Waheed Anwar

ISOLATION AND CHARACTERIZATION OF ENTOMOPATHOGENIC FUNGI AND THEIR EVALUATION AGAINST BEMISIA TABACI

WAHEED ANWAR

INSTITUTE OF AGRICULTURAL SCIENCES UNIVERSITY OF THE PUNJAB LAHORE

2016

ISOLATION AND CHARACTERIZATION OF ENTOMOPATHOGENIC FUNGI AND THEIR EVALUATION AGAINST BEMISIA TABACI

A thesis submitted to the University of the Punjab in partial fulfillment of the requirement for the degree of Doctor of Philosophy in Agriculture (Plant Pathology)

Waheed Anwar

Supervisors

Prof. Dr. Muhammad Saleem Haider Prof. Dr. Ahmad Ali Shahid

INSTITUTE OF AGRICULTURAL SCIENCES UNIVERSITY OF THE PUNJAB LAHORE

CERTIFICATE This is to certify that the research entitled “Isolation and characterization of entomopathogenic fungi and their evaluation against Bemisia tabaci” described in this thesis by Mr. Waheed Anwar, is an original work of the author and has been carried out under our direct supervision. We have personally gone through all the data, materials and results reported in the dissertation and certify their correctness and authenticity. We further certify that the materials included in this thesis has not been used in part or full in a dissertation already submitted or in the process of submission in partial or complete fulfillment of the award of any other degree from any institution. We also certify that the thesis has been prepared under our supervision according to the prescribed format and we endorse its evaluation for the award of Ph.D. degree through the official procedures of the University of the Punjab, Lahore, Pakistan.

Here thesis is in pure academic language and it is free from typos and grammatical errors.

SUPERVISORS

Dr. Muhammad Saleem Haider Professor, Date: ______

Dr. Ahmad Ali Shahid Professor, Date: ______

DECLARATION CERTIFICATE

This thesis which is being submitted for the degree of Ph.D. in the University of the Punjab, Lahore, Pakistan does not contain any material which has been submitted for the award of Ph.D. Degree in any University and, to the best of my knowledge and faith, neither does this thesis contain any material published or written previously by another person, except when due reference is made to the source in the text of the thesis.

Waheed Anwar Ph.D. Scholar Institute of Agricultural Sciences University of the Punjab, Lahore, Pakistan

Dedicated To My Beloved

PARENTS

ACKNOWLEDGMENTS

All praises are for Almighty (The most affectionate, the most merciful), and Holy Prophet Muhammad (May God bless and peace be upon him).I bow before Almighty Allah in deep thankfulness that His infinite wisdom and mercy, granted me enough strength to complete this critique. I thank from the core of heart to Holy Prophet Muhammad (May God bless and peace be upon Him) forever a torch of guidance and knowledge for humanity as a whole. I would like to express the deepest appreciation to my Supervisor Prof. Dr. Muhammad Saleem Haider, Institute of Agricultural Sciences, University of the Punjab, Lahore, who has the attitude and the substance of a genius: he continually and convincingly conveyed a spirit of adventure in regard to research and scholarship, and an excitement in regard to teaching. Without his guidance and persistent help this dissertation would not have been possible. I wish to express my deep sense of gratitude to my co supervisor Prof. Dr. Ahmad Ali Shahid, Center of Excellence in Molecular Biology, University of the Punjab, Lahore, for his skillful advices, sincere co-operation, and learned guidance, keen interest, help and superb suggestions. I found him very generous, supportive and always available in time of need. A great debt of gratefulness and sincere thanks are extended toward Dr. Zia Ur Rehman and Dr. Usman Hameed, Research Associates, Institute of Agricultural Sciences, University of the Punjab, Lahore, for their support, kind attitude, endless help and best wishes during the accomplishment of this research work. I am very thankful to Higher Education Commission of Pakistan (HEC) for providing financial support to perform partial research work in Brown’s Lab, School of Plant Sciences, University of Arizona, Arizona, USA under international Research Support Initiative Program (IRSIP) for six months. My very special thanks to Prof. Dr. Judith K. Brown, School of Plant Sciences, University of Arizona, Arizona, USA for their kind help, accommodative behaviour and suggestions during IRSIP fellowship. I express my sincere thanks to Dr. Uzma Bashir and Dr. Noureen Akhtar, The First Fungal Culture Bank of Pakistan (FCBP), IAGS, University of the Punjab, Lahore, Pakistan for their constructive suggestions, timely helping and cooperation during identification of fungal Isolates. I am also thankful to Prof. Dr. Ashraf Randhawa (Rtd.), Department of Plant Pathology, University of Agriculture, Faisalabad, Pakistan for their his valuable input during the compilation of final draft. I am also grateful to my friends and fellows including, Abdul Wahid, M. Javed Iqbal, Rashid Alvi, Sidra Mushtaq, Muhammad Tariq Manzoor, Azmat Ullah Khan, Muhammad Ali, Hamid Mushtaq, Sehrish Iftikhar, Asim Javed, Hafeez Ul Haq, Jawad Shah, Mehwish Rauf, Amna Ali, Raheela Hafeez especially Kiran Nawaz, my Seniors especially Dr. Hafiz Muhammad Azhar, Dr. Nasir Subhani and Dr. Sajid Ali, and all staff members of IAGS including Muhammad Sajjad Gujjar and Abdul Raffy for their assistance and good desires throughout my research work. With a great sense of respect and honour I wish to express my deep sense of gratitude to my parents, Brothers and Sister for their support at various steps of this study. Their moral and financial support, sincere wishes and encouragement remained a great source for strengthening for education for whole span of this study. Their love and concern in me can be remembered but can never be returned fully. I am nothing without their prayers, cares and shares for my success.

Waheed Anwar

CONTENTS

Sr. no Contents Page No.

Certificate Declaration certificate Dedications Acknowledgments Table of contents List of tables i List of figures ii List of plates vii Abbreviations viii Summary ix

1 INTRODUCTION AND LITERATURE REVIEW 1 1.1 Bemisia tabaci 1 1.2 Host range of Bemisia tabaci 2 1.3 Biotypes of Bemisia tabaci 3 1.4 Historical outbreaks of Bemisia tabaci 5 1.5 Types of damage caused by Bemisia tabaci 7 1.6 Pest management strategies for Bemisia tabaci 8 1.6.1 Cultural control 8 1.6.2 Chemical control 9 1.6.3 Biological control 10 1.7 Entomopathogenic Fungi 13 1.8 Classification of Entomopathogenic Fungi 13 1.8.1 Phylum Oomycota 14 1.8.2 Phylum Chytridiomycota 14 1.8.3 Phylum Zygomycota 14 1.8.4 Phylum Ascomycota and Deuteromycota 14 1.9 Classification of fungi at phylogenetic level 15 1.9 Molecular Approach for identification of Entomopathogenic Fungi 17 1.10 Infection mechanism of Entomopathogenic Fungi 18 1.11 Distribution of Entomopathogenic Fungi 20 1.12 Pathogenicity of Entomopathogenic Fungi 21 1.13 Chitinases 25 1.13.1 Fungal Chitinases 27 1.14 Applications of Chitinases 27 1.15 Pathogenicity of Fungal Chitinases 28 1.16 Plants Transformation 30 1.17 Virus Induced gene silencing 30 1.17.1 Vectors for viral induced gene silencing 31

2 METHODOLOGY 34 2.1 Isolation and morphological characterization of fungi 34 2.1.1 Survey and sampling 34 2.1.2 Isolation of fungi 35 2.1.3 Morphological characterization of fungi 36 2.2 Molecular characterization of fungi 36 2.2.1 Phylogenetic analysis 37 2.3 Occurrence and Diversity 37 2.4 Virulence bioassay of entomopathogenic fungi against Bemisia tabaci 38 2.4.1 Maintenance of Bemisia tabaci 38 2.4.2 Spore suspension 39 2.4.3 Spore counting 39 2.4.4 Spore viability 40 2.4.5 Designing of virulence bioassay experiment 40 2.4.6 Data analysis 41

2.5 Isolation and characterization of chitinase genes from 42 entomopathogenic fungi 2.5.1 Primer designing for the fungal chitinases 42 2.5.2 Isolation of Chit1, Chit2 from M. anisopliae and Chit1from 44 Beauveria and T. longibrachiatum 2.5.2.1 Ligation 44 2.5.2.2 Transformation in E. coli (DH5α) 44 2.5.2.3 Plasmid isolation 45 2.4.2.4 Restriction digestions 45 2.4.2.5 Sequencing and homology analysis 46 2.5.3 Characterization of Chitinase Genes 46 2.5.3.1 Homology modeling and validation 46 2.6 Expression of Chitinase Open Reading Frame (ORF’s) in Cotton 47 Plants 2.6.1 Obtaining of a Virus Induced Gene Silencing (VIGS) vector 47 2.6.2 Isolation of chitinases ORF’s 47 2.6.3 Cloning into ρGEM-T easy 48 2.6.4 Construction of VIGS-Chit recombinant plasmids 48 2.6.5 Particle bombardment 48 2.7 Transgenic Expression Analysis 49 2.7.1 RNA extraction 49 2.7.2 cDNA 50

2.8 Chitinase Assay 50 2.8.1 Enzyme assay 51 2.8.2 Calculations 52 2.9 Virulence bioassay of chitinase transgenic plants against B. tabaci 52

03 RESULTS 53 3.1 Sampling and Morphological characterization of insect-associated 53 fungi 3.1.1 Isolation of fungi 52 3.1.2 Morphological characterization of insect-associated fungi 55 3.2 Molecular characterization and phylogenetic analysis of insect 60 associated fungi 3.2.1 Phylogenetic analysis of rDNA-ITS region of Penicillium sp. 61 3.2.2 Phylogenetic analysis of rDNA-ITS region of Beauveria sp. 61 3.2.3 Phylogenetic analysis of rDNA-ITS region of Metarhizium 64 anisopliae 3.2.4 Phylogenetic analysis of rDNA-ITS region of Alternaria sp. 64 3.2.5 Phylogenetic analysis of rDNA-ITS region of Acremonium sp. 67 3.2.6 Phylogenetic analysis of rDNA-ITS region of Clonostachys rosea 67 3.2.7 Phylogenetic analysis of rDNA-ITS region of Cladosporium sp. 70 3.2.8 Phylogenetic analysis of rDNA-ITS region of Trichoderma sp. 70 3.2.9 Phylogenetic analysis of rDNA-ITS region of Fusarium sp. 73 3.2.10 Phylogenetic analysis of rDNA-ITS region of Aspergillus sp. 73 3.2.11 Phylogenetic comparison of rDNA-ITS region of all fungal 76 species 3.3 Distribution and frequency of insect associated fungi 78 3.3.1 Occurrence frequency in hot arid zone 78 3.3.1.1 Species diversity and similarities between different hosts in hot 81 arid zone 3.3.2 Occurrence frequency in cotton zone 82 3.3.2.1 Species diversity and similarities between different hosts in cotton 84 zone 3.3.3 Occurrence frequency of central mixed zone 85

3.3.3.1 Species diversity and similarities between different hosts in central 88 mixed zone 3.3.4 Species diversity and similarities between different collection sites 88

3.4 Virulence bioassay of different fungal genera against Bemisia tabaci 89 3.4.1 Virulence of Trichoderma against 4thinstar nymphal and adult 89 stages of B. tabaci 3.4.2 Virulence of Cladosporium against 4thinstar nymphal and adult 91 stages of B. tabaci 3.4.3 Virulence of Metarhizium and Verticillium against 4th instar 93 nymphal and adult stages of B. tabaci 3.4.4 Virulence of Beauveria against 4th instar nymphal and adult stages 96 of B. tabaci 3.4.5 Virulence of Fusarium against 4th instar nymphal and adult stages 98 of B. tabaci 3.4.6 Virulence of Clonostachys rosea and Acremonium sp. against 4th 100 instar nymphal and adult stages of B. tabaci 3.4.7 Virulence of Penicillium against 4thinstar nymphal and adult 102 stages of B. tabaci 3.4.8 Virulence of different fungi against 4th instar nymphal and adult 104 stages against B. tabaci 3.5 Isolation and characterization of chitinases from entomopathogenic 110 fungi 3.5.1 Isolation of endochitinase Chit1 and Chit2 110 3.5.2 Characterization of endochitnase Chit1 and Chit2 112 3.5.2.1 Characterization of endochitinase Chit1 from B. bassiana isolate 112 Tn-13 3.5.2.2 Characterization of endochitinase Chit1 from B. bassiana isolate 113 Tn-27 3.5.2.3 Characterization of endochitinase Chit1 from B. brongniartii 114 isolate Tn-09 3.5.2.4 Characterization of endochitinase Chit1 from M. anisopliae isolate 115 Tn-16 3.5.2.5 Characterization of endochitinase Chit1 from M. anisopliae isolate 116 Tn-25 3.5.2.6 Characterization of endochitinase Chit2 from M. anisopliae isolate 117 Tn-16

3.5.2.7 Characterization of endochitinase Chit1 from T. longibrachiatum 118 isolate SR 3.5.3 Phylogenetic analysis of endochitinase of family 18 glycosyl 119 hydrolases 3.5.4 Homology modeling and validation of Chit1 and Chit2 protein 121 3.6 Expression of chitinases in cotton plants, enzyme assay and bioassay 128 against B. tabaci 3.6.1 Expression of chitinases in cotton plants 128 3.6.2 Chitinase activity assay 130 3.6.3 Virulence bioassay of chitinase transformed plants against B. 131 tabaci 3.6.3.1 Virulence bioassay of chitinase transformed plants against 4th 131 instar nymph and adult stages of B. tabaci

04 DISCUSSION 134 06 CONCLUSION 151 07 FUTURE ASPECTS 152 08 REFERENCES 153 APPENDIXES

LIST OF TABLES

Table No. Title Page No. 2.1 Detail of entomopathogenic fungi used in isolation of 42 chitinase gene 2.2 Chitinase Gene Bank accession no’s of M. anisopliae and 43 B. bassiana from NCBI

2.3 Set of different primers 43 2.4 Primers sets for amplification of chitinase gene 47 2.5 Reagents for the synthesis of cDNA 50 2.6 Reaction scheme for 96 well plate assay 51 3.1 Details of fungal genera with their isolation source 53 3.2 Morphological characterization of insect associated fungi 55 3.3.1 Fungi found on different insects of suborder 80 Sternorrhyncha (Hemiptera) in hot arid zone 3.3.2 Summary of fungal species diversity of suborder 81 Sternorrhyncha (Hemiptera) in hot arid zone

3.3.3 Fungi found on different insects of suborder 83 Sternorrhyncha (Hemiptera) in cotton zone 3.3.4 Summary of fungal species diversity of suborder 85 Sternorrhyncha (Hemiptera) in cotton zone

3.3.5 Fungi found on different insects of suborder 86 Sternorrhyncha (Hemiptera) in central mixed zone 3.3.6 Summary of fungal species diversity of suborder 88 Sternorrhyncha (Hemiptera) in central mixed zone

3.4.1 Mortality range and percentage mortality of different 89 species of Trichoderma against 4th instar nymphal stage of B. tabaci

3.4.2 Mortality range and percentage mortality of different 90 species of Trichoderma against adult stage of B. tabaci 3.4.3 Mortality range and percentage mortality of different 92 species of Cladosporium against 4th instar nymphal stage of B. tabaci 3.4.4 Mortality range and percentage mortality of different 92 species of Cladosporium against adult stage of B. tabaci

3.4.5 Mortality range and percentage mortality of different 94 species of Metarhizium and Verticillium against 4th instar

nymphal stage of B. tabaci 3.4.6 Mortality range and percentage mortality of different 95 species of Metarhizium and Verticillium against adult stage of B. tabaci

3.4.7 Mortality range and percentage mortality of different 96 species of Beauveria against 4th instar nymphal stage of B. tabaci 3.4.8 Mortality range and percentage mortality of different 97 species of Beauveria against adult stage of B. tabaci

3.4.9 Mortality range and Percentage Mortality of Different 98 Species of Fusarium against 4th instar nymphal stage of B. tabaci

3.4.10 Mortality range and percentage mortality of different 99 species of Fusarium against adult stage of B. tabaci 3.4.11 Mortality range and percentage mortality of different 104 species of Clonostachys and Acremonium against 4th instar nymphal Stage of B. tabaci 3.4.12 Mortality range and percentage mortality of different 104 species of Clonostachys and Acremonium against adult stage of B. tabaci

3.4.13 Mortality range and percentage mortality of different 103 species of Penicillium against 4th instar nymphal stage of B. tabaci 3.4.14 Mortality range and percentage mortality of different 103 species of Penicillium against adult stage of B. tabaci 3.5.1 PCR finding with different set of Primers 110 3.5.2 Comparison of the active sites and amino acids residues of 113 the family 18 endochitinases

3.6.1 Chitinase activity of transformed cotton plants 131 3.6.2 Percentage mortality of chitinase transformed plants against 132 4th instar nymphal stage of B. tabaci

3.6.3 Percentage mortality of chitinase transformed plants against 133 adult stage of B. tabaci

LIST OF FIGURES

Figure No. Title Page No. 2.1 Google map showing all localities of insect sampling in 35 different agroecological zones 2.2 Clip cages used in experimentation for virulence bioassay of 41 Bemisia tabaci

3.2.1 PCR amplification of ITS region of fungal isolates was amplified by PCR 60 with ITS1 and ITS4 primers 3.2.2 Phylogenetic tree showing the relationship of Penicillium sp. 62 based on ITS region and 5.8S sequence 3.2.3 Phylogenetic tree showing the relationship of Beauveria sp. 63 based on ITS region and 5.8S sequence 3.2.4 Phylogenetic tree showing the relationship of Metarhizium 65 anisopliae based on ITS region and 5.8S sequence

3.2.5 Phylogenetic tree showing the relationship of Alternaria sp. 66 based on ITS region and 5.8S sequence 3.2.6 Phylogenetic tree showing the relationship of Acremonium 68 based on ITS region and 5.8S sequence 3.2.7 Phylogenetic tree showing the relationship of Clonostachys 69 rosea based on ITS region and 5.8S sequence 3.2.8 Phylogenetic tree showing the relationship of Cladosporium 71 cladosporioides and Cladosporium sp. based on ITS Region and 5.8S sequence

3.2.9 Phylogenetic tree showing the relationship of T. 72 longibrachiatum and T. harzianum based on ITS Region and 5.8S sequence

3.2.10 Phylogenetic tree showing the relationship of Fusarium sp. 74 based on ITS region and 5.8S sequence 3.2.11 Phylogenetic tree showing the relationship of Aspergillus sp. 75 based on ITS region and 5.8S sequence

3.2.12 Phylogenetic tree showing the relationship and cluster of 77 isolated fungal species based on ITS region and 5.8S sequence 3.3.1 Fungi found on individual insect of suborder Sternorrhyncha 79 (Hemiptera) in hot arid zone

3.3.2 Fungi found on different insects of suborder Sternorrhyncha 81

iii

(Hemiptera) in hot arid zone 3.3.3 Fungi found on individual insects of Suborder 84 Sternorrhyncha (Hemiptera) in cotton zone

3.3.4 Fungi found on different insects of suborder Sternorrhyncha 84 (Hemiptera) in cotton zone 3.3.5 Fungi found on individual insect of suborder Sternorrhyncha 87 (Hemiptera) in central mixed zone 3.3.6 Fungi found on different insects of suborder Sternorrhyncha 87 (Hemiptera) in central mixed zone

3.4.1 Comparison in percentage mortality of 4th instar nymphs and 91 adults of B. tabaci by different concentration of Trichoderma. 3.4.2 Comparison in percentage mortality of 4th instar nymphs and 93 adults of B. tabaci by different concentration of Cladosporium. 3.4.3 Comparison in percentage mortality of 4th instar nymphs and 95 adults of B. tabaci by different concentration of Metarhizium and Verticillium

3.4.4 Comparison in percentage mortality of 4th instar nymphs and 97 adults of B. tabaci by different concentration of Beauveria. 3.4.5 Comparison in percentage mortality of 4th instar nymphs and 100 adults of B. tabaci by different concentration of Fusarium sp. 3.4.6 Comparison in percentage mortality of 4th instar nymphs and 102 adults of B. tabaci by different concentration of Clonostachys and Acremonium.

3.4.7 Comparison in percentage mortality of 4th instar nymphs 104 and adults of B. tabaci by different concentration of Penicillium.

3.4.8 Percentage Mortality of fungal species against 4th instar 106 Nymphal and adult stages (4x108) 3.4.9 Percentage Mortality of fungal species against 4th instar 107 Nymphal and adult stages (4x104)

3.5.1 PCR confirmation of partial endochitinase Chit1 and Chit2 111 from B. bassiana, M. anisopliae and T. longibrachiatum 3.5.2 Restriction analysis of partial endochitinases genes in E.coli 111 DHα5 by using EcoR1 restriction enzyme

3.5.3 Nucleotides along deduced amino acids indicated below 113 codons of Buv_Chit1 gene of B. bassiana isolate Tn-13.

Substrate binding and catalytic domains are highlighted while start and stop codons are represented in bold. 3.5.4 Nucleotides along deduced amino acids indicated below 114 codons of Buv_Chit1 gene of B. bassiana isolate Tn-27. Substrate binding and catalytic domains are highlighted while start codon is represented in bold.

3.5.5 Nucleotides along deduced amino acids indicated below 115 codons of Buv_Chit1 gene of B. brongniartii isolate Tn-09. Substrate binding and catalytic domains are highlighted while start codon is represented in bold.

3.5.6 Nucleotides along deduced amino acids indicated below 116 codons of Met_Chit1 gene of M. anisopliae isolate Tn-16. Substrate binding and catalytic domains are highlighted while start and stop codons are represented in bold 3.5.7 Nucleotides along deduced amino acids indicated below 117 codons of Met_Chit1 gene of M. anisopliae isolate Tn-25. Substrate binding and catalytic domains are highlighted while start codon is represented in bold.

3.5.8 Nucleotides along deduced amino acids indicated below 118 codons of Met_Chit2 gene of M. anisopliae isolate Tn-16. Substrate binding domain is underlined and catalytic domains are highlighted while start and stop codons are represented in bold. 3.5.9 Nucleotides along deduced amino acids indicated below 119 codons of Tri_Chit1 gene of T. longibrachiatum isolate SR. Catalytic domain is highlighted and start codon is represented in bold. 3.5.10 Phylogenetic analysis of endochitinase of family 18 glycosyl 120 hydrolases isolated from entomopathogenci fungal species.

3.5.11 Homology modeling of Chit1 protein of B. bassiana (Tn-13), 122 B. bassiana (Tn-27) and B. brongniartii (Tn-09). 3.5.12 Homology modeling of Chit1 protein of M. anisopliae (Tn- 123 25) and M. anisopliae (Tn-16) 3.5.13 Homology modeling of Chit2 of M.anisopliae isolate (Tn- 124 16) and Chit1 of T. longibrachiatum (SR) 3.5.14 Ramachandran Plot showing the phi -psi torsion angles for 125 all residues in most stable predicted 3-D conformation of chitinase protein (A) B. bassiana isolate Tn-13(B) B. bassiana isolate Tn-27 (C) B. brogniartii isolate Tn-09

3.5.15 Ramachandran plot showing the phi -psi torsion angles for 125

all residues in most stable predicted 3-D conformation of chitinase protein (A) M. anisopliae isolate Tn-16 (B) M. anisoplaie isolate Tn-25 3.5.16 Ramachandran plot showing the phi -psi torsion angles for 127 all residues in most stable predicted 3-D conformation of chitinase protein (A) Chit2 of M. anisoplaie isolate Tn-16 (B) Chit1 of T. longibrachiatum isolate SR

3.6.1 Amplification of chitinase ORFs from Beauveria and 128 Metarhizium

3.6.2 Restriction analyses of VIGS-Chit recombinant plasmids 129 3.6.3 Visual evidence of CLCrV induce gene silencing. (A,B) 130 Control (C,D) Mock (E,F) CLCrV-Chit1 of B. bassiana isolate- 13

3.6.4 Virulence of fungal chitinases transformed plants against 4th 133 instar nymph and adult B. tabaci

LIST OF PLATES

Plate No. Title Page No. 3.1.1 Front colony morphology of different fungi on SDAY 57 media 3.1.2 Reverse colony morphology of different fungi on SDAY 58 media 3.1.3 Microscopic characteristics of different fungi 59 3.4.1 The infection of different fungi on B. tabaci 4th instar 108 nymph. (A) T. longibrachiatum (B) Cladosporium sp. (C) M. anisopliae (D) V. lecanii (E) B. bassiana (F) F. equiseti (G) C. rosea (H) P. polonicum 3.4.2 The infection of different fungi on adult B. tabaci. (A) T. 109 longibrachiatum (B) Cladosporium sp. (C) M. anisopliae (D) V. lecanii (E) B. bassiana (F) F. equiseti (G) C. rosea (H) P. polonicum

vii

LIST OF ABBREVIATIONS

CLCuv Cotton leaf curl virus CLCrV Cotton leaf crumple virus VIGS Virus-Induced Gene Silencing ORF Open reading frame % Percentage Rpm Revolutions per minute pH Hydrogen ion concentration °C Degree centigrade SDAY Sabrouraud Dextrose Peptone Yeast extract agar ITS Internal transcribed spacer region CTAB Cetyl trimethylammonium bromide E. coli Escherichia coli TAE Tris-acetate-EDTA DNA Deoxyribo nucleic acid RNA Ribo nucleic acid PCR Polymerase chain reaction RT Reverse transcriptase cDNA Complementary deoxyribo nucleic acid BLAST Basic Local Alignment Search Tool MgCl2 Magnesium Chloride mM Millimolar Mg Milligram µL Microliter mL Milliliter mL-1 per millilitre NCBI National Center for Biotechnology Information µm Micrometer Cm Centimeter Mm Millimeter OD Optical density Ng Nanogram w/v Weight per volume dNTP DeoxyriboNucleotide TriPhosphate Pmol Picomoles Bp Base pairs Φ Phi Ψ Psi MS Mass Spectrum ≤ Less than and equal to ANOVA Analysis of variance LSD Least significant difference DMRT Duncan’s Multiple Range Test DEPC Multiple of gravity V Volt

viii

SUMMARY

Cotton whitefly, Bemisia tabaci is a cryptic sucking insect pest found all over the world. B. tabaci causes losses in many horticultural, ornamental and agricultural crops directly through feeding and indirectly by transmitting a number of viruses. Resistance has been developed in B. tabaci against pesticides due to excessive application of pesticides in different areas of the world. Biological control of B. tabaci is more persistent and also having no environmental and health issues. Entomopathogenic fungi in conserved biological control are an emerging field and have potential to pest control by using different biotechnological techniques.

In recent research work, different fungi associated with naturally dead insects (B. tabaci, Aphis gossypii and Phenacoccus solenopsis of order Hemiptera from three agroecological zones (hot arid, cotton and central mixed zone) were isolated. Further, these isolated fungi were characterized morphologically using different dicots keys. Morphological characteristics like colony shape and color, spore shape and diameter and some other distinguished micro-characteristics were also studied. Fungi that were characterized morphologically includes; different species of Aspergillus, Acremonium, Beauveria, Cladosporium, Alternaria, Clonostachys, Penicillium, Trichoderma, Fusarium, Metarhizium and Verticillium. Different isolated fungi were also characterized on its molecular basis by amplifying internal transcribed spacer region (ITS) followed by phylogenetic analysis to determine genetic relationship among different fungal genera. Phylogenetic analysis revealed that studied fungal genera are distinguished and fell under their particular clades.

The frequency of occurrence of insect associated fungi was also studied in the individual zones. Total 50 fungal isolates from three insect’s hosts were found in cotton zone while 49 and 41 were found in hot arid and central mixed zone respectively. It was observed that in the individual hosts, overall 53 fungal isolates of different genera from B. tabaci, 50 from A. gossypii and 37 from P. solenopsis were found in all agroecological zones. In the case of individual occurrence frequency of fungi, Aspergillus flavus and Verticillium lecanii with 8.16 % maximum occurrence frequency was found in hot arid zone, while Aspergillus nudulans, Beauveria bassiana, Fusarium solani and Fusarium oxysporum were found with maximum 8 %

of occurrence frequency individually in cotton zone, and Aspergillus nidulans was found with 12.20 % occurrence frequency in central mixed zone.

Virulence of different fungi with two spore suspensions (4 x 108 and 4 x 104 mL-1) were observed against 4th instar nymphal and adult stages of B. tabaci. All fungi were comparatively more virulent to 4th instar nymphal stage as compared to adult stage of B. tabaci with the spore suspension of 4 x 108 mL-1. Metarhizium anisopliae, Beauveria bassiana, and Verticillium lecanii showed promising results against 4th instar nymphal and adult stages of B. tabaci while some isolates of Fusarium showed significant results against 4th instar nymphal stage of B. tabaci.

Endochitinases (Chit1 and Chit2) gene of family 18 glycosyl hydrolyses were amplified, cloned and characterized from genomic DNA of different isolates of B. bassiana, B. brongniartii, M. anisopliae and T. longibrachiatum. Catalytic motif of family 18 glycosyl hydrolyses was found in all Chit1 of B. bassiana, B. brongniartii, M. anisopliae and T. longibrachiatum, and also in Chit2 of M. anisopliae while signal peptide was only found in B. bassiana isolate Tn-27. Substrate binding motif was found in Chit1 of B. bassiana, B. brongniartii and M. anisopliae while it was absent in Chit1 of T. longibrachiatum and Chit2 of M. anisopliae. Phylogenetic analysis was also carried out to investigate the evolutionary relationship among the fungal chitinases of Beauveria, Metarhizium and Trichoderma. Results reveal that Chit1 and Chit2 isolated in this study are most closely related to the family 18 glycosyl hydrolyses. Transient expressions of Chit1 from B. bassiana and M. anisopliae, and Chit2 from M. anisopliae were studied in cotton plants using Geminivirus mediated gene silencing vector (VIGS) of Cotton Leaf Crumple Virus (CLCrV). Chitinase activity of Chit1 of B. bassiana (0.91 µ/mL) was maximum as compared to Chit1 and Chit2 of M. anisopliae. Virulence of these transformed cotton plants against 4th instar nymphal and adult stages of B. tabaci reveals that plants with Chit1 of B. bassiana showed more mortality of 4th instar nymphal and adult B. tabaci as compared to Chit1 and Chit2 of M. anisopliae.

Chapter 1

INTRODUCTION AND LITERATURE REVIEW

1.1 Bemisia tabaci The Bemisia tabaci was described for the first time by Gennadius in 1889, as an important pest on tobacco from Greece (Tay, Evans, Boykin, & De Barro, 2012). This insect pest belongs to the family: Aleyrodidae, order: Hemiptera, class: Insecta or Hexapoda (Xu et al., 2012). It is known by several common names like tobacco whitefly, cotton whitefly and sweet potato whitefly (Byrne & Bellows, 1991). B. tabaci is an important invasive species globally, in tropical and subtropical agriculture in addition to green house production systems since last 20 years (Brown, Perring, Cooper, Bedford, & Markham, 2000; Qiu, De Barro, Xu, & Ren, 2006; Qiu et al., 2007). In 1897, it was first time reported on potato in new world commonly known as sweet potato whitefly, originally illustrated as Aleyrodes inconspicua (Quaintance, 1900). Except Antarctica, it has been reported from all the continents because the adaptation of geographical origin and could easily breed to new host plants (Martin, Mifsud, & Rapisarda, 2000). The countries which considered as the geographic origins of the B. tabaci are Asia, Africa, North and South America (Paul J. De Barro, Liu, Boykin, & Dinsdale, 2011). Pakistan was considered to be one of the centers of origin of this pest (Mound, 1983) but the recent evolutionary data based on mtCO1 gave evidence that sub-Saharan Africa is a more likely origin for B. tabaci (Boykin et al., 2007; Paul J. De Barro et al., 2011).

Whitefly is a small insect, white to light yellow in color and body is covered in a waxy powdery material. B. tabaci is arrhenotokous: fertilized egg develops into diploid female (XX) and unfertilized one into males, which is haploid (XO). Whitefly undergoes incomplete metamorphosis. After passing through the four nymphal stages, adults develop from eggs. Eggs are laid on the under surface of leaves usually in the semi-circular form. Once hatched, the first-instar larva is capable of moving the short distance in search of suitable feeding site. They start feeding on the lower surface of the leaves. Molting occurs throughout the second and third nymphal stars to fourth that stops feeding. The optimum temperature for whitefly development is between 25C- 27ºC. Life span can extend up to 105 days (Dalmon, 2007; Gerling & Mayer,

1996; Wang & Tsai, 1996). B. tabaci is multivoltine produced 11-15 generations within one year under field conditions. A female can lay an average of 80 eggs in her life time (Dalmon, 2007; Fishpool & Burban, 1994) and they have no diapauses or dormant stages. Therefore, whiteflies are constant through the frequent utilization of numerous plant host resources over the annual (Naranjo et al., 2009). Movement from one plant host species to another is consequently an essential element of the whitefly ecology which facilitates finding host plants and colonization in a frequently variable ecosystem. Semiochemicals released by host plants play a major role in mediating host choice on the majority of the herbivores insects (Xiao & Fadamiro, 2009).

1.2 Host range of Bemisia tabaci B. tabaci infests at least 600 different plant species, though however, it showed preference to Asteraceae, Compositae, Cruciferae, Cucurbitaceae, Euphorbiaceae, Fabaceae, Labiatae, Leguminosae, Malvaceae and Solanaceae families plants (Bayhan, Ulusoy, & Brown, 2006; Johnson et al., 1982; Elsey & Farnham, 1994; Mound & Halsey, 1978), with a distinct affinity to cabbage, cotton, cucumber, eggplant, gerbera, gherkin, melon, poinsettia, squash, sweet potato, and tomato (Xu, Lin, & Liu, 2011; Ying, Jian, Rui‐yan, & Ju‐cai, 2003;van Lenteren & Noldus, 1990; Shah & Liu, 2013). Many new weed hosts of whitefly include: Borreria verticilliata (Rubiaceae), Waltheria indica, W. rotundifolia (Sterculicaceae), Herisanthia hemoralis (Malvaceae), Cleome espinosa (Cleomaceae), Richardia grandiflora, Pavonia cancellata, Stachytarpheta sanguinea (Verbenaceae), Solanum ambrosiacum (Solanaceae), Diodia teres (Rubiaceae), Herissantia crispa (Malvaceae), and Phyllanthus tenellus (Euphorbiaceae) (Oliveira et al., 2000). Recently new weed hosts reported in the USA include: Valeriana officinalis (Valerianaceae), Hyperium perfolatum (Hypericaceae), Tanacetum parthenium, and Echinacea pallida (Asteraceae) (Simon et al., 2003). In Pakistan, it was found to colonize on 164 plants species from 42 families (Attique, Rafiq, Ghaffar, Ahmad, & Mohyuddin, 2003). Main host crops of B. tabaci in Pakistan are cucurbits, pepper, cotton, okra, tomatoes, soybean, rape-seed, cowpea and sunflower (Perveen et al., 2010). In Pakistan, cotton is economically important plant among all host plants of B. tabaci and most of the cotton varieties are susceptible for whitefly (Javaid et al., 2012). Cotton leaf curl virus (CLCuV) disease is transmitted through B. tabaci and grafting in different plants viz Okra, soybean, and cotton (Hameed et al., 1994). The

CLCuV disease caused a loss of US$5 billion in Pakistan during 1992-1997. According to reports, 20 to 100 % cotton yield loss happens due to this insect each year (Perveen et al., 2010).

1.3 Biotypes of B. tabaci Bemisia tabaci is a cryptic sucking insect pest species complex found all over the world (Dinsdale, Cook, Riginos, Buckley, & De Barro, 2010; Brown, 2010) which means that it is a group of closely related species referred to as biotypes or haplotypes (Calvert et al., 2001; Mound, 1963; Rosell et al., 1997; Gill & Brown, 2009). While morphologically indistinguishable, members of this species complex differ on a molecular level and exhibit full or incomplete reproductive isolation due to reproductive incompatibility (De Barro, Liu, Boykin, & Dinsdale, 2011; Oliveira, Henneberry, & Anderson, 2001). Whitefly is haplodiploid and reproductive incompatibility is indicated by a failure to produce healthy female progeny or a substantial reduction in fecundity and/or the proportion of diseased females in the progeny. The species complex has been found to differ not only in host range (Omondi, Obeng‐Ofori, Kyerematen, & Danquah, 2005; Xu et al., 2011; Zang, Chen, & Liu, 2006), but also their potential in plant virus transmission; rate of development (Liu et al., 2012); ability to develop insecticide resistance (Alon et al., 2006; Costa, Brown, Sivasupramaniam, & Bird, 1993; A. R. Horowitz, Kontsedalov, Khasdan, & Ishaaya, 2005; Luo et al., 2010), behavior (Crowder et al., 2010; Liu, 2007; Likun Wang, Feng, Wang, Wang, & Zhang, 2010), geographical distributions; interactions with viruses and host plants (Colvin et al., 2006; Liu, Zhao, Jiang, Zhou, & Liu, 2009; De Barro & Bourne, 2010) and also in the species of their endo-symbionts (Ahmed et al., 2010).

Biotype concept of B. tabaci emerged in the mid-1980s with the first invasion of B. tabaci population in the southern United States that had a different esterase profile; host range and also induced silver leaf disorder in squash, hence the named silver leaf whitefly. Based on the earlier observations, the indigenous American B. tabaci population was named the A biotype (cotton, sweet potato or tobacco strain) and the invading population as the B biotype (poinsettia strain) (Brown et al., 1995a). Thereafter, the use of biotypes term became the accepted way to designate to genetically distinguishable B. tabaci.

Although there are a large number of evidences that show the presence of biological variants for the B. tabaci group, but there is no specific set of biological data that can be used across the whole group (De Barro et al., 2011) furthermore majority of B. tabaci biotype designation was based on genetic marker and not on biological data. This practice results in misuse of the term biotype (Downie, 2010). There has been an intense debate about whether B. tabaci is a complex species, consist of many biotypes or a species complex (Brown, 2010, De Barro et al., 2011). A recent study based on mtCO1 sequences clarified the global analysis of B. tabaci and gave the specific boundaries to subdivide B. tabaci. Pairwise genetic divergence of 3.5% was considered to be the boundary that discriminate different species (Dinsdale et al., 2010). Bemisia tabaci is now considered as a cryptic species complex comprising 11 genetic groups and at least 24 morphologically similar species which hardly interbreed and form different phylogenetic clades (Dinsdale et al., 2010; De Barro et al., 2011).

The outbreak of whitefly, particularly in areas where it was previously not important, is linked to the emergence of new biotypes (Legg, French, Rogan, Okao- Okuja, & Brown, 2002; Simone, Brown, Hiebert, & Cullen, 1990). Evolution in agriculture results in irrigated monoculture, the requirement for intensive agriculture (two cropping seasons in a year) is the key factors in biotype appearance ( Brown et al., 1995). Due to its growing importance, it is necessary to develop techniques for systematic and evolutionary studies (Hillis & Moritz, 1990). More recent molecular techniques are: protein polymorphism involving isozyme variation in esterase, Random amplified polymorphic DNA (RAPD), PCR fingerprinting, mitochondrial DNA marker gene (mtCO1), the ribosomal RNAs, 18SrDNA (eukaryotes), Amplified Fragment length polymorphism (AFLP) and a ribosomal nuclear marker (ITSI) have been used to review B. tabaci systematics (Abdullahi, Winter, Atiri, & Thottappilly, 2003; Paul J. De Barro et al., 2011; Legg et al., 2002; Simon et al., 2003; Thierry et al., 2011). Currently the most widely used and accepted method to identify and discriminate among B. tabaci species are based on mtCO1 sequences analysis (Dinsdale et al., 2010). Based on mitochondrial cytochrome oxidase 1 gene (mtCO1), B. tabaci complex (comprising non- B type variants and B ) can be divided into 5 major groups on a geographical basis viz Malaysia and Thailand from Southeast region of Asia, Nepal, Pakistan and India from Indian subcontinent; North Africa,

Southwest Europe and Middle East from Mediterranean Basin; Mexico, Puerto Rico and United States from the new world; Cameroon, Uganda, Mozambique and Zambia from Equatorial Africa (Frohlich, Torres‐Jerez, Bedford, Markham, & Brown, 1999).

In Pakistan, the presence of the B biotypes was first reported in Punjab in 1996. Bemisia tabaci was reported from Pakistan by Bedford et al. (1994) who used esterase to discriminate B. tabaci populations and referred as biotypes P and K. De Barro and Hart (2000) used ribosomal ITS1, described that the whiteflies recognized as P and K by Bedford et al. (1994) were very closely related. In a subsequent study, Simon et al. (2003) identified the presences of three biotypes: Southeast Asian, Indian and Mediterranean-African in Pakistan based on RAPD-PCR and mtCO1 gene. De Barro, Trueman, & Frohlich, 2005 again assigned both P and K to Asia П by using ITS1, that on the basis of mtCO1, had been previously designated as Indian Subcontinent‟ (Brown, 2001)„Pakistan, Thailand, and China cluster‟(Viscarret et al., 2003). Ahmed, in 2010 used cytochrome oxidase gene (CO1) and reported that a new biotype of the B. tabaci named PK1 was responsible for high levels of infestation on cotton in Punjab. This lack of clarity and consistency around identification of B. tabaci has confused the current understanding of the factors responsible for the outbreak.

1.4 Historical Outbreaks of B. tabaci During the last two decades, serious outbreaks of B. tabaci have been reported in different parts of the world (Basu, 1995). In the Near East, B. tabaci has been reported as the main pest in Egypt, Jordan, Libya, Morocco, Tunisia, Yemen, Iraq, Pakistan, Cyprus, Algeria, Turkey, the United Arab Emirates, Lebanon, Somalia, Malta, Saudi Arabia, Sudan, Tunisia, Kuwait and Bahrain. It mostly attacks ornamental plants and vegetables under the protected cultivation (Traboulsi, 1994). It also caused infection on cotton and citrus in Israel and Pakistan and on pears and olives in Morocco (Traboulsi, 1994). In Taiwan and China, serious outbreaks of B. tabaci were observed in 1953 and in 1972 in Yunnan. Currently, B. tabaci has wide spread from Northern to Southern parts of the country (Rumei, 1996). In Yemen, whitefly has been reported on watermelons since 1989 (Bedford et al., 1994). Brazil has been seriously affected by whitefly since 1995 and annually losses have exceeded 5 billion US$. In the Southeast to almost the entire area of the country has B. tabaci infestation. The major crops affected were melons, beans, cabbage, cotton, tomatoes,

okra and several other crops were also infested (Lima, Navia, Inglis, & De Oliveira, 2000). Serious damage was first recorded in 1931 in the Israel on different crops such as tomatoes, cauliflower, eggplants, and cabbage. In addition to these losses, many other crops such as melon and cucumber plants were also infested with B. tabaci in the interior valleys, coastal plain and the upper Galilee (Be‟eri & Kapuler, 1963). Colombia (Quintero et al., 1998), Bolivia (Morales & Anderson, 2001) and South American countries such as Argentina (Viscarret et al., 2000) have also reported serious issues of whitefly.

Bemisia tabaci had been reported for a long time as a serious agricultural pest all over the southern and western states in the USA. When serious outbreaks occurred in Arizona and California, it became economically important pest till 1981.Whiteflies caused a high infestation of poinsettias and symptoms of silver leaf was observed on squash plants in 1989 in Florida (Maynard & Cantliffe, 1989; Price et al., 1986). In 1991, California‟s Imperial Valley was occupied by destructive potential of insects (Toscano, Castle, Henneberry, & Castle, 1998). Whitefly caused damages of approximately 200 to 500 million US$ in Texas, Arizona, Florida and California in 1991-1992 (Ellsworth et al., 1999). In the same year whitefly also caused losses of 33 million US$ by infecting sesame, melon, cotton and watermelon in the Mexicali Valley and cotton production was reduced from 39,415 ha in 1991 to only 653 ha in 1992 (Medina Esparza & Leon Paul, 1994).

In 1967, cotton leaf curl disease was first time reported in few cotton plants (Gossypium hirsutum L) at Khokhran near Multan, Pakistan (Hussain & Ali, 1975). After that, it became a severe issue in 1991-92 and sustained till the development of cotton leaf curl resistant variety CIM-1100 in 1996. During 2001 in Burewala, this issue rose again and broke the resistance of all the commercially available cotton lines (Mansoor, Briddon, Zafar, & Stanley, 2003). Many workers have been reported that cotton leaf curl virus disease markedly reduced the yield of cotton seeds (Idris, 1990; Harrison et al., 1997; Brown, 2001; Ahmad et al., 2008). Ahmad et al. (2002) evaluated that in cotton cultivars the average decrease in boll weight 33.8%, plant height 40.6%, ginning out turn 3.9%, fiber length 3.4%, the number of bolls per plant 72.5%, and fiber strength 0.7% due to cotton leaf curl virus disease.

1.5 Types of Damage caused by B. tabaci The whitefly, B. tabaci recognized as a key pest on many crops. It causes economic damage in both open field and green house through feeding on phloem sap, excretion of honey dews and through transmitting plant viruses (Ahmed et al., 2010; Chu et al., 2006; Jones, 2003; Mugiira, Liu, & Zhou, 2008). Whitefly causes direct damage to plant foliage through their feeding habits. Heavy infestation of B. tabaci adults and nymph can reduce host plant vigor, growth rate and yield due to sap removal and also weaken and wilt of the host plant (Berlinger, 1986). Feeding of some whitefly nymphs (notably the B biotype) is associated with phytotoxicity disorders, such as the occurrence of irregular ripening of tomatoes and silver leaf of squash (Hanif-Khan et al., 1996; Schuster, Mueller, Kring, & Price, 1990). Newly developing leaves become silvery in appearance due to infestation by immature whiteflies, because of the removal of the upper epidermis from the underlying cell layer. The resultant air spaces reflect light, causing the silver color. Bleached and poor quality fruits developed on the silvered plants (Chen, McAuslane, Carle, & Webb, 2004). Indirect feeding damage results due to the accumulation of honeydew produced by the feeding nymphs. The honeydew is present on plant leaves, flowers and fruits and serves as a substrate for the growth of black sooty mold, thus preventing proper photosynthesis and resulting in stickiness defoliation, discoloration, and stunting (Ali & Aheer, 2007; Aslam, Khan, Rasheed, & Khan, 2001). Whitefly infestation also reduces the value and quality of agricultural crops and crop products. Particularly in the case of cotton lint, which cannot be processed when covered by the residues of sticky honeydews and fungus mycelium and greatly reduced the product‟s value (Byrne & Bellows Jr, 1991; Jones, 2003).

Major damage caused by B. tabaci is associated with its notable property to transmit numerous viruses. Brown et al. (2012) reported 1100 whitefly species worldwide, and only three, B. tabaci, Trialeurodes vaporariorum and T. abutiloneus were known as the vector of plant viruses. Among these three species, B. tabaci (Gennadius) is considered the most significant of the whitefly vectors of plant viruses, and whitefly species can only transmit geminiviruses (Duffus, 1987; Harrison, 1985). There are 288 species of begomoviruses (family Geminiviridae) which are known to be transmitted by B. tabaci (Brown, 2009). B. tabaci also transmits plant virus species belonging to the genera Ipomoviruses, Carlavirus, Crinivirus and Torradovirus

(Jones, 2003; Navas-Castillo, Fiallo-Olive, & Sanchez-Campos, 2011). These viruses caused symptoms on their host plant, which can be described as leaf mosaic (New World Begomoviruses), leaf curl (Old Word Begomoviruses), leaf necrosis (Torradoviruses), and vein yellowing (Ipomoviruses). Begomoviruses transmitted by whitefly cause serious diseases of vegetables and fiber crops worldwide (Brown et al., 2012). As described above, whitefly has directly and indirectly affected plant health so its management is the necessity of the time for good plant health and production of economically important crops.

1.6 Pest Management Strategies for B. tabaci 1.6.1 Cultural control Management of whitefly by the application of cultural practices consists of the exploitation of existing or new components of the agro-ecosystem to decrease pest damage to non-economic levels (Hilje, 2000). A large number of cultural control practices initially developed for use on virus vector systems such as trap crops, crop residue, disposal crop-free periods, removal of alternate hosts planting dates and living mulches have been modified to manage B. tabaci (Mason, Ye, Suzuki, D'ercole, & Matsushima, 2000; Schuster, Mueller, Kring, & Price, 1990). Hilje, et al. (2001) evaluated and recommended cultural practices such as crop residue disposal, rouging, use of barriers and intercropping. But these practices are effective only in tropical tomato production areas throughout the year with the combination of insecticides and use of resistant varieties (Polston & Anderson, 1997). In tomato growing areas, the incidence of Tomato mottle virus (ToMoV) (Csizinszky, Schuster, & Kring, 1995) and Tomato yellow leaf curl virus (TYLCV) (Czosnek et al., 2001) was reduced to different levels of efficiency by using aluminum mulches and orange or yellow polyethylene films. When tomatoes are grown in a large area, the application of mulches is not always practical and cost effective (Yehezkel Antignus, 2007; Antignus et al., 2004). The best results of cultural control reported to date appear to occur when ultraviolet-absorbing plastic films were used as insect-proof nets or greenhouse covers (Raviv & Antignus, 2004; Doukas & Payne, 2007). In addition, being a physical barrier for the insects, these UV-absorbing films can decrease virus incidence through the inhibition of whitefly movement, and have proven particularly effective for the management of begomoviruses (Ben-Yakir et al., 2008; Legarrea et al., 2010). Although many cultural practices have already been

recognized to control B. tabaci (Antignus, 2007; Hilje et al., 2001) but these practices are not very effective and are not alternative of resistant varieties or virus and whitefly-free transplants.

1.6.2 Chemical control At the present time, the application of insecticides is the major approach used to control B. tabaci populations (Horowitz, Denholm, & Morin, 2007; Palumbo, Horowitz, & Prabhaker, 2001). When all other control methods fail to control the target pests then chemical control becomes imperative. Endosulfan is the only organochlorine which is still being used on cotton whitefly effectively. It belongs to cyclodiene subclass of organochlorines and is considered as an antagonist of the GABA receptors-chloride channel complex (Anthony, Holyoke, & Sattelle, 1994). B. tabaci has been controlled by conventional insecticides including organochlorines, pyrethroids, carbamates and organophosphates since long (Ahmad, Arif, Ahmad, & Denholm, 2002, 1999). Later on, the development of insecticide resistance against conventional chemistries has raised serious concerns about their efficacy in the field. But the introduction of neonicotinoids in the form of imidacloprid and acetamiprid proved an immediate relief for cotton growers in Pakistan. Imidacloprid was the first member of this family and was effective against many insects showing resistance to carbamates, organophosphates and pyrethroids (Palumbo et al., 2001). Imidacloprid has been tremendously efficient for the management of B. tabaci in vegetable production (Mullins, 1993; Palumbo et al., 2001). Acetamiprid belongs to the second generation of the nicotinoids (Yamada, Takahashi, & Hatano, 1999). It is systemic insecticide with translaminar activity and both contact with stomach actions. Its foliar sprays provided even more effective control of whitefly compared to imidacloprid (Rauch & Nauen, 2003). These insecticides proved invaluable additions in the tools for controlling cotton whitefly and are used extensively on cotton. Diafenthiuron is a thiourea derivative and it was a very useful entry in the available chemical insecticides against whitefly. It was introduced in Pakistan since the start of 21st century. It has a unique mode of action; it disturbs the insect‟s respiratory system by inhibiting the oxidative phosphorylation (Luo et al., 2010; Roditakis et al., 2009). Moreover, various reports regarding development of resistance in whitefly particularly against endosulfan (Crowder, Ellsworth, Tabashnik, & Carriere, 2008; Horowitz et al., 2005) and imidacloprid (Rauch & Nauen, 2003) have further

enhanced the need to measure the variability in the tolerance of B. tabaci to endosulfan, imidacloprid, acetamiprid and diafenthiuron in different cotton growing regions of Pakistan. These insecticides gave good control of whitefly due to their different mode of actions coupled with the absence of cross-resistance to the conventional chemistries (Prabhaker, Toscano, Castle, & Henneberry, 1997). But their continuous and indiscriminate use particularly on cotton may decrease their efficiency.

The overuse of insecticides in some cropping systems frequently leads to develop resistance, mostly in the case of B. tabaci and TYLCV (Horowitz et al., 2007). Whitefly transport the virus is capable of contaminating a tomato plant with TYLCV within 4 h of inoculative feeding and insecticides with a rapid killing effect on mature plants prevent viral spread. Application of conventional insecticides by the growers twice in a week created resistant against insecticides in B. tabaci and after that daily insecticide applications were not effective against B. tabaci due to the development of resistance. In addition, the extensive use of insecticides adversely affected non-target organisms and caused secondary pest resurgence with environmental and health concerns (Bashir et al., 2001). Control of whitefly is much difficult due to increasing resistance to pesticides (Ahmad et al., 2002) and hence concerning public awareness and effects of chemical pesticides on the environment.

1.6.3 Biological control The application of natural enemies in biological control is considering a very efficient approach for the management of insect pests (Van Driesche & Bellows, 1996). Natural enemies such as parasitoids and predators are successfully used in the history of successful biological control of whiteflies (Gerling, 1990). Both specific and generalist natural enemies of whiteflies belong to the B. tabaci complex are identified (Arno, Gabarra, Liu, Simmons, & Gerling, 2009; Gerling et al., 2001). Under greenhouse conditions, B. tabaci are primarily controlled by the application of predators. One of the most successful natural enemies of whitefly is mite Amblyseius swirskii (Athias-Henriot). It is very effective in many vegetable species except tomato and used extensively. Numerous species of zoophytophagous hemipterans are used commercially, mostly Nesidiocoris tenuis Reuter in the Mediterranean basin and Macrolophus caliginosus (Wagner) in Northern Europe (Chan & Godfray, 1993; Arno et al., 2009; Gerling et al., 2001). Delphastus (Coccinellidae) species are

extensively used to control B. tabaci on gerbera plants, while the incompatibility of A. swirskii with tomato plants is overcome by means of both parasitoids and predator species. Parasitoids have drawn substantial attention because of their significance in biological control of insect pests through parasitism and host feeding (Chan & Godfray, 1993).

Parasitoids are primarily important agents to manage whitefly biologically; they parasitize whitefly nymphs to produce their new generations and also feed on nymphs to improve their fitness. Encarsia and Eretmocerus are the fundamental genera among the widespread fauna of the B. tabaci parasitoids. Gerling et al. (2001) reported 34 Encarsia spp., 12 Eretmocerus spp., two Amitus spp., and one from each Metaphycus spp. and Signiphora spp. of B. tabaci parasitoids. Childs et al. (2011) also reported eight species of both Encarsia and Eretmocerus genera from Western Sydney. Li et al. (2011) found 41 Encarsia spp., 12 Eretmocerus spp., two Amitus spp. and one Ablerus sp. in their survey in South, Southeast, North, Northwest, and central China. The majority of the research has revealed that premature hosts are usually preferred by parasitoids for feeding, whereas some researches revealed that the mature nymphs are preferred, though host size did not effect on the host feeding (Mansaray & Sundufu, 2010). It has been examined that Er. melanoscutus Zolnerowich, Rose, and En. pergandiella Howard females parasitized mostly on the third instar nymphs and the lowest on the first instar nymphs of B. tabaci (Greenberg, Jones, & Liu, 2008; Liu, 2007). While Er. mundus Mercet was most successfully parasitized on younger host instars (Greenberg et al., 2008). Yang and Wan (2011) reported that Er. hayati Zolnerowich and Rose effectively parasitized and fed almost all instar nymphs of B. tabaci except the late fourth instar; parasitism on first, second, and third instars was significantly higher than on the fourth instar but the utmost prevalence of parasitism was shown on the first instar.

