Anti-Cancer Effects and Tumor Marker Role of Glutathione S-Transferase Mu 5 in Human Bladder Cancer

International Journal of Molecular Sciences

Article Anti-Cancer Effects and Tumor Marker Role of Glutathione S-Transferase Mu 5 in Human Bladder Cancer

Yeong-Chin Jou 1,2,†, Shou-Chieh Wang 3,4,5,†, Yuan-Chang Dia 3,6, Shou-Tsung Wang 3, Min-Hua Yu 3, Hsin-Yi Yang 7, Lei-Chin Chen 8, Cheng-Huang Shen 1,2,* and Yi-Wen Liu 3,*

1 Department of Urology, Ditmanson Medical Foundation Chiayi Christian Hospital, Chiayi 600, Taiwan; [email protected] 2 Department of Health and Nutrition Biotechnology, Asian University, Taichung 41354, Taiwan 3 Department of Microbiology, Immunology and Biopharmaceuticals, College of Life Sciences, National Chiayi University, Chiayi 600, Taiwan; [email protected] (S.-C.W.); [email protected] (Y.-C.D.); [email protected] (S.-T.W.); [email protected] (M.-H.Y.) 4 Department of Food Science, College of Life Sciences, National Chiayi University, Chiayi 600, Taiwan 5 Division of Nephrology, Department of Internal Medicine, Kuang Tien General Hospital, Taichung 437, Taiwan 6 Department of Pathology, Ditmanson Medical Foundation Chiayi Christian Hospital, Chiayi 600, Taiwan 7 Department of Clinical Medicine, Ditmanson Medical Foundation Chiayi Christian Hospital, Chiayi 600, Taiwan; [email protected] 8 Department of Nutrition, I-Shou University, Kaohsiung 82445, Taiwan; [email protected] * Correspondence: [email protected] (C.-H.S.); [email protected] (Y.-W.L.); Tel.:+886-5-2765041 (C.-H.S.); +886-5-2717809 (Y.-W.L.) † The two authors contributed equally to this work.

Citation: Jou, Y.-C.; Wang, S.-C.; Dia, Abstract: Our previous study demonstrated that the glutathione S-transferase Mu 5 (GSTM5) gene is Y.-C.; Wang, S.-T.; Yu, M.-H.; Yang, highly CpG-methylated in bladder cancer cells and that demethylation by 5-aza-dC activates GSTM5 H.-Y.; Chen, L.-C.; Shen, C.-H.; Liu, gene expression. The aim of the present study was to investigate the role of GSTM5 in bladder cancer. Y.-W. Anti-Cancer Effects and Tumor The levels of GSTM5 gene expression and DNA methylation were analyzed in patients with bladder Marker Role of Glutathione cancer, and functional studies of GSTM5 were conducted using GSTM5 overexpression in cultured S-Transferase Mu 5 in Human bladder cancer cells. Clinical analysis revealed that the GSTM5 mRNA expression was lower in Bladder Cancer. Int. J. Mol. Sci. 2021, bladder cancer tissues than in normal tissues and that the level of GSTM5 DNA methylation was 22, 3056. https://doi.org/10.3390/ higher in bladder cancer tissues than in normal urine pellets. Overexpression of GSTM5 decreased ijms22063056 cell proliferation, migration and colony formation capacity. Glutathione (GSH) assay results indicated that cellular GSH concentration was decreased by GSTM5 expression and that GSH supplementation Academic Editor: Evgeny Imyanitov reversed the decrease in proliferation and migration of cells overexpressing GSTM5. By contrast,

Received: 27 February 2021 a GSH synthesis inhibitor significantly decreased 5637 cell GSH levels, survival and migration. Accepted: 15 March 2021 Furthermore, GSTM5 overexpression inhibited the adhesion of cells to the extracellular matrix protein Published: 17 March 2021 fibronectin. To elucidate the effect of GSTM5 on anticancer drugs used to treat bladder cancer, cellular viability was compared between cells with or without GSTM5 overexpression. GSTM5-overexpressed Publisher’s Note: MDPI stays neutral cells showed no significant change in the cytotoxicity of cisplatin or mitomycin C in 5637, RT4 and with regard to jurisdictional claims in BFTC 905 cells. Though a degree of resistance to doxorubicin was noted in 5637 cells overexpressing published maps and institutional affil- GSTM5, no such resistance was observed in RT4 and BFTC 905 cells. In summary, GSTM5 plays iations. a tumor suppressor role in bladder cancer cells without significantly affecting chemoresistance to cisplatin and mitomycin C, and the cellular GSH levels highlight a key mechanism underlying the cancer inhibition effect of GSTM5. These findings suggest that low gene expression and high DNA methylation levels of GSTM5 may act as tumor markers for bladder cancer. Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. Keywords: bladder cancer; DNA methylation; glutathione S-transferase Mu; glutathione; tumor This article is an open access article suppressor distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/).

Int. J. Mol. Sci. 2021, 22, 3056. https://doi.org/10.3390/ijms22063056 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, 3056 2 of 19

1. Introduction Bladder cancer is the fourth most common type of cancer among men in the United States [1] and is the ninth most common cancer type worldwide [2]. Although bladder cancer is the 13th most lethal cancer type globally [2], its high recurrence impairs patient quality of life and results in considerable economic burden. Recently, immunotherapy has provided hope for the treatment of metastatic platinum-refractory bladder cancer but is only effective in patients with programmed cell death 1 ligand 1-positive status [3]. Therefore, it is important to prevent the development of bladder tumors by elucidating the factors involved in their carcinogenesis and progression. There are various risk factors for the development of bladder cancer, including exposure to arylamines [4], smoking [5], exposure to environmental arsenic [6,7], aging and hereditary influences. Among these factors, cigarette smoke is the single most prevalent cause of bladder cancer [8]. Gene polymorphism is also a factor for bladder cancer development. Glutathione S-transferases (GSTs), a family of phase 2 detoxification enzymes, play an important role in the metabolism and/or detoxification of various endo- and xenobiotics, including drugs [9]. GSTs catalyze the conjugation of glutathione (GSH) to a wide variety of xenobiotics. This detoxification ability plays an important role in cellular protection from the environment and oxidative stress but is also implicated in cellular resistance to various chemotherapy drugs [10]. GSTs can be categorized into different families according to similarities in amino acid sequence. GSTmu (GSTM) is one of the largest GST families, which contains five members, GSTM1-M5. It is known that approximately 50% of the population pos- sess the GSTM1-null genotype, which results in a lack of GSTM1 enzyme activity [11]. Furthermore, loss of the GSTM1 gene is known to be correlated with human bladder cancer [11,12]. Smoking also increases the odds ratio of bladder cancer in individuals with the GSTM1-null genotype [12,13]. Cigarette smoke contains various carcinogens, including nitrosamines, and the bladder carcinogen N-butyl N-(4-hydroxybutyl) nitrosamine has been shown to induce mouse bladder carcinogenesis accompanied by decreasing GSTM1 gene expression [14]. The human genome database indicates that GSTM1-M5 is located on chromosome 1 and in close proximity to each other [15]. Furthermore, genes in the same GST family have a greater opportunity to play as substitutes for one another. For example, GSTM2 has been reported to functionally compensate for GSTM1-null in Indian people [16]. Moreover, a protective genotype with higher GSTM3 expression exhibits a lower breast cancer risk when GSTM1 is absent [17]. The role of GSTM2 has been studied in lung cancer, where it was found to decrease benzo[a]pyrene-induced DNA damage in lung cancer cells [18,19]. DNA methylation of the GSTM2 gene promoter decreases its gene expression by inhibiting Sp1 binding [20], and GSTM2 expression suppresses the migration of lung cancer cells [21]. A global analysis of promoter methylation in treatment-naïve urothelial cancer suggests that GSTM3 is one of the hypermethylated genes in invasive urothelial carcinoma [22]. In addition, other published reports have indicated an association between GSTM5 and cancers. A study of Barrett’s adenocarcinoma indicated that the gene expression of GSTM2, GSTM3 and GSTM5, but not GSTM4, was lower in tumors than in normal tissues and that DNA methylation also regulates gene expression [23]. In our previous study, the GSTM5 gene was found to be heavily CpG methylated and expressed at low levels in human bladder cancer cells. After treatment with the DNA methylation inhibitor 5-aza-20-deoxycytidine (5-aza-dC), the methylation level of GSTM5 was decreased, resulting in an increase in GSTM5 gene expression in 5637 and J82 cells [24]. In the present study, the DNA methylation level of human GSTM5 was analyzed in patients with bladder cancer and normal subjects, and GSTM5 was overexpressed in bladder cancer cells to assess changes in cancer-associated characteristics.

2. Results 2.1. GSTM5 mRNA Expression Is Downregulated in Bladder Cancer Tissues The GSTM5 mRNA expression data of patients with bladder cancer were extracted from the publicly available Oncomine database. After data-mining for GSTM5 and Int. J. Mol. Sci. 2021, 22, 3056 3 of 19 bladder cancer in cancer vs. normal differential analysis (p < 0.001, fold change > 1.5, gene rank the top 10%), three mRNA databases exhibited differential expression (Sanchez- Carbayo bladder 2,cancer Lee bladder in cancer and vs. Dyrskjot normal differential bladder 3). analysis In these (p three< 0.001, databases, fold change GSTM5 >1.5, gene rank mRNA was downregulatedthe top 10%), in superficial three mRNA and databases infiltrating exhibited bladder differential tumor tissues expression compared (Sanchez-Carbayo with normal tissuesbladder (Figure 2, Lee1), suggesting bladder and that Dyrskjot GSTM5 bladder may 3).play In thesea tumor three suppressor databases, role GSTM5 mRNA in human bladder wascancer. downregulated in superﬁcial and inﬁltrating bladder tumor tissues compared with normal tissues (Figure1), suggesting that GSTM5 may play a tumor suppressor role in human bladder cancer.

