Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia Viridis and Transcriptome Wide Identification of Cnidarian Homologues

Total Page:16

File Type:pdf, Size:1020Kb

Load more

G C A T T A C G G C A T

genes

Article

Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

  • Aldo Nicosia 1,
  • *
  • ID , Carmelo Bennici 1, Girolama Biondo 1, Salvatore Costa 2
  • ,

ID

Marilena Di Natale 1, Tiziana Masullo 1, Calogera Monastero 1, Maria Antonietta Ragusa 2,

  • Marcello Tagliavia 1 and Angela Cuttitta 1,
  • *

1

National Research Council-Institute for Marine and Coastal Environment (IAMC-CNR), Laboratory of Molecular Ecology and Biotechnology, Detached Unit of Capo Granitola, Via del mare, 91021 Torretta Granitola (TP), Sicily, Italy; [email protected] (C.B.); [email protected] (G.B.); [email protected] (M.D.N.);

[email protected] (T.M.); [email protected] (C.M.); [email protected] (M.T.)

Department of Biological, Chemical and Pharmaceutical Sciences and Technologies, University of Palermo,

Viale delle Scienze, Ed. 16, 90128 Palermo, Sicily, Italy; [email protected] (S.C.); [email protected] (M.A.R.)

2

*

Correspondence: [email protected] (A.N.); [email protected] (A.C.); Tel.: +39-0924-40600 (A.N. & A.C.)

Received: 10 November 2017; Accepted: 5 January 2018; Published: 11 January 2018

Abstract: Gene family encoding translationally controlled tumour protein (TCTP) is defined as

highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this

study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea

anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida,

Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution

of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria

showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein

structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses

revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally,

the transcriptional profile of A. viridis TCTP (AvTCTP) after challenges with different abiotic/biotic

stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation.

These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in

environmental stress and immune responses.

Keywords: cnidarians; transcriptome wide analysis; translationally controlled tumour protein;

TCTPs; comparative genomics; homology modelling; gene expression

1. Introduction

The translationally controlled tumour protein (TCTP) represents a conserved protein that is widely expressed among eukaryotes. Members of TCTP family are 21–23 kDa proteins that do not

share any similarity with other known protein families [

the yeast Schizosaccharomyces pombe revealed a fold similar to a small chaperone [ four β-sheets, named A–D and three principal helices, known as H1–H3, which are connected in a

complex topology [ ]. Sequence and structural comparison between members of TCTP protein family

1], while analyses of TCTP 3D structure from

2]. It consists of

2

Genes 2018, 9, 30

2 of 21

revealed that differences among structure mainly relies in a flexible loop located between the core and

the helical domain [2].

TCTP homologues have been characterised in a variety of invertebrates, these include the nematodes Brugia malayi [

3

] and Caenorhabditis elegans [

  • 4], the crab Eriocheir sinensis [
  • 5],

the shrimps Litopenaeus vannamei, Penaeus indicus, Penaeus monodon and Marsupenaeus japonicas [

6

–9].

Recently, members of the TCTP family have also been identified in marine bivalves such as

Venerupis philippinarum [10], Mytilus galloprovincialis [11] and Chlamys farreri [12]. TCTP proteins

are ubiquitous expressed to exert diverse physiological activities; indeed, they play a role in different

cellular pathways such as cell growth, cell cycle progression and differentiation, gene regulation, stress/immune response, apoptosis and it has been also ascribed to TCTP an extracellular role cytokine-like [13,14]. However, there is little characterisation of TCTP genes in non-bilaterians as a single homologue has been described in Hydra vulgaris [15] and to date, even if identified,

no homologues have been characterised in other cnidarians.

The sea anemone Anemonia viridis is a common Mediterranean cnidarian [16,17]. The phylum
Cnidaria is a sister to Bilateria within the Eumetazoan, a phylogenetic split that dates back to the

Precambrian era [18]. The phylum split into two major lineages: the class Anthozoa to which A. viridis

belongs and its sister group, the Medusozoa. Combined analyses of morphological characters and

molecular data are consistent with the idea that the Anthozoans are basal within the cnidarian phylum

and they best represent the primitive cnidarians [19 and a diploblastic organisation, genomic and transcriptional analyses revealed unexpected ancestral

complexity [21 23]. Extant cnidarians represent the first organisms from organized cells into tissues [24

,20]. Despite the occurrence of a single body axis

  • ]

and as sister group of the Bilateria they are of great interest for the identification of mechanisms leading

to bilaterian traits [25–27].

Several cnidarian transcriptome datasets have been generated during the years [21

,22,28–30]

  • and have permitted the use of bioprospecting and computational analysis [31 33]. In the present

work, an open reading frame (ORF) for a TCTP family member, herein designated as A. viridis TCTP (AvTCTP), was recovered from A. viridis and its genomic organisation was characterised. An extensive transcriptional and genomic survey for the mining of expressed TCTPs from the

stony corals (Acropora millepora and Acropora digitifera), the sea anemones (Nematostella vectensis and

Exaiptasia pallida in addition to A. viridis) and H. vulgaris was carried out to analyse the molecular

evolution of the TCTP gene family among cnidarians.