Almost all parasitoids kill whitefly nymphs either by piercing the nymph with ovipositor following egg oviposition or by piercing the nymph and sucking the body fluids through labium (ShuSen et al., 2009; Zang & Liu, 2009). The efficacy of the parasitoid performance for controlling whitefly might be increased by food deprivation for an optimal period prior to release. Zang and Liu, (2009) reported that En. sophia feeds and parasitizes more B. tabaci nymphs during their whole lifespan if the adult parasitoids keep on without food for 6 hours prior to release and found that

they live considerably longer than the parasitoids with no food deprivation. Zang and Liu, (2010) also examined En. formosa and Er. melanoscutus and found that parasitoids depriving of food for 6 hours feeds more B. tabaci nymphs and parasitizes equal or more number than the parasitoids of continuous feeding. Srinivasa et al. (1999) and Beevi et al. (1999) observed 0-38.88% parasitism on B. tabaci nymphs by applying E. sp. nr. meritoria on diverse host plants. Geetha and Swamiappan, (2001) found that E. sp. nr. Meritoria caused 70-80% parasitism in guava in Coimbatore during 199. By using E. guadeloupae and E. meritoria, highest parasitism rate of 60- 92% was observed during 1999-2000 in Thrissur and Bangalore and in Minicoy during 2000 (Ramani, 2000). Beevi and Lyla, (2001) also recorded parasitism rate of 1-60% on many host plants by using these two species in Kerala. However, parasitism rate was observed to be extremely density-dependent and also diverse with host plants (Ramani, 2000; Beevi & Lyla, 2001; Srinivasa et al., 1999).

Plant species and varieties comprise plant attributes including leaf features, volatile compounds, presence or absence of pubescence and wax, etc. High dense and rigid hairs on the leaves generate low rates of parasitism (Rajam et al., 1988). Pubescent and trichomes on the leaves reduce parasitism of whitefly (Gruenhagen & Perring, 2001). Eretmocerus species associated with greater parasitism rate on hirsute varieties of melon and soybean (McAuslane, Simmons, & Jackson, 2000) indicating that some parasitoid species might be more efficient on certain pubescent plant leaves. Parasitism of the whitefly, B. tabaci was poorer on velvet leaf, Aboutilon theofrasti Medic than that of on other plants as a result of the discharge of trichome exudates that captured parasitoids (Gruenhagen & Perring, 2001). Waxy leaf surface also affects parasitism and Eretmocerus spp. and En. pergandiella had a greater parasitism on reduced wax both in laboratory and field crops than on other plants (Jackson, Farnham, Simmons, Van Giessen, & Elsey, 2000; McAuslane et al., 2000).

In the competitive interactions among parasitoids, one species can affect the other species directly by means of multi-parasitism whereas intra-specific interference (Collier & Hunter, 2001; Zang et al., 2011). However, Pang et al. (2011) studied the interspecific competitive interactions of En. Formosa and En. Sophia and found that the parasitism rate by En. Formosa was higher than that of En. Sophia when both of them were used individually. Many species of natural enemies are dynamic mutually under natural environmental condition. Consequently, a combination of naturally

occurring predators and parasitoids is generally applied for the management of B. tabaci. Furthermore, the similar predators may prey on additional nonspecific pests. The application of natural enemies to control B. tabaci is not reliable and other options are the use of biological agents such as entomopathogenic fungi (Cuthbertson et al., 2003; Cuthbertson et al., 2005).

1.7 Entomopathogenic fungi Entomopathogenic fungi are mostly associated with insects. A group of fungi associated with insect body, attach them and cause infection on the different part of their body is called entomopathogenic fungi. The word entomogenous derived from Greek words, Entomo which mean “insects‟ while genes word mean “arising in” so etymologically it is called microorganism which arises in insects. A number of insects were controlled through entomopathogenic fungi in last 50 years in the different area of the world (Ansari, Vestergaard, Tirry, & Moens, 2004; Butt, Jackson, & Magan, 2001; Lacey, Frutos, Kaya, & Vail, 2001). It is very easy to apply entomopathogens on leaf surface where nymphs and adults of whitefly are present mostly but coverage is necessary. It was studied that entomopathogens have no health effect to human and other hosts (Vestergaard et al., 2003; Zimmerman, 2008; Goettel et al., 2001). Several pesticides have already been developed from entomopathogens in the different area of the world as substitute control agents (Goettel et al., 2005). A wide range of different fungal species from many classes are studied that causes infection on insect bodies (Goettel et al., 2005).

1.8 Classification of Entomopathogenic Fungi Above 700 well known fungal species from 100 genera have been recognized as entomopathogenic fungi but some of them are successfully used to control insect, medical, forestry and agricultural fields (Roberts & Wraight, 1986, McCoy et al., 1988). Though, entomopathogenicity arose and was lost in different phyla with the passage of time. Except for Basidiomycetes, insect-associated fungi are recognized within every major fungal lineage. Entomopathogenic fungi are capable of infecting different insect orders such as Lepidoptera, Hemiptera, Hymenoptera, Diptera, Orthoptera and Coleoptera (Ferron, 1978).

1.8.1 Phylum Oomycota In this phylum, fungi have cellulose in their cell wall, lack chitin and zoospores are biflagellate. Several species of this phylum are saprophytic and parasites of animals and plants. While, two genera of this phylum are pathogenic to mosquito larvae and Lagenidium giganteum is widely studied (Scholte et al., 2004; Glare, 2010). Many other Lagenidium species are pathogenic to aquatic crustaceans and crabs (Hatai et al., 2000). Some species cause infection on Diptera and Chironomids are Leptolegnia spp. (Saprolegniales). Zattau and Mcinnis, (1987) studied that these species attack insects through secondary zoospore.

1.8.2 Phylum Chytridiomycota The fungi that contain chitin and lacks cellulose in cell wall are classified in this phylum. Major insect infecting Chytridiomycetes are grouped in Blastocladiales genus Coelomomyces. More than 70 Coelomomyces species are pathogenic to insects (Barr, 2001). These fungi mostly attack Dipteranas and Hemipterans orders of insects. Insect associated Myriophagus (Chytridiales) attack on pupae of Diptera, Coelomycidium (Blastocladiales) infect mosquitoes and black flies contain some other species (Samson et al., 2013).

1.8.3 Phylum Zygomycota Fungal hyphae are multicellular, non-septate and zygospores formed by the fusion of gametangia, are recognized as the phylum of Zygomycota typically (Tanabe, O'Donnell, Saikawa, & Sugiyama, 2000). Within the phylum Zygomycota, the class Trichomycetes contained species that mostly infect insects. Cooper and Sweeney, (1986) reported a species Smittium morbosum (Trichomycetes) as the pathogen of mosquito. Trichomycetes has mostly weak or symbiotic associations, not like true infectious agents (Beard & Adler, 2002). Some species of Mucor (Mucorales) are mostly associated with the death of insects. Another order Entomophthorales of this phylum consist of more than 200 insect-associated fungi. Many species of this order have the potential to produce secondary spores from primary spores and few of them produce long lasting resting spores.

1.8.4 Phylum Ascomycota and Deuteromycota The fungi that have gained most of the concentration for control of B. tabaci are the Ascomycetes and Deuteromycetes. These fungi are widely used because of the

chances for production on artificial media, their prevalence, comparatively long shelf lives and ease of application. The most important insect pathogenic species are Metarhizium, Beauveria, Aschersonia, Lecanicillium, Aspergillus, Tolypocladium, Culicinomyces, Sorosporella and Hirsutella (Huang et al., 2010; Bischoff et al., 2009). Approximately, 22 species of Beauveria are recognized as pathogenic to insects from 49 known species (Kirk, 2003). From known species of Beauveria, B. bassiana commonly called white muscardine fungi is most important causing infection on different insects from different insect orders (Rehner & Buckley, 2005). The genus Lecanicillum includes at least 15 different species of fungal pathogens affecting a wide host of insects ( Wang, Huang, You, Guan, & Liu, 2005), lives as the saprophyte and obtains nutrients from dead organisms. L. muscarium mostly cause epidemics in greenhouses naturally (James, Buckner, & Freeman, 2003; Meekes, Fransen, & van Lenteren, 2002).

1.9 Classification of fungi at Phylogenetic level

Genetic methods for identification and taxonomic classification of fungi have been established in recent years (Yeo & Wong, 2002). The earlier classifications were a phylogenetic overview of virtually of all the fungi (James et al., 2006). Reclassification of fungi is according to phylogenetically sound principles which based upon DNA sequences. The publications afterwards provided many necessary taxonomic readjustments that were indicated by the phylogenetic studies (Hibbett et al., 2007). The ITS gene sequences have been adopted as a biological bar code gene (Schoch et al., 2012) because of its vast range of fungi, but it is less useful for the identification of fungi in some important groups of Ascomycota especially in the order Hypocreales. Erynia, Eryniopsis, Furia, Strongwellsea, Pandora and Zoophthora were classified in the family “Entomophthoracea”. Whereas Neozygites were in the family “Neozygitacea”. Metarhiziuma, Beauveria, Lecanicillium, Nomuraea and Cordyceps were placed in family “Clavicipitaceae” (Roy et al., 2006).

Recently, a new classification of kingdom fungi with molecular analysis was proposed. The classification includes 195 taxa, down to the level of order, of which 16 are described or validated here: Dikarya subkingdom nov.; Chytridiomycota, Neocallimastigomycota phyla nov.; Monoblepharidomycetes, Neocallimastigomycetes class. nov.; Eurotiomycetidae, Lecanoromycetidae, Mycocaliciomycetidae subclass.

nov.; Acarosporales, Corticiales, Baeomycetales, Candelariales, Gloeophyllales, Melanosporales, Trechisporales, Umbilicariales ords. nov. The clade containing Ascomycota and Basidiomycota is classified as subkingdom Dikarya, reflecting the putative synapomorphy of dikaryotic hyphae. The most dramatic shifts in the classification relative to previous works concern the groups that have traditionally been included in the Chytridiomycota and Zygomycota. The Chytridiomycota is retained in a restricted sense, with Blastocladiomycota and Neocallimastigomycota representing segregate phyla of flagellated Fungi. Taxa traditionally placed in Zygomycota are distributed among Glomeromycota and several subphyla incertae sedis, including Mucoromycotina, Entomophthoromycotina, Kickxellomycotina, and Zoopagomycotina. Microsporidia are included in the Fungi, but no further subdivision of the group is proposed. Several genera of „basal‟ Fungi of uncertain position are not placed in any higher taxa, including Basidiobolus, Caulochytrium, Olpidium, and Rozella (Hibbett et al., 2007). A new phylum Entomophthoromycota was anticipated, which is further divided into two sub-families “Entomophthoroideae” and “Erynioideae”. Erynioideae includes Erynia, Furia, Strongwellsea and Pandora whereas Eryniopsis falls in Entomophthoroideae. According to Humber‟s classification, Metarhizium and Neozygites remain in their already assigned families, but Metarhizium with synonym: Metacordyceps, Nomuraea, Pochonia, Rotiferophthora etc. Two new families were also explained in this classification. Family “Cordycipitaceae” which contains Cordyceps (synonyms: Beauveria, Isaria, Lecanicillium, Evlachovaea, Microhilum, Simplicillium, etc.) Torrubiella (synonyms: Akanthomyces, Gibellula, Granulomanus, Pseudogibellula) Ascopolyporus Conoidiocrella & Family “Ophiocordycipitaceae” which includes Elaphocordyceps (synonym: Tolypocladium) Ophiocordyceps (synonyms: Hirsutella, Hymenostilbe, Paraisaria, Sorosporella, Syngliocladium) (Humber, 2012). This classification was further updated by Kepler et al. 2014. According to which Metarhizium (synonyms: Chamaeleomyces, Metacordyceps, Nomuraea), Pochonia, Metapochonia, Rotiferophthora Aschersonia (synonym: Hypocrella), other Aschersonioid genera; Moelleriella, Orbiocrella, Regiocrella, Samuelsia. Cordyceps (possible synonyms: Torrubiella, Lecanicillium1) Beauveria, Gibellula (synonym: Granulomanus), Isaria (synonym: Evlachovaea) Ascopolyporus, Conoidiocrella, Elaphocordyceps (synonym:

Tolypocladium), Ophiocordyceps (synonyms Hirsutella, Hymenostilbe, Paraisaria, Sorosporella, Syngliocladium) and Polycephalomyces were classified.

1.10 Molecular Approach for identification of Entomopathogenic fungi Entomopathogenic fungi were identified on the basis of conventional methods and taxonomic keys available in the literature. Conventional identification and characterization of fungal species have relied mainly on differences in morphological characters such as colony size, color, and shape of appressoria and conidia, the existence of the Glomerella teleomorph, the most favorable temperature for growth, presence or absence of setae (Smith & Black, 1990; Gunnell & Gubler, 1992). Different environmental factors influence on the survival of intermediate forms and stability of morphological traits. However, these criteria are not always sufficient for consistent discrimination between different species. The overlap of phenotypes and morphological features among species makes classification difficult.

Molecular techniques are significant tools in solving the problems of species delimitation and offer alternative methods for taxonomic studies (Fegan et al., 1993). Mitochondrial DNA (mtDNA), ribosomal DNA (rDNA), arbitrarily primed polymerase chain reaction (AP-PCR), AT-rich DNA and polymorphisms in nuclear DNA have been widely used to distinguish between populations of different fungus species (Sreenivasaprasad et al., 1993; Correll et al., 1993; Hodson et al., 1993; Freeman et al., 1993; Johnston & Jones, 1997). Because of lower conservation of nucleotide sequences in the internal transcribed spacer (ITS) and non-transcribed regions among the small and large nuclear rDNA subunits than in the coding regions, these have been utilized to identify current evolutionary divergence in fungal species (Ford, Banniza, Photita, & Taylor, 2004). According to dissimilarities in the sequence of the ITS regions of representative isolates, species-specific primers have been designed to identify different fungal species (Ford et al., 2004).

Fungal identification on molecular basis was done by amplification of the internal-transcribed-spacer-region (ITS) of nuclear rDNA (Schoch et al., 2012). This region is highly variable, having conserved primer sites in the fungal genome and used in ecological studies as well as in systemic studies of fungi genetics. ITS region was used for fungus bar-coding unofficially before the 1990s. Fungal ITS sequences in NCBI have been accumulated more than 2 hundred thousand since 2011 (Karsch-

Mizrachi et al., 2012). ITS region is highly conserved in fungi except for few cases and between the range of 450-750 bp in length approximately. The ITS region consists of three sub-regions viz ITS-1 and ITS-2, and the intercalary 5.8S gene. The 5.8S gene is highly conserved while ITS1 and ITS2 provide differences within the genus and even within species level (Nilsson, Kristiansson, Ryberg, Hallenberg, & Larsson, 2008). In different areas of the world, ITS regions are used as DNA bar- coding of fungi except for few fungal groups (Gazis, Rehner, & Chaverri, 2011), other additional markers can be used to bar-coding of Aspergillus and Fusarium (Balajee et al., 2009).

1.11 Infection mechanism of Entomopathogenic fungi Entomopathogenic fungi have a unique mode of infection which involves several processes until the insect is completely colonized and killed. The pathogenicity of insect-associated fungi is different from bacteria and viruses because these fungi attack the insects by breaching the host cuticle. The cuticle is composed of lipids, chitin fibrils embedded in a matrix of proteins, N-acylcatecholamines, and pigments (Wang et al., 2002). These fungi release extracellular enzymes such as lipases; protease and chitinases to break the main constituents of the cuticle (chitin, protein, and lipids) and hyphal tip penetrate the cuticle (Cho, Liu, Farmerie, & Keyhani, 2006; Wang et al., 2002). The successfulness of infection was directly proportional to secretion of exo-enzymes (Boldo et al., 2009; Lubeck et al., 2008; Mustafa & Kaur, 2009). It is supposed that both enzymatic action and mechanical force are responsible for penetration of fungus to the hemocoel of the insect (Vey, Hoagland, & Butt, 2001). The widespread genetic and transcriptomic studies of entomopathogenic fungal infection mechanism discovered that a large number of different genes participated in the pathogenicity (Cho, Kirkland, Holder, & Keyhani, 2007; Freimoser, Screen, Bagga, Hu, & St Leger, 2003) such as guanine nucleotide- binding proteins and its regulator (Fang, Pava-Ripoll, Wang, & Leger, 2009), chitinases which helps in attachment of spore (Wang & St. Leger, 2007), a perilipin- like protein that regulates appressorium turgor pressure and help in escaping the pathogen from recognition of host immunity (Wang & St. Leger, 2006).

The production of different amounts of cuticle-degrading enzymes results from the enzymatic action of fungus and differs among the species and strains of the fungi. These enzymes will show different levels of virulence against their hosts. After

the successful penetration of the cuticle, the entomopathogenic fungi produce hyphae bodies or blastospores, which are passively circulated in the fat body and hemolymph of insects (Wang et al., 2002). Fungal pathogens secrete different hydrolytic enzymes inside the insect host, mostly in the hemocoel to kill their host. B. bassiana and M. anisopliae release a huge amount of single extracellular protease called chymoelastase protease or Pr1 to break cuticle of their host (Cho et al., 2006; Wang et al., 2002). Though, the cuticle-degrading enzymes are released in a sequential manner with the chitinases, esterases, and proteolytic enzymes. In other words, proteins surrounding the cuticle must be degraded before the action of chitinases begins (Wang et al., 2002; Cho et al., 2006).

The initial stages of infection of entomopathogens, significant symptoms were observed and behavior symptoms like activities of insect, feeding and lack in coordination appear before some days of death (locust and grasshopper infested with M. anisopliae). Sometimes behavior symptoms like feeding increased as in the case of Colorado potato beetles infected with B. bassiana. Positive and negative geotropism, alter mating and behavioral fever was also observed after fungal infection (Noma & Strickler, 2000). Sometimes, insect change its body temperature by bathing in sun or by moving to warm surfaces viz response of grasshoppers and locusts in infection of Metarhizum and Beauveria (Blanford & Thomas, 2001). This phenomenon is also called as “Behavior fever”. Insects infected with entomopathogens were killed within 2-15 days mostly depending upon species and strains of fungi (Boucias & Pendland, 1998). In high humidity conditions, fungi produce more hyphae after the death of insect and produce conidia on the surface of insect and serve as saprophytic fungi (Sun et al., 2003; Shimazu, 2004) while in dry conditions, fungi produce conidia in the body of insects (Hasan, 2014; Yang, Tian, Liang, & Zhang, 2007).

Spore producing entomopathogens frequently produce spore after the death of their host. For example, Strongwellsea castrans produces abdominal holes in flies and produced spores after the death of insects. Entomophthorales discharge their spores by force from an infected cadaver to spread their spores to new hosts for pathogenicity (Luz & Fargues, 1998; Eilenberg & Meadow, 2002). Fungi use different strategies to fight with their host. For example, members of Hyphomycetes produce spores in abundance and disperse them by rain, wind, and invertebrates. The wind is most effective in spore distribution from the hyphae bearing conidia out of the insect

cadaver. The spread of disease is faster if the fungi cause infection in different stages of insect. For example, a disease in insect populations increased by infected winged insects (Dromph, 2001; Steinkraus, Howard, Hollingsworth, & Boys, 1999).

1.12 Distribution of Entomopathogenic fungi Distribution of individual species of entomopathogenic fungi is a broadly spread component of most terrestrial ecosystems. Though, some species of entomopathogenic fungi can be found practically all over the world such as many species of B. bassiana are reported from rainforest (Aung et al., 2008). B. bassiana has been found in Canada as far north as latitude 75° (Widden & Parkinson, 1979). These fungi have been also found from north of the Arctic Circle. Many species of Tolypocladium cylindrosporum and B. bassiana have found in Norway (Klingen, Eilenberg, & Meadow, 2002), and Isaria farinosa, B. bassiana and M. anisopliae in Finland (Vanninen, 1995). Insect-associated fungi have been recently reported from Antarctica and Arctic Greenland (Eilenberg, Schmidt, Meyling, & Wolsted, 2007). Some cosmopolitan fungi belong to the genus Lecanicillium, Beauveria, Neozygites and Conidiobolus have been found on Antarctic sites, but without their arthropod hosts (Bridge, Clark, & Pearce, 2005).

Many insects-associated mycoflora could be found from soil and ground environment (Sosnowska et al., 2004). A rich and diverse insect pathogenic fungal species were found from humid tropical forests and majority of species belong in the genus Cordyceps (Ascomycota: Hypocreales) (Aung et al., 2008). Even though the fact that both M. anisopliae and B. bassiana are frequent in all places but B. bassiana is very susceptible to the interruption effects of cultivation and hence limited to natural habitats. The capability of M. anisopliae to survive in cultivated soils is well recognized (Quesada-Moraga, Navas-Cortes, Maranhao, Ortiz-Urquiza, & Santiago- Alvarez, 2007; Rath, Koen, & Yip, 1992; Sanchez-PeNa, Lara, & Medina, 2011; Vanninen, 1996).

Many studies showed that frequency of insect-associated fungi in intensively cultivated soil is less as compared to forest soils (Bałazy, 2004; Chandler, Hay, & Reid, 1997; Mietkiewski et al., 1991; Vanninen, 1995). On the other hand, the diversity of entomopathogenic fungi in the temperate forests is quite high as compared to agricultural areas (Sosnowska et al., 2004). The variations in their

diversity and prevalence of species were also observed among the different types of forests (Chandler et al., 1997; Mietkiewski et al., 1991). Entomopathogenic fungi are frequently present in populations of insect hosts but when the density of the host population is normal infections occur periodically. Insect-associated fungi increase their numbers to multiply in the environment and contribute to the reduction of insect‟s population during the outbreak of insects (Fuxa & Tanada, 1987).

1.13 Pathogenicity of entomopathogenic fungi A number of insect-associated fungi are known to be quite effective against whitefly both in vitro and in vivo (Lacey et al., 1996; Carruthers et al., 1993; Osborne & Landa, 1992). Isaria fumosorosea proved to be highly destructive to the young instars of the insects (Wraight et al., 1998, 2000). Likewise, B. bassiana showed 52- 98% dead rate of B. tabaci when applied @ 1-4x 10 6 mL-1 (Eyal et al., 1994; Nagasi et al; 1998). The mortality rate is depends on the stage of the insect (ElKatatny, 2010; Anand & Tiwary, 2009; Inglis et al., 2001; Angel-Sahagun et al., 2005; Daniel & Wyss, 2009) and nymphs are more susceptible as compared to the adults (Easwaramoorthy, 2003). Suffering from the insects is inversely proportional with the age of the insects (Dayakar & Kanaujia, 2003; Legaspi et al., 1998). Parasitism is also a variant in different strains of species (Lin et al., 2007) apart from dose rate of application (Anand & Tiwary, 2009; De Assis et al., 2002). The adults of whitefly are found to be a natural carrier of Zoophthora and Conidiobolous (Gindin & Ben-Ze‟ev, 1994; Silvie & Papierok, 1991). Host specificity of B. bassiana is very interesting as its characters distinguish it from other species. B. bassiana is virulent against nymphal and adult stages of B. tabaci (Rehner & Buckley, 2005). Strains of B. bassiana isolated from Heteropteran host found highly virulent as compared to some commercial products of B. bassiana viz Mycotrol. Commercial products are not able to adapt to the specific host and hot dry conditions of the environment (Steinkraus & Tugwell, 1997). In whitefly, the second instar is most susceptible to B. bassiana infections (James et al., 2003) and most widely studied pathogen affecting whiteflies. Isolates of B. bassiana take about seven to ten days to see pest reductions and over 90% mortality rates have been documented in laboratory studies (Vicentini, Camparoto, Teixeira, & Mantovani, 2001). Although similar results have been replicated in the field (Jaronski & Lord, 1996; Wraight & Bradley, 1996; Liu et al., 1999; Wraight & Carruthers, 1999), B. bassiana is usually combined with other

control agents to achieve similar levels of mortality (Naveed et al., 2008). The choice of B. bassiana as the strain to produce commercially was influenced by the greater conidia mass production potential as compared with other strains of entomopathogens against whitefly (Wraight et al., 2001). Akey and Henneberry, (1998) reported considerably suppressed populations of large B. tabaci nymphs with the treatment of Naturalis-L (B. bassiana strain JW-1), Mycotrol, and PFR-97 in Arizona on cotton plants. On the other hands, applications of Mycotrol by other workers in Southern Texas and the Imperial Valley observed no efficient control of whiteflies in cotton (Liu et al., 1999; Wraight & Bradley, 1996).

Several products based on mycopathogens have been commercialized in different parts of the world (e.g. Mycotal and Vertalec) against whitefly, mites and other canopy plant pests (Charnley & Collins, 2007). Lecanicillium spp. has been widely used against various arthropod pests in different parts of the world and at least 15 products based on Lecanicillium spp. have been commercialized (Faria & Wraight, 2009). L. muscarium caused mortality ranging between 89-96% of whitefly eggs, first, second, and third instar nymphs when spore solutions suspended in water and sprayed onto leaves (Ali & Ren, 2009). Though, eggs, and adults of whitefly are comparatively resistant to infection (Gindin, Geschtovt, Raccah, & Barash, 2000). Zare et al. (2001) have isolated two different species of Lecanicilum spp. that have greater efficiency in reducing whitefly densities: Lecanicilum muscarium, Lecanicilum lecanii and these species were commercially used as Mycotal and Vertalec (Cuthbertson et al., 2005). According to Nier et al. (1993), the pathogenicity of V. lecanii against nymphs of B. tabaci at the concentration of 3.2 x 106 conidia mL- 1 gave 91-100 % mortality, respectively, but a suspension containing 1 x 107 conidia mL-1 resulted in the infection rate of 78 %. Some fungicides are harmful to L. muscarium and should not be used at the same time with this pathogen (Shah et al., 2003). Faria and Wraight, (2001) studied that V. lecanii + boverin (Beauveria bassiana) gave 98 % mortality of whitefly. Similarly, Beauveria high-pressure hydraulic and tractor mounted air blast sprayers were less efficient and gave 65-80% mortality of whitefly (Wraight & Carruthers, 1999; Wraight & Bradley, 1996; Jaronski & Lord, 1996; Liu et al., 1999). In Southwestern Florida, Liu et al. (1999) reported that tomatoes and eggplants treated with Mycotal (V. lecanii) showed no reductions in whitefly nymphs. However, these researchers observed 40-50%

infection of whitefly pupae. The diverse studies for bioassays with insect-associated fungi showed that its nymphal stages are highly vulnerable including B. bassiana (Al- Deghairi, 2009; Vicentini et al., 2001; Ramos, et al., 2000), L. muscarium (Fatiha, Ali, Ren, & Afzal, 2007), I. fumosorosea (Fiedler & Sosnowska, 2007) and I. amoenoroseus (Candido, 1999).

Metarhizium anisopliae (Metschnikoff) Sorokin, another very important fungus was first time studied against scarab beetle Anisoplia and infects more than 200 insect host species (Moore & Prior, 1993; Zimmermann, 2007). Different strains of M. anisopliae consist of white colored mycelium and egg to oval shaped conidia depends on the variety. Since the discovery of M. anisopliae, much work has been done to control Orthoptera, Lepidoptera and Coleoptera (Goettel & Inglis 1997; Stephen et al., 1996). It is extensively used as possible biological insect control agents (Lacey, et al., 2001) against B. tabaci, coconut beetle, termite, grasshoppers and rice bug termite ( Loc et al., 2005; Chinh et al., 2001; Thuy et al., 2001).

Along with well known entomopathogenic fungi, some of Fusarium species were also reported as insect-associated fungi and also exist as the saprophyte on dead insects (Sun et al., 2008; Teetor-Barsch & Roberts, 1983). Some entomopathogenic Fusarium species have been studied to cause moderate to high levels of infection, mostly against dipterous and homopterous insects.

Though, many other Fusarium species have also been observed to create low to moderate levels of infections on other different orders of insects (Lepidoptera and Coleoptera) (Teetor & Roberts, 1983). Several species of entomopathogenic Fusarium mostly kill their host insects through the action of toxins produced by penetrating hyphae ( Gupta, Krasnoff, Underwood, Renwick, & Roberts, 1991). Like Fusarium, Trichoderma species were also isolated from insects. Recently, Trichoderma longibrachiatum has been reported from Cowpea aphid, Aphis craccivora (Ibrahim, Hamieh, Ghanem, & Ibrahim, 2011). T. longibrachiatum showed pathogenicity against Leucinodes orbonalis, one of the major pests of brinjal (eggplant, Solanum melongena) (Gosh & Pal, 2016). The entomopathogenic effect of T. longibrachiatum has been reported a few years ago on naturally infected cowpea aphid (Aphis craccivora) and whitefly (Ibrahim et al., 2011). Aspergillus is known as saprophyte but it was also isolated from insects and showed mortality against different

insects. Aspergillus flavus and A. clavatus showed mortality against Aphids (Seye et al., 2014), A. ochraceus, A. kanagawaensis and one strain of A. sulphureus showed mortality against Aedes fluviatilis (Moraes et al., 1998) and A. terreus against ticks (Suliman & Muhammed, 2012).

In Iraq, some other fungal species including Penicillium sp., and Alternaria alternata were first time isolated from Sunn pest (Eurygoster integriceps) (Assaf et. al., 2011). The fungi produce toxins such as penicillic acid that can infect insects (Tanada & Kaya, 1993). da Costa, et.al. (2003) used two strains such as Penicillium corylophilum and Aspergillus giganteus, for bioassays in the second and fourth nymph‟s stage of Triatoma infestans and Panstrongylus megistus. Studies revealed that A. giganteus was pathogenic and caused 50% mortality of the nymphs of the two species tested with exception of the nymphs of the fourth stage of P. megistus. Another fungus Clonostachyus rosea was recently isolated from insects. Toledo, et al. (2006) first time reported that C. rosea showed pathogenicity against two leafhoppers pest, Sonesimia grossa and Oncometopia tucumana (Hemiptera: Cicadellidae) in Argentina. C. rosea caused 82.5% mortality of O. tucmana after 14 days by inoculation but showed 12.5% mortality of the dead insects.

In Pakistan, no remarkable work has so far been done to control the insects through biological methods. The different local isolates of entomopathogenic fungi have been isolated from different insects (Husnain et al., 2014). Locally, the pathogenicity of entomopathogenic fungi against whitefly has been evaluated by Husnain et al. (2014) and Shahid et al. (2003). Nasir and Perveen (2001) isolated thirteen genera of entomopathogenic fungi from whitefly species. Alternaria, Aspergillus and Cladosporium were the predominant fungal species. Among these isolates, Paecilomyces fumosoroseus and M. anisopliae proved pathogenic against whitefly.

The virulence capability of pathogenic fungi upon eggs is established but very little is known about eggs (Hajek & St. Leger, 1994). Little infectivity of the insect eggs is shown by B. bassiana (Ramos, 2000), Isaria famosorosea (Candido, 1999; Lacey et al., 1998), I. farinosus (Negasi, Parker, & Brownbridge, 1998) and L. muscarium (Meade & Byrne, 1991). Eggs show relatively high resistance as compared to other stages of insects (Al-Deghairi, 2009; Abdel-Baky et al., 2008). The

vulnerability of eggs increases when the pathogen is applied at a high dose of conidia (Al-Deghairi, 2009). High population density of whitefly is not at all a requirement for transmission of the virus as even a single adult is able to transmit the geminivirus (L. Hilje, pers. comm.). In recent times, there has been a growing interest in increasing the production of chitinase using recombination DNA technology as it provides a better option for higher yields, cost efficient, and easy enzyme production (Adrio & Demain, 2010). Fungal chitinases have been applied for biological control of insect pests on transgenic plants either alone or in combination with other insecticidal proteins (Matsumoto, 2006). Therefore, fungal hydrolytic enzymes such as chitinase through transgenic approach are possible agents for the biological control of plant pathogens such as whitefly that cause various diseases.

1.14 Chitinases In recent years several investigators have suggested that entomopathogenic fungi producing chitinase may be utilized as an effective organic control agent against whitefly. It is due to the cuticle of whitefly group comprises mostly of chitin. It is important to mention that the fabrication of chitinases is applied as a decisive factor for the collection of possible bio-control agent aligns to insects. For the biological control of various insects, microbial chitinolytic enzymes are considered very significant in this regard as they have the ability to impede chitin evidence. For the expansion of potential bio-control agents of insects, the role of fungal chitinases is important and it composes a good armory of various proteins which is suitable for it.

Chitin, a poly-β-1, 4-N-acetylglucosamine, is a rich sustainable organic source and one of the main structural machinery of the cell wall of various plant pathogenic fungi moreover of cuticles and shells of arthropods, insects, mollusks and crustaceans (Gooday, 1990; Mathur & Narang, 1990). The main component of insect cuticle is chitin. Gravimetric investigation showed that the chitin substance comprises up to 40% of the exuvial parches mass relying on the insect classes. It differs significantly with the several cuticle varieties even in a sole organism (Kramer, Hopkins, & Schaefer, 1995). Chitin is formed in the exo and endocuticle, unsclerotized procuticle but it is not created in the epicuticle, the peripheral section of the integument (Andersen, 1979). It works as a moderate but automatically sturdy substance and it is constantly connected with cuticle proteins which mostly established the mechanical stuff of the cuticle (Hojrup et al., 1986). Chitin consists of 22-44% of cell wall

substance of fungi and it is crucial for preserving the systemic reliability of hyphae (Peberdy, 1994). There are two allomorphic types of chitin, namely, α-chitin and β- chitin that vary in stuff and polarities of adjoining sequences in consecutive sheets (Aam et al., 2010; Chen, Shen, & Liu, 2010). Fungal cell walls hold α-chitin. The insect cuticle is fabricated of crystalline chitin nanofibers in proteins, lipids matrix, and polyphones that provide as a physical fence against pests and diseases (Vincent & Wegst, 2004). Pathogens that may pierce the gut and contaminate it should enter this chitin-rich wall (Shen & Jacobs-Lorena, 1997; Sampson & Gooday, 1998; Howell et al., 2005).

Chitinases are the enzymes that hydrolyse a linear polymer of chitin substrate while chitin is polysaccharides of N-acetylglucosamine units. N- Acetylglucosamine is linked together beta 1-4 linkage. Chitin has large molecular intricacy, mass insolubility, and heterogenous formation. A different type of microorganisms like fungi and bacteria are responsible for degradation of chitin by producing specific extracellular enzymes through hydrolyses (Cottrell, Moore, & Kirchman, 1999). Chitinases are found in a large number of organisms including plants (Salami, Ebadi, Naghavi, & Dry, 2008), insects (Merzendorfer, 2003), bacteria (Ningthoujam, Sanasam, Tamreihao, & Nimaich, 2009) and fungi (Rattanakit, Yano, Plikomol, Wakayama, & Tachiki, 2007). Chitinases performed the different function in different organisms. They are involved in parasitism in bacteria (Sorbotten et al., 2005; Ningthoujam et al., 2009), defense in plants and invertebrates (Salami et al., 2008), the decay of old cuticle in insects (Patil et al., 2000; Dahiya et al., 2006). While in fungi, they are involved in nutrition, morphogenesis, and parasitism (Duo-Chuan, 2006).

Chitinases are classified into two major families viz family 18 and family 19 on the basis of their catalytic domain as well as due to the sequence of amino acids. Family 18 contain chitinases from animals, fungi, bacteria, viruses and few plants while chitinases of family 19 belong to plants and Streptomyces griseus (Patil et al., 2000; Dahiya et al., 2006). All chitinases hydrolyze the structural chitin and cell wall morphogenesis occur (Sahai & Manocha, 1993). The proteins having antifungal and insecticidal activity against different pathogens were detected in plants (Melchers et al., 1994; Neuhaus & Spangenberg, 1990).

1.14.1 Fungal chitinases A great number of genes encoding chitinases have been studied and scrutinized from a broad diversity of fungi as well as yeast and filamentous fungi such as Saccharomyces cerevisiae (Kuranda & Robbins, 1991), Thermomyces lanuginosus (Palanivelu & Lakshmi, 2013), Aspergillus nidulans (Ulbrich et al., 1998) Apanocladium album (Blaiseau & Lafay, 1992), Rhizopus oligosporus (Takaya, Yamazaki, Horiuchi, Ohta, & Takagi, 1998), Trichoderma harzianum (Viterbo, Haran, Friesem, Ramot, & Chet, 2001), and Gliogladiumroseum (Gan et al., 2007). Chitinases of fungi have the similar role as bacterial chitinases but these are also needed to break the cell walls when regular cells divide (Li & Greene, 2010). These are also engaged in mycoparasitism (Duo-Chuan, 2006). Fungal chitinase belongs to the family 18 of the glycosyl-hydrolase superfamily (Suzuki, 1999) and has a high amino acid homology with class III plant chitinases (Hayes et al., 1994). There are 5 domains of family 18 of fungal chitinases namely catalytic, N-terminal signal peptide region, Chitin binding domain, serine-threonine and C-terminal extension. The peptides present at N-teminal provide signals to the protein for secreting of the protein from the cell through secretary pathway. After secretion through the cell membrane, the signal peptide releases the outer protein. The intracellular proteins do not have this kind of chitinase domain and continue to work throughout morphogenesis (Seidl, Huemer, Seiboth, & Kubicek, 2005; Takaya et al., 1998). The most important domain is the catalytic one and is involved in the hydrolyzation of chitin. Broadly speaking, there are endochitinase and exochitinase in fungi (Novotna, Fliegerova, & Simunek, 2008). Endochitinases cut randomly and produce soluble molecular of N- acetylglucosamine, chitotriose, chitotetraose and di-acetylchitobiose. Exochitinases are further divided into two groups including chitobiosidases which act on di- acetychitobiose from the non-reducing end and 1-4 beta-N-acetylglucoseaminidases that act on oligomeric products of endochitinases as well as chitobiosidases monomers of N-acetylglucosamides units (Cohen-Kupiec & Chet, 1998; Novotna et al., 2008).

1.15 Applications of chitinases Chitinases have received major consideration because of their broad range of applications (Dahiya, Tewari, & Hoondal, 2006) because they are involved in fungi for formation of protoplasm (Kitamoto, Mori, Yamamoto, Ohiwa, & Ichikawa, 1988),

bio-control of plant pathogens and insects (Gupta, Saxena, Chaturvedi, & Virdi, 1995; Jobin, Couture, Goyer, Brzezinski, & Beaulieu, 2005; Shanmugam, Thakur, & Gupta, 2013; Vaidya, Shah, Vyas, & Chhatpar, 2001; Yuan & Crawford, 1995). Chitinase can be used to increase transgenic fungal resistance to plants carrying a chitinase transgene (Baranski et al., 2008; Distefano et al., 2008; Shah et al., 2009; Xiao-Jing et al., 2005). Chitinases have been used for the production of single cell protein for aquaculture and animal feed and also act as inhibitors and bio-pesticides (Patil et al., 2000). Chitinases are also useful as antimicrobials, used for the production of single cell proteins, food preservation, blood cholesterol control and wound healing (Karthik, Akanksha, Binod, & Pandey, 2014).

1.16 Pathogenicity of Fungal Chitinases Entomopathogenic fungi were used to manage the whitefly and fungal bioassay showed virulence against nymphal and adults‟ stages of B. tabaci (Wraight et al., 2000; Wraight et al., 1998). Chitinases from insect-associated fungi can be used to develop transgenic plant and increase fungus virulence against whitefly. Over- expressions of the chitinase gene Bbchit1 from the Beauveria bassiana in transgenic B. bassiana can signiﬁcantly increase the pathogenicity of B. bassiana strain for whitefly and aphids. Bioassay of Bbchit1 gene showed that that over production of endochitinase Bbchit1 increased the infection eﬃciency of B. bassiana in aphids and accelerates infection as compared to the values for the wild-type strain (Fan et al., 2007). The entomopathogenic fungus M. anisopliae genome encodes different chitinase. Fungus strains, when over-express Chit2 gene increases the effectiveness to kill its host, the cotton strainer bug Dysdercus peruvianus. While the fungal strains that lack gene encoding Chit2 showed decrease pathogenicity towards insects (Boldo et al., 2009). Entomopathogenic fungus, M. anisopliae encode Chit42 gene and showed insecticidal activity against silkworm B. mori, the Asian corn borer and Ostrinia furnacalis (Li et al., 2012).

B. bassiana and M. anisopliae have the variety of chitinases (Bhanu et al., 2012; Fang et al., 2005). M. anisopliae encode Chit2 gene which causes pathogenicity of transgenic isolates through silencing and over-expression of chitinase gene (Boldo et al., 2009). Isaria fumosorosea produces quite an efficient chitinase to break the insect cuticle (Ali, Wu, Huang, & Ren, 2010). Chitinase gene Ifu-Chit1 obtained from

I. fumosorosea and transgenic B. bassiana resulted in enhancing virulence against the moth, Dendrolimus punctatus as compared to its wild strain type (Qiang et al., 2009).

Entomopathogenic fungus V. lecanii is a very promising bio-control of aphid and whitefly. V. lecanii release chitinase that has significant potential in the biological control of some insect pests. Similar to other insect-associated fungi, V. lecanii secrete chitinase that has the ability to degrade the cuticle of different insects successfully, and this feature highlights the bio-control potential of V. lecanii to insect pests (Fang et al., 2005). Though chitinase of V. lecanii has a significant role in the biological control of many insect pests but only two chitinase genes from V. lecanii have been isolated up till now (Zhu et. al., 2008). An endochitinase gene Vlchit1 from V. lecanii was cloned and overexpressed in E. coli. Enzymatic activity assay and overexpression test showed that the Vlchit1 is a functional enzyme. This enzyme can hydrolyze the chitin substrate and the Vlchit1 gene might be functional gene source for genetic manipulation and constructing new transgenic plants with resistance to different insects and fungal pests (Zhu et al., 2008).

The role of chitinase in plant defense against fungal attack has been very well documented (Lawrence & Novak, 2006; Adams, 2004). Genes encoding for fungal and plant chitinases are very efficient to control a large number of plant pathogenic fungi, which are major pathogens leading to crop loss by the production of transgenic plants loss (Saiprasad et al., 2009; Bolar et al., 2000; Lorito et al., 1998). Several classes of genes have been used in a genetic engineering to develop resistance in cotton to fungal pathogens but there is no data available concerning the transgenic approach of chitinase genes against insects. In the last two decades, efforts have been made by the transgenic expression of plant fungal chitinase in crop transgenic plants (Fierens, 2005). These data led to the suggestion that combines expression of antifungal genes could be an effective approach to engineering enhanced crop protection against fungus and insects (Zhu et al., 1996).

An intensive consideration of different aspects of fungal chitinase, ranging from protein functions to biochemical features, gene regulation and substrate-binding properties of various chitinases, will be required for the improvement of chitinase research toward latest biotechnological application (Okay, 2005). However, fungal chitinases are 100 times more active as compared to plant enzymes. Fungal chitinases

are very effective on a wide range of pathogens and nontoxic to plants even at high concentrations (Lorito et al., 1998). Consequently, fungal chitinases are considered as the best option for production of transgenic plants against whitefly (Fierens et al., 2005; Saiprasad et al., 2009; Zhu, Chen, & Li, 1996).

1.17 Plants Transformation In 1984, plant transformation was first described in tobacco (De Block, Debrouwer, & Moens, 1997; Fraley et al., 1984; Paszkowski et al., 1984). Rapid developments in transformation technology have resulted in the genetic modification of different plant species. Different methods are used to introduce gene into plant cells such as direct gene transfer into protoplasts (Neuhaus & Spangenberg, 1990; Karesch et al., 1991), Agrobacterium tumefaciens-mediated transformation (Zupan & Zambryski, 1995; Tepfer, 1990; Sun et al., 2006; Hooykaas & Schilperoort, 1992) and particle bombardment (Chu et al., 2006; Seki et al., 1991; Christou, 1992; Birch & Franks, 1991).

In Agrobacterium-mediated transformation system, different factors are involved that play a crucial role in expression. Recently, the expression of different Agrobacterium virulent and avirulent strains has been studied (Anand & Mysore, 2007; Gelvin, 2003; Tzfira & Citovsky, 2002). The transformation strategies have their own limitations which include the limited expression of the particular gene (Jiang et al., 2003; Ditt et al., 2001) and phenotypic appearance as a result of T-DNA insertion (von Mering et al., 2002; Stephens & Banting, 2000). As far as easy and faster transformation of a gene is concerned, VIGS is better than others and is practically adopted for transient expression of chitinase genes in plants.

1.18 Virus-induced Gene silencing VIGS, virus-induced gene silencing is a classic response of plants against infectious viruses. It is a mechanism in which plants protect themselves against the invasion of any foreign gene by RNA-mediated post-transcription (Baulcombe, 1999). In addition to the VIGS‟s useful understanding in plant defense, it has also emerged as a functional genomics tool to knock-out the expression of desired plant genes in few model plants (Ekengren, Liu, Schiff, Dinesh‐Kumar, & Martin, 2003; Holzberg, Brosio, Gross, & Pogue, 2002; Peart et al., 2002; Sharma & Johri, 2003; Yoshioka et al., 2003). It is also used to identify the specific phenotype in forward genetics (Lu et

al., 2003). Vectors based on plant viruses carried homologous plant sequences of endogenous plant genes by triggering gene silencing through homology-dependent degradation of RNA mechanism commonly known as RNA silencing. The dsRNA replication intermediate derived from the virus would be processed so that the small interfering RNA (siRNA) in the infected cell would correspond to parts of the viral vector genome, including any non-viral insert (Baulcombe, 1999). The siRNA targets RNase complex of the corresponding host mRNA if the insert is from host cell while symptoms of the infected plants reflect the loss of functioning of host gene functioning (Lu et al., 2003; Voinnet 2001; Yoshioka et al., 2003).

1.18.1 Vectors for Viral Induced Gene Silencing Viral-based vector targets specific regions of the plant cell where viral vector move systemically. The majority of viral vectors is responsible for silencing travel in the plants through the phloem in the vascular tissues to most parts of the plant, but still few of them may reach the meristematic tissues (Peele et al., 2001). Viral binary vectors are developed based on the specific features of viruses. These features make them efficient and specific in their expression in different parts of plants, its safety for individuals and the environment and expression of basic cellular functions. So far, more than 30 different VIGS vectors have been developed based on the genome of different viruses and these vectors have been used in the study of different metabolic pathways, gene functions, basic functions of cell, microbial interaction, developmental biology and abiotic stress (Purkayastha & Dasgupta, 2009; Becker & Lange, 2010). VIGS can be used to study plant resistance against bacteria and many new genes in the pathway of the Pto-mediated defense response against Pseudomonas syringae have been discovered in tomato, i.e., MEK1, NPR1, TGA2.2, MEK2 and NTF6 (Ekengren, Liu, Schiff, Dinesh‐Kumar, & Martin, 2003 ; Zhuo et al., 2011). The roles of WIPK, NbHSP90c-1, SIPK and NbHSP70c-1 genes in non-host resistance to P. cichorii, and SGLP resistance against Ralstonia solanacearum, have been studied through VIGS in tobacco plants (Sharma et al., 2003; Kanzaki et al., 2003). The function of COR, a virulence factor of P. syringae, was also revealed by VIGS and function of SlALC1 and SGT1, two key genes in the jasmonate (JA) pathway and resistance against P. syringae have been discovered (Chandok, Ekengren, Martin, & Klessig, 2004).

VIGS has also been widely used to study the resistance of plants to herbivore attack, nematode, and aphids such as Manduca sexta. Various genes have been reported to have significant roles in resistance against aphids and nematodes. Suppressing germin-like jasmonate resistant4 (JAR4) and threonine deaminase (TD) through VIGS confirmed that these genes have important roles in activating plant defenses to M. sexta (Kang et al., 2006). MPK2 and MPK1 which are necessary components of the systemic signal pathway were studied through VIGS to be required for successful defense against herbivorous insects (Kandoth et al., 2007). VIGS is being used to evaluate the function of genes chosen by a wide variety of criteria; including expression pattern, sequence homology, and chromosome position and in systems where throughput is high enough, genes selected at random.

VIGS acts as transient assay and facilitate the study of genes which, if lost may turn out to be lethal in plants. Many expressions vectors are under use for commercial protein production in the pharmaceutical industry (Tuttle et al., 2008; McCormick et al., 1999). The Viral vector transfection system helps to regulate the overproduction of metabolites and proteins that were likely going to be harmful if added by conventional means of transformation (Kumagai et al., 1995). In N. benthamiana plants, the over-expression of phytoene synthase led to a ten times increase in phytoene accumulation in plants (Kumagai et al., 1995). Similarly, in Capsicum species over-expression of a capsanthin-capsorubin synthase gene led to the production of capsanthin, a carotenoid that is not normally found in N. benthamiana. The capability to readily express non-endogenous genes opens up a wide range of possibilities that cannot be matched by gene knockout technologies alone (Chen et al., 2005; Liu et al., 2004).In Petunia hybrida and tobacco plants, different flower development related genes including floral organ identity genes (AP3) (Liu et al., 2004; Kramer et al., 2007), flower development genes (PhPHB2, NbMADS4-2, PhPHB1, NbMADS4-1) (Chen et al., 2005; Dong et al., 2007) and flowering time determine genes (FCA and FY) have been identified by using VIGS.

Bouvier et al. (2006) observed that VIGS was very helpful to suppress the expression of SAMT1 in N. benthamiana and suggested that this methylation-related protein has an important role in plant development. These results recommend that VIGS is one of the most powerful tools for the analysis of genes whose loss-of-

function mutants cause embryonic and seedling-lethality (Robertson, 2004).VIGS has many advantages over most established functional genomics tools (Pfieger et al., 2008; Stratmann & Hind, 2011; Unver & Budak, 2009; Burch-Smith et al., 2004; Purkayastha & Dasgupta, 2009) such as to avoid plant transformation viz functional characterization of genes with difficulties in transformation would be easier once the VIGS system is established in that species (Burch-Smith et al., 2004), faster in producing loss of functional phenotype of a specific gene in short time (Dinesh- Kumar, Anandalakshmi, Marathe, Schiff, & Liu, 2003), overcome functional redundancy (Ekengren et al., 2003; He et al., 2004), allows functional analyses of gene and measuring the seeding vigour and embryotic development (Liu et al., 2004; Burch-Smith et al., 2004; Ratcliff et al., 2001).

The present study was designed to isolate different fungi from dead Aphis gossypii from family Aphididiae, Bemisia tabaci from family Aleyrodidae and cotton mealy bug from family Phenacoccus solenopsis from suborder Strenorrhyncha of Order Hemiptera collected from the cotton zone, hot arid zone and central mixed zone of Punjab, Pakistan. All isolated insect fungi were characterized morphologically by different characters like colony growth, hyphae and conidia shape and side. The insect fungi were characterized genetically by amplifying their internal transcribed spacer region (ITS) followed by phylogenetic analysis. Their occurrence diversity was studied in different agroecological zones and the virulence of indigenous insect- associated fungi were analyzed against 4th instar nymphal and adult stages of B. tabaci by applying different conidial suspension. Further, Chitinase genes were amplified, cloned and sequenced from promising strains of entomopathogenic fungi. Characterization of genes was done by finding their open reading frames; chitin hydrolysis domain, binding motifs, and their active sites. Chitinases were also expressed in plants by using virus-induced gene silencing vector modified from the Cotton leaf crumple virus (CLCrV) and chitinase activity was also observed using chitinase assay kit. Transformed plants were bioassayed against 4th instar nymphal and adult stages of B. tabaci.

Chapter 2

METHODOLOGY

2.1 ISOLATION AND MORPHOLOGICAL CHARACTERIZATION OF FUNGI 2.1.1 Survey and Sampling A detailed survey of cotton fields for the collection of natural dead insect samples was carried out in different agroecological zones of Punjab, Pakistan. These agroecological zones include; (1) Hot arid Zone, (2) Central mixed zone (3) Cotton zone (Anwar et al., 2012; 2015). Details of sampling localities in different agroecological zones are provided in Annexure 1. Directorate of Pest Warning and Quality Control of Pesticides, Punjab provided information about pesticides applications in different localities of three agroecological zones. Cotton fields with minimum pesticides application during the sampling season in each agroecological zone were selected for the collection of dead insects. Naturally dead Aphis gossypii from family Aphididiae, Bemisia tabaci from family Aleyrodidae and cotton mealy bug from family Phenacoccus solenopsis from suborder Strenorrhyncha showing fungal infection were collected from upper leaves from 3 to 4 feet above the soil level. Hand lens was used to observe the fungal infection during sampling of insects attached or hanging on leaves. Ten insect sample of each family from each locality were collected and carried separately in clean and sterilized sampling bags to the Lab. These insect samples were stored at 4°C until next use for the isolation of fungi associated with them. The members of culturable ascomycetes were main emphasis during this study.

Figure 2.1: Google map showing all localities of insect sampling in different agroecological zones

2.1.2 Isolation of fungi For the isolation of total fungi associated with sampled insects, the insect samples were surface sterilized with 1% sodium hypochlorite (NaOCl) followed by washing with autoclaved distilled water (Topuz, Erler, & Gumrukcu, 2016). After surface sterilization, the insect samples were placed on Sobauraud Dextrose Peptone Yeast extract agar media (SDAY) plates with 1 quarter strength (SDAY/4). The pH of media was adjusted to 6.5 and autoclaved at 121 °C temperature for 15 minutes. Detailed recipe of full length and quarter SDAY media is provided in Annexure 2. The antibacterial streptomycin (1 g) was added to the media when cooled down up to 40°C before pouring in Petri plates. Thirty mL of media was poured in each Petri plate. The insect samples were placed in the middle of SDAY media Petri plate and incubated at 25°C in control conditions incubator for 3 days. Total fungi on the insect body and along the body on media were purified in separate SDAY media plates.

2.1.3 Morphological characterization of fungi The isolated purified fungal colonies were allowed to mature and their morphological characters were observed. For the morphological characterization, pigmentation, exudates, colony color and colony reverse color; hyphal septation; conidia shape and size were studied. Different dichotomous keys (Samson 1974; Domsch et al., 1980; Goettel & Inglis, 1997; Humber, 2012) were used to identify the fungi at the species level. Further, these identified fungi were submitted to First Fungal Culture Bank of Pakistan (FCBP), Institute of Agricultural Sciences, University of the Punjab, Lahore Pakistan for the confirmation of identification and allocation of accession numbers.