Figure 1. Glutathione S-transferase Mu 5 (GSTM5) mRNA expression is downregulated in patients with bladder cancer from the Oncomine database. Three mRNA databases exhibited different expression levels of GSTM5 mRNA between normalFigure and cancer 1. Glutathione tissues (left S panel:-transferase Sanchez-Carbayo Mu 5 (GSTM5) bladder mRNA 2, middle expre panel:ssion Lee is bladder, downregulated right panel: in Dyrskjotpatients bladder 3). Thewith dots bladder are the maximumcancer from and the minimum, Oncomine the boxdataba containsse. Three 75% tomRNA 25% values, databases the line exhibited in box is different median, and the lines −7 −9 outsideexpression the box are levels the valuesof GSTM5 of 90% mRNA and 10%. between The n norm meansal bladderand cancer sample tissues number, (left *panel:p < 1 ×Sanchez-10 ; *** p < 1 × 10 comparedCarbayo to normal. bladder 2, middle panel: Lee bladder, right panel: Dyrskjot bladder 3). The dots are the maximum and minimum,2.2. DNA the Methylationbox contains Level 75% of to the 25% GSTM5 values, Gene the Promoterline in box Is Increasedis median, in Bladderand the Cancer Tissues lines outside the box are the values of 90% and 10%. The n means bladder sample number, * p < In our previous study [24], GSTM5 mRNA expression was enhanced in 5637 bladder 1E-7; ** p < 1E-8; *** p < 1E-9 compared to normal. cancer cells following treatment with 10 µM 5-aza-dC; the DNA CpG methylation level of the GSTM5 promoter was also decreased from 84.6 to 61.5%. In the present study, 2.2. DNA Methylation5-aza-dC Level administrationof the GSTM5 Gene also increased Promoter GSTM5 Is Increased mRNA in (Figure Bladder2A) Cancer and protein (Figure2B) Tissues expression in 5637 cells and to a greater degree in RT4 cells (Figure2A,B). In our previous studyIn view [24], of GSTM5 the inhibited mRNA gene expression activation was and enhanced expression in of 5637 GSTM5 bladder caused by DNA cancer cells followingCpG treatment methylation, with the 10 DNA µM methylation5-aza-dC; the level DNA of GSTM5 CpG methylation was analyzed level using of tumors from the GSTM5 promoterpatients was withalso bladderdecreased cancer from and 84 urine.6 to pellets61.5%. from In the healthy present individuals study, 5-aza- with no previous history of bladder cancer. The characteristics of the study population are listed in Table1. dC administration also increased GSTM5 mRNA (Figure 2A) and protein (Figure 2B) Though the mean age was different between patients and healthy subjects (Table1), the expression in 5637correlation cells and to between a greater age degree and GSTM5 in RT4 DNA cells methylation (Figure 2A,B). level in the 100 volunteers was In view of thenot inhibited statistically gene significant activation (Figure and2 expressionC). Though theof GSTM5 sex distribution caused was by alsoDNA different be- CpG methylation, tweenthe DNA patients methylation and healthy level subjects, of GSTM5 the GSTM5 was analyzed DNA methylation using tumors level was from no difference patients with bladderbetween cancer male and and urine female pellets subjects from (p healthy= 0.7) (Table individuals2). When with comparing no previous 50 patients with history of bladder 50cancer. healthy The subjects, characteristics GSTM5 DNAof the methylation study population level was are significantly listed in Table higher 1. in bladder Though the mean cancerage was tissues different than in between healthy urinepatients pellets and (Figure healthy2D). subjects After the (Table DNA methylation1), the levels correlation betweenwere age classified and GSTM5 into DNA three levels,methyl includingation level low in (<30%),the 100 mediumvolunteers (≥30% was and not <75%) and high (≥75%), the difference between healthy subjects and patients with bladder cancer also statistically significant (Figure 2C). Though the sex distribution was also different between reached significance (p = 0.003) (Table3). Differences between GSTM5 DNA methylation patients and healthylevels subjects, at various the cancer GSTM5 stages DNA were alsomethylation analyzed, level and the was results no alsodifference indicated a signif- between male and icantfemale difference subjects (Table (p = 0.7)4). These(Table findings 2). When suggest comparing that hypermethylation 50 patients with of 50 the GSTM5 healthy subjects, GSTM5gene represents DNA anmethylation essential biomarker level was of bladder significantly cancer, whichhigher results in bladder in the lower mRNA cancer tissues thanexpression in healthy levels urine observed pellets (Figure in Figure 2D).1. Analysis After the of publicly DNA methylation available clinical levels survival data associated with GSTM5 expression (Kaplan–Meier Plotter, https://kmplot.com/analysis/,

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 20

levels at various cancer stages were also analyzed, and the results also indicated a significant difference (Table 4). These findings suggest that hypermethylation of the GSTM5 gene represents an essential biomarker of bladder cancer, which results in the lower mRNA expression levels observed in Figure 1. Analysis of publicly available clinical survival data associated with GSTM5 expression (Kaplan–Meier Plotter, https://kmplot.com/analysis/, accessed on 20 November 2020) is displayed in Figure 2E,F. These data indicate that high GSTM5 expression may increase the probability of relapse- Int. J. Mol. Sci.free2021 survival, 22, 3056 in patients with bladder cancer (Figure 2F). 4 of 19 In addition, the GSTM1-null ratio was also analyzed in the 100 study volunteers by using the multiplex PCR method according to our previous study [24]. However, no sig- accessed on 20 November 2020) is displayed in Figure2E,F. These data indicate that high nificant differencesGSTM5 were expression observed may between increase no thermal probability subjects of(62%) relapse-free and those survival with in bladder patients with cancer (64%). bladder cancer (Figure2F).

µ Figure 2. The status of GSTM5 DNA methylation in bladder cancer cells and clinical samples. (A) The effect of 10 M 5-aza-dC on GSTM5 mRNA expression. (B) The effect of 10 µM 5-aza-dC on GSTM5 protein expression. The anti-GSTM5 antibodiesFigure were 2. AbnovaThe status H00002949-D01P. of GSTM5 DNA (C) Correlation methylation between in bladder age and GSTM5cancer DNAcells and methylation clinical level samples. in 50 bladder (A) cancerThe tissues effect and of 50 10 normal µM human5-aza-dC urine on pellets. GSTM5 The mRNA linear regression expression. formula (B) isThe on theeffect bottom of 10 right µM (R 5-aza-dC2 = 0.1074), on which was calculatedGSTM5 byprotein Microsoft expression. Excel. (D) The GSTM5 anti-GSTM5 DNA methylation antibodies level were in 50 bladderAbnova cancer H00002949-D01P. tissues and 50 normal (C) Corre- human urine pellets.lation between The statistical age and results GSTM5 were analyzedDNA methylation by SigmaPlot. leve (El )in Kaplan–Meier 50 bladder cancer plot showing tissues the and overall 50 normal survival probability of 404 bladder cancer patients. (F) Kaplan–Meier plot of the relapse-free survival probability of 187 bladder cancer patients.

Int.Int. J.J. Mol.Mol. Sci.Sci. 2021,, 22,, xx FORFOR PEERPEER REVIEWREVIEW 5 of 20

Int. J. Mol. Sci. 2021, 22, 3056 5 of 19 human urine pellets.. TheThe linearlinear regressionregression formulaformula isis onon thethe bottom right (R(R22 = 0.1074),, which was calculated by Microsoft Excel. (D)) GSTM5GSTM5 DNADNA methylationmethylation levellevel inin 5050 bladderbladder cancercancer tissuestissues andand 50 normal human urine pellets.. TheThe statisticstatistical results were analyzed by SigmaPlot. (E)) KaplanKaplan– TableMeier 1. plotThe showing age and the sex overall of 50 surviv patientsal probability with bladder of 404 cancer bladder and cancer 50 healthy patients. individuals. (F)) KaplanKaplan– Meier plot of the relapse--freefree survivalsurvival probabilityprobability ofof 187187 bladderbladder cancercancer patients.patients. Characteristics Bladder Cancer Healthy Individual Table 1.Age The (min/max)age and sex of 50 patients with bladder 28/92 cancer and 50 healthy individuals. 20/81 CharacteristicsMean of age Bladder 73.16Cancer Healthy Individual 35.42 Sexuality (male/female) 32/18 11/39 Age (min/max) 28/92 20/81 Mean of age 73.16 35.42 Sexuality (male/female) 32/18 11/39 Table 2. Comparison of the sex differences between groups and GSTM5 DNA methylation levels.

Table 2. ComparisonSample Group of thethe sexsex differencesdifferences betweenbetween Male groupsgroups andand GSTM5GSTM5 Female DNADNA methylationmethylation levelslevelsp-Value.. SampleGroup Group Male Female p-Value Bladder cancerGroup number (%) 32 (74.42) 18 (31.58) <0.001 HealthyBladder individual cancer number number (%) (%) 1132 (25.58) (74.42) 18 39 (31.58) (68.42) <0.001 HealthyAll individual samples number (%) 11 (25.58) 39 (68.42) ± ± MethylationAll samples level (%) 61.17 22.62 59.43 22.32 0.700 Methylation level (%) 61.17 ± 22.62 59.43 ± 22.32 0.700 Table 3. GSTM5 gene methylation levels of 50 patients with bladder cancer and 50 healthy individuals. Table 3. GSTM5 gene methylation levels of 50 patients with bladder cancer and 50 healthy indi- Theviduals. methylation The methylation level is divided levellevel isis divideddivided into 3 classesintointo 33 classes (low, (( mediumllow, medium and and high). high).