Based on advances in homology recognition and using modern modelling and comparative tools,

the 3D structures of representative cnidarian TCTPs were predicted and compared in order to provide

structural and evolutionary details. Moreover, the gene expression pattern of AvTCTP in different sea

anemone districts and in response to abiotic and immune challenges was evaluated.

2. Materials and Methods

2.1. Ethics Statement

A. viridis housing and husbandry were performed in accordance with the best practices developed in the cnidarian community to optimise animal health. All experiments were carried out in compliance

with local laws and to date no specific permit is required for the performed experiments. However, all facilities and procedures complied with the Directive 2010/63/EU and the Animal Research:

Reporting of In Vivo Experiments (ARRIVE) guidelines.

2.2. Data Mining

The characterized TCTPs were used initially to retrieve their corresponding sequences from the

publicly available database at the National Centre for Biotechnology Information (NCBI). To obtain

more homologs, these sequences were used as query to perform extensive protein-protein BLAST (BLASTP), nucleotide BLAST (BLASTX) and protein-nucleotide BLAST (TBLASTN) searches until

Genes 2018, 9, 30

3 of 21

no novel putative matches could be retrieved. The putative matching sequences from A. millepora, A. digitifera, A. viridis, N. vectensis and H. vulgaris were obtained from public available databases under the following accession numbers: XP_015766473.1 (A. digitifera), JR988252.1 (A. millepora),

FK734027.1 and FK724838.1 (A. viridis), XM_021056176.1 (E. pallida), DV094372.1 and XM_001624752.1

(N. vectensis), NM_001309745.1 (H. vulgaris 1) and XM_002157314.3 (H. vulgaris 2). All the corresponding

genomic sequences were retrieved similarly with the exception of AvTCTP which has been isolated

experimentally. Because the existence of numerous gap in the N. vectensis genomic scaffold

NEMVEscaffold_304, it was not possible to unambiguously assign gene structure. Thus, the version to

date annotated has been used.

2.3. DNA, RNA Extraction and cDNA Synthesis

Specimens of A. viridis were manually collected from the Capo Granitola Coast (Torretta Granitola,

Latitude 3734030.0000 N Longitude 1240047.2600 E) in the South of Sicily (Italy) and maintained in

Millipore Filtered Sea Water (MFSW) at 18

±

1 C with a 12:12 h light:dark photoperiod. Sea anemones

were acclimated for 20 days prior to challenges.

During acclimation, water parameters (pH, salinity, temperature, dissolved oxygen, turbidity,

conductivity, ammonium, ammonia, chloride and nitrate levels) were continuously checked to measure

the water quality of the aquarium through YSI ProDSS multiparameter probe (626870-1) (Dublin,

Ireland). Moreover, health of the sea anemones was monitored through continuous observation.

For RNA purification, tentacles, pharynx, basal disk and body column and mesenterial filaments

were rapidly recovered. Tissues were frozen in liquid nitrogen and ground into a fine powder using

a tissue disruptor. The powder was dissolved in Trizol reagent (Invitrogen Corporation, Carlsbad, CA, USA) and further RNA purification steps were performed according to the manufacturer’s instructions. RNA concentrations and quality were verified by spectrophotometry (optical density (OD) at 260 nm), whereas the RNA integrity was checked using a 1.5% agarose gel. The RNA was

stored at

80 C for future use. For DNA extraction, the powder was dissolved in a DNAzol reagent

(Invitrogen Corporation) and further genomic DNA purification steps were performed according to

the manufacturer’s instructions. DNA concentrations and quality were verified by spectrophotometry

(OD at 260 nm), whereas the integrity was checked using a 0.8% agarose gel. The DNA was stored at

−20 C for future use.

The extracted RNA (2 µg) was treated with RNA qualified 1 (RQ1) RNase-Free DNase

(Promega, Madison, WI, USA) to remove any residual genomic DNA contamination and the DNase

was inactivated by adding 25 mM EDTA. First-strand cDNA was synthesised from 2 µg DNase-treated

total RNA samples using oligo(dT)18 and Superscript III (Invitrogen Corporation) following the

manufacturer’s instructions. The cDNA mixture was stored at −20 C.

2.4. Full-Length cDNA and Gene Cloning from Anemonia viridis

Based on the partial sequence of AvTCTP cDNA, the 30 end was obtained by PCR-RACE (rapid

amplification of cDNA ends) using the SMART RACE cDNA application kit (Clontech, Mountain View,

CA, USA) and the 30 AvTCTP primer (Table 1) as described in the user manual. The 30 RACE product was cloned into the pGEM-T Easy vector (Promega, USA) and transformed into XL1- Blue

Escherichia coli cells (Stratagene, San Diego, CA, USA). Plasmid DNA, from three independent clones,

was purified on Illustra

plasmidPrep Mini SpinKit (GE Healthcare Life Sciences, Chicago, IL, USA)

and sequenced using T7 and SP6 primers.