2.2 MOLECULAR CHARACTERIZATION OF FUNGI Identification based on morphological characterization was confirmed by the amplification of internal transcribed spacer (ITS) region. Total DNA of fungi was extracted by modified CTAB method (Stenglein & Balatti, 2006). The fungi were grown on saboroud dextrose peptone yeast extract broth media for 3 days with continuous shaking at 150 rpm. The ingredient of media was same as mentioned previously for the isolation of fungi except for agar. The mycelium of fungi was filtered from broth media with Whatman filter paper no.1. Filtered mycelium was grind in liquid nitrogen using pestle and mortar to form fine powder and transferred to 1.5 mL tubes. Two hundred microliter of β- mercaptoethanol was added in already prepared CTAB (20 mL) buffer and kept at 65°C in the water bath. Pre-warmed CTAB plus β-mercaptoethanol (700 µL) was added to the tubes containing powder of fungal mycelium and incubated at 65 °C for half hour in the water bath. After incubation, 700 µL of Chloroform: Isoamyl (24:1) was added and mixed. The tubes were centrifuged at 13000 rpm for 10 minutes and 500 µL of the supernatant was transferred to newly marked eppendorf tubes. Isopropanol (500 µL) was added, mixed it 2-3 times and incubated at -20°C for 2 hours. The supernatant was discarded after incubation followed by centrifuging at 13000 rpm for 5 minutes. The pellet was washed with 70 % ethanol followed by centrifuging at 13000 rpm for 3 minutes. The pellet was air dried and resuspended 100 µL of 5% T.E buffer. DNA (5 µL) was run on 1 % agarose gel to check the quality of DNA. For the preparation of 1 % agarose gel, 0.7 gram agarose was added to 70 mL of 1X TAE buffer, boiled in the oven for 3 minutes and 3 µL ethidium bromide was added before solidification.

For the amplification of internal transcribed spacer (ITS) region, the concentration of genomic DNA was calculated using nanodropper (Thermo

Scientific) and diluted at the concentration of 50 ng/µl using M1V1=M2V2 formula (Chong, 2016). ITS1 and ITS4 primers were used to amplify the internal transcribed spacer region (White, Bruns, Lee, & Taylor, 1990) using Polymerase chain reaction (PCR). For PCR reaction, 25 µl reaction was made using 18.9 µl nuclease free water,

2.5 µl PCR buffer, 0.5 µL of 25mM MgCl2, 1 µl 10 mM dNTPs, 0.5 µl ITS1 primer, 0.5 µl ITS4 primer, 0.1 µl DNA Taq polymerase (5U/ µL, Thermo Fisher Scientific) and 2 µl DNA template. PCR conditions were used with the initial denaturation for 1 minute at 95°C, 35 cycles of denaturation at 95°C for one minute followed by 1 minute initiation at 50°C and 1 minute elongation time at 72°C temperature. Finally, the reaction was elongated at 72°C for 10 minutes. The PCR product was confirmed on 1 % agarose gel as compared to 1 kb ladder. Amplified PCR products were purified using QIAquick PCR purification kit (Qiagen, Valencia, CA, United States). Purified PCR products were sequenced from 1st BASE Malaysia using above- mentioned primer based on procedure (Sanger, Nicklen, & Coulson, 1977). Sequences were submitted to the NCBI database for the assignment of Genbank accession numbers.

2.2.1 Phylogenetic Analysis Different sequences of ITS region of the same fungal species were collected from NCBI. Alignment and determination of consensus sequences were carried out using BioEdit (Hall, 1999). Homologous sequences in the databases were searched using the Basic Local Alignment Search Tool (Altschul, 1997). The ITS sequences were retrieved from GenBank and the phylogenic trees were constructed using the neighbor-joining method in the MEGA6 software (Tamura, Stecher, Peterson, Filipski, & Kumar, 2013).

2.3 OCCURRENCE DIVERSITY The occurrence frequency of each isolated fungal species was calculated individually in all three agroecological zones by following modified formula described by Aung et al.( 2008). The occurrence of insect-associated fungi on three hosts Aphis gossypii, Bemisia tabaci and the cotton mealy bug was compared for each agroecological zone using Chi-square test.

No. of fungi A Occurrence frequency of fungi A = ------x 100 Total isolated fungi

Shanon diversity and Simpson diversity indices were also applied to observe the diversities of isolated fungi on Aphis gossypii, Bemisia tabaci and the cotton mealy bug in different agroecological zones (Hayek & Buzas, 1997). Evenness index was applied to find out the closeness of equability of individual fungal species present (Gotelli & Colwell, 2001) while Sorenson‟s Formula was applied to find the similarities in occurrences of species (Odum, 1971). The similarity ranges were from 0-1 (1= very similar, o= no similarity).

S= 2C/ (A+B)

S= Degree of similarity A, B = Numbers of fungal species at host/zone C= Common fungal species in both collections

2.4 VIRULENCE BIOASSAY OF ENTOMOPATHOGENIC FUNGI AGAINST BEMISIA TABACI

2.4.1 Maintenance of Bemisia tabaci Bemisia tabaci was maintained in glass cages on cotton plants. For the maintenance of B. tabaci, cotton plants were grown in the growth chamber at 25°C temperature and 50 % humidity with 12 hour dark and light intervals (Tuttle et al., 2008). When healthy cotton plants attained the height of 25 to 30 cm and 10 to 15 leaves per plant, these plants were shifted in the glass house at 25°C temperature and 50 % humidity. The adult B. tabaci biotype B (Zia, et al, unpublished) were collected from virus free cotton plants of insectary of Institute of Agricultural Sciences (IAGS) by self-modified aspirator and transferred to the healthy cotton plants in the glass house. The adults of B. tabaci started to feed on healthy cotton plants. After the period of 3 to 4 weeks, the heavy population of B. tabaci eggs, instars, nymphs and adults were observed with the hand lens on the underside of cotton leaves in the glass house. These cotton plants having eggs, instars and nymphs were shifted to the glass cages under the control condition of temperature 23-25 °C and humidity 40% to 50% with

light and dark periods in insectary (Tuttle et al., 2008). After 5 to 6 days, the adults of B. tabaci were observed which hatched from eggs, instars and nymphs. The adults of B. tabaci were fed on virus free plant sap and maintained their virus free population in glass cages. The old cotton plants were replaced with newly grown cotton plants after every 5 days interval in glass cages for permanent and uniform maintenance of B. tabaci culture. Hand lens was used for observation and routine inspection of plants in glass cages. The nymphs and adults of B. tabaci were collected from glass cages for further experimentation.

2.4.2 Spore suspension For the preparation of spore suspension, preserved cultures were revived on Sabouraud Dextrose Peptone Yeast Extract agar with quarter strength (SDAY/4) media plates. Fungal cultures were incubated for seven days at 28°C temperature for proper growth of fungus cultures. Spores were harvested from fungal plates by scratching and shifted into 15 mL conical centrifuge tubes containing 5 mL autoclaved distilled water. Tubes were labeled and vortexed to homogenize the spores. These spore suspensions were preserved at 4°C for further use.

2.4.3 Spore counting The spore counting was done by using hemocytometer. The hemocytometer was a thick crystal slide with the size of a glass slide (30 x 70 mm and 4 mm thickness). The hemocytometer had two chambers, upper and lower chambers for spore counting. Each chamber‟s counting grid was 3 mm x 3 mm in size. The grid had 9 square subdivisions of width 1mm. The central square was used for counting the spores. This square was splinted in 25 squares of width 0.2 mm (200μm). Each one of the 25 central squares was subdivided into 16 small squares. Therefore, the central square was made up of 400 small squares. The hemocytometer was washed by 100% ethanol and then by autoclaved distilled water two times before spore counting. Ten µl spore suspension were placed on hemocytometer and hemocytometer was placed on the microscope stage. Spores were counted mass per volume concentration and diluted up to 4x108 and 4x104 spores/mL-1 respectively and preserved at 4°C temperature till next use.

2.4.4 Spore viability To check the viability of spore suspensions, spore viability test was performed before using in virulence bioassay against B. tabaci. Each tube containing different spore suspension was vortexed to homogenize the spores and inoculated on SDAY/4 media plates followed by incubation at 28°C temperature and only viable spore suspensions showing germination were used for further experimentation.

2.4.5 Designing of virulence bioassay experiment For virulence bioassay, different fungal isolates were used in a group of the same genera for pathogenicity comparison. Two concentrations (4x108 and 4x104 mL-1) of spore suspension (Batta, 2012; Fan et al., 2014) were used for virulence bioassay against 4th nymphal and adult stages of B. tabaci.

For the infectivity of different spore concentrations of different fungal isolates, nymphal and adult stages of B. tabaci were selected (Kedar, Saini, & Kumaranag, 2014). For the nymphal stage, the cotton leaves from the upper surface were washed by autoclaved distilled water for removing the B. tabaci sugary secretions which cause sooty mold. The under surface of cotton leaves were observed under the stereomicroscope. The egg, nymph, pupa and adult of B. tabaci were present inside the surface of leaves. The eggs, 1st instar stage, 2nd instar stage, 3rd instar stage, pupal stage, and adult stage were removed except 4th instar stage from the leaf surface with the help of camel hair brush under the stereomicroscope. Five clip cages were fixed on 5 leaves containing 4th instar (nymphs) of B. tabaci. Five leaves containing 4th instar (nymphs) were inoculated by two fungal spore suspensions and replicated five times. Tween 20 (5%) was also added in spore suspensions as sticking material before the application of spore suspensions (Pelizza, Stenglein, Cabello, Dinolfo, & Lange, 2011). The leaves were tagged according to fungal spore suspension and their replicates. Five replicates of control were also applied for comparison. In control distilled water along with tween 20 (5%) were applied.

For the adult stage, the cotton leaves were washed satisfactorily by autoclaved distilled water and removed all the life stages of B. tabaci from the leaves and their sugary secretions. The clip cages were fixed on cotton leaves (figure 2.2) and adults of whitefly were shifted to these clip cages with the help of handmade transpirator. Leaves were inoculated by different fungal spore suspensions and replicated five

times. Five percent tween 20 were added in fungal spore suspensions before applying on leaves. In control distilled water along with tween 20 (5 %) were applied. All experiments were placed in the insectary at 30°C temperature and 55 % humidity with 12 hours light and dark period.

Figure 2.2: Clip cages used in experimentation for virulence bioassay of Bemisia tabaci

2.4.6 Data analysis Data regarding mortality rate in nymphs and adults of B. tabaci was observed after 24 hours intervals for 6 days by using modified Abbott‟s formula (Flemings & Ratnakaran, 1985).

Post-treated nymph/adult population in treatment pre-treated nymph/adult population in control Mortality (%) = 1------x ------x 100 Pre-treated nymph/adult population in treatment post-treated nymph/adult population in control

Statistical package Statistics 8.1 was used to for the statistical analysis of the recorded data. In different agroecological zones (hot arid, cotton and central mixed), occurrence diversity was compared using Chi-Squared test while in the case of virulence bioassay. The virulence bioassay data was subjected to Fisher‟s analysis of variance at 5 % probability. Means were separated by using the least significance difference (LSD) test at α: 0.05. Standard deviations represented in the tables and were calculated by means of MS Excel (Steel & Torrie, 1980).

2.5 ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM ENTOMOPATHOGENIC FUNGI Chitinase genes were amplified from different isolates of M. anisopliae, B. bassiana, B. brongniartii and T. longibrachiatum. Details of fungal isolates are given in Table 2.1. To isolate chitinase gene, genomic DNA was extracted through modified CTAB method (Stenglein & Balatti, 2006) as described previously and stored at - 20°C temperature in the refrigerator for next use.

Table 2.1: Detail of entomopathogenic fungi used in isolation of chitinase gene

Sr. Entomopathogenic Isolated From Tagged No Fungi As 1 Beauveria brongniartii Dead Bemisia tabaci of cotton Tn-09 field of IAGS, Lahore, Pak 2 Beauveria bassiana Aphid of cotton field, Tn-13 Bahawalpur, Pak 3 Metarhizium anisopliae Dead mealybug from cotton field Tn-16 of IAGS, PU, Lahore 4 Trichoderma Dead Bemisia tabaci of cotton SR longibrachiatum field, Sahiwal, Pak 5 Metarhizium anisopliae Dead Bemisia tabaci of cotton Tn-25 field, Layyah, Pak 6 Beauveria bassiana Dead Bemisia tabaci of cotton Tn-27 field, Layyah, Pak

2.5.1 Primer designing for the fungal Chitinases To design primers, different chitinase genes of M. anisopliae, B. bassiana and T. longibrachiatum from NCBI Genbank database were collected from previously isolated genomic DNA. Details of GenBank accession numbers are provided in Table 2.2.

Table 2.2: Chitinase GenBank accession no of M. anisopliae and B. Bassiana from NCBI Sr. No Genbank No. Total bp Sr. No Genbank No. Total bp M. anisopliae (Chit1) M. anisopliae (Chit2) 1 KF445082.1 1214 1 KF445082.1 1214 2 KF445078.1 1328 2 KF445078.1 1328 3 DQ011663.2 2133 3 DQ011663.2 2133 4 FJ609320.1 1382 4 FJ609320.1 1382 5 FJ609315.1 1443 B. bassiana (Chit1) T. longibrachiatum (Chit1) 1 GU073382.1 1047 1 GU180607 2084 2 JF834544.1 1052 2 HG931310 813 3 HQ435871.1 1047 3 KJ787130 1793 4 GU166156.1 1047 5 EU828354.1 1051

The sequences of two chitinase genes; Chit1and Chit2 for M. anisopliae, Chit1for B. bassiana and T. longibrachiatum were aligned using CLC sequence viewers 6 software and extra sequence were removed from both ends. Consensus sequences were used to design primers using Primer3plus online software (http://www.bioinformatics.nl/cgi-bin/primer3plus.cgi). Different sets of primers were designed separately for detection of chitinase genes and then amplification of partial length chitinase gene after confirmation. The list of designed primers is provided in Table 2.3.

Table 2.3: Set of different primers

Primers set for amplification of Chitinase gene Meta_Chit1_comp_F Forward 5′ TCCCATGTTCTGTACTCGTTC 3′ Meta_Chit1_comp_R Reverse 5′ CCCTTGCTCTTGAGGTAGGTAAC 3′ Meta_Chit2_Comp_F Forward 5′ GACAAGCACCCGGAGCGC 3′ Meta_Chit2_Comp_R Reverse 5′ CTTGCTTGACACATTGGTAA 3′ Buv_Chit1_Comp_F Forward 5′ TGGCTCCTTTTCTTCAAACC 3′ Buv_Chit1_Comp_R Reverse 5′ CGCCAAATGTCCAATTCTTG 3′ Tri_Chit1F Forward 5′ GCATCTGTGATTTTGCATAC 3′ Tri_Chit1R Reverse 5′ GCCAAGAGACTTGAGGTAAG 3′

2.5.2 Isolation of Chit1, Chit2 from M. anisopliae and Chit1from Beauveria and T. longibrachiatum For the isolation of Chit1and Chit2 chitinase genes from two isolates of M. anisopliae (Tn-16 and Tn-25) and of Chit1chitinase gene from two isolates of B. bassiana (Tn-13 and Tn-27) and one isolate of B. brongniartii (Tn-09) and T. longibrachiatum (SR). PCR was performed using Meta_Chit1_comp, Meta_Chit2_comp, Buv_Chit1_Comp and Tri_Chit1forward and reverse primers (Table 2.4). For the PCR, a reaction mixture containing 18.4 µL nuclease free water, 2

µL of 1x tag buffer, 1 µL of 10 mM dNTPs, 0.5 µL of 25 mM MgCl2 , 0.5 forward and reserve primer (conc. Of 10 pmole in 1 µL), 0.1 µL of Tag polymerase (5U/ µL, Thermo Fisher Scientific) and 2 µL of genomic DNA as template (50 ng/µL) were prepared. The PCR condition with initial denaturation of 95°C for a minute, 35 cycles at 95°C for a minute as denaturation time followed by different annealing temperature for the isolation of chitinase genes from M. anisopliae and B. bassiana (54°C for 1 minutes), Chit1from M. anisopliae (55°C for 1 minute), Chit2 from M. anisopliae (52°C for 1 minute), Chit1from B. bassiana and T. longibrachiatum (45°C for 1 minute) were used. The extension time for PCR reactions was for 2 minutes at 72°C temperature. Finally the reactions were extended for 10 minutes at 72 °C.

2.5.2.1 Ligation PCR products were purified from gel using Microgen purification kit according to the protocol provided by the manufacturer. Purified PCR products were ligated into pGEM T-easy cloning vector. For ligation, a master mixture containing 2 µL nuclease free water, 5 µL 2X ligation buffer, 1 µL pGEM T-easy vector and 1 µL DNA ligase enzyme were prepared. The concentration of PCR products were calculated using nanodrop and added into the ligation reaction at the ratio of 3:1 (insert: vector). The ligation reaction was spin down briefly and incubated overnight at 4°C temperature.

2.5.2.2 Transformation in E. coli (DH5α) The ligation products were transformed into DH5α strain of E. coli. Already prepared competent cells of E.coli vials thawed on ice and 10 µL ligation products were added to the competent cells, mixed slowly with the pipette and incubated on ice for 20 minutes. The cells were heat shocked at 42°C in water bath for 60 seconds and again placed on ice for 5 minutes. In each sample, 500 µL LB media were added and

incubated at 37°C with agitation in a shaker for one hour. After incubation, 200 µL of each sample was spread on already prepared LB plates containing ampicillin and X- gal and incubated overnight at 37°C temperature. White colonies were picked from plates, mixed in 5 ml of liquid LB media with 100 mg/ml ampicillin and incubated overnight at 37°C temperature with agitation on a shaker.

2.5.2.3 Plasmid isolation Fermentas GeneJet Plasmid Miniprep kit was used for plasmid isolation and bacterial cells were centrifuged at 5,000 rpm for 10 minutes and the supernatant was discarded while the pellet cells were stored at -20°C in the refrigerator until next use. The pellet cells were resuspended in 250 µL of resuspension solution and transferred to 1.5 mL tubes by decanting or pipetting. The 250 µL lysis solution was added to it and mixed 4-6 times followed by addition of 350 µL of neutralization solution and mixed immediately by inverting 4-6 times. The tubes containing cells were centrifuged at 12000 rpm for 5 minutes and 800 µL of the supernatant was transferred to the supplied spin column using a pipette. The tubes were again centrifuged for a minute at 12000 rpm and 500 µL of solution was added into it. This step was repeated for a second wash and empty columns were again centrifuged at 12000 rpm for a minute. The spin columns were transferred to new 1.5 mL tubes and 50 µL of already heated water at 60°C were added directly to the membrane without touching the membrane. It was allowed to incubate at 60°C for 10 minutes and centrifuged at 12000 rpm for 3 minutes. Spin columns were removed and tubes containing plasmids were stored at -20°C after proper labeling.

2.5.2.4 Restriction digestions Restriction analysis was performed to confirm the recombinant plasmids. The plasmids concentration was measured through Nanodrop and diluted up to 50 ng/mL. For restriction digestion, Thermo Fisher Fast digest restriction kit (Catalog No. 1991) was used. Restriction digestion reaction of 10 µL was prepared containing 6.5 µL nuclease free water, 1 µL of 10X buffer, 0.5 µL of EcoR1 restriction enzyme (Fast Digest) and 2 µL of plasmid. It was incubated at 37°C temperature for 30 minutes, loaded in 1% agarose gel and run at 80 V for an hour.

2.5.2.5 Sequencing and homology analysis The plasmids were sent for sequencing to Eton Biosciences, San Diego, USA with M13 forward and reverse primers. Sequences were assembled for forward and reverse strands using DNA SeqMan pro software and vector sequence was trimmed from start and end. The final sequences were blast on NCBI nucleotides database.

2.5.3 Characterization of chitinase genes The isolated chitinase genes from different isolates of M. anisopliae, T. longibrachiatum, B. brongniartii and B. bassiana were characterized. For characterization sequences were blast on NCBI database and their percentage homology and phylogenetic analysis were studied. Further, the total Open reading frames (ORFs) of each chitinase gene were analyzed using Editseq software. BLAST analyses (NCBI; http://www.ncbi/BLAST; Altschul et al., 1997) and ClustalW software (htpp://www.ch.embnet.org/software/ClustalW.html; Larkin et al., 2007) were utilized to compare the Chit1and Chit2 sequence with other chitinases available in public database. The ORFs were analyzed to find the conserved domain using Conserved Domain Search service (CD-Search) tool of NCBI. Molecular weight and signal peptide of isolated chitinase were predicted by using software SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/; Bendtsen, Nielsen, von Heijne, & Brunak, 2004).

2.5.3.1 Homology modeling and validation Homology modeling approach was used to predict 3D model of chitinase. The deduced amino acid sequence of Chit1and Chit2 was submitted to the automated comparative protein modeling server (http://swissmodel.expasy.org//SWISS- MODEL.html). Five chitinases 5KZ6, 3N11, 3N15, 3N17, 3N18, 3N13 for Tn-27, five chitinases 1D2K, 1LL7, 1LL6, 1WNO, and 1W9P, for Tn-16, 3G6L, and four chitinases1D2K, 1LL7, 1LL6, and 1WNO for Tn-25, and SR at the Protein Data Bank (http://www.rcsb.org/pdb/) with the highest identity to query amino acid sequence were chosen as modeling templates. The Tn-9, Tn-13, and Tn-16 PK were modeled using MODELLER 9v11 (Pieper et al., 2006) as the quality of models for these chitinases was not good using Swiss-model. The deduced amino acid sequences for these queries were subjected to a BLAST search (BLASTp, using default parameters) against a Protein Data Bank (PDB) database (Bernstein et al., 1977). Six templates based on the highest percentage of sequence identity: PDB code 5KZ6, 3N11, 3N15,

3N17, 3N18, 3N13 for Tn-9 and Tn-13 and six templates 2XVN, 4TX6, 2XUC, 2UY2, 1HVQ, 4TOQ for Tn-16 PK were used. The selected homology model was evaluated for compatibility with various structural parameters and stereo-chemical properties using reliability and comparative assessment tools PROCHECK (Laskowski, MacArthur, Moss, & Thornton, 1993). Structure quality was determined in term of residues % in favorable, Glycine residue and non Proline % etc.

2.6 EXPRESSION OF CHITINASE OPEN READING FRAMES (ORFs) IN COTTON PLANTS

2.6.1 Virus-Induced Gene Silencing (VIGS) vector VIGS vector derived from Cotton leaf crumple virus (CLCrV) was obtained from a permanent inventory of clones from Brown‟s Lab, School of Plant Sciences, University of Arizona, Tucson, USA already developed for transient gene expression for cotton (Tuttle et al., 2008). In this VIGS vector, the ORF coding coat protein of component A of cotton leaf crumple virus (pJRTCLCrVA. 008) was replaced with Multiple Cloning Site (MCS) (Genbank. EU541443). B component of cotton leaf crumple virus was also obtained from Brown‟s Lab, University of Arizona, Arizona, USA.

2.6.2 Isolation of chitinase ORFs For the isolation of open reading frames (ORFs) containing chitin catalytic domain, primers were designed containing NheI restriction site in reverse primers while EcoRI in forward primer. The details of primers used for isolation of Chit ORFs are given in Table 2.4.

Table 2.4: Primers sets for amplification of chitinase gene Primers Sequence of primers Product size Tn-13_ORF_ F 5′ TGGGAATTCATGGTCAGCGCCTCGC 3′ 966 bp Tn-13_ORF_ R 5′ GTAGCTAGCTCATTCGCCAAATGTCCAATTC 3′ Tn-25_ORF_F 5′ TGGGAATTCATGAAGACGATGTTGTCTATTGG 3′ 765 bp Tn-25_ORF_R 5′ GTAGCTAGCGAATTCACTAATAAGTTCTTGGG 3′

Tn-16pk_ORF_F 5′ TGGGAATTCATGCTACATCAGCACGTCC 3′ 921 bp Tn-16pk_ORF_R 5′ GTAGCTAGCTCAAAGAGCACATGATAAACTC 3′

Different ORFs from M. anisopliae and B. bassiana isolates were amplified from previously cloned chitinases in the pGEM-T easy cloning vector. The PCR condition with the initial denaturation temperature of 95°C for a minute, 35 cycles at 95°C for a minute as denaturation time followed by different annealing temperature for different ORFs of M. anisopliae and B. bassiana were used. The annealing temperatures were 56° C, 54°C and 53°C for ORF of Chit1gene of B. bassiana (Tn-13 isolate), ORF of Chit1gene of M. anisopliae (Tn-25 isolate) and ORF of Chit2 gene of M. anisopliae (Tn-16 isolate) respectively. The extension time for PCR reactions was for 2 minutes at 72°C temperature. Finally, the reactions were extended for 10 minutes at 72 °C.

2.6.3 Cloning into pGEM T-easy The ORFs of M. anisopliae and B. bassiana were ligated into pGEM T-easy vector and transformed into DH5α strain of E. coli. Plasmids were isolated, sequenced and analyzed before cloning into VIGS vector. After confirming the sequences of different ORFs, plasmids were restricted with EcoRI and NheI restriction enzymes to clone into VIGS vector.

2.6.4 Construction of VIGS-Chit recombinant plasmids Before the construction of VIGS-Chit recombinant plasmids, VIGS vector (CLCrV-A) were restricted with EcoRI and NheI restriction enzymes and purified using QIAquick PCR purification kit ( Qiagen, Valencia, CA, United States). Already restricted ORFs of different chitinases were ligated into VIGS vector at the ratio of 3:1 (insert: vector), transformed into DH5α strain of E. coli. Recombinant plasmids were isolated and confirmed by restriction analyses and sequencing of VIGS-Chit recombinant plasmids.

2.6.5 Particle bombardment Seeds of cotton (Gossypium hirsutum) plant were germinated in 7 inch square pots and pots were filled with potting soil. Four seeds were used in the single pot and seedling was grown for 5-10 days until first true leaves appeared. Leaves were inoculated biolistically, transferred to the individual pot and kept in the growth chamber with a photoperiod of 16/8 h at 900 μmol m−2 s−1 and 23-25°C temperature. Miracle Gro (Miracle Gro Products, Inc.) fertilizer was used twice a week and temperature comparison experiments were carried out in Institute of Agricultural,

University of the Punjab by using 30°C/26°C or 22°C/18°C day/night temperature cycles, relative humidity 40% to 50%. Plants received ambient day length with a 3-h during the dark period with 11 to 12 μmol m−2 s−1 of luminous light to activate long day responses during the year. Plants were started independently in 225-mL styrofoam cups with one-third peat-lite (WR Grace Co.) and two-thirds pea gravel, potting mixture, and transplanted to 1,650-mL pots 2 dpi. Fertilizers and water were applied three times during a week with weak Hoagland solution (Saravitz et al., 2008). Gold microprojectiles 1-μm-diameter (InBio) coated with a mixture of 5 μg each of the A (containing chitinase ORFs) and B components of CLCrV were used for the bombardment of seedlings (Kjemtrup et al., 1998). Micro projectiles DNA-coated were loaded onto the filter end of a Millipore Swinnex filter and each seedling was placed directly under the outlet and bombarded once. Four seedlings were shot one plant at a time with an outlet pressure of 30 to 60 psi, with 60 psi becoming the standard for routine work except for the temperature comparison experiment. Seedlings were inoculated by using commercially available Particle Delivery System (BioRad PDS1000-He) with 0.5 µg of each component and caused an average infection rate of 70%.

2.7 TRANSGENIC EXPRESSION ANALYSIS

2.7.1 RNA Extraction Total RNA was extracted from transformed cotton leaves according to the method described by (Muoki et al., 2012). Cotton plant leaves were ground in liquid nitrogen to form fine powder, transferred into 750 μl of preheated (65°C) extraction buffer-I into tubes, mixed briefly and incubated at 65°C for 15 minutes. Then, an equal volume of chloroform-isoamyl alcohol was added, mixed gently for ten seconds and centrifuged at 13,000 rpm for 10 minutes at room temperature. The upper phase was transferred to new eppendorf and repeated the last step. Further 750 μl of extraction buffer-II was added to the supernatant and vortexed a briefly. Added 200μl of chloroform into the tube, vortexed and incubated for 10 minutes at room temperature. The upper phase was transferred to new eppendorf and 500 µL ice chilled isopropanol was added to precipitate the RNA. Tubes were vortexed gently, incubated at room temperature for 15 minutes and centrifuged at 12,000 rpm for 15 minutes. After centrifugation, the supernatant was transferred to new eppendorf and

RNA pellet was washed with 70% ethanol for three times. Eppendorf tubes were mixed and centrifuged at 7200 rpm for 5 minutes at room temperature. Pellet was air dried for 10 minutes at 55°C and dissolved in 50 μL of DEPC-treated water. RNA was quantified by nano dropper and readings were taken at 260/280 nm wavelength.

2.7.2 cDNA cDNA was synthesized by using high capacity cDNA reverse transcriptase kit, Applied Biosystems, Carlsbad and reagents used for cDNA were given in table 2.5. All reagents were mixed and placed in PCR cycler. The PCR was performed at 25°C for 10 minutes, 37°C for 120 minutes and 85°C for 5 minutes followed by 35 cycles.

Table 2.5: Reagents for the synthesis of cDNA Component Volume/Reaction (μL) 10X RT Buffer 2.0 25X dNTP Mix(100 Mm) 0.8 10 X RT Random Primer 2.0 MultiScribe Reverse Transcriptase 1.0 RNase Inhibitor 1.0 Nuclease-free water 3.2 Total per reaction 10.0

For the confirmation of expression analysis, total RNA was extracted from young cotton leaves after 14 days and cDNA was synthesized. The coat protein region of cotton leaf crumple virus was amplified using AGTTCTAGAATCACCTTCCAC TATGAGAC forward primer and TCAGAATTCCCTTAACGTGCGATAGAT TCTGGGC reverse primers (Tuttle et al., 2008) while fungal chitinases were also amplified using the different set of primers for ORFs already described in table 2.5. The PCR products were run on 1 % agarose gel for confirmation of transient expression.

2.8 Chitinase assay To determine chitinase assay, leaves extracts of different transformed cotton plants were prepared in distilled sterilized water. Chitinase activity was determined using Chitinase Assay Kit (Sigma-Aldrich, Catalog no. CS0980). The chitinase activity of control plants was minus from total activity of transformed plants to determine the chitinase activity of chitinase ORFs expressed in this study.

2.8.1 Enzyme Assay The hydrolysis activity of chitinases was performed at pH 4.8 and 37 °C temperature (Donnelly, 2004). The enzymatic hydrolysis librated Ƥ-Nitrophenol

(Frandberg, 1994). Ionization of Ƥ-Nitrophenol was caused by adding basic stop solution, resulted in yellow Ƥ-Nitrophenylate ion. The absorbance of Ƥ-Nitrophenylate ion was measured at 405 nm (Tronsmo, 1993). To quantify the total hydrolytic activity, separate reactions were run with three substrates supplied with the kit. The assays were performed in duplicates and for each substrate; a separate activity assay was performed according to the following procedure.

The substrate solution and standard solution was equilibrated by incubating 20 minutes at 37°C temperature in the water bath. The plate reader was set at 405 nm. The reaction components were added to the 96 well plates (according to the table 2.6) and mixed by pipetting. Then the substrate was added followed by the enzyme. The plate was incubated for 30 minutes at 37°C temperature. After incubation, the reactions were stopped by adding 200 µl of stop solution except the wells containing a standard solution and yellow tint color was developed. The absorbance was measured at 405 nm within 30 minutes after ending the reaction.

Table 2.6: Reaction scheme for 96 Well Plate Assay Substrate Sample Standard solution Solution Blank 1 100 µl ------Standard 2 ------300 µl Positive 90 µl 10 µl of chitinase control --- Control assay Test 90 µl 10 µl of sample ---

1= A blank reaction (Substrate solution without enzyme) was run because a portion of the substrate may hydrolyze spontaneously during the incubation time.

2= A standard was run because the activity was required for calculations.

2.8.2 Calculations

Unit definition; one unit will release 1.0 micromole of p-nitrophenol from appropriate substrate per minute at pH 4.8 at 37°C.

(A405sample – A405 blank) x 0.05 x 0.3 x DF Units/mL = ------A405standard x time x Venz

Where A405sample is absorbance of the sample at 405 nm, A405 blank is absorbance of blank at 405 nm, 0.05 is micromole per mL of p-nitrophenol in the standard solution, DF is dilution factor, A405standard is absorbance of the standard solution at 405 nm, time in minutes and Venz is volume of sample in mL.

2.9 VIRULENCE BIOASSAY OF CHITINASE TRANSGENIC PLANTS AGAINST B. TABACI After confirmation of expression of different chitinase in plants through VIGS and chitinase enzyme assay, 4th instar nymph and adult B. tabaci were allowed to feed similarly as in conidial bioassay and data after different intervals regarding percentage mortality were calculated using modified Abbot‟s Formula (Flemings & Ratnakaran, 1985).

Chapter 3 RESULTS

3.1 SAMPLING, ISOLATION AND MORPHOLOGICAL CHARACTERIZATION OF INSECT-ASSOCIATED FUNGI

3.1.1 Isolation of Fungi Survey of cotton fields for the collection of 900 natural dead insect samples were carried out in three different agro-ecological zones (Cotton, Central mixed and Hot arid) of Punjab, Pakistan and total fungi associated with them were purified. A total of 23 fungal species from 12 genera were isolated during this study. Details of fungal species are provided in table 3.1.

Table 3.1: Details of fungal genera with their isolation Source Sr. No Gen Bank Name of fungi Source of isolation Code No. 01 Beauveria bassiana Ahid of cotton field, Bahawalpur Tn-13 B. Bank LN827604 02 Fusarium eqiuseti Aphid of cotton Field, IAGS, Sample G. Bank. PU , LHR K LN827599 03 Penicillium polonicum Bemisia tabaci, cotton field, Sahiwal Tn-11 G. Bank. LN827605 04 Fusarium incarnatum Bemisia tabaci, IAGS field Sample 5 G. Bank. , PU , LHR LN827601 05 Fusarium eqiuseti Mealybug, IAGS W 08 G. Bank. , PU , LHR LN827600 06 Clonostachys rosae Aphid from cotton field, Bahawalpur Tn-15 G. Bank. LN827606 08 Fusarium sp. Mealybug of cotton field, IAGS, Lahore W 03 G. Bank. LN827602 09 Fusarium equiseti Aphid of cotton Field, IAGS Sample J G. Bank. PU, LHR LN827603 10 Acremonium sp. Mealybug of cotton field, Layyah TN-4 G. Bank. LT604469 11 Acremonium sp. Aphid, cotton field, Bahawalpur W07 G. Bank. LT604470 12 Aspergillus flavus Mealybug of cotton field Bahawalnagar A2 G. Bank. LT604471 13 Aspergillus flavus Aphid, cotton field, Muzafargarh A3 G. Bank. LT604472 14 Aspergillus flavus Bemisia tabaci of cotton Field, Tn-17 G. Bank. Bahawalpur LN849895 15 Aspergillus fumigatus Bemisia tabaci of cotton Field, Layyah Sample G. Bank. A LN849889 16 Aspergillus fumigatus Aphid of cotton Field, Sahiwal Sample G. Bank. B LN849890 17 Aspergillus fumigatus Mealybug of cotton Field, Bahawalpur Sample G. Bank. C LN849891 18 Aspergillus fumigatus Aphid of cotton Field, Lahore Sample G. Bank. U LN849893

19 Aspergillus fumigatus Mealybug of cotton Field, Lahore Sample G. Bank. L LN849892 20 Aspergillus nidulans Aphid of cotton field, Multan A4 G. Bank. LT604483 21 Aspergillus nidulans Mealybug of cotton field, Mehmood A5 G. Bank. Booti, Lahore LT604484 22 Aspergillus oryzae Aphid of cotton field, Muzafargarh A9 G. Bank. LT604465 23 Aspergillus oryzae Mealy bug of cotton field, sundar lahore A8 G. Bank. LT604466 24 Aspergillus oryzae Bemisia tabaci, cotton field, Multan A7 G. Bank. LT604464 25 Alternaria sp Aphid of cotton field, Bahawalnagar SN G. Bank. LT604491 26 Alternaria sp Mealy bug of cotton field, Sahiwal SW G. Bank. LT604492 27 Alternaria tenuissima Bemisia tabaci, cotton field, Kasur SO G. Bank. LT604489 28 Alternaria tenuissima Aphid of cotton field, Multan SP G. Bank. LT604490 29 Beauveria bassiana Bemisia tabaci, cotton field, Layyah Tn-21 G. Bank. LT604473 30 Beauveria bassiana Mealy bug of cotton field, Sundar, Lahore Tn-27 G. Bank. LT604474 31 Beauveria brongniartii Bemisia tabaci, cotton field, Muzaffargarh Tn-9 G. Bank. LT604475 32 Beauveria brongniartii Aphid of cotton field, Multan Tn-22 G. Bank. LT604476 33 Clonostachys rosea Bemisia tabaci, cotton field, Layyah SZ G. Bank. LT604480 34 Cladosporium sp. Bemisia tabaci, cotton field, Kasur Tn-12 G. Bank. LT604477 35 Cladosporium sp. Aphid from cotton field, Layyah Tn-11 G. Bank. LT604478 36 Cladosporium sp. Mealy bug of cotton field, Multan Tn-20 G. Bank. LT604479 37 Cladosporium Aphid from cotton field, Layyah W08 G. Bank. cladosporioides LT604487 38 Cladosporium Bemisia tabaci, cotton field, Sahiwal W09 G. Bank. cladosporioides LT604488 39 Trichoderma harzianum Bemisia tabaci, cotton field, Bahawalnagar ST G. Bank. LT604467 40 Trichoderma harzianum Aphid from cotton field, PU, Lahore W04 G. Bank. LT604468 41 Trichoderma Mealy bug of cotton field, Layyah SQ G. Bank. longibrachiatum LT159847 42 Penicillium expansum Aphid from cotton field, Kasur Tn-14 G. Bank. LT604485 43 Penicillium expansum Bemisia tabaci, cotton field, Muzafargarh W01 G. Bank. LT604486 44 Penicillium expansum Mealy bug of cotton field, Multan Tn-18 G. Bank. LT604493 45 Metarhizium anisopliae Bemisia tabaci, cotton field, Muzafargarh Tn-16 G. Bank. LT604481 46 Metarhizium anisopliae Mealy bug of cotton field, Sahiwal Tn-25 G. Bank. LT604482 47 Fusarium solani Bemisia tabaci, cotton field, IAGS Sample G. Bank. X LT159846 48 Verticillium lecanii Bemisia tabaci, Cotton field, Sundar, Tn-13 G. Bank Lahore LT626262 49 Verticillium lecanii Mealy bug of cotton field, Layyah Tn-32 G. Bank LT626263 51 Verticillium lecanii Aphid of cotton field, Bahawalpur Tn-30 G. Bank

LT626264 52 Verticillium lecanii Mealy bug of cotton field, Layyah Tn-29 G. Bank LT626265 53 Verticillium lecanii Bemisia tabaci of cotton field, Sundar, Tn-31 G. Bank Lahore LT626266

3.1.2 Morphological characterization of insect-associated fungi A total of 22 different fungal species associated with three insects (Bemisia tabaci, Aphis gossypii and Phenacoccus solenopsis) were isolated on SDAY media plates from different localities of three agro-ecological zones (hot arid, cotton and central mixed) of the Punjab, Pakistan and their morphological characterization was done by observing macro and micro characteristics including structure of their vegetative growth as well as their reproduction structures, spores and conidia. Morphological characterizations of each species of different genera are compared in table 3.2.

Table 3.2 Morphological characterization of insect associated fungi

Fungal species Colony Colony Colony Conidia Conidia shape Conidiophores/ Fig color reverse texture diameter Phialides size Beauveria Yellowish Whitish velutinous 2.5-2.8 µm Globose Conidiophore= 3.1.1 (J), 3.1.2 (J), brongniartii 40 µm 3.1.3 (J) Beauveria Reddish pinkish floccose 3-3.5 µm ellipsoidal Conidiophore= 3.1.1 (K), bassiana 45 µm 3.1.2 (K), 3.1.3(K) Metarhizium Whitish dull velvety 2-5.2 µm cylindrical Conidiophore= 3.1.1 (L), anisopliae yellow 5-15×1.6-3 µm 3.1.2 (L), 3.1.3 (L) Verticillium White uncolored cottony 3.6-9.0 µm Round Phialides= 7-12 3.1.1 (N), 3..2 lecanii ×2-3 µm (N), 3.1.3 (N) Clonostachys Pinkish dull granular 2.5-3.5 µm Globose Conidiophore= 3.1.1 (T), rosea yellow 50-145 µm 3.1.2 (T), 3.1.3 (T). Trichoderma yellow dull green velutinous 2.5-3.5 µm Ovate Conidiophore= 3.1.1(U), 3.1.2 harzianum green 70-120 µm (U), 3.1.3 (U) Trichoderma dark dull green floccose 3.5-4.5 µm ellipsoidal Conidiophore= 3.1.1 (V), longibrachiatum greenish 80-130 µm 3.1.2 (V), 3.1.3 (V) Alternaria olivaceous olivaceous velvety 4-5 µm oblavate Conidiophore= 3.1.1 (R), tenuusimia green brown 240 µm 3.1.2 (R), .3.1.3 (R) Alternaria sp. light medium velvety 3-4 µm obclavate Conidiophore= 3.1.1 (S), brown brown 40 µm 3.1.2 (S), 3.1.3 (S) Penicillium dull green light floccose 4-5µm Globose Conidiophore= 3.1.1 (Q), polonicum brown 300 µm 3.1.2 (Q), 3.1.3 (Q) Penicillium grayish yellow velutinous 3.7-4.5 µm subglobose Conidiophore= 3.1.1 (P), expansum turquoise brown 400 µm 3.1.2 (P), 3.1.3 (P)

Acremonium sp. White yellowish velvety 6-9 µm cylindrical Phialides= 18- 3.1.1 (O), 39 ×2-3 µm 3.1.2 (O), 3.1.3 (O) Cladosporium olivaceous olivaceous velutinous 2-3 µm ellipsoidal to lemon Conidiophore= 3.1.1 (M), cladosporioides green black 360 µm 3.1.2 (M), 3.1.3 (M) Aspergillus yellow dark floccose 7-8 µm globose to Phialides= 6- 3.1.1 (G), nidulans green purple ellipsoidal 11×3-2 µm 3.1.2, 3.1.3 (G) Aspergillus grayish red brown velutinous 3-4 µm Globose Phialides =7-12 3.1.1 (H), fumigatus turquoise to ×2-3 µm 3.1.2 floccose (H), 3.1.3 (H) Aspergillus olive uncolored floccose 4.0-7.5 µm globose to ovoid Phialides= 12- 3.1.1 (I), 3.1.2 (I), oryzae brown 15 ×3-2 µm 3.1.3 (I) Aspergillus dark green brownish velutinous 4-5 µm spherical Phialides= 8-14 3.1.1 (F), flavus orange ×3-2 µm 3.1.2 (F), 3.1.3 (F) Fusarium solani Purple pale cottony Micro Macro Micro Macro Conidiophore= 3.1.1 (A), 2.5-6.2 4.8-6.9 oval creamy fusiform 9-16×2.5-4 µm 3.1.2 µm µm fusiform (A), (1-2 (3-5 3.1.3 (A) celled) celled) Fusarium white peach cottony 2.4-6.0 4.6-6.4 oval fusiform Conidiophore= 3.1.1 µm µm fusiform (B), oxysporum (1-2 (3-5 5-12×2.5-3.6 3.1.2 celled) celled) µm (B), 3.1.3 (B) Fusarium white buff- velutinous Absent 3.0-4.5 ellipsoidal fusiform Conidiophore= 3.1.1 µm (C), incarnatum brown (3-5 17-49 × 3.0-4.5 3.1.2 celled) µm (C), 3.1.3 (C) Fusarium peach to dark velutinous 2.9-5.0 4.5-6.5 ellipsoidal fusiform Conidiophore= 3.1.1 (1-2 (3-5 (D), equiseti buff brown celled) celled) 15-45 × 3.5-4.0 3.1.2 µm (D), 3.1.3 (D) Fusarium sp. peach peach to cottony 3.0-6.5 4.5-6.5 ellipsoidal fusiform Conidiophore= 3.1.1 (3-5 (E), creamish (1celled) celled) 10-30×2-4.5 3.1.2 µm (E), 3.1.3 (E)

A B C D

E F G H

I J K L

M N O P

Q R S T

U V

Plate 3.1.1: Front colony morphology of different fungi on SDAY media. (A) F. solani (B) F. oxysporum (C) F. incarnatum (D) F. equiseti (E) Fusarium sp. (F) A. flavus (G) A. nidulans (H) A. fumigates (I) A. oryzae (J) B. brongniartii (K) B. bassiana (L) M. anisopliae (M) C. cladosporioides (N) V. lecanii (O) Acremonium sp. (P) P. expansum (Q) P. polonicum (R) A. tenuusimia (S) Alternaria sp. (T) C. rosea (U) T. harzianum (V) T. longibrachiatum

A B C D

E F G H

I J K L

N M O P

Q S T R

A U V

Plate 3.1.2: Reverse colony morphology of different fungi on SDAY media. (A) F. solani (B) F. oxysporum (C) F. incarnatum (D) F. equiseti (E) Fusarium sp. (F) A. flavus (G) A. nidulans (H) A. fumigates (I) A. oryzae (J) B. brongniartii (K) B. bassiana (L) M. anisopliae (M) C. cladosporioides (N) V. lecanii (O) Acremonium sp. A (P) P. expansum (Q) P. polonicum (R) A. tenuusimia (S) Alternaria sp. (T) C. rosea (U) T. harzianum (V) T. longibrachiatum

A 58

A B C D

E F G H

I J K L

N M O P

Q T R S

A U V

Plate 3.1.3: Microscopic characteristics of different fungi. (A) F. solani (B) F. oxysporum (C) F. incarnatum (D) F. equiseti (E) Fusarium sp. (F) A. flavus (G) A. nidulans (H) A. fumigatus (I) A. oryzae (J) B. brongniartii (K) B. bassiana (L) M. anisopliae (M) C. cladosporioides (N) V. lecanii (O) Acremonium sp. (P) P. A expansum (Q) P. polonicum (R) A. tenuusimia (S) Alternaria sp. (T) C. rosea (U) T. harzianum (V) T. longibrachiatum

A 59

3.2 MOLECULAR CHARACTERIZATION OF FUNGI Genomic DNA isolated from different fungal isolates was amplified by PCR with ITS4 and ITS1 primers gave the amplification of an approximately 600 bp rDNA fragment from all isolates (figure 3.2.1). To confirm the molecular identity of fungal isolates, the rDNA ITS region of the present isolates were amplified and sequenced. The accession numbers for all ITS sequences amplified in this study are given in Table 3.1.1. DNA sequencing revealed that these fragments ranged in size from 591 to 623 bp. Different 5.8S rDNA sequences were selected based on 90 % similarity score of the determined sequence with a reference sequence. Multiple sequence alignment of 5.8S rDNA gene sequences of test strains and selected homologous sequences was done by using ClustalW. BLAST analysis showed that the percentage of similarity of the fungal isolates ranged from 100%-99% with available sequences on NCBI database. Thus, according to the closest BLAST search, the species name was assigned.

Tn-4 Tn-5 Tn-9 Tn-11 Tn-12 Tn-13 Tn-14 Tn-15 Tn-16 Tn-17 Tn-18 Tn-21 Tn-25 Tn-27 Tn-30 M

600 bp

250 bp

W03 W04 W06 W09 SA SB SC SX M

1500 bp 750 bp 550 bp 500 bp 250 bp 250 bp

Figure 3.2.1: PCR amplification of ITS region of fungal isolates was amplified by PCR with ITS1 and ITS4 primers directed the amplification of an approximately 600 bp rDNA fragment from all isolates. M = Promega 1 Kb DNA Ladder.

3.2.1 Phylogenetic analysis of rDNA-ITS region of Penicillium spp. Genetic relationship among different Penicillium isolates was observed by a neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in the database and our fungal isolates were classified into different clades comprising the Penicillium species. In the neighbor joining tree, the isolate P. polonicum (LN827605) showed maximum homology with P. polonicum (KF938446) (Figure 3.2.2). Neighbor joining tree revealed that P. polonicum isolate (LN827605) fell into a clade that included P. polonicum GQ999174, KF494147 and KF494148. Whereas, the isolates of P. expansum (LT604485, LT60448 and LT604493) constituted in a different clade that was distant from the other isolates of P. polonicum in a phylogenetic tree. P. expansum isolates were closely related to P. expansum DQ681345, KP204878, KC169942 with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus

Penicillium.

3.2.2 Phylogenetic analysis of rDNA-ITS region of Beauveria spp. A neighbor-joining phylogenetic tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI to observe the genetic diversity among different isolates of Beauveria. Our fungal isolates fell within different clades comprising the Beauveria species. In the neighbor joining tree, the isolate B. brongniartii (LT604475 and LT604476) showed maximum similarities with B. brongniartii (JX110375, JX110374) (Figure 3.2.3). Neighbor joining tree revealed that B. brongniartii isolates (LT604475, LT604476) were classified into a clade that included B. brongniartii (JX110369, JX110374, JX110375). Whereas, the isolates of B. bassiana (LT604474, LT604473) constituted in a different clade that was distant from the other isolates of B. brongniartii in the neighbor-joining tree. B. bassiana isolates (LT604474, LT604473) were closely related to B. bassiana (KC753396, KC753394) with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Beauveria.

KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum HQ829141 Acremonium sp. HQ829115 Acremonium sp. HQ829097 Acremonium sp. HQ829110 Acremonium sp. KX082929 Clonostachys rosea KM007098 Clonostachys rosea HQ607798 Clonostachys rosea KU350706 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae FJ545326 Metarhizium anisopliae EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae JF947191 Beauveria brongniartii KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana KC753393 Beauveria bassiana JN379808 Beauveria bassiana JX110369 Beauveria brongniartii JX110372 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii AY633745 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum KJ589553 Cladosporium cladosporioides KP143685 Cladosporium sp. KJ589546 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KJ527013 Cladosporium sp. KJ527012 Cladosporium sp. KC292377 Cladosporium cladosporioides KC007185 Cladosporium sp. JQ388271 Cladosporium sp. GU584946 Alternaria sp. HQ674662 Alternaria sp. KF308837 Alternaria tenuissima KJ541475 Alternaria sp. KM215618 Alternaria sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima EF591304 Aspergillus oryzae JX110980 Aspergillus oryzae KF669485 Aspergillus oryzae KF669486 Aspergillus oryzae KJ650331 Aspergillus oryzae KP278181 Aspergillus flavus KP278183 Aspergillus flavus FJ878645 Aspergillus nidulans AY373888 Aspergillus nidulans FJ878647 Aspergillus nidulans FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus GQ999174 Penicillium polonicum KF938446 Penicillium polonicum LN827605 Tn-11 Penicillium polonicum KF494148 Penicillium polonicum KF494147 Penicillium polonicum KC884404 Penicillium polonicum DQ681322 Penicillium expansum AF455466 Penicillium expansum AJ608953 Penicillium expansum DQ681345 Penicillium expansum KP204878 Penicillium expansum KC169942 Penicillium expansum LT604485 Tn-14 Penicillium expansum w18 Penicillium expansum LT604486 WO1 Penicillium expansum

Figure 3.2.2: Phylogenteic tree showing the relationship of Penicillium spp. based on ITS region and 5.8S sequence

KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum HQ829110 Acremonium sp. HQ829097 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. JX110372 Beauveria brongniartii JX110373 Beauveria brongniartii JX110369 Beauveria brongniartii JF947191 Beauveria brongniartii LT604476 Tn22 Beauveria brongniartii LT604475 Tn9 Beauveria brongniartii JX110375 Beauveria brongniartii JX110374 Beauveria brongniartii JN379808 Beauveria bassiana KC753393 Beauveria bassiana KC753394 Beauveria bassiana KC753395 Beauveria bassiana KC753396 Beauveria bassiana LT604473 Tn21 Beauveria bassiana LT604474 Tn27 Beauveria bassiana HQ607798 Clonostachys rosea KU350706 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea KM007098 Clonostachys rosea KX082929 Clonostachys rosea JQ690085 Fusarium equiseti JX114784 Fusarium equiseti HQ671182 Fusarium equiseti GQ365157 Fusarium equiseti AY633745 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. JF740898 Fusarium sp. JF819150 Fusarium sp. KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae FJ545326 Metarhizium anisopliae FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KC292377 Cladosporium cladosporioides JQ388271 Cladosporium sp. KC007185 Cladosporium sp. KJ527012 Cladosporium sp. KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima KM215618 Alternaria sp. KF308837 Alternaria tenuissima HQ674662 Alternaria sp. KJ541475 Alternaria sp. GU584946 Alternaria sp. AY373888 Aspergillus nidulans FJ878647 Aspergillus nidulans FJ878645 Aspergillus nidulans KP278181 Aspergillus flavus KP278183 Aspergillus flavus KJ650331 Aspergillus oryzae KF669486 Aspergillus oryzae KF669485 Aspergillus oryzae EF591304 Aspergillus oryzae JX110980 Aspergillus oryzae FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus KF494148 Penicillium polonicum KF938446 Penicillium polonicum KF494147 Penicillium polonicum GQ999174 Penicillium polonicum KC884404 Penicillium polonicum DQ681322 Penicillium expansum AF455466 Penicillium expansum AJ608953 Penicillium expansum DQ681345 Penicillium expansum KP204878 Penicillium expansum

Figure 3.2.3: Phylogenteic tree showing the relationship of Beauveria spp. based on ITS region and 5.8S sequence.

3.2.3 Phylogenetic analysis of rDNA-ITS region of Metarhizium anisopliae Genetic relationship among different M. anisopliae isolates was observed by neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI database and our fungal isolates were classified into different clades comprising the Metarhizium species. In the neighbor joining tree, the isolate M. anisopliae (LT604482) and M. anisopliae (LT604481) showed maximum similarity with M. anisopliae (JF792884) (Figure 3.2.4). Neighbor joining tree revealed that M. anisopliae isolates (LT604482, LT604481) were placed into a clade that contained M. anisopliae (JF589646, FJ589645 and EU307885) with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Metarhizium.

3.2.4 Phylogenetic analysis of rDNA-ITS region of Alternaria spp. Genetic relationship among different Alternaria isolates was observed by a neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI database and our fungal isolates were classified into a clade comprising the Alternaria species and was clearly distant from other species. Alternaria sp. (LT604491, LT604492) showed maximum homology with Alternaria sp. (KR094462) (Figure 3.2.5). In neighbor joining tree, Alternaria sp. (LT604491, LT604492) was divided into a clade that was closely related to Alternaria sp. KR094462 and KM215618. Similarly, A. tenuissima isolates (LT604489, LT604490) were closely related to A. tenuissima (KT291415) with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Alternaria.

KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana KC753393 Beauveria bassiana JN379808 Beauveria bassiana JX110372 Beauveria brongniartii JF947191 Beauveria brongniartii JX110369 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii EU307885 Metarhizium anisopliae LT604482 Tn-25 Metarhizium anisopliae FJ545279 Metarhizium anisopliae FJ545326 Metarhizium anisopliae FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae LT604481 Tn-16 Metarhizium anisopliae KT876552 Clonostachys rosea KT876553 Clonostachys rosea KU350706 Clonostachys rosea HQ607798 Clonostachys rosea KM007098 Clonostachys rosea KX082929 Clonostachys rosea AY633745 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum GU584946 Alternaria sp. HQ674662 Alternaria sp. KF308837 Alternaria tenuissima KJ541475 Alternaria sp. KM215618 Alternaria sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KJ527012 Cladosporium sp. KC007185 Cladosporium sp. JQ388271 Cladosporium sp. KC292377 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides KP278181 Aspergillus flavus KP278183 Aspergillus flavus KJ650331 Aspergillus oryzae KF669486 Aspergillus oryzae KF669485 Aspergillus oryzae EF591304 Aspergillus oryzae JX110980 Aspergillus oryzae FJ878647 Aspergillus nidulans AY373888 Aspergillus nidulans FJ878645 Aspergillus nidulans FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus GQ999174 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum KF494147 Penicillium polonicum KC884404 Penicillium polonicum DQ681345 Penicillium expansum DQ681322 Penicillium expansum AF455466 Penicillium expansum AJ608953 Penicillium expansum KP204878 Penicillium expansum

Figure 3.2.4: Phylogenteic tree showing the relationship of Metarhizium anisopliae based on ITS region and 5.8S sequence.

KU317853 Trichoderma longibrachiatum KU317855 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum JF947191 Beauveria brongniartii KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana KC753393 Beauveria bassiana JN379808 Beauveria bassiana JX110369 Beauveria brongniartii JX110372 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. KT876552 Clonostachys rosea KT876553 Clonostachys rosea KM007098 Clonostachys rosea KU350706 Clonostachys rosea HQ607798 Clonostachys rosea KX082929 Clonostachys rosea AY633745 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae FJ545326 Metarhizium anisopliae FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KC292377 Cladosporium cladosporioides JQ388271 Cladosporium sp. KC007185 Cladosporium sp. KJ527012 Cladosporium sp. KJ527013 Cladosporium sp. KP143685 Cladosporium sp. SP Alternaria tenuissima SW Alternaria sp. SO Alternaria tenuissima SN Alternaria sp. KT291415 Alternaria tenuissima KR094462 Alternaria sp. KM215618 Alternaria sp. KJ541475 Alternaria sp. GU584946 Alternaria sp. HQ674662 Alternaria sp. KF308837 Alternaria tenuissima DQ681345 Penicillium expansum KP204878 Penicillium expansum AJ608953 Penicillium expansum AF455466 Penicillium expansum DQ681322 Penicillium expansum GQ999174 Penicillium polonicum KC884404 Penicillium polonicum KF494147 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus FJ878645 Aspergillus nidulans FJ878647 Aspergillus nidulans AY373888 Aspergillus nidulans EF591304 Aspergillus oryzae JX110980 Aspergillus oryzae KF669485 Aspergillus oryzae KF669486 Aspergillus oryzae KJ650331 Aspergillus oryzae KP278181 Aspergillus flavus KP278183 Aspergillus flavus

Figure 3.2.5: Phylogenteic tree showing the relationship of Alternaria spp. based on ITS region and 5.8S sequence.

3.2.5 Phylogenetic analysis of rDNA-ITS region of Acremonium spp. Genetic relationship among different Acremonium isolates was observed by a neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI database and our fungal isolates were classified into different clade comprising the Acremonium species. In the neighbor joining tree, the isolate Acremonium (LT604470 and LT604469) showed maximum similarity with already reported Acremonium sp.(HQ829115) (Figure 3.2.6). Neighbor joining tree revealed that Acremonium isolates (LT604470, LT604469) fell into a distant clade that was clearly separated from other species. Our isolates were classified into a clade that included Acremonium (HQ829115, HQ829141 and HQ829110) with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Acremonium.

3.2.6 Phylogenetic analysis of rDNA-ITS region of Clonostachys rosea Genetic relationship among different C. rosea isolates was observed by a neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI database and our fungal isolates were classified into different a clade comprising the Clonostachys species. In the neighbor joining tree, the isolate C. rosea (LN827606 and LT604480) showed maximum similarity with C. rosea (KU350706) (Figure 3.2.7). Neighbor joining tree revealed that C. rosea isolates (LN827606 and LT604480) was classified into a clade that included closely related C. rosea (KU350706 and KX082929) with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Clonostachys.

KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KR868234 Trichoderma harzianum KR868232 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829141 Acremonium sp. HQ829115 Acremonium sp. LT604469 Tn-4 Acremonium sp. LT604470 WO7 Acremonium sp. JN379808 Beauveria bassiana KC753393 Beauveria bassiana KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana JX110372 Beauveria brongniartii JF947191 Beauveria brongniartii JX110369 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae FJ545326 Metarhizium anisopliae FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae KM007098 Clonostachys rosea KX082929 Clonostachys rosea HQ607798 Clonostachys rosea KU350706 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea AY633745 Fusarium incarnatum KR135132 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KC292377 Cladosporium cladosporioides JQ388271 Cladosporium sp. KC007185 Cladosporium sp. KJ527012 Cladosporium sp. KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima KM215618 Alternaria sp. KJ541475 Alternaria sp. KF308837 Alternaria tenuissima HQ674662 Alternaria sp. GU584946 Alternaria sp. AJ608953 Penicillium expansum KP204878 Penicillium expansum AF455466 Penicillium expansum DQ681322 Penicillium expansum DQ681345 Penicillium expansum KC884404 Penicillium polonicum KF494147 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum GQ999174 Penicillium polonicum FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus AY373888 Aspergillus nidulans FJ878645 Aspergillus nidulans FJ878647 Aspergillus nidulans EF591304 Aspergillus oryzae JX110980 Aspergillus oryzae KF669485 Aspergillus oryzae KF669486 Aspergillus oryzae KJ650331 Aspergillus oryzae KP278181 Aspergillus flavus KP278183 Aspergillus flavus

Figure 3.2.6: Phylogenteic tree showing the relationship of Acremonium based on ITS region and 5.8S sequence

KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KR868234 Trichoderma harzianum KR868232 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii JX110373 Beauveria brongniartii JX110372 Beauveria brongniartii JX110369 Beauveria brongniartii JF947191 Beauveria brongniartii JN379808 Beauveria bassiana KC753393 Beauveria bassiana KC753394 Beauveria bassiana KC753395 Beauveria bassiana KC753396 Beauveria bassiana HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae FJ545326 Metarhizium anisopliae EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae KX082929 Clonostachys rosea LN827606 Tn-15 Clonostachys rosea KM007098 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea HQ607798 Clonostachys rosea KU350706 Clonostachys rosea LT604480 SZ Clonostachys rosea AY633745 Fusarium incarnatum KR135132 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR094462 Alternaria sp. KT291415 Alternaria tenuissima KM215618 Alternaria sp. KJ541475 Alternaria sp. KF308837 Alternaria tenuissima GU584946 Alternaria sp. HQ674662 Alternaria sp. KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KC292377 Cladosporium cladosporioides JQ388271 Cladosporium sp. KC007185 Cladosporium sp. KJ527012 Cladosporium sp. KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KP278181 Aspergillus flavus KP278183 Aspergillus flavus KJ650331 Aspergillus oryzae KF669486 Aspergillus oryzae KF669485 Aspergillus oryzae EF591304 Aspergillus oryzae JX110980 Aspergillus oryzae FJ878647 Aspergillus nidulans AY373888 Aspergillus nidulans FJ878645 Aspergillus nidulans FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus GQ999174 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum KF494147 Penicillium polonicum KC884404 Penicillium polonicum AF455466 Penicillium expansum AJ608953 Penicillium expansum DQ681322 Penicillium expansum DQ681345 Penicillium expansum KP204878 Penicillium expansum

Figure 3.2.7: Phylogenteic tree showing the relationship of Clonostachys rosea based on ITS region and 5.8S sequence.

3.2.7 Phylogenetic analysis of rDNA-ITS region of Cladosporium spp.

A neighbor-joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI to observe the genetic diversity among different isolates of Cladosporium. Our fungal isolates fell within two different clades comprising the Cladosporium species. In the neighbor joining tree, the isolate C. cladosporioides (LT604487, LT604488) showed maximum similarities with C. cladosporioides (KJ589553) (Figure 3.2.8). Neighbor joining tree revealed that C. cladosporioides isolates (LT604487, LT604488) were classified into a clade that included C. cladosporioides (KJ589553, KJ589542 and KJ589546). Whereas, the isolates of Cladosporium sp. (LT604477, LT604478 and LT604479) constituted in a different clade that was distant from the other isolates of C. cladosporioides in the neighbor-joining tree. Cladosporium sp. isolates (LT604477, LT604478 and LT604479) were closely related to Cladosporium (KJ589553, KJ527013 and KJ527012) with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Cladosporium.

3.2.8 Phylogenetic analysis of rDNA-ITS region of Trichoderma spp. Genetic relationship among different Trichoderma isolates was observed by a neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI database and our fungal isolates were classified into different clades comprising the Trichoderma species. In the neighbor joining tree, T. longibrachiatum (LT159847) showed maximum homology with T. longibrachiatum (AF362099) (Figure 3.2.9). Neighbor joining tree revealed that T. longibrachiatum (LT159847) fell into a clade that was closely related to T. longibrachiatum AF362099 and KU317856. While the isolates of T. harzianum grouped into a distinguished clade that was very distant from the other isolates of T. longibrachiatum in the neighbor-joining tree. T. harzianum isolates (LT604467, LT604468) were closely related to T. harzianum KR868284, KR868241 and KR868239 with maximum ITS sequence similarity. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Trichoderma.

AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana JN379808 Beauveria bassiana KC753393 Beauveria bassiana JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii JX110372 Beauveria brongniartii JF947191 Beauveria brongniartii JX110369 Beauveria brongniartii HQ829110 Acremonium sp. HQ829097 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. HQ607798 Clonostachys rosea KU350706 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea KM007098 Clonostachys rosea KX082929 Clonostachys rosea FJ008998 Fusarium sp. AY633745 Fusarium incarnatum FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae FJ545326 Metarhizium anisopliae EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae LT604487 W08 Cladosporium cladosporioides LT604488 WO9 Cladosporium cladosporioides LT604479 Tn-20 Cladosporium sp. KJ589553 Cladosporium cladosporioides KJ589546 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KC292377 Cladosporium cladosporioides JQ388271 Cladosporium sp. KC007185 Cladosporium sp. KJ527012 Cladosporium sp. KJ527013 Cladosporium sp. KP143685 Cladosporium sp. LT604478 Tn-11 Cladosporium sp. LT604477 Tn-12 Cladosporium sp. GU584946 Alternaria sp. HQ674662 Alternaria sp. KF308837 Alternaria tenuissima KJ541475 Alternaria sp. KM215618 Alternaria sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima KP278181 Aspergillus flavus KP278183 Aspergillus flavus KJ650331 Aspergillus oryzae KF669486 Aspergillus oryzae KF669485 Aspergillus oryzae JX110980 Aspergillus oryzae EF591304 Aspergillus oryzae FJ878645 Aspergillus nidulans AY373888 Aspergillus nidulans FJ878647 Aspergillus nidulans FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus GQ999174 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum KF494147 Penicillium polonicum KC884404 Penicillium polonicum DQ681345 Penicillium expansum DQ681322 Penicillium expansum AF455466 Penicillium expansum AJ608953 Penicillium expansum KP204878 Penicillium expansum

Figure 3.2.8: Phylogenteic tree showing the relationship of Cladosporium cladosporioides and Cladosporium sp. based on ITS region and 5.8S sequence.

LT604467 ST Trichoderma harzianum LT604468 wo4 Trichoderma harzianum KR868284 Trichoderma harzianum KR868241 Trichoderma harzianum KR868239 Trichoderma harzianum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KU317856 Trichoderma longibrachiatum LT159847 our isolate Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU317855 Trichoderma longibrachiatum HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana JN379808 Beauveria bassiana KC753393 Beauveria bassiana JF947191 Beauveria brongniartii JX110369 Beauveria brongniartii JX110372 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii KT876552 Clonostachys rosea KT876553 Clonostachys rosea HQ607798 Clonostachys rosea KM007098 Clonostachys rosea KU350706 Clonostachys rosea KX082929 Clonostachys rosea EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae FJ545326 Metarhizium anisopliae FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae AY633745 Fusarium incarnatum FJ008998 Fusarium sp. FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KJ527012 Cladosporium sp. KC007185 Cladosporium sp. JQ388271 Cladosporium sp. KC292377 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides GU584946 Alternaria sp. HQ674662 Alternaria sp. KF308837 Alternaria tenuissima KJ541475 Alternaria sp. KM215618 Alternaria sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima KP278181 Aspergillus flavus KP278183 Aspergillus flavus KJ650331 Aspergillus oryzae KF669486 Aspergillus oryzae KF669485 Aspergillus oryzae JX110980 Aspergillus oryzae EF591304 Aspergillus oryzae AY373888 Aspergillus nidulans FJ878645 Aspergillus nidulans FJ878647 Aspergillus nidulans FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus AJ608953 Penicillium expansum KP204878 Penicillium expansum DQ681322 Penicillium expansum DQ681345 Penicillium expansum AF455466 Penicillium expansum KF494147 Penicillium polonicum GQ999174 Penicillium polonicum KC884404 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum

Figure 3.2.9: Phylogenteic tree showing the relationship of T. longibrachiatum and T. harzianum based on ITS region and 5.8S sequence.

3.2.9 Phylogenetic analysis of rDNA-ITS region of Fusarium spp. Genetic relationship among different Fusarium isolates was observed by the neighbor-joining tree. A neighbor joining tree was assembled on the basis of the available 5.8S rDNA gene sequences in NCBI database and our fungal isolates were classified into different clades comprising the Fusarium species. In the neighbor joining tree, F. equiseti (LN827600, LN827603 and LN827599) showed maximum homology with F. equiseti (LN827603) (Figure 3.2.10). Neighbor joining tree revealed that F. equiseti fell into a clade that was closely related to F. equiseti (GQ365157 and GQ671182). While Fusarium sp. (LN827602) and F. incarnatum (LN827601) both isolates of insects were classified in the same main cluster that was closely related to already reported ITS sequences of KR135132 and KF525436. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Fusarium.

3.2.10 Phylogenetic analysis of rDNA-ITS region of Aspergillus spp. Genetic relationship among different Aspergillus isolates was observed by a neighbor-joining tree and our fungal isolates were classified into different clades comprising the Aspergillus species. In the neighbor joining tree, A. nidulans (LT604484 and LT604483) showed maximum homology with A. nidulans (AY373888) (Figure 3.2.11). Neighbor joining tree revealed that A. nidulans (LT604484 and LT604483) fell into a clade that was closely related to A. nidulans AY373888 and FJ878647. While the isolates of A. oryzae and A. flavus grouped in a similar clade that was distant from the other isolates of A. nidulans and A. fumigatus in the neighbor-joining tree. Our isolates of A. oryzae (LT604465, LT604464 and LT604466) was closely related with already reported ITS sequences of A. oryzae (JX110980 and EF591304) and A. flavus isolates (LT604471 and LT604472) showed maximum homology with ITS sequence of A. flavus KP278183 and KP278182. While, A. fumigates isolates (LN849889, LN849890, LN849893 and LN849892) showed maximum similarity with ITS sequence of A. fumigatus (FJ227896 and KT877346) in the phylogenetic tree. A comparative analysis of 5.8S rDNA gene sequence showed that our fungal strains are very close to members of the genus Aspergillus.

KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KR868234 Trichoderma harzianum KR868232 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. LN827600 W08 Fusarium equiseti GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti KU504317Fusarium sp. FJ009000 Fusarium sp. FJ008998 Fusarium sp. AY633745 Fusarium incarnatum JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum LN827601 Sample 5 Fusarium incarnatum LN827603 sample J Fusarium equiseti LN827599 sample K Fusarium equiseti LN827602 W03 Fusarium sp. HQ607798 Clonostachys rosea KU350706 Clonostachys rosea KX082929 Clonostachys rosea KM007098 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae FJ545326 Metarhizium anisopliae EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana KC753393 Beauveria bassiana JN379808 Beauveria bassiana JF947191 Beauveria brongniartii JX110369 Beauveria brongniartii JX110372 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii KR094462 Alternaria sp. KT291415 Alternaria tenuissima KM215618 Alternaria sp. KJ541475 Alternaria sp. KF308837 Alternaria tenuissima GU584946 Alternaria sp. HQ674662 Alternaria sp. KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KJ527012 Cladosporium sp. KC007185 Cladosporium sp. JQ388271 Cladosporium sp. KC292377 Cladosporium cladosporioides KJ589542 Cladosporium cladosporioides KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides DQ681345 Penicillium expansum KP204878 Penicillium expansum DQ681322 Penicillium expansum AJ608953 Penicillium expansum AF455466 Penicillium expansum GQ999174 Penicillium polonicum KC884404 Penicillium polonicum KF494147 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum AY373888 Aspergillus nidulans FJ878647 Aspergillus nidulans FJ878645 Aspergillus nidulans FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus JX110980 Aspergillus oryzae EF591304 Aspergillus oryzae KF669485 Aspergillus oryzae KF669486 Aspergillus oryzae KJ650331 Aspergillus oryzae KP278181 Aspergillus flavus KP278183 Aspergillus flavus

Figure 3.2.10: Phylogenteic tree showing the relationship of Fusarium spp. on ITS region and 5.8S sequence.

AF362099 Trichoderma longibrachiatum KT278853 Trichoderma longibrachiatum KT426899 Trichoderma longibrachiatum KU317853 Trichoderma longibrachiatum KU317855 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU057351 Trichoderma longibrachiatum KR868232 Trichoderma harzianum KR868234 Trichoderma harzianum KR868237 Trichoderma harzianum KR868239 Trichoderma harzianum KR868241 Trichoderma harzianum KR868284 Trichoderma harzianum JF947191 Beauveria brongniartii KC753395 Beauveria bassiana KC753396 Beauveria bassiana KC753394 Beauveria bassiana KC753393 Beauveria bassiana JN379808 Beauveria bassiana JX110369 Beauveria brongniartii JX110372 Beauveria brongniartii JX110373 Beauveria brongniartii JX110374 Beauveria brongniartii JX110375 Beauveria brongniartii HQ829097 Acremonium sp. HQ829110 Acremonium sp. HQ829115 Acremonium sp. HQ829141 Acremonium sp. EU307885 Metarhizium anisopliae FJ545279 Metarhizium anisopliae FJ589645 Metarhizium anisopliae FJ589646 Metarhizium anisopliae FJ545326 Metarhizium anisopliae KX082929 Clonostachys rosea KT876552 Clonostachys rosea KT876553 Clonostachys rosea KM007098 Clonostachys rosea HQ607798 Clonostachys rosea KU350706 Clonostachys rosea FJ008998 Fusarium sp. AY633745 Fusarium incarnatum FJ009000 Fusarium sp. KU504317Fusarium sp. GQ365157 Fusarium equiseti HQ671182 Fusarium equiseti JF740898 Fusarium sp. JF819150 Fusarium sp. JQ690085 Fusarium equiseti JX114784 Fusarium equiseti KF255436 Fusarium incarnatum KR135132 Fusarium incarnatum KJ527013 Cladosporium sp. KP143685 Cladosporium sp. KJ527012 Cladosporium sp. KC007185 Cladosporium sp. JQ388271 Cladosporium sp. KJ589542 Cladosporium cladosporioides KJ589546 Cladosporium cladosporioides KJ589553 Cladosporium cladosporioides KC292377 Cladosporium cladosporioides GU584946 Alternaria sp. HQ674662 Alternaria sp. KF308837 Alternaria tenuissima KJ541475 Alternaria sp. KM215618 Alternaria sp. KR094462 Alternaria sp. KT291415 Alternaria tenuissima AF455466 Penicillium expansum DQ681322 Penicillium expansum DQ681345 Penicillium expansum KP204878 Penicillium expansum AJ608953 Penicillium expansum KF494147 Penicillium polonicum GQ999174 Penicillium polonicum KC884404 Penicillium polonicum KF494148 Penicillium polonicum KF938446 Penicillium polonicum FJ878645 Aspergillus nidulans FJ878647 Aspergillus nidulans AY373888 Aspergillus nidulans LT604483 A4 Aspergillus nidulans LT604484 A5 Aspergillus nidulans LN849892 Sample L Aspergillus fumigatus LN849893 Sample U Aspergillus fumigatus LN849891 Sample C Aspergillus fumigatus LN849890 Sample B Aspergillus fumigatus LN849889 sample A Aspergillus fumigatus FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus KP278181 Aspergillus flavus KP278183 Aspergillus flavus KJ650331 Aspergillus oryzae KF669486 Aspergillus oryzae KF669485 Aspergillus oryzae JX110980 Aspergillus oryzae LT604471 A2 Aspergillus flavus LN849895 Tn-17 Aspergillus flavus LT604472 A3 Aspergillus flavus LT604464 A7 Aspergillus oryzae LT604466 A8 Aspergillus oryzae LT604465 A9 Aspergillus oryzae EF591304 Aspergillus oryzae

Figure 3.2.11: Phylogenteic tree showing the relationship of Aspergillus spp. based on ITS region and 5.8S sequence.

3.2.11 Phylogenetic comparison of rDNA-ITS region of all fungal species Genetic relationship among different isolates of all isolated fungi was observed by a neighbor-joining tree and 4 main clusters were found in phylogenetic analysis. Aspergillus and Penicillium species fell under same main cluster while Cladosporium and Alternaria were found in other cluster. Similarly Acremonium, Clonostachys, Trichoderma, Metarhizium and Beauveria were found in same cluster while Fusarium formed a separate cluster. In Sub-clusters, the isolates of B. brongniartii (LT604475 and LT604476) showed maximum similarities with B. brongniartii (JX110375, JX110374). Beauveria brongniartii isolates were classified into a clade that included B. brongniartii (JX110369, JX110374, JX110375). The isolates of M. anisopliae showed maximum similarity with M. anisopliae (JF792884) and the isolates of P. polonicum (LN827605) exhibited homology with P. polonicum (KF938446). Penicillium expansum isolates were constituted in a different clade that was distant from the other isolates of P. polonicum in a phylogenetic tree (Figure 3.2.12). Alternaria sp. (LT604491, LT604492) showed maximum homology with Alternaria sp. (KR094462). Similarly, A. tenuissima isolates were closely related to A. tenuissima (KT291415) with maximum ITS sequence similarity. Whereas the isolates of Acremonium showed resemblance with already reported Acremonium sp. (HQ829115). In the neighbor joining tree, the isolate of C. rosea showed homology with C. rosea (KU350706). Cladosporium sp. isolates were closely related to Cladosporium (KJ589553, KJ527013 and KJ527012) with maximum ITS sequence similarity and T. longibrachiatum (LT159847) showed maximum homology with T. longibrachiatum (AF362099). Neighbor joining tree revealed that F. equiseti fell into a clade that was closely related to F. equiseti (GQ365157 and GQ671182). While Fusarium sp. and F. incarnatum were classified in the same main cluster that was closely related to KR135132 and KF525436. The isolates of A. oryzae and A. flavus grouped in a similar clade that was distant from the other isolates of A. nidulans and A. fumigatus in the neighbor-joining tree. Aspergillus oryzae was closely related with already reported ITS sequences of A. oryzae (JX110980 and EF591304) and A. flavus isolates (LT604471 and LT604472) showed homology with ITS sequence of A. flavus KP278183 and KP278182. While, A. fumigates isolates showed maximum similarity with ITS sequence of A. fumigatus (FJ227896 and KT877346) in the phylogenetic tree.

LN827601 S5 Fusarium incarnatumLN827600 W08 Fusarium equiseti

LN827602 W03 Fusarium sp.

JX205167 Fusarium equiseti KT030798 Fusarium equiseti KM265496 Fusarium sp. KM066540 Fusarium sp. KR094457 Fusarium equiseti

JX885463 Fusarium incarnatumKC341965 Fusarium sp.

JF819150 Fusarium sp. KM051401 Fusarium sp.

KJ996100 Fusarium sp. our 2 isolate Penicillium polonicum JX114784 Fusarium equiseti LN827605 TN-11 Penicillium polonicum GQ365157 Fusarium equiseti LT604486 WO1 Penicillium expansum LT604485 TN-14 Penicillium expansum KF494147 Penicillium polonicum AF455466 PenicilliumKP204878 expansum Penicillium expansum KJ741330 PenicilliumKR002875 polonicum Penicillium polonicum JF740898 Fusarium sp. DQ681345 Penicillium expansum KJ676451 Penicillium polonicum HQ671182 Fusarium equiseti AJ608953 Penicillium expansum LN867320 Penicillium polonicum KF494148 Penicillium polonicum

W18 Penicillium expansum LT604484 A5 Aspergillus nidulans

KC169942 Penicilliumexpansum KC884404 Penicillium polonicum KF255436 Fusarium incarnatum DQ681322 Penicillium expansum LT558926 Penicillium polonicum AB248971 Aspergillus nidulans KU504317 Fusarium sp. AY373888 AspergillusLT604483 A4nidulans Aspergillus nidulans KP131592 Aspergillus nidulans KU900501 Fusarium equiseti FJ009000 Fusarium sp. FJ878647 Aspergillus nidulans AY633745 Fusarium incarnatum FJ878641LN849892 Aspergillus SL nidulansAspergillus fumigatus KP278174 Aspergillus nidulans LC094423 Fusarium incarnatum LN849890 SB Aspergillus fumigatus FJ008998 Fusarium sp. KU321545 Aspergillus fumigatus AB820720 Fusarium incarnatum FJ227896 Aspergillus fumigatus KT877346 Aspergillus fumigatus LC171332LN849889 Aspergillus SA Aspergillus fumigatus fumigatus JQ690085KU296944 Fusarium Fusarium equiseti sp. LN849891 SC Aspergillus fumigatus KR135132 Fusarium incarnatum LN849893 SU Aspergillus fumigatus AB586988 Fusarium incarnatum AJ871014 Aspergillus flavus KJ650336 Aspergillus oryzae KP026922KP666190 Fusarium Fusarium equiseti sp. KJ650331 Aspergillus oryzae LN827599 SK Fusarium equiseti KP278181LT604465 Aspergillus A9 Aspergillus flavus oryzae LN827603 SJ Fusarium equiseti KT970479 Aspergillus oryzae KC753396 Beauveria bassiana KR296888LN849895 Aspergillus TN-17 Aspergillus flavus flavus KC753381 Beauveria bassiana LT604474 TN-27 Beauveria bassiana F669487 Aspergillus oryzae KP307914 Aspergillus oryzae KC753379 Beauveria bassiana JQ269826 Aspergillus flavus KU978916 Aspergillus flavus KC753394 Beauveria bassiana HQ340106 Aspergillus flavus KC753393 Beauveria bassiana KJ650330 Aspergillus oryzae LT604473 TN-21 Beauveria bassiana HQ285536 Aspergillus flavus KJ650337 Aspergillus oryzae KC753395 Beauveria bassiana AY373848 Aspergillus flavus KC753398 Beauveria bassiana KJ650339 Aspergillus oryzae JX292092 Aspergillus flavus KC753392 Beauveria bassiana KF669485 Aspergillus oryzae JX110375 Beauveria brongniartii LT604466 A8 Aspergillus oryzae KF669486 Aspergillus oryzae JX110373 Beauveria brongniartii HQ340104 Aspergillus flavus JX501360 Aspergillus flavus LT604476 TN-22 Beauveria brongniartii LT604471 A2 Aspergillus flavus JX110374 Beauveria brongniartii LT604472 A3 Aspergillus flavus JX110379 Beauveria brongniartii KP278183 Aspergillus flavus LT604464 A7 Aspergillus oryzae JF951750 Aspergillus flavus LT604475 TN-9 Beauveria brongniartii EF591304 Aspergillus oryzae JX110381 Beauveria brongniartii JX110980 Aspergillus oryzae HM055433 Metarhizium anisopliae KR094462 Alternaria sp. HM055427 Metarhizium anisopliae LT604492 SW Alternaria sp. FJ589645 Metarhizium anisopliae HQ674662 Alternaria sp. GQ995482KT291415 Alternaria Alternaria sp.tenuissima AY646382 Metarhizium anisopliae FJ545326 Metarhizium anisopliae EF432293 Alternaria sp. KM215618 Alternaria sp. FJ545279 Metarhizium anisopliae KJ541475LT604489 Alternaria SO sp.Alternaria tenuissima KC292377 Cladosporium cladosporioides EF432275 AlternariaLT604488 sp. WO9 Cladosporium cladosporioides KF308837KP900248 Alternaria Cladosporium tenuissima cladosporioides LT604481 Tn-16JF792884 Metarhizium Metarhizium anisopliae anisopliae LT604491 SN Alternaria sp. GU584946 AlternariaLT604487 sp. W08 Cladosporium cladosporioides KP701905 Cladosporium cladosporioides LT604482 TN-25EU307885 Metarhizium Metarhizium anisopliae anisopliae KP701922 Cladosporium cladosporioides LT604479 Tn-20 Cladosporium sp. KP701872 Cladosporium cladosporioides LT604477 Tn-12 Cladosporium sp. LT159847KU317855 SQ Trichoderma Trichoderma longibrachiatum longibrachiatum LT604478 TN-11 Cladosporium sp. KU317853 Trichoderma longibrachiatum KP701898 Cladosporium cladosporioides KX034368 Cladosporium sp. AF362099 Trichoderma longibrachiatum KX034366 Cladosporium sp. KP701941 Cladosporium cladosporioides KX034367 Cladosporium sp. KP701933 Cladosporium cladosporioides KT426899 Trichoderma longibrachiatum KU182497 Cladosporium cladosporioides KT278853 Trichoderma longibrachiatum KU317856 Trichoderma longibrachiatum KU057351 TrichodermaKR868321 Trichodermalongibrachiatum harzianum KR868288 Trichoderma harzianum KR868284 Trichoderma harzianum KR868234 Trichoderma harzianum KR868336 Trichoderma harzianum KR868241 Trichoderma harzianum

KR868237 Trichoderma harzianum LT604468 WO4 Trichoderma harzianum LT604467 ST TrichodermaKR868239 harzianum Trichoderma harzianum KR868232 TrichodermaLT576164 harzianum Clonostachys rosea

LT604480 SZ Clonostachys roseaFJ025204 Clonostachys rosea

HQ607798 Clonostachys rosea

LT220588 Clonostachys rosea

LT220563 Clonostachys rosea LN827606 TN-15 Clonostachys rosea

HQ829141 Acremonium sp.

HQ829134 Acremonium sp.

HQ829143 Acremonium sp. LC133854 Acremonium sp. Acremonium LC133854

LT604470 WO7 Acremonium sp. sp. Acremonium JN207284

LT604469 TN-4 Acremonium sp. sp. Acremonium AM901698

JQ717337 Acremonium sp. Acremonium JQ717337

JQ717349 Acremonium sp. Acremonium JQ717349 JN578630 Acremonium sp. Acremonium JN578630

Figure 3.2.12: Phylogenteic tree showing the relationship and clusters of isolated fungal species based on ITS region and 5.8S sequence

3.3 DISTRIBUTION AND OCCURRENCE FREQUENCY OF INSECT- ASSOCIATED FUNGI A total of 300 insect samples of B. tabaci, A. gossypii and P. solenopsis were collected from hot arid, cotton and central mixed zones individually. A total of 100 samples of each insect (B. tabaci, A. gossypii and P. solenopsis) from 10 cotton fields of each agroecological zone were collected. While, 10 samples of B. tabaci, A. gossypii and P. solenopsis were collected from each field within each zone. Natural infections caused by different fungal genera were observed (Table1, 2, 3) and showed that whitefly; aphid and mealy bug were infected by fungal infection. In addition to well-known entomopathogenic fungi, some other fungi were also isolated from three different insects. The fungus was distributed in all the collection sites surveyed. The occurrence of insect-associated fungi was different in three hosts in all three agroecological zones. A total of 50 fungal isolates from different genera were found in the cotton zone from B. tabaci, A. gossypii and P. solenopsis while 49 and 41 were found in the hot arid zone and central mixed zone respectively. It was observed that an individual host, overall 53 fungal isolates of different genera from B. tabaci 50 from A. gossypii and 37 from P. solenopsis were found in all agroecological zones.

3.3.1 Occurrence frequency in the hot arid zone A total of 300 samples of each insect (B. tabaci, A. gossypii and P. solenopsis) were collected from the hot arid zone (Layyah and Muzaffargarh) to analyze for the occurrence frequency and distribution of insect-associated fungi. The occurrence frequency of insect- associated fungi among all types of observed fungal species was highest on B. tabaci with 42.86 % followed by 30.61 % from A. gossypii and lowest with 26.53 % from P. solenopsis in hot arid zone (Figure 3.3.1). Four major species of entomopathogenic fungi were found in the hot arid zone including Verticillium lecanii, Beauveria bassiana, Beauveria brongniartii and Metarhizium anisopliae with different occurrence frequencies in each district on different hosts. The frequency of the occurrence of individual entomopathogenic fungi species on different insects was variable in the hot arid zone. Among the four genera of entomopathogenic fungi, V. lecanii (8.16%) was maximum followed by B. bassiana (4.0.8%) and M. anisopliae (4.08%); however, B. brongniartii (2.04%) was found with a minimum frequency as compared to others fungal species (Table 3.3.1).

Eighteen other fungal species from 9 genera were also found in the hot arid zone including Fusarium oxysporum, Fusarium equiseti, Fusarium incarnatum, Fusarium solani, Fusarium sp., Penicillium expansum, Penicillium polonicum, Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Alternaria sp., Alternaria tenuissima, Trichoderma longibrachiatum, Cladosporium sp., Cladosporium cladosporioides, Clonostachys rosea , yeast and Acremonium sp. with different occurrence frequency.

Among these eighteen fungal species, A. flavus and F. oxysporum was recorded with maximum occurrence frequency of 8.16% each as compared to F. solani, F. equiseti, A. oryzae and Cladosporium sp., with occurrence frequencies of 6.12 % individually. While occurrence frequency of F. incarnatum, Fusarium sp., A. nidulans, P. expansum, C. rosea and yeast were 4.08% individually and P. polonicum, A. tenuissima, Acremonium sp., C. cladosporioides and T. longibrachiatum were found with a minimum occurrence frequency of 2.04% individually (Figure 3.3.2).

Figure 3.3.1: Fungi found on individual insect of suborder Sternorrhyncha (Hemiptera) in the hot arid zone (There were marked differences among the studied species)

Table 3.3.1: Fungi found on different insects of suborder Sternorrhyncha (Hemiptera) in the hot arid zone th * ** 2 Ni (No. of i species individually) ƭ ᵡ Total P Sr. Fungi isolates no B. A. P. tabaci gossypii solenopsis 1 Acremonium sp. 0 0 1 2.04 2.77 0.25 1 2 2 1 1 8.16 0.09 0.95 Aspergillus flavus 4 3 1 1 1 6.12 0.12 0.94 Aspergillus fumigatus 3 4 1 0 0 2.04 1.34 0.51 Aspergillus nidulans 1 5 1 1 1 6.12 0.12 0.94 Aspergillus oryzea 3 6 0 1 0 2.04 2.27 0.32 Alternaria sp. 1 1 0 0 2.04 1.34 0.51 Alternaria tenuissima 1 7 1 1 0 4.08 0.8 0.67 Beauveria bassiana 2 8 1 0 0 2.04 1.34 0.51 Beauveria brongniartii 1 9 1 1 0 4.08 0.8 0.67 Clonostachys rosea 2 10 1 2 0 6.12 2.13 0.34 Cladosporium sp. 3 11 Cladosporium 0 1 0 2.04 2.27 0.32 cladosporioides 1 12 1 0 1 4.08 1.05 0.59 Fusarium sp. 2 13 Fusarium equiseti 2 0 1 6.12 1.34 3 0.50 14 1 1 0 4.08 0.8 0.67 Fusarium incarnatum 2 15 1 1 2 8.16 1.17 0.56 Fusarium oxysporum 4 16 1 1 1 6.12 0.12 0.94 Fusarium solani 3 17 Metarhizium 1 1 0 4.08 0.8 0.67 anisopliae 2 18 1 0 0 2.04 1.34 0.51 Penicillium polonicum 1 19 1 0 1 4.08 1.05 0.59 Penicillium expansum 2 20 Trichoderma 0 0 1 2.04 2.77 0.25 longibrachiatum 1 21 Trichoderma 0 0 0 0 1 harzianum 0 22 1 1 2 8.16 1.17 0.56 Verticillium lecanii 4 23 1 1 0 4.08 0.8 0.67 Yeast 2 * 42.86 30.61 26.53 ƭ 49 Total 21 15 13 * = occurrence frequency in percentage **= Chi Square

Figure 3.3.2: Fungi found on different insects of suborder Sternorrhyncha (Hemiptera) in the hot arid zone

3.3.1.1 Species diversity and similarities between different hosts in the hot arid zone Shannon and Simpson‟s indices gave similar results of species diversity from different hosts (Table 3.3.2). The species diversity index for B. tabaci was the highest, followed by A. gossypii and P. solenopsis. Similarly, species richness (S) for B. tabaci was highest, followed by A. gossypii and P. solenopsis in hot arid zone. Similarities indices of fungal species among different hosts (Table 3.3.2) showed values and Sorenson similarity index of all insects was same in the hot arid zone.

Table 3.3.2: Summary of fungal species diversity of suborder Sternorrhyncha (Hemiptera) in the hot arid zone

B. tabaci A. gossypii P. solenopsis Shannon Index (H) 2.91 2.62 2.35 Simpson Index (1-D) 0.94 0.92 0.89 Species richness (S‟) 19 14 11 Individual numbers 21 15 13 Evenness (Eh) 0.97 0.98 0.96 Sorenson similarity Index 1 1 1

3.3.2 Occurrence frequency in the cotton zone A total of 300 samples of each insect were collected from the cotton zone (Rahim Yar Khan and Sahiwal) to analyze for the occurrence frequency and distribution of insect-associated fungi. The occurrence frequency of insect-associated fungi among all types of observed fungal species was 42 % highest on A. gossypii that was followed by 30% from B. tabaci and 28% lowest from P. solenopsis in the cotton zone (Figure 3.3.3). Four well-known species of entomopathogenic fungi were found in the cotton zone such as Verticillium lecanii, Beauveria bassiana, Beauveria brongniartii and Metarhizium anisopliae with different occurrence frequencies in each district on different host. The frequency of occurrence of individual entomopathogenic fungi species on different insects was variable among cotton mixed zone. Among the four genera of entomopathogenic fungi, B. bassiana (8%) was maximum followed by V. lecanii (6%), M. anisopliae (4%); however, B. brongniartii (2%) was found with a minimum occurrence frequency as compared to others fungal species (Table 3.3.3). The geography of collection sites influenced the distribution of entomopathogenic fungi.

Eighteen other fungal species from 9 genera were also found in cotton zone including Fusarium oxysporum, Fusarium equiseti, Fusarium incarnatum, Fusarium solani, Fusarium sp., Penicillium expansum, Penicillium polonicum, Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Alternaria sp., Alternaria tenuissima Trichoderma harzianum, Cladosporium sp., Cladosporium cladosporioides, Clonostachys rosea and Acremonium sp. with different frequency. Total frequency of occurrence of these fungi was variable within the cotton zone.

Among these eighteen fungal species, A. nidulans, F. oxysporum and F. solani were found with a maximum occurrence frequency of 8.0% each as compared to A. flavus, A. oryzae, F. equiseti and F. incarnatum with occurrence frequency of 6.0% individually. While occurrence frequency of A. tenuissima, P. expansum, P. polonicum, C. cladosporioides, Cladosporium sp. and C. rosea was 4.0% individually. The occurrence frequency of Acremonium sp. and T. harzianum was 2.0%. However, Acremonium sp. and T. harzianum were recorded with a minimum occurrence frequency in cotton zone (Figure 3.3.4).

Table 3.3.3: Fungi found on different insects of suborder Sternorrhyncha (Hemiptera) in the cotton zone th * ** 2 Ni (No. of i species individually) ƭ ᵡ Total P Sr. Fungi isolates B. A. P. no tabaci gossypii solenopsis 1 Acremonium sp. 0 1 0 2.00 1.38 0.50 1 2 1 0 2 6.00 2.87 0.24 Aspergillus flavus 3 3 0 1 1 4.00 0.98 0.61 Aspergillus fumigatus 2 4 1 2 1 8.00 0.1 0.95 Aspergillus nidulans 4 5 1 2 0 6.00 1.28 0.53 Aspergillus oryzea 3 6 0 1 1 4.00 0.98 0.61 Alternaria sp. 2 1 1 0 4.00 0.86 0.65 Alternaria tenuissima 2 7 2 1 1 8.00 0.82 0.66 Beauveria bassiana 4 8 0 1 0 2.00 1.38 0.50 Beauveria brongniartii 1 9 0 1 0 2.00 1.38 0.50 Clonostachys rosea 1 10 1 0 1 4.00 1.46 0.48 Cladosporium sp. 2 11 Cladosporium 1 1 0 4.00 0.86 0.65 cladosporioides 2 12 0 0 1 2.00 2.57 0.28 Fusarium sp. 1 13 1 2 0 6.00 1.28 0.53 Fusarium equiseti 3 14 0 2 1 6.00 1.36 0.51 Fusarium incarnatum 3 15 1 2 1 8.00 0.1 0.95 Fusarium oxysporum 4 16 1 1 2 8.00 1 0.60 Fusarium solani 4 17 Metarhizium 1 0 1 4.00 1.46 0.48 anisopliae 2 18 1 0 0 2.00 2.33 0.31 Penicillium polonicum 1 19 0 0 1 2.00 2.57 0.28 Penicillium expansum 1 20 Trichoderma 0 0 0 0 1 longibrachiatum 0 21 Trichoderma 1 0 0 2.00 2.33 0.31 harzianum 1 22 1 2 0 6.00 1.28 0.53 Verticillium lecanii 3 23 0 0 0 0 1 Yeast 0 * 30 42 28 ƭ 50 Total 15 21 14 * = occurrence frequency in percentage **= Chi Square

Figure 3.3.3: Fungi found on individual insect of suborder Sternorrhyncha (Hemiptera) in the cotton zone (There were marked differences among the studied species)

Figure 3.3.4: Fungi found on different insects of suborder Sternorrhyncha (Hemiptera) in the cotton zone

3.3.2.1 Species diversity and similarities between different hosts in the cotton zone Species diversity from different hosts using Shannon and Simpson‟s indices gave similar results (Table 3.3.4). The species diversity index for A. gossypii was the highest, followed by A. gossypii and P. solenopsis. The species richness (S) for A. gossypii was highest, followed by B. tabaci and P. solenopsis in the cotton zone.

Similarities indices of fungal species among different hosts (Table 3.3.4) showed values and Sorenson similarity index of all insects was same in the cotton zone.

Table 3.3.4: Summary of fungal species diversity of suborder Sternorrhyncha (Hemiptera) in cotton zone B. tabaci A. gossypii P. solenopsis Shannon Index (H) 2.62 2.65 2.44 Simpson Index (1-D) 0.92 0.93 0.91 Species richness (S‟) 14 a 15 a 12 b Individual numbers 15 b 21a 14 b Evenness (Eh) 0.98 0.94 0.96 Sorenson similarity Index 1 1 1

3.3.3 Occurrence frequency of the central mixed zone A total of 300 samples of each insect were collected from the central mixed zone (Okara, Kasur, and Lahore) to analyze for the occurrence frequency and distribution of insect-associated fungi. The occurrence frequency of insect-associated fungi among all types of observed fungal species was 41.46 % highest on B. tabaci that was followed by 34.15 % from A. gossypii and 24.39 % lowest from P. solenopsis in the central mixed zone (Figure 3.3.5). Three different species of entomopathogenic fungi were found in the central mixed zone such as Verticillium lecanii, Beauveria bassiana and Metarhizium anisopliae with different occurrence frequency in each district on different host. The frequency of occurrence of individual entomopathogenic fungi species on different insects was variable among the central mixed zone. Among the four genera of entomopathogenic fungi, M. anisopliae (7.32%) was found with a maximum occurrence frequency followed by B. bassiana (4.88%) and V. lecanii (2.44%). V. lecanii was found with a minimum occurrence frequency as compared to others fungal species (Table 3.3.5).

Seventeen other fungal species from 9 genera were also found in the central mixed zone including Fusarium oxysporum, Fusarium equiseti, Fusarium incarnatum, Fusarium solani, Fusarium sp., Penicillium expansum, Aspergillus fumigatus, Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Alternaria tenuissima, Trichoderma longibrachiatum, Trichoderma harzianum, Cladosporium sp., Cladosporium cladosporioides and yeast with different

frequency in the central mixed zone. Total frequency of occurrence of these fungal species was variable within central mixed zone.

Among the seventeen fungal species A. nidulans was found with a maximum occurrence frequency of 12.2% as compared to A. flavus (9.76%), A. fumigatus, F. equiseti, F. incarnatum, F. oxysporum with occurrence frequencies of 7.32% individually. Total frequency of occurrence of C. cladosporioides, F. solani, Fusarium sp. and P. expansum was 4.88% in the central mixed zone. Although, Cladosporium sp., T. longibrachiatum, T. harzianum and yeast were recorded with a minimum occurrence frequency of 2.44% as compared to other fungal species in this zone (Figure 3.3.6).

Table 3.3.5: Fungi found on different insects of suborder Sternorrhyncha (Hemiptera) in the central mixed zone th * ** 2 Ni (No. of i species individually) ƭ ᵡ Total P Sr. Fungi B. A. P. isolates no tabaci gossypii solenopsis 1 Acremonium sp. 0 0 0 0 0 1 2 Aspergillus flavus 1 1 2 9.76 1.44 4 0.49 3 Aspergillus fumigates 0 2 1 7.32 2.27 3 0.32 4 Aspergillus nidulans 2 2 1 12.20 0.09 5 0.95 5 Aspergillus oryzea 0 0 1 2.44 3.09 1 0.21 6 Alternaria sp. 0 0 0 0 0 1 Alternaria tenuissima 1 0 0 2.44 1.41 1 0.49 7 Beauveria bassiana 1 0 1 4.88 1.26 2 0.53 8 Beauveria 0 0 0 0 1 brongniartii 0 9 Clonostachys rosea 0 0 0 0 0 1 10 Cladosporium sp. 1 0 0 2.44 1.41 1 0.49 11 Cladosporium 2 0 0 4.88 2.82 0.24 cladosporioides 2 12 Fusarium sp. 1 0 1 4.88 1.26 2 0.53 13 Fusarium equiseti 1 1 1 7.32 0.15 3 0.93 14 Fusarium incarnatum 1 2 0 7.32 1.71 3 0.42 15 Fusarium oxysporum 2 1 0 7.32 1.19 3 0.55 16 Fusarium solani 1 1 0 4.88 0.68 2 0.71 17 Metarhizium 2 0 1 7.32 1.58 0.45 anisopliae 3 18 Penicillium polonicum 0 0 0 0 0 1 19 Penicillium expansum 0 2 0 4.88 3.86 2 0.14 20 Trichoderma 0 0 1 2.44 3.09 0.21 longibrachiatum 1 21 Trichoderma 0 1 0 2.44 1.92 0.38 harzianum 1 22 Verticillium lecanii 1 0 0 2.44 1.41 1 0.49 23 Yeast 0 1 0 2.44 1.92 1 0.38 *ƭ 41.46 34.15 24.39 Total 17 14 10 41 * = occurrence frequency in percentage

**= Chi Square

Figure 3.3.5: Fungi found on individual insect of suborder Sternorrhyncha (Hemiptera) in the central mixed zone (There were marked differences among the studied species)

Figure 3.3.6: Fungi found on different insects of suborder Sternorrhyncha (Hemiptera) in the central mixed zone

3.3.3.1 Species diversity and similarities between different hosts in central mixed zone Species diversity from different hosts using Shannon and Simpson‟s indices gave similar results (Table 3.3.6).The species diversity index for B. tabaci was the highest, followed by A. gossypii and P. solenopsis. The species richness (S) for B. tabaci was highest, followed by A. gossypii and P. solenopsis in central mixed zone. Similarities indices of fungal species among different hosts (Table 3.3.6) showed values and Sorenson similarity index of all insects was same in the central mixed zone.

Table 3.3.6: Summary of fungal species diversity of suborder Sternorrhyncha (Hemiptera) in the central mixed zone B. tabaci A. gossypii P. solenopsis Shannon Index (H) 2.51 2.24 2.16 Simpson Index (1-D) 0.91 0.89 0.88 Species richness (S‟) 13 10 9 Individual numbers 17 14 10 Evenness (Eh) 0.94 0.94 0.97 Sorenson similarity Index 1 1 1

3.3.4 Species diversity and similarities between different collection sites

The maximum species diversity was found in hot arid zone followed by cotton zone and central mixed zone (Tables 3.3.1, 3.3.2, 3.3.3, 3.3.4 and 3.3.5). The highest individual number of fungi was found in the cotton zone (50 taxa) followed by the hot arid zone (49 taxa) and central mixed zone (41 taxa). The greatest species richness was recorded in the hot arid zone (44 taxa) followed by cotton zone (41 taxa) and central mixed zone (31 taxa).

3.4 VIRULENCE BIOASSAY OF DIFFERENT FUNGAL GENERA AGAINST BEMISIA TABACI The virulence of different species of 9 fungal genera isolated from different agroecological zones was assessed against 4th instar nymphal and adult stages of B. tabaci with 4x108 mL-1 and 4x104 mL-1 conidial suspension. The virulence of Beauveria, Metarhizium and Verticillium was promising while other fungal genera also showed incomparable results. The details virulence bioassays of individual fungal genera are described below.

3.4.1 Virulence of Trichoderma against 4th instar nymphal and adult stages of B. tabaci The virulence of two isolates of T. harzianum and T. longibrachiatum was evaluated against 4th instar nymphal stage of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 48 hours of incubation by T. longibrachiatum (4×108 mL-1) while T. harzianum (4×108 mL-1) started mortality after 72 hours. The highest virulence was observed by T. longibrachiatum isolates (4×108 mL-1) causing 35.87% mortality of B. tabaci nymphs after 2 days and 71.33% after 6 days as compared to T. harzianum caused 59.80 % mortality after 6 days. The mortality was reduced with the reduction in conidial suspension of T. longibrachiatum and T. harzianum. The mortality range of T. longibrachiatum was more consistent as compared to T. harzianum with different spore suspensions as represented in Table 3.4.1.

Table 3.4.1: Mortality range and percentage mortality of different species of Trichoderma against 4th instar nymphal stage of B. tabaci

Fungal taxa MORTALITY

Conidial

Sr. no Sr.

Conc.

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

T. % ± SD 35.87±6.58 39.94±5.38 59.97±7.58 69.97±7.81 71.33±7.32 4 x 10 8 de cd ab a a longibrachiatum % ± SD 19.94±5.25 24.3±6.53 35.82±4.62 39.86±6.87 40.27±6.89 1 4 x 10 4 f ef de cd cd

T. % ± SD --- 26.26±6.51 39.99±6.78 48.88±8.81 59.8±7.43 4 x 10 8 g ef cd bc ab harzianum 2 % ± SD --- 17.41±5.53 25.19±5.06 35.92±4.46 42.85±5.21 4 x 10 4 g ef ef cde cd LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of two isolates of T. harzianum and T. longibrachiatum was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 96 hours of incubation by T. longibrachiatum (4×108 mL-1) and T. harzianum (4×108 mL-1). The highest virulence was observed by T. longibrachiatum isolates (4×108 mL-1 spores/ml) causing 17.91% mortality of B. tabaci adults after 4 days and 18.92% after 6 days as compared to T. harzianum isolate (4×108 mL-1) killed more than 15.16% of adults within 4 days and caused 31.04% mortality of adults after 7 days. The mortality was reduced with the reduction in conidial suspension of T. longibrachaitum and T. harzianum. The mortality range of T. longibrachiatum was more consistent as compared to T. harzianum with different spore suspensions as represented in Table 3.4.2.

Table 3.4.2: Mortality range and percentage mortality of different species of Trichoderma against adult stage of B. tabaci Fungal taxa MORTALITY

Conidial

Sr. no Sr.

Conc.

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

T. 4 x 10 8 % ± SD ------17.91±6.31 23.97±8.15 35.79±7.72 g g cde bc a 1 longibrachiatum 4 x 10 4 % ± SD ------5.19±4.22 8.8±6.43 18.92±7.59 g g fg efg cd T. 4 x 10 8 % ± SD ------15.16±5.17 24.06±4.86 31.04±6.87 g g def bc ab 2 harzianum 4 x 10 4 % ± SD ------5.43±4.04 12.97±5.44 17.05±5.25 g g fg def cde LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of T. longibrachiatum and T. harzianum was compared on 4th instar nymphal and adult stages of B. tabaci. The T. longibrachiatum was virulent against 4th instar nymphal and adult stages after 6 days as compared to T. harzianum that showed less virulence against adults (figure 3.4.1).

Figure 3.4.1: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Trichoderma

3.4.2 Virulence of Cladosporium against 4th instar nymphal and adult stages of B. tabaci The virulence of six isolates of Cladosporium sp. and Cladosporium cladosporioides was evaluated against 4th instar nymphal stage of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 72 hours of incubation by Cladosporium sp. (4×108 mL-1) while C. cladosporioides (4×108 mL-1) started mortality after 96 hours. The highest virulence was observed by Cladosporium sp. isolates (4×108 mL-1) causing 8.43% mortality of B. tabaci nymphs after 2 days and 60.05% after 6 days as compared to C. cladosporioides causing no mortality after 2 days and caused 54.14% mortality after 6 days. The mortality was reduced with the reduction in conidial suspension of Cladosporium sp. and C. cladosporioides. The mortality range of Cladosporium sp. was more consistent as compared to C. cladosporioides with different spore suspensions as represented in Table 3.4.3.

Table 3.4.3: Mortality range and percentage mortality of different species of Cladosporium against 4th instar nymphal stage of B. tabaci

MORTALITY

Conidial

Sr. no Sr.

Conc. Fungal taxa mL

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

Cladosporium sp. 4 x 10 8 % ± SD --- 8.43±2.38 20.74±3.06 45.62±3.38 60.05±2.89 i h f c a 1 4 x 10 4 % ± SD ------12.52±3.02 30.9 ± 4.96 48.71±5.86 i i gh e bc Cladosporium 4 x 10 8 % ± SD ------15.19±4.55 42.78±3.55 54.14±3.73 i i g d b 2 cladosporioides 4 x 10 4 % ± SD ------13.27±4.31 28.65±4.41 44.16±3.06 i i g e c LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of six isolates of Cladosporium sp. and Cladosporium cladosporioides was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 96 hours of incubation by Cladosporium sp. (4×108 mL-1) and C. cladosporioides (4×108 mL-1). The highest virulence was observed by Cladosporium sp. isolates (4×108 mL-1) causing 7.05 % mortality of B. tabaci adults after 3 days and 35.57% after 6 days as compare to C. cladosporioides causing 4.50% mortality after 3 days and 40.25 % after 6 days. The mortality was reduced with reduction in conidial suspension of Cladosporium sp. and C. cladosporioides. The mortality range of Cladosporium sp. was more consistent as compared to C. cladosporioides with different spore suspensions as represented in Table 3.4.4. However, adults are less susceptible to Cladosporium as compared to 4th instar nymphal stage of B. tabaci.