ThreeThree-Tier-Tier C Classiﬁcationlassification of BladderBladder C Cancerancer HealthyHealthy Individual Individual p-Valuep-Value MMethylationethylation L Levelevel NumberNumber (%) (%) NumberNumber (%) (%) MethylationMethylation levelslevels (%)(%) 0.003 0.003 Low (< (<30)30) 0 0(0) (0) 10 10(20) (20) Medium ( (3030 ≦ x < 75 75)) 3232 (64) (64) 28 28(56) (56) High ( ≧75)75) 1818 (36) (36) 12 12(24) (24)

Table 4. The correlation between GSTM5 gene methylation levels and bladder cancer stages in 100 Tablesubjects. 4. The The correlation methylation between levellevel isis divideddivided GSTM5 intointo gene 33 classes methylation ((llow, medium levels and and high). bladder cancer stages in 100 subjects. The methylation level is dividedMethylation into 3 classes Levels (low, medium and high). Cancer Stage Low (<30) Medium (30 ≦ x < 75) High (≧75) p-Value Methylation Levels Number (%) Number (%) Number (%) Cancer Stage p-Value Bladder status Low (<30) Medium (30 x < 75) High ( 75) 0.031 Number (%) Normal 10 (100) Number28 (47.67) (%) Number12 (40) (%) BladderStage status 0is 0 (0) 9 (15) 2 (6.67) 0.031 NormalSuperficial 10 (100)0 (0) 17 28 (28.33) (47.67) 11 (36.67) 12 (40) StageInfiltrating 0is 00 (0) (0) 6 9(10) (15) 5 (16.67) 2 (6.67) SuperficialTotal 10 0(0) (100) 60 17 (100) (28.33) 30 11 (100) (36.67) Infiltrating 0 (0) 6 (10) 5 (16.67) Total 10 (100) 60 (100) 30 (100) 2.3. Biological Effects of GSTM1-5 Overexpression inin Bladder Cancer Cells In addition to GSTM5 and GSTM1, there are another 3 members in the GSTM family,, includingincludingIn addition, GSTM2GSTM2- the4. GSTM1~5 GSTM1-null share 66 ratio to 88% was amino also acid analyzed sequence in thesimilarity. 100 study GSTM2 volunteers is byknown using to the play multiplex a tumor suppressor PCR method role [21], according and functional to our characteristics previous study that [may24]. also However, nobe significant shared GSTM5 differences (Figure 1); were therefore, observed the effects between of GSTM1 normal-5 on subjects cell viability (62%) were and com- those with bladderpared by cancer overexpressing (64%). these proteins in 5637 cells. GSTM1-5 were transiently overexpressed in 5637 cells and detected by anti-DDK flag (Figure 3A) or anti-GSTM1-5-specific 2.3.antibodies Biological (Figure Effects 3B). of GSTM1-5The molecular Overexpression weight of the in overexpressed Bladder Cancer GSTMs Cells was about 28– 29 kDa,, which is slightly greater than that of endogenous GSTMs (about 26 kDa). As In addition to GSTM5 and GSTM1, there are another 3 members in the GSTM family, shown in Figure 3A, the cell viability was significantly decreased in GSTM2, GSTM3 and including GSTM2-4. GSTM1~5 share 66 to 88% amino acid sequence similarity. GSTM2 is known to play a tumor suppressor role [21], and functional characteristics that may also be shared GSTM5 (Figure1); therefore, the effects of GSTM1-5 on cell viability were compared

by overexpressing these proteins in 5637 cells. GSTM1-5 were transiently overexpressed in 5637 cells and detected by anti-DDK flag (Figure3A) or anti-GSTM1-5-specific antibodies (Figure3B). The molecular weight of the overexpressed GSTMs was about 28–29 kDa, which is slightly greater than that of endogenous GSTMs (about 26 kDa). As shown in Figure3A, the cell viability was significantly decreased in GSTM2, GSTM3 and GSTM5- Int. J. Mol. Sci. 2021, 22, 3056 6 of 19

overexpressed cells. Figure3B indicates that anti-GSTM2 and -GSTM3 antibodies have a higher specificity than those against GSTM1, GSTM4 and GSTM5. Due to the nonspecific activity of the anti-GSTM5 antibody from GeneTex, another antibody from Abnova was used to generate the data presented in Figures2B and4A. As the primary function of GSTs is to catalyze the conjugation of GSH to a wide variety of electrophilic substrates, the enzyme activity was also compared in 5637 cells overexpressing GSTM1-5, using CDNB as a substrate. The results suggested that GSTM1 possessed the greatest enzymatic activity (Figure3C). Considering the differences in substrate binding affinity between GSTM1-5, the findings may not represent the real enzymatic activity of all cells overexpressing GSTMs; therefore, the cellular GSH level was also selected to assess the enzyme activity because the glutathione transferase consumes GSH as a result of this enzyme reaction. Figure3D indicates that cellular GSH levels were decreased in cells overexpressing GSTM2 and GSTM5 but increased in GSTM3-overexpressed cells. Among them, GSTM5 overexpression depleted GSH levels to the greatest degree. The phenomenon of GSTM5 overexpression- reduced GSH cellular level was confirmed in two additional bladder cancer cell lines, RT4 and BFTC 905 (Figure3E).

2.4. GSTM5 Overexpression Decreases Intracellular GSH Levels and Suppresses the Proliferation and Migration of Bladder Cancer Cells The conjugation of GSH with various electrophilic compounds is supposed to decrease the cellular damage caused by the reactive compounds. However, the process also depletes cellular GSH, which is integral to other protective mechanisms in addition to glutathione transferase, including the glutathione peroxidase pathway. Since GSTM5 decreased GSH levels to a greater degree than the other GSTMs (Figure3D), the potential effect of this GSTM5-induced GSH reduction in cellular activity was investigated. After stable overexpression, the protein levels of GSTM5 were significantly increased in 5637 cells (5637ovGSTM5) (Figure4A). The cellular GSH concentration was also decreased in 5637ovGSTM5 cells compared with those transfected with the vector control (5637VC) (Figure4B). The cell viability was significantly decreased after transient GSTM5 expression (Figure3A ). In the stable cell lines, the effects of GSTM5 on the proliferative rate and colony formation ability were analyzed. The results indicated that the cell proliferation and the number of colonies in soft agarose were decreased by GSTM5 overexpression (Figure4C,D ). Moreover, the migration activity of 5637ovGSTM5 cells was significantly lower than that of 5637VC cells by Transwell assay (Figure4E). Wound healing assays also showed that GSTM5 overexpression retarded the healing rate (Figure4F) ( Video S1). GSTM5 overexpression inhibited cell migration was also observed in BFTC 905 cells (Figure4G ). The results of the aforementioned functional assays indicate that GSTM5 plays a suppressor role in both bladder cancer proliferation and migration.

2.5. GSH Reverses GSTM5-Inhibited Cell Proliferation and Migration In the present study, GSTM5 was found to decrease cellular GSH levels and suppress cancer cell proliferation and migration. Therefore, to further elucidate whether GSH supplementation could restore cell proliferation and migration ability, 5637ovGSTM5 cells were treated with 4 mM GSH-M. Restoration of GSH levels was conﬁrmed 24 h after GSH- M treatment (Figure5A) and reversed the retardation of 5637ovGSTM5 cell proliferation (Figure5B). In addition, the migration ability of 5637ovGSTM5 cells was signiﬁcantly increased after GSH-M treatment (Figure5C). Taken together, these data suggest that the GSTM5-induced suppression of cancer cell proliferation and migration were reversed by intracellular GSH supplementation. Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 6 of 20

shown in Figure 3A, the cell viability was significantly decreased in GSTM2, GSTM3 and GSTM5-overexpressed cells. Figure 3B indicates that anti-GSTM2 and -GSTM3 antibodies have a higher specificity than those against GSTM1, GSTM4 and GSTM5. Due to the nonspecific activity of the anti-GSTM5 antibody from GeneTex, another antibody from Ab- nova was used to generate the data presented in Figures 2B and 4A. As the primary function of GSTs is to catalyze the conjugation of GSH to a wide variety of electrophilic substrates, the enzyme activity was also compared in 5637 cells overexpressing GSTM1-5, using CDNB as a substrate. The results suggested that GSTM1 possessed the greatest enzymatic activity (Figure 3C). Considering the differences in substrate binding affinity between GSTM1-5, the findings may not represent the real enzymatic activity of all cells overexpressing GSTMs; therefore, the cellular GSH level was also selected to assess the enzyme activity because the glutathione transferase consumes GSH as a result of this enzyme reaction. Figure 3D indicates that cellular GSH levels were decreased in cells overexpressing GSTM2 and GSTM5 but increased in GSTM3-overexpressed cells. Among them, GSTM5 overexpression depleted GSH levels to the greatest degree. The phenomenon of GSTM5 overexpression-reduced GSH cellular level was confirmed in two addi- Int. J. Mol. Sci. 2021, 22, 3056 tional bladder cancer cell lines, RT4 and BFTC 905 (Figure 3E). 7 of 19

