulin, which are important components required for structural integrity of actin and stress fiber
formation (Nehls and Drenckhahn, 1991; Ngu et al., 2008). Phosophorylation of myosin
II (Clark et al., 2006; Kendrick-Jones et al., 1983; Smith et al., 1983) and tropomodulin
(Mudry et al., 2003; Wagner et al., 2002) have been suggested as a regulatory mechanism
to alter their binding affinity to cytoskeleton, leading to disassembly of actin filament
rearrangement. Thus phosphorylation of these actin associated proteins may be important
for the formation of stress fiber in response to shear stress force.
Myosin II is a class of actin binding protein that moves along actin filaments. All
myosin II proteins are composed of two heavy chains and two pairs of light chains.
Moreover, myosin II molecules form bipolar filaments through electrostatic interactions
of the myosin heavy chain (MHC) tail (Hostetter et al., 2004). The globular motor
domain of each MHC catalyzes ATP hydrolysis and interacts with actin. Phosphorylation of MHC promotes dissociation of myosin II filaments and potentially leads to actomyosin remodeling. In addition to myosin II, tropomodulin and tropomyosin are also actin
83 binding proteins. Tropomodulin possesses both actin-capping domains and tropomyosin
binding domain. The actin-capping ability of tropomodulin allows it to cap the pointed
end (for disassembly) of actin filament to prevent dissociation of beta-actin subunits, and
together with tropomoysin association, tropomodulin inhibits depolymerization of actin
and stabilizes the structure of the actin cytoskeleton (Kostyukova et al., 2005;
Kostyukova et al., 2007; Kostyukova and Hitchcock-Degregori, 2004). Phosphorylation
of tropomodulin within its N-terminal domain by TRPM7 kinase results in a loss of actin-
capping ability while the C-terminal actin-capping and tropomoyosin binding ability are
unaffected (Dorovkov et al., 2008). Conversely, another study examining tropomodulin
functions demonstrated that phosphorlyation of tropomodulin increased its association
with cytoskeletal proteins (Wagner et al., 2002) and such interaction helps stabilize the
cytoskeleton (Krieger et al., 2002; Mudry et al., 2003; Ono and Ono, 2002).
Regulation of actin dynamics is important for many biological processes
including cytokinesis, cell migration, cell adhesion and mechanical stress response. As
previously described, TRPM7 is suggested to regulate actin dynamics by phosphorylating the myosin II heavy chain and tropomodulin. It has been shown to be involved in shear stress response and alteration of cell morphology. These data all indicate that TRPM7 has cytoskeletal related function(s) and perhaps provide insight into a potential model for
a fluid-induced shear stress response involving TRPM7. Presumably under normal
conditions TRPM7 would be dispersed throughout the plasma membrane (Figure 11a).
As the fluid flow rate increases TRPM7 channels are inserted and localize at the cell
membrane region under induced shear stress force (Figure 11b). The localization of
TRPM7 should permit its interaction with myosin II heavy chain and tropomodulin, as
84 well as substrate phosphorylation by the TRPM7 kinase domain. As a result myosin
filaments would dissociate from each other while tropomodulin would also lose its ability
to cap actin at the N-terminal domain, followed by actin depolymerization and cytoskeleton rearrangement (Figure 11c). Changes in tropomodulin binding affinity to
actin may be only a temporal effect. In addition, phosphorylation at different regions of tropomodulin could have dual effect on actin structure; N-terminal phosphorylation of tropomodulin would facilitate actin reorganization, whereas phosphorylation at other sites of tropomodulin, possibly by other kinases may enhance tropomyosin binding and actin
capping ability in the C-terminal domain in which would promote ultimate stabilization
of actin stress fibers (Figure 11d). As a result, actin stress fibers can provide structural
support to endothelial cells with alignment parallel to fluid flow (stress vector) to resist
shear force and to prevent cell tearing.
85
Figure 11. Proposed Model of TRPM7 Function in Endothelial Shear Stress
Response
(a) In resting state, TRPM7 channels are disturbed through out plasma membrane.
(b) TRPM7 channels are inserted and localize at the region of cell membrane under
shear force caused by increase in fluid flow (arrow represents direction vector of
shear force).
(c) TRPM7 C-terminal domain interacts with tropomodulin and myosin II heavy
chain followed by substrate phosphorylation with TRPM7 alpha-kinase to allow
disassembly and reorganization of actin filaments.
(d) Actin stress filaments are formed aligning parallel to shear force vector and
stabilized by tropomodulin and myosin II filaments to resist shear stress induced
by fluid flow.
86 11a
11b
87
11c
11d
88
4.2.1 Future Studies of TRPM7 Shear Stress Response
Several lines of research could be undertaken to address the proposed role of
TRPM7 in modulating cytoskeletal dynamics in the shear stress response. First, a TRPM7
kinase-dead mutant and a channel mutant (with key point mutations that abolish ion
conductance) can be used to examine the effect of TRPM7 kinase activation and channel
activity on the formation of actin stress fibers under fluid induced shear stress condition.
An endothelial cell line such as human microvascular endothelial cells (HMEC-1) could be transfected with wild-type or mutant TRPM7 constructs and subsequently exposed to fluid flow in a perfusion system. The dynamics of the actin cytoskeleton could then be
observed using actin markers such as Texas Red-conjugated phalloidin (Birukov et al.,
2002; Clark et al., 2008b) or with GFP- β actin transfected cells for live images. The loss
of actin stress fiber formation in cells expressing the kinase-dead mutant would confirm that TRPM7 kinase activity is required for actin cytoskeletal remodeling and actin stress fiber formation. With the use of Western analysis and phosphor-antibodies to examine
phosphorylation changes of actin or accessory proteins in wild type or kinase-dead
mutant expressing cells could help to capture proteins that are involved in the fluid shear stress response but not known as a TRPM7 kinase substrate. Next, mutation of TRPM7- specific phosphorylation sites on myosin II heavy chain and tropomodulin could be used to mimic either the dephosphorylated or phophorylated state of the two substrates. Over expression of phosphorylation mutants could be used to confirm that TRPM7 directed
phosphorylation is involved in regulating cytoskeleton dynamics and actin-binding proteins. The loss of stress fiber formation in endothelial cells transfected with negative phosphomutants would indicate that TRPM7 kinase activity is required for stress fiber
89 formation by phosphorylating of myosin II and tropomodulin as a protective mechanism
to resist shear force.
4.3 Potential Model of TRPM7 Functions in Synaptic Vesicle Release
Synapses are highly specialized intercellular junctions that mediate the
transmission of information between axons and target cells. Neurons communicate
through synapses by means of neurotransmitter release. The exocytosis of synaptic
vesicles allows neurotransmitter content to diffuse through synaptic cleft and bind
appropriate receptors on postsynaptic membrane. The cytoskeleton is an important
structural component of synapses. The formation and morphological changes of the
synapse ultimately requires the dynamic actin cytoskeleton (Al-Alwan et al., 2003;
Averbeck et al., 2004; Dillon and Goda, 2005). The cytoskeleton also provides functional supports necessary for neuronal activities, especially for neurotransmitter release.
Synaptic vesicle transport along the axon to a synapse requires the cooperation of microtubules and kinesin. Furthermore, regulation of synaptic vesicle populations in the reserve pool involves the action of the actin-based cytoskeleton reversibly tethered to synapsin, a synaptic vesicle-associated phosphoprotein that resides on the membrane of synaptic vesicle (Benfenati et al., 1991; Hirokawa et al., 1989). TRPM7 has been functionally implicated in synaptic vesicle docking and release processes, as well as interaction with cytoskeleton associated proteins. However the underlying mechanism and machinery involved in synaptic vesicle release and whether the process involves
TRPM7 and cytoskeletal accessory proteins remain unclear. Many questions have arisen from the limited experimental data available. Krapivinsky et al. have shown that TRPM7
90 resides on the cholinergic synaptic vesicle membrane of sympathetic neurons (peripheral neurons) (Krapivinsky et al., 2006), but whether TRPM7 is also present in the synaptic vesicle membrane of central cortical neurons is questionable. During synaptic vesicle docking the vesicular protein VAMP2 interacts with membrane-associated SNARE proteins, SNAP25 and syntaxins to form a stable complex that later associates with synaptotagmin (Pevsner et al., 1994; Sollner et al., 1993). Subsequently, proteins such as snapin also interact with SNAP25 to assist the docking event (Ilardi et al., 1999).