Table 3.4.4: Mortality range and percentage mortality of different species of Cladosporium against adult stage of B. tabaci Fungal taxa Conidial MORTALITY

Sr. no Sr. Conc. AFTER -1 mL 48 hrs 72 hrs 96 hrs 120 hrs 144 hrs Cladosporium sp. 4 x 10 8 % ± SD ------7.05±2.69 15.48±4.70 35.57±7.19 f f de c a 1 4 x 10 4 % ± SD ------8.43±3.92 18.22±4.60 f f f d c Cladosporium 4 x 10 8 % ± SD ------4.5 ± 3.4 20.57±4.24 40.25±4.27 f f ef c a 2 cladosporioides 4 x 10 4 % ± SD ------13.45±3.14 23.15±4.52 f f f c b LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of Cladosporium and C. cladosporioides was compared on 4th instar nymphal and adult stages of B. tabaci. The Cladosporium was virulent against 4th instar nymphal and adult stages after 6 days as compared to C. cladosporioides that showed less virulence against adults (figure 3.4.2).

Figure 3.4.2: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Cladosporium

3.4.3 Virulence of Metarhizium and Verticillium against 4th instar nymphal and adult stages of B. tabaci The virulence of seven isolates of Metarhizium anisopliae and eight isolates of Verticillium lecanii was evaluated against 4th instar nymphal stage of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 48 hours of incubation by M. anisopliae (4×108 mL-1). The highest virulence was observed by M. anisopliae isolates (4×108 mL-1) causing 10.14% mortality of B. tabaci nymphs after 1 day and 100% after 6 days. While the mortality of the nymphs started after 96 hours of incubation by V. lecanii (4×108 mL-1). V. lecanii isolates (4×108 mL-1) showed highest virulence causing 10.45 % mortality of B. tabaci nymphs after 3 days and 65.51% after 6 days. The mortality was reduced with the reduction in conidial suspension of M. anisopliae and V. lecanii.

The mortality range of M. anisopliae was more consistence as compared to V. lecanii with different spore suspensions as represented in Table 3.4.5.

Table 3.4.5: Mortality range and percentage mortality of different species of Metarhizium and Verticillium against 4th instar nymphal stage of B. tabaci

MORTALITY

Conidial

Sr. no Sr.

Co Fungal taxa mL

nc.

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

Metarhizium % ± SD 10.14±2.26 40.53±2.97 70.11±2.70 88.21±3.41 100 ± 0.00 4 x 10 8 j h d b a anisopliae. 1 % ± SD --- 12.39±2.20 30.82±2.37 54.16±3.75 78.56±1.96 4 x 10 4 k j i f c Verticillium % ± SD ------10.45±2.26 45.77±2.01 80.38±3.16 4 x 10 8 k k j g c 2 Lecanii % ± SD ------30.89±2.90 65.51±2.34 4 x 10 4 k k k i e LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of seven isolates of M. anisopliae and eight isolates of V. lecanii was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 72 hours of incubation by M. anisopliae (4×108 mL-1). The highest virulence was observed by M. anisopliae isolates (4×108 mL-1) causing 8.23% mortality of B. tabaci adults after 2 days and 70.17% after 6 days. While, the mortality of the adults started after 120 hours of incubation by V. lecanii (4×108 mL-1). V. lecanii isolates (4×108 mL-1) showed highest virulence causing 40.05% mortality of B. tabaci adults after 5 days and 62.39% after 6 days. The mortality was reduced with the reduction in conidial suspension of M. anisopliae and V. lecanii. The mortality range of M. anisopliae was more consistence as compared to V. lecanii with different spore suspensions as represented in Table 3.4.6.

Table 3.4.6: Mortality range and percentage mortality of different species of Metarhizium and Verticillium against adult stage of B. tabaci Fungal taxa MORTALITY

Conidial

Sr. no Sr.

Conc. Conc.

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

Metarhizium 4 x 10 8 % ± SD --- 8.23±2.39 25.49±4.00 44.05±3.37 70.17±3.80 k j g d a 1 anisopliae 4 x 10 4 % ± SD ------12.78±2.18 30.83±3.01 52.25±4.56 k k i f c Verticillium 4 x 10 8 % ± SD ------20.33±3.59 44.59±4.28 k k k e b 2 Lecanii 4 x 10 4 % ± SD ------20.33±3.59 44.59±4.28 k k k h d LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of M. anisopliae and V. lecanii was compared on 4th instar nymphal and adult stages of B. tabaci. M. anisopliae was virulent against 4th instar nymphal and adult stages after 6 days as compared to V. lecanii that showed less virulence against adults (figure 3.4.3).

Figure 3.4.3: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Metarhizium and Verticillium

3.4.4 Virulence of Beauveria against 4th instar nymphal and adult stages of B. tabaci The virulence of eight isolates of Beauveria bassiana and two isolates of Beauveria brongniartii was evaluated against 4th instar nymphal stage of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 48 hours of incubation by B. bassiana (4×108 mL-1) while B. brongniartii (4×108 mL-1) started mortality after 72 hours. The highest virulence was observed by B. bassiana isolates (4×108 mL-1) causing 8.86% mortality of B. tabaci nymphs after 2 days and 100% after 6 days as compared to B. brongniartii causing no mortality after 2 days and 99.25% after 6 days. The mortality was reduced with the reduction in conidial suspension of B. bassiana and B. brongniartii. The mortality range of was B. bassiana more consistence as compared to B. brongniartii with different spore suspensions as represented in Table 3.4.7.

Table 3.4.7: Mortality range and percentage mortality of different species of Beauveria against 4th instar nymphal stage of B. tabaci

MORTALITY

Conidial

Sr. no Sr.

Conc. Fungal taxa mL

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

Beauveria % ± SD 8.86±1.77 58.11±3.00 78.35±3.63 99.53±1.02 100±0 4 x 10 8 j f c a a bassiana % ± SD --- 25.43±2.73 48.58±2.28 69.31±3.75 85.75±2.60 1 4 x 10 4 k i g e b Beauveria % ± SD --- 40.72±4.99 72.43±4.13 88.08±4.62 99.25±1.06 4 x 10 8 k h de b a 2 brongniartii % ± SD --- 26.10±5.13 42.64±3.85 58.45±10.15 77.38±4.03 4 x 10 4 k i h f cd LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of eight isolates of B. bassiana and two isolates of B. brongniartii was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 72 hours of incubation by B. bassiana (4×108 mL-1) while B. brongniartii (4×108 mL-1) started mortality after 96 hours. The highest virulence was observed by B. bassiana isolates (4×108 mL-1) causing 8.63% mortality of B. tabaci adults after 3 days and 100% after 6 days as compared to B. brongniartii causing no mortality after 3 days and 65.01% after 6 days. The mortality was reduced with the reduction in conidial suspension of B. bassiana and B. brongniartii. The mortality range of B.

bassiana was more consistent as compared to B. brongniartii with different spore suspensions as represented in Table 3.4.8.

Table 3.4.8: Mortality range and percentage mortality of different species of Beauveria against adult stage of B. tabaci

Fungal taxa MORTALITY

Conidial

Sr. no Sr.

Conc.

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

Beauveria 4 x 10 8 % ± SD --- 8.63±2.12 58.72±3.68 78.24±3.03 100±0 l K e b a 1 bassiana 4 x 10 4 % ± SD ------25.36±3.03 51.81±4.44 71.57±4.99

l L hi f c Beauveria 4 x 10 8 % ± SD ------23.08±3.63 48.61±5.22 65.01±6.26 l L i fg d 2 brongniartii 4 x 10 4 % ± SD ------13.42±5.78 29.27±6.43 45.76±4.71 l L j h g LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of B. bassiana and B. brongniartii was compared on 4th instar nymphal and adult stages of B. tabaci. The B. bassiana was virulent against 4th instar nymphal and adult stages after 6 days as compared to B. brongniartii that showed less virulence against adults (figure 3.4.4).

Figure 3.4.4: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Beauveria.

3.4.5 Virulence of Fusarium against 4th instar nymphal and adult stages of B. tabaci The virulence of eight isolates of F. solani and F. incarnatum, eleven isolates of F. oxysporum, nine isolates of F. equiseti and five isolates of Fusarium sp. was evaluated against 4th instar nymphal stage of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 48 hours of incubation by Fusarium sp. (4×108 mL-1) while F. oxysporum (4×108 mL-1) started mortality after 72 hours. The highest virulence was observed by Fusarium sp. isolates (4×108 mL-1) causing 6.66% mortality of B. tabaci nymphs after 2 days and 97.9% after 6 days as compared to F. oxysporum causing no mortality after 2 days and 95.5 % after 6 days. F. solani and F. equiseti started mortality of the nymphs after 48 hours of incubation while F. incarnatum (4×108 mL-1) started mortality after 72 hours. The highest virulence was observed by F. solani isolates (4×108 mL-1) causing 5.75% mortality of B. tabaci nymphs after 2 days and 64.25% after 6 days as compared to F. incarnatum causing no mortality after 2 days and 97.5 % after 6 days. The highest virulence was recorded by F. equiseti causing 17 % mortality of B. tabaci nymphs after 2 days and 96 % after 6 days. The mortality was reduced with reduction in conidial suspension of Fusarium sp. (Table 3.4.9)

Table 3.4.9: Mortality range and percentage mortality of different species of Fusarium against 4th instar nymphal stage of B. tabaci

Sr. no Fungal taxa mL Conc. MORTALITY

Conidial

AFTER

- 1 48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

1 Fusarium sp. 4 x 10 8 % ± SD 6.66±3.73 13.34±5.40 52.40±11.78 76.4±8.05 97.9±3.36 j i f d a 4 x 10 4 % ± SD --- 6.40 ±3.27 19.46±4.69 70.25±10.70 96.66±3.67 j j h de a 2 4 x 10 8 % ± SD 17.01±4.15 40.27±9.99 76.19 ±14.9 82.52±7.68 96.33±4.75 hi g d bcd a F. equiseti 4 x 10 4 % ± SD --- 22.72±3.33 50.47±9.50 72.05±12.90 86.67±10.06 k h f d bc 3 F. incarnatum 4 x 10 8 % ± SD --- 18.85±3.38 51.33±6.59 72.44±5.08 97.5±2.41 k h f d a 4 x 10 4 % ± SD --- 12.22±2.70 33.75±3.78 65.22±2.91 96.14±3.51 k i gh e a 4 F. oxysporum 4 x 10 8 % ± SD --- 22.45±7.36 63.22±5.99 82.22±4.99 95.5±4.47 k h e b a

4 x 10 4 % ± SD --- 19.5±3.82 38.55±4.95 72.75±5.49 89.45±5.96 k h g d b 5 F. solani 4 x 10 8 % ± SD 5.75±2.61 12.5±4.07 28.55±5.30 43.56±4.49 64.25±7.09 j i h g e 4 x 10 4 % ± SD --- 6.68±2.79 19.87±5.31 32.18±5.88 46.5±6.88 k j h gh g LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of eight isolates of F. solani and F. incarnatum, eleven isolates of F. oxysporum, nine isolates of F. equiseti and five isolates of Fusarium sp. was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 144 hours of incubation by Fusarium sp. and F. equiseti (4×108 mL-1) while F. oxysporum (4×108 mL-1) started mortality after 120 hours. However, F. solani and F. incarnatum showed zero mortality on adults of B. tabaci. The highest virulence was observed by F. oxysporum causing 6.65 % mortality on adults after 5 days 17.5 % after 6 days. Fusarium sp. causing 5.60 % mortality on adults after 5 days and F. equiseti 6.34 % mortality after 6 days. The mortality was reduced with reduction in conidial suspension of Fusarium sp. (Table 3.4.10)

Table 3.4.10: Mortality range and percentage mortality of different species of Fusarium against adult stage of B. tabaci

Sr. no Fungal taxa mL Conc. MORTALITY

nidial AFTER

- 1 48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

1 Fusarium sp. 4 x 10 8 % ± SD ------5.60 ±3.79 e e e e cd 4 x 10 4 % ± SD ------4.45 ±3.22 e e e e d 2 F. equiseti 4 x 10 8 % ± SD ------6.34 ±4.28 e e e e c 4 x 10 4 % ± SD ------4.21 ±2.30 e e e e d 3 F. incarnatum 4 x 10 8 % ± SD ------e e e e e 4 x 10 4 % ± SD ------e e e e e 4 F. oxysporum 4 x 10 8 % ± SD ------6.65±3.38 17.5±3.36 e e e e a 4 4 x 10 % ± SD ------4.22±2.13 8.48 ±3.10 e e e e b 5 F. solani 4 x 10 8 % ± SD ------e e e e e 4 x 10 4 % ± SD ------e e e e e LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of Fusarium sp. was compared on 4th instar nymphal and adult stages of B. tabaci. The F. incarnatum was virulent against 4th instar nymphal and adult stages after 6 days as compared to other Fusarium sp. that showed less virulence against adults (figure 3.4.5).

Figure 3.4.5: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Fusarium spp

3.4.6 Virulence of Clonostachys rosea and Acremonium sp. against 4th instar nymphal and adult stages of B. tabaci The virulence of three isolates of Clonostachys rosea and two isolates of Acremonium sp. was evaluated against nymphs of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 96 hours of incubation by C. rosea (4×108 mL-1). The highest virulence was observed by C. rosea isolates (4×108 mL-1) causing 16.33% mortality of B. tabaci nymphs after 4 days and 50.42% after 6 days. While, the mortality of the nymphs started after 72 hours of incubation by Acremonium (4×108 mL-1). Acremonium isolates (4×108 mL-1) showed highest virulence causing 21.29% mortality of B. tabaci nymphs after 3 days and 67.66% after 6 days. The mortality was reduced with the reduction in conidial suspension of C. rosea and Acremonium. The mortality range of Acremonium was more consistent as compared to C. rosea with different spore suspensions as represented in Table 3.4.11.

100

Table 3.4.11: Mortality range and percentage mortality of different species of Clonostachys and Acremonium against 4th instar nymphal stage of B. tabaci MORTALITY

Conidial

Sr. no Sr.

Conc. Conc. Fungal taxa mL AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

------16.30±5.65 37.19±4.15 50.42±4.05 % ± SD Clonostachys 4 x 10 8 j j h d b 1 rosea. ------10.33±4.05 25.51±3.53 41.64±5.32 % ± SD 4 x 10 4 j j hi f cd --- 21.29±6.46 37.83±6.63 52.07±3.85 67.66±4.84 8 % ± SD Acremonium sp. 4 x 10 j fg d b a 2 --- 11.83±3.32 21.69±5.74 32.95±5.90 45.69±7.44 % ± SD 4 x 10 4 j hi fg e bc LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of three isolates of C. rosea and two isolates of Acremonium sp. was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 120 hours of incubation by C. rosea (4×108 mL-1). The highest virulence was observed by C. rosea isolates (4×108 mL-1) causing 8.88 % mortality of B. tabaci adults after 5 days and 23.40 % after 6 days. While the mortality of the adults started after 72 hours of incubation by Acremonium (4×108 mL-1). Acremonium isolates (4×108 mL-1) showed highest virulence causing 7.30 % mortality of B. tabaci adults after 3 days and 31.82% after 6 days. The mortality was reduced with the reduction in conidial suspension of C. rosea and Acremonium sp. The mortality range of Acremonium was more consistent as compared to C. rosea with different spore suspensions as represented in Table 3.4.12.

Table 3.4.12: Mortality range and percentage mortality of different species of Clonostachys and Acremonium against adult stage of B. tabaci MORTALITY

Conidial

Sr. no Sr.

Conc. Conc. Fungal taxa mL

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

------8.88±2.54 23.40±4.98 Clonostachys 8 % ± SD 1 4 x 10 h h h ef b rosea ------6.47±2.43 16.67±2.73 % ± SD 4 x 10 4 h h h fg c --- 7.30±4.46 15.01±3.76 23.61±5.90 31.82±4.71 % ± SD 4 x 10 8 h fg cd b a 2 Acremonium sp. --- 2.33±3.29 5.96±3.08 9.82±3.61 13.67±2.53 % ± SD 4 x 10 4 h gh fg def cde LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

101

The virulence of Clonostachys rosea and Acremonium was compared on 4th instar nymphal and adult stages of B. tabaci. The Acremonium was virulent against 4th instar nymphal and adult stages after 6 days as compare to C. rosea that showed less virulence against adults (figure 3.4.6).

Figure 3.4.6: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Clonostachys and Acremonium

3.4.7 Virulence of Penicillium against 4th instar nymphal and adult stages of B. tabaci The virulence of two isolates of Penicillium polonicum and five isolates of Penicillium expansum was evaluated against nymphs of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the nymphs started after 72 hours of incubation by P. polonicum (4×108 mL-1) and P. expansum (4×108 mL-1). The highest virulence was observed by P. polonicum isolates (4×108 mL-1) causing 6.72% mortality of B. tabaci nymphs after 3 days and 44.06% after 6 days as compared to P. expansum causing 8.78% mortality after 2 days and 44.36% after 6 days. The mortality was reduced with reduction in conidial suspension of P. polonicum and P. expansum (Table 3.4.13).

102

Table 3.4.13: Mortality range and percentage mortality of different species of Penicillium against 4th instar nymphal stage of B. tabaci MORTALITY

Conidial

Sr. no Sr.

Conc. Fungal taxa mL

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

Penicillium polonicum --- 6.72±2.93 14.65±7.22 28.48±10.03 44.06±9.64 4 x 10 8 % ± SD d cd c b a 1 --- 5.61±2.91 13.17±6.05 22.39±1.5 42.31±8.29 4 x 10 4 % ± SD d cd c b a Penicillium --- 8.78±6.37 14.28±5.80 29.91±10.10 44.36±10.97 a 4 x 10 8 % ± SD d cd c b 2 expansum --- 7.94±6.04 12.84±5.62 25.69±9.37 45.16±10.95 4 x 10 4 % ± SD d cd cd b a LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of two isolates of P. polonicum and five isolates of P. expansum was evaluated against adults of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial suspension. The mortality of the adults started after 120 hours of incubation by P. polonicum (4×108 spores/ml) and P. expansum (4×108 mL- 1). The highest virulence was observed by P. polonicum isolates (4×108 mL-1) causing 10.6% mortality of B. tabaci adults after 5 days and 22.40% after 6 days as compared to P. expansum causing 15.69% mortality after 5 days and 27.59% after 6 days. The mortality was reduced with the reduction in conidial suspension of P. polonicum and P. expansum. However, adults are less susceptible to P. polonicum and P. expansum as compared to 4th instar nymphal stages of B. tabaci (Table 3.4.14) Table 3.4.14: Mortality range and percentage mortality of different species of Penicillium against adult stage of B. tabaci Fungal taxa MORTALITY

Conidial

Sr. no Sr.

Conc. Conc.

- AFTER

48 hrs 72 hrs 96 hrs 120 hrs 144 hrs

------10.6±4.62 22.40±7.30 4 x 10 8 % ± SD d d d c ab 1 Penicillium polonicum ------9.8±4.00 23.22±6.27 4 x 10 4 % ± SD d d d c ab ------15.69±7.44 27.59±8.64 4 x 10 8 % ± SD Penicillium d d d bc a 2 Expansum ------11.83±7.56 25.49±8.63 4 x 10 4 % ± SD d d d c a LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of P. polonicum and P. expansum was compared on 4th instar nymphal and adult stages of B.tabaci. The P. expansum was virulent against 4th instar

103

nymphal and adult stages after 6 days as compared to P. polonicum that showed less virulence against adults (figure 3.4.7).

Figure 3.4.7: Comparison in percentage mortality of 4th instar nymphs and adults of B. tabaci by different concentration of Penicillium

3.4.8 Virulence of different fungi against 4th instar nymphal and adult stages of B. tabaci The virulence of different fungal species was evaluated against the 4th instar nymphal stage of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL- 1 conidial suspension. The 100% mortality of B. tabaci nymphs was observed by B. bassiana, M. anisopliae and B. brongniartii isolates (4×108 mL-1) after 6 days and as compared to V. lecanii showed 80.38% mortality within same time duration. While, many Fusarium species also showed 95-98% mortality after 6 days and minimum mortality rate of 44-50% was recorded by P. polonicum, P. expansum, Clonostachys rosea and C. cladosporioides with conidial suspension of 4×108 mL-1. The mortality was reduced with the reduction in conidial suspension of all fungal species.

The virulence of different fungal species was evaluated against adult stages of B. tabaci on G. hirsutum plants by using 4×108 mL-1 and 4×104 mL-1 conidial

104

suspension. The highest virulence was observed by B. bassiana (4×108 mL-1) causing 100% mortality of B. tabaci adults after 6 days. While, M. anisopliae and B. brongniartii isolates showed 65-70% mortality within the same time period as compared to F. incarnatum causing no mortality after 6 days. The minimum mortality rate of 5-17% was recorded by Fusarium sp, F. equiseti and F. oxysporum with conidial suspension of 4×108 mL-1. The mortality was reduced with the reduction in conidial suspension of all fungal species. The mortality of different fungi with different spore suspensions against 4th instar and adult stages are represented in the figures 3.4.8 and 3.4.9.

105

Figure 3.4.8: Percentage Mortality of fungal species against B. tabaci 4th instar Nymphal stage and adult stages (Conc. 4x108)

106

Figure 3.4.9: Percentage Mortality of fungal species against B. tabaci 4th instar Nymphal stage and adult stages (Conc. 4x104)

107

A B C

D E F

G H

Plate 3.4.1: The infection of different fungi on B. tabaci 4th instar nymph. (A) T. longibrachiatum (B) Cladosporium sp. (C) M. anisopliae (D) V. lecanii (E) B. bassiana (F) F. equiseti (G) C. rosea (H) P. polonicum

108

A B C

D E F

G H

Plate 3.4.2: The infection of different fungi on adult B. tabaci. (A) T. longibrachiatum (B) Cladosporium sp. (C) M. anisopliae (D) V. lecanii (E) B. bassiana (F) F. equiseti (G) C. rosea (H) P. polonicum

109

3.5 ISOLATION AND CHARACTERIZATION OF CHITINASES FROM ENTOMOPATHOGENIC FUNGI

3.5.1 Isolation of endochitinase Chit1 and Chit2 Chitinase gene was isolated from genomic DNA of B. bassiana, M. aniopliae and T. longibrachiatum through PCR using the primers design based on chitinase conserved domain sequences (table 3.5.1). The amplification of chitinase genes from genomic DNA of different fungal isolates were shown in figure 3.5.1. The PCR reaction produced an expected size ~1 kb bands for Chit1 from B. bassiana, M. aniopliae and T. longibrachiatum while ~1.5 kb band was found for Chit2 from M. anisopliae isolate Tn-16.

Table 3.5.1: PCR finding with different set of Primers Sr. No Fungal Strain Primer Amplicon size 1 Metarhizium anisopliae (Tn-16) Meta_Chit_1 1000 bp Meta_Chit_2 1400 bp 2 Metarhizium anisopliae (Tn-25) Meta_Chit_1 1000 bp 3 Trichoderma longibrachiatum (SR) Tri_Chit_1 900 bp 4 Beauveria brongniartii (Tn-9) Buv_Chit_1 1100 bp 5 Beauveria bassiana (Tn-13) Buv_Chit_1 1100 bp 6 Beauveria bassiana Buv_Chit_1 1000 bp (Tn-27)

The partial endochitinase Chit1 and Chit 2 were cloned in pGEM T-easy vector. Recombinant clones were confirmed through restriction digestion (figure 3.5.2). The amplicon of 1 kb was observed with gene specific primer and fragment size of 1 kb gene insert was released from recombinant vectors using EcoR1 restriction enzyme and also confirmed after sequencing of recombinant plasmids.

110

M -ve Tn-25 SR Tn-16 Tn-9 Tn-13 Tn-27 Tn-16 Chit1 Chit1 Chit1 Chit1 Chit1 Chit1 Chit2

1000 bp

Figure 3.5.1: PCR confirmation of partial endochitinase Chit1 and Chit2 from B. bassiana, M. aniopliae and T. logibrachiatum. M = Promega 1 Kb DNA Plus Ladder.

M -ve Tn-16 Tn-25 SR Tn-16 Tn-9 Tn-13 Tn-27 Chi2 Chit1 Chit1 Chit1 Chit1 Chit1 Chit1

3000 bp Plasmid

1000 bp Restricted fragment

Figure3.5.2: Restriction analysis of transformed plasmid by using EcoR1restriction enzyme.

The partial cloned endochitinase gene in pGEM T easy vector (about 1.3 kb) was sequenced using M13 primers employing primer walking technique. Vector sequences were removed from nucleotide sequence through GENE TOOL and

111

subjected to BLAST analysis. It showed homology with conserved domain of glycosyl hydrolases family 18. The sequence of cloned fragment was subjected to BLASTn and showed that the nucleotide sequence of Chit1 and Chit2 has maximum similarity to endochitinases from other entomopathogenic fungi. The Chit1 and Chit2 showed 93%, 94%, 96%, 98%, 99% homology to endchitinases from M. anisopliae Chit1 (AF027498), M. anisopliae Chit2 (DQ011663), M. anisopliae Chit2 (FJ609319), B. bassiana Chit1 (EU828354), T. logibrachiatum Chit1 (GU180607) respectively.

3.5.2 Characterization of Endochitinase Chit1 and Chit2

3.5.2.1 Characterization of endochitinase Chit1 from B. bassiana isolate Tn-13 Endochitinase gene, Chit1 was isolated from genomic DNA of B. bassiana isolate Tn-13. Endochitinase gene was comprised of 346 amino acids; encoded a protein Chit1 and lack signal peptide. Encoded protein has molecular mass of 36.81 kDa and chitinase of B. bassiana (isolate Tn-13) was acidic in nature with pI value of 5.16 (Table 3.5.2). Conserved domain search analysis revealed that Chit1 consists of two domains, a chitin-binding domain and a catalytic glycosyl hydrolase family 18 (GH18) domain. The chitin-binding domain was located at C-terminal to the catalytic domain. It was evaluated on the basis of sequence alignment that structural motifs that were responsible for substrate binding SIGG (SxGG) and catalytic motif DGIDIDIESG (DxxDxDxE) were highly conserved in Chit1 (shown in black box in Fig. 3.5.3). The potential substrate binding site was placed at 105 aa site and catalytic active site was positioned at 138 aa site. BLAST analysis showed that sequence of Chit1 revealed 94% of identity with amino acid sequence of B. bassiana strain (ACZ28129 and KGQ05237).

112

Table 3.5.2: Comparison of the active sites and amino acid residues of the family 18 endochitinases Species Total no Molecular pI Signal Residues Sequences of of wt. value peptides of active active site residues sites B. bassiana 346 36.81kDa 5.16 _ _ 138-147 DGIDIDIESG (Tn-13) B. bassiana 323 34.30kDa 5.99 ++ 156-165 DGIDIDIESG (Tn-27) B. brongniartii 323 34.30 kDa 599 _ _ 138-147 DGIDIDIESG (Tn-09) M. anisopliae 299 32.48 kDa 8.43 _ _ 97-106 DGIDVDWEYP (Tn-16) M. anisopliae 255 27.73 kDa 5.05 _ _ 43-52 DGIDVDWEYP (Tn-25) T. 216 23.41 kDa 4.46 _ _ 7-16 DGIDIDWEYP longibrachiatum (SR) M. anisopliae 306 32.73 kDa 7.37 _ _ 77-86 NGFDFDIEVN (Tn-16Pak)

Figure 3.5.3: Nucleotides along deduced amino acids indicated below codons of Buv_Chit1 gene of B. bassiana isolate Tn-13. Substrate binding and catalytic domains are highlighted while start and stop codons are represented in bold.

3.5.2.2 Characterization of endochitinase Chit1 from B. bassiana isolate Tn-27 Endochitinase gene, Chit1 was isolated from genomic DNA of B. bassiana isolate Tn-27. Endochitinase gene was comprised of 323 amino acids; encoded a

113

protein Chit1 and contained signal peptide. Encoded protein has molecular mass of 34.30 kDa and chitinase of B. bassiana (isolate Tn-27) was acidic in nature with pI value of 5.99 (Table 3.5.2). Conserved Domain search analysis revealed that Chit1 consist of two domains, a chitin-binding domain and a catalytic glycosyl hydrolase family 18 (GH18) domain. The chitin-binding domain was located at C-terminal to the catalytic domain. It was evaluated on the basis of alignment of sequences that structural motifs that were responsible for substrate binding SIGG (SxGG) and catalytic motif DGIDIDIESG (DxxDxDxE) were highly conserved in Chit1 (shown in black box in Fig. 3.5.4). The potential substrate binding site was placed at 123 aa site and catalytic active site was positioned at 156 aa site. BLAST analysis showed that sequence of Chit1 revealed 95% of identity with amino acid sequence of B. bassiana strain (ACZ28129 and ADP44708).

Figure 3.5.4: Nucleotides along deduced amino acids indicated below codons of Buv_Chit1 gene of B. bassiana isolate Tn-27. Substrate binding and catalytic domains are highlighted while start codon is represented in bold.

3.5.2.3 Characterization of endochitinase Chit1 from B. brongniartii isolate Tn-09 Chit1 gene was amplified from genomic DNA of B. brongniartii isolate Tn- 09. Endochitinase gene was comprised of 323 amino acids; encoded a protein Chit1 and lack signal peptide. Encoded protein has molecular mass of 34.30 kDa and

114

chitinase of B. bassiana (isolate Tn-09) was acidic in nature with pI value of 5.99 (Table 3.5.2). Conserved Domain search analysis revealed that Chit1 consists of two domains, a chitin-binding domain and a catalytic glycosyl hydrolase family 18 (GH18) domain. The chitin-binding domain was located at C-terminal to the catalytic domain. It was evaluated on the basis of sequence alignment that structural motifs that were responsible for substrate binding SIGG (SxGG) and catalytic motif DGIDIDIESG (DxxDxDxE) were highly conserved in Chit1 (shown in black box in Fig. 3.5.5). The potential substrate binding site was placed at 105 aa site and catalytic active site was positioned at 138 aa site. BLAST analysis showed that sequence of Chit1 revealed 95% of identity with amino acid sequence of B. brongniartii (ACZ28129 and ADP44708).

Figure 3.5.5: Nucleotides along deduced amino acids indicated below codons of Buv_Chit1 gene of B. brongniartii isolate Tn-09. Substrate binding and catalytic domains are highlighted while start codon is represented in bold.

3.5.2.4 Characterization of endochitinase Chit1 from M. anisopliae isolate Tn-16 Endochitinase gene, Chit1 was isolated from genomic DNA of M. anisopliae isolate Tn-16. Endochitinase gene was composed of 299 amino acids; encoded a mature protein Chit1 and lack signal peptide. Encoded protein has molecular mass of 32.48 kDa and chitinase of M. anisopliae isolate (Tn-16) was basic in nature with pI

115

value of 8.43 (Table 3.5.2). Conserved Domain search analysis revealed that Chit1 consists of two domains, a chitin-binding domain and a catalytic glycosyl hydrolase family 18 (GH18) domain. The chitin-binding domain was located at C-terminal to the catalytic domain. It was evaluated on the basis of sequence alignment that structural motifs that were responsible for substrate binding SIGG (SxGG) and catalytic motif DGIDVDWEYP (DxxDxDxE) were highly conserved in Chit1 (shown in black box in Fig. 3.5.6). The potential substrate binding site was placed at 60 aa site and catalytic active site was positioned at 97 aa site. BLAST analysis showed that sequence of Chit1 revealed 97% of identity with amino acid sequence of M. anisopliae strain (ACU30520 and AAY32603).

Figure 3.5.6: Nucleotides along deduced amino acids indicated below codons of Met_Chit1 gene of M. anisopliae isolate Tn-16. Substrate binding and catalytic domains are highlighted while start and stop codons are represented in bold 3.5.2.5 Characterization of endochitinase Chit1 from M. anisopliae isolate Tn-25 Endochitinase gene, Chit1 was isolated from genomic DNA of M. anisopliae isolate TN-25. Endochitinase gene was comprised of 255 amino acids; encoded a protein Chit1 and lack signal peptide. Encoded protein has molecular mass of 27.73 kDa and chitinase of M. anisopliae isolate (Tn-25) was acidic in nature with pI value of 5.05 (Table 3.5.2). Conserved Domain search analysis revealed that Chit1 consists of two domains, a chitin-binding domain and a catalytic glycosyl hydrolase family 18

116

(GH18) domain (Fig. 3.5.14). The chitin-binding domain was located at C-terminal to the catalytic domain. It was evaluated on the basis of sequence alignment that structural motifs that were responsible for substrate binding SIGG (SxGG) and catalytic motif DGIDVDWEYP (DxxDxDxE) were highly conserved in Chit1 (shown in black box in Fig. 3.5.7). The potential substrate binding site was placed at 6 aa site and catalytic active site was positioned at 43 aa site. BLAST analysis showed that sequence of Chit1 revealed 98% of identity with amino acid sequence of M. anisopliae strain (KJK95695 and ACU30519).

Figure 3.5.7: Nucleotides along deduced amino acids indicated below codons of Met_Chit1 gene of M. anisopliae isolate Tn-25. Substrate binding and catalytic domains are highlighted while start codon is represented in bold.

3.5.2.6 Characterization of endochitinase Chit2 from M. anisopliae isolate Tn-16 Endochitinase gene, Chit2 was isolated from genomic DNA of M. anisopliae isolate TN-16PK. Endochitinase gene was comprised of 306 amino acids; encoded a protein Chit2 and lack signal peptide. Encoded protein has molecular mass of 32.73 kDa and chitinase of M. anisopliae isolate (Tn-16PK) was basic in nature with pI value of 7.37 (Table 3.5.2). Conserved Domain search analysis revealed that Chit2 consists of a catalytic glycosyl hydrolase family 18 (GH18) domain. It was evaluated on the basis of sequence alignment that structural motif that was responsible for catalytic motif NGFDFDIEVN (DxxDxDxE) was highly variable in Chit2 (shown in

117

black box in Fig. 3.5.8). The potential catalytic active site was positioned at 77 aa site. BLAST analysis showed that sequence of Chit2 revealed 93% of identity with amino acid sequence of M. anisopliae strain (KJK78139 and ACU30524).

Figure 3.5.8: Nucleotides along deduced amino acids indicated below codons of Met_Chit2 gene of M. anisopliae isolate Tn-16. Substrate binding domain is underlined and catalytic domains are highlighted while start and stop codons are represented in bold.

3.5.2.7 Characterization of endochitinase Chit1 from T. longibrachiatum isolate SR Endochitinase gene, Chit1 was isolated from genomic DNA of T. longibrachiatum isolate SR. Endochitinase gene was comprised of 216 amino acids; encoded a protein Chit1 and lack signal peptide. Encoded protein has molecular mass of 23.41 kDa and chitinase of T. longibrachiatum isolate (SR) was acidic in nature with pI value of 4.46 (Table 3.5.2). Conserved Domain search analysis revealed that Chit1 consists of a catalytic glycosyl hydrolase family 18 (GH18) domain (Fig. 3.5.9). It was evaluated on the basis of sequence alignment that structural motif that was responsible for catalytic motif DGIDVDWEYP (DxxDxDxE) was highly conserved in Chit1 (shown in black box in Fig. 3.5.17). The potential substrate binding site was placed at 6 aa site and catalytic active site was positioned at 43 aa site. BLAST

118

analysis showed that sequence of Chit1 revealed 99% of identity with amino acid sequence of T. longibrachiatum strain (ACD46738 and CDM98718).

Figure 3.5.9: Nucleotides along deduced amino acids indicated below codons of Tri_Chit1 gene of T. longibrachiatum isolate SR. Catalytic domain is highlighted and start codon is represented in bold

3.5.3 Phylogenetic analysis of endochitinase of family 18 glycosyl hydrolases Phylogenetic analysis was carried out to consider the evolutionary relationship between the fungal chitinases of Beauveria, Metarhizium and Trichoderma. A neighbor-joining tree was assembled by using the ClustalW program on the basis of the available endochitinase sequences in NCBI database. In neighbor-joining tree, endochitinase of fungal isolates grouped into five different clades and showed maximum homology to fungal class 18 basic chitinases as determined by a multi domain structure analysis. Endochitinase (Chit1) from isolates of B. bassiana and B. brongniartii fell into two clades that included B. bassiana Chit1 (GUO73382 and AY145440) and B. brongniartii Chit1 (KF559204). Neighbor joining tree revealed that Chit1 of T. longibrachiatum isolate was classified into a clade that included T. longibrachiatum Chit1 (HG931311 and HG931317) with maximum similarities of Chit1 endochitinase. M. anisopliae isolate of Chit1 was classified into distant clade and showed maximum similarities with Chit1 of M. anisopliae (FJ609315 and

119

AY758593). Whereas, endochitinase (Chit2) isolated in this study from M. anisopliae formed a distinct clade that was clearly separated from Chit1 in the neighbor-joining tree. Chit2 of M. anisopliae was closely related to M. anisopliae Chit2 (AJ293217 and FJ609319) with maximum sequence similarity. Though, there was a large phylogenetic distance between Chit2 and other chitinases from insect-pathogenic fungi. A comparative gene sequence analysis revealed that our endochitinase Chit1 and Chit 2 are the most closely related to of family 18 glycosyl hydrolases as shown in Figure 3.5.10.

KJ787131 Trichoderma longibrachiatum (Chit1) GU180607 Trichoderma longibrachiatum (Chit1) KJ787130 Trichoderma longibrachiatum (Chit1) HG931310 Trichoderma longibrachiatum (Chit1) HG931311 Trichoderma longibrachiatum (Chit1) Trichoderma longibrachiatum isolate SR (Chit1) HG931317 Trichoderma longibrachiatum (Chit1) HG931308 Trichoderma longibrachiatum (Chit1) HG931322 Trichoderma longibrachiatum (Chit1) HG931315 Trichoderma longibrachiatum (Chit1) KP178484 Trichoderma longibrachiatum (Chit1) DQ097518 Metarhizium anisopliae (Chit1) FJ609315 Metarhizium anisopliae (Chit1) Metarhizium anisopliae isolate Tn-16 (Chit1) Metarhizium anisopliae isolate Tn-25 (Chit1) AY758399 Metarhizium anisopliae (Chit1) DQ011865 Metarhizium anisopliae (Chit1) FJ609316 Metarhizium anisopliae (Chit1) AM181166 Metarhizium anisopliae (Chit1) AF027497 Metarhizium anisopliae (CHIT1) AF027498 Metarhizium anisopliae (Chit1) DQ011663 Metarhizium anisopliae (Chit2) FJ609320 Metarhizium anisopliae (Chit2) KF445078 Metarhizium anisopliae (Chit2) KF445082 Metarhizium anisopliae (Chit2) FJ609319 Metarhizium anisopliae (Chit2) Metarhizium anisopliae isolate Tn-16 (Chit2) AJ293217 Metarhizium anisopliae (Chit2) KF559204 Beauveria bassiana (Chit1) Beauveria brongniartii isolate Tn-09 (Chit1) Beauveria bassiana isolate Tn-13 (Chit1) XM_008601414 Beauveria bassiana (Chit1) GU073382 Beauveria bassiana (Chit1) Beauveria bassiana isolate Tn-27 (Chit1) AY145440 Beauveria bassiana(Chit1) JF834544 Beauveria bassiana (Chit1) EU828354 Beauveria bassiana (Chit1) HQ435871 Beauveria bassiana (Chit1)

Figure 3.5.10: Phylogenetic analysis of endochitinase of family 18 glycosyl hydrolases isolated from entomopathogenic fungal species.

120

3.5.4 Homology modeling and validation of Chit1 and Chit2 protein

The deduced amino acid sequences of Chit1 and Chit2 protein were submitted to the automated comparative protein modeling server (http://swissmodel.expasy.org //SWISS-MODEL.html). Five chitinases templates (5KZ6, 3N11, 3N15, 3N17, 3N13) for B. bassiana isolates, (1D2K, 1LL7, 1LL6, 1WNO, 1W9P ) for M. anisopliae, (2XVN, 4TX6, 2XUC, 2UY2, 1HVQ) for M. anisopliae isolate Tn-16PK and (1D2K , 1LL7, 1LL6, 1WNO ) for T. longibrachiatum with 99% identity to Chit1 and Chit2 amino acid sequence were selected for modeling. The homology model of the Chit1 and Chit2 protein and its catalytic and binding domain motifs are showed in figures 3.5.11, 3.5.12, 3.5.13. Homology modeling showed that the Chit1 and Chit2 of entomopathogenic fungi contain (α / β) 8 TIM barrel structure like other members of the class 18 hydrolase family. Generated models were validated by using Ramachandran plot calculations computed with the PROCHECK program. The Φ and Ψ distributions of the Ramachandran plots of non-Proline and non-Glycine, residues are given in figures 3.5.14, 3.5.15, and 3.5.16. Altogether 99-100 % of the residues were in favored and allowed regions. Ramachandran plot of T. longibrachiatum Chit1 (SR) showed 92.3% residues in most favored regions and 7.7% residue in allowed region. While M. anisopliae Chit2 (Tn-16PK) plot showed 86.2% residues in most favored regions, 11.1% in allowed region and 2.0% in disallowed regions. Ramachandran plot of M. anisopliae Chit1 (Tn-25) and M. anisopliae Chit1 (Tn-16) showed 90.4%, 91.5% and 8.7%, 7.7% residues in favored and allowed regions, respectively. Validation of Chit1 models of B. bassiana (Tn-13, Tn-27) and B. brongniartii (Tn-09) showed 88.9%, 86.9%, 89.7% in most favored regions, 8.8%, 9.8%, 9.5% in allowed regions and 0.4%, 1.2%, 0.4% in disallowed regions, respectively.

121

A B C

Figure 3.5.11. Homology modeling of Chit1 protein of B. bassiana (Tn-13, A), B. bassiana (Tn-27, B) and B. brongniartii (Tn-09, C). The side chains of catalytic and binding domain motifs are shown in figure. The deduced amino acid residues of catalytic (DGIDIDIESG) and substrate binding motifs (SIGG) are indicated. The residues of catalytic domain are depicted in pink color and green ribbon while the residues of binding domain are depicted in pink color and light blue ribbon.

122

A B

Figure 3.5.12. Homology modeling of Chit1 protein of M. anisopliae (Tn-25, A) and M. anisopliae (Tn-16, B). The side chains of catalytic and binding domain motifs are shown in figure. The deduced amino acid residues of catalytic (DGIDVDWEYP) and substrate binding site (SIGG) are indicated. The residues of catalytic domain are depicted in pink color and sky blue ribbon while the residues of binding domain are depicted in pink color and dark blue ribbon.

123

A B

Figure 3.5.13: Homology modeling of Chit2 of M.anisopliae isolate (Tn-16, A) and Chit1 of T. longibrachiatum (SR, B) proteins. The side chains of catalytic domain motif are shown in figure and deduced amino acid residues of catalytic motif (DGIDIDWEYP Chit1) and (NGFDFDIEVN Chit2) are indicated. The residues of catalytic domain are depicted in pink color.

124

A B C

Ramachandran Plot statistics Ramachandran Plot statistics Ramachandran Plot statistics

No. of No. of No. of residues %-tage residues %-tage residues %-tage ------Most favoured regions [A,B,L] 212 ------Most favoured regions [A,B,L] 233 88.9%* 86.9%* Most favoured regions [A,B,L] 236 89.7%* Additional allowed regions [a,b,l,p] 23 8.8% Additional allowed regions [a,b,l,p] 24 9.8% Additional allowed regions [a,b,l,p] 25 9.5% Generously allowed regions [~a,~b,~l,~p] 5 1.9% Generously allowed regions [~a,~b,~l,~p] 5 2.0% Generously allowed regions [~a,~b,~l,~p] 1 0.4% Disallowed regions [XX] 1 0.4%* Disallowed regions [XX] 3 1.2%* Disallowed regions [XX] 1 0.4%* ------Non-glycine & non-proline residues 262 100.0% Non-glycine and non-proline residues 244 100.0% Non-glycine and non-proline residues 263 00.0%

End-residues (excl. Gly and Pro) 2 End-residues (excl. Gly and Pro) 2 End-residues (excl. Gly and Pro) 2

Glycine residues 40 Glycine residues 39 Glycine residues 40 Proline residues 18 Proline residues 18 Proline residues 18 ------Total number of residues 322 Total number of residues 303 Total number of residues 323

Figure 3.5.14: Ramachandran Plot showing the phi -psi torsion angles for all residues in most stable predicted 3-D conformation of chitinase protein (A) B. bassiana isolate Tn-13(B) B. bassiana isolate Tn-27 (C) B. brogniartii isolate Tn-09

125

A B

Ramachandran Plot statistics Ramachandran Plot statistics

No. of No. of residues %-tage residues %-tage ------Most favoured regions [A,B,L] 215 91.5% Most favoured regions [A,B,L] 198 90.4% Additional allowed regions [a,b,l,p] 18 7.7% Additional allowed regions [a,b,l,p] 19 8.7% Generously allowed regions [~a,~b,~l,~p] 2 0.9% Generously allowed regions [~a,~b,~l,~p] 2 0.9% Disallowed regions [XX] 0 0.0% Disallowed regions [XX] 0 0.0% ------Non-glycine and non-proline residues 235 100.0% Non-glycine and non-proline residues 219 100.0%

End-residues (excl. Gly and Pro) 1 End-residues (excl. Gly and Pro) 2

Glycine residues 26 Glycine residues 23 Proline residues 12 Proline residues 11 ------Total number of residues 274 Total number of residues 255

Figure 3.5.15: Ramachandran plot showing the phi -psi torsion angles for all residues in most stable predicted 3-D conformation of chitinase protein (A) M. anisopliae isolate Tn-16 (B) M. anisoplaie isolate Tn-25

126

A B

Ramachandran Plot statistics Ramachandran Plot statistics

No. of No. of residues %-tage residues%-tage ------Most favoured regions [A,B,L] 218 86.2%* Most favoured regions [A,B,L] 168 92.3% Additional allowed regions [a,b,l,p] 28 11.1% Additional allowed regions [a,b,l,p] 14 7.7% Generously allowed regions [~a,~b,~l,~p] 2 0.8% Generously allowed regions [~a,~b,~l,~p] 0 0.0% Disallowed regions [XX] 5 2.0%* Disallowed regions [XX] 0 0.0% ------Non-glycine and non-proline residues 253 100.0% Non-glycine and non-proline residues 182 100.0%

End-residues (excl. Gly and Pro) 2 End-residues (excl. Gly and Pro) 1

Glycine residues 26 Glycine residues 19 Proline residues 25 Proline residues 12 ------Total number of residues 306 Total number of residues 214

Figure 3.5.16: Ramachandran plot showing the phi -psi torsion angles for all residues in most stable predicted 3-D conformation of chitinase protein (A) Chit2 of M. anisoplaie isolate Tn-16 (B) Chit1 of T. longibrachiatum isolate SR

127

3.6 EXPRESSION OF CHITINASES IN COTTON PLANTS, ENZYME ASSAY AND BIOASSAY AGAINST BEMISIA TABACI 3.6.1 Expression of chitinase in cotton plants The ORFs encoding conserved domain of catalytic family 18 from Chit1 gene of Beauveria bassiana (Tn-13 isolate), Metarhizium anisopliae (Tn-25 isolate) and Chit2 gene of M. anisopliae (Tn-16 isolate) were selected for their expression in cotton plant using VIGS vector modified using A component of cotton leaf crumple virus (Tuttle et al., 2008).

For the isolation of different open reading frames (ORFs) from different chitinases, ORFs specific primers were used. The unique restriction sites EcoRI and NheI were not present in entire sequences of all ORFs while these restriction sites were present in multiple cloning sites (MCS) of VIGS vector so these restriction sites were added in forward and reverse primers set respectively. The specific ORFs of chitinase were amplified from recombinant plasmids cloned in pGEM T-easy vector (fig 3.6.1). The verification of positive clones was carried out by PCR, restriction analyses and the results confirmed that Chit1 from B. bassiana (Tn-13) and Chit1 (Tn-25) and Chit2 (Tn-16) from M. anisopliae were present in transformants. The amplicon of 1 kb was observed with ORFs specific primer and fragment size of 1 kb gene insert was released from recombinant vectors using restriction enzyme, sequenced and confirmed the presence of Chitinase ORFs in clones.

M Tn-16 Tn-25 Tn-13 +ve Chit2 Chit1 Chit1

1000 bp

Figure 3.6.1: amplification of chitinase ORFs from Beauveria and Metarhizium. M= PromegaTM 1 kb Plus DNA Ladder 128

To construct VIGS-Chit ORF recombinant plasmids, restricted ORFs from pGEM T easy were cloned in already restricted VIGS vector with EcoRI and NheI, transformed into E. coli and VIGS-Chit ORFs recombinant plasmids were confirmed through restriction analyses (fig 3.6.2). Restriction analyses and sequencing confirmed the VIGS-Chit1_tn13, VGS-Chit1_tn25 and VGS-Chit2_tn16.

M Tn-16 Tn-25 Tn-13 Chit2 Chit1 Chit1

5000 bp

1000 bp

Figure 3.6.2: Restriction analyses of VIGS-Chit recombinant plasmids. M= PromegaTM 1 kb Plus DNA Ladder

Seedlings were bombarded with 1-μm-diameter gold micro-projectiles (InBio) coated with a mixture of 5 μg each of the A (recombinant ORFs) and B components of CLCrV as described (Kjemtrup et al., 1998). Expression was positive when confirmed by amplifying coat protein specific primers and ORFs specific primers after 6 days inoculation (Tuttle et al., 2008). The symptoms of cotton leaf crumple virus (fig 3.6.3) were also confirmed the expression of chitinase in cotton plants.

129

A B

C D

E F

Figure 3.6.3: Visual evidence of CLCrV induce gene silencing. (A,B) Control (C,D) Mock (E,F) CLCrV-Chit1 of B. bassiana isolate- 13

3.6.2 Chitinase Activity assay

All transformed cotton plants produce chitinase including mock, control after 6 days. The transformed plants showed chitinase activity as compared to mock. Transformed plants of Chit1 of B. bassiana (Tn-13) showed maximum activity of 6.00 U/mL (mean) as compared to transformed plants of Chit2 (Tn-16) and Chit1 (Tn- 25) of M. anisopliae that showed activities of 5.86 U/mL and 5.55 U/mL respectively. The net chitinase activity was calculated by reducing the amount of chitinase in control. The activity of control (VIGS+GUS gene) was 5.09 U/mL (Mean of all replicates) while it was 4.25 U/mL (Mean of all replicates) in Mock. ORF of Chit1 from B. bassiana (isolate Tn-13) showed maximum activity of 0.91 u/mL (mean of all

130

replicates) as compared to ORFs of Chit1 (isolate Tn-25) and Chit2 (isolate Tn-16) from M. anisopliae that showed 0.77 u/mL and 0.46 U/mL (Mean of all replicates) respectively as described in Table 3.6.1.

Table 3.6.1: Chitinase Activity of Transformed Cotton Plants Total chitinase activity Chitinase Net chitinase Sr. Name of of transformed plants activity in activity No. chitinase (U/mL) control (U/mL) (U/mL) Chit1 of B. 1 bassiana 6.00 5.09 0.91 a (Tn-13) Chit2 of M. 2 anisopliae 5.86 5.09 0.77 b (Tn-16) Chit1 of M. 3 anisopliae 5.55 5.09 0.46 c (Tn-25) 4 Mock 5.13 ------LSD (0.05) NS NS 0.09 * The values showing different letters differ significantly at α: 0.05

3.6.3 Virulence bioassay of chitinase transformed plants against B. tabaci

The virulence of Chit1 and Chit2 of were assessed against 4th instar nymphal and adult stages of B. tabaci on transformed G. hirsutum plants. The virulence of Chit1 of Beauveria (Tn-13), and Chit2 of Metarhizium (Tn-16) was promising while Chit1 of Beauveria (Tn-13) showed incomparable results. The details virulence bioassays of individual fungal genera are described below.

3.6.3.1 Virulence bioassay of chitinase transformed plants against 4th instar nymph and adult stages of B. tabaci The virulence of Chit1 of B. bassiana (Tn-13), M. anisopliae (Tn-25) and Chit2 of M. anisopliae (Tn-16) was evaluated against nymphs of B. tabaci on transformed plants of G. hirsutum. The mortality of the nymph was started after 120 131

hours of inoculation with Chit1 and Chit2 of B. bassiana and M. anisopliae. The virulence observed by isolates of B. bassiana (Tn-13) was maximum causing 40.10 % mortality of B. tabaci nymphs followed by Chit2 of M. anisopliae (34.27%) after 6 days of inoculation. While, the mortality of B. tabaci nymphs was recorded as minimum (18.37 %) by inoculation of Chit1 of M. anisopliae (Tn-25) after 6 days (Table 3.6.2). The results of insect bioassay revealed that overproduction of the endochitinase Chit1 and Chit2 can enhance the infection efficiency of B. bassiana and M. anisopliae against nymphs of B. tabaci. Although, B. tabaci nymphal stages are more vulnerable as compared to adults.

Table 3.6.2: Percentage mortality of chitinase transformed plants against 4th instar nymphal stage of B. tabaci Sr. Name of MORTALITY no chitinase AFTER 48 72 96 hrs 120 hrs 144 hrs hrs hrs 1 Chit1 of B. Percentage±SD ------15.25±1.57 25.46±1.64 40.10±1.57 bassiana i i f c a (Tn-13) 2 Chit2 of M. Percentage±SD ------12.12±1.55 21.44±1.55 34.27±1.54 anisopliae i i g cd ab (Tn-16) 3 Chit1 of M. Percentage±SD ------8.75 ±1.60 10.86±1.53 18.37±1.57 anisopliae i i gh g e (Tn-25) LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of Chit1 of B. bassiana (Tn-13), M. anisopliae (Tn-25) and Chit2 of M. anisopliae (Tn-16) was evaluated against adults of B. tabaci on transformed plants of G. hirsutum. The mortality of the adults was started after 120 hours of inoculation with Chit1 and Chit2. The virulence observed by isolates of B. bassiana (Tn-13) was maximum causing 24.22 % mortality of B. tabaci nymphs followed by Chit2 of M. anisopliae (14.78%) after 6 days of inoculation. While, the mortality of B. tabaci nymphs was recorded as minimum (9.65 %) by inoculation of Chit1 of M. anisopliae (Tn-25) after 6 days (Table 3.6.3). The results of insect bioassay revealed that overproduction of the endochitinase Chit1 and Chit2 can enhance the infection efficiency of B. bassiana and M. anisopliae against adults of B. tabaci.