Figure 3. The expression and biological effects of GSTM1-5 by transient transfection expression. (A) The protein expression and cell viability after transfection. A total of 5637 cells were transfected with empty vectors or vectors with GSTM1-5 genes. After transfection for 24 h and 48 h, the proteins were detected by anti-DDK antibodies. Cell viability was analyzed after transfection for 32 h. (B) The protein expression and antibody characteristics. A total of 5637 cells were transfected with empty vectors or vectors with GSTM1-5 genes for 24 h; GSTM1~5 proteins were detected by their individual antibodies from GeneTex. (C) GST activity assay. A total of 5637 cells were transfected with empty vectors or vectors with GSTM1-5 genes for 24 h, the protein expression and GST activity were analyzed individually. (D) Cellular GSH level. A total of 5637 cells were transfected with empty vectors or vectors with GSTM1-5 genes for 24 h, the protein expression and GSH level (assayed by Cayman Chemical kit 703002) were analyzed. (E) Cellular GSH level in RT4 and BFTC 905 cells. After transient transfection for 24 h, cells were collected for GSH level detection (assayed by Cayman Chemical kit 703,002). All data are presented as the mean ± SE of three independent experiments. * p < 0.05; ** p < 0.01; *** p < 0.001. Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 8 of 20 Int. J. Mol. Sci. 2021, 22, 3056 8 of 19

FigureFigure 4. 4.Bladder Bladder cancercancer cellcell proliferationproliferation andand migrationmigration ability were decreased after GSTM5 overexpression. overexpression. (A (A) )The The proteinprotein expression expression in in 5637 5637 cells cells with with or or without without overexpression overexpression of emptyof empty vector vector (5637VC) (5637VC) or GSTM5or GSTM5 (5637ovGSTM5-1 (5637ovGSTM5-1 and 5637ovGSTM5-2and 5637ovGSTM5-2 were fromwere 2from stably 2 transfectedstably transfected colonies) colonies) was detected was detected by Western by Western blot. The blot. anti-DDK The anti-DDK antibodies antibodies (TA50011- 100(TA50011-100 from OriGene) from and OriGene) anti-GSTM5 and anti-GST antibodiesM5 antibodies (H00002949-D01P (H00002949-D01P from Abnova) from Abnova) were used were for used detection. for detection. (B,C) GSTM5- (B,C) overexpressedGSTM5-overexpressed 5637 cells 5637 decreased cells decrea intracellularsed intracellular GSH levels GSH ( Blevels) and (B cell) and proliferation cell proliferation (C). The (C). glutathione The glutathione (GSH) (GSH) levels levels were analyzed by a modified method described in Materials and Methods. (D) The number of colonies in cancer were analyzed by a modiﬁed method described in Materials and Methods. (D) The number of colonies in cancer cells was cells was decreased by GSTM5 overexpression. (E) The migration ability of 5637 cells was suppressed by GSTM5 overex- decreasedpression by by Transwell GSTM5 overexpression. assay. Upper panel: (E) The Transwell migration insert ability with of a 5637 circular cells membrane was suppressed of 0.65 by cm GSTM5 diameter. overexpression Lower panel: by Transwellmicroscopic assay. images: Upper scale panel: bar Transwellis 500 µm. insertAll data with are a presented circular membrane as the mean of ± 0.65 SE of cm three diameter. independent Lower panel:experiments. microscopic * p < images:0.05; ** scalep < 0.01; bar *** is 500p < 0.001.µm. All (F) data Wound are presented healing assay. as the Four mean different± SE of wound three independent sites were recorded experiments. in each * p well< 0.05; for **24p h.< The 0.01 ; ***experimentp < 0.001. was (F) Woundrepeated healing once (right assay. an Fourd left). different Red line: wound 5637 cells, sites green were line: recorded 5637VC in cells, each blue well line: for 24 5637ovGSTM5 h. The experiment cells. was(G) repeatedThe migration once(right capacity and of left). BFTC Red 905 line: cells 5637 was cells, inhibited green by line: GSTM5 5637VC overexpression. cells, blue line: Upper 5637ovGSTM5 panel: Transwell cells. (insertsG) The migrationwith a circular capacity membrane of BFTC of 905 0.65 cells cm was diameter. inhibited Lo bywer GSTM5 panel: overexpression.microscopic images; Upper scale panel: bar Transwellis 500 µm. inserts with a circular membrane of 0.65 cm diameter. Lower panel: microscopic images; scale bar is 500 µm.

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 9 of 20

2.5. GSH Reverses GSTM5-Inhibited Cell Proliferation and Migration In the present study, GSTM5 was found to decrease cellular GSH levels and suppress cancer cell proliferation and migration. Therefore, to further elucidate whether GSH supplementation could restore cell proliferation and migration ability, 5637ovGSTM5 cells were treated with 4 mM GSH-M. Restoration of GSH levels was confirmed 24 h after GSH- M treatment (Figure 5A) and reversed the retardation of 5637ovGSTM5 cell proliferation (Figure 5B). In addition, the migration ability of 5637ovGSTM5 cells was significantly in- Int. J. Mol. Sci. 2021, 22, 3056 creased after GSH-M treatment (Figure 5C). Taken together, these data suggest9 of 19 that the GSTM5-induced suppression of cancer cell proliferation and migration were reversed by intracellular GSH supplementation.

Figure 5. GSH supplementation restores the cell proliferation and migration ability of bladder cancer cells, overexpressing Figure 5. GSHGSTM5. supplementation Four millimolar GSH-M-treatedrestores the cell 5637ovGSTM5 proliferation cells and showed migration an increase ability in (A of) intracellular bladder cancer GSH levels, cells, (overexpressingB) cell GSTM5. Fourproliferation millimolar and (GSH-M-treatedC) cell migration. Upper5637o panel:vGSTM5 Transwell cells insertshowed with an a circular increase membrane in (A) ofintracellular 0.65 cm diameter. GSH Lower levels, (B) cell proliferationpanel: and microscopic (C) cell migration. images; scale Upper bar is 500 panel:µm. AllTranswell data are presented insert with as the a meancircular± SE membrane of three independent of 0.65 cm experiments. diameter. Lower panel: microscopic** p < 0.01; images; *** p < 0.001. scale bar is 500 µm. All data are presented as the mean ± SE of three independent experiments. ** p < 0.01; *** p < 0.001. 2.6. BSO Administration Decreases Intracellular GSH and Suppresses the Proliferation and Migration of 5637 Bladder Cancer Cells 2.6. BSO Administration Decreases Intracellular GSH and Suppresses the Proliferation and Mi- BSO is an inhibitor of the glutamate-cysteine ligase catalytic subunit, which is the key grationenzyme of 5637 for Bladder GSH biosynthesis. Cancer Cells After treatment with 400 µM BSO for 24 h, intracellular BSOGSH is levels an inhibitor were decreased of the (Figure glutamate-cysteine6A), and proliferation ligase was catalytic almost arrested subunit, ( Figure which6B ) is the key enzymein both for 5637VCGSH biosynthesis. and 5637ovGSTM5 After cells. treatmen Since 400t withµM BSO 400 had µM such BSO a markedfor 24 impacth, intracellular on proliferation after treatment for 2 days, a decreased dose of 40 µM was used for prolif- GSH levels were decreased (Figure 6A), and proliferation was almost arrested (Figure 6B) eration assay again (Figure6C). Treatment with 40 µM BSO also signiﬁcantly decreased in boththe 5637VC rates of 5637VCand 5637ovGSTM5 and 5637ovGSTM5 cells. cell Since proliferation 400 µM (FigureBSO had6C). such In cell a migrationmarked impact on proliferationassay, BSO after signiﬁcantly treatment reduced for 2 cell days, migration a decr capacityeased ofdose 5637 of and 40 5637VC µM was cells, used but notfor proliferation 5637ovGSTM5assay again (Figure cells because 6C). theTreatment migration with ability 40 of µM the latterBSO wasalso originallysignificantly on the decreased low the rates sideof 5637VC (Figure6 D).and 5637ovGSTM5 cell proliferation (Figure 6C). In cell migration assay, BSO significantly reduced cell migration capacity of 5637 and 5637VC cells, but not 5637ovGSTM5 cells because the migration ability of the latter was originally on the low side (Figure 6D).

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 10 of 20

Int. J. Mol. Sci. 2021, 22, 3056 10 of 19

Figure 6. BSO decreased cell migration and proliferation. (A) 400 µM buthionine sulfoximine (BSO) treatment for 24 h decreasedFigure the intracellular6. BSO decreased GSH concentration cell migration in cells. and (B proliferation.) 400 µM BSO blocked(A) 400 cellµM proliferation. buthionine Thesulfoximine medium was changed once on(BSO) day 4. treatment (C) 40 µM for BSO 24 also h decreased decreased cellthe proliferation.intracellular TheGSH medium concentration was changed in cells. every (B day.) 400 (D µM) Effect BSO of 400 µM BSO onblocked cell migration cell proliferation. of 5637 (left), The 5637VC medium (middle) was and changed 5637ovGSTM5 once on (right) day 4. cells. (C) Upper 40 µM panel: BSO Transwellalso decreased insert with a circularcell membrane proliferation. of 0.65 The cm diameter.medium Lowerwas changed panel: microscopic every day. images; (D) Effect scale of bar 400 is 500µMµ BSOm. All on t datacell migration are presented as the meanof 5637± SE (left), of three 5637VC independent (middle) experiments. and 5637ovGSTM5 *** p < 0.001. (right) cells. Upper panel: Transwell insert with a circular membrane of 0.65 cm diameter. Lower panel: microscopic images; scale bar is 500 µm. All t data are presented2.7. Cellas the Adhesion mean ± Capacity SE of three Is Decreased independent in GSTM5-Overexpressing experiments. *** p < 0.001. Cells Cell adhesion to the extracellular matrix is one of the important characteristics in 2.7. Cell Adhesion tumorCapacity cell Is invasion Decreased [25 ].in Thus, GSTM5-Overexpressing this functional assay wasCells performed to determine the effects Cell adhesion to the extracellular matrix is one of the important characteristics in tumor cell invasion [25]. Thus, this functional assay was performed to determine the effects of GSTM5 therein. Figure 7A shows that 5637ovGSTM5 cells exhibited a reduced ability of cell adhesion to fibronectin compared with 5637VC cells. This inhibition effect was also observed in RT4 (Figure 7B) and BFTC 905 cells (Figure 7C).