The full-length cDNA, consisting in sequences from original expressed sequence tags (ESTs)

and additional elements from 30 RACE product was amplified using an appropriate pair of primers

(FlTCTP Fw/Rv) cloned in into the pGEM-T Easy vector (Promega) and the nucleotide sequence was

verified using T7 and SP6 sequencing primers. Based on the 50- and 30-UTR (untranslated region)

sequences, the primer set FlTCTP Fw/Rv was used to isolate the genomic DNA sequences.

Genes 2018, 9, 30

4 of 21

Table 1. Specific primers used in this study.

  • 0
  • 0

  • Primers
  • Sequences (5 –3 )
  • Amplicon Size (bp)

0

  • GACCGCTTTAATGGAGTCTTCF
  • 3 RACE
  • -

GAGGTCGAGCTGTACCAACAAF TTGTTCACGACGAACTTCCTACR

GGTTCCAAATCCTCCACAAACCF TGTCCCAATCCGCACGTTACR
Fl-TCTP RCC2
877 83
GCCTGTTGGACACCGATGATF TGCAAGGCTCTCTCCAGTCCR

GGATGAAATGTTCGGAGGAAACF CATAGTGGGCTGTTCGCTGTATR
COP γ qTCTP
142 133

F

Forward primer

R

Reverse primer

RACE: rapid amplification of cDNA ends; RCC2: Regulator of Chromosome Condensation protein 2;

COP-γ: Coatomer subunit gamma; bp: base pair.

2.5. Sequence and Phylogenetic and Structural Analyses

ConSurf webserver [34] was used to construct and map the evolutionary variability of nucleotides

onto the secondary structures of the 50-UTR from AvTCTP. Functional sites and domains in the

predicted amino acid sequences were predicted using the Simple Modular Architecture Research Tool

(SMART) program, the InterPro database [35], the Pfam database [36], the PROSITE program [37] and

the Eukaryotic Linear Motif resource (ELM) for Functional Sites in Proteins.

To reconstruct the molecular evolution of the TCTP family Basic Local Alignment Search
Tool (TBLASTN, BLASTP) analyses were performed to recover TCTPs from GenBank (Table 2).

TCTP protein sequences were aligned using T-Coffee software (http://tcoffee.crg.cat/apps/tcoffee/

index.html) [38]. Phylogenetic and molecular evolutionary analyses were conducted using a Maximum Likelihood (ML) method, implemented in MEGA version 7.0 [39] in which Poisson correction, pairwise

deletion and bootstrapping (1000 replicates) were considered as parameters, to reconstruct the

evolutionary diversification and the molecular evolution of TCTP proteins family in cnidarians and

different Eumetazoan groups. Moreover, the 3D structures of TCTP proteins were reconstructed

exploiting the advances in homologues detection [23,27,40]. Thus homology modelling via the Protein

Homology/analogY Recognition Engine 2.0 (Phyre 2) software [41] using the intensive modelling mode

was carried out. Candidate structures for homology modelling were selected according to pairwise

alignment. At least two different structures were used as a template for each generated structure and

homology models were built for all the sets of proteins. Validation of the structural protein models was performed by assessing the Ramachandran plots. Cycles of clash minimization were also performed for

the refinement of structures. Secondary structures assignments and relative solvent accessibility (RSA)

were calculated by the DSSP program [42,43] as implemented in ENDscript [44]. Additionally, ConSurf

webserver [34] was used to map the evolutionary variability of amino acids onto the reconstructed

structures of homologues which were rendered using the UCSF Chimera package [45].

Table 2. Translationally Controlled Tumour Proteins (TCTPs) from Eumetazoans used for

phylogenetic Analysis.

  • Species
  • Accession Number
  • Taxonomic Group

Homo sapiens Mus musculus Sus scrofa

AAQ01550.1 NP033455.1 AAL68965.1
Mammalia Mammalia Mammalia

Genes 2018, 9, 30

5 of 21

Table 2. Cont.

  • Species
  • Accession Number
  • Taxonomic Group

Rattus norvegicus Gallus gallus
Xenopus tropicalis Pogona vitticeps

NP446319.1 NP990729.1 NP_001008074.1 XP_020652710.1 NP937783.1
Mammalia
Aves
Amphibia Reptilia Osteichtyes

Danio rerio Salmo salar

  • ACI68686.1
  • Osteichtyes

Osteichtyes Osteichtyes Agnata

Xiphophorus maculatus
Takifugu rubripes Petromyzon marinus Branchiostoma floridae Ciona intestinalis
Apostichopus japonicus

XP005807723.1 XP003962088.1 EB084009.1 XP_002592847.1 FK151528.1 ABC87996.1 AID69538.1 XP795619.2
Cephalochordata
Tunicata
Echinodermata Echinodermata Echinodermata
Insecta

Stichopus monotuberculatus Strongylocentrotus purpuratus
Nilaparvata lugens
Drosophila melanogaster
Anopheles sinensis Spodoptera frugiperda Harpegnathos saltator Megachile rotundata Fenneropenaeus chinensis
Penaeus monodon

XP_022184371.1 NP001303431.1 KFB46001.1
Insecta Insecta Insecta Insecta Insecta Crustacea Crustacea
ADK56158.1 XP011150938.1 XP_003700051.1 ABB05535.1 ACD13588.1