Krapivinsky and his collegues demonstrated using co-immunprecipitation experiments that TRPM7 only forms molecular complexes with synaptic vesicle proteins including synapsin I, synaptotagmin I and snapin but not with other synaptic vesicle proteins
(VAMP2) or membrane fusionary proteins such as SNAP25 and syntaxins. In addition, the N-terminal domain of TRPM7 was shown to directly interact with snapin
(Krapivinsky et al., 2006) but no experimental data supports that snapin interacts other vesicle docking proteins such as synapsin I or synaptotagmin I. How can a TRPM7 anitbody co-immunoprecipitate the two synaptic vesicle proteins, synapsin I and synaptotagmin I along with TRPM7? My results from pull-down assays and LC-MS/MS data provide a possible idea to explain the missing link. The C-terminal domain of
TRPM7 may also associate with synaptic vesicle proteins, possibly with VAMP2, synapsin I or synaptotagmin I.
In addition to be functionally important for synaptic vesicle docking and fusion,
TRPM7 alpha-kinase domain also regulates synaptic vesicle mobility by an unknown mechanism (Brauchi et al., 2008). Synaptic vesicles are transported away from the cell body and down the axon to the synaptic cleft. This process of axonal transport is now
91 known to occur on microtubules. The microtubules in axons are positioned and oriented with their plus (+) ends toward the axon terminal. Kinesin and dynein are motors responsible for transport on microtubules. Kinesin transports materials towards the (+) end and proceeds from the cell body to the synaptic junctions, whereas dynein accounts for transport in the opposite direction, moving substances toward cell body. Studies of vesicle transport indicate that phosphorylation of kinesin provides a possible mechanism to alter vesicle motility by reducing kinesin ability to bind vesicles and microtubules
(Morfini et al., 2002; Okada et al., 1995; Sato-Yoshitake et al., 1992). Phosphorylated kinesin has been shown to have significantly reduced ability to bind synaptic vesicles.
Moreover, synaptic vesicles pre-incubated with phosphorylated kinesin associated less frequently with microtubules than synaptic vesicles pre-incubated with unphosphorylated kinesin, which in turn may reduce the efficiency for synaptic vesicle transport hence a decrease in synaptic vesicle motility (Sato-Yoshitake et al., 1992). Similarly, TRPM7 alpha-kinase may regulate synaptic vesicle motility through the phosphorylation of kinesin or other microtubule associating proteins.
Synaptic vesicle docking and fusion are mediated by the assembly of a stable
SNARE core complex of proteins including both synaptic vesicle membrane proteins including VAMP2, snapin (Ilardi et al., 1999) and synaptotagmin (Yoshida et al., 1992)) and the plasma membrane proteins syntaxin (Bennett et al., 1992) and SNAP-25 (Oyler et al., 1989)). A model to explain TRPM7 function in synaptic vesicle docking and fusion may involve the interaction of TRPM7 with these SNARE proteins (Figure 12). Prior to the vesicle docking event, TRPM7 could interact with snapin and other synaptic vesicle proteins, syntaxin I and synaptotagmin I. As synaptic vesicles approach to the presyanptic
92 membrane and the docking process starts, the synaptic vesicle proteins, VAMP2 and synaptotagmin form the SNARE complex with the target membrane SNARE proteins,
SNAP25 and syntaxins (Pevsner et al., 1994; Sollner et al., 1993). Snapin may also interact with SNAP25 to assist the docking event (Ilardi et al., 1999). Once a stable
SNARE complex is formed the fusion of the synaptic vesicle membrane into cell membrane may start.
93
Figure 12. Proposed Model of TRPM7 Function in Synaptic Vesicle Release
Synaptic vesicle is transported along microtubule by kinesin. TRPM7 regulates synaptic
vesicle motility by phosphorylating kinesin. During the docking process, SNARE
proteins on synaptic vesicle (VAMP2, snapin and synaptotagmin) bind SNARE proteins
on cell membrane (SNAP25 and syntaxin) to form a docking complex, following by fusion event of synaptic vesicle.
94
95 4.3.1 Future Studies of TRPM7 Associated Synaptic Vesicle Release
To investigate the proposed function of TRPM7 in mediating synaptic vesicle
transport, a TRPM7 kinase-dead mutant or channel mutant with abolished ion
conductivity could be used to examine the effect of TRPM7 kinase and channel activity
on synaptic vesicle release. Both peripheral cholinergic neurons (superior cervical
ganglia neuron cell line) and cortical neurons (HCN-1A cell line) would be transfected with TRPM7 kinase and channel mutant constructs. Recording of excitatory postsynaptic potential (EPSP), as a mean to evaluate synaptic vesicle release activity, in this comparison study can help to determine if TRPM7-mediated synaptic vesicle release in only limited to peripheral cholinergic neurons. Alternatively, the use of an in vitro binding or kinase assay and co-immunoprecipitation could check for direct binding of
TRPM7 to kinesin or synaptic vesicle proteins. Western blot would also be useful in examining phosphorylation changes in wild type or kinase-dead mutant expressing cells in order to identify synaptic vesicle proteins or microtubule associating proteins as substrates for the TRPM7 kinase. Next, mass spectrometry can be used to pinpoint phosphorylation sites on positive substrates of TRPM7 kinase. Finally, mutations at phosphorylation sites mimicking TRPM7 substrate phosphorylation and dephophorylation could determine the effect of TRPM7 kinase-dependent phosphorylation on synaptic vesicle mobility. Total Internal Reflection Fluorescence
(TIRF) Microscopy can be applied for such a purpose to observe changes in synaptic vesicle mobility in cells co-transfected with the phosphomutants and VAMP2- pHluorin, a synaptic vesicle marker. Any altered activites (changes in vesicle mobility) observed in cells expressing phospho-mutants of vesicle proteins or microtubule associating proteins
96 would be informative to show that TRPM7 dependent phosphorylation is required to regulate synaptic vesicle motility.
97 5. Summary
This project was designed to gain insight into the functions and protein-protein interaction of the TRPM7 channel. C-terminal TRPM7-GST fusion proteins containing mainly the alpha-kinase domain were used as bait to capture endogenous TRPM7 associating proteins in mouse brain lysate. Initially, MALDI-TOF mass spectrometry was used to determine TRPM7 interactors in samples (from pull-down assay) resolved on 1D
SDS-PAGE gel electrophoresis. In total, three TRPM7 associating proteins were identified using MALDI-TOF analysis: beta-tubulin, beta-actin and nebulin-related anchoring protein. Due the resolving limit of 1D SDS-PAGE gel and detection limit of
Coomassie Brilliant Blue stain, we used an alternative approach, LC-MS/MS, to identify
TRPM7 associating proteins. According to the result from LC-MS/MS analysis, identified TRPM7 associated proteins can be divided into 3 different groups: cytoskeleton proteins, synaptic vesicle proteins and ATPase. The identification of cytoskeletal proteins and synaptic vesicle proteins is not surprising since it is consistent with the suggested functions of TRPM7 in cytoskeleton remodeling and synaptic vesicle release from literatures. Moreover, our result suggests that in addition to the N-terminal domain, the C-terminal region of TRPM7 may also associate with synaptic vesicle proteins to bring assistance to the docking and fusion events of synaptic vesicles.