132

Table 3.6.3: Percentage mortality of chitinase transformed plants against adult stage of B. tabaci Sr. Name of MORTALITY no Chitinase AFTER 48 72 96 120 hrs 144 hrs hrs hrs hrs 1 Chit1 of B. Percentage±SD ------9.34±1.55 24.22±1.56 bassiana e e e c a (Tn-13) 2 Chit2 of M. Percentage±SD ------5.56±1.69 14.78±1.62 anisopliae e e e d b (Tn-16) 3 Chit1 of M. Percentage±SD ------3.44±1.69 9.65 ±1.61 anisopliae e e e d c (Tn-25) LSD= (Similar small alphabetic showed no significant difference; P> 0.05)

The virulence of Chit1 of B. bassiana (Tn-13), M. anisopliae (Tn-25) and Chit2 of M. anisopliae (Tn-16) was compared on 4th instar nymphal and adult stages of B. tabaci. Chit1 of B. bassiana (Tn-13) showed maximum mortality against 4th instar nymphal and adult stages after 6 days as compared to Chit1 M. anisopliae (Tn- 25) and Chit2 of M. anisopliae (Tn-16) that showed less virulence as shown in figure 3.6.4.

Figure 3.6.4: Virulence of fungal chitinase transformed plants against 4th instar nymph and Adult B. tabaci

133

Chapter 4

DISCUSSION

In the present studies, fungi associated with dead bodies of Bemisia tabaci, Aphis gossypii and cotton mealybug (Phenacoccus solenopsis) were isolated and morphologically characterized from three agroecological zones of Punjab, Pakistan. A total of 900 insect samples of B. tabaci, A. gossypii and P. solenopsis were collected from hot arid, cotton and central mixed zones. Most of the fungi present in Pakistan during this research work have also been documented from different areas of the world (Vanninen et al., 1989; Meyling & Eilenberg, 2006; Vanninen, 1995). Similar to present findings, Wakil et al. (2014) reported the occurrence of different entomopathogenic fungi from 25,720 insects sample from numerous geographic areas of Punjab, Pakistan. Morphological characteristics comprising of growth rate, colony color and colony appearance, conidial size, conidial shape, length of conidiophores were considered as taxonomically useful characteristics for fungal identification (Samuels, Dodd, Gams, Castlebury, & Petrini, 2002; Tzean et al., 1997; Meyling & Elenberg, 2006; Vanninen, 1995; Doberski & Tribe, 1980; Kubatova & Dvorak, 2005; Jankevica, 2004). Studies revealed that all isolates of individual species did not differ much in morphological characteristics with most isolates exhibiting rapid growth, effuse conidiation or loosely arranged conidia in pustules.

Beauveria bassiana was isolated from different insect‟s samples of B. tabaci, A. gossypii and P. solenopsis in this study and morphologically characterized. Similar morphological characteristics were previously observed by different scientists in different areas of the world (Jankevica, 2004; Meyling & Elenberg, 2006; Kubatova & Dvorak, 2005). Zimmerman in 2007, reported many species in genus Beauveria, all of which were pathogenic to insects. B. brongniartii was also isolated from insect‟s sample. It was a new record in Iraq from Sunn pest, Eurygoster integriceps. This fungus is very scarce due to its specificity to host range and reduced competitive saprophytic nature (Kessler, Enkerl, Schweize, & Keller, 2004). The illustration of B. brongniartii isolates recorded in this study is similar to the finding of de Hoog (1972). Morphologically, it is like B. bassiana; however, the distinction can be made on the basis of shape and size of conidia (Tzean et al., 1997). Another fungus, M. anisopliae

134

was isolated from different insect source of B. tabaci, A. gossypii and P. solenopsis. Morphologically, M. anisopliae isolated in the present study is similar in conidial dimensions as reported by Rath et al. (1992). Isolates of V. lecanii from different insect source of B. tabaci, A. gossypii and P. solenopsis were characterized in the present study. Kouvelis et al. (2008) identiﬁed V. lecanii morphologically with typically short ellipsoidal conidia, yellowish white colony color, and reverse of the colony was deep yellow similar to as observed in this study. Two species of Trichoderma were isolated. Trichoderma species were conventionally identified by using morphological characterization, and it is a potential technique to identify Trichoderma species (Anees et al., 2010; Gams & Bissett, 2002; Samuels et al., 2002). Isolates of T. harzianum and T. longibrachiatum isolated from B. tabaci and A. gossypii were confirmed by its morphological characters. All descriptions of present studies of Trichoderma are quite similar with the morphological characterization of Trichoderma as reported in earlier investigations (Bisset, 1991; Samuels et al., 1996; Gams & Bissett, 2002; Samuels et al., 2002; Choi, Hong, & Yadav, 2003; Shah, Nasreen, & Sheikh, 2012).

In the present study, numerous other species of fungi comprising Alternaria, Fusarium, Cladosporium, Penicillium, Aspergillus, and Acremonium were also isolated from different insect species. Penicillium was in accordance with those observed by Pitt (1979). He described the colonies of Penicillium species as a fast growing, filamentous and flat. Initially, the colony color was white which then becomes dark green, blue green, gray-green, olive gray, pinkish or yellow with time. Moreover, various pigments are more or less typical for the Penicillium species. Rahjoo et al. (2008) found similar results to identify 191 isolates of Fusarium spp. including the morphology of colonies grown on PDA and the morphology of macro- conidia, micro-conidia, conidiogenous cells, and chlamydospores as found in present study. Aspergillus species were identified using available taxonomic keys (Samson, 1974; Domsch et al., 1980; Goettel & Inglis, 1997). Morphological characters of Aspergillus in the present study are similar to Klich‟s, (2002) findings who described the distinguishing character of Aspergillus ficcum as thickening of conidiophore wall 2-3µ and comparatively smaller (15-25µ) phialides. Conidiophore characters of Aspergillus are in agreements with the results of Rao (1965), Sonawane (1983),

135

Narain et al. (1985) and Ghosh (1998). The conidiophores of Aspergillus were pale olivaceous to olivaceous-brown, straight or curved, geniculate, slightly swollen at apex having terminal scars indicating the point of attachment of conidia. The present findings are parallel with the result of earlier workers (Rao, 1965; Sonawane, 1983; Narain et al., 1985, Shinde, 1995; Deshmukh, 1998; Shinde, 2003; Ghosh, 1998; Ramjegathesh & Ebenezar, 2012) in which, they observed more or less same types of conidiophores. Clonostachys rosea isolated from B. tabaci and A. gossypii was identified morphologically and all isolates showed similar characteristics. Similar morphology of C. rosea was found by Toledo et al. (2006), Schroers (2001) and Schroers et al. (1999). The Morphological characteristics of Acremonium were similar with the studies of Gobayashi et al. (1992). Results obtained from the morphological interactive key were in agreement and isolates within the same group were identified as the same species (Kornerup & Wanscher, 1978; Gams, 1971).

However, identification of species on basis of morphological study alone is inadequate for precise identification of a species as there are relatively few morphological features and a limited difference that may result in overlapping and false identification of the isolates (Anees et al., 2010). Moreover, culture conditions also influence morphological characteristics (Diguta, Vincent, Guilloux-Benatier, Alexandre, & Rousseaux, 2011). Thus, use of the molecular technique is necessary for compensation of the limitations caused by morphological characterization. Ribosomal genes, their IGS spacer regions and ITS regions have been extensively used to identify and differentiate among the species (Fouly et al., 1997) as well as in genetic diversity (Anderson, Chambers, & Cairney, 2001; Uetake et al., 2002), phylogenetic (Rakotonirainy, Cariou, Brygoo, & Riba, 1994), and taxonomic studies (Driver, Milner, & Trueman, 2000). ITS sequences have been used to distinguish between different fungal species (Thomsen & Jensen, 2002; Jensen et al., 2001; Anderson et al., 2001; Fouly et al., 1997). Internal transcribed spacer region (ITS) of entomopathogenic fungi was amplified from genomic DNA followed by phylogenetic analysis in present study. The ITS region is one of the most reliable loci to identify a strain at the species level (Kullnig-Gradinger, Szakacs, & Kubicek, 2002). Identification of all the species was done by comparing the sequences of the 5.8S-ITS region of the sequences deposited

136

in GenBank. All of the isolates had homology percentage of 99-100%. The results of current study are in good agreement with the study of several other reports and confirmed ITS amplicons ranging from 600 to 650 bp (Cardoso, Queiroz, Pereira, & Araújo, 2007; Larena, Salazar, González, Julián, & Rubio, 1999; Anderson & Parkin, 2007; Manter & Vivanco, 2007). Neighbor joining tree revealed that B. brongniartii isolates (LT604475, LT604476) were classified into a clade that included B. brongniartii (JX110369, JX110374, JX110375). Whereas, the isolates of B. bassiana (LT604474, LT604473) formed a different clade that was distinctly separated from the other isolates of B. brongniartii in the neighbor-joining tree. B. bassiana isolates (LT604474, LT604473) were closely related to B. bassiana (KC753396, KC753394) with maximum ITS sequence similarity. Beauveria isolates had a greater genetic variation as compared to the ITS sequences. Because Beauveria sp. is a haploid fungus having predominant asexual reproduction; hence the main cause for genetic variation is parasexual recombination or mutation (Castrillo & Brooks, 1998). Gaitan et al. (2002) and Devi et al. (2001) observed that the isolates from different climatic zones and hosts had a high genetic similarity level among them. In contrast, high genetic variability was studied between B. bassiana isolates using ITS markers (Berretta, Lecuona, Zandomeni, & Grau, 1998; Castrillo & Brooks, 1998). A comparative ITS sequence analysis showed that fungal isolates in present study are similar to the members of the genus Beauveria.

Universal ITS1 and ITS4 primers were used to amplify ITS regions and 5.8S rDNA of M. anisopliae generate fragment of approximately 550 bp for all isolates. At the same region, 540bp fragment for M. anisopliae var. anisopliae strain E9, B/Vi and C and 600 bp for M. anisopliae strains were amplified in Australia and Brazil by Destefano et al. (2004). In present study, neighbor joining tree revealed that M. anisopliae isolates (LT604482, LT604481) were placed into a clade that contained M. anisopliae (JF589646, FJ589645 and EU307885) with maximum ITS sequence similarity. The results of this study are very similar to findings of Roberts et al. (2004) who grouped Metarhizium species into same clade A. Genetic relationship among different Trichoderma isolates was observed by neighbor-joining tree and T. longibrachiatum isolate (LT159847) fell into a clade that was closely related to T. longibrachiatum AF362099 and KT278853. Although, the isolates of T. harzianum

137

grouped into a distinguished clade that were distinctly separated from the other isolates of T. longibrachiatum in the neighbor-joining tree. T. harzianum isolates (LT604467, LT604468) were closely related to T. harzianum KR868284, KR868241 and KR868239 with maximum ITS sequence similarity. The results from this study are similar to the results of Hermosa et al. (2004) who identified Trichoderma isolates by using molecular techniques and further used sequence analysis to characterize it into two main clades. Maymon et al. (2004) assembled a consistent phylogenetic tree comprising isolates belonging to the T. harziunum and grouped in the same clade. A comparative 5.8S rDNA gene sequence analysis revealed that our fungal strains are the closest to members of the genus Trichoderma. There was a greater sequence similarity among the ITS sequences of the filamentous fungi which were identified as Penicillium sp., showing the percentage similarity of 99% among the other Penicillium sp. Neighbor joining tree revealed that P. polonicum isolate (LN827605) fell into a clade that included P. polonicum GQ999174, KF494147 and KF494148. Whereas, the isolates of P. expansum (LT604485, LT60448 and LT604493) formed a separate clade that was clearly distinct from the other isolates of P. polonicum in the neighbor-joining tree. P. expansum isolates were closely related to P. expansum DQ681345, KP204878, KC169942 with maximum ITS sequence similarity. There are various species of Penicillium with very few differences which make its taxonomy very complex. Even though observable characteristics are used in classification systems of organisms, many species categorized as Penicillium are morphologically same, and this technique of identification remains challenging (Cardoso et al., 2007). As there is very low ITS variability between nucleotide sequences of ITS region among these fungi, so it did not provide adequate discrimination (Cardoso et al., 2007). Filamentous fungus Aspergillus spp. was confirmed by using ITS amplicons ranging from 600 to 650 bp as reported in other studies (Manter & Vivanco, 2007; Cardoso et al., 2007; Anderson & Parkin, 2007; Larena et al., 1999). Neighbor joining tree revealed that A. nidulans (LT604484 and LT604483) fell into a clade that was closely related to A. nidulans AY373888 and FJ878647. While, the isolates of A. oryzae and A. flavus grouped in a similar clade that was noticeably distinct from the other isolates of A. nidulans and A. fumigates. Though, A. fumigatus isolates (LN849889, LN849890, LN849893 and LN849892) showed maximum homology with ITS sequence of A. fumigatus FJ227896. Das et al. (2013) studied a fast 138

evolution analysis based on 18S rDNA gene sequences depicted that the isolate GHBF09 shares a same clade with A. flavus and occupies a distinct phylogenetic position within the representative members of the genus Aspergillus. Neighbor joining tree revealed that Alternaria sp. (LT604491, LT604492) was divided into a clade that was closely related to Alternaria sp. KR094462 and KM215618. Whereas, A. tenuissima isolates (LT604489, LT604490) were closely related to A. tenuissima (KT291415) with maximum ITS sequence similarity of already reported Alternaria species. Simmons (1986) examined several Alternaria anamorphs, and placed them into similar clade with maximum similarity to Alternaria species. Four Alternaria species examined in this study were consistently placed into two separate clades, each of which also contained Alternaria species. Findings of present study support the current distinction of Alternaria spp. as phylogenetically distinct, with other fungal species but most closely associated with Alternaria species. In the neighbor joining tree, F. equiseti (LN827600, LN827603 and LN827599) showed maximum homology with F. equiseti (LN827603). Neighbor joining tree revealed that F. equiseti fell into a clade that was closely related to F. equiseti (GQ365157 and GQ671182). While, Fusarium sp. (LN827602) and F. incarnatum (LN827601) both isolates of insects were classified in the same main cluster that was closely related to already reported ITS sequences of KR135132 and KF525436. Identification of Fusarium species described by Hennequin, et al. (1999) based on rDNA sequencing and confirmed that F. oxysporum, F. solani and F. proliferatum were grouped into distant clades that are similar to present findings. Although the results obtained from nuclear and mitochondrial sequence analyses were not identical (i.e. minor diﬀerences were found in some intermediate tree nodes, branch lengths, and relationships among some species- clades), because fungal species of present study were isolated from different hosts (insects) but most of the phylogenetic relationships revealed in these analyses were similar. Reliable distinction between and among isolates has been reported over the past decade using molecular identiﬁcation and characterization. However, it is necessary to use combination of different molecular methods to achieve reproducible and precise results. Morphological and molecular approaches play important roles in the identification of fungal isolates. Each approach has its own limitations and strengths. By combining morphological and molecular approaches, all fungal isolates are successfully identified. The results obtained from the morphological interactive 139

key, BLAST and phylogenetic analysis were found to be in agreement with previous studies.

Entomopathogenic fungi comprise a diverse group of species (Wongsa, Tasanatai, Watts, & Hywel-Jones, 2005; Abdullah & Amin, 2009) and have been documented from all main insect taxa to exploit their potential as biological control agents (Assaf, Haleem, & Abdullah, 2011; Fisher, Rehner, & Bruck, 2011). Natural occurrence of entomopathogenic fungi from insects has well reported in literature (Batalla-Carrera et al., 2013; Meyling, Lübeck, Buckley, Eilenberg, & Rehner, 2009; Wakil, et al., 2013; Klingen, Eilenberg, & Meadow, 2002; Shapiro-ilan et al., 2003). However, to our knowledge, there are only few earlier reports on natural occurrence of entomopathogenic fungi from insect of geographically diverse areas. Occurrence of entomopathogenic fungi from different areas of the Punjab, Pakistan was studied in present research work. A total of 50 fungal isolates from different genera were found in cotton zone from B. tabaci, A. gossypii and P. solenopsis while 49 and 41 were found in hot arid zone and central mixed zone respectively. In hot arid zone, the frequency of occurrence of insect associated fungi was highest on B. tabaci with 42.86 % followed by 30.61 % from A. gossypii and lowest with 26.53 % from P. solenopsis in hot arid zone. Whereas, frequency of occurrence of entomopathogenic fungi in cotton zone was 42 % highest on A. gossypii that was followed by 30 % from B. tabaci and 28% lowest from P. solenopsis. In central mixed zone, frequency of occurrence of insect associated fungi was 41.46 % on B. tabaci that was followed by 34.15 % from A. gossypii and 24.39 % from P. solenopsis. The occurrence frequency of entomopathogenic fungi was highest in cotton zone as compared to central mixed and hot arid zone. Findings of this study is in agreement with Pilz et al. (2007) collected M. anisopliae and Beauveria sp. from field-collected larvae (1.4%), pupae (0.2%), and adults (0.05%) of western corn rootworm. Similarly, 542 entomopathogenic fungal isolates from dead insects were reported from islands and mountains in numerous places of Korea during 2003-2007 (Kim et al., 2010). Various entomopathogenic fungi especially B. brongniartii, B. bassiana, V. lecani, and M. anisopliae were isolated from diseased insects from western and central areas of Latvia (Jankevica, 2004).

140

In the favor of results of individual occurrence diversity of fungal species, Padanad & Krishnaraj, (2009) also identified V. Lacanii and B. bassiana from Spodoptera litura (Lepidoptera: Noctuidae) insect cadavers collected from India. Kim et al. (2010) isolated 542 different isolates of Beauveria from the samples of dead insects and insect associated fungi B. bassiana were recorded mainly from the pupae and larvae of olive moth in the phylloplane (Oliveira, Pereira, Lino-Neto, Bento, & Baptista, 2012). Manfrino et al. (2014) isolated three different species of insect pathogenic fungi from six aphid species during a survey of cereal crops in Argentina. Several isolates of insect associated fungi including 15 isolates of M. anisopliae and 10 isolates of B. bassiana were identified from A. gossypii (Hemiptera: Aphididae) (Herlinda et al., 2010). During the survey of South Africa, Hatting (1999) recovered two Hyphomycetes and six Entomophthorales species of insect pathogenic fungi from soil and caused infection on aphid hosts. In the western parts of Latvia, various entomopathogenic fungal species such as V. lecanii, B. bassiana, B. brongniartii and M. anisopliae were isolated and identified from dead insects (Jankevica, 2004). In Pakistan, Wakil et al. (2014) isolated B. bassiana and M. anisopliae from the insects of stored grains.

In the case of occurrence diversity, similar to present findings, Torres- Barragan et al. (2004) collected 3,400 insects from the agricultural zone and tropical forest of El Eden Ecological Reserve, Mexico: three of Verticillium sp., one isolate of Aspergillus sp., and two of Penicillium sp., from three insect orders, Diptera, Isoptera, and Hymenoptera were documented. Alternatively, a large number of fungal isolates were recorded from the agricultural areas: 3 isolates of A. parasiticus, 100 of F. moniliforme and 246 of F. oxysporum out of 3,100 insects (11.3%) from three insect orders, Homoptera, Coleoptera, and Lepidoptera. In this study, Aspergillus niger and A flavus were isolated which have been isolated earlier as insect pathogens by several authors (Sur et al., 1998; Abdullah et al., 2001, 2002; Sun & Liu, 2008; Abdullah & Amin, 2009; Assaf et al., 2011). Abdullah et al., 2001, 2002 have isolated these two species from subterranean termite populations in Basrah, Iraq. Fusarium species have been reported as insect pathogen and isolated from larvae and adult insects (Sur et al., 1998). In numerous studies, it has also been reported as soil opportunistic pathogen to insects (Abdullah & Amin, 2009; Sun & Liu, 2008; Ali-Shtayeh et al., 2003; Sun et

141

al., 2008). Previously, A. alternata, A. flavus, A. fumigatus, F. oxysporum and F. solani were isolated from stored grain insects of Pakistan along with other entomopathogenic fungi (Wakil et al., 2014).

In this study, species diversity and species richness was evaluated by using Shannon and Simpson indices. Species diversity from different hosts using Shannon and Simpson indices gave similar results. The highest species diversity was found in hot arid zone followed by cotton zone and central mixed zone. There was the great influence of geographical location on the distribution of entomopathogenic fungi as indicated by the occurrence of M. anisopliae, a southern species in Finland (Vanninen, 1995). The dispersal of entomopathogenic fungi can be affected by the behavior of insects as insects are responsible for the spread of fungal conidia, minimizing plant to plant distances can minimize the population of pests but these conditions become favorable for the insects living under the soil (Schmidt, Thewes, Thies, & Tscharntke, 2004).

In the current study, B. tabaci was maintained on cotton plants in the laboratory and numbers of fungal isolates were assessed for their virulence against 4th instar nymphal and adult stages of B. tabaci. The findings of the current research showed that mortality percentage of B. tabaci varied among different fungal isolates. The virulence of Beauveria, Metarhizium and Verticillium was promising on both stages while other fungal genera also showed remarkable virulence potential on 4th instar nymphal stage. Various species of insect pathogenic fungi have already been recognized previously as successful biocontrol agents of whitefly. B. bassiana is considered as one of the most important insect pathogenic fungi among other species (Daniel & Wyss, 2010; Torrado-Leon et al., 2006; Wraight et al., 2000). This fungus causes the infection by penetrating through the cuticle and propagating in the hemocoel of the insect to kill it (Toledo, de Remes Lenicov, & Lastra, 2010). In the current study, the virulence of B. bassiana and B. brongniartii was evaluated against 4th instar nymphal and adult stage of B. tabaci. B. bassiana (4×108 spores mL-1) which showed 100% mortality in B. tabaci nymphs after 6 days as compared to B. brongniartii showed 99.25% mortality after 6 days. As compared to nymphs, B. bassiana (4×108 spores mL-1) killed 100% B. tabaci adults after 6 days and B. brongniartii showed 65.01% mortality of adults after 6 days. The mortality was 142

reduced with the reduction in conidial suspension of B. bassiana and B. brongniartii. Wraight et al. (1998) recorded the pathogenicity of three species of B. bassiana against silver leaf whitefly, B. argentifolii. Eyal et al. (1994) reported 52-98% mortality of B. tabaci (Gennadius) by B. bassiana with concentrations of 4×106 conidia mL−1. Nagasi et al. (1998) observed that B. bassiana was most pathogenic to first instar and adults of B. argentifolii. However, Wraight et al. (2000) reported higher dose of 5×1013 conidia and achieved 90% control of B. tabaci nymphs after 7 days. Chan-cupul et al. (2013) evaluated the virulence of B. bassiana on whitefly 2nd nymphal instar and there was high mortality caused by fungal infection by B. bassiana isolates. Comparatively, the isolates of present studies showed more pathogenicity as reported in previous studies. A difference may be due to host plant as described by Santiago-alvarez, (2006) that mortality of nymphs due to B. bassiana differed significantly on different host plants. Two important fungi, M. anisopliae and V. lecanii were reported on whiteflies (Nunez del Prado, Iannacone, & Gomez, 2008). Pathogenicity of M. anisopliae and V. lecanii was evaluated against adult and 4th instar nymphal stages of B. tabaci on G. hirsutum plants. M. anisopliae (4×108 mL-1) killed 100% of B. tabaci nymphs after 6 days. While V. lecanii isolates (4×108 spores mL-1) showed 65.51% mortality of nymphs after 6 days. The highest virulence was observed by M. anisopliae (4×108 spores mL-1) causing 70.17% mortality of B. tabaci adults after 6 days as compared to V. lecanii (4×108 spores mL-1) resulting in less mortality 62.39% after 6 days. As compared to current results, Ibrahim et al., (2011) found that M. anisopliae killed more than 30 % of larvae of B. tabaci within 3 days, 50% within 4.5 days and caused mortality in 88% of larvae in 7 days. Moreover, there was high virulence of different isolates of M. anisopliae against B. tabaci nymphs on eggplant (Norhelina, Sajap, Mansour, & Idris, 2013). V. lecanii was tested to be an effective biological control agent against whitefly under greenhouse condition (Kim, 2002). L. muscarium pathogenicity on various nymphal instars of T. vaporariorum was studied by Andrew et al. (2005). L. muscarium with 106 conidial concentrations caused 63.74 % mortality of 1st and 2nd instars of T. vaporariorum and 71.68 % mortality of 3rd and 4th instars of T. vaporariorum. The insect associated fungus V. lecanii in the tropical environment of greenhouses, in North Europe and the USA, frequently decimates populations of scales and aphids; e. g. 100% mortality of several target insects was reported in limited trials (Hall, 1981). Rodriguez et al. (2010) tested 143

48 M. anisopliae isolates on Varroa destructor by applying a suspension of 107 conidia mL-1. The isolate of M. anisopliae (Qu-M845) was found to be most effective which showed 85% mortality. There was the difference in virulence in different strains of Beauveria and Metarhizium (Zimmermann, 2007a, b; Anderson et al., 2011) are in conformity with present results.

Cladosporium spp. is considered as an important biocontrol agent against whiteflies and aphids (Roberts & Humber, 1981). The pathogenicity of Cladosporium sp. and C. cladosporioides isolates was evaluated against 4th instar nymphal and adult stages of B. tabaci on G. hirsutum plants. Cladosporium sp. isolates (4×108 spores mL-1) causing 60.05% mortality of B. tabaci nymphs after 6 days as compared to C. cladosporioides causing 54.14% mortality after 6 days. However, Cladosporium sp. (4×108 spores mL-1) causing 35.57% mortality of B. tabaci adults after 6 days as compared to C. cladosporioides causing 40.25 % mortality. Five species of entomopathogenic were tested against whiteflies and aphids by Abdel-Baky (2000) and the mortality rate is in accordance with the present findings. Pathogenicity of Cladosporium sp. to whitefly life stages was high on whitefly nymphs (87.8%) as compared to adults (8.08%). T. longibrachiatum (4×108 spores mL-1) showed 71.33% mortality of B. tabaci nymphs after 6 days as compared to T. harzianum causing 59.80 % mortality. While in the case of adults, the highest virulence was observed by T. longibrachiatum isolates (4×108 spores mL-1) causing 18.92% mortality of B. tabaci adults after 6 days as compared to T. harzianum isolate (4×108 spores mL-1) killed more than 31.04 % of adults within 6 days. Ghosh and Pal (2016) evaluated the pathogenicity of T. longibrachiatum by using 4.9×107 spores mL-1 on borer insect L. orbonalis. The larval death percentage of borer insect L. orbonalis was higher during the treatment time and 20 % mortality was recorded on day 4 after treatment and increased to 39, 50, and 55.5 % on day 7, 10, and 13 after treatment. The entomopathogenic effect T. longibrachiatum has been reported a few years ago on naturally infected cowpea aphid (Aphis craccivora) (Ibrahim et al., 2011). T. longibrachiatum has been previously reported from Cowpea aphid, Aphis craccivora Koch (Ibrahim, 2011) and its soil isolate showed entomopathogenic activity against Leucinodes orbonalis, considered as a damaging pest on eggplant (Solanum melongena) (Gosh & Pal, 2016). C. rosea isolates (4×108 spores mL-1) killed 50.42% nymphs of B. tabaci after 6 days. As compared to nymphs, C. rosea isolates (4×108 144

spores mL-1) causing 23.54 % mortality of B. tabaci adults after 6 days. The mortality was reduced with the reduction in conidial suspension of C. rosea. Toledo et al. (2006) applied C. rosea and observed 82.5% mortality of Oncometopia tucumama after 14 days of post inoculation but the fungal infection was confirmed for only 12.5% of the dead insects. The variation in results may be due to different insects. Fusarium was virulent against 4th instar nymphal stage. Adults were less susceptible to entomopathogenic fungi as compared to a nymphal stage of B. tabaci. The potential of entomopathogenic fungi differs with the stage of the target insect varies (Inglis, Goettel, Butt, & Strasser, 2001; Angel-Sahagun et al., 2005; Anand, Prasad, & Tiwary, 2009; Anand & Tiwary, 2009; Daniel & Wyss, 2009; ElKatatny, 2010). With very few exceptions, susceptibility and vulnerability are more in adults towards fungi (Easwaramoorthy, 2003). As the age of the insect advances, the susceptibility toward entomopathogenic fungi decreases (Dayakar & Kanaujia, 2003; Amer, El-Sayed, Bakheit, Moustafa, & El-Sayed, 2008). Fusarium was reported as insect pathogens in several studies (Sun et al., 2008; Sur et al., 1998; Abdullah & Amin, 2009; Ali- Shtayeh et al., 2003; Sun & Liu, 2008). There is great variation in virulence of individual entomopathogenic fungi, but the factors that are responsible for this variation are still unknown (Anderson et al., 2011). In this study, though all the entomopathogenic fungal species showed virulence against whitefly but considerable differences were observed between isolates of different genera and even in the same genera (Alston et al., 2005). The highest mortality was caused by B. bassiana followed by M. anisopliae. The reason for this higher mortality due to B. bassiana can be attributed to the native nature of this isolate as being native isolates they might be better adapted or prepared to infect a particular host that cohabit in the same location (Batalla-Carrera et al., 2013).

Genes encoding hydrolytic enzymes can be cloned and transferred to plant to provide resistance to fungal and insect diseases (Lorito et al., 1998). Chitinase is specifically interesting because of its broad spectrum fungicidal, insecticidal activity, part of the plant defense system, and nontoxic to plants, animals, and higher vertebrates. Several genes encoding hydrolytic enzyme (endochitinase) were cloned and transferred to plants to impart resistance against plant pathogens (Upendra, 2006; Gentile et al., 2007; Lorito et al., 1998). Current results of endochitinases showed that the Chit1 and Chit2 sequences isolated from entomopathogenic fungi belong to family 145

18 of glycosyl hydrolases based on amino acid similarity (Garcia et al., 1994; Pishko, Kirkland, & Cole, 1995; Lorito et al., 1998). Chitin binding domain (ChBD) is responsible for specific binding of chitinases to insoluble chitin (Raikhel, Lee, & Broekaert, 1993). Chit1 gene of M. anisopliae var. anisopliae encodes a chitinase with a similar molecular weight (Baratto et al., 2003). The evaluation of the predicted Chit2 chitinase exhibited maximum resemblance to fungal glycohydrolase family 18 (Falquet et al., 2002) (Falquet et al., 2002). The structural motif of a substrate-binding site (SXGG) and catalytic domain motif (D1XXD2XD3XE) was recognized and found to be highly conserved in fungal chitinase of family 18 (Orikoshi et al., 2003). Endochitinase Chit1 was also cloned from genomic DNA of T. longibrachiatum isolate SR. This gene had a size of 216 amino acids and encoded a mature protein, Chit1, without signal peptide. The predicted molecular mass of the encoded protein was 23.41 kDa and composed of a catalytic glycosyl hydrolase family 18 (GH18) domain. The potential catalytic active site was located at aa 7 site. Chit1 of T. longibrachiatum lacks chitin-binding domain. Some fungal chitinases do not have ChBD domain as reported in some earlier studies (Limon, Margolles-Clark, Benitez, & Penttila, 2001). BChit1gene from B. bassiana (Fang et al., 2005) and Chit36 gene from T. harzianum (Viterbo, Haran, Friesem, Ramot, & Chet, 2001) also lack ChBD domain. Homology modeling showed that the Chit1 and Chit2 of entomopathogenic fungi contain the (α / β) 8 TIM barrel structure similar to other members of the class 18 hydrolase family. The active site is formed by two signature sequences which lie along barrel strands 3 and 4 of the class 18 chitinases on the carboxyl end of the β-barrel and appear to be important both for the stability of the fold and for catalytic activity (Hollis et al., 2000). Generated models were validated by using Ramachandran plot calculations and 99% of the residues were in favored and allowed regions. In the case of Ramchandran plot, if a model has more than 90% residues in the favorable region, then it is considered as good quality model (Ramachandran et al., 1963).

A neighbor-joining phylogenetic tree was constructed for the assessment of evolutionary relationships and classification of the predicted chitinase Chit1 and Chit2 into fungal classes. In the neighbor-joining tree, endochitinase of fungal isolates grouped into five different clades and showed maximum homology to fungal class 18

146

chitinases. Endochitinase (Chit1) from isolates of B. bassiana and B. brongniartii fell into two clades that included B. bassiana Chit1 (GUO73382 and AY145440) and B. brongniartii Chit1 (KF559204). M. anisopliae isolates of Chit1 were classified into distant clade and showed maximum similarities with Chit1 of M. anisopliae (FJ609315 and AY758593). While endochitinase (Chit2) from M. anisopliae formed a distinct clade that was clearly separated from Chit1. However, there was a large phylogenetic distance between Chit2 and other chitinase genes from insect-pathogenic fungi. A comparative gene sequence analysis revealed that endochitinase Chit1 and Chit2 in the present study are most closely related to family 18 glycosyl hydrolases. Similarly, da Silva et al., (2005) also studied the evolutionary relationships of Chit1 and Chit2. The neighbor joining tree was classified into five clades, Metarhizium Chit30 and Chit2 fell into the same clade and showed maximum homology with the plant like chitinase. While other clades were occupied with Chit42 and shared similarity with fungal-like chitinase (da Silva et al., 2005).

It is essential to analyze the functionality of the transgene product before transferring the gene into target crops. In order to assay the endochitinase activity (of transgene product) in transformed cotton, chitinase assay was used. Chitinase activity of transformed cotton plants was studied and all plants produced chitinase. The net chitinase activity was calculated by reduced amount of chitinase in control. Chit1 from B. bassiana (isolate Tn-13) showed maximum activity of 0.91 u/mL as compared to Chit1 (isolate Tn-25) after 6 days and Chit2 (isolate Tn-16) from M. anisopliae that showed 0.77 u/mL and 0.46 U/mL respectively. As results showed that all isolates depicted chitinase activity which ranged from 0.46 to 0-91 U/mL. Chitinase activity of 0.01-0.0398U/mL was recorded for various M. anisopliae isolates in culture media studied by Nahar et al. (2004). In the study by Dhar and Kaur (2010), different isolates of B. bassiana showed maximum chitinase activity of 2.64- 35.08 U/mL on the 4th day of fungal growth in an SDA (Sabouraud dextrose Agar) media. The activity in their study was determined after incubation of culture supernatant with 10 % (w/v) colloidal chitin for 2 h at 37ºC. The chitinolytic activity of seventeen isolates of M. anisopliae was evaluated by Braga et al. (1998) in different culture media and activity was found to vary from 0.0261 to 0.1340U/mL. Kang et al. 1999 reported higher chitinolytic activity (8.66mU/mL) in the fluid culture

147

when M. anisopliae were grown in a medium containing colloidal chitin as a sole carbon source (Kang et al., 1999). The enzyme activity in their study significantly varied with variance in substrate and type of isolates. Dhar and Kaur (2010) reported variation (0.11-0.90 U/mL) in maximum chitinase activity (days 4-8) with different isolates of B. bassiana cultured on basal salts medium containing 1% casein. Coudron et al. (1984) reported maximum chitinase activity of entomopathogenic fungi between pH 4.0-5.2. They suggested the requirement of an ionized acidic group and a protonated basic group for chitinase activity, emphasizing pH regulation for enzyme activity. However, this presents a scope for further improvement in enzyme activity with change in growth medium for entomopathogenic fungi. Further, variation in enzyme activity is also subjected to fungal strain (Gupta, Krasnoff, Underwood, Renwick, & Roberts, 1991; Dhar & Kaur, 2010). The present study proposes that the isolates of entomopathogenic fungi are virulent as they produced a greater amount of chitinase enzyme. It is clear from the results that chitinase activity is generally higher in inoculated plants as compared to control plants.

It has been well documented that greater activity of chitinase in plants can cause the reduction in the damage caused by pathogens (Broglie & Chet, 1991). Bioassay against target pathogen is the best way to know the usability of the cloned gene in plants and all cotton plants produce mild symptoms of CLCrV such as downward leaf curling and lighter veins. Viral-induced gene silencing through geminivirus vectors in Arabidopsis (Turnage, Muangsan, Peele, & Robertson, 2002) and N. benthamiana (Kjemtrup et al., 1998) produced severe symptoms as compared to tobacco rattle virus (TRV) VIGS vector that has been widely used (Ratcliff et al., 2001; Dong, Burch-Smith, Liu, Mamillapalli, & Dinesh-Kumar, 2007). The virulence of Chit1 and Chit2 were assessed against 4th instar nymphal and adult stages of B. tabaci on transformed G. hirsutum plants. The virulence of Chit1 of Beauveria (Tn- 13) and Chit2 of Metarhizium (Tn-16) was efficient. Chit1 of B. bassiana (Tn-13) showed maximum 40.10 % mortality of B. tabaci nymphs followed by Chit2 of M. anisopliae (34.27%) and Chit1 of M. anisopliae (Tn-25) (18.37 %) after 6 days of inoculation. As compared to nymphs, Chit1 of B. bassiana (Tn-13) killed 24.22 % adults of B. tabaci followed by Chit2 of M. anisopliae (14.78%) after 6 days of inoculation. While the mortality of B. tabaci adults was recorded as the minimum

148

(9.65 %) by inoculation of Chit1 of M. anisopliae (Tn-25) after 6 days. The insect bioassay results displayed that overproduction of the novel endochitinase Chit1 and Chit2 can increase the infection efficiency of B. bassiana, M. anisopliae and promote infection against adults of B. tabaci. Although, nymphal stage of B. tabaci are more susceptible as compared to adults. Transformations of various plants with chitinase genes showing enhanced disease resistance have been achieved. Development of Colorado potato beetle can be inhibited by the expression of chitinase in tomato (Lawrence & Novak 2006). Wasano et al. (2009) showed that the occurrence of 56- kDa defense protein containing chitin like domain in mulberry latex was responsible for providing strong insect resistance to lepidopteran caterpillars, including the cabbage armyworm, Mamestra brassicae and the Eri silkworm, Samia ricini. Similarly, Kitajima et al., (2010) also reported strong insecticidal activities associated with two chitinase proteins from the latex of Mulberry (Morus sp.) against larvae of Drosophila melanogaster. Fang et al. (2005) evaluated that the overexpression of B. bassiana chitinase, gene BbChit1 enhance the virulence against aphids (Fang et al., 2005). Garcia et al. (1994) studied that Chit42 chitinase is responsible for most of the extracellular chitinase found in different T. harzianum strains (Garcia et al., 1994) that have been enhanced by overexpression of this enzyme (Baek, Howell, & Kenerley, 1999; Viterbo et al., 2001). When Chit33 chitinase was overexpressed, it increased the stable antifungal activity of transformants (Limon, Pintor-Toro, & Benítez, 1999). Different chitinase genes transformed into different plants increased plant defense against various pathogens (Datta et al., 2001; Rohini & Rao, 2001; Yamamoto et al., 2000; Lorito et al., 1998; Terakawa, Takaya, Horiuchi, Koike, & Takagi, 1997).

The results presented in this study reveal that laboratory bioassays are a relevant stage in the selection of the most efficient strains of entomopathogenic fungi for controlling whitefly. The pathogenicity of Chit1 and Chit2 can be influenced by strain used. Thus, it was reported that isolated chitinase is of great significance for improvement of its entomopathogenicity and could also provide a potent tool for studying the functions of chitinase genes in general. In addition, cloning and characterization of the chitinase genes are significant to reveal the relationships between chitinase and virulence in insects. Therefore, the engineering of chitinase encoding genes into plants should provide enhanced protection against insects that

149

contain chitin. However, the outcome may be affected by the specific activity, concentration, and targeting of the enzyme within the cell and the characteristics of the fungal-host cell interaction.

150

CONCLUSION

In present research work, the entomopathogenic fungi associated with cotton whitefly (Bemisia tabaci), aphid (Aphis gossypii) and cotton mealybug (Phenacoccus solenopsis) were isolated and characterized morphologically showed very low variations in morphological characters and in internal transcribed spacer region (ITS). Most of the genera fell under the same clades in the phylogenetic analysis with no specific distribution pattern of fungi on different insect hosts for individual as well as total fungi with each insect. Metarhizium anisopliae, Beauveria bassiana, Verticillium lecanii especially Fusarium spp. showed promising results against 4th instar nymphal and adult stages of B. tabaci. Moreover, fungal chitinases characterized in this study revealed that they have active domains for their catalytic activity where chitinase activity of Chit1 of B. bassiana (0.91 µ/mL) was maximum as compared to Chit1 and Chit2 of M. anisopliae. Similarly, transgenic cotton plants for Chit1 of B. bassiana showed more mortality of 4th instar nymphal and adult B. tabaci as compared to Chit1 and Chit2 of M. anisopliae 4th instar nymphal and adult stages of B. tabaci.

151

FUTURE ASPECTS

 In future, the morphological and molecular characterization in combination can be used for proper identification of fungal flora associated with different insects.

 The entomopathogenic fungi can be evaluated with known entomopathogenic fungi for their effectiveness on different life stages of insect pests of economical importance.

 Chitinase genes isolated in this study can also be characterized from individual isolates of different fungi. Chitinases can be produced in vitro for their virulence against different stages of B. tabaci.

 Fungal chitinases can be evaluated for their pathogenicity against beneficial insects before they are introduced as bio-pesticides. Virulent chitinase gene in single or in combination can be transformed into cotton plants through phloem specific promoter and can be evaluated against different stages of whitefly without any harmful effects on other insects except phloem-feeding insects

152

Chapter 5 REFERENCES

Aam, B. B., Heggset, E. B., Norberg, A. L., Sorlie, M., Varum, K. M., & Eijsink, V. G. (2010). Production of chitooligosaccharides and their potential applications in medicine. Marine drugs, 8(5), 1482-1517. Abbink, T. E., Peart, J. R., Mos, T. N., Baulcombe, D. C., Bol, J. F., & Linthorst, H. J. (2002). Silencing of a gene encoding a protein component of the oxygen- evolving complex of photosystem II enhances virus replication in plants. Virology, 295(2), 307-319. Abdel-Baky, N. F. (2000). Cladosporium spp. an entomopathogenic fungus for controlling whiteflies and aphids in Egypt. Pakistani Journal of Biological Sciences, 3(10), 1662-1667. Abdel-Baky, N. F., & Al-Deghairi, M. A. (2008). Role of host plants on the biological aspects and parasitism levels of Eretmocerus mundus mercet (Hymenoptera: Aphelinidae), a parasitoid of Bemisia tabaci (Gennadius)(Hemiptera: Aleyrodidae). Journal of Entomology, 5(6), 356-368. Abdullah, S. K., Hassan, K.S., & Mansour, Z.F. (2002). Pathogenic potential of five fungal isolates on the termite Micocerotermes diversus. Iraqi Journal of Biology, 2:42-54, (In Arabic). Abdullah, S. K., Hassan, K.S., & Mansour, Z.F. (2001). Mycobiota associated with the subterranean termite Micocerotermes diversus in Basrah, Iraq. Iraqi Journal of Biology, 1:109-116. Abdullahi, I., Winter, S., Atiri, G. I., & Thottappilly, G. (2003). Molecular characterization of whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae) populations infesting cassava. Bulletin of entomological research, 93(02), 97- 106. Adams, D. J. (2004). Fungal cell wall chitinases and glucanases. Microbiology, 150(7), 2029-2035. Adrio, J. L., & Demain, A. L. (2010). Recombinant organisms for production of industrial products. Bioengineered bugs, 1(2), 116-131. Ahmad, G., Malik, S. A., Mahmood, Z., Iqbal, M. Z., Ahmad, S., & Ahmad, S. (2002). Effect of cotton leaf curl virus disease on morphology, yield and fiber 153

characteristics of susceptible lines/cultivars of cotton (Gossypium hirsutum L.). Asian Journal of Plant Sciences, 6, 705-707. Ahmad, M., Arif, M. I., Ahmad, Z., & Denholm, I. (2002). Cotton whitefly (Bemisia tabaci) resistance to organophosphate and pyrethroid insecticides in Pakistan. Pest management science, 58(2), 203-208. Ahmad, M., Arif, M. I., Ahmad, Z., & Denholm, I. (2002). Cotton whitefly (Bemisia tabaci) resistance to organophosphate and pyrethroid insecticides in Pakistan. Pest management science, 58(2), 203-208. Ahmad, S., Iqbal, M., Hayat, K., Ashraf, F., & Sadiq, M. A. (2008). Effect of cotton leaf-curl virus on the yield-components and fiber properties of cotton genotypes under varying plant spacing and nitrogen fertilizer. Science Technology and Development (Pakistan). Ahmad. M., & Azhar, F. M. (1999). Genetic mechanism controlling seed cotton yield and its components in F1 and F2 generations of G. hirsutum L. International Journal of Biology, 4: 227-233. Ahmed, M. Z., Ren, S. X., Mandour, N. S., Maruthi, M. N., Naveed, M., & Qiu, B. L. (2010). Phylogenetic analysis of Bemisia tabaci (Hemiptera: Aleyrodidae) populations from cotton plants in Pakistan, China, and Egypt. Journal of pest science, 83(2), 135-141. Akey, D. H., & Henneberry, T. J. (1998). Control of silver leaf whitefly with the entomopathogenic fungi, Paecilomyces fumosoroseus and Beauveria bassiana in upland cotton in Arizona. In Proceedings. Al-Deghairi, M. A. (2009). Combining effect of Beauveria bassaania (Bals.) and Ertemocerus mundus mercet (Hymenoptera: Aphelinidae) on sweetpotato whitefly, Bemisia tabaci gennadius (Aleyrodidae; Hemiptera). Journal of Entomology, 6(2), 72-81. Ali, A., & Aheer, G. M. (2007). Varietal resistance against sucking insect pests of cotton under Bahawalpur ecological conditions in Pakistan. Journal of Agricultural Research (Pakistan). Ali, S., Huang, Z., & Ren, S. X. (2009). Production and extraction of extracellular lipase from the entomopathogenic fungus Isaria fumosorosea (Cordycipitaceae; Hypocreales). Biocontrol Science and Technology, 19(1), 81-89.

154

Ali, S., Wu, J., Huang, Z., & Ren, S. X. (2010). Production and regulation of extracellular chitinase from the entomopathogenic fungus Isaria fumosorosea. Biocontrol Science and Technology, 20(7), 723-738. Ali-Shtayeh, M. S., Marai, A. B. B., & Jamous, R. M. (2003). Distribution, occurrence and characterization of entomopathogenic fungi in agricultural soil in the Palestinian area. Mycopathologia, 156(3), 235-244. Alon, M., Benting, J., Lueke, B., Ponge, T., Alon, F., & Morin, S. (2006). Multiple origins of pyrethroid resistance in sympatric biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect biochemistry and molecular biology, 36(1), 71- 79. Al-Rashed, S. A. A., Bakar, F. D. A., Said, M., Hassan, O., Rabu, A., Illias, R. M., & Murad, A. M. A. (2010). Expression and characterization of the recombinant Trichoderma virens endochitinase Cht2. African Journal of Microbiology Research, 4(16), 1758-1767. Alston, D. G., Rangel, D. E., Lacey, L. A., Golez, H. G., Kim, J. J., & Roberts, D. W. (2005). Evaluation of novel fungal and nematode isolates for control of Conotrachelus nenuphar (Coleoptera: Curculionidae) larvae. Biological control, 35(2), 163-171.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., & Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic acids research, 25(17), 3389-3402.

Amer, M. M., El-Sayed, T. I., Bakheit, H. K., Moustafa, S. A., & El-Sayed, Y. A. (2008). Pathogenicity and genetic variability of five entomopathogenic fungi against Spodoptera littoralis. Research Journal of Agriculture and Biological Science, 4, 354-367. Anand, A., & Mysore, K. S. (2007). Agrobacterium biology and crown gall disease. In Plant-Associated Bacteria (pp. 359-384). Springer Netherlands. Anand, R., & Tiwary, B. N. (2009). Pathogenicity of entomopathogenic fungi to eggs and larvae of Spodoptera litura, the common cutworm. Biocontrol Science and Technology, 19(9), 919-929.

155

Anand, R., Prasad, B., & Tiwary, B. N. (2009). Relative susceptibility of Spodoptera litura pupae to selected entomopathogenic fungi. Biocontrol, 54(1), 85-92. Andersen, S. O. (1979). Biochemistry of insect cuticle. Annual review of entomology, 24(1), 29-59. Anderson, I. C., & Parkin, P. I. (2007). Detection of active soil fungi by RT-PCR amplification of precursor rRNA molecules. Journal of Microbiological Methods, 68(2), 248-253. Anderson, I. C., Chambers, S. M., & Cairney, J. W. (2001). ITS–RFLP and ITS sequence diversity in Pisolithus from central and eastern Australian sclerophyll forests. Mycological Research, 105(11), 1304-1312. Anderson, R. D., Bell, A. S., Blanford, S., Paaijmans, K. P., & Thomas, M. B. (2011). Comparative growth kinetics and virulence of four different isolates of entomopathogenic fungi in the house fly (Muscadomestica L.). Journal of invertebrate pathology, 107(3), 179-184.

Andrew, C. G. S., Keith, F. A. W., & Carola, C. (2005). Compatibility of the entomopathogenic fungus, Lecanicillium muscarium and insecticides for eradication of sweetpotato whitefly, Bemisia tabaci. Mycopathologia, 160 (1): 35 - 41

Anees, M., Tronsmo, A., Edel-Hermann, V., Hjeljord, L. G., Héraud, C., & Steinberg, C. (2010). Characterization of field isolates of Trichoderma antagonistic against Rhizoctonia solani. Fungal biology, 114(9), 691-701. Angel-Sahagun, C. A., Lezama-Gutiérrez, R., Molina-Ochoa, J., Galindo-Velasco, E., López-Edwards, M., Rebolledo-Domínguez, O., & Foster, J. E. (2005). Susceptibility of biological stages of the horn fly, Haematobia irritans, to entomopathogenic fungi (Hyphomycetes). Journal of Insect Science, 5(1), 50. Ansari, M. A., Vestergaard, S., Tirry, L., & Moens, M. (2004). Selection of a highly virulent fungal isolate, Metarhizium anisopliae CLO 53, for controlling Hoplia philanthus. Journal of invertebrate pathology, 85(2), 89-96. Anthony, N. M., Holyoke, C. W., & Sattelle, D. B. (1994). Blocking actions of picrotoxinin analogues on insect (Periplaneta americana) GABA receptors. Neuroscience letters, 171(1), 67-69.

156

Antignus, Y. (2007). The management of Tomato yellow leaf curl virus in greenhouses and the open field, a strategy of manipulation. In Tomato Yellow Leaf Curl Virus Disease (pp. 263-278). Springer Netherlands. Antignus, Y., Lachman, O., & Pearlsman, M. (2005). Light manipulation by soil mulches protects crops from the spread of Begomoviruses. In IX International Plant Virus Epidemiology Symposium, Lima, Peru. Antignus, Y., Vunsh, R., Lachman, O., Pearlsman, M., Maslenin, L., Hananya, U., & Rosner, A. (2004). Truncated Rep gene originated from Tomato yellow leaf curl virus‐Israel confers strain‐specific resistance in transgenic tomato. Annals of Applied Biology, 144(1), 39-44.

Anwar, W., Aslam, S. N. K. M., Haider, M. S., Shahid, A. A., & Ali, M., 2015. Exploring fungal flora associated with insects of cotton agro-ecological zones of Punjab, Pakistan. Pakistan journal of Entomology, 37(1), 27-31.

Anwar, W., Khan, S. N., Aslam, M., & Haider, M. S. (2012). Occurrence of insect associated fungi in hot arid zone, Pakistan. African Journal of Microbiology Research, 6(41), 6878-6883. Arno, J., Gabarra, R., Liu, T. X., Simmons, A. M., & Gerling, D. (2009). Natural enemies of Bemisia tabaci: predators and parasitoids. In Bemisia: Bionomics and Management of a Global Pest (pp. 385-421). Springer Netherlands. Aslam, M., Khan, A. H., Rasheed, T., & Khan, I. A. (2001). Monitoring whitefly, Bemisia tabaci (genn.) on cotton. Pakistan Journal of Zoology, 33, 261-264. Assaf, L. H., Haleem, R. A., & Abdullah, S. K. (2011). Association of entomopathogenic and other opportunistic fungi with insects in dormant locations. Jordan Journal of Biological Sciences, 4(2), 87-92. Attique, M. R., Rafiq, M., Ghaffar, A., Ahmad, Z., & Mohyuddin, A. I. (2003). Hosts of Bemisia tabaci (Genn.) (Homoptera: Aleyrodidae) in cotton areas of Punjab, Pakistan. Crop Protection, 22(5), 715-720. Aung, O. M., Soytong, K., & Hyde, K. D. (2008). Diversity of entomopathogenic fungi in rainforests of Chiang Mai Province, Thailand. Fungal Divers, 30, 15-22.

157

Baek, J. M., Howell, C. R., & Kenerley, C. M. (1999). The role of an extracellular chitinase from Trichoderma virens Gv29-8 in the bio-control of Rhizoctonia solani. Current genetics, 35(1), 41-50. Balajee, S. A., Borman, A. M., Brandt, M. E., Cano, J., Cuenca-Estrella, M., Dannaoui, E., & O'donnell, K. (2009). Sequence-based identification of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: Journal of Clinical Microbiology, 47(4), 877-884. Bałazy, S. (2004). Znaczenie obszarów chronionych dla zachowania zasobów grzybów entomopatogenicznych. Kosmos, 53(1), 5-16. Baranski, R., Klocke, E., & Nothnagel, T. (2008). Chitinase CHIT36 from Trichoderma harzianum enhances resistance of transgenic carrot to fungal pathogens. Journal of phytopathology, 156(9), 513-521. Baratto, C. M., Vanusa da Silva, M., Santi, L., Passaglia, L., Schrank, I. S., Vainstein, M. H., & Schrank, A. (2003). Expression and characterization of the 42 kDa chitinase of the bio-control fungus Metarhizium anisopliae in Escherichia coli. Canadian journal of microbiology, 49(11), 723-726. Barr, D. J. S. (2001). Chytridiomycota. In Systematics and Evolution (pp. 93-112). Springer Berlin Heidelberg. Bashir, M. H., Afzal, M., Sabri, M. A., & Raza, A. B. M. (2001). Relationship between sucking insect pests and physic-morphic plant characters towards resistance/susceptibility in some new genotypes of cotton. Pakistan journal of Entomology, 23(1-2), 75-78. Basu, A. N. A. N. (1995). Bemisia tabaci (Gennadius) Crop pest and principal whitefly vector of plant viruses. Batalla-Carrera, L., Morton, A., Santamaria, S., & Garcia-del-Pino, F. (2013). Isolation and virulence of entomopathogenic fungi against larvae of hazelnut weevil Curculio nucum (Coleoptera, Curculionidae) and the effects of combining Metarhizium anisopliae with entomopathogenic nematodes in the laboratory. Biocontrol Science and Technology, 23(1), 101-125. Batta, Y. A. (2012). The first report on entomopathogenic effect of Fusarium avenaceum (Fries) Saccardo (Hypocreales, Ascomycota) against rice weevil

158

(Sitophilus oryzae L. Curculionidae, Coleoptera). Journal of Entomological and Acarological Research, 44(3), 11. Baulcombe, D. C. (1999). Fast forward genetics based on virus-induced gene silencing. Current opinion in plant biology, 2(2), 109-113. Be‟eri, Y., & Kapuler, B. (1963). Summer Squash: Growing of Vegetables, Part B, 235-240. Beard, C. E., & Adler, P. H. (2002). Seasonality of Trichomycetes in larval black flies from South Carolina, USA. Mycologia, 94(2), 200-209. Becker, A., & Lange, M. (2010). VIGS–genomics goes functional. Trends in plant science, 15(1), 1-4. Bedford, I. D., Briddon, R. W., Brown, J. K., Rosell, R. C., & Markham, P. G. (1994). Geminivirus transmission and biological characterization of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Annals of Applied Biology, 125(2), 311-325. Beevi, S. P., & Lyla, K. R. (2001). Host plant mediated natural parasitism by Encarsia spp. (Hymenoptera: Aphilinidae) on spiraling whitefly Aleurodicus dispersus Russell (Homoptera: Aleyrodidae). Proceedings of Second National Symposim on Integrated Pest Management in Horticultural Ecosystems. New Molecules, Biopesticides and Environment, 17-19. Beevi, S. P., Lyla, K. R., & Vidya, P. (1999). Report of Encarsia (Hymenoptera: Aphelinidae) on spiralling whitefly Aleurodicus dispersus Russell (Homoptera: Aleyrodidae). Insect Environment, 5(1), 44. Bendtsen, J. D., Nielsen, H., von Heijne, G., & Brunak, S. (2004). Improved prediction of signal peptides: SignalP 3.0. Journal of molecular biology, 340(4), 783-795. Ben-Yakir, D., Hadar, M., Offir, Y., Chen, M., & Tregerman, M. (2008). Protecting crops from pests using optinet screens and chromatinet shading nets. Acta Horticulturae. Berlinger, M. J. (1986). Host plant resistance to Bemisia tabaci. Agriculture, ecosystems & environment, 17(1), 69-82.