Int. J. Mol. Sci. 2021, 22, 3056 11 of 19

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEWof GSTM5 therein. Figure7A shows that 5637ovGSTM5 cells exhibited a reduced ability11 of 20 of cell adhesion to ﬁbronectin compared with 5637VC cells. This inhibition effect was also observed in RT4 (Figure7B) and BFTC 905 cells (Figure7C).

Figure 7. Cell adhesion analysis. (A) The adhesion capacity of 5637, (B) RT4, and (C) BFTC 905 cells. Figure 7. Cell adhesion analysis. (A) The adhesion capacity of 5637, (B) RT4, and (C) BFTC 905 Each VC cell was set as 100%. The data are presented as the mean ± SE of three independent cells. Each VC cell was set as 100%. The data are presented as the mean ± SE of three independent experiments.experiments. *p *

Int. J. Mol. Sci. 2021, 22, 3056 12 of 19 Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 12 of 20

RT4 (Figure8B) and BFTC 905 (Figure8C) cells. These ﬁndings suggest that overexpression andof GSTM5 mitomycin protein C, didwhich not are affect commonly the susceptibility used anticancer of bladder drugs cancer for bladder cells to cisplatincancer treat- and ment.mitomycin C, which are commonly used anticancer drugs for bladder cancer treatment.

Figure 8. GSTM5 overexpression does not signiﬁcantly alter the sensitivity of cells to doxorubicin, cisplatin and mitomycin C. Figure(A) The 8. drug GSTM5 sensitivity overexpression of 5637, 5637VC does not and significantly 5637ovGSTM5 alter cellsthe sensitivity (B) drug sensitivity of cells to ofdoxorubicin, RT4VC and cisplatin RT4ovGSTM5. and mitomycin (C) Drug C.sensitivity (A) The drug of BFTC sensitivity 905VC andof 5637, BFTC 5637VC 905ovGSTM5. and 5637ovGSTM5 Cells were analyzedcells (B) drug in a wide-range sensitivity of drug RT4VC concentration and RT4ovGSTM5. by MTT assay. (C) DrugThe individual sensitivity drug of BFTC treatment 905VC times and BFTC are displayed 905ovGSTM5. above Cells each were data. analyzed in a wide-range drug concentration by MTT assay. The individual drug treatment times are displayed above each data. 3. Discussion 3. Discussion The present study revealed that low GSTM5 gene expression and high GSTM5 DNA methylationThe present level study tended revealed to bladder that low cancer GSTM5 (Figures gene1 expression and2D) and and that high patients GSTM5 withDNA methylationbladder cancer level and tended high GSTM5to bladder expression cancer (Figures had a longer 1 and relapse-free2D) and that survival patients (withFigure blad-2F ). derIn vitro cancerassays and demonstratedhigh GSTM5 expression that GSTM5 had inhibited a longer cell relapse-free proliferation survival (Figure (Figure4C), colony2F). In vitroformation assays (Figure demonstrated4D), cell that migration GSTM5 (Figure inhibited4E–G) cell andproliferation ﬁbronectin (Figure adhesion 4C), (Figurecolony 7for-). mationFurthermore, (Figure GSTM5-induced 4D), cell migration GSH (Figure decrease 4E–G) was and found fibronectin to play adhesion a role in (Figure the inhibition 7). Fur- thermore,of cell proliferation GSTM5-induced and migration. GSH decrease GSH, was a small found molecule to play a with role in a molecularthe inhibition weight of cell of proliferation307, is a cellular and metabolitemigration. foundGSH, a in small the majoritymolecule of with organisms. a molecular GSH weight is an antioxidantof 307, is a cellularwhosefunctions metabolite are found dependent in the majority on the thiol of organisms. group of cysteine GSH is residues,an antioxidant and in whose its reduced func- tionsform, are is dependent a marketed on drug the thiol for maintaining group of cyst normaleine residues, liver function. and in its Furthermore, reduced form, GSH is a marketed drug for maintaining normal liver function. Furthermore, GSH also manifests

Int. J. Mol. Sci. 2021, 22, 3056 13 of 19

also manifests other biologic functions, especially those associated with cancer cells. For example, increased GSH levels promoted cell proliferation in HepG2 cells [26] and cell metastasis in B16 melanoma cells [27]. The information elucidates that intracellular GSH concentration affects cancer cell function and plays a pivotal role in cancer characteristics. Redox homeostasis is important for both normal and cancer cells. The cells will un- dergo death following redox imbalance, where the levels of reactive oxygen species exceed the intrinsic antioxidant capacity. In cancer cells, elevated GSH level not only counteracts elevated oxidative stress but also contributes to chemotherapeutic resistance [28]. For example, GSH mediates Nrf2-induced boningmycin resistance in A549 and HepG2 cancer cells [29]. In the present study, the GSTM5-reduced GSH level inhibited the proliferation of bladder cancer cells (Figure4C) but did not affect sensitivity to cisplatin and mitomycin C (Figure8). Although the GSH conjugation function of GSTs can neutralize electrophilic endogenous and xenobiotic compounds by introducing a GSH molecule into them [30], GSTM5 overexpression accompanied by GSH decreasing did not affect the cytotoxic sensitivity of cisplatin and mitomycin C. This suggests that GSTM5 induction may be a potential strategy for bladder cancer treatment without inducing significant resistance to cisplatin and mitomycin C. GSTM5 overexpression slightly increased resistance to doxorubicin in 5637 cells (Figure8A), increasing the IC 50 from 3.2 µM (5637VC) to 5.2 µM (5637ovGSTM5). However, no change in doxorubicin sensitivity was observed in RT4 and BFTC 905 cells (Figure8B,C). Therefore, the influence of GSTM5 on doxorubicin sensitivity is different between diverse cancer cells. It is still unclear what molecular mechanism contributes to the difference, but similar results have been reported in the study of GSTP1. In stable transfection of laryngeal carcinoma, HEp2 cells with human GSTP1 resulted in a 3-fold increase in doxorubicin resistance, compared with that of the control cells [31]. However, in ovarian cancer cells, stable GSTP1 knockdown did not significantly influence the IC50 value of doxorubicin [32]. According to the aforementioned reports and our results, it suggests that the influence of GSTs on drug sensitivity should be analyzed in individual cell lines. The anticancer role of GSTs has been reported in some studies. In non-small cell lung cancer, GSTM2 can inhibit cell migration [21]. In hepatocellular carcinoma cells, GSTZ1 also serves as a tumor suppressor [33]. To date, several studies have reported a correlation between GSTM5 and cancer, though the direct effects of GSTM5 on tumor cells remain unclear. For example, the gene expression of GSTM5 is lower in tumor tissues than in normal tissues in Barrett’s adenocarcinoma [23], GSTM5 expression is downregulated in breast and prostate cancer [34]. GSTM5 expression was also shown to be a positive biomarker for survival in ovarian serous cystadenocarcinoma [35]. The aforementioned reports and the present study suggest that GSTM5 expression and its DNA methylation levels may act as biomarkers for bladder cancer progression. To the best of our knowledge, the current study is the first to directly indicate that GSTM5 plays an anticancer role and that the GSTM5-reduced GSH mediates an important mechanism for this anticancer effect. However, it is still unknown how GSTM5 reduces GSH, which will be investigated in future metabolite analysis. There is one major limitation in the current study that should be addressed in future investigations. Since the collection of sufficient normal bladder tissues via regular surgery was somewhat challenging; therefore, we decided to use urine pellets of healthy individuals as the alternative target specimens of comparative control. Although urine pellets may contain not only bladder-originated cells, however, many previous studies have demonstrated the appropriateness of urine pellets in DNA methylation analysis of bladder cancers [36–38]. Therefore, in future studies, the GSTM5 DNA methylation status will be compared between paired bladder tissues and urine pellets.

4. Materials and Methods 4.1. Extraction of Genomic DNA from Human Bladder Tumors, Human Urine Pellets and Cultured Cell Lines Bladder tumor samples (n = 50) from patients with bladder cancer and urine pellets (n = 50) from nonbladder cancer subjects were collected. All subjects gave their informed Int. J. Mol. Sci. 2021, 22, 3056 14 of 19

consent for inclusion before sample collection. The study was conducted in accordance with the Declaration of Helsinki 2013, and the study protocol was reviewed and approved by the institutional review board (IRB) of Ditmanson Medical Foundation Chiayi Christian Hospital (Chiayi, Taiwan). The approval number is CYCH-IRB 103070 (approved on 5 January 2015). DNA extraction of bladder tumor samples, urine pellets and culture cells followed the instructions of the DNA extraction kit (Geno Plus Genomic DNA extraction miniprep system, Viogene, New Taipei City, Taiwan).

4.2. Bisulfite Conversion of Genomic DNA and Analysis of the DNA Methylation Level in Human Samples Bisulfite conversion was performed using the EZ DNA methylation-gold kit (Zymo Research, Irvine, CA, USA). Five hundred nanograms of genomic DNA was reacted with sodium bisulfite following the kit instructions. After bisulfite conversion, the selected GSTM5 DNA promoter region was PCR amplified using bisulfite-specific primers: 50- TTTAGGGYGGGTTGGGGAAGTTGG -30 (forward) and 50- AAAAAAAACRATCC- CTAAAACCAATCCTACAACTAC -30 (reverse), which amplified −209 to 198 bp of the human GSTM5 gene (amplicon size 407 bp). Next, the PCR products were subcloned into the T&A cloning vectors, which were transformed into competent cells. To determine the CpG methylation status of the 50 CpG island of GSTM5, 10 clones of each sample were randomly picked for sequencing.