Co-immunprecipitation experiments were used to confirm specific association of
TRPM7 with cytoskeletal protein, beta-actin and beta-tubulin. Both beta-actin and beta- tubulin were co-precipitated along with TRPM7 by TRPM7 antibody but not by normal rabbit IgG. As an indication, TRPM7 may associate with the two cytoskeletal proteins through direct interactions. However, further investigation with microtubule binding
98 proteins assay and in vitro protein interaction assay has disproved this possibility; both experimental results consistently indicate that TRPM7 does not directly interact with microtubules or soluble tubulin subunits. Therefore one or more microtubule binding or accessory proteins must be involved in the association between TRPM7 and microtubules. This study has contributed evidence to strengthen the small body of published literature that implicates TRPM7 in cytoskeleton remodeling and synaptic vesicle release. Based on the results presented here and the findings from other research groups we have postulated physiological models to explain the role that TRPM7 may play in regulating cytoskeletal dynamics and synaptic vesicle release..
99 6. Reference List
Aarts,M., Iihara,K., Wei,W.L., Xiong,Z.G., Arundine,M., Cerwinski,W., MacDonald,J.F., and Tymianski,M. (2003). A key role for TRPM7 channels in anoxic neuronal death. Cell 115, 863-877.
Aarts,M.M. and Tymianski,M. (2005a). TRPM7 and ischemic CNS injury. Neuroscientist. 11, 116-123.
Aarts,M.M. and Tymianski,M. (2005b). TRPMs and neuronal cell death. Pflugers Arch. 451, 243-249.
Abed,E. and Moreau,R. (2007). Importance of melastatin-like transient receptor potential 7 and cations (magnesium, calcium) in human osteoblast-like cell proliferation. Cell Prolif. 40, 849-865.
Al-Alwan,M.M., Liwski,R.S., Haeryfar,S.M., Baldridge,W.H., Hoskin,D.W., Rowden,G., and West,K.A. (2003). Cutting edge: dendritic cell actin cytoskeletal polarization during immunological synapse formation is highly antigen-dependent. J. Immunol. 171, 4479-4483.
Arur,S., Uche,U.E., Rezaul,K., Fong,M., Scranton,V., Cowan,A.E., Mohler,W., and Han,D.K. (2003). Annexin I is an endogenous ligand that mediates apoptotic cell engulfment. Dev. Cell 4, 587-598.
Averbeck,M., Braun,T., Pfeifer,G., Sleeman,J., Dudda,J., Martin,S.F., Kremer,B., Aktories,K., Simon,J.C., and Termeer,C. (2004). Early cytoskeletal rearrangement during dendritic cell maturation enhances synapse formation and Ca(2+) signaling in CD8(+) T cells. Eur. J. Immunol. 34, 2708-2719.
100 Barr,M.M., DeModena,J., Braun,D., Nguyen,C.Q., Hall,D.H., and Sternberg,P.W. (2001). The Caenorhabditis elegans autosomal dominant polycystic kidney disease gene homologs lov-1 and pkd-2 act in the same pathway. Curr. Biol. 11, 1341-1346.
Benfenati,F., Valtorta,F., and Greengard,P. (1991). Computer modeling of synapsin I binding to synaptic vesicles and F-actin: implications for regulation of neurotransmitter release. Proc. Natl. Acad. Sci. U. S. A 88, 575-579.
Bennett,M.K., Calakos,N., and Scheller,R.H. (1992). Syntaxin: a synaptic protein implicated in docking of synaptic vesicles at presynaptic active zones. Science 257, 255-259.
Birukov,K.G., Birukova,A.A., Dudek,S.M., Verin,A.D., Crow,M.T., Zhan,X., DePaola,N., and Garcia,J.G. (2002). Shear stress-mediated cytoskeletal remodeling and cortactin translocation in pulmonary endothelial cells. Am. J. Respir. Cell Mol. Biol. 26, 453-464.
Brauchi,S., Krapivinsky,G., Krapivinsky,L., and Clapham,D.E. (2008). TRPM7 facilitates cholinergic vesicle fusion with the plasma membrane. Proc. Natl. Acad. Sci. U. S. A 105, 8304-8308.
Burre,J., Beckhaus,T., Corvey,C., Karas,M., Zimmermann,H., and Volknandt,W. (2006). Synaptic vesicle proteins under conditions of rest and activation: analysis by 2-D difference gel electrophoresis. Electrophoresis 27, 3488-3496.
Caterina,M.J., Rosen,T.A., Tominaga,M., Brake,A.J., and Julius,D. (1999). A capsaicin- receptor homologue with a high threshold for noxious heat. Nature 398, 436-441.
Caterina,M.J., Schumacher,M.A., Tominaga,M., Rosen,T.A., Levine,J.D., and Julius,D. (1997). The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816-824.
Choi,D.W., Koh,J.Y., and Peters,S. (1988). Pharmacology of glutamate neurotoxicity in cortical cell culture: attenuation by NMDA antagonists. J. Neurosci. 8, 185-196.
101 Choi,D.W., Maulucci-Gedde,M., and Kriegstein,A.R. (1987). Glutamate neurotoxicity in cortical cell culture. J. Neurosci. 7, 357-368.
Chubanov,V., Waldegger,S., Schnitzler,M., Vitzthum,H., Sassen,M.C., Seyberth,H.W., Konrad,M., and Gudermann,T. (2004). Disruption of TRPM6/TRPM7 complex formation by a mutation in the TRPM6 gene causes hypomagnesemia with secondary hypocalcemia. Proc. Natl. Acad. Sci. U. S. A 101, 2894-2899.
Clapham,D.E. (2003). TRP channels as cellular sensors. Nature 426, 517-524.
Clapham,D.E., Runnels,L.W., and Strubing,C. (2001). The TRP ion channel family. Nat. Rev. Neurosci. 2, 387-396.
Clark,K., Langeslag,M., van,L.B., Ran,L., Ryazanov,A.G., Figdor,C.G., Moolenaar,W.H., Jalink,K., and van Leeuwen,F.N. (2006). TRPM7, a novel regulator of actomyosin contractility and cell adhesion. EMBO J. 25, 290-301.
Clark,K., Middelbeek,J., Dorovkov,M.V., Figdor,C.G., Ryazanov,A.G., Lasonder,E., and van Leeuwen,F.N. (2008a). The alpha-kinases TRPM6 and TRPM7, but not eEF- 2 kinase, phosphorylate the assembly domain of myosin IIA, IIB and IIC. FEBS Lett. 582, 2993-2997.
Clark,K., Middelbeek,J., Lasonder,E., Dulyaninova,N.G., Morrice,N.A., Ryazanov,A.G., Bresnick,A.R., Figdor,C.G., and van Leeuwen,F.N. (2008b). TRPM7 regulates myosin IIA filament stability and protein localization by heavy chain phosphorylation. J. Mol. Biol. 378, 790-803.
Clark,K., Middelbeek,J., Morrice,N.A., Figdor,C.G., Lasonder,E., and van Leeuwen,F.N. (2008c). Massive autophosphorylation of the Ser/Thr-rich domain controls protein kinase activity of TRPM6 and TRPM7. PLoS. ONE. 3, e1876.
Cote,G.P. and Bukiejko,U. (1987). Purification and characterization of a myosin heavy chain kinase from Dictyostelium discoideum. J. Biol. Chem. 262, 1065-1072.
102 Cote,G.P., Luo,X., Murphy,M.B., and Egelhoff,T.T. (1997). Mapping of the novel protein kinase catalytic domain of Dictyostelium myosin II heavy chain kinase A. J. Biol. Chem. 272, 6846-6849.
Crawley,S.W. and Cote,G.P. (2009). Identification of dimer interactions required for the catalytic activity of the TRPM7 alpha-kinase domain. Biochem. J. 420, 115-122.