159

Bernstein, F. C., Koetzle, T. F., Williams, G. J., Meyer, E. F., Brice, M. D., Rodgers, J. R., Kennard, O., Shimanouchi, T., & Tasumi, M. (1977). The protein data bank. European Journal of Biochemistry, 80(2), 319-324.

Berretta, M. F., Lecuona, R. E., Zandomeni, R. O., & Grau, O. (1998). Genotyping isolates of the entomopathogenic fungus Beauveria bassiana by RAPD with fluorescent labels. Journal of invertebrate pathology, 71(2), 145-150. Bhanu Prakash, G. V. S., Padmaja, V., Jami, S. K., & Kirti, P. B. (2012). Expression of chitinase genes of Metarhizium anisopliae isolates in lepidopteran pests and on synthetic media. Journal of basic microbiology, 52(6), 628-635. Birch, R. G., & Franks, T. (1991). Development and optimisation of microprojectile systems for plant genetic transformation. Functional Plant Biology, 18(5), 453- 469. Bischoff-Ferrari, H. A., Dawson-Hughes, B., Staehelin, H. B., Orav, J. E., Stuck, A. E., Theiler, R., & Henschkowski, J. (2009). Fall prevention with supplemental and active forms of vitamin D: a meta-analysis of randomized controlled trials. British Medical Journal, 339, b3692. Bissett, J. (1991). A revision of the genus Trichoderma. II. Infrageneric classification. Canadian Journal of Botany, 69(11), 2357-2372. Blaiseau, P. L., & Lafay, J. F. (1992). Primary structure of a chitinase-encoding gene (chi1) from the filamentous fungus Aphanocladium album: similarity to bacterial chitinases. Gene, 120(2), 243-248. Blanford, S., & Thomas, M. B. (2001). Adult survival, maturation, and reproduction of the desert locust Schistocerca gregaria infected with the fungus Metarhizium anisopliae var acridum. Journal of invertebrate pathology, 78(1), 1-8. Bolar, J. P., Norelli, J. L., Wong, K. W., Hayes, C. K., Harman, G. E., & Aldwinckle, H. S. (2000). Expression of endochitinase from Trichoderma harzianum in transgenic apple increases resistance to apple scab and reduces vigor. Phytopathology, 90(1), 72-77. Boldo, J. T., Junges, A., Do Amaral, K. B., Staats, C. C., Vainstein, M. H., & Schrank, A. (2009). Endochitinase CHI2 of the biocontrol fungus Metarhizium anisopliae affects its virulence toward the cotton stainer bug Dysdercus peruvianus. Current genetics, 55(5), 551-560. 160

Boucias, D. G., & Pendland, J. C. (1998). Entomopathogenic fungi: fungi imperfecti. In Principles of insect pathology (pp. 321-364). Springer US. Bouvier, F., Linka, N., Isner, J. C., Mutterer, J., Weber, A. P., & Camara, B. (2006). Arabidopsis SAMT1 defines a plastid transporter regulating plastid biogenesis and plant development. The Plant Cell, 18(11), 3088-3105. Boykin, L. M., Shatters, R. G., Rosell, R. C., McKenzie, C. L., Bagnall, R. A., De Barro, P., & Frohlich, D. R. (2007). Global relationships of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed using Bayesian analysis of mitochondrial COI DNA sequences. Molecular phylogenetics and evolution, 44(3), 1306-1319. Braga, G. U., Vencovsky, R., & Messias, C. L. (1998). Estimates of genetic parameters related to chitinase production by the entomopathogenic fungus Metarhizium anisopliae. Genetics and Molecular Biology, 21(2), 171-177. Bridge, P. D., Clark, M. S., & Pearce, D. A. (2005). A new species of Paecilomyces isolated from the Antarctic springtail Cryptopygus antarcticus. Mycotaxon, 92(1), 213-222. Brogile, K., Chet, I., Holliday, M., & Cressman, R. (1991). Transgenic plants with enhanced resistance of fungal pathogen Rhizoctonia solani. Science, 254, 1194- 1197. Brown, J. K. (2001). The molecular epidemiology of begomoviruses. Trends in plant virology, 279-316. Brown, J. K. (2009). Phylogenetic biology of the Bemisia tabaci sibling species group. In Bemisia: bionomics and management of a global pest (pp. 31-67). Springer Netherlands. Brown, J. K., Coats, S. A., Bedford, I. D., Markham, P. G., Bird, J., & Frohlich, D. R. (1995). Characterization and distribution of esterase electromorphs in the whitefly, Bemisia tabaci (Genn.) (Homoptera: Aleyrodidae). Biochemical genetics, 33(7-8), 205-214. Brown, J. K., Fauquet, C. M., Briddon, R. W., Zerbini, M., Moriones, E., & Navas- Castillo, J. (2001). Geminiviridae. In: Virus Taxonomy: Ninth report of the international committee on taxonomy of viruses. Eds King Amq, Adams, M. J. Carstens, E.B. And Lefkowitz, E.J. Elsevier, Amsterdam, Netherlands, 351-373.

161

Brown, J. K., Perring, T. M., Cooper, A. D., Bedford, I. D., & Markham, P. G. (2000). Genetic analysis of Bemisia (Hemiptera: Aleyrodidae) populations by isoelectric focusing electrophoresis. Biochemical genetics, 38(1-2), 13-25. Burch‐Smith, T. M., Anderson, J. C., Martin, G. B., & Dinesh‐Kumar, S. P. (2004). Applications and advantages of virus‐induced gene silencing for gene function studies in plants. The Plant Journal, 39(5), 734-746. Butt, T. M., Jackson, C., & Magan, N. (Eds.). (2001). Fungi as biocontrol agents: progress problems and potential. CABI. Byrne, D. N., & Bellows Jr, T. S. (1991). Whitefly biology. Annual review of entomology, 36(1), 431-457. Calvert, L. A., Cuervo, M., Arroyave, J. A., Constantino, L. M., Bellotti, A., & Frohlich, D. (2001). Morphological and mitochondrial DNA marker analyses of whiteflies (Homoptera: Aleyrodidae) colonizing cassava and beans in Colombia. Annals of the Entomological Society of America, 94(4), 512-519. Candido, G. (1999). Virulence of the entomopathogenic fungus Paecilomyces amoenerosues (Hennigs) Samson toward the whitefly Bemisia argentifolii Belows and Perring. 100 p (Doctoral dissertation, Thesis MSc. University of California, Riverside, California, USA). Cardoso, P. G., Queiroz, M. V. D., Pereira, O. L., & Araujo, E. F. D. (2007). Morphological and molecular differentiation of the pectinase producing fungi Penicillium expansum and Penicillium griseoroseum. Brazilian Journal of Microbiology, 38(1), 71-77. Carruthers, R., Wraight, S., & Jones, W. (1993). An overview of biological control of the Sweetpotato whitefly, Bemisia tabaci. Proceedings (USA). Castrillo, L. A., & Brooks, W. M. (1998). Differentiation of Beauveria bassiana isolates from the darkling beetle, Alphitobius diaperinus, using isozyme and RAPD analyses. Journal of Invertebrate pathology, 72(3), 190-196. Chan, M. S., & Godfray, H. C. J. (1993). Host-feeding strategies of parasitoid wasps. Evolutionary Ecology, 7(6), 593-604. Chan-Cupul, W., Ruiz-Sanchez, E., Lara-Reyna, J., Reyes-Ramirez, A., Cristobal- Alejo, J., Tun-Suarez, J. M., & Gonzalez, D. M. (2013). Pathogenicity of native isolates of Isaria fumosorosea (Deuteromycotina: Hyphomycetes) on immature

162

whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) and their genetic variability. African Journal of Microbiology Research, 7(11), 925-931. Chandler, D., Hay, D., & Reid, A. P. (1997). Sampling and occurrence of entomopathogenic fungi and nematodes in UK soils. Applied Soil Ecology, 5(2), 133-141. Chandok, M. R., Ekengren, S. K., Martin, G. B., & Klessig, D. F. (2004). Suppression of pathogen-inducible NO synthase (iNOS) activity in tomato increases susceptibility to Pseudomonas syringae. Proceedings of the National Academy of Sciences of the United States of America, 101(21), 8239-8244. Charnley, A., & Collins, S. (2007). Entomopathogenic fungi and their role in pest control. Environmental and Microbial Relationships, 4, 159. Chen, C., Ridzon, D. A., Broomer, A. J., Zhou, Z., Lee, D. H., Nguyen, J. T., & Lao, K. Q. (2005). Real-time quantification of microRNAs by stem–loop RT– PCR. Nucleic acids research, 33(20), 179-179. Chen, J. K., Shen, C.R., & Liu, C. L. (2010). N-acetylglucosamine: production and applications. Marine drugs, 8(9), 2493-2516. Chen, J., McAuslane, H. J., Carle, R. B., & Webb, S. E. (2004). Impact of Bemisia argentifolii (Homoptera: Auchenorrhyncha: Aleyrodidae) infestation and squash silver leaf disorder on zucchini yield and quality. Journal of economic entomology, 97(6), 2083-2094. Chiel, E., Gottlieb, Y., Zchori-Fein, E., Mozes-Daube, N., Katzir, N., Inbar, M., & Ghanim, M. (2007). Biotype-dependent secondary symbiont communities in sympatric populations of Bemisia tabaci. Bulletin of Entomological Research, 97(04), 407-413. Childs, I. J., Gunning, R. V., & Mansfield, S. (2011). Parasitoids of economically important whiteflies associated with greenhouse vegetable crops in western Sydney. Australian journal of Entomology, 50(3), 296-299. Chinh, T. K., Quyen, H. T., & Tu, H. T. M. (2001). Selecting medium for rearing and multiplicating Metarhizium anisopliae fungus for controlling termite, Coptotermes formosanus .Proceeding, International Workshop on Biology Hanoi. 2, 77-81.

163

Cho, E. M., Kirkland, B. H., Holder, D. J., & Keyhani, N. O. (2007). Phage display cDNA cloning and expression analysis of hydrophobins from the entomopathogenic fungus Beauveria (Cordyceps) bassiana. Microbiology, 153(10), 3438-3447. Cho, E.M., Liu, L., Farmerie, W., & Keyhani, N.O. (2006). EST analysis of cDNA libraries from the entomopathogenic fungus Beauveria (Cordyceps) bassiana. Evidence for stage-specific gene expression in aerial conidia, in vitro blastospores and submerged conidia. Microbiology, 152(9), 2843-2854. Choi, I. Y., Hong, S. B., & Yadav, M. C. (2003). Molecular and morphological characterization of green mold, Trichoderma spp. isolated from oyster mushrooms. Mycobiology, 31(2), 74-80.

Chong, H.S. (2016). Wither the concepts of mole and concentration: Conceptual

confusion in applying M1V1 = M2V2. Universal journal educational research, 4(5), 1158-1162.

Christou, P. (1992). Genetic transformation of crop plants using micro-projectile bombardment. The Plant Journal, 2(3), 275-281.

Chu, D., Wan, F. H., Zhang, Y. J., & Brown, J. K. (2010). Change in the biotype composition of Bemisia tabaci in Shandong Province of China from 2005 to 2008. Environmental Entomology, 39(3), 1028-1036.

Chu, D., Zhang, Y. J., Brown, J. K., Cong, B., Xu, B. Y., Wu, Q. J., & Zhu, G. R. (2006). The introduction of the exotic Q biotype of Bemisia tabaci from the Mediterranean region into China on ornamental crops. Florida Entomologist, 89(2), 168-174.

Chu, Z., Yuan, M., Yao, J., Ge, X., Yuan, B., Xu, C., & Zhang, Q. (2006). Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes & development, 20(10), 1250-1255.

Cohen-Kupiec, R., & Chet, I. (1998). The molecular biology of chitin digestion. Current opinion in biotechnology, 9(3), 270-277.

164

Colinet, H., Nguyen, T. T. A., Cloutier, C., Michaud, D., & Hance, T. (2007). Proteomic profiling of a parasitic wasp exposed to constant and fluctuating cold exposure. Insect biochemistry and molecular biology, 37(11), 1177-1188. Collier, T. R., & Hunter, M. S. (2001). Lethal interference competition in the whitefly parasitoids Eretmocerus eremicus and Encarsia sophia. Oecologia, 129(1), 147- 154. Colvin, J., Omongo, C., Govindappa, M., Stevenson, P. C., Maruthi, M., Gibson, G., & Muniyappa, V. (2006). Host‐plant viral infection effects on arthropod‐vector population growth, development and behaviour: Management and epidemiological implications. Advances in virus research, 67, 419-452. Cooper, R., & Sweeney, A. (1986). Laboratory studies on the recycling potential of the mosquito pathogenic fungus Culicinomyces clavisporus. Journal of invertebrate pathology, 48(2), 152-158. Correll, J., Rhoads, D., & Guerber, J. (1993). Examination of mitochondrial DNA restriction fragment length polymorphisms, DNA fingerprints, and randomly amplified polymorphic DNA of Colletotrichum orbiculare. Phytopathology, 83(11), 1199-1204. Costa, H., Brown, J., Sivasupramaniam, S., & Bird, J. (1993). Regional distribution, insecticide resistance, and reciprocal crosses between the A and B biotypes of Bemisia tabaci. International Journal of Tropical Insect Science, 14(02), 255- 266. Cottrell, M. T., Moore, J. A., & Kirchman, D. L. (1999). Chitinases from uncultured marine microorganisms. Applied and environmental microbiology, 65(6), 2553- 2557. Coudron, T., Kroha, M., & Ignoffo, C. (1984). Levels of chitinolytic activity during development of three entomopathogenic fungi. Comparative biochemistry and physiology Part B: Comparative Biochemistry, 79(3), 339-348. Crowder, D. W., Ellsworth, P. C., Tabashnik, B. E., & Carriére, Y. (2008). Effects of operational and environmental factors on evolution of resistance to pyriproxyfen in the sweetpotato whitefly (Hemiptera: Aleyrodidae). Environmental entomology, 37(6), 1514-1524. Crowder, D. W., Horowitz, A. R., De Barro, P. J., Liu, S. S., Showalter, A. M., Kontsedalov, S., & Carrière, Y. (2010). Mating behaviour, life history and 165

adaptation to insecticides determine species exclusion between whiteflies. Journal of Animal Ecology, 79(3), 563-570. Csizinszky, A., Schuster, D., & Kring, J. (1995). Color mulches influence yield and insect pest populations in tomatoes. Journal of the American Society for Horticultural Science, 120(5), 778-784. Cuthbertson, A. G., & Walters, K. F. (2005). Pathogenicity of the entomopathogenic fungus, Lecanicillium muscarium, against the sweetpotato whitefly Bemisia tabaci under laboratory and glasshouse conditions. Mycopathologia, 160(4), 315- 319. Cuthbertson, A. G., Walters, K. F., & Deppe, C. (2005). Compatibility of the entomopathogenic fungus Lecanicillium muscarium and insecticides for eradication of sweetpotato whitefly, Bemisia tabaci. Mycopathologia, 160(1), 35- 41. Czosnek, H., Ghanim, M., Morin, S., Rubinstein, G., Fridman, V., & Zeidan, M. (2001). Whiteflies: vectors, and victims, of geminiviruses. Advances in virus research, 57, 291-322. da Costa, G. L., de Moraes, A. M. L., & Galvao, C. (2003). Entomopathogenic effect of Aspergillus giganteus and Penicillium corylophilum on two triatomine vectors of Chagas disease. Journal of basic microbiology, 43(1), 3-7. da Silva, M. V., Santi, L., Staats, C. C., da Costa, A. M., Colodel, E. M., Driemeier, D., Schrank, A. (2005). Cuticle-induced endo/exoacting chitinase CHIT30 from Metarhizium anisopliae is encoded by an ortholog of the chi3 gene. Research in microbiology, 156(3), 382-392. Dahiya, N., Tewari, R., & Hoondal, G. S. (2006). Biotechnological aspects of chitinolytic enzymes: a review. Applied microbiology and biotechnology, 71(6), 773-782. Dalmon, A. (2007). Caractérisation biologique et moléculaire de deux crinivirus de la tomate et structure génétique des populations de Bemisia tabaci. Aix Marseille 2. Daniel, C., & Wyss, E. (2009). Susceptibility of different life stages of the European cherry fruit fly, Rhagoletis cerasi, to entomopathogenic fungi. Journal of Applied Entomology, 133(6), 473-483.

166

Daniel, C., & Wyss, E. (2010). Field applications of Beauveria bassiana to control the European cherry fruit fly Rhagoletis cerasi. Journal of Applied Entomology, 134(9‐10), 675-681. Daoust, R. A., & Roberts, D. W. (1982). Virulence of natural and insect-passaged strains of Metarhizium anisopliae to mosquito larvae. Journal of Invertebrate Pathology, 40(1), 107-117. Das, A., Bhattacharya, S., Palaniswamy, M., & Angayarkanni, J. (2013). Molecular identification of Aspergillus flavus GHBF09 involved in aflatoxin B1 production in rice straw. Annals of Biological Research, 4, 102-110. Datta, K., Tu, J., Oliva, N., Ona, I., Velazhahan, R., Mew, T. W., & Datta, S. K. (2001). Enhanced resistance to sheath blight by constitutive expression of infection-related rice chitinase in transgenic elite indica rice cultivars. Plant Science, 160(3), 405-414. Dayakar, S., & Kanaujia, K. R. (2003). Evaluation of the pathogenicity of Beauveria bassiana, Metarhizium anisopliae and Nomuraea rileyi on different larval stages of tobacco caterpillar, Spodoptera litura (F.). Indian Journal of Plant Protection, 31(2), 9-12. de Assis Filho, F., Naidu, R., Deom, C., & Sherwood, J. (2002). Dynamics of Tomato spotted wilt virus replication in the alimentary canal of two thrips species. Phytopathology, 92(7), 729-733. De Barro, P. J. (2012). The Bemisia tabaci species complex: questions to guide future research. Journal of Integrative Agriculture, 11(2), 187-196. De Barro, P. J., Liu, S. S., & Bourne, A. (2010). Age-based differential host acceptability and human mediated disturbance prevent establishment of an invasive species and displacement of a native competitor. Biological invasions, 12(10), 3429-3438. De Barro, P. J., Liu, S. S., Boykin, L. M., & Dinsdale, A. B. (2011). Bemisia tabaci: a statement of species status. Annual review of entomology, 56, 1-19. De Barro, P., & Hart, P. (2000). Mating interactions between two biotypes of the whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae) in Australia. Bulletin of entomological research, 90(02), 103-112. De Barro, P., Trueman, J., & Frohlich, D. (2005). Bemisia argentifolii is a race of B. tabaci (Hemiptera: Aleyrodidae): the molecular genetic differentiation of B. 167

tabaci populations around the world. Bulletin of entomological research, 95(03), 193-203. De Block, M., Debrouwer, D., & Moens, T. (1997). The development of a nuclear male sterility system in wheat. Expression of the barnase gene under the control of tapetum specific promoters. Theoretical and Applied Genetics, 95(1-2), 125- 131. de Faria, M. R., & Wraight, S. P. (2007). Mycoinsecticides and mycoacaricides: a comprehensive list with worldwide coverage and international classification of formulation types. Biological Control, 43(3), 237-256. Deshmukh, A. N. (1998). Studies on leaf spot and fruit rot of chilli caused by Alternaria alternata (Fr.) Keissler. M.Sc. (Agri.) Thesis submitted to M.P.K.V., Rahuri. Devi, K. U., Padmavathi, J., Sharma, H., & Seetharama, N. (2001). Laboratory evaluation of the virulence of Beauveria bassiana isolates to the sorghum shoot borer Chilo partellus Swinhoe (Lepidoptera: Pyralidae) and their characterization by RAPD-PCR. World Journal of Microbiology and Biotechnology, 17(2), 131- 137. Dhar, P., & Kaur, G. (2009). Effects of carbon and nitrogen sources on the induction and repression of chitinase enzyme from Metarhizium anisopliae isolates. Annals of microbiology, 59(3), 545-551. Dhar, P., & Kaur, G. (2010a). Cuticle-degrading proteases produced by Metarhizium anisopliae and their induction in different media. Indian journal of microbiology, 50(4), 449-455. Dhar, P., & Kaur, G. (2010b). Effects of carbon and nitrogen sources on the induction and repression of chitinase enzyme from Beauveria bassiana isolates. African Journal of Biotechnology, 9(47), 8092-8099. Diguta, C., Vincent, B., Guilloux-Benatier, M., Alexandre, H., & Rousseaux, S. (2011). PCR ITS-RFLP: a useful method for identifying filamentous fungi isolates on grapes. Food microbiology, 28(6), 1145-1154. Dinesh-Kumar, S., Anandalakshmi, R., Marathe, R., Schiff, M., & Liu, Y. (2003). Virus-induced gene silencing. Plant Functional Genomics, 287-293. Dinsdale, A., Cook, L., Riginos, C., Buckley, Y., & De Barro, P. (2010). Refined global analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: 168

Aleyrodidae) mitochondrial cytochrome oxidase 1 to identify species level genetic boundaries. Annals of the Entomological Society of America, 103(2), 196-208. Distefano, G., La Malfa, S., Vitale, A., Lorito, M., Deng, Z., & Gentile, A. (2008). Defence-related gene expression in transgenic lemon plants producing an antimicrobial Trichoderma harzianum endochitinase during fungal infection. Transgenic research, 17(5), 873-879. Ditt, R. F., Nester, E. W., & Comai, L. (2001). Plant gene expression response to Agrobacterium tumefaciens. Proceedings of the National Academy of Sciences, 98(19), 10954-10959. Doberski, J., & Tribe, H. (1980). Isolation of entomogenous fungi from elm bark and soil with reference to ecology of Beauveria bassiana and Metarhizium anisopliae. Transactions of the British Mycological Society, 74(1), 95-100. Domsch, K. H., Gams, W., & Anderson, T. H. (1980). Compendium of soil fungi. Volume 2. Academic Press (London) Ltd. Dong, Y., Burch-Smith, T. M., Liu, Y., Mamillapalli, P., & Dinesh-Kumar, S. P. (2007). A ligation-independent cloning tobacco rattle virus vector for high- throughput virus-induced gene silencing identifies roles for NbMADS4-1 and-2 in floral development. Plant physiology, 145(4), 1161-1170. Donnelly, L. E., & Barnes, P. J. (2004). Acidic mammalian chitinase–a potential target for asthma therapy. Trends in pharmacological sciences, 25(10), 509-511. Doukas, D., & Payne, C. C. (2007). Effects of UV-blocking films on the dispersal behavior of Encarsia formosa (Hymenoptera: Aphelinidae). Journal of economic entomology, 100(1), 110-116. Downie, D. (2010). Baubles, bangles, and biotypes: a critical review of the use and abuse of the biotype concept. Journal of Insect Science, 10(1), 176. Driver, F., Milner, R. J., & Trueman, J. W. (2000). A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycological Research, 104(02), 134-150. Dromph, K. M. (2001). Dispersal of entomopathogenic fungi by collembolans. Soil Biology and Biochemistry, 33(15), 2047-2051. Duo-Chuan, L. (2006). Review of fungal chitinases. Mycopathologia, 161(6), 345- 360. 169

Easwaramoorthy, S. (2003). Entomopathogenic fungi, In: Biopesticides and bioagents in integrated pest management of agricultural crops, (R.P. Srivastava, ed.). International book distributing co., India 341-379.

Eilenberg, J., & Meadow, R. (2002). Fungi for biological control of brassica root flies Delia radicum and Delia floralis. Advances in Microbial Control of Insect Pests (pp. 181-191): Springer. Eilenberg, J., Schmidt, N. M., Meyling, N. V., & Wolsted, C. (2007). Preliminary survey for insect pathogenic fungi in Greenland. IOBC WPRS BULLETIN, 30(1), 117. Ekengren, S. K., Liu, Y., Schiff, M., Dinesh‐Kumar, S., & Martin, G. B. (2003). Two MAPK cascades, NPR1, and TGA transcription factors play a role in Pto‐mediated disease resistance in tomato. The Plant Journal, 36(6), 905-917. El-Katatny, M. H. (2010). Virulence potential of some fungal isolates and their control-promise against the Egyptian cotton leaf worm, Spodoptera littoralis. Archives of Phytopathology and Plant Protection, 43(4), 332-356. Ellsworth, P. C., Tronstad, R., Leser, J., Goodell, P. B., Godfrey, L. D., Henneberry, T. J., & Nichols, R. L. (1999). Sticky cotton sources and solutions. IPM Series, (13). Elsey, K., & Farnham, M. (1994). Response of Brassica oleracea L. to Bemisia tabaci (Gennadius). HortScience, 29(7), 814-817. Eyal, J., Mabud, M. A., Fischbein, K., Walter, J., Osborne, L., & Landa, Z. (1994). Assessment of Beauveria bassiana Nov. EO-1 strain, which produces a red pigment for microbial control. Applied Biochemistry and Biotechnology, 44(1), 65-80. Falquet, L., Pagni, M., Bucher, P., Hulo, N., Sigrist, C. J., Hofmann, K., & Bairoch, A. (2002). The Prosite database, its status in 2002. Nucleic acids research, 30(1), 235-238. Fan, J. H., Xie, Y. P., Xue, J. L., Xiong, Q., Jiang, W.J., Zhang, Y.J., & Ren, Z. M. (2014). The strain HEB01 of Fusarium sp., a new pathogen that infects brown soft scale. Annals of microbiology, 64(1), 333-341.

170

Fan, Y., Fang, W., Guo, S., Pei, X., Zhang, Y., Xiao, Y., Pei, Y. (2007). Increased insect virulence in Beauveria bassiana strains overexpressing an engineered chitinase. Applied and Environmental Microbiology, 73(1), 295-302. Fang, W., Leng, B., Xiao, Y., Jin, K., Ma, J., Fan, Y., Pei, Y. (2005). Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence. Applied and Environmental Microbiology, 71(1), 363-370. Fang, W., Pava-Ripoll, M., Wang, S., & Leger, R. S. (2009). Protein kinase A regulates production of virulence determinants by the entomopathogenic fungus, Metarhizium anisopliae. Fungal Genetics and Biology, 46(3), 277-285. Faria, M., & Wraight, S. P. (2001). Biological control of Bemisia tabaci with fungi. Crop protection, 20(9), 767-778. Fatiha, L., Ali, S., Ren, S., & Afzal, M. (2007). Biological characteristics and pathogenicity of Verticillium lecanii against Bemisia tabaci (Homoptera: Aleyrodidae) on eggplant. Pakistan journal of Entomology, 29(2), 63-72. Fegan, M., Manners, J., Maclean, D., Irwin, J., Samuels, K., Holdom, D., & Li, D. (1993). Random amplified polymorphic DNA markers reveal a high degree of genetic diversity in the entomopathogenic fungus Metarhizium anisopliae var. anisopliae. Microbiology, 139(9), 2075-2081. Ferron, P. (1978). Biological control of insect pests by entomogenous fungi. Annual Review of Entomology, 23(1), 409-442. Fiedler, Ż., & Sosnowska, D. (2007). Nematophagous fungus Paecilomyces lilacinus (Thom) Samson is also a biological agent for control of greenhouse insects and mite pests. BioControl, 52(4), 547-558. Fierens, K., Gils, A., Sansen, S., Brijs, K., Courtin, C. M., Declerck, P. J., Robben, J. (2005). His374 of wheat endoxylanase inhibitor TAXI‐I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases. Febs Journal, 272(22), 5872-5882. Fisher, J. J., Rehner, S. A., & Bruck, D. J. (2011). Diversity of rhizosphere associated entomopathogenic fungi of perennial herbs, shrubs and coniferous trees. Journal of invertebrate pathology, 106(2), 289-295. Fishpool, L. D. C., & Burban, C. (1994). Bemisia tabaci: the whitefly vector of African cassava mosaic geminivirus. Tropical Science, 34(1), 55-72.

171

Fleming, R., & Retnakaran, A. (1985). Evaluating single treatment data using Abbott‟s formula with reference to insecticides. Journal of Economic Entomology, 78(6), 1179-1181. Ford, R., Banniza, S., Photita, W., & Taylor, P. (2004). Morphological and molecular discrimination of Colletotrichum truncatum causing anthracnose on lentil in Canada. Australasian Plant Pathology, 33(4), 559-569. Fouly, H. M., Wilkinson, H. T., & Chen, W. (1997). Restriction analysis of internal transcribed spacers and the small subunit gene of ribosomal DNA among four Gaeumannomyces species. Mycologia, 590-597. Fraley, R. T., Horsch, R. B., Matzke, A., Chilton, M.-D., Chilton, W. S., & Sanders, P. R. (1984). In vitro transformation of petunia cells by an improved method of co-cultivation with A. tumefaciens strains. Plant molecular biology, 3(6), 371- 378. Frandberg, E., & Schnürer, J. (1994). Evaluation of a chromogenic chito‐oligosaccharide analogue, p‐nitrophenyl‐β‐D‐N, N'‐diacetylchitobiose, for the measurement of the chitinolytic activity of bacteria. Journal of applied bacteriology, 76(3), 259-263. Freeman, S., Pham, M., & Rodriguez, R. (1993). Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A+ T-rich DNA, and nuclear DNA analyses. Experimental Mycology, 17(4), 309-322. Freimoser, F. M., Screen, S., Bagga, S., Hu, G., & St Leger, R. J. (2003). Expressed sequence tag (EST) analysis of two subspecies of Metarhizium anisopliae reveals a plethora of secreted proteins with potential activity in insect hosts. Microbiology, 149(1), 239-247. Frohlich, D., Torres‐Jerez, I., Bedford, I., Markham, P., & Brown, J. K. (1999). A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Molecular Ecology, 8(10), 1683-1691. Fuxa, J. R., & Tanada, Y. (1987). Epidemiological concepts applied to insect epizootiology Epizootiology of insect diseases (pp. 3-21): Wiley New York. Gaitan, A., Valderrama, A. M., Saldarriaga, G., Velez, P., & Bustillo, A. (2002). Genetic variability of Beauveria bassiana associated with the coffee berry borer Hypothenemus hampei and other insects. Mycological Research, 106(11), 1307- 1314. 172

Gams, W., & Zare, R. (2001). A revision of Verticillium sect. Prostrata. III. Generic classification. Nova Hedwigia, 329-337. Gan, Z., Yang, J., Tao, N., Yu, Z., & Zhang, K. (2007). Cloning and expression analysis of a chitinase gene Crchi1 from the mycoparasitic fungus Clonostachys rosea (syn. Gliocladium roseum). Journal of Microbiology-Seoul 45(5), 422. Garcia, I., Lora, J. M., de la Cruz, J., Benitez, T., Llobell, A., & Pintor-Toro, J. A. (1994). Cloning and characterization of a chitinase (CHIT42) cDNA from the mycoparasitic fungus Trichoderma harzianum. Current genetics, 27(1), 83-89. Gazis, R., Rehner, S., & Chaverri, P. (2011). Species delimitation in fungal endophyte diversity studies and its implications in ecological and biogeographic inferences. Molecular Ecology, 20(14), 3001-3013. Geetha, B., & Swamiappan, M. (2001). Record of parasitoid and a parasite mite on spiralling whitefly, Aleurodicus dispersus Russell in Tamil Nadu. Insect Environment, 6(4), 179-180. Gelvin, S. B. (2003). Agrobacterium-mediated plant transformation: the biology behind the “gene-jockeying” tool. Microbiology and molecular biology reviews, 67(1), 16-37. Gennadius, P. (1889). Disease of tobacco plantations in the Trikonia. The aleurodid of tobacco. Ellenike Georgia, 5, 1-3. Gentile, A., Deng, Z., La Malfa, S., Distefano, G., Domina, F., Vitale, A., Tribulato, E. (2007). Enhanced resistance to Phoma tracheiphila and Botrytis cinerea in transgenic lemon plants expressing a Trichoderma harzianum chitinase gene. Plant Breeding, 126(2), 146-151. Gerling, D. (1990). Natural enemies of whiteflies: predators and parasitoids. Whiteflies: their bionomics, pest status and management, 147-185. Gerling, D. M. (1996). Bemisia: 1995 taxonomy, biology, damage, control and management (No. 632.752 B455). Intercept. Gerling, D., Alomar, O., & Arnò, J. (2001). Biological control of Bemisia tabaci using predators and parasitoids. Crop Protection, 20(9), 779-799. Ghosh, C. L. (1998). Studies on Alternaria alternata (Fr.) Keissler of Gerbera (Gerbera jamesonii Hook.). M.Sc. (Agri.) Thesis submitted to M.P.K.V., Rahuri. Ghosh, S. K., & Pal, S. (2016). Entomopathogenic potential of Trichoderma longibrachiatum and its comparative evaluation with malathion against the insect 173

pest Leucinodes orbonalis. Environmental monitoring and assessment, 188(1), 1-7. Gindin, G., & Ben-Ze‟ev, I. (1994). Natural occurrence of and inoculation experiments with Conidiobolus coronatus and Conidiobolus sp. in glasshouse populations of Bemisia tabaci. Phytoparasitica, 22(3), 197-208. Gindin, G., Geschtovt, N., Raccah, B., & Barash, I. (2000). Pathogenicity of Verticillium lecanii to different developmental stages of the silverleaf whitefly, Bemisia argentifolii. Phytoparasitica, 28(3), 229-239. Glare, T., & Goettel, M. (2010). Entomopathogenic fungi and their role in regulation of insect populations. Insect Control: Biological and Synthetic Agents. Goettel, M. S., & Inglis, G. D. (1997). Fungi: Hyphomycetes. In “Manual of Techniques in Insect Pathology” (LA Lacey, Ed.) pp. 213–249. Goettel, M. S., Eilenberg, J., & Glare, T. R. (2005). Entomopathogenic fungi and their role in regulation of insect populations. In: Gilbert L, Iatrou K, Gill S (Eds.), Comprehensive Molecular Insect Science, 6, 361- 406. Goettel, M. S., Hajek, A. E., Siegel, J. P., & Evans, H. C. (2001). Safety of fungal biocontrol agents. Fungi as biocontrol agents, 347. Gooday, G. W. (1990). The ecology of chitin degradation Advances in microbial ecology (pp. 387-430): Springer. Gotelli, N. J., & Colwell, R. K. (2001). Quantifying biodiversity: procedures and pitfalls in the measurement and comparison of species richness. Ecology letters, 4(4), 379-391. Gottlieb, Y., Ghanim, M., Chiel, E., Gerling, D., Portnoy, V., Steinberg, S., & Mozes- Daube, N. (2006). Identification and localization of a Rickettsia sp. in Bemisia tabaci (Homoptera: Aleyrodidae). Applied and Environmental Microbiology, 72(5), 3646-3652. Greenberg, S. M., Jones, W. A., & LIU, T. X. (2008). Bemisia tabaci (Homoptera: Aleyrodidae) instar effects on rate of parasitism by Eretmocerus mundus and Encarsia pergandiella (Hymenoptera: Aphelinidae). Entomological science, 11(1), 97-103. Gruenhagen, N. M., & Perring, T. M. (2001). Impact of leaf trichomes on parasitoid behavior and parasitism of silver leaf whiteflies (Homptera: Aleyrodidae). Southwestern Entomologist, 26(4), 279-290. 174

Gunnell, P. S., & Gubler, W. D. (1992). Taxonomy and morphology of Colletotrichum species pathogenic to strawberry. Mycologia, 157-165. Gupta, B., Saha, J., Sengupta, A., & Gupta, K. (2014). Recent advances on Virus Induced Gene silencing (VIGS): Plant functional genomics. Journal of Plant Biochemistry & Physiology, 2013. Gupta, R., Saxena, R., Chaturvedi, P., & Virdi, J. (1995). Chitinase production by Streptomyces viridificans: its potential in fungal cell wall lysis. Journal of Applied Bacteriology, 78(4), 378-383. Gupta, S., Krasnoff, S. B., Underwood, N. L., Renwick, J., & Roberts, D. W. (1991). Isolation of beauvericin as an insect toxin from Fusarium semitectum and Fusarium moniliforme var. subglutinans. Mycopathologia, 115(3), 185-189. Hajek, A., & St. Leger, R. (1994). Interactions between fungal pathogens and insect hosts. Annual review of entomology, 39(1), 293-322. Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Paper presented at the Nucleic acids symposium series. Hameed, S., Khalid, S., Ehsan-ul-Haq, S., & Hashrni, A. A. (1994). Cotton leaf curl disease in Pakistan caused by a whitefly-transmitted geminivirus. Plant Disease, 78(5), 529. Hanif-Khan, S., Bullock, R., Stoffella, P., Brecht, J., Powell, C., & McAuslane, H. (1996). Symptom development and susceptibility of dwarf cherry tomato to tomato irregular ripening, a fruit disorder induced by silverleaf whitefly. Horticulture Science, 31(4), 678-678. Harrison, B. (1985). Advances in geminivirus research. Annual Review of Phytopathology, 23(1), 55-82. Harrison, B., Liu, Y., Khalid, S., Hameed, S., Otim-Nape, G., & Robinson, D. (1997). Detection and relationships of cotton leaf curl virus and allied whitefly‐transmitted geminiviruses occurring in Pakistan. Annals of Applied Biology, 130(1), 61-75. Hasan, S. (2014). Entomopathogenic fungi as potent agents of biological control. International Journal of. Hatai, T., Matsuzawa, A., Inoshita, S., Mochida, Y., Kuroda, T., Sakamaki, K., & Takeda, K. (2000). Execution of apoptosis signal-regulating kinase 1 (ASK1)- 175

induced apoptosis by the mitochondria-dependent caspase activation. Journal of Biological Chemistry, 275(34), 26576-26581. Hatting, J. L., Humber, R. A., Poprawski, T. J., & Miller, R. M. (1999). A survey of fungal pathogens of aphids from South Africa, with special reference to cereal aphids. Biological Control, 16(1), 1-12. Hayek, L. A. C., & Buzas, M. A. (2010). Surveying natural populations: quantitative tools for assessing biodiversity: Columbia University Press. Hayes, C.K., Klemsdal, S., Lorito, M., Di Pietro, A., Peterbauer, C., Nakas, J.P., Tronsmo, A., & Harman, G.E. (1994). Isolation and sequence of an endochitinase-encoding gene from a cDNA library of Trichoderma harzianum. Gene, 138(1), 143-148. He, X., Anderson, J. C., Pozo, O. d., Gu, Y. Q., Tang, X., & Martin, G. B. (2004). Silencing of subfamily I of protein phosphatase 2A catalytic subunits results in activation of plant defense responses and localized cell death. The Plant Journal, 38(4), 563-577. Herlinda, S., Irsan, C., Mayasari, R., & Septariani, S. (2010). Identification and selection of entomopathogenic fungi as biocontrol agents for Aphis gossypii from South Sumatra. Microbiology Indonesia, 4(3). Hermosa, M. R., Keck, E., Chamorro, I., Rubio, B., Sanz, L., Vizcaíno, J. A., Monte, E. (2004). Molecular characterization of bio-control agents. Bulletin-OILB- SROP, 27(8), 165-168. Hibbett, D. S., Binder, M., Bischoff, J. F., Blackwell, M., Cannon, P. F., Eriksson, O. E., ... & Lumbsch, H. T. (2007). A higher-level phylogenetic classification of the Fungi. Mycological research, 111(5), 509-547.

Hilje, L. (2000). Prácticas agrícolas para el manejo de Bemisia tabaci. Manejo Integrado de Plagas, 56, 22-30. Hilje, L., Costa, H. S., & Stansly, P. A. (2001). Cultural practices for managing Bemisia tabaci and associated viral diseases. Crop Protection, 20(9), 801-812. Hillis, D. M., & Moritz, C. (1990). An overview of applications of molecular systematics. In: molecular systematics. Hillis, D. M. And Mortiz, C. Eds. Sinauer Assoc., Sunderland, Ma, 502-515

176

Hodson, A., Mills, P. R., & Brown, A. E. (1993). Ribosomal and mitochondrial DNA polymorphisms in Colletotrichum gloeosporioides isolated from tropical fruits. Mycological Research, 97(3), 329-335. Højrup, P., Andersen, S., & Roepstorff, P. (1986). Primary structure of a structural protein from the cuticle of the migratory locust, Locusta migratoria. Biochemical journal, 236(3), 713-720. Hollis, T., Monzingo, A. F., Bortone, K., Ernst, S., Cox, R., & Robertus, J. D. (2000). The X-ray structure of a chitinase from the pathogenic fungus Coccidioides immitis. Protein Science, 9(03), 544-551. Holzberg, S., Brosio, P., Gross, C., & Pogue, G. P. (2002). Barley stripe mosaic virus‐induced gene silencing in a monocot plant. The Plant Journal, 30(3), 315- 327. Hoog, G. d. (1972). The genera Beauveria, Isaria, Tritiirachium and Acrodontium gen. nov. Stud. Mycol, 1, 1-41. Hooykaas, P. J., & Schilperoort, R. A. (1992). Agrobacterium and plant genetic engineering 10 Years Plant Molecular Biology (pp. 15-38): Springer. Horowitz, A. R., Kontsedalov, S., Khasdan, V., & Ishaaya, I. (2005). Biotypes B and Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Archives of insect biochemistry and physiology, 58(4), 216-225. Horowitz, A., Denholm, I., Gorman, K., Cenis, J., Kontsedalov, S., & Ishaaya, I. (2003). Biotype Q of Bemisia tabaci identified in Israel. Phytoparasitica, 31(1), 94-98. Horowitz, R., Denholm, I., & Morin, S. (2007). Resistance to insecticides in the TYLCV vector, Bemisia tabaci Tomato Yellow Leaf Curl Virus Disease (pp. 305- 325): Springer. Howell, J. T., & Davis, M. (2005). Plant defense mechanisms against fungal pathogens: polygalacturonase inhibitor proteins. Canadian journal of plant pathology, 27(1), 5-15. Huang, Z., Teh, S. K., Zheng, W., Lin, K., Ho, K. Y., Teh, M., & Yeoh, K. G. (2010). In vivo detection of epithelial neoplasia in the stomach using image-guided Raman endoscopy. Biosensors and Bioelectronics, 26(2), 383-389.

177

Humber, R. A. (2012). Identification of entomopathogenic fungi, in Manual of Techniques in Insect Pathology, ed. by Lacey LA. Academic Press, San Diego, CA, pp. 151–186.

Husnain, H., Shahid, A. A., Haq, M. I., Ali, A., Muhammed, U., & Anam, U. (2014). Efficacy of entomopathogenic fungi as biological control agent against insect pests of Gossypium hirsutum. Journal of Natural Sciences Research, 4(5), 68-72.

Hussain, T., & Ali, M. (1975). Review of cotton diseases of Pakistan. Pakistan cottons. Huvenne, H., & Smagghe, G. (2010). Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. Journal of insect physiology, 56(3), 227-235. Hwang, I. S., & Hwang, B. K. (2010). The pepper 9-lipoxygenase gene CaLOX1 functions in defense and cell death responses to microbial pathogens. Plant physiology, 152(2), 948-967. Ibrahim, H. Y. E., Salam, A. M., Abdel-Mogib, M. M. E., El-nagar Hoda, S. A., & Nada, S. A. (2011). Survey of entomopathogenic fungi naturally infecting cowpea aphid, Aphis craccivora. KOCH. Journal of Plant Protection and Pathology, Mansoura Univ., 2 (12), 1063 – 1070. Ibrahim, L., Hamieh, A., Ghanem, H., & Ibrahim, S. (2011). Pathogenicity of entomopathogenic fungi from Lebanese soils against aphids, whitefly and non- target beneficial insects. International Journal of Agriculture Sciences, 3(3), 156. Idris, A. M. (1990). Cotton leaf curl virus disease in the Sudan. Mededelingen van de Faculteit Landbouwwetenschappen, Rijksuniversiteit Gent, 55(2a), 263-267. Inglis, G. D., Goettel, M. S., Butt, T. M., & Strasser, H. (2001). Use of Hyphomycetous fungi for managing insect pests. Fungi as biocontrol agents, 23- 69. Jackson, D. M., Farnham, M., Simmons, A., Van Giessen, W., & Elsey, K. (2000). Effects of planting pattern of collards on resistance to whiteflies (Homoptera: Aleyrodidae) and on parasitoid abundance. Journal of economic entomology, 93(4), 1227-1236.

178

James, R., Buckner, J., & Freeman, T. (2003). Cuticular lipids and silverleaf whitefly stage affect conidial germination of Beauveria bassiana and Paecilomyces fumosoroseus. Journal of invertebrate pathology, 84(2), 67-74. James, T. Y., Letcher, P. M., Longcore, J. E., Mozley-Standridge, S. E., Porter, D., Powell, M. J., & Vilgalys, R. (2006). A molecular phylogeny of the flagellated fungi (Chytridiomycota) and description of a new phylum (Blastocladiomycota). Mycologia, 98(6), 860-871.

Jankevica, L. (2004). Ecological associations between entomopathogenic fungi and pest insects recorded in Latvia. Latvijas entomologs, 41, 60-65. Jaques, A. K., Fukamizo, T., Hall, D., Barton, R. C., Escott, G. M., Parkinson, T., & Adams, D. J. (2003). Disruption of the gene encoding the ChiB1 chitinase of Aspergillus fumigatus and characterization of a recombinant gene product. Microbiology, 149(10), 2931-2939. Jaronski, S. T., Lord, J. C., & Paden, R. (1996). "Evaluation of Beauveria bassiana (Mycotrol) with pyrethroids for control of whitefly in spring cantaloupes 1995."Arthr Mngt Tests, 21, 102-103. Javaid, M., Arif, M. J., Gogi, M. D., Shahid, M. R., Iqbal, M. S., Bibi, R., & Shehzad, M. A. (2012). Relative resistance in different cultivars of Pakistani cotton against cotton whitefly. Jiang, H., Doerge, R., & Gelvin, S. B. (2003). Transfer of T‐DNA and Vir proteins to plant cells by Agrobacterium tumefaciens induces expression of host genes involved in mediating transformation and suppresses host defense gene expression. The Plant Journal, 35(2), 219-236. Jobin, G., Couture, G., Goyer, C., Brzezinski, R., & Beaulieu, C. (2005). Streptomycete spores entrapped in chitosan beads as a novel biocontrol tool against common scab of potato. Applied microbiology and biotechnology, 68(1), 104-110. Johnson, M. W., Toscano, N. C., Reynolds, H. T., Sylvester, E., Kido, K., & Natwick, E. (1982). Whiteflies cause problems for southern California growers. California Agriculture, 36(9), 24-26. Johnston, P. R., & Jones, D. (1997). Relationships among Colletotrichum isolates from fruit-rots assessed using rDNA sequences. Mycologia, 420-430.

179

Jones, D. R. (2003). Plant viruses transmitted by whiteflies. European Journal of Plant Pathology, 109(3), 195-219. Kandoth, P. K., Ranf, S., Pancholi, S. S., Jayanty, S., Walla, M. D., Miller, W., & Stratmann, J. W. (2007). Tomato MAPKs LeMPK1, LeMPK2, and LeMPK3 function in the systemin-mediated defense response against herbivorous insects. Proceedings of the National Academy of Sciences, 104(29), 12205-12210. Kang, J.-H., Wang, L., Giri, A., & Baldwin, I. T. (2006). Silencing threonine deaminase and JAR4 in Nicotiana attenuata impairs jasmonic acid–isoleucine– mediated defenses against Manduca sexta. The Plant Cell, 18(11), 3303-3320. Kang, S. C., Park, S., & Lee, D. G. (1999). Purification and characterization of a novel chitinase from the entomopathogenic fungus, Metarhizium anisopliae. Journal of invertebrate pathology, 73(3), 276-281. Kanzaki, H., Saitoh, H., Ito, A., Fujisawa, S., Kamoun, S., Katou, S., & Terauchi, R. (2003). Cytosolic HSP90 and HSP70 are essential components of INF1‐mediated hypersensitive response and non‐host resistance to Pseudomonas cichorii in Nicotiana benthamiana. Molecular Plant Pathology, 4(5), 383-391. Karesch, H., Bilang, R., Scheid, O. M., & Potrykus, I. (1991). Direct gene transfer to protoplasts of Arabidopsis thaliana. Plant cell reports, 9(10), 571-574. Karsch-Mizrachi I., Nakamura Y., & Cochrane G. (2012). The international nucleotide sequence database collaboration. Nucleic Acids Research, 40(1): 33-37 Karthik, N., Akanksha, K., Binod, P., & Pandey, A. (2014). Production, purification and properties of fungal chitinases-A review. Kedar, S., Saini, R., & Kumaranag, K. (2014). Biology of cotton whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae) on cotton. Journal of Entomological Research, 38(2), 135-139. Kepler, R. M., Humber, R. A., Bischoff, J. F., & Rehner, S. A. (2014). Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia, 106(4), 811-829.

Kessler, P., Enkerl, J., Schweize, C., & Keller, S. (2004). Survival of Beauveria brongniartii in the soil after application as a biocontrol agent against the European cockchafer Melolontha melolontha. Biocontrol, 49(5), 563-581.

180

Kim, J. J., Lee, M. H., Yoon, C. S., Kim, H. S., Yoo, J. K., & Kim, K. C. (2002). J. National Inst. Agril. Sci. Tech. (NIAST): Korea. Kim, W. G., Seok, S. J., Weon, H. Y., Lee, K. H., Lee, C. J., & Kim, Y. S. (2010). Isolation and identification of entomopathogenic fungi collected from mountains and Islands in Korea. The Korean Journal of Mycology, 38(2), 99-104. Kitamoto, Y., Mori, N., Yamamoto, M., Ohiwa, T., & Ichikawa, Y. (1988). A simple method for protoplast formation and improvement of protoplast regeneration from various fungi using an enzyme from Trichoderma harzianum. Applied microbiology and biotechnology, 28(4-5), 445-450. Kjemtrup, S., Sampson, K. S., Peele, C. G., Nguyen, L. V., Conkling, M. A., Thompson, W. F., & Robertson, D. (1998). Gene silencing from plant DNA carried by a geminivirus. The Plant Journal, 14(1), 91-100. Klich, M. A. (2002). Identification of common Aspergillus species. Utrecht, The Netherlands, Centraalbureau voor Schimmelcultures. ISBN 90-70351-46-3. Klingen, I., Eilenberg, J., & Meadow, R. (2002). Effects of farming system, field margins and bait insect on the occurrence of insect pathogenic fungi in soils. Agriculture, ecosystems & environment, 91(1), 191-198. Kontsedalov, S., Zchori‐Fein, E., Chiel, E., Gottlieb, Y., Inbar, M., & Ghanim, M. (2008). The presence of Rickettsia is associated with increased susceptibility of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides. Pest management science, 64(8), 789-792. Kornerup, A., & Wanscher, J.H. (1978). Methuen handbook of Colour. 3rd ed. London, UK: Eyre Methuen. Kouvelis, V. N., Sialakouma, A., & Typas, M. A. (2008). Mitochondrial gene sequences alone or combined with ITS region sequences provide firm molecular criteria for the classification of Lecanicillium species. Mycological research, 112(7), 829-844. Kramer, E. M., Holappa, L., Gould, B., Jaramillo, M. A., Setnikov, D., & Santiago, P. M. (2007). Elaboration of B gene function to include the identity of novel floral organs in the lower eudicot Aquilegia. The Plant Cell, 19(3), 750-766. Kramer, K. J., Hopkins, T. L., & Schaefer, J. (1995). Applications of solids NMR to the analysis of insect sclerotized structures. Insect Biochemistry and Molecular Biology, 25(10), 1067-1080. 181

Kubátová, A., & Dvorak, L. (2005). Entomopathogenic fungi associated with insect hibernating in underground shelters. Czech Mycology, 57(3/4), 221. Kullnig-Gradinger, C. M., Szakacs, G., & Kubicek, C. P. (2002). Phylogeny and evolution of the genus Trichoderma: a multigene approach. Mycological Research, 106(07), 757-767. Kumagai, M. H., Donson, J., Della-Cioppa, G., Harvey, D., Hanley, K., & Grill, L. K. (1995). Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proceedings of the National Academy of Sciences, 92(5), 1679-1683. Kuranda, M. J., & Robbins, P. W. (1991). Chitinase is required for cell separation during growth of Saccharomyces cerevisiae. Journal of Biological Chemistry, 266(29), 19758-19767. Lacey, L. (1998). The effect of selected allelochemicals on germination of conidia and blastospores and mycelial growth of the entomopathogenic fungus, Paecilomyces fumosoroseus (Deuteromycotina: Hyphomycetes). Mycopathologia, 142(1), 17-25. Lacey, L. A., Fransen, J. J., & Carruthers, R. (1995). Global distribution of naturally occurring fungi of Bemisia, their biology and use as biological control agents. Bemisia: 1995, taxonomy, biology, damage, control and management. Lacey, L., Frutos, R., Kaya, H., & Vail, P. (2001). Insect pathogens as biological control agents: do they have a future? Biological control, 21(3), 230-248. Larena, I., Salazar, O., González, V., Julián, M. a. C., & Rubio, V. (1999). Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology, 75(2), 187-194. Larkin, M. A., Blackshields, G., Brown, N., Chenna, R., McGettigan, P. A., McWilliam, H., & Lopez, R. (2007). Clustal W and Clustal X version 2.0. bioinformatics, 23(21), 2947-2948. Laskowski, R. A., MacArthur, M. W., Moss, D. S., & Thornton, J. M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. Journal of applied crystallography, 26(2), 283-291. Lawrence, S. D., & Novak, N. G. (2006). Expression of poplar chitinase in tomato leads to inhibition of development in Colorado potato beetle. Biotechnology letters, 28(8), 593-599.

