G C A T T A C G G C A T

genes

Article

Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

• Aldo Nicosia ^1,
• *
• ^ID , Carmelo Bennici ¹, Girolama Biondo ¹, Salvatore Costa ²
• ,

ID

Marilena Di Natale ¹, Tiziana Masullo ¹, Calogera Monastero ¹, Maria Antonietta Ragusa ²,

• Marcello Tagliavia ¹ and Angela Cuttitta ^1,
• *

1

National Research Council-Institute for Marine and Coastal Environment (IAMC-CNR), Laboratory of Molecular Ecology and Biotechnology, Detached Unit of Capo Granitola, Via del mare, 91021 Torretta Granitola (TP), Sicily, Italy; [email protected] (C.B.); [email protected] (G.B.); [email protected] (M.D.N.);

[email protected] (T.M.); [email protected] (C.M.); [email protected] (M.T.)

Department of Biological, Chemical and Pharmaceutical Sciences and Technologies, University of Palermo,

Viale delle Scienze, Ed. 16, 90128 Palermo, Sicily, Italy; [email protected] (S.C.); [email protected] (M.A.R.)

2

*

Correspondence: [email protected] (A.N.); [email protected] (A.C.); Tel.: +39-0924-40600 (A.N. & A.C.)

Received: 10 November 2017; Accepted: 5 January 2018; Published: 11 January 2018

Abstract: Gene family encoding translationally controlled tumour protein (TCTP) is defined as

highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this

study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea

anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida,

Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution

of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria

showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein

structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses

revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally,

the transcriptional profile of A. viridis TCTP (AvTCTP) after challenges with different abiotic/biotic

stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation.

These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in

environmental stress and immune responses.

Keywords: cnidarians; transcriptome wide analysis; translationally controlled tumour protein;

TCTPs; comparative genomics; homology modelling; gene expression

1. Introduction

The translationally controlled tumour protein (TCTP) represents a conserved protein that is widely expressed among eukaryotes. Members of TCTP family are 21–23 kDa proteins that do not

share any similarity with other known protein families [

the yeast Schizosaccharomyces pombe revealed a fold similar to a small chaperone [ four β-sheets, named A–D and three principal helices, known as H1–H3, which are connected in a

complex topology [ ]. Sequence and structural comparison between members of TCTP protein family

1], while analyses of TCTP 3D structure from

2]. It consists of

2

• Genes 2018, 9, 30; doi:10.3390/genes9010030
• www.mdpi.com/journal/genes

Genes 2018, 9, 30

2 of 21

revealed that differences among structure mainly relies in a flexible loop located between the core and

the helical domain [2].

TCTP homologues have been characterised in a variety of invertebrates, these include the nematodes Brugia malayi [

3

] and Caenorhabditis elegans [

• 4], the crab Eriocheir sinensis [
• 5],

the shrimps Litopenaeus vannamei, Penaeus indicus, Penaeus monodon and Marsupenaeus japonicas [

6

–9].

Recently, members of the TCTP family have also been identified in marine bivalves such as

Venerupis philippinarum [10], Mytilus galloprovincialis [11] and Chlamys farreri [12]. TCTP proteins

are ubiquitous expressed to exert diverse physiological activities; indeed, they play a role in different

cellular pathways such as cell growth, cell cycle progression and differentiation, gene regulation, stress/immune response, apoptosis and it has been also ascribed to TCTP an extracellular role cytokine-like [13,14]. However, there is little characterisation of TCTP genes in non-bilaterians as a single homologue has been described in Hydra vulgaris [15] and to date, even if identified,

no homologues have been characterised in other cnidarians.

The sea anemone Anemonia viridis is a common Mediterranean cnidarian [16,17]. The phylum
Cnidaria is a sister to Bilateria within the Eumetazoan, a phylogenetic split that dates back to the

Precambrian era [18]. The phylum split into two major lineages: the class Anthozoa to which A. viridis

belongs and its sister group, the Medusozoa. Combined analyses of morphological characters and

molecular data are consistent with the idea that the Anthozoans are basal within the cnidarian phylum

and they best represent the primitive cnidarians [19 and a diploblastic organisation, genomic and transcriptional analyses revealed unexpected ancestral

complexity [21 23]. Extant cnidarians represent the first organisms from organized cells into tissues [24

,20]. Despite the occurrence of a single body axis

• –
• ]

and as sister group of the Bilateria they are of great interest for the identification of mechanisms leading

to bilaterian traits [25–27].