DeMali,K.A. and Burridge,K. (2003). Coupling membrane protrusion and cell adhesion. J. Cell Sci. 116, 2389-2397.
DeMali,K.A., Wennerberg,K., and Burridge,K. (2003). Integrin signaling to the actin cytoskeleton. Curr. Opin. Cell Biol. 15, 572-582.
Dillon,C. and Goda,Y. (2005). The actin cytoskeleton: integrating form and function at the synapse. Annu. Rev. Neurosci. 28, 25-55.
Dorovkov,M.V., Beznosov,S.N., Shakh,S., Kotlianskaia,L., and Kostiukova,A.S. (2008). [Effect of mutations imitating the phosphorylation by TRPM7 kinase on the function of the N-terminal domain of tropomodulin]. Biofizika 53, 943-949.
Dorovkov,M.V. and Ryazanov,A.G. (2004). Phosphorylation of annexin I by TRPM7 channel-kinase. J. Biol. Chem. 279, 50643-50646.
Drennan,D. and Ryazanov,A.G. (2004). Alpha-kinases: analysis of the family and comparison with conventional protein kinases. Prog. Biophys. Mol. Biol. 85, 1- 32.
Dulyaninova,N.G., Malashkevich,V.N., Almo,S.C., and Bresnick,A.R. (2005). Regulation of myosin-IIA assembly and Mts1 binding by heavy chain phosphorylation. Biochemistry 44, 6867-6876.
Duncan,L.M., Deeds,J., Hunter,J., Shao,J., Holmgren,L.M., Woolf,E.A., Tepper,R.I., and Shyjan,A.W. (1998). Down-regulation of the novel gene melastatin correlates with potential for melanoma metastasis. Cancer Res. 58, 1515-1520.
103 Erler,I., Al-Ansary,D.M., Wissenbach,U., Wagner,T.F., Flockerzi,V., and Niemeyer,B.A. (2006). Trafficking and assembly of the cold-sensitive TRPM8 channel. J. Biol. Chem. 281, 38396-38404.
Fleig,A. and Penner,R. (2004). The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends Pharmacol. Sci. 25, 633-639.
Fonfria,E., Marshall,I.C., Benham,C.D., Boyfield,I., Brown,J.D., Hill,K., Hughes,J.P., Skaper,S.D., and McNulty,S. (2004). TRPM2 channel opening in response to oxidative stress is dependent on activation of poly(ADP-ribose) polymerase. Br. J. Pharmacol. 143, 186-192.
Fonfria,E., Marshall,I.C., Boyfield,I., Skaper,S.D., Hughes,J.P., Owen,D.E., Zhang,W., Miller,B.A., Benham,C.D., and McNulty,S. (2005). Amyloid beta-peptide(1-42) and hydrogen peroxide-induced toxicity are mediated by TRPM2 in rat primary striatal cultures. J. Neurochem. 95, 715-723.
Forscher,P. (1989). Calcium and polyphosphoinositide control of cytoskeletal dynamics. Trends Neurosci. 12, 468-474.
Fujiwara,Y. and Minor,D.L., Jr. (2008). X-ray crystal structure of a TRPM assembly domain reveals an antiparallel four-stranded coiled-coil. J. Mol. Biol. 383, 854- 870.
Futey,L.M., Medley,Q.G., Cote,G.P., and Egelhoff,T.T. (1995). Structural analysis of myosin heavy chain kinase A from Dictyostelium. Evidence for a highly divergent protein kinase domain, an amino-terminal coiled-coil domain, and a domain homologous to the beta-subunit of heterotrimeric G proteins. J. Biol. Chem. 270, 523-529.
Gaffield,M.A., Rizzoli,S.O., and Betz,W.J. (2006). Mobility of synaptic vesicles in different pools in resting and stimulated frog motor nerve terminals. Neuron 51, 317-325.
104 Galbraith,C.G., Skalak,R., and Chien,S. (1998). Shear stress induces spatial reorganization of the endothelial cell cytoskeleton. Cell Motil. Cytoskeleton 40, 317-330.
Gaudet,R. (2008). A primer on ankyrin repeat function in TRP channels and beyond. Mol. Biosyst. 4, 372-379.
Geiger,B. and Bershadsky,A. (2002). Exploring the neighborhood: adhesion-coupled cell mechanosensors. Cell 110, 139-142.
Gerke,V., Creutz,C.E., and Moss,S.E. (2005). Annexins: linking Ca2+ signalling to membrane dynamics. Nat. Rev. Mol. Cell Biol. 6, 449-461.
Gkika,D., Hsu,Y.J., van der Kemp,A.W., Christakos,S., Bindels,R.J., and Hoenderop,J.G. (2006). Critical role of the epithelial Ca2+ channel TRPV5 in active Ca2+ reabsorption as revealed by TRPV5/calbindin-D28K knockout mice. J. Am. Soc. Nephrol. 17, 3020-3027.
Goldberg,M.P., Weiss,J.H., Pham,P.C., and Choi,D.W. (1987). N-methyl-D-aspartate receptors mediate hypoxic neuronal injury in cortical culture. J. Pharmacol. Exp. Ther. 243, 784-791.
Grimm,C., Kraft,R., Sauerbruch,S., Schultz,G., and Harteneck,C. (2003). Molecular and functional characterization of the melastatin-related cation channel TRPM3. J. Biol. Chem. 278, 21493-21501.
Grimm,C., Kraft,R., Schultz,G., and Harteneck,C. (2005). Activation of the melastatin- related cation channel TRPM3 by D-erythro-sphingosine [corrected]. Mol. Pharmacol. 67, 798-805.
Guatimosim,C., Hull,C., Von,G.H., and Prado,M.A. (2002). Okadaic acid disrupts synaptic vesicle trafficking in a ribbon-type synapse. J. Neurochem. 82, 1047- 1057.
105 Hanano,T., Hara,Y., Shi,J., Morita,H., Umebayashi,C., Mori,E., Sumimoto,H., Ito,Y., Mori,Y., and Inoue,R. (2004). Involvement of TRPM7 in cell growth as a spontaneously activated Ca2+ entry pathway in human retinoblastoma cells. J. Pharmacol. Sci. 95, 403-419.
Hara,Y., Wakamori,M., Ishii,M., Maeno,E., Nishida,M., Yoshida,T., Yamada,H., Shimizu,S., Mori,E., Kudoh,J., Shimizu,N., Kurose,H., Okada,Y., Imoto,K., and Mori,Y. (2002). LTRPC2 Ca2+-permeable channel activated by changes in redox status confers susceptibility to cell death. Mol. Cell 9, 163-173.
Hirokawa,N., Sobue,K., Kanda,K., Harada,A., and Yorifuji,H. (1989). The cytoskeletal architecture of the presynaptic terminal and molecular structure of synapsin 1. J. Cell Biol. 108, 111-126.
Hofmann,T., Chubanov,V., Gudermann,T., and Montell,C. (2003). TRPM5 is a voltage- modulated and Ca(2+)-activated monovalent selective cation channel. Curr. Biol. 13, 1153-1158.
Hostetter,D., Rice,S., Dean,S., Altman,D., McMahon,P.M., Sutton,S., Tripathy,A., and Spudich,J.A. (2004). Dictyostelium myosin bipolar thick filament formation: importance of charge and specific domains of the myosin rod. PLoS. Biol. 2, e356.
Ilardi,J.M., Mochida,S., and Sheng,Z.H. (1999). Snapin: a SNARE-associated protein implicated in synaptic transmission. Nat. Neurosci. 2, 119-124.
Jaquemar,D., Schenker,T., and Trueb,B. (1999). An ankyrin-like protein with transmembrane domains is specifically lost after oncogenic transformation of human fibroblasts. J. Biol. Chem. 274, 7325-7333.