4.3. Cell Culture and RT–PCR Three human bladder cancer cell lines, RT4, BFTC 905 and 5637, were purchased from Bioresource Collection and Research Center (Hsinchu, Taiwan). RT4 cells were cultured in McCoy’s 5a medium with 10% fetal bovine serum, 1% penicillin and 1% streptomycin, BFTC 905 and 5637 cells were cultured in RPMI 1640 medium with the same additional agents [24]. After washing the cells with PBS and lysing the cells with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), total RNA was extracted according to the manufacturer’s instructions. Reverse transcription (RT) was performed on 2 µg of total RNA by 1.5 µM random hexamer and RevertAid™ reverse transcriptase (Fermentas, Waltham, MA, USA). Then, 1/20 volume of the reaction mixture was used for PCR with human GSTM5-specific primers (50 ATGCCCATGACACTGGGGTACTG 30, 50 CCATGTGGTTATCCATAACCTGG 30, product size 328 bp) and GAPDH-specific primers (50CAAGGTCATCCATGACAACTTTG30, 50GTCCACCACCCTGTTGCTGTAG30, product size 496 bp). The PCR products were analyzed by 1–2% agarose gel electrophoresis.

4.4. Western Blot Total lysates of 5637 cells, empty vector-transfected 5637 cells (5637VC), and GSTM5- overexpressed 5637 cells (5637ovGSTM5) were extracted by PRO-PREP protein extraction solution (iNtRON Biotechnology, Burlington, MA, USA). Equal amounts of protein (30 µg) were separated by 8% SDS-polyacrylamide gels electrophoresis and transferred to polyvinylidene diﬂuoride membranes. Immunodetection was performed using antibodies against human GSTM1~5 (GTX100298, GTX47111, GTX65535, GTX32637, GTX108776, GeneTex, Irvine, CA, USA), against GSTM5 (H00002949-D01P, Abnova, Taipei, Taiwan) and against β-actin (A5441, Sigma-Aldrich, St. Louis, MO, USA) as an internal control. Mouse or rabbit IgG antibodies coupled to horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA, USA) were used as the secondary antibodies. Protein expression was visualized by Luminol/Enhancer solution (Thermo Scientiﬁc, Waltham, MA, USA) and a luminescence detector.

4.5. GSTMs Overexpression in 5637 Cells GSTM1~5 expression vectors were purchased from Origene, Rockville, MD, USA (RC223332, RC210718, RC201013, RC202097, RC208900) with Myc-DDK tagged. A total of 5637 cells were cultured in a 6-well plate with a density of 3 × 105 cells/well and transfected the next day. The transfection reagent was PolyJet in vitro DNA transfection Int. J. Mol. Sci. 2021, 22, 3056 15 of 19

reagent (SignaGen Laboratories, Frederick, MD, USA) in the combination of 1 µg plasmid DNA and 3 µL PolyJet. After incubation for 6 h, the transfection medium was replaced by a fresh medium without DNA and PolyJet. For stable clone selection, the transfected cells were subcultured in 10 cm dishes with 800 µg/mL antibiotic G418 (GoldBio, St Louis, MO, USA). After 5 days, single colonies were picked up individually and seeded into a 24-well plate for ampliﬁcation. The stable transfection cell lines were kept in a culture medium with 400 µg/mL G418.

4.6. GSTM5 Overexpression in RT4 and BFTC 905 Cells Cells were cultured in 10 cm dishes with 80% conﬂuence for transfection. The GSTM5 expression vector with Myc-DDK tagged and control vector was from Origene. Cells in one dish were incubated with the combination of 5 µg plasmid DNA and 15 µL PolyJet. After incubation for 24 h, the cells were collected for GSH level assay (6 × 105 cells/sample) and seeded in the density of 6 × 104 cells/Transwell/24-well for migration assay, 2 × 104 cells/ well/96-well for ﬁbronectin adhesion assay, 3 × 104 cells/well/24-well (BFTC 905) or 6 × 104 cells/well/24-well (RT4) for drug cytotoxicity assay

4.7. GST Activity Assay The detection method of GST activity was modified from a GST activity assay kit from Cayman Chemical, Ann Arbor, MI, USA (item no. 703,302). After cell transfection for 24 h, cells were collected in GST store buffer (100 mM KH2PO4 (J.T.Baker, Radnor, PA, USA), 2 mM EDTA (Thermo Fisher Scientific)) and sonicated on ice. After centrifugation at 10,000× g for 10 min, 4 °C, then the supernatant was further centrifuged at 100,000× g for 1 h, 4 °C. The supernatant (cytosol fraction) was analyzed for GST activity in a 96-well plate. Twenty µL supernatant was added into a well with assay buffer (75 mM KH2PO4 (J.T.Baker), 0.075% Triton X-100 (J.T.Baker), 2 mM L-glutathione-reduced form (Alfa Aesar, Haverhill, MA, USA) on ice. After adding substrate 1-chloro-2,4-dinitrobenzene (CDNB) (Alfa Aesar) and mixing well, the OD340 nm values were read by a spectrophotometer at 25 °C for 20 min with 1 min interval. GST activity was calculated as [(OD340/min)/0.00503 µM−1] × [0.2 mL/0.02 mL] = nmol/min/mL, then divided by protein concentration (mg/mL) to get the final GST activity (nmol/min/mg).

4.8. Cellular GSH Quantification The detection of intracellular glutathione levels was using a glutathione assay kit (Cayman Chemical item no. 703,002) or a modified method from this kit. For the kit assay, one-well cells of a 6-well plate were collected with 1 mL of cell homogenization buffer (50 mM 2-(N-morpholino)ethanesulfonic acid (MES) (Sigma-Aldrich), 1 mM EDTA, pH 6.0) and sonicated on ice. In the modified assay, two 6 cm plates of cells were collected with 0.5 mL of the same cell homogenization buffer and sonicated on ice. After centrifugation at 10,000× g at 4 ◦C for 15 min, the supernatant was collected in a 1.5 mL tube. The cell supernatants were mixed with 5% metaphosphoric acid (MPA) (Sigma-Aldrich) for 5 min for deproteination and then centrifuged at RT for 5 min. One milliliter of supernatant was mixed with 50 µL of 4 M triethanolamine (Sigma-Aldrich) for pH adjustment. GSH standards (1000, 500, 250, 125, 62.5, 31.25 and 15.625 µM) with serial dilutions were prepared for making standard curve plots. Next, 150 µL of cocktail reagent (0.1 M MES, 0.025 M phosphoric acid, 0.5 mM EDTA, 20 µM 5,50-dithiobis(2-nitrobenzoic acid) (DTNB) (Sigma-Aldrich)) and 50 µL of sample/standard were added to 96-well plates. After the 96-well plate was incubated at room temperature for 25 min, the absorbance was read at 405 nm. For supplementation of cellular GSH, glutathione-reduced ethyl ester (GSH-M, Sigma-Aldrich) was added to the cell medium for 24 h before assay.

4.9. Cell Proliferation Assay Bladder cancer cells were seeded in 12-well plates at 6000 cells per well in RPMI- 1640 medium with 400 µg/mL G418. The medium with or without 4 mM GSH-M, or Int. J. Mol. Sci. 2021, 22, 3056 16 of 19

40 µM buthionine sulfoximine (BSO) (Sigma-Aldrich), was changed every day. Cells were trypsinized and counted using a hemocytometer every day.

4.10. Colony Formation Assay Before cell seeding, each well was covered with 0.5% agarose (Uni-Onward, New Taipei City, Taiwan) at 37 °C for 30 min. Bladder cancer cells (2 × 104 cells/well) were seeded into six-well culture plates in 0.3% agarose and incubated for 2 weeks to allow colony formation. The medium (2 mL/well) was changed every 3 days. The number of colonies from three independent experiments was counted using ImageJ, version 1.48 (NIH, Bethesda, MD, USA).

4.11. Migration Assay Migration assays were performed using 24-well Transwell chambers with 8 µm pore membrane (Wuxi NEST Biotechnology, Wuxi, Jiangsu, China). Bladder cancer cells were seeded in the upper chamber at 3 × 104 cells/well (5637) or 6 × 104 cells/well (BFTC 905) in 0.1 mL of RPMI 1640 serum-free medium. Medium with 10% FBS was placed in the bottom ◦ well (0.5 mL/well). After incubation for 24 h at 37 C in an atmosphere containing 5% CO2, the medium was discarded. Then cells were ﬁxed in 4% formaldehyde (Sigma-Aldrich) at room temperature for 2 min, and then in methanol for 15 min. After PBS wash, cells were stained with 0.5% crystal violet (Sigma-Aldrich) for 5 min. After PBS wash, cells on the inside surface of the Transwell were removed by a cotton swab. The chambers were photographed, and stained cells were dissolved with DMSO for 10 min and then detected for the OD at 580 nm.

4.12. Wound Healing Assay Cells were seeded in 6-well plates. After the cells reached conﬂuence, a wound was made with a 200-µL plastic tip in each well. The wells were then washed twice with PBS to remove cell debris and then incubated with a culture medium. The wound areas were automatically monitored for 24 h by taking a photograph every 30 min in an augmented microscope (Lionheart, BioTek, Winooski, VT, USA). The wound areas were automatically analyzed by computer, and the wound healing curve was performed based on the area change over time. The wound area of each condition was presented as 100 at the beginning. The values are the mean of four wounds in each well.