Several cnidarian transcriptome datasets have been generated during the years [21

,22,28–30]

• and have permitted the use of bioprospecting and computational analysis [31 33]. In the present
• –

work, an open reading frame (ORF) for a TCTP family member, herein designated as A. viridis TCTP (AvTCTP), was recovered from A. viridis and its genomic organisation was characterised. An extensive transcriptional and genomic survey for the mining of expressed TCTPs from the

stony corals (Acropora millepora and Acropora digitifera), the sea anemones (Nematostella vectensis and

Exaiptasia pallida in addition to A. viridis) and H. vulgaris was carried out to analyse the molecular

evolution of the TCTP gene family among cnidarians.

Based on advances in homology recognition and using modern modelling and comparative tools,

the 3D structures of representative cnidarian TCTPs were predicted and compared in order to provide

structural and evolutionary details. Moreover, the gene expression pattern of AvTCTP in different sea

anemone districts and in response to abiotic and immune challenges was evaluated.

2. Materials and Methods

2.1. Ethics Statement

A. viridis housing and husbandry were performed in accordance with the best practices developed in the cnidarian community to optimise animal health. All experiments were carried out in compliance

with local laws and to date no specific permit is required for the performed experiments. However, all facilities and procedures complied with the Directive 2010/63/EU and the Animal Research:

Reporting of In Vivo Experiments (ARRIVE) guidelines.

2.2. Data Mining

The characterized TCTPs were used initially to retrieve their corresponding sequences from the

publicly available database at the National Centre for Biotechnology Information (NCBI). To obtain

more homologs, these sequences were used as query to perform extensive protein-protein BLAST (BLASTP), nucleotide BLAST (BLASTX) and protein-nucleotide BLAST (TBLASTN) searches until

Genes 2018, 9, 30

3 of 21

no novel putative matches could be retrieved. The putative matching sequences from A. millepora, A. digitifera, A. viridis, N. vectensis and H. vulgaris were obtained from public available databases under the following accession numbers: XP_015766473.1 (A. digitifera), JR988252.1 (A. millepora),

FK734027.1 and FK724838.1 (A. viridis), XM_021056176.1 (E. pallida), DV094372.1 and XM_001624752.1

(N. vectensis), NM_001309745.1 (H. vulgaris 1) and XM_002157314.3 (H. vulgaris 2). All the corresponding

genomic sequences were retrieved similarly with the exception of AvTCTP which has been isolated

experimentally. Because the existence of numerous gap in the N. vectensis genomic scaffold

NEMVEscaffold_304, it was not possible to unambiguously assign gene structure. Thus, the version to

date annotated has been used.

2.3. DNA, RNA Extraction and cDNA Synthesis

Specimens of A. viridis were manually collected from the Capo Granitola Coast (Torretta Granitola,

Latitude 37^◦34⁰30.00⁰⁰ N Longitude 12^◦40⁰47.26⁰⁰ E) in the South of Sicily (Italy) and maintained in

◦

Millipore Filtered Sea Water (MFSW) at 18

±

1 C with a 12:12 h light:dark photoperiod. Sea anemones

were acclimated for 20 days prior to challenges.

During acclimation, water parameters (pH, salinity, temperature, dissolved oxygen, turbidity,

conductivity, ammonium, ammonia, chloride and nitrate levels) were continuously checked to measure

the water quality of the aquarium through YSI ProDSS multiparameter probe (626870-1) (Dublin,

Ireland). Moreover, health of the sea anemones was monitored through continuous observation.

For RNA purification, tentacles, pharynx, basal disk and body column and mesenterial filaments

were rapidly recovered. Tissues were frozen in liquid nitrogen and ground into a fine powder using

a tissue disruptor. The powder was dissolved in Trizol reagent (Invitrogen Corporation, Carlsbad, CA, USA) and further RNA purification steps were performed according to the manufacturer’s instructions. RNA concentrations and quality were verified by spectrophotometry (optical density (OD) at 260 nm), whereas the RNA integrity was checked using a 1.5% agarose gel. The RNA was

stored at

−

80 ^◦C for future use. For DNA extraction, the powder was dissolved in a DNAzol reagent

(Invitrogen Corporation) and further genomic DNA purification steps were performed according to

the manufacturer’s instructions. DNA concentrations and quality were verified by spectrophotometry

(OD at 260 nm), whereas the integrity was checked using a 0.8% agarose gel. The DNA was stored at

−20 ^◦C for future use.