Jiang,J., Li,M., and Yue,L. (2005). Potentiation of TRPM7 inward currents by protons. J. Gen. Physiol 126, 137-150.
Jiang,X., Newell,E.W., and Schlichter,L.C. (2003). Regulation of a TRPM7-like current in rat brain microglia. J. Biol. Chem. 278, 42867-42876.
106 Jordt,S.E. and Julius,D. (2002). Molecular basis for species-specific sensitivity to "hot" chili peppers. Cell 108, 421-430.
Kanki,H., Kupershmidt,S., Yang,T., Wells,S., and Roden,D.M. (2004). A structural requirement for processing the cardiac K+ channel KCNQ1. J. Biol. Chem. 279, 33976-33983.
Kendrick-Jones,J., Smith,R.C., Craig,R., Cande,W.Z., Tooth,P.J., and Scholey,J.M. (1983). The role of myosin light chain phosphorylation in the regulation of contractile activity. Biochem. Soc. Trans. 11, 154.
Kim,B.J., Park,E.J., Lee,J.H., Jeon,J.H., Kim,S.J., and So,I. (2008). Suppression of transient receptor potential melastatin 7 channel induces cell death in gastric cancer. Cancer Sci. 99, 2502-2509.
Kimberling,W.J., Fain,P.R., Kenyon,J.B., Goldgar,D., Sujansky,E., and Gabow,P.A. (1988). Linkage heterogeneity of autosomal dominant polycystic kidney disease. N. Engl. J. Med. 319, 913-918.
Kolisek,M., Beck,A., Fleig,A., and Penner,R. (2005). Cyclic ADP-ribose and hydrogen peroxide synergize with ADP-ribose in the activation of TRPM2 channels. Mol. Cell 18, 61-69.
Kostyukova,A.S. and Hitchcock-Degregori,S.E. (2004). Effect of the structure of the N terminus of tropomyosin on tropomodulin function. J. Biol. Chem. 279, 5066- 5071.
Kostyukova,A.S., Hitchcock-Degregori,S.E., and Greenfield,N.J. (2007). Molecular basis of tropomyosin binding to tropomodulin, an actin-capping protein. J. Mol. Biol. 372, 608-618.
Kostyukova,A.S., Rapp,B.A., Choy,A., Greenfield,N.J., and Hitchcock-Degregori,S.E. (2005). Structural requirements of tropomodulin for tropomyosin binding and actin filament capping. Biochemistry 44, 4905-4910.
107 Krapivinsky,G., Mochida,S., Krapivinsky,L., Cibulsky,S.M., and Clapham,D.E. (2006). The TRPM7 ion channel functions in cholinergic synaptic vesicles and affects transmitter release. Neuron 52, 485-496.
Krieger,I., Kostyukova,A., Yamashita,A., Nitanai,Y., and Maeda,Y. (2002). Crystal structure of the C-terminal half of tropomodulin and structural basis of actin filament pointed-end capping. Biophys. J. 83, 2716-2725.
Laemmli,U.K., Beguin,F., and Gujer-Kellenberger,G. (1970). A factor preventing the major head protein of bacteriophage T4 from random aggregation. J. Mol. Biol. 47, 69-85.
Langeslag,M., Clark,K., Moolenaar,W.H., van Leeuwen,F.N., and Jalink,K. (2007). Activation of TRPM7 channels by phospholipase C-coupled receptor agonists. J. Biol. Chem. 282, 232-239.
Launay,P., Fleig,A., Perraud,A.L., Scharenberg,A.M., Penner,R., and Kinet,J.P. (2002). TRPM4 is a Ca2+-activated nonselective cation channel mediating cell membrane depolarization. Cell 109, 397-407.
Lee,N., Chen,J., Sun,L., Wu,S., Gray,K.R., Rich,A., Huang,M., Lin,J.H., Feder,J.N., Janovitz,E.B., Levesque,P.C., and Blanar,M.A. (2003). Expression and characterization of human transient receptor potential melastatin 3 (hTRPM3). J. Biol. Chem. 278, 20890-20897.
Li,Z. and Murthy,V.N. (2001). Visualizing postendocytic traffic of synaptic vesicles at hippocampal synapses. Neuron 31, 593-605.
Liedtke,W., Choe,Y., Marti-Renom,M.A., Bell,A.M., Denis,C.S., Sali,A., Hudspeth,A.J., Friedman,J.M., and Heller,S. (2000). Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor. Cell 103, 525- 535.
108 Liedtke,W., Tobin,D.M., Bargmann,C.I., and Friedman,J.M. (2003). Mammalian TRPV4 (VR-OAC) directs behavioral responses to osmotic and mechanical stimuli in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A 100 Suppl 2, 14531-14536.
Linder,S. and Aepfelbacher,M. (2003). Podosomes: adhesion hot-spots of invasive cells. Trends Cell Biol. 13, 376-385.
Liu,B. and Qin,F. (2005). Functional control of cold- and menthol-sensitive TRPM8 ion channels by phosphatidylinositol 4,5-bisphosphate. J. Neurosci. 25, 1674-1681.
Liu,D. and Liman,E.R. (2003). Intracellular Ca2+ and the phospholipid PIP2 regulate the taste transduction ion channel TRPM5. Proc. Natl. Acad. Sci. U. S. A 100, 15160- 15165.
Lu,L., Feng,Y., Hucker,W.J., Oswald,S.J., Longmore,G.D., and Yin,F.C. (2008a). Actin stress fiber pre-extension in human aortic endothelial cells. Cell Motil. Cytoskeleton 65, 281-294.
Lu,L., Oswald,S.J., Ngu,H., and Yin,F.C. (2008b). Mechanical properties of actin stress fibers in living cells. Biophys. J. 95, 6060-6071.
Luck-Vielmetter,D., Schleicher,M., Grabatin,B., Wippler,J., and Gerisch,G. (1990). Replacement of threonine residues by serine and alanine in a phosphorylatable heavy chain fragment of Dictyostelium myosin II. FEBS Lett. 269, 239-243.
Luo,G., Leroy,E., Kozak,C.A., Polymeropoulos,M.H., and Horowits,R. (1997a). Mapping of the gene (NRAP) encoding N-RAP in the mouse and human genomes. Genomics 45, 229-232.
Luo,G., Zhang,J.Q., Nguyen,T.P., Herrera,A.H., Paterson,B., and Horowits,R. (1997b). Complete cDNA sequence and tissue localization of N-RAP, a novel nebulin- related protein of striated muscle. Cell Motil. Cytoskeleton 38, 75-90.
Lupas,A.N. and Gruber,M. (2005). The structure of alpha-helical coiled coils. Adv. Protein Chem. 70, 37-78.
109 MacPherson,L.J., Geierstanger,B.H., Viswanath,V., Bandell,M., Eid,S.R., Hwang,S., and Patapoutian,A. (2005). The pungency of garlic: activation of TRPA1 and TRPV1 in response to allicin. Curr. Biol. 15, 929-934.
Malek,A.M. and Izumo,S. (1996). Mechanism of endothelial cell shape change and cytoskeletal remodeling in response to fluid shear stress. J. Cell Sci. 109 ( Pt 4), 713-726.
Maljevic,S., Lerche,C., Seebohm,G., Alekov,A.K., Busch,A.E., and Lerche,H. (2003). C- terminal interaction of KCNQ2 and KCNQ3 K+ channels. J. Physiol 548, 353- 360.
Matsushita,M., Kozak,J.A., Shimizu,Y., McLachlin,D.T., Yamaguchi,H., Wei,F.Y., Tomizawa,K., Matsui,H., Chait,B.T., Cahalan,M.D., and Nairn,A.C. (2005). Channel function is dissociated from the intrinsic kinase activity and autophosphorylation of TRPM7/ChaK1. J. Biol. Chem. 280, 20793-20803.
McKemy,D.D., Neuhausser,W.M., and Julius,D. (2002). Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416, 52-58.