Lepeophtheirus salmonis Octopus bimaculoides Aplysia californica Crassostrea virginica Caenorhabditis elegans Caenorhabditis remanei Dictyocaulus viviparus
Brugia malayi Clonorchis sinensis Macrostomum lignano
Hydra vulgaris 1 Hydra vulgaris 2 Hydractinia echinata Podocoryna carnea

  • ACO12977.1
  • Crustacea

Mollusca Mollusca Mollusca Nematoda Nematoda Nematoda Nematoda Platyhelmintes Platyhelmintes
Hydrozoa Hydrozoa Hydrozoa
XP_014780570.1 XP_005092645.1 XP_022338092.1
Q93573.1 EFP12520.1 KJH46926.1 XP001897741 AAX84199.1 PAA86325.1
NM_001309745.1 XM_002157314.3
DT623491.1

  • DY451741.1
  • Hydrozoa

Clytia hemisphaerica Polypodium hydriforme
Kudoa iwatai Aurelia aurita Alatina alata
Haliclystus sanjuanensis Haliclystus auricula
Calvadosia cruxmelitensis Acanthogiorgia aspera Heliopora coerulea Acropora digitifera Acropora millepora Acropora palmata Montastraea faveolata Nematostella vectensis
Metridiumsenile Anemonia viridis Aiptasia pulchella Exaiptasia pallida

  • FP985759.1
  • Hydrozoa

Hydrozoa Myxozoa Scyphozoa Cubozoa Staurozoa Staurozoa Staurozoa
GBGH01019625.1 GBGI01001069.1 GBRG01251580.1 GEUJ01004399.1 HAHB01030183.1 HAHA01057349.1 HAHC01090444.1 GETB01037007.1 IABP01022130.1 XP_015766473.1
JR988252.1 GW212294.1 GW258989.1 XM_001624752.1
FC834313.1 FK734027.1 CK662981.1 XP_020911835.1 XP_003382650.1
Anthozoa Octocorallia Anthozoa Octocorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia
Porifera

Amphimedon qeenslandica

Genes 2018, 9, 30

6 of 21

2.6. Anemonia viridis Translationally Controlled Tumour Protein Tissue-Specific Expression Pattern

Reverse Transcription-PCR (RT-PCR) was used to profile the tissue specific mRNA expression of AvTCTP. The cDNA from the different anatomical district previously synthetized were used as templates, whereas qTCTP-F and qTCTP-R (Table 1) primers were used. PCR amplifications were

Recommended publications
  • Anthopleura and the Phylogeny of Actinioidea (Cnidaria: Anthozoa: Actiniaria)

    Anthopleura and the Phylogeny of Actinioidea (Cnidaria: Anthozoa: Actiniaria)

    Org Divers Evol (2017) 17:545–564 DOI 10.1007/s13127-017-0326-6 ORIGINAL ARTICLE Anthopleura and the phylogeny of Actinioidea (Cnidaria: Anthozoa: Actiniaria) M. Daly1 & L. M. Crowley2 & P. Larson1 & E. Rodríguez2 & E. Heestand Saucier1,3 & D. G. Fautin4 Received: 29 November 2016 /Accepted: 2 March 2017 /Published online: 27 April 2017 # Gesellschaft für Biologische Systematik 2017 Abstract Members of the sea anemone genus Anthopleura by the discovery that acrorhagi and verrucae are are familiar constituents of rocky intertidal communities. pleisiomorphic for the subset of Actinioidea studied. Despite its familiarity and the number of studies that use its members to understand ecological or biological phe- Keywords Anthopleura . Actinioidea . Cnidaria . Verrucae . nomena, the diversity and phylogeny of this group are poor- Acrorhagi . Pseudoacrorhagi . Atomized coding ly understood. Many of the taxonomic and phylogenetic problems stem from problems with the documentation and interpretation of acrorhagi and verrucae, the two features Anthopleura Duchassaing de Fonbressin and Michelotti, 1860 that are used to recognize members of Anthopleura.These (Cnidaria: Anthozoa: Actiniaria: Actiniidae) is one of the most anatomical features have a broad distribution within the familiar and well-known genera of sea anemones. Its members superfamily Actinioidea, and their occurrence and exclu- are found in both temperate and tropical rocky intertidal hab- sivity are not clear. We use DNA sequences from the nu- itats and are abundant and species-rich when present (e.g., cleus and mitochondrion and cladistic analysis of verrucae Stephenson 1935; Stephenson and Stephenson 1972; and acrorhagi to test the monophyly of Anthopleura and to England 1992; Pearse and Francis 2000).
  • Resurrecting a Subgenus to Genus: Molecular Phylogeny of Euphyllia and Fimbriaphyllia (Order Scleractinia; Family Euphylliidae; Clade V)

    Resurrecting a Subgenus to Genus: Molecular Phylogeny of Euphyllia and Fimbriaphyllia (Order Scleractinia; Family Euphylliidae; Clade V)