4.13. Cell Adhesion Assay The 96-well plates were precoated with ﬁbronectin (5 µg/cm2) (Corning, corning, NY, USA) at 37 ◦C for 2 h. A total of 8 × 103 cells/well (5637) or 2 × 104 cells/well (BFTC 905) or 8 × 103 cells/well (RT4) in serum-free RPMI 1640 were seeded into each well and incubated at 37 ◦C for 2 h (5636) or 3.5 h (BFTC 905 and RT4). After incubation, nonattached cells were washed out by PBS, and then attached cells were ﬁxed in 4% formaldehyde at room temperature for 30 min. Subsequently, cells were stained with 0.5% crystal violet for 1 min. After PBS wash, the plate was photographed, and cells were dissolved in DMSO. The absorbance at 580 nm was detected.

4.14. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) Assay Cell viability was detected by the MTT assay. The 5637 cells were seeded at 3 × 104 cells /well into 24-well plates for 24 h and then treated with doxorubicin (Sigma-Aldrich) for 24 h or treated with mitomycin C (Sigma-Aldrich) or cisplatin (Sigma-Aldrich) for 48 h. Twenty-ﬁve microliters of MTT (50 mg/mL) (AK Scientiﬁc, Union City, CA, USA) was added to each well and incubated for 90 min in a 5% CO2 incubator. After incubation, discarded the medium and 500 µL of DMSO was added to each well and mixed well by micropipette. One hundred microliters of the suspension were transferred to a 96-well plate, and the OD values were read at 595 nm. Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 17 of 20

4.14. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) Assay Cell viability was detected by the MTT assay. The 5637 cells were seeded at 3 × 104 cells/well into 24-well plates for 24 h and then treated with doxorubicin (Sigma-Aldrich) for 24 h or treated with mitomycin C (Sigma-Aldrich) or cisplatin (Sigma-Aldrich) for 48 h. Twenty-five microliters of MTT (50 mg/mL) (AK Scientific, Union City, CA, USA) was added to each well and incubated for 90 min in a 5% CO2 incubator. After incubation, discarded the medium and 500 µL of DMSO was added to each well and mixed well by micropipette. One hundred microliters of the suspension were transferred to a 96-well Int. J. Mol. Sci. 2021, 22, 3056 plate, and the OD values were read at 595 nm. 17 of 19

4.15. Statistical Analysis Statistical4.15. Statistical differences Analysis were analyzed by one-way analysis of variance followed by Student’s t-Statisticaltest. The statistics differences in human were analyzed samples were by one-way analyzed analysis by SPSS of for variance Windows followed ver- by sion 21.0Student’s (IBM Corp.,t-test. Armonk, The statistics NY, USA) in human except samples noted in were the analyzedfigure legend. by SPSS All statistics for Windows in theversion cell line 21.0 assay (IBM Corp.,were Armonk,calculated NY, using USA) GraphPad except noted Prism in the software, ﬁgure legend. version All statistics5.0 (GraphPadin the cellPrism line software, assay were La calculatedJolla, CA, USA). using GraphPad Numerical Prism data software,are expressed version as the 5.0 mean (GraphPad ± standardPrism error software, (SE) from La Jolla, three CA, independent USA). Numerical experiments. data are expressed as the mean ± standard error (SE) from three independent experiments. 5. Conclusions 5. Conclusions To the best of our knowledge, the present study was the first to demonstrate that the anticancer Torole the of bestGSTM5 of our in bladder knowledge, cancer the an presentd that the study decreased was the levels ﬁrst of to GSH demonstrate play an that the anticancer role of GSTM5 in bladder cancer and that the decreased levels of GSH important mediator of this function (Figure 9). As high GSTM5 expression was associated play an important mediator of this function (Figure9). As high GSTM5 expression was with a higher probability of relapse-free survival, in the future, increasing GSTM5 expres- associated with a higher probability of relapse-free survival, in the future, increasing sion may be a consideration for bladder cancer therapy, and GSTM5 DNA methylation GSTM5 expression may be a consideration for bladder cancer therapy, and GSTM5 DNA level may be a useful biomarker for patients with bladder cancer. methylation level may be a useful biomarker for patients with bladder cancer.

Figure 9. Schematic of GSTM5-inhibited bladder cancer. Demethylation of the GSTM5 gene CpG Figureisland 9. Schematic promotes of geneGSTM5-inhibite activation andd bladder mRNA cancer. expression. Demethylation Increased GSTM5 of the GSTM5 protein expressiongene CpG reduces island promotes gene activation and mRNA expression. Increased GSTM5 protein expression re- the intracellular GSH concentration. Decreased GSH levels inhibit cell migration, proliferation, duces the intracellular GSH concentration. Decreased GSH levels inhibit cell migration, prolifera- colony formation and cell adhesion. In chemotherapeutic drug resistance, decreased GSH increases tion, colony formation and cell adhesion. In chemotherapeutic drug resistance, decreased GSH increasesdoxorubicin doxorubicin resistance resistance slightly slightly but but has has no effectno effect oncisplatin on cisplatin and and mitomycin mitomycin C. C.

SupplementarySupplementary Materials: Materials: The followingThe following are available are available online online at www.mdpi.com/xxx/s1, at https://www.mdpi.com/1422-006 Video S1: Wound7/22/6/3056/s1 healing assay. ,Time-lapse Video S1: Wound images healingwere re assay.corded Time-lapse from 0 to images14 h after were wound recorded production. from 0 to 14 h after wound production. The real time is presented in the right-upper corner. Left: 5637 cells, middle: 5637VC cells, right: 5637ovGSTM5 cells. Author Contributions: Conceptualization, Y.-C.J., C.-H.S. and Y.-W.L.; methodology, S.-C.W., S.-T.W., M.-H.Y.; formal analysis, H.-Y.Y. and L.-C.C.; investigation, Y.-C.D., C.-H.S. and Y.-W.L.; resources, Y.-C.J. and C.-H.S.; data curation, Y.-C.J. and S.-C.W.; writing—original draft preparation, S.-C.W. and Y.-W.L.; writing—review and editing, C.-H.S. and Y.-W.L. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Ministry of Science and Technology, Taiwan, R.O.C., grant number MOST104–2320-B-415-001-MY3, MOST107–2320-B-415-001 and MOST108–2320-B- 415-006-MY3 and Ditmanson Medical Foundation Chiayi Christian Hospital, Chiayi, Taiwan, grant number R107-002. Int. J. Mol. Sci. 2021, 22, 3056 18 of 19

Institutional Review Board Statement: The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board of Ditmanson Medi- cal Foundation Chiayi Christian Hospital (approval number CYCH-IRB 103070, date of approval: 5 January 2015. Informed Consent Statement: Informed consent was obtained from all subjects involved in the study. Written informed consent was obtained from the patient(s) to publish this paper. Data Availability Statement: The data and materials used in the current study are available from the corresponding author on reasonable request. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [CrossRef][PubMed] 2. Antoni, S.; Ferlay, J.; Soerjomataram, I.; Znaor, A.; Jemal, A.; Bray, F. Bladder Cancer Incidence and Mortality: A Global Overview and Recent Trends. Eur. Urol. 2017, 71, 96–108. [CrossRef][PubMed] 3. Stenehjem, D.D.; Tran, D.; Nkrumah, M.A.; Gupta, S. PD1/PDL1 inhibitors for the treatment of advanced urothelial bladder cancer. Onco Targets Ther. 2018, 11, 5973–5989. [CrossRef] 4. Lower, G.M., Jr. Concepts in causality: Chemically induced human urinary bladder cancer. Cancer 1982, 49, 1056–1066. [CrossRef] 5. Brennan, P.; Bogillot, O.; Cordier, S.; Greiser, E.; Schill, W.; Vineis, P.; Lopez-Abente, G.; Tzonou, A.; Chang-Claude, J.; Bolm- Audorff, U.; et al. Cigarette smoking and bladder cancer in men: A pooled analysis of 11 case-control studies. Int. J. Cancer 2000, 86, 289–294. [CrossRef] 6. Straif, K.; Benbrahim-Tallaa, L.; Baan, R.; Grosse, Y.; Secretan, B.; El Ghissassi, F.; Bouvard, V.; Guha, N.; Freeman, C.; Galichet, L.; et al. A review of human carcinogens—Part C: Metals, arsenic, dusts, and fibres. Lancet Oncol. 2009, 10, 453–454. [CrossRef] 7. Jou, Y.C.; Wang, S.C.; Dai, Y.C.; Chen, S.Y.; Shen, C.H.; Lee, Y.R.; Chen, L.C.; Liu, Y.W. Gene expression and DNA methylation regulation of arsenic in mouse bladder tissues and in human urothelial cells. Oncol. Rep. 2019, 42, 1005–1016. [CrossRef] [PubMed] 8. Burger, M.; Catto, J.W.; Dalbagni, G.; Grossman, H.B.; Herr, H.; Karakiewicz, P.; Kassouf, W.; Kiemeney, L.A.; La Vecchia, C.; Shariat, S.; et al. Epidemiology and risk factors of urothelial bladder cancer. Eur. Urol. 2013, 63, 234–241. [CrossRef] 9. Oakley, A. Glutathione transferases: A structural perspective. Drug Metab. Rev. 2011, 43, 138–151. [CrossRef][PubMed] 10. Hayes, J.D.; Strange, R.C. Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology 2000, 61, 154–166. [CrossRef] 11. Engel, L.S.; Taioli, E.; Pfeiffer, R.; Garcia-Closas, M.; Marcus, P.M.; Lan, Q.; Boffetta, P.; Vineis, P.; Autrup, H.; Bell, D.A.; et al. Pooled analysis and meta-analysis of glutathione S-transferase M1 and bladder cancer: A HuGE review. Am. J. Epidemiol. 2002, 156, 95–109. [CrossRef][PubMed] 12. Kang, H.W.; Song, P.H.; Ha, Y.S.; Kim, W.T.; Kim, Y.J.; Yun, S.J.; Lee, S.C.; Choi, Y.H.; Moon, S.K.; Kim, W.J. Glutathione S-transferase M1 and T1 polymorphisms: Susceptibility and outcomes in muscle invasive bladder cancer patients. Eur. J. Cancer 2013, 49, 3010–3019. [CrossRef][PubMed] 13. Matic, M.; Pekmezovic, T.; Djukic, T.; Mimic-Oka, J.; Dragicevic, D.; Krivic, B.; Suvakov, S.; Savic-Radojevic, A.; Pljesa-Ercegovac, M.; Tulic, C.; et al. GSTA1, GSTM1, GSTP1, and GSTT1 polymorphisms and susceptibility to smoking-related bladder cancer: A case-control study. Urol. Oncol. 2013, 31, 1184–1192. [CrossRef][PubMed] 14. Chuang, J.J.; Dai, Y.C.; Lin, Y.L.; Chen, Y.Y.; Lin, W.H.; Chan, H.L.; Liu, Y.W. Downregulation of glutathione S-transferase M1 protein in N-butyl-N-(4-hydroxybutyl)nitrosamine-induced mouse bladder carcinogenesis. Toxicol. Appl. Pharmacol. 2014, 279, 322–330. [CrossRef][PubMed] 15. Pearson, W.R.; Vorachek, W.R.; Xu, S.J.; Berger, R.; Hart, I.; Vannais, D.; Patterson, D. Identification of class-mu glutathione transferase genes GSTM1-GSTM5 on human chromosome 1p13. Am. J. Hum. Genet. 1993, 53, 220–233. 16. Bhattacharjee, P.; Paul, S.; Banerjee, M.; Patra, D.; Banerjee, P.; Ghoshal, N.; Bandyopadhyay, A.; Giri, A.K. Functional com- pensation of glutathione S-transferase M1 (GSTM1) null by another GST superfamily member, GSTM2. Sci. Rep. 2013, 3, 2704. [CrossRef] 17. Yu, K.D.; Fan, L.; Di, G.H.; Yuan, W.T.; Zheng, Y.; Huang, W.; Chen, A.X.; Yang, C.; Wu, J.; Shen, Z.Z.; et al. Genetic variants in GSTM3 gene within GSTM4-GSTM2-GSTM1-GSTM5-GSTM3 cluster influence breast cancer susceptibility depending on GSTM1. Breast Cancer Res. Treat. 2010, 121, 485–496. [CrossRef] 18. Weng, M.W.; Hsiao, Y.M.; Chiou, H.L.; Yang, S.F.; Hsieh, Y.S.; Cheng, Y.W.; Yang, C.H.; Ko, J.L. Alleviation of benzo[a]pyrene- diolepoxide-DNA damage in human lung carcinoma by glutathione S-transferase M2. DNA Repair 2005, 4, 493–502. [CrossRef] [PubMed] 19. Tang, S.C.; Sheu, G.T.; Wong, R.H.; Huang, C.Y.; Weng, M.W.; Lee, L.W.; Hsu, C.P.; Ko, J.L. Expression of glutathione S-transferase M2 in stage I/II non-small cell lung cancer and alleviation of DNA damage exposure to benzo[a]pyrene. Toxicol. Lett. 2010, 192, 316–323. [CrossRef] Int. J. Mol. Sci. 2021, 22, 3056 19 of 19