McNamara,F.N., Randall,A., and Gunthorpe,M.J. (2005). Effects of piperine, the pungent component of black pepper, at the human vanilloid receptor (TRPV1). Br. J. Pharmacol. 144, 781-790.
McNeill,M.S., Paulsen,J., Bonde,G., Burnight,E., Hsu,M.Y., and Cornell,R.A. (2007). Cell death of melanophores in zebrafish trpm7 mutant embryos depends on melanin synthesis. J. Invest Dermatol. 127, 2020-2030.
Mochizuki,T., Wu,G., Hayashi,T., Xenophontos,S.L., Veldhuisen,B., Saris,J.J., Reynolds,D.M., Cai,Y., Gabow,P.A., Pierides,A., Kimberling,W.J., Breuning,M.H., Deltas,C.C., Peters,D.J., and Somlo,S. (1996). PKD2, a gene for polycystic kidney disease that encodes an integral membrane protein. Science 272, 1339-1342.
110 Monteilh-Zoller,M.K., Hermosura,M.C., Nadler,M.J., Scharenberg,A.M., Penner,R., and Fleig,A. (2003). TRPM7 provides an ion channel mechanism for cellular entry of trace metal ions. J. Gen. Physiol 121, 49-60.
Montell,C. (2003). Mg2+ homeostasis: the Mg2+nificent TRPM chanzymes. Curr. Biol. 13, R799-R801.
Montell,C. (2005a). The TRP superfamily of cation channels. Sci. STKE. 2005, re3.
Montell,C. (2005b). TRP channels in Drosophila photoreceptor cells. J. Physiol 567, 45- 51.
Montell,C. and Rubin,G.M. (1989). Molecular characterization of the Drosophila trp locus: a putative integral membrane protein required for phototransduction. Neuron 2, 1313-1323.
Morfini,G., Szebenyi,G., Elluru,R., Ratner,N., and Brady,S.T. (2002). Glycogen synthase kinase 3 phosphorylates kinesin light chains and negatively regulates kinesin- based motility. EMBO J. 21, 281-293.
Mosavi,L.K., Cammett,T.J., Desrosiers,D.C., and Peng,Z.Y. (2004). The ankyrin repeat as molecular architecture for protein recognition. Protein Sci. 13, 1435-1448.
Mudry,R.E., Perry,C.N., Richards,M., Fowler,V.M., and Gregorio,C.C. (2003). The interaction of tropomodulin with tropomyosin stabilizes thin filaments in cardiac myocytes. J. Cell Biol. 162, 1057-1068.
Murakami,M., Xu,F., Miyoshi,I., Sato,E., Ono,K., and Iijima,T. (2003). Identification and characterization of the murine TRPM4 channel. Biochem. Biophys. Res. Commun. 307, 522-528.
Nadler,M.J., Hermosura,M.C., Inabe,K., Perraud,A.L., Zhu,Q., Stokes,A.J., Kurosaki,T., Kinet,J.P., Penner,R., Scharenberg,A.M., and Fleig,A. (2001). LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature 411, 590-595.
111 Nehls,V. and Drenckhahn,D. (1991). Demonstration of actin filament stress fibers in microvascular endothelial cells in situ. Microvasc. Res. 42, 103-112.
Nelson,G., Hoon,M.A., Chandrashekar,J., Zhang,Y., Ryba,N.J., and Zuker,C.S. (2001). Mammalian sweet taste receptors. Cell 106, 381-390.
Ngu,H., Lu,L., Oswald,S.J., Davis,S., Nag,S., and Yin,F.C. (2008). Strain-induced orientation response of endothelial cells: effect of substratum adhesiveness and actin-myosin contractile level. Mol. Cell Biomech. 5, 69-81.
Nilius,B., Mahieu,F., Prenen,J., Janssens,A., Owsianik,G., Vennekens,R., and Voets,T. (2006). The Ca2+-activated cation channel TRPM4 is regulated by phosphatidylinositol 4,5-biphosphate. EMBO J. 25, 467-478.
Nilius,B., Prenen,J., Droogmans,G., Voets,T., Vennekens,R., Freichel,M., Wissenbach,U., and Flockerzi,V. (2003). Voltage dependence of the Ca2+- activated cation channel TRPM4. J. Biol. Chem. 278, 30813-30820.
Oancea,E., Vriens,J., Brauchi,S., Jun,J., Splawski,I., and Clapham,D.E. (2009). TRPM1 forms ion channels associated with melanin content in melanocytes. Sci. Signal. 2, ra21.
Oancea,E., Wolfe,J.T., and Clapham,D.E. (2006a). Functional TRPM7 channels accumulate at the plasma membrane in response to fluid flow. Circ. Res. 98, 245- 253.
Oancea,E., Wolfe,J.T., and Clapham,D.E. (2006b). Functional TRPM7 channels accumulate at the plasma membrane in response to fluid flow. Circ. Res. 98, 245- 253.
Oberwinkler,J., Lis,A., Giehl,K.M., Flockerzi,V., and Philipp,S.E. (2005). Alternative splicing switches the divalent cation selectivity of TRPM3 channels. J. Biol. Chem. 280, 22540-22548.
112 Okada,Y., Sato-Yoshitake,R., and Hirokawa,N. (1995). The activation of protein kinase A pathway selectively inhibits anterograde axonal transport of vesicles but not mitochondria transport or retrograde transport in vivo. J. Neurosci. 15, 3053- 3064.
Ono,S. and Ono,K. (2002). Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics. J. Cell Biol. 156, 1065-1076.
Oyler,G.A., Higgins,G.A., Hart,R.A., Battenberg,E., Billingsley,M., Bloom,F.E., and Wilson,M.C. (1989). The identification of a novel synaptosomal-associated protein, SNAP-25, differentially expressed by neuronal subpopulations. J. Cell Biol. 109, 3039-3052.
Peier,A.M., Moqrich,A., Hergarden,A.C., Reeve,A.J., Andersson,D.A., Story,G.M., Earley,T.J., Dragoni,I., McIntyre,P., Bevan,S., and Patapoutian,A. (2002). A TRP channel that senses cold stimuli and menthol. Cell 108, 705-715.
Penner,R. and Fleig,A. (2007). The Mg2+ and Mg(2+)-nucleotide-regulated channel- kinase TRPM7. Handb. Exp. Pharmacol. 313-328.
Perraud,A.L., Fleig,A., Dunn,C.A., Bagley,L.A., Launay,P., Schmitz,C., Stokes,A.J., Zhu,Q., Bessman,M.J., Penner,R., Kinet,J.P., and Scharenberg,A.M. (2001). ADP-ribose gating of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology. Nature 411, 595-599.
Peters,D.J. and Sandkuijl,L.A. (1992). Genetic heterogeneity of polycystic kidney disease in Europe. Contrib. Nephrol. 97, 128-139.
Pevsner,J., Hsu,S.C., Braun,J.E., Calakos,N., Ting,A.E., Bennett,M.K., and Scheller,R.H. (1994). Specificity and regulation of a synaptic vesicle docking complex. Neuron 13, 353-361.
Pinna,L.A. and Ruzzene,M. (1996). How do protein kinases recognize their substrates? Biochim. Biophys. Acta 1314, 191-225.
113 Prawitt,D., Monteilh-Zoller,M.K., Brixel,L., Spangenberg,C., Zabel,B., Fleig,A., and Penner,R. (2003). TRPM5 is a transient Ca2+-activated cation channel responding to rapid changes in [Ca2+]i. Proc. Natl. Acad. Sci. U. S. A 100, 15166-15171.
Ramsey,I.S., Delling,M., and Clapham,D.E. (2006). An introduction to TRP channels. Annu. Rev. Physiol 68, 619-647.