The extracted RNA (2 µg) was treated with RNA qualified 1 (RQ1) RNase-Free DNase

(Promega, Madison, WI, USA) to remove any residual genomic DNA contamination and the DNase

was inactivated by adding 25 mM EDTA. First-strand cDNA was synthesised from 2 µg DNase-treated

total RNA samples using oligo(dT)₁₈ and Superscript III (Invitrogen Corporation) following the

manufacturer’s instructions. The cDNA mixture was stored at −20 ^◦C.

2.4. Full-Length cDNA and Gene Cloning from Anemonia viridis

Based on the partial sequence of AvTCTP cDNA, the 3⁰ end was obtained by PCR-RACE (rapid

amplification of cDNA ends) using the SMART RACE cDNA application kit (Clontech, Mountain View,

CA, USA) and the 3⁰ AvTCTP primer (Table 1) as described in the user manual. The 3⁰ RACE product was cloned into the pGEM-T Easy vector (Promega, USA) and transformed into XL1- Blue

Escherichia coli cells (Stratagene, San Diego, CA, USA). Plasmid DNA, from three independent clones,

was purified on Illustra

™

plasmidPrep Mini SpinKit (GE Healthcare Life Sciences, Chicago, IL, USA)

and sequenced using T7 and SP6 primers.

The full-length cDNA, consisting in sequences from original expressed sequence tags (ESTs)

and additional elements from 3⁰ RACE product was amplified using an appropriate pair of primers

(FlTCTP Fw/Rv) cloned in into the pGEM-T Easy vector (Promega) and the nucleotide sequence was

verified using T7 and SP6 sequencing primers. Based on the 5⁰- and 3⁰-UTR (untranslated region)

sequences, the primer set FlTCTP Fw/Rv was used to isolate the genomic DNA sequences.

Genes 2018, 9, 30

4 of 21

Table 1. Specific primers used in this study.

• 0
• 0

• Primers
• Sequences (5 –3 )
• Amplicon Size (bp)

0

• GACCGCTTTAATGGAGTCTTC^F
• 3 RACE
• -

GAGGTCGAGCTGTACCAACAA^F TTGTTCACGACGAACTTCCTAC^R

GGTTCCAAATCCTCCACAAACC^F TGTCCCAATCCGCACGTTAC^R
Fl-TCTP RCC2
877 83
GCCTGTTGGACACCGATGAT^F TGCAAGGCTCTCTCCAGTCC^R

GGATGAAATGTTCGGAGGAAAC^F CATAGTGGGCTGTTCGCTGTAT^R
COP γ qTCTP
142 133

F

Forward primer

R

Reverse primer

RACE: rapid amplification of cDNA ends; RCC2: Regulator of Chromosome Condensation protein 2;

COP-γ: Coatomer subunit gamma; bp: base pair.

2.5. Sequence and Phylogenetic and Structural Analyses

ConSurf webserver [34] was used to construct and map the evolutionary variability of nucleotides

onto the secondary structures of the 5⁰-UTR from AvTCTP. Functional sites and domains in the

predicted amino acid sequences were predicted using the Simple Modular Architecture Research Tool

(SMART) program, the InterPro database [35], the Pfam database [36], the PROSITE program [37] and

the Eukaryotic Linear Motif resource (ELM) for Functional Sites in Proteins.

To reconstruct the molecular evolution of the TCTP family Basic Local Alignment Search
Tool (TBLASTN, BLASTP) analyses were performed to recover TCTPs from GenBank (Table 2).

TCTP protein sequences were aligned using T-Coffee software (http://tcoffee.crg.cat/apps/tcoffee/

index.html) [38]. Phylogenetic and molecular evolutionary analyses were conducted using a Maximum Likelihood (ML) method, implemented in MEGA version 7.0 [39] in which Poisson correction, pairwise

deletion and bootstrapping (1000 replicates) were considered as parameters, to reconstruct the

evolutionary diversification and the molecular evolution of TCTP proteins family in cnidarians and

different Eumetazoan groups. Moreover, the 3D structures of TCTP proteins were reconstructed

exploiting the advances in homologues detection [23,27,40]. Thus homology modelling via the Protein

Homology/analogY Recognition Engine 2.0 (Phyre 2) software [41] using the intensive modelling mode

was carried out. Candidate structures for homology modelling were selected according to pairwise

alignment. At least two different structures were used as a template for each generated structure and

homology models were built for all the sets of proteins. Validation of the structural protein models was performed by assessing the Ramachandran plots. Cycles of clash minimization were also performed for

the refinement of structures. Secondary structures assignments and relative solvent accessibility (RSA)

were calculated by the DSSP program [42,43] as implemented in ENDscript [44]. Additionally, ConSurf

webserver [34] was used to map the evolutionary variability of amino acids onto the reconstructed

structures of homologues which were rendered using the UCSF Chimera package [45].