    Resurrecting a subgenus to genus: molecular phylogeny of Euphyllia and Fimbriaphyllia (order Scleractinia; family Euphylliidae; clade V) Katrina S. Luzon1,2,3,*, Mei-Fang Lin4,5,6,*, Ma. Carmen A. Ablan Lagman1,7, Wilfredo Roehl Y. Licuanan1,2,3 and Chaolun Allen Chen4,8,9,* 1 Biology Department, De La Salle University, Manila, Philippines 2 Shields Ocean Research (SHORE) Center, De La Salle University, Manila, Philippines 3 The Marine Science Institute, University of the Philippines, Quezon City, Philippines 4 Biodiversity Research Center, Academia Sinica, Taipei, Taiwan 5 Department of Molecular and Cell Biology, James Cook University, Townsville, Australia 6 Evolutionary Neurobiology Unit, Okinawa Institute of Science and Technology Graduate University, Okinawa, Japan 7 Center for Natural Sciences and Environmental Research (CENSER), De La Salle University, Manila, Philippines 8 Taiwan International Graduate Program-Biodiversity, Academia Sinica, Taipei, Taiwan 9 Institute of Oceanography, National Taiwan University, Taipei, Taiwan * These authors contributed equally to this work. ABSTRACT Background. The corallum is crucial in building coral reefs and in diagnosing systematic relationships in the order Scleractinia. However, molecular phylogenetic analyses revealed a paraphyly in a majority of traditional families and genera among Scleractinia showing that other biological attributes of the coral, such as polyp morphology and reproductive traits, are underutilized. Among scleractinian genera, the Euphyllia, with nine nominal species in the Indo-Pacific region, is one of the groups Submitted 30 May 2017 that await phylogenetic resolution. Multiple genetic markers were used to construct Accepted 31 October 2017 Published 4 December 2017 the phylogeny of six Euphyllia species, namely E. ancora, E. divisa, E.
  • Anthozoa: Hexacorallia: Scleractinia: Dendrophylliidae) from Korea

    Anthozoa: Hexacorallia: Scleractinia: Dendrophylliidae) from Korea

    Anim. Syst. Evol. Divers. Vol. 32, No. 1: 38-43, January 2016 http://dx.doi.org/10.5635/ASED.2016.32.1.038 Short communication A New Record of Dendrophyllia compressa (Anthozoa: Hexacorallia: Scleractinia: Dendrophylliidae) from Korea Eunae Choi, Jun-Im Song* College of Natural Sciences, Ewha Womans University, Seoul 03760, Korea ABSTRACT Dendrophyllia compressa Ogawa and Takahashi, 1995 is newly reported from Korea. The specimen was collected off Seogwipo, Jeju-do, Korea in 1969. It is described herein based on the morphological characters of the skeletal structures. Dendrophyllia compressa is characterized by its small and bushy growth form with branches, vertical growth direction, small calicular diameter, compressed calice, Pourtalès Plan with vertical septal inner edges, flat and spongy columella, exserted septal upper margins, and epitheca. Dendrophyllia compressa has been synonymized with Cladopsammia eguchii (Wells, 1982). However, the former species differs from the latter species in its growth form, growth direction, colony size, corallite size, and corallite shape. Keywords: Anthozoa, Scleractinia, Dendrophylliidae, Dendrophyllia, Korea INTRODUCTION cribed. The specimen was collected from the subtidal zone off The family Dendrophylliidae Gray, 1847 comprises 167 Seogwipo, Jeju-do, Korea in 1969. It was dissolved in sod- species in 21 genera (Cairns, 2001; Roberts et al., 2009; ium hypochlorite solution diluted with distilled water for World Register of Marine Species, 2015). Among these 24 hours to remove all the soft tissues, washed in distilled species, 29 species in the genus Dendrophyllia have been water, and dried for the examination of the skeletal struc- reported worldwide (Roberts et al., 2009; World Register of tures. The external growth forms and shapes of the coralla Marine Species, 2015).
  • Cnidarian Immunity and the Repertoire of Defense Mechanisms in Anthozoans

    Cnidarian Immunity and the Repertoire of Defense Mechanisms in Anthozoans

    biology Review Cnidarian Immunity and the Repertoire of Defense Mechanisms in Anthozoans Maria Giovanna Parisi 1,* , Daniela Parrinello 1, Loredana Stabili 2 and Matteo Cammarata 1,* 1 Department of Earth and Marine Sciences, University of Palermo, 90128 Palermo, Italy; [email protected] 2 Department of Biological and Environmental Sciences and Technologies, University of Salento, 73100 Lecce, Italy; [email protected] * Correspondence: [email protected] (M.G.P.); [email protected] (M.C.) Received: 10 August 2020; Accepted: 4 September 2020; Published: 11 September 2020 Abstract: Anthozoa is the most specious class of the phylum Cnidaria that is phylogenetically basal within the Metazoa. It is an interesting group for studying the evolution of mutualisms and immunity, for despite their morphological simplicity, Anthozoans are unexpectedly immunologically complex, with large genomes and gene families similar to those of the Bilateria. Evidence indicates that the Anthozoan innate immune system is not only involved in the disruption of harmful microorganisms, but is also crucial in structuring tissue-associated microbial communities that are essential components of the cnidarian holobiont and useful to the animal’s health for several functions including metabolism, immune defense, development, and behavior. Here, we report on the current state of the art of Anthozoan immunity. Like other invertebrates, Anthozoans possess immune mechanisms based on self/non-self-recognition. Although lacking adaptive immunity, they use a diverse repertoire of immune receptor signaling pathways (PRRs) to recognize a broad array of conserved microorganism-associated molecular patterns (MAMP). The intracellular signaling cascades lead to gene transcription up to endpoints of release of molecules that kill the pathogens, defend the self by maintaining homeostasis, and modulate the wound repair process.
  • The Earliest Diverging Extant Scleractinian Corals Recovered by Mitochondrial Genomes Isabela G