Reiser,J., Polu,K.R., Moller,C.C., Kenlan,P., Altintas,M.M., Wei,C., Faul,C., Herbert,S., Villegas,I., vila-Casado,C., McGee,M., Sugimoto,H., Brown,D., Kalluri,R., Mundel,P., Smith,P.L., Clapham,D.E., and Pollak,M.R. (2005). TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function. Nat. Genet. 37, 739-744.
Renkema,K.Y., Nijenhuis,T., van der Eerden,B.C., van der Kemp,A.W., Weinans,H., van Leeuwen,J.P., Bindels,R.J., and Hoenderop,J.G. (2005). Hypervitaminosis D mediates compensatory Ca2+ hyperabsorption in TRPV5 knockout mice. J. Am. Soc. Nephrol. 16, 3188-3195.
Runnels,L.W., Yue,L., and Clapham,D.E. (2001). TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science 291, 1043-1047.
Runnels,L.W., Yue,L., and Clapham,D.E. (2002). The TRPM7 channel is inactivated by PIP(2) hydrolysis. Nat. Cell Biol. 4, 329-336.
Ryazanov,A.G., Pavur,K.S., and Dorovkov,M.V. (1999). Alpha-kinases: a new class of protein kinases with a novel catalytic domain. Curr. Biol. 9, R43-R45.
Ryazanov,A.G., Ward,M.D., Mendola,C.E., Pavur,K.S., Dorovkov,M.V., Wiedmann,M., Erdjument-Bromage,H., Tempst,P., Parmer,T.G., Prostko,C.R., Germino,F.J., and Hait,W.N. (1997). Identification of a new class of protein kinases represented by eukaryotic elongation factor-2 kinase. Proc. Natl. Acad. Sci. U. S. A 94, 4884- 4889.
114 Ryazanova,L.V., Dorovkov,M.V., Ansari,A., and Ryazanov,A.G. (2004). Characterization of the protein kinase activity of TRPM7/ChaK1, a protein kinase fused to the transient receptor potential ion channel. J. Biol. Chem. 279, 3708- 3716.
Rycroft,B.K. and Gibb,A.J. (2002). Direct effects of calmodulin on NMDA receptor single-channel gating in rat hippocampal granule cells. J. Neurosci. 22, 8860- 8868.
Rycroft,B.K. and Gibb,A.J. (2004). Regulation of single NMDA receptor channel activity by alpha-actinin and calmodulin in rat hippocampal granule cells. J. Physiol 557, 795-808.
Sano,Y., Inamura,K., Miyake,A., Mochizuki,S., Yokoi,H., Matsushime,H., and Furuichi,K. (2001). Immunocyte Ca2+ influx system mediated by LTRPC2. Science 293, 1327-1330.
Sato-Yoshitake,R., Yorifuji,H., Inagaki,M., and Hirokawa,N. (1992). The phosphorylation of kinesin regulates its binding to synaptic vesicles. J. Biol. Chem. 267, 23930-23936.
Schindl,R. and Romanin,C. (2007). Assembly domains in TRP channels. Biochem. Soc. Trans. 35, 84-85.
Schlingmann,K.P., Waldegger,S., Konrad,M., Chubanov,V., and Gudermann,T. (2007). TRPM6 and TRPM7--Gatekeepers of human magnesium metabolism. Biochim. Biophys. Acta 1772, 813-821.
Schlingmann,K.P., Weber,S., Peters,M., Niemann,N.L., Vitzthum,H., Klingel,K., Kratz,M., Haddad,E., Ristoff,E., Dinour,D., Syrrou,M., Nielsen,S., Sassen,M., Waldegger,S., Seyberth,H.W., and Konrad,M. (2002). Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 31, 166-170.
115 Schmitt,N., Schwarz,M., Peretz,A., Abitbol,I., Attali,B., and Pongs,O. (2000). A recessive C-terminal Jervell and Lange-Nielsen mutation of the KCNQ1 channel impairs subunit assembly. EMBO J. 19, 332-340.
Schmitz,C., Perraud,A.L., Johnson,C.O., Inabe,K., Smith,M.K., Penner,R., Kurosaki,T., Fleig,A., and Scharenberg,A.M. (2003). Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell 114, 191-200.
Schwake,M., Jentsch,T.J., and Friedrich,T. (2003). A carboxy-terminal domain determines the subunit specificity of KCNQ K+ channel assembly. EMBO Rep. 4, 76-81.
Smith,G.D., Gunthorpe,M.J., Kelsell,R.E., Hayes,P.D., Reilly,P., Facer,P., Wright,J.E., Jerman,J.C., Walhin,J.P., Ooi,L., Egerton,J., Charles,K.J., Smart,D., Randall,A.D., Anand,P., and Davis,J.B. (2002). TRPV3 is a temperature-sensitive vanilloid receptor-like protein. Nature 418, 186-190.
Smith,R.C., Cande,W.Z., Craig,R., Tooth,P.J., Scholey,J.M., and Kendrick-Jones,J. (1983). Regulation of myosin filament assembly by light-chain phosphorylation. Philos. Trans. R. Soc. Lond B Biol. Sci. 302, 73-82.
Sollner,T., Bennett,M.K., Whiteheart,S.W., Scheller,R.H., and Rothman,J.E. (1993). A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75, 409-418.
Steimle,P.A., Naismith,T., Licate,L., and Egelhoff,T.T. (2001). WD repeat domains target dictyostelium myosin heavy chain kinases by binding directly to myosin filaments. J. Biol. Chem. 276, 6853-6860.
Su,L.T., Agapito,M.A., Li,M., Simonson,W.T., Huttenlocher,A., Habas,R., Yue,L., and Runnels,L.W. (2006). TRPM7 regulates cell adhesion by controlling the calcium- dependent protease calpain. J. Biol. Chem. 281, 11260-11270.
Sun,H.Q., Yamamoto,M., Mejillano,M., and Yin,H.L. (1999). Gelsolin, a multifunctional actin regulatory protein. J. Biol. Chem. 274, 33179-33182.
116 Takahashi,M., Itakura,M., and Kataoka,M. (2003). New aspects of neurotransmitter release and exocytosis: regulation of neurotransmitter release by phosphorylation. J. Pharmacol. Sci. 93, 41-45.
Takezawa,R., Schmitz,C., Demeuse,P., Scharenberg,A.M., Penner,R., and Fleig,A. (2004). Receptor-mediated regulation of the TRPM7 channel through its endogenous protein kinase domain. Proc. Natl. Acad. Sci. U. S. A 101, 6009- 6014.
Talavera,K., Yasumatsu,K., Voets,T., Droogmans,G., Shigemura,N., Ninomiya,Y., Margolskee,R.F., and Nilius,B. (2005a). Heat activation of TRPM5 underlies thermal sensitivity of sweet taste. Nature 438, 1022-1025.
Talavera,K., Yasumatsu,K., Voets,T., Droogmans,G., Shigemura,N., Ninomiya,Y., Margolskee,R.F., and Nilius,B. (2005b). Heat activation of TRPM5 underlies thermal sensitivity of sweet taste. Nature 438, 1022-1025.
Talavera,K., Yasumatsu,K., Yoshida,R., Margolskee,R.F., Voets,T., Ninomiya,Y., and Nilius,B. (2008). The taste transduction channel TRPM5 is a locus for bitter- sweet taste interactions. FASEB J. 22, 1343-1355.
Tsuruda,P.R., Julius,D., and Minor,D.L., Jr. (2006). Coiled coils direct assembly of a cold-activated TRP channel. Neuron 51, 201-212.
Uemura,T., Kudoh,J., Noda,S., Kanba,S., and Shimizu,N. (2005). Characterization of human and mouse TRPM2 genes: identification of a novel N-terminal truncated protein specifically expressed in human striatum. Biochem. Biophys. Res. Commun. 328, 1232-1243.