Table 2. Translationally Controlled Tumour Proteins (TCTPs) from Eumetazoans used for

phylogenetic Analysis.

• Species
• Accession Number
• Taxonomic Group

Homo sapiens Mus musculus Sus scrofa

AAQ01550.1 NP033455.1 AAL68965.1
Mammalia Mammalia Mammalia

Genes 2018, 9, 30

5 of 21

Table 2. Cont.

• Species
• Accession Number
• Taxonomic Group

Rattus norvegicus Gallus gallus
Xenopus tropicalis Pogona vitticeps

NP446319.1 NP990729.1 NP_001008074.1 XP_020652710.1 NP937783.1
Mammalia
Aves
Amphibia Reptilia Osteichtyes

Danio rerio Salmo salar

• ACI68686.1
• Osteichtyes

Osteichtyes Osteichtyes Agnata

Xiphophorus maculatus
Takifugu rubripes Petromyzon marinus Branchiostoma floridae Ciona intestinalis
Apostichopus japonicus

XP005807723.1 XP003962088.1 EB084009.1 XP_002592847.1 FK151528.1 ABC87996.1 AID69538.1 XP795619.2
Cephalochordata
Tunicata
Echinodermata Echinodermata Echinodermata
Insecta

Stichopus monotuberculatus Strongylocentrotus purpuratus
Nilaparvata lugens
Drosophila melanogaster
Anopheles sinensis Spodoptera frugiperda Harpegnathos saltator Megachile rotundata Fenneropenaeus chinensis
Penaeus monodon

XP_022184371.1 NP001303431.1 KFB46001.1
Insecta Insecta Insecta Insecta Insecta Crustacea Crustacea
ADK56158.1 XP011150938.1 XP_003700051.1 ABB05535.1 ACD13588.1

Lepeophtheirus salmonis Octopus bimaculoides Aplysia californica Crassostrea virginica Caenorhabditis elegans Caenorhabditis remanei Dictyocaulus viviparus
Brugia malayi Clonorchis sinensis Macrostomum lignano
Hydra vulgaris 1 Hydra vulgaris 2 Hydractinia echinata Podocoryna carnea

• ACO12977.1
• Crustacea

Mollusca Mollusca Mollusca Nematoda Nematoda Nematoda Nematoda Platyhelmintes Platyhelmintes
Hydrozoa Hydrozoa Hydrozoa
XP_014780570.1 XP_005092645.1 XP_022338092.1
Q93573.1 EFP12520.1 KJH46926.1 XP001897741 AAX84199.1 PAA86325.1
NM_001309745.1 XM_002157314.3
DT623491.1

• DY451741.1
• Hydrozoa

Clytia hemisphaerica Polypodium hydriforme
Kudoa iwatai Aurelia aurita Alatina alata
Haliclystus sanjuanensis Haliclystus auricula
Calvadosia cruxmelitensis Acanthogiorgia aspera Heliopora coerulea Acropora digitifera Acropora millepora Acropora palmata Montastraea faveolata Nematostella vectensis
Metridiumsenile Anemonia viridis Aiptasia pulchella Exaiptasia pallida

• FP985759.1
• Hydrozoa

Hydrozoa Myxozoa Scyphozoa Cubozoa Staurozoa Staurozoa Staurozoa
GBGH01019625.1 GBGI01001069.1 GBRG01251580.1 GEUJ01004399.1 HAHB01030183.1 HAHA01057349.1 HAHC01090444.1 GETB01037007.1 IABP01022130.1 XP_015766473.1
JR988252.1 GW212294.1 GW258989.1 XM_001624752.1
FC834313.1 FK734027.1 CK662981.1 XP_020911835.1 XP_003382650.1
Anthozoa Octocorallia Anthozoa Octocorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia Anthozoa Hexacorallia
Porifera

Amphimedon qeenslandica

Genes 2018, 9, 30

6 of 21

2.6. Anemonia viridis Translationally Controlled Tumour Protein Tissue-Specific Expression Pattern

Reverse Transcription-PCR (RT-PCR) was used to profile the tissue specific mRNA expression of AvTCTP. The cDNA from the different anatomical district previously synthetized were used as templates, whereas qTCTP-F and qTCTP-R (Table 1) primers were used. PCR amplifications were