20. Tang, S.C.; Wu, M.F.; Wong, R.H.; Liu, Y.F.; Tang, L.C.; Lai, C.H.; Hsu, C.P.; Ko, J.L. Epigenetic mechanisms for silencing glutathione S-transferase m2 expression by hypermethylated specificity protein 1 binding in lung cancer. Cancer 2011, 117, 3209–3221. [CrossRef] 21. Tang, S.C.; Wu, C.H.; Lai, C.H.; Sung, W.W.; Yang, W.J.; Tang, L.C.; Hsu, C.P.; Ko, J.L. Glutathione S-transferase mu2 suppresses cancer cell metastasis in non-small cell lung cancer. Mol. Cancer Res. MCR 2013, 11, 518–529. [CrossRef] 22. Ibragimova, I.; Dulaimi, E.; Slifker, M.J.; Chen, D.Y.; Uzzo, R.G.; Cairns, P. A global profile of gene promoter methylation in treatment-naive urothelial cancer. Epigenetics 2014, 9, 760–773. [CrossRef][PubMed] 23. Peng, D.F.; Razvi, M.; Chen, H.; Washington, K.; Roessner, A.; Schneider-Stock, R.; El-Rifai, W. DNA hypermethylation regulates the expression of members of the Mu-class glutathione S-transferases and glutathione peroxidases in Barrett’s adenocarcinoma. Gut 2009, 58, 5–15. [CrossRef][PubMed] 24. Wang, S.C.; Huang, C.C.; Shen, C.H.; Lin, L.C.; Zhao, P.W.; Chen, S.Y.; Deng, Y.C.; Liu, Y.W. Gene Expression and DNA Methylation Status of Glutathione S-Transferase Mu1 and Mu5 in Urothelial Carcinoma. PLoS ONE 2016, 11, e0159102. [CrossRef] [PubMed] 25. Wang, W.; Liu, F.; Wang, C.; Wang, C.; Tang, Y.; Jiang, Z. Glutathione S-transferase A1 mediates nicotine-induced lung cancer cell metastasis by promoting epithelial-mesenchymal transition. Exp. Ther Med. 2017, 14, 1783–1788. [CrossRef] 26. Huang, Z.Z.; Chen, C.; Zeng, Z.; Yang, H.; Oh, J.; Chen, L.; Lu, S.C. Mechanism and significance of increased glutathione level in human hepatocellular carcinoma and liver regeneration. FASEB J. 2001, 15, 19–21. [CrossRef] 27. Carretero, J.; Obrador, E.; Anasagasti, M.J.; Martin, J.J.; Vidal-Vanaclocha, F.; Estrela, J.M. Growth-associated changes in glutathione content correlate with liver metastatic activity of B16 melanoma cells. Clin. Exp. Metastasis 1999, 17, 567–574. [CrossRef][PubMed] 28. Traverso, N.; Ricciarelli, R.; Nitti, M.; Marengo, B.; Furfaro, A.L.; Pronzato, M.A.; Marinari, U.M.; Domenicotti, C. Role of glutathione in cancer progression and chemoresistance. Oxid. Med. Cell Longev. 2013, 2013, 972913. [CrossRef] 29. Zhang, H.X.; Chen, Y.; Xu, R.; He, Q.Y. Nrf2 mediates the resistance of human A549 and HepG2 cancer cells to boningmycin, a new antitumor antibiotic, in vitro through regulation of glutathione levels. Acta Pharm. Sin. 2018, 39, 1661–1669. [CrossRef] 30. Hayes, J.D.; Flanagan, J.U.; Jowsey, I.R. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 51–88. [CrossRef] 31. Harbottle, A.; Daly, A.K.; Atherton, K.; Campbell, F.C. Role of glutathione S-transferase P1, P-glycoprotein and multidrug resistance-associated protein 1 in acquired doxorubicin resistance. Int J. Cancer 2001, 92, 777–783. [CrossRef] 32. Sawers, L.; Ferguson, M.J.; Ihrig, B.R.; Young, H.C.; Chakravarty, P.; Wolf, C.R.; Smith, G. Glutathione S-transferase P1 (GSTP1) directly influences platinum drug chemosensitivity in ovarian tumour cell lines. Br. J. Cancer 2014, 111, 1150–1158. [CrossRef] 33. Li, J.; Wang, Q.; Yang, Y.; Lei, C.; Yang, F.; Liang, L.; Chen, C.; Xia, J.; Wang, K.; Tang, N. GSTZ1 deficiency promotes hepatocellular carcinoma proliferation via activation of the KEAP1/NRF2 pathway. J. Exp. Clin. Cancer Res. 2019, 38, 438. [CrossRef] 34. Sun, C.; Gu, Y.; Chen, G.; Du, Y. Bioinformatics Analysis of Stromal Molecular Signatures Associated with Breast and Prostate Cancer. J. Comput. Biol. 2019, 26, 1130–1139. [CrossRef][PubMed] 35. Wang, Y.; Lei, L.; Chi, Y.G.; Liu, L.B.; Yang, B.P. A comprehensive understanding of ovarian carcinoma survival prognosis by novel biomarkers. Eur. Rev. Med. Pharm. Sci. 2019, 23, 8257–8264. [CrossRef] 36. Hentschel, A.E.; Nieuwenhuijzen, J.A.; Bosschieter, J.; Splunter, A.P.V.; Lissenberg-Witte, B.I.; Voorn, J.P.V.; Segerink, L.I.; Moorselaar, R.; Steenbergen, R.D.M. Comparative Analysis of Urine Fractions for Optimal Bladder Cancer Detection Using DNA Methylation Markers. Cancers 2020, 12, 859. [CrossRef][PubMed] 37. Hoque, M.O.; Begum, S.; Topaloglu, O.; Chatterjee, A.; Rosenbaum, E.; Van Criekinge, W.; Westra, W.H.; Schoenberg, M.; Zahurak, M.; Goodman, S.N.; et al. Quantitation of promoter methylation of multiple genes in urine DNA and bladder cancer detection. J. Natl. Cancer Inst. 2006, 98, 996–1004. [CrossRef][PubMed] 38. Urakami, S.; Shiina, H.; Enokida, H.; Kawakami, T.; Kawamoto, K.; Hirata, H.; Tanaka, Y.; Kikuno, N.; Nakagawa, M.; Igawa, M.; et al. Combination analysis of hypermethylated Wnt-antagonist family genes as a novel epigenetic biomarker panel for bladder cancer detection. Clin. Cancer Res. 2006, 12, 2109–2116. [CrossRef][PubMed]