    The Earliest Diverging Extant Scleractinian Corals Recovered by Mitochondrial Genomes Isabela G

    www.nature.com/scientificreports OPEN The earliest diverging extant scleractinian corals recovered by mitochondrial genomes Isabela G. L. Seiblitz1,2*, Kátia C. C. Capel2, Jarosław Stolarski3, Zheng Bin Randolph Quek4, Danwei Huang4,5 & Marcelo V. Kitahara1,2 Evolutionary reconstructions of scleractinian corals have a discrepant proportion of zooxanthellate reef-building species in relation to their azooxanthellate deep-sea counterparts. In particular, the earliest diverging “Basal” lineage remains poorly studied compared to “Robust” and “Complex” corals. The lack of data from corals other than reef-building species impairs a broader understanding of scleractinian evolution. Here, based on complete mitogenomes, the early onset of azooxanthellate corals is explored focusing on one of the most morphologically distinct families, Micrabaciidae. Sequenced on both Illumina and Sanger platforms, mitogenomes of four micrabaciids range from 19,048 to 19,542 bp and have gene content and order similar to the majority of scleractinians. Phylogenies containing all mitochondrial genes confrm the monophyly of Micrabaciidae as a sister group to the rest of Scleractinia. This topology not only corroborates the hypothesis of a solitary and azooxanthellate ancestor for the order, but also agrees with the unique skeletal microstructure previously found in the family. Moreover, the early-diverging position of micrabaciids followed by gardineriids reinforces the previously observed macromorphological similarities between micrabaciids and Corallimorpharia as
  • The Aquaculture of Live Rock, Live Sand, Coral and Associated Products

    The Aquaculture of Live Rock, Live Sand, Coral and Associated Products

    AQUACULTURE OF LIVE ROCKS, LIVE SAND, CORAL AND ASSOCIATED PRODUCTS A DISCUSSION AND DRAFT POLICY PAPER FISHERIES MANAGEMENT PAPER NO. 196 Department of Fisheries 168 St. Georges Terrace Perth WA 6000 April 2006 ISSN 0819-4327 The Aquaculture of Live Rock, Live Sand, Coral and Associated Products A Discussion and Draft Policy Paper Project Managed by Andrew Beer April 2006 Fisheries Management Paper No. 196 ISSN 0819-4327 Fisheries Management Paper No. 196 CONTENTS OPPORTUNITY FOR PUBLIC COMMENT...............................................................IV DISCLAIMER V ACKNOWLEDGEMENT..................................................................................................V SECTION 1 EXECUTIVE SUMMARY & PROPOSED POLICY OPTIONS ....... 1 SECTION 2 INTRODUCTION.................................................................................... 5 2.1 BACKGROUND ............................................................................................. 5 2.2 OBJECTIVES................................................................................................. 5 2.3 WHY LIVE ROCK, SAND AND CORAL AQUACULTURE? ............................... 6 2.4 MARKET...................................................................................................... 6 SECTION 3 THE TAXONOMY AND BIOLOGY OF LIVE ROCK, SAND AND CORAL ..................................................................................................... 9 3.1 LIVE ROCK .................................................................................................
  • Target Substrata

    Target Substrata

    TARGET SUBSTRATA OVERVIEW CORALS AND THEIR RELATIVES STONY HEXACORALS OTHER HEXACORALS OCTOCORALS HYDROZOANS Acropora Sea Anemones Soft Corals Fire Coral Non-Acropora Zoanthids Sea Fans Lace Coral Black Coral Blue Coral Hydroids Corallimorpharians Organ Pipe OTHER SUBSTRATA Sponge Macroalgae Dead Coral Rock Coralline Algae Dead Coral With Algae Rubble Algal Assemblage Turf Algae Sand Silt CORALS AND THEIR RELATIVES STONY CORALS ACROPORA Phylum Cnidaria | Class Anthozoa | Sub-Class Hexacorallia | Order Scleractinia (Hard Corals) | Family Acroporidae | Genus Acropora Acropora is one genus within the family of Acroporidae; Generally, the species are characterized by the presence of an axial (terminal) corallite (skeleton of an individual polyp) at the branch tips surrounded by radial corallites; The name Acropora is derived from the Greek “akron” which means summit. Acropora Branching Barefoot Conservation | TARGET SUBSTRATA | July 2016 1 Acropora Bottlebrush Acropora Digitate Acropora Tabulate Barefoot Conservation | TARGET SUBSTRATA | July 2016 2 Acropora Submassive Acropora Encrusting Non-Acropora Phylum Cnidaria | Class Anthozoa | Sub-Class Hexacorallia | Order Scleractinia (Hard Corals) | Family Acroporidae Coral Branching Barefoot Conservation | TARGET SUBSTRATA | July 2016 3 (continued) Coral Branching Coral Massive Barefoot Conservation | TARGET SUBSTRATA | July 2016 4 Coral Encrusting Coral Foliose Coral Submassive Barefoot Conservation | TARGET SUBSTRATA | July 2016 5 (continued) Coral Submassive Coral Mushroom Barefoot Conservation
  • Anthopleura Radians, a New Species of Sea Anemone (Cnidaria: Actiniaria: Actiniidae)