Ullrich,N.D., Voets,T., Prenen,J., Vennekens,R., Talavera,K., Droogmans,G., and Nilius,B. (2005). Comparison of functional properties of the Ca2+-activated cation channels TRPM4 and TRPM5 from mice. Cell Calcium 37, 267-278.
Vazquez,E. and Valverde,M.A. (2006). A review of TRP channels splicing. Semin. Cell Dev. Biol. 17, 607-617.
117 Venkatachalam,K. and Montell,C. (2007). TRP channels. Annu. Rev. Biochem. 76, 387- 417.
Voets,T., Nilius,B., Hoefs,S., van der Kemp,A.W., Droogmans,G., Bindels,R.J., and Hoenderop,J.G. (2004). TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J. Biol. Chem. 279, 19-25.
Wagner,L.M., Fowler,V.M., and Takemoto,D.J. (2002). The interaction and phosphorylation of tropomodulin by protein kinase Calpha in N/N 1003A lens epithelial cells. Mol. Vis. 8, 394-406.
Walder,R.Y., Landau,D., Meyer,P., Shalev,H., Tsolia,M., Borochowitz,Z., Boettger,M.B., Beck,G.E., Englehardt,R.K., Carmi,R., and Sheffield,V.C. (2002). Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat. Genet. 31, 171-174.
Watanabe,H., Davis,J.B., Smart,D., Jerman,J.C., Smith,G.D., Hayes,P., Vriens,J., Cairns,W., Wissenbach,U., Prenen,J., Flockerzi,V., Droogmans,G., Benham,C.D., and Nilius,B. (2002). Activation of TRPV4 channels (hVRL-2/mTRP12) by phorbol derivatives. J. Biol. Chem. 277, 13569-13577.
Wehage,E., Eisfeld,J., Heiner,I., Jungling,E., Zitt,C., and Luckhoff,A. (2002). Activation of the cation channel long transient receptor potential channel 2 (LTRPC2) by hydrogen peroxide. A splice variant reveals a mode of activation independent of ADP-ribose. J. Biol. Chem. 277, 23150-23156.
Wen,H. and Levitan,I.B. (2002). Calmodulin is an auxiliary subunit of KCNQ2/3 potassium channels. J. Neurosci. 22, 7991-8001.
Wes,P.D., Chevesich,J., Jeromin,A., Rosenberg,C., Stetten,G., and Montell,C. (1995). TRPC1, a human homolog of a Drosophila store-operated channel. Proc. Natl. Acad. Sci. U. S. A 92, 9652-9656.
Woolfson,D.N. (2005). The design of coiled-coil structures and assemblies. Adv. Protein Chem. 70, 79-112.
118 Woudenberg-Vrenken,T.E., Bindels,R.J., and Hoenderop,J.G. (2009). The role of transient receptor potential channels in kidney disease. Nat. Rev. Nephrol.
Wu,G. and Somlo,S. (2000). Molecular genetics and mechanism of autosomal dominant polycystic kidney disease. Mol. Genet. Metab 69, 1-15.
Wykes,R.C., Lee,M., Duffy,S.M., Yang,W., Seward,E.P., and Bradding,P. (2007). Functional transient receptor potential melastatin 7 channels are critical for human mast cell survival. J. Immunol. 179, 4045-4052.
Wyszynski,M., Lin,J., Rao,A., Nigh,E., Beggs,A.H., Craig,A.M., and Sheng,M. (1997). Competitive binding of alpha-actinin and calmodulin to the NMDA receptor. Nature 385, 439-442.
Xie,Z. and Cai,T. (2003). Na+-K+--ATPase-mediated signal transduction: from protein interaction to cellular function. Mol. Interv. 3, 157-168.
Xu,H., Ramsey,I.S., Kotecha,S.A., Moran,M.M., Chong,J.A., Lawson,D., Ge,P., Lilly,J., Silos-Santiago,I., Xie,Y., DiStefano,P.S., Curtis,R., and Clapham,D.E. (2002). TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature 418, 181-186.
Xu,X.Z., Moebius,F., Gill,D.L., and Montell,C. (2001). Regulation of melastatin, a TRP- related protein, through interaction with a cytoplasmic isoform. Proc. Natl. Acad. Sci. U. S. A 98, 10692-10697.
Yamaguchi,H., Matsushita,M., Nairn,A.C., and Kuriyan,J. (2001). Crystal structure of the atypical protein kinase domain of a TRP channel with phosphotransferase activity. Mol. Cell 7, 1047-1057.
Yellen,G. (2002). The voltage-gated potassium channels and their relatives. Nature 419, 35-42.
119 Yoshida,A., Oho,C., Omori,A., Kuwahara,R., Ito,T., and Takahashi,M. (1992). HPC-1 is associated with synaptotagmin and omega-conotoxin receptor. J. Biol. Chem. 267, 24925-24928.
Yus-Najera,E., Santana-Castro,I., and Villarroel,A. (2002). The identification and characterization of a noncontinuous calmodulin-binding site in noninactivating voltage-dependent KCNQ potassium channels. J. Biol. Chem. 277, 28545-28553.
Zeevi,D.A., Frumkin,A., and Bach,G. (2007). TRPML and lysosomal function. Biochim. Biophys. Acta 1772, 851-858.
Zeevi,D.A., Frumkin,A., Offen-Glasner,V., Kogot-Levin,A., and Bach,G. (2009). A potentially dynamic lysosomal role for the endogenous TRPML proteins. J. Pathol.
Zhang,W., Chu,X., Tong,Q., Cheung,J.Y., Conrad,K., Masker,K., and Miller,B.A. (2003). A novel TRPM2 isoform inhibits calcium influx and susceptibility to cell death. J. Biol. Chem. 278, 16222-16229.
Zhang,Z., Okawa,H., Wang,Y., and Liman,E.R. (2005). Phosphatidylinositol 4,5- bisphosphate rescues TRPM4 channels from desensitization. J. Biol. Chem. 280, 39185-39192.
120 Appendix 1
Cloning with TRPM7 cDNA
TRPM7 cDNA carried by pcDNATM4 TOPO plasmid from invitrogen was used. Multiple restrictions sites (as listed in Tables below) located on TRPM7 cDNA were targeted to excise the different C-terminal regions of interest (refer to Materials and Methods section, Figure 4) for the purpose to generate fusion constructs (#1, 4-7). Fusion constructs #2 and #3 were generated with PCR cloning instead of conventional cloning methods due to the difficulties to locate suitable restriction sites on TRPM7 cDNA map.
Excised TRPM7 cDNA segments were inserted into pGEX-5X vectors (refer to
Appendix 2).
121
Conventional Cloning: Fusion Constructs and Restriction Sites Used Clone # Name of Fusion Restriction Enzyme sites Location on Construct for TRPM7 Bluescript TRPM7 cDNA
1 α kinase EcoNI (5’) + BsaBI (3’) 4960 5761 4 C-terminus-N BsrGI (5’) + BsaBI (3’) 3482 5761 5 C-terminus-C BsrGI (5’) + NotI (3’) 3482 5590 (end) 6 Coiled-coil BbvCI (5’) + AlwNI (3’) 3639 4275 7 Long coiled-coil BsrGI (5’) + SalI (3’) 3482 4739
Polymerase Chain Reaction Cloning Clone # Name of Fusion Restriction Enzyme Sites Location on Construct Added TRPM7 cDNA
2 α kinase- C Forward : EcoRI 4697 5590 (end) Reverse: XhoI 3 Long α kinase- C Forward : EcoRI 4456 5590 (end) Reverse: XhoI
122 Appendix 2 pGEX-5X Features and Restriction Map
The pGEX-5X vector contains cDNA of Glutathione S-Transferase, ampicillin resistant gene (Amp), and LacIq gene. In addition, pGEX-5X vector has 3 different versions to account for 3 different open reading frames as shown in figure below.
123
124