    Anthopleura Radians, a New Species of Sea Anemone (Cnidaria: Actiniaria: Actiniidae)

    Research Article Biodiversity and Natural History (2017) Vol. 3, No. 1, 1-11 Anthopleura radians, a new species of sea anemone (Cnidaria: Actiniaria: Actiniidae) from northern Chile, with comments on other species of the genus from the South Pacific Ocean Anthopleura radians, una nueva especie de anémona de mar (Cnidaria: Actiniaria: Actiniidae) del norte de Chile, con comentarios sobre las otras especies del género del Océano Pacifico Sur Carlos Spano1,* & Vreni Häussermann2 1Genomics in Ecology, Evolution and Conservation Laboratory, Departamento de Zoología, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Barrio Universitario s/n Casilla 160-C, Concepción, Chile. 2Huinay Scientific Field Station, Chile, and Pontificia Universidad Católica de Valparaíso, Facultad de Recursos Naturales, Escuela de Ciencias del Mar, Avda. Brazil 2950, Valparaíso, Chile. ([email protected]) *Correspondence author: [email protected] ZooBank: urn:lsid:zoobank.org:pub:7C7552D5-C940-4335-B9B5-2A7A56A888E9 Abstract A new species of sea anemone, Anthopleura radians n. sp., is described from the intertidal zone of northern Chile and the taxonomic status of the other Anthopleura species from the South Pacific are discussed. A. radians n. sp. is characterized by a yellow-whitish and brown checkerboard-like pattern on the oral disc, adhesive verrucae along the entire column and a series of marginal projections, each bearing a brightly-colored acrorhagus on the oral surface. This is the seventh species of Anthopleura described from the South Pacific Ocean; each one distinguished by a particular combination of differences related to their coloration pattern, presence of zooxanthellae, cnidae, and mode of reproduction. Some of these species have not been reported since their original description and thus require to be taxonomically validated.
  • Zoanthid (Cnidaria: Anthozoa: Hexacorallia: Zoantharia) Species of Coral Reefs in Palau

    Zoanthid (Cnidaria: Anthozoa: Hexacorallia: Zoantharia) Species of Coral Reefs in Palau

    Mar Biodiv DOI 10.1007/s12526-013-0180-5 ORIGINAL PAPER Zoanthid (Cnidaria: Anthozoa: Hexacorallia: Zoantharia) species of coral reefs in Palau James Davis Reimer & Doris Albinsky & Sung-Yin Yang & Julien Lorion Received: 3 June 2013 /Revised: 16 August 2013 /Accepted: 20 August 2013 # Senckenberg Gesellschaft für Naturforschung and Springer-Verlag Berlin Heidelberg 2013 Abstract Palau is world famous for its relatively pristine and Introduction highly diverse coral reefs, yet for many coral reef invertebrate taxa, few data exist on their diversity in this Micronesian coun- Palau is located at the southwestern corner of Micronesia, and try. One such taxon is the Zoantharia, an order of benthic is just outside the Coral Triangle, the region with the highest cnidarians within the Class Anthozoa (Subclass Hexacorallia) marine biodiversity in the world (Hoeksema 2007). Thus, Palau that are commonly found in shallow subtropical and tropical is an important link between the central Indo-Pacific and the waters. Here, we examine the species diversity of zoanthids in Pacific Islands, and diversity and distribution data of marine Palau for the first time, based on shallow-water (<35 m) scuba organisms from Palau can help us to understand the evolutionary surveys and morphological identification to create a preliminary and biogeographical history of the region. Because of Palau’s zoanthid species list for Palau. Our results indicated the presence combination of a high habitat diversity with a close proximity to of nine zoanthid species in Palau (Zoanthus sansibaricus, Z. the Coral Triangle, it has the most diverse marine flora and fauna gigantus, Palythoa tuberculosa, P. mutuki, P.
  • Species Delimitation in Sea Anemones (Anthozoa: Actiniaria): from Traditional Taxonomy to Integrative Approaches

    Species Delimitation in Sea Anemones (Anthozoa: Actiniaria): from Traditional Taxonomy to Integrative Approaches

    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 10 November 2019 doi:10.20944/preprints201911.0118.v1 Paper presented at the 2nd Latin American Symposium of Cnidarians (XVIII COLACMAR) Species delimitation in sea anemones (Anthozoa: Actiniaria): From traditional taxonomy to integrative approaches Carlos A. Spano1, Cristian B. Canales-Aguirre2,3, Selim S. Musleh3,4, Vreni Häussermann5,6, Daniel Gomez-Uchida3,4 1 Ecotecnos S. A., Limache 3405, Of 31, Edificio Reitz, Viña del Mar, Chile 2 Centro i~mar, Universidad de Los Lagos, Camino a Chinquihue km. 6, Puerto Montt, Chile 3 Genomics in Ecology, Evolution, and Conservation Laboratory, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, P.O. Box 160-C, Concepción, Chile. 4 Nucleo Milenio de Salmonidos Invasores (INVASAL), Concepción, Chile 5 Huinay Scientific Field Station, P.O. Box 462, Puerto Montt, Chile 6 Escuela de Ciencias del Mar, Pontificia Universidad Católica de Valparaíso, Avda. Brasil 2950, Valparaíso, Chile Abstract The present review provides an in-depth look into the complex topic of delimiting species in sea anemones. For most part of history this has been based on a small number of variable anatomic traits, many of which are used indistinctly across multiple taxonomic ranks. Early attempts to classify this group succeeded to comprise much of the diversity known to date, yet numerous taxa were mostly characterized by the lack of features rather than synapomorphies. Of the total number of species names within Actiniaria, about 77% are currently considered valid and more than half of them have several synonyms. Besides the nominal problem caused by large intraspecific variations and ambiguously described characters, genetic studies show that morphological convergences are also widespread among molecular phylogenies.
  • Anemonia Sulcata and Its Symbiont Symbiodinium As a Source of Anti-Tumor and Anti-Oxidant Compounds for Colon Cancer Therapy: a Preliminary in Vitro Study

    Anemonia Sulcata and Its Symbiont Symbiodinium As a Source of Anti-Tumor and Anti-Oxidant Compounds for Colon Cancer Therapy: a Preliminary in Vitro Study

    biology Article Anemonia sulcata and Its Symbiont Symbiodinium as a Source of Anti-Tumor and Anti-Oxidant Compounds for Colon Cancer Therapy: A Preliminary In Vitro Study Laura Cabeza 1,2,3, Mercedes Peña 1,2,3 , Rosario Martínez 4 , Cristina Mesas 1,2,3, Milagros Galisteo 5, Gloria Perazzoli 1,2,3, Jose Prados 1,2,3,* , Jesús M. Porres 4,† and Consolación Melguizo 1,2,3,† 1 Institute of Biopathology and Regenerative Medicine (IBIMER), Center of Biomedical Research (CIBM), University of Granada, 18100 Granada, Spain; [email protected] (L.C.); [email protected] (M.P.); [email protected] (C.M.); [email protected] (G.P.); [email protected] (C.M.) 2 Department of Anatomy and Embryology, Faculty of Medicine, University of Granada, 18071 Granada, Spain 3 Biosanitary Institute of Granada (ibs.GRANADA), SAS-University of Granada, 18014 Granada, Spain 4 Institute of Nutrition and Food Technology (INyTA), Biomedical Research Center (CIBM), Department of Physiology, University of Granada, 18100 Granada, Spain; [email protected] (R.M.); [email protected] (J.M.P.) 5 Department of Pharmacology, School of Pharmacy, University of Granada, 18071 Granada, Spain; [email protected] * Correspondence: [email protected] † Co-senior authors: These authors contributed equally to this work. Citation: Cabeza, L.; Peña, M.; Simple Summary: Colorectal cancer is one of the most frequent types of cancer in the population. Martínez, R.; Mesas, C.; Galisteo, M.; Recently, invertebrate marine animals have been investigated for the presence of natural products Perazzoli, G.; Prados, J.; Porres, J.M.; which can damage tumor cells, prevent their spread to other tissues or avoid cancer develop.
  • Horizontal Acquisition of Symbiodiniaceae in the Anemonia

    Horizontal Acquisition of Symbiodiniaceae in the Anemonia

    Horizontal acquisition of Symbiodiniaceae in the Anemonia viridis (Cnidaria, Anthozoa) species complex Barbara Porro, Thamilla Zamoum, Cedric Mallien, Benjamin Hume, Christian R. Voolstra, Eric Röttinger, Paola Furla, Didier Forcioli To cite this version: Barbara Porro, Thamilla Zamoum, Cedric Mallien, Benjamin Hume, Christian R. Voolstra, et al.. Horizontal acquisition of Symbiodiniaceae in the Anemonia viridis (Cnidaria, Anthozoa) species com- plex. Molecular Ecology Notes, Wiley-Blackwell, In press. hal-03021288 HAL Id: hal-03021288 https://hal.archives-ouvertes.fr/hal-03021288 Submitted on 26 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Title: Horizontal acquisition of Symbiodiniaceae in the Anemonia viridis (Cnidaria, 2 Anthozoa) species complex 3 Running title: Horizontal symbionts acquisition in A.viridis 4 Barbara Porro1, Thamilla Zamoum1, Cédric Mallien1, Benjamin C.C. Hume2, Christian R. 5 Voolstra3, Eric Röttinger1, Paola Furla1* & Didier Forcioli1*§ 6 7 1 , CNRS, INSERM, Institute for Research on Cancer and Aging (IRCAN),