182

Legarrea, S., Karnieli, A., Fereres, A., & Weintraub, P. G. (2010). Comparison of UV‐absorbing nets in pepper crops: Spectral properties, effects on plants and pest control. Photochemistry and photobiology, 86(2), 324-330. Legaspi Jr, B., Allen, J., Brewster, C., Morales-Ramos, J., & King, E. (1998). Areawide management of the cotton boll weevil: use of a spatio–temporal model in augmentative biological control. Ecological modelling, 110(2), 151-164. Legg, J., French, R., Rogan, D., Okao‐Okuja, G., & Brown, J. K. (2002). A distinct Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha: Aleyrodidae) genotype cluster is associated with the epidemic of severe cassava mosaic virus disease in Uganda. Molecular Ecology, 11(7), 1219-1229. Li, S. J., Xue, X., Ahmed, M. Z., Ren, S. X., Du, Y. Z., Wu, J. H., & Qiu, B. L. (2011). Host plants and natural enemies of Bemisia tabaci (Hemiptera: Aleyrodidae) in China. Insect Science, 18(1), 101-120. Li, S. J., Xue, X., Ahmed, M. Z., Ren, S. X., Du, Y. Z., Wu, J. H., & Qiu, B. L. (2011). Host plants and natural enemies of Bemisia tabaci (Hemiptera: Aleyrodidae) in China. Insect Science, 18(1), 101-120. Li, X., Xia, B., Jiang, Y., Wu, Q., Wang, C., He, L., & Wang, R. (2010). A new pathogenesis-related protein, LrPR4, from Lycoris radiata, and its antifungal activity against Magnaporthe grisea. Molecular biology reports, 37(2), 995- 1001. Li, Y. Y., Tang, J., Fu, K. H., Gao, S. G., Wu, Q., & Chen, J. (2012). Construction of transgenic Trichoderma koningi with chit42 of Metarhizium anisopliae and analysis of its activity against the Asian corn borer. Journal of Environmental Science and Health, Part B, 47(7), 622-630. Lima, L., Navia, D., Inglis, P., & De Oliveira, M. (2000). Survey of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) biotypes in Brazil using RAPD markers. Genetics and Molecular Biology, 23(4), 781-785. Limon, M. C., Margolles-Clark, E., Benítez, T., & Penttila, M. (2001). Addition of substrate-binding domains increases substrate-binding capacity and specific activity of a chitinase from Trichoderma harzianum. FEMS microbiology letters, 198(1), 57-63.

183

Limon, M. C., Pintor-Toro, J. A., & Benítez, T. (1999). Increased antifungal activity of Trichoderma harzianum transformants that overexpress a 33-kDa chitinase. Phytopathology, 89(3), 254-261. Lin, K., Wu, K., Zhang, Y., & Guo, Y. (2007). Overwintering and population dynamics of Bemisia tabaci biotype B in greenhouse during the spring in northern China. Crop Protection, 26(12), 1831-1838. Liu, J., Zhao, H., Jiang, K., Zhou, X. P., & Liu, S. S. (2009). Differential indirect effects of two plant viruses on an invasive and an indigenous whitefly vector: implications for competitive displacement. Annals of Applied Biology, 155(3), 439-448. Liu, T. X. (2007). Life history of Eretmocerus melanoscutus (Hymenoptera: Aphelinidae) parasitizing nymphs of Bemisia tabaci biotype B (Homoptera: Aleyrodidae). Biological Control, 42(1), 77-85. Liu, Y., Nakayama, N., Schiff, M., Litt, A., Irish, V. F., & Dinesh-Kumar, S. (2004). Virus induced gene silencing of a deficiens ortholog in Nicotiana benthamiana. Plant molecular biology, 54(5), 701-711. Loc, N. T., Chi, V. T. B., & Hung, P. (2005). Efficacy of some new isolates of Metarhizium anisopliae and Beauveria bassiana against rice ear head bug, Leptocorisa acuta. Omonrice, 13, 69-75. Lorito, M., Woo, S. L., Fernandez, I. G., Colucci, G., Harman, G. E., Pintor-Toro, J. A., & Zoina, A. (1998). Genes from mycoparasitic fungi as a source for improving plant resistance to fungal pathogens. Proceedings of the National Academy of Sciences, 95(14), 7860-7865. Lu, R., Martin-Hernandez, A. M., Peart, J. R., Malcuit, I., & Baulcombe, D. C. (2003). Virus-induced gene silencing in plants. Methods, 30(4), 296-303. Lubeck, I., Arruda, W., Souza, B. K., Stanisçuaski, F., Carlini, C. R., Schrank, A., & Vainstein, M. H. (2008). Evaluation of Metarhizium anisopliae strains as potential biocontrol agents of the tick Rhipicephalus (Boophilus) microplus and the cotton stainer Dysdercus peruvianus. Fungal Ecology, 1(2), 78-88. Luo, C., Jones, C., Devine, G., Zhang, F., Denholm, I., & Gorman, K. (2010). Insecticide resistance in Bemisia tabaci biotype Q (Hemiptera: Aleyrodidae) from China. Crop Protection, 29(5), 429-434.

184

Luz, C., & Fargues, J. (1998). Factors affecting conidial Production of Beauveria bassiana from fungus killed cadavers of Rhodnius prolixus. Journal of invertebrate pathology, 72(2), 97-103. Manfrino, R., Hatting, J., Humber, R., Salto, C. E., & Lopez Lastra, C. (2014). Natural occurrence of entomophthoroid fungi (Entomophthoromycota) of aphids (Hemiptera: Aphididae) on cereal crops in Argentina. Annals of applied biology, 164(1), 151-158. Mansaray, A., & Sundufu, A. J. (2010). Effect of three bean species on the development and reproduction of a population of the parasitoid, Encarsia bimaculata, on the whitefly, Bemisia tabaci. Journal of Insect Science, 10(1), 28. Mansoor, S., Briddon, R. W., Zafar, Y., & Stanley, J. (2003). Geminivirus disease complexes: an emerging threat. Trends in plant science, 8(3), 128-134. Manter, D. K., & Vivanco, J. M. (2007). Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. Journal of Microbiological Methods, 71(1), 7- 14. Martin, J. (2000). The occurrence of Dialeurodes citrifolii and Aleurochiton pseudoplatani (Hemiptera: Aleyrodidae) in Lebanon–important new records in the Europe-Mediterranean Region. Bulletin of entomological research, 90(06), 527-528. Mason, J., Ye, P., Suzuki, K., D'ercole, A., & Matsushima, G. K. (2000). Insulin-like growth factor-1 inhibits mature oligodendrocyte apoptosis during primary demyelination. The Journal of Neuroscience, 20(15), 5703-5708. Mathur, N. K., & Narang, C. K. (1990). Chitin and chitosan, versatile polysaccharides from marine animals. Journal of chemical education, 67(11), 938. Matsumoto, K.S., Guevara-Gonzalez, R.G., & Torres-Pacheco, I. (2006). Fungal chitinases. Advances in agricultural and food biotechnology, 289-304.

Maymon, M., Minz, D., Barbul, O., Zveibil, A., Elad, Y., & Freeman, S. (2004). Identification of Trichoderma biocontrol isolates to clades according to ap-PCR and ITS sequence analyses. Phytoparasitica, 32(4), 370-375.

185

Maynard, D. N., & Cantliffe, D. J. (1989). Squash silver leaf and tomato irregular ripening: new vegetable disorders in Florida. University of Florida, IFAS, Florida Cooperative Extension Service, Vegetable Crops Fact Sheet VC-37. McAuslane, H. J., Simmons, A. M., & Jackson, D. M. (2000). Parasitism of Bemisia argentifolii on collard with reduced or normal leaf wax. Florida Entomologist, 428-437. McCormick, A. A., Kumagai, M. H., Hanley, K., Turpen, T. H., Hakim, I., Grill, L. K., & Levy, R. (1999). Rapid production of specific vaccines for lymphoma by expression of the tumor-derived single-chain Fv epitopes in tobacco plants. Proceedings of the National Academy of Sciences, 96(2), 703-708. McCoy, G. W., Samson, R. A., & Boucias, D. G. (1988). Entomogenous fungi in „CRC Handbook of Natural Pesticides, Part A. Entomogenous Protozoa and fungi’. (CM Ignoffo, ed.). Meade, D. L., & Byrne, D. N. (1991). The use of Verticillium lecanii against subimaginal instars of Bemisia tabaci. Journal of Invertebrate Pathology, 57(2), 296-298. Medina-Esparza, J., & Leon-Paul, R. (1994). Evaluation of pesticides for the control of whitefly on cotton. Inifap-Cirno-Cemexi, Mexicali Valley-1993. In Proceedings of the International Pest Work Committee, Mazatlan, Mexico. Meekes, E. T., Fransen, J. J., & van Lenteren, J. C. (2002). Pathogenicity of Aschersonia spp. against whiteflies Bemisia argentifolii and Trialeurodes vaporariorum. Journal of Invertebrate Pathology, 81(1), 1-11. Melchers, L. S., Groot, M. A. d., Knaap, J. A., Ponstein, A. S., Sela‐Buurlage, M. B., Bol, J. F., & Linthorst, H. J. (1994). A new class of tobacco chitinases homologous to bacterial exo‐chitinases displays antifungal activity. The Plant Journal, 5(4), 469-480. Merzendorfer, H., & Zimoch, L. (2003). Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases. Journal of Experimental Biology, 206(24), 4393-4412. Meyling, N. V., Lubeck, M., Buckley, E. P., Eilenberg, J., & Rehner, S. A. (2009). Community composition, host range and genetic structure of the fungal entomopathogen Beauveria in adjoining agricultural and seminatural habitats. Molecular Ecology, 18(6), 1282-1293. 186

Mietkiewski, R., Zurek, M., Tkaczuk, C., & Balazy, S. (1991). Occurrence of entomopathogenic fungi in arable soil, forest soil and litter. Roczniki Nauk Rolniczych Seria E, 21, 61-68. Moore, D., & Prior, C. (1993). The potential of mycoinsecticides. Biocontrol News and Information, 14(2), 31-40. Moraes, A. M. L., Moraes, A., Moraes, A. M., Moraes, A., Moraes, A. M., & Moraes, A. (1998). Aspergilli from the digestive tract of Brazilian Triatomids. Morales, F. J., & Anderson, P. K. (2001). The emergence and dissemination of whitefly-transmitted geminiviruses in Latin America. Archives of virology, 146(3), 415-441. Mound, L. A. (1963). Host‐correlated variation in Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae). Paper presented at the Proceedings of the Royal Entomological Society of London. Series A, General Entomology. Mound, L. A. (1983). Biology and identity of whitefly vectors of plant pathogens. Blackwell Scientific. Mound, L. A., & Halsey, S. H. (1978). Whiteflies of the world. British Museum of Natural History and Wiley, New York, NY. Mugiira, R., Liu, S. S., & Zhou, X. (2008). Tomato yellow leaf curl virus and Tomato leaf curl Taiwan virus Invade South‐east Coast of China. Journal of Phytopathology, 156(4), 217-221. Mullins, J. (1993). Imidacloprid. A new nitroguanidine insecticide. Paper presented at the ACS symposium series American Chemical Society. Mustafa, U., & Kaur, G. (2009). Extracellular enzyme production in Metarhizium anisopliae isolates. Folia microbiologica, 54(6), 499-504. Nagasi, A., Parker, B. L., & Brownbridge, M. (1998). Screening and bioassay of entomopathogenic fungi for the control of silverleaf whitefly, Bemisia argentifolli. International Journal of Tropical Insect Science, 18(01), 37-44. Nahar, P., Ghormade, V., & Deshpande, M. V. (2004). The extracellular constitutive production of chitin deacetylase in Metarhizium anisopliae: possible edge to entomopathogenic fungi in the biological control of insect pests. Journal of invertebrate pathology, 85(2), 80-88.

187

Narain, A., Swain, N. C., Sahoo, K. C., Dash, S. K., & Shukla, V. D. (1985). A new leaf blight and fruit rot of watermelon. Indian Phytopathology, 38, 149-151. Naranjo, S. E., & Ellsworth, P. C. (2009). The contribution of conservation biological control to integrated control of Bemisia tabaci in cotton. Biological Control, 51(3), 458-470. Nasir, M.A., & Perveen, R. (2001). In vitro bio-control of whitefly, vector of leaf curl virus of cotton. Pakistan Journal of Phytopathology, 13, 8-11.

Navas-Castillo, J., Fiallo-Olivé, E., & Sánchez-Campos, S. (2011). Emerging virus diseases transmitted by whiteflies. Annual review of phytopathology, 49, 219- 248. Naveed, M., Salam, A., Saleem, M. A., & Sayyed, A. H. (2008). Effect of foliar applications of some insecticides on Bemisia tabaci, predators and parasitoids: Implications in its management in Pakistan. Phytoparasitica, 36(4), 377-387. Neuhaus, G., & Spangenberg, G. (1990). Plant transformation by microinjection techniques. Physiologia Plantarum, 79(1), 213-217. Neuhaus, J. M. (1999). Plant chitinases (pr-3, pr-4, pr-8, pr-11).Pathogenesis-related proteins in plants, 77-105. Nier, T., River, F., & Bermudez, J. C. (1993). First report of Mexico on the isolation of Verticillium lecanii from whitefly and in vitro pathogenicity tests on this insect. Revista Mexicana De Micologia, 7, 149-156. Nilsson, R. H., Kristiansson, E., Ryberg, M., Hallenberg, N., & Larsson, K. H. (2008). Intraspecific ITS variability in the kingdom Fungi as expressed in the international sequence databases and its implications for molecular species identification. Evolutionary bioinformatics, 4. Ningthoujam, S., Sanasam, S., Tamreihao, K., & Nimaich, S. (2009). Antagonistic activities of local actinomycete isolates against rice fungal pathogens. African journal of microbiology research, 3(11), 737-742. Noma, T., & Strickler, K. (2000). Effects of Beauveria bassiana on Lygus hesperus (Hemiptera: Miridae) feeding and oviposition. Environmental entomology, 29(2), 394-402. Norhelina, L., Sajap, A., Mansour, S., & Idris, A. (2013). Infectivity of five Metarhizium anisopliae (Deuteromycota: Hyphomycetales) strains on whitefly,

188

Bemisia tabaci (Homoptera: Aleyrodidae) infesting brinjal, Solanum melongena (Solanaceae). Academy of Enomology Journal , 6, 127-132. Novotna, Z., Fliegerova, K., & Simunek, J. (2008). Characterization of chitinases of polycentric anaerobic rumen fungi. Folia microbiologica, 53(3), 241-245. Nunez del Prado, E., Iannacone, J., & Gómez, H. (2008). Efecto de Dos Hongos Entomopatógenos en el Control de Aleurodicus cocois (Curtis, 1846)(Hemiptera: Aleyrodidae). Chilean journal of agricultural research, 68(1), 21-30. Odum, E. P. (1971). Fundamentals of Ecology (3rd edn.) WB Saunders Company. Philadelphia, PA. Okay, S. (2005). Cloning of chitinase a gene (chia) from Serratia marcescens BN10 and its expression in Coleoptera-specific Bacillus thuringiensis (Doctoral dissertation, Middle East Technical University). Oliveira, I., Pereira, J. A., Lino-Neto, T., Bento, A., & Baptista, P. (2012). Fungal diversity associated to the olive moth, Prays oleae Bernard: a survey for potential entomopathogenic fungi. Microbial ecology, 63(4), 964-974. Oliveira, M. A. S., Icuma, I. M., Alves, R. T., Oliveira, J. N. S., de Oliveria, M. R. V., & Lima, L. H. C. (2000). Avaliacao de surtos de mosca-branca em areas do sistema produtivo de melao, soja e feijao.Embrapa Cerrados. Comunicado Tecnico. Oliveira, M., Henneberry, T., & Anderson, P. (2001). History, current status, and collaborative research projects for Bemisia tabaci. Crop protection, 20(9), 709- 723. Omondi, A., Obeng‐Ofori, D., Kyerematen, R., & Danquah, E. (2005). Host preference and suitability of some selected crops for two biotypes of Bemisia tabaci in Ghana. Entomologia experimentalis et Applicata, 115(3), 393-400. Orikoshi, H., Baba, N., Nakayama, S., Kashu, H., Miyamoto, K., Yasuda, M., & Tsujibo, H. (2003). Molecular analysis of the gene encoding a novel cold-adapted chitinase (ChiB) from a marine bacterium, Alteromonas sp. strain O-7. Journal of bacteriology, 185(4), 1153-1160. Osborne, L., & Landa, Z. (1992). Biological control of whiteflies with entomopathogenic fungi. Florida entomologist, 456-471.

189

Padanad, M. S., & Krishnaraj, P. (2009). Pathogenicity of native entomopathogenic fungus Nomuraea rileyi against Spodoptera litura. Journal of Plant Health Progress (8). Palanivelu, P., & Lakshmi, V. (2013). Molecular cloning and characterization of a chitinase gene from the thermophilic fungus, Thermomyces lanuginosus-RMB. IOSR Journal of Pharmacy and Biological Sciences, 5, 99-107. Palumbo, J. C., Horowitz, A., & Prabhaker, N. (2001). Insecticidal control and resistance management for Bemisia tabaci. Crop protection, 20(9), 739-765. Pang, S. T., Wang, L., Hou, Y. H., & Shi, Z. H. (2011). Interspecific interference competition between Encarsia formosa and Encarsia sophia (Hymenoptera: Aphelinidae) in parasitizing Bemisia tabaci (Hemiptera: Aleyrodidae) on five tomato varieties. Insect Science, 18(1), 92-100. Park, J. A., Ahn, J. W., Kim, Y. K., Kim, S. J., Kim, J. K., Kim, W. T., & Pai, H. S. (2005). Retinoblastoma protein regulates cell proliferation, differentiation, and endoreduplication in plants. The Plant Journal, 42(2), 153-163. Paszkowski, J., Shillito, R. D., Saul, M., Mandak, V., Hohn, T., Hohn, B., & Potrykus, I. (1984). Direct gene transfer to plants. The EMBO Journal, 3(12), 2717. Paterson, R. R. M. (2006). Fungi and fungal toxins as weapons. Mycological research, 110(9), 1003-1010. Patil, R. S., Ghormade, V., & Deshpande, M. V. (2000). Chitinolytic enzymes: an exploration. Enzyme and Microbial Technology, 26(7), 473-483. Peart, J. R., Lu, R., Sadanandom, A., Malcuit, I., Moffett, P., Brice, D. C., & Coleman, M. J. (2002). Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences, 99(16), 10865-10869. Peberdy, J. F. (1994). Protein secretion in filamentous fungi trying to understand a highly productive black box. Trends in biotechnology, 12(2), 50-57. Peele, C., Jordan, C. V., Muangsan, N., Turnage, M., Egelkrout, E., Eagle, P., & Robertson, D. (2001). Silencing of a meristematic gene using geminivirus‐derived vectors. The Plant Journal, 27(4), 357-366.

190

Pelizza, S., Stenglein, S., Cabello, M., Dinolfo, M., & Lange, C. (2011). First record of Fusarium verticillioides as an entomopathogenic fungus of grasshoppers. Journal of Insect Science, 11(1), 70. Pereira, E. d. S., Sarquis, M. I. d. M., Ferreira-Keppler, R. L., Hamada, N., & Alencar, Y. B. (2009). Filamentous fungi associated with mosquito larvae (Diptera: Culicidae) in municipalities of the Brazilian Amazon. Neotropical entomology, 38(3), 352-359. Perring, T. M. (2001). The Bemisia tabaci species complex. Crop protection, 20(9), 725-737. Perveen, R., Khan, M., Islam, N., Chohan, S., Haider, S., & Nasir, I. (2010). Whitefly population on different cotton varieties in Punjab. Sarhad Journal of Agriculture, 26(4), 583-588. Pflieger, S., Blanchet, S., Camborde, L., Drugeon, G., Rousseau, A., Noizet, M., & Jupin, I. (2008). Efficient virus induced gene silencing in Arabidopsis using a „one step‟TYMV derived vector. The Plant Journal, 56(4), 678-690. Pilz, C., Wegensteiner, R., & Keller, S. (2007). Selection of entomopathogenic fungi for the control of the western corn rootworm Diabrotica virgifera. Journal of Applied Entomology, 131(6), 426-431. Pishko, E. J., Kirkland, T. N., & Cole, G. T. (1995). Isolation and characterization of two chitinase-encoding genes (cts1, cts2) from the fungus Coccidioides immitis. Gene, 167(1), 173-177. Pitt, J. I. (1979). The genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces. The genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces. Polston, J. E., & Anderson, P. K. (1997). The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant disease, 81(12), 1358- 1369. Prabhaker, N., Toscano, N. C., Castle, S. J., & Henneberry, T. J. (1997). Selection for imidacloprid resistance in silverleaf whiteflies from the Imperial Valley and development of a hydroponic bioassay for resistance monitoring. Pesticide Science, 51(4), 419-428. Price, J. F., Schuster, D. F., & Short, D. T. (1986). Managing sweet potato whitefly. Greenhouse Grower, 55-57. 191

Purkayastha, A., & Dasgupta, I. (2009). Virus-induced gene silencing: a versatile tool for discovery of gene functions in plants. Plant Physiology and Biochemistry, 47(11), 967-976. Qiang, T. A. N. G., YuPing, Z., Ling, X., LiHua, S., ZengZhi, L., & Bo, H. (2009). Generation of transgenic Beauveria bassiana strains with chitinase gene from Isaria fumosorosea and its increased virulence against Dendrolimus punctatus (Lepidoptera: Lasiocampidae). Acta Entomologica Sinica, 52(7), 755-762. Qiu, B. L., Coats, S. A., Ren, S. X., Dris, A. M., Xu, C. X., & Brown, J. K. (2007). Phylogenetic relationships of native and introduced Bemisia tabaci (Homoptera: Aleyrodidae) from China and India based on mtcoi DNA sequencing and host plant comparisons. Progress in Natural Sciences, 17, 645-654. Qiu, B., De Barro, P. J., Xu, C., & Ren, S. (2006). Effect of temperature on the life history of Encarsia bimaculata (Hymenoptera: Aphelinidae), a parasitoid of Bemisia tabaci (Hemiptera: Aleyrodidae). European Journal of Entomology, 103(4), 787-792. Quaintance, A.L. (1900). Contribution towards a monograph of the American Aleurodidae. U.S. Department of Agriculture, Bureau of Entomology, 8, 9–64. Quesada-Moraga, E., Navas-Cortés, J. A., Maranhao, E. A., Ortiz-Urquiza, A., & Santiago-Álvarez, C. (2007). Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycological research, 111(8), 947-966. Quintero, C., Cardona Mejia, C. Ramirez, D., & Jimenez, NC (1998). First record of biotype B of Bemisia tabaci (Homoptera: Aleyrodidae) in Colombia = First report of the B biotype of Bemisia tabaci (Homoptera: Aleyrodidae) in Colombia. International Journal of Entomology, 1 (2), 23-28. Rahjoo, V., Zad, J., Javan-Nikkhah, M., Gohari, A. M., Okhovvat, S., Bihamta, M.,& Klemsdal, S. (2008). Morphological and molecular identification of Fusarium isolated from maize ears in Iran. Journal of Plant Pathology, 463-468. Raikhel, N., Lee, H., & Broekaert, W. (1993). Structure and function of chitin-binding proteins. Annual review of plant biology, 44(1), 591-615. Rajam, B., Peter, C., & David, B. V. (1988). Influence of host plants on the parasitism of Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) by Encarsia sp. Current science. Bangalore, 57(22), 1246-1247. 192

Rakotonirainy, M., Cariou, M., Brygoo, Y., & Riba, G. (1994). Phylogenetic relationships within the genus Metarhizium based on 28S rRNA sequences and isozyme comparison. Mycological Research, 98(2), 225-230. Ramachandran, G. N., Ramakrishnan, C., & Sasisekharan, V. (1963). Stereochemistry of polypeptide chain configurations. Journal of molecular biology, 7(1), 95-99. Ramani, S. (2000). Fortuitous introduction of an aphelinid parasitoid of the spiralling whitefly, Aleurodicus dispersus Russell (Homoptera: Aleyrodidae) into the Lakshadweep islands with notes on host plants and other natural enemies. Journal of Biological Control, 14(1), 55-60. Ramjegathesh, R., & Ebenezar, E. G. (2012). Morphological and physiological characters of Alternaria alternata causing leaf blight disease of onion. International Journal of Plant Pathology, 3(2), 34-44. Ramos, E. Q., Alves, S. B., Tanzini, M. R., & Lopez, R. B. (2000). Susceptibilidad de Bemisia tabaci a Beauveria bassianaa en condiciones de laboratorio. CATIE, Turrialba (Costa Rica). Rao, V. G. (1965). Alternaria tenuis Auct. in Bombay-Maharashtra. Mycopathologia et mycologia applicata, 27(3-4), 257-264. Ratcliff, F., Martin-Hernandez, A. M., & Baulcombe, D. C. (2001). Technical advance: tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal, 25(2), 237-245. Rath, A., Koen, T., & Yip, H. (1992). The influence of abiotic factors on the distribution and abundance of Metarhizium anisopliae in Tasmanian pasture soils. Mycological Research, 96(5), 378-384. Rattanakit, N., Yano, S., Plikomol, A., Wakayama, M., & Tachiki, T. (2007). Purification of Aspergillus sp. S1-13 chitinases and their role in saccharification of chitin in mash of solid-state culture with shellfish waste. Journal of bioscience and bioengineering, 103(6), 535-541. Rauch, N., & Nauen, R. (2003). Identification of biochemical markers linked to neonicotinoid cross resistance in Bemisia tabaci (Hemiptera: Aleyrodidae). Archives of insect biochemistry and physiology, 54(4), 165-176. Raviv, M., & Antignus, Y. (2004). UV radiation effects on pathogens and insect pests of greenhouse grown crops. Photochemistry and Photobiology, 79(3), 219-226.

193

Rehner, S. A., & Buckley, E. (2005). A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia, 97(1), 84-98. Ricardo, H. R., Destefano, I., Suzete, A., Lanza, D., & Claudio, L. M. (2004). Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers. Genetics and Molecular Biology, 27(2), 245-252. Roberts, D. W., & Humber, R. A. (1981). Entomogenous fungi. Biology of conidial fungi, 2(201), e236. Roberts, D. W., & Leger, R. J. S. (2004). Metarhizium spp., cosmopolitan insect- pathogenic fungi: mycological aspects. Advances in applied microbiology, 54, 1- 70. Roberts, D. W., & Wraight, S. P. (1986). Current status on the use of insect pathogens as biocontrol agents in agriculture: Fungi. Fundamental and applied aspects of invertebrate pathology/edited by Robert A. Samson, Just M. Vlak and Dick Peters. Robertson, D. (2004). VIGS vectors for gene silencing: many targets, many tools. Annual Reviews of Plant Biology., 55, 495-519. Roditakis, E., Grispou, M., Morou, E., Kristoffersen, J. B., Roditakis, N., Nauen, R., & Tsagkarakou, A. (2009). Current status of insecticide resistance in Q biotype Bemisia tabaci populations from Crete. Pest management science, 65(3), 313- 322. Rodriguez, M., Gerding, M., France, A., & Ceballos, R. (2010). Evaluation of Metarhizium anisopliae var. anisopliae Qu-M845 isolate to control Varroa destructor (Acari: Varroidae) in laboratory and field trials. Rohini, V., & Rao, K. S. (2001). Transformation of peanut (Arachis hypogaea L.) with tobacco chitinase gene: variable response of transformants to leaf spot disease. Plant Science, 160(5), 889-898. Rosell, R. C., Bedford, I. D., Frohlich, D. R., Gill, R. J., Brown, J. K., & Markham, P. G. (1997). Analysis of morphological variation in distinct populations of Bemisia tabaci (Homoptera: Aleyrodidae). Annals of the Entomological Society of America, 90(5), 575-589.

194

Roy, H. E., Steinkraus, D. C., Eilenberg, J., Hajek, A. E., & Pell, J. K. (2006). Bizarre interactions and endgames: entomopathogenic fungi and their arthropod hosts. Annu. Rev. Entomol., 51, 331-357.

Rumei, X. (1996). Occurrence and distribution of Bemisia in China. Bemisia: 1995, Taxonomy, Biology, Damage, Control and Management. Russell, L. M. (1957). Synonyms of Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae). Bulletin of the Brooklyn Entomological Society, 52, 122-123. Sahai, A., & Manocha, M. (1993). Chitinases of fungi and plants: their involvement in morphogenesis and host-parasite interaction. FEMS Microbiology Reviews, 11(4), 317-338. Saiprasad, G., Mythili, J., Anand, L., Suneetha, C., Rashmi, H., Naveena, C., & Ganeshan, G. (2009). Development of Trichoderma harzianum endochitinase gene construct conferring antifungal activity in transgenic tobacco. Indian Journal of Biotechnology, 8, 199-206. Salami, S., Ebadi, A., Naghavi, M., & Dry, I. (2008). Cloning and functional characterization of a class III chitinase gene from grapevine: Inhibition of fungal growth by recombinant VvChiF III. African Journal of Biotechnology, 7(24). Sampson, M. N., & Gooday, G. W. (1998). Involvement of chitinases of Bacillus thuringiensis during pathogenesis in insects. Microbiology, 144(8), 2189-2194. Samson, R. A. (1974). Paecilomyces and some allied Hyphomycetes. Studies in Mycology, 6, 1-119. Samson, R. A., Evans, H. C., & Latge, J. P. (2013). Atlas of entomopathogenic fungi: Springer Science & Business Media. Samuels, G. J. (1996). Trichoderma: a review of biology and systematics of the genus. Mycological Research, 100(8), 923-935. Samuels, G. J., Dodd, S. L., Gams, W., Castlebury, L. A., & Petrini, O. (2002). Trichoderma species associated with the green mold epidemic of commercially grown Agaricus bisporus. Mycologia, 94(1), 146-170. Samuels, G. J., Ismaiel, A., Mulaw, T. B., Szakacs, G., Druzhinina, I. S., Kubicek, C. P., & Jaklitsch, W. M. (2012). The Longibrachiatum clade of Trichoderma: a revision with new species. Fungal diversity, 55(1), 77-108.

195

Sánchez-Campos, S., Navas-Castillo, J., Camero, R., Soria, C., Diaz, J., & Moriones, E. (1999). Displacement of tomato yellow leaf curl virus (TYLCV)-Sr by TYLCV-Is in tomato epidemics in Spain. Phytopathology, 89(11), 1038-1043. Sanchez-Pena, S. R., Lara, J. S. J., & Medina, R. F. (2011). Occurrence of entomopathogenic fungi from agricultural and natural ecosystems in Saltillo, Mexico, and their virulence towards thrips and whiteflies. Journal of Insect Science, 11(1), 1. Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain- terminating inhibitors. Proceedings of the National Academy of Sciences, 74(12), 5463-5467. Santiago-Alvarez, C., Maranhao, E. A., Maranhao, E., & Quesada-Moraga, E. (2006). Host plant influences pathogenicity of Beauveria bassiana to Bemisia tabaci and its sporulation on cadavers. BioControl, 51(4), 519-532. Saravitz, C. H., Downs, R. J., & Thomas, J. F. (2008). Phytotron procedural manual. Technical Bulletin, 244. Schmidt, M. H., Thewes, U., Thies, C., & Tscharntke, T. (2004). Aphid suppression by natural enemies in mulched cereals. Entomologia Experimentalis et Applicata, 113(2), 87-93. Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. L., Levesque, C. A., & Crous, P. W. (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences, 109(16), 6241-6246. Scholte, E. J., Knols, B. G., Samson, R. A., & Takken, W. (2004). Entomopathogenic fungi for mosquito control: a review. Journal of Insect Science, 4(1), 19. Schornack, S., Ballvora, A., Gürlebeck, D., Peart, J., Ganal, M., Baker, B., & Lahaye, T. (2004). The tomato resistance protein Bs4 is a predicted non nuclear Trinbller protein that mediates defense responses to severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. The Plant Journal, 37(1), 46-60. Schroers, H. J. (2001). Monograph of Bionectria (Ascomycota, Hypocreales, Bionectriaceae) and its Clonostachys anamorphs. Centraalbureau voor Schimmel cultures. Schroers, H. J., Samuels, G. J., Seifert, K. A., & Gams, W. (1999). Classification of the mycoparasite Gliocladium roseum in Clonostachys as C. rosea, its 196

relationship to Bionectria ochroleuca, and notes on other Gliocladium-like fungi. Mycologia, 365-385. Schuster, D., Mueller, T., Kring, J., & Price, J. (1990). Relationship of the sweetpotato whitefly to a new tomato fruit disorder in Florida. HortScience, 25(12), 1618-1620. Seidl, V., Huemer, B., Seiboth, B., & Kubicek, C. P. (2005). A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases. FEBS Journal, 272(22), 5923-5939. Seki, M., Shigemoto, N., Komeda, Y., Imamura, J., & Yamada, Y. (1991). Transgenic Arabidopsis thaliana plants obtained by particle-bombardment-mediated transformation. Applied microbiology and biotechnology, 36(2), 228-230. Setnikov, D., Holappa, L., Santiago, P. M., Gould, B., Jaramillo, M. A., & Kramer, E. (2007). Elaboration of B gene function to include the identity of novel floral organs in the lower eudicot Aquilegia (Ranunculaceae). Seye, F., Bawin, T., Boukraa, S., Zimmer, J. Y., Ndiaye, M., Delvigne, F., & Francis, F. (2014). Pathogenicity of Aspergillus clavatus produced in a fungal biofilm bioreactor toward Culex quinquefasciatus (Diptera: Culicidae). Journal of Pesticide Science, 39(3), 127-132. Shah, J. M., Raghupathy, V., & Veluthambi, K. (2009). Enhanced sheath blight resistance in transgenic rice expressing an endochitinase gene from Trichoderma virens. Biotechnology letters, 31(2), 239-244. Shah, M. M. R., & Liu, T. X. (2013). Feeding experience of Bemisia tabaci (Hemiptera: Aleyrodidae) affects their performance on different host plants. PloS one, 8(10), 77368. Shah, P., & Pell, J. (2003). Entomopathogenic fungi as biological control agents. Applied microbiology and biotechnology, 61(5-6), 413-423. Shah, S., Nasreen, S., & Sheikh, P. (2012). Cultural and morphological characterization of Trichoderma spp. associated with green mold disease of Pleurotus spp. in Kashmir. Research Journal of Microbiology, 7(2), 139. Shahid, A. A., Chaudhry, B., & Riazuddin S. (2003). Pathogenicity of entomopathogenous fungi Metarhizium anisopliaeon, Heliothis armigera and Bemisia tabaci. Pakistan Journal of Phytopathology, 15(1-2), 33-36.

197

Shanmugam, V., Thakur, H., & Gupta, S. (2013). Use of chitinolytic Bacillus atrophaeus strain S2BC-2 antagonistic to Fusarium spp. for control of rhizome rot of ginger. Annals of Microbiology, 63(3), 989-996. Shapiro-ilan, D. I., Gardner, W. A., Fuxa, J. R., Wood, B. W., Nguyen, K. B., Adams, B. J., & Hall, M. J. (2003). Survey of entomopathogenic nematodes and fungi endemic to pecan orchards of the Southeastern United States and their virulence to the pecan weevil (Coleoptera: Curculionidae). Environmental Entomology, 32(1), 187-195. Sharma, A., & Johri, B. (2003). Growth promoting influence of siderophore- producing Pseudomonas strains GRP3A and PRS 9 in maize (Zea mays L.) under iron limiting conditions. Microbiological research, 158(3), 243-248. Shen, Z., & Jacobs-Lorena, M. (1997). Characterization of a novel gut-specific chitinase gene from the human malaria vector Anopheles gambiae. Journal of Biological Chemistry, 272(46), 28895-28900. Shimazu, M. (2004). Effects of temperature on growth of Beauveria bassiana F-263, a strain highly virulent to the Japanese pine sawyer, Monochamus alternatus, especially tolerance to high temperatures. Applied entomology and zoology, 39(3), 469-475. Shinde, B.M. (1995). Investigation on leaf spot disease of soybean (Glycine max L. Merill) caused by Alternaria and Dreschslera. M.Sc. (Agri.) Thesis submitted to M.P.K.V., Rahuri. Shinde, M.A. (2003). Studies on leaf spot of Aster (Callistephus chinensis L. Nees). M.Sc. (Agri.) Thesis submitted to M.P.K.V., Rahuri. ShuSen, S., LianSheng, Z., Liu, T. X., ChangChun, R., & GuangZhi, S. (2009). Host- feeding behaviors of parasitoids on hosts and implications for biological control. Acta Entomologica Sinica, 52(4), 424-433. Silvie, P., & Papierok, B. (1991). Natural enemies of insect pests on cotton in Chad: preliminary data on entomophthoralean fungi. Coton et Fibres Tropicales, 46(4), 304-308. Simmons, E. G. (1986). Alternaria themes and variations. 22-26. Mycotaxon (USA). Simon, B., Cenis, J., Demichelis, S., Rapisarda, C., Caciagli, P., & Bosco, D. (2003). Survey of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in Italy with the

198

description of a new biotype (T) from Euphorbia characias. Bulletin of entomological research, 93(03), 259-264. Simone, G. W., Brown, J. K., Hiebert, E., & Cullen, R. E. (1990). New geminivirus epidemic in Florida tomatoes and peppers. Phytopathology, 80, 1063. Smith, B. J., & Black, L. L. (1990). Morphological, cultural and pathogenic variation among Colletotrichum species isolated from strawberry. Plant Disease, 74(1), 69-76. Sonawane, C. S. (1983). Part-I Studies into post harvest diseases of pomegranate (Punica granatum L.). M.Sc. (Agri.) Thesis submitted to M.P.K.V., Rahuri. Sørbotten, A., Horn, S. J., Eijsink, V. G., & Vårum, K. M. (2005). Degradation of chitosans with chitinase B from Serratia marcescens. FEBS journal, 272(2), 538- 549. Sosnowska, D., Bałazy, S., Prishchepa, L., & Mikulskaya, N. (2004). Biodiversity of arthropod pathogens in the Białowieża Forest. Journal of Plant Protection, 44(4), 313-121. Sreenivasaprasad, S., Brown, A. E., & Mills, P. (1993). Coffee berry disease pathogen in Africa: genetic structure and relationship to the group species Colletotrichum gloeosporioides. Mycological Research, 97(8), 995-1000. Srinivasa, M. V., Viraktamath, C. A., & Reddy, C. (1999). A new parasitoid of the spiralling white fly, Aleurodicus dispersus Russell (Hemiptera: Aleyrodidae) in South India. Pest Management in Horticultural Ecosystems, 5(1), 59-61. Steel, R. G. D., & Torrie, J. H. (1980). Principle and procedure of statistics MacGraw- Hill. New York. Steinkraus, D. C., & Tugwell, N. P. (1997). Beauveria bassiana (Deuteromycotina: Moniliales) effects on Lygus lineolaris (Hemiptera: Miridae). Journal of Entomological Science, 32(1), 79-90. Steinkraus, D., Howard, M., Hollingsworth, R., & Boys, G. (1999). Infection of sentinel cotton aphids (Homoptera: Aphididae) by aerial conidia of Neozygites fresenii (Entomophthorales: Neozygitaceae). Biological Control, 14(3), 181-185. Stenglein, S. A., & Balatti, P. A. (2006). Genetic diversity of Phaeoisariopsis griseola in Argentina as revealed by pathogenic and molecular markers. Physiological and Molecular Plant Pathology, 68(4), 158-167.

199

Stephan, D., Welling, M., & Zimmermann, G. (1996). Locust control with Metarhizium flaivoviride: formulation and application of blastospores. IOBC WPRS BULLETIN, 19, 232-235. Stephens, D. J., & Banting, G. (2000). The use of yeast two hybrid screens in studies of protein: Protein interactions involved in trafficking. Traffic, 1(10), 763-768. Stratmann, J. W., & Hind, S. R. (2011). Gene silencing goes viral and uncovers the private life of plants. Entomologia Experimentalis et Applicata, 140(2), 91-102. Sun, B. D., & Liu, X. Z. (2008). Occurrence and diversity of insect-associated fungi in natural soils in China. Applied soil ecology, 39(1), 100-108. Sun, B. D., Yu, H. Y., Chen, A. J., & Liu, X. Z. (2008). Insect-associated fungi in soils of field crops and orchards. Crop Protection, 27(11), 1421-1426. Sun, H. J., Uchii, S., Watanabe, S., & Ezura, H. (2006). A highly efficient transformation protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant and Cell Physiology, 47(3), 426-431. Sun, J., Fuxa, J. R., & Henderson, G. (2003). Effects of virulence, sporulation, and temperature on Metarhizium anisopliae and Beauveria bassiana laboratory transmission in Coptotermes formosanus. Journal of invertebrate pathology, 84(1), 38-46. Sur, B. (1998). Survey of termite-inhabited soil and mosquito breeding sites in Lucknow, India for potential mycopathogens of Anopheles stephensi. Mycopathologia, 144(2), 77-80. Suzuki, K., Taiyoji, M., Sugawara, N., Nikaidou, N., Henrissat, B., & Watanabe, T. (1999). The third chitinase gene (chiC) of Serratia marcescens 2170 and the relationship of its product to other bacterial chitinases. Biochemical journal, 343(3), 587-596. Svitil, A. L., Chadhain, S., Moore, J. A., & Kirchman, D. L. (1997). Chitin degradation proteins produced by the marine Bacterium vibrio harveyi growing on different forms of chitin. Applied and Environmental Microbiology, 63(2), 408-413. Takaya, N., Yamazaki, D., Horiuchi, H., Ohta, A., & Takagi, M. (1998). Intracellular chitinase gene from Rhizopus oligosporus: molecular cloning and characterization. Microbiology, 144(9), 2647-2654.

200

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution, 30(12), 2725-2729. Tanabe, Y., O'Donnell, K., Saikawa, M., & Sugiyama, J. (2000). Molecular phylogeny of parasitic Zygomycota (Dimargaritales, Zoopagales) based on nuclear small subunit ribosomal DNA sequences. Molecular Phylogenetics and Evolution, 16(2), 253-262. Tanada, Y., & Kaya, H.K. (1993). Insect Pathology, Academic Press, San Diego, USA, 666 pp Tay, W. T., Evans, G. A., Boykin, L. M., & De Barro, P. J. (2012). Will the real Bemisia tabaci please stand up? PLoS One, 7(11), e50550. Teetor-Barsch, G. H., & Roberts, D. W. (1983). Entomogenous Fusarium species. Mycopathologia, 84(1), 3-16. Tepfer, D. (1990). Genetic transformation using Agrobacterium rhizogenes. Physiologia Plantarum, 79(1), 140-146. Terakawa, T., Takaya, N., Horiuchi, H., Koike, M., & Takagi, M. (1997). A fungal chitinase gene from Rhizopus oligosporus confers antifungal activity to transgenic tobacco. Plant Cell Reports, 16(7), 439-443. Thierry, M., Becker, N., Hajri, A., Reynaud, B., LETT, J. M., & Delatte, H. (2011). Symbiont diversity and non-random hybridization among indigenous (Ms) and invasive (B) biotypes of Bemisia tabaci. Molecular ecology, 20(10), 2172-2187. Thomsen, L., & Jensen, A. B. (2002). Application of nested-PCR technique to resting spores from the Entomophthora muscae species complex: implications for analyses of host-pathogen population interactions. Mycologia, 94(5), 794-802. Thuy, P.T., Thanh, N.T., & Dinh, N.V. (2001). Efficacy of Beauveria bassiana against insect pests of agriculture and forestry crops. Proceeding, International Workshop on Biology Hanoi, 2, 436-441. Toledo, A., de Remes Lenicov, A., & Lastra, C. L. (2010). Histopathology caused by the entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae, in the adult planthopper, Peregrinus maidis, a maize virus vector. Journal of Insect Science, 10(1), 35. Toledo, A., Virla, E., Humber, R., Paradell, S., & Lastra, C. L. (2006). First record of Clonostachys rosea (Ascomycota: Hypocreales) as an entomopathogenic fungus 201

of Oncometopia tucumana and Sonesimia grossa (Hemiptera: Cicadellidae) in Argentina. Journal of invertebrate pathology, 92(1), 7-10. Topuz, E., Erler, F., & Gumrukcu, E. (2016). Survey of indigenous entomopathogenic fungi and evaluation of their pathogenicity against the carmine spider mite, Tetranychus cinnabarinus (Boisd.), and the whitefly, Bemisia tabaci (Genn.) biotype B. Pest management science. Torrado-Leon, E., Montoya-Lerma, J., & Valencia-Pizo, E. (2006). Sublethal effects of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycotina: Hyphomycetes) on the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) under laboratory conditions. Mycopathologia, 162(6), 411-419. Torres-Barragán, A., Anaya, A. L., Alatorre, R., & Toriello, C. (2004). Entomopathogenic fungi from „El Eden‟Ecological Reserve, Quintana Roo, Mexico. Mycopathologia, 158(1), 61-71. Toscano, N., Castle, S., Henneberry, T., & Castle, N. (1998). Persistent silverleaf whitefly exploits desert crop systems. California Agriculture, 52(2), 29-33. Traboulsi, R. (1994). Bemisia tabaci: a report on its pest status with particular reference to the Near East. FAO Plant Protection Bulletin, 42(1/2), 33-58. Tronsmo, A., & Harman, G. E. (1993). Detection and quantification of N-acetyl-β-D- glucosaminidase, chitobiosidase, and endochitinase in solutions and on gels. Analytical biochemistry, 208(1), 74-79. Turnage, M. A., Muangsan, N., Peele, C. G., & Robertson, D. (2002). Geminivirus based vectors for gene silencing in Arabidopsis. The Plant Journal, 30(1), 107- 114. Tuttle, J. R., Idris, A. M., Brown, J. K., Haigler, C. H., & Robertson, D. (2008). Geminivirus-mediated gene silencing from Cotton leaf crumple virus is enhanced by low temperature in cotton. Plant Physiology, 148(1), 41-50. Tzean, S.S., Hsieh, L.S., & Wu, W.J. (1997). Atlas of enomopathogenic fungi from Taiwan. Council of Agriculture, Taiwan, R.O.C. 214 pp. Tzfira, T., & Citovsky, V. (2002). Partners-in-infection: host proteins involved in the transformation of plant cells by Agrobacterium. Trends in cell biology, 12(3), 121-129. Uetake, Y., Arakawa, M., Nakamura, H., Akahira, T., Sayama, A., Cheah, L. H., & Matsumoto, N. (2002). Genetic relationships among violet root rot fungi as 202

revealed by hyphal anastomosis and sequencing of the rDNA ITS regions. Mycological Research, 106(02), 156-163. Ulbrich, N., Hilgenfeld, R., Hanel, H., Sachse, B., Braun, P., Wink, J., & Schell, J. (1998). Antifungal polypeptide and process for its production: Google Patents. Unver, T., & Budak, H. (2009). Virus-induced gene silencing, a post transcriptional gene silencing method. International journal of plant genomics, 2009. Upendra, M. (2006). Characterization of native isolates of Trichoderma spp. and cloning of endochitinase gene (Doctoral dissertation, M. Sc. Thesis, University of Agricultural Sciences, Dharwad). Vaidya, R., Shah, I., Vyas, P., & Chhatpar, H. (2001). Production of chitinase and its optimization from a novel isolate Alcaligenes xylosoxydans: potential in antifungal biocontrol. World Journal of Microbiology and Biotechnology, 17(7), 691-696. Van Driesche, R. G., & Bellows Jr, T. S. (1996). Biology of arthropod parasitoids and predators. In Biological control (pp. 309-336). Springer US. Van Lenteren, J. C. V., & Noldus, L. P. J. J. (1990). Whitefly-plant relationships: behavioural and ecological aspects. Vänninen, I. (1995). Distribution and occurrence of four entomopathogenic fungi in Finland: effect of geographical location, habitat type and soil type. Mycological Research, 100(1), 93-101. Vänninen, I., Husberg, G. B., & Hokkanen, H. (1989). Occurrence of entomopathogenic fungi and entomoparasitic nematodes in cultivated soils in Finland. Vestergaard, S., Cherry, A., Keller, S., & Goettel, M. (2003). Safety of Hyphomycete fungi as microbial control agents Environmental impacts of microbial insecticides (pp. 35-62): Springer. Vey, A., Hoagland, R. E., & Butt, T. M. (2001). Toxic metabolites of fungal biocontrol agents. Fungi as biocontrol agents, 311. Vicentini, V. E. P., Camparoto, M. L., Teixeira, R., & Mantovani, M. (2001). Averrhoa carambola L., Syzygium cumini (L.) Skeels and Cissus sicyoides L.: medicinal herbal tea effects on vegetal and animal test systems. Acta Scientarium, 23(2), 593-598.

203

Vincent, J. F., & Wegst, U. G. (2004). Design and mechanical properties of insect cuticle. Arthropod structure & development, 33(3), 187-199. Viscarret, M. M., Botto, E. N., & Polaszek, A. N. D. R. E. W. (2000). Whiteflies (Hemiptera: Aleyrodidae) of economic importance and their natural enemies (Hymenoptera: Aphelinidae, Signiphoridae) in Argentina. Revista Chilena de Entomología, 26, 5-12. Viscarret, M., Torres-Jerez, I., De Manero, E. A., López, S., Botto, E., & Brown, J. K. (2003). Mitochondrial DNA evidence for a distinct New World group of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) indigenous to Argentina and Bolivia, and presence of the Old World B biotype in Argentina. Annals of the Entomological Society of America, 96(1), 65-72. Viterbo, A., Haran, S., Friesem, D., Ramot, O., & Chet, I. (2001). Antifungal activity of a novel endochitinase gene (chit36) from Trichoderma harzianum Rifai TM. FEMS Microbiology Letters, 200(2), 169-174. Voinnet, O. (2001). RNA silencing as a plant immune system against viruses. Trends in Genetics, 17(8), 449-459. Von Mering, C., Krause, R., Snel, B., Cornell, M., Oliver, S. G., Fields, S., & Bork, P. (2002). Comparative assessment of large-scale data sets of protein–protein interactions. Nature, 417(6887), 399-403. Wakil, W., Ghazanfar, M. U., & Yasin, M. (2014). Naturally occurring entomopathogenic fungi infecting stored grain insect species in Punjab, Pakistan. Journal of Insect Science, 14(1), 182. Wakil, W., Ghazanfar, M. U., Riasat, T., Kwon, Y. J., Qayyum, M. A., & Yasin, M. (2013). Occurrence and diversity of entomopathogenic fungi in cultivated and uncultivated soils in Pakistan. Entomological Research, 43(1), 70-78. Wang, C., & Leger, R. J. S. (2006). A collagenous protective coat enables Metarhizium anisopliae to evade insect immune responses. Proceedings of the National Academy of Sciences, 103(17), 6647-6652. Wang, C., & Leger, R. J. S. (2007). The Metarhizium anisopliae perilipin homolog MPL1 regulates lipid metabolism, appressorial turgor pressure, and virulence. Journal of Biological Chemistry, 282(29), 21110-21115.

204

Wang, C., Typas, M. A., & Butt, T. M. (2002). Detection and characterization of pr1 virulent gene deficiencies in the insect pathogenic fungus Metarhizium anisopliae. FEMS microbiology letters, 213(2), 251-255. Wang, K., & Tsai, J. H. (1996). Temperature effect on development and reproduction of silverleaf whitefly (Homoptera: Aleyrodidae). Annals of the Entomological Society of America, 89(3), 375-384. Wang, L., Feng, Z., Wang, X., Wang, X., & Zhang, X. (2010). DEGseq: an R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics, 26(1), 136-138. Wang, L., Huang, J., You, M., Guan, X., & Liu, B. (2005). Effects of toxins from two strains of Verticillium lecanii (Hyphomycetes) on bioattributes of a predatory ladybeetle, Delphastus catalinae (Col., Coccinellidae). Journal of Applied Entomology, 129(1), 32-38. Wasano, N., Konno, K., Nakamura, M., Hirayama, C., Hattori, M., & Tateishi, K. (2009). A unique latex protein, MLX56, defends mulberry trees from insects. Phytochemistry, 70(7), 880-888. White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, 18(1), 315-322. Widden, P., & Parkinson, D. (1979). Populations of fungi in a high arctic ecosystem. Canadian Journal of Botany, 57(21), 2408-2417. Wongsa, P., Tasanatai, K., Watts, P., & Hywel-Jones, N. (2005). Isolation and in vitro cultivation of the insect pathogenic fungus Cordyceps unilateralis. Mycological research, 109(08), 936-940. Wraight, S. P., & Bradley, C. A. (1996). Production, formulation, and application technologies for use of entomopathogenic fungi to control field crop pests. Fifth Simp sio de Controle Bi logico, Anais: Confer ncias Palestras. Embrapa-CNPSo, Foz do Igua-cu, Brazil, 177. Wraight, S. P., & Carruthers, R. I. (1999). Production, delivery, and use of mycoinsecticides for control of insect pests on field crops. Biopesticides: use and Delivery, 233-269. Wraight, S., Carruthers, R. I., Bradley, C., Jaronski, S., Lacey, L., Wood, P., & Galaini-Wraight, S. (1998). Pathogenicity of the entomopathogenic fungi 205

Paecilomyces spp. and Beauveria bassiana against the silverleaf whitefly, Bemisia argentifolii. Journal of invertebrate pathology, 71(3), 217-226. Wraight, S., Carruthers, R., Jaronski, S., Bradley, C., Garza, C., & Galaini-Wraight, S. (2000). Evaluation of the entomopathogenic fungi Beauveria bassiana and Paecilomyces fumosoroseus for microbial control of the silverleaf whitefly, Bemisia argentifolii. Biological Control, 17(3), 203-217. Wraight, S., Jacksonz, M., & De Kock, S. (2001). Formulation of fungal biocontrol agents. Fungi as Biocontrol Agents: Progress Problems and Potential, 253. Xiao, Y., & Fadamiro, H. Y. (2009). Host preference and development of Leptoglossus zonatus (Hemiptera: Coreidae) on Satsuma mandarin. Journal of economic entomology, 102(5), 1908-1914. Xiao-Jing, X., Li-Qun, Z., You-Yong, Z., & Wen-Hua, T. (2005). Improving biocontrol effect of Pseudomonas fluorescens P5 on plant diseases by genetic modification with chitinase gene. Chinese Journal of Agricultural Biotechnology, 2(01), 23-27. Xu, C., Qiu, B., Cuthbertson, A. G., Zhang, Y., & Ren, S. (2012). Adaptability of sweet potato whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) on seven marginal host plants. International Journal of Pest Management, 58(4), 297-301. Xu, J., Lin, K. K., & Liu, S. (2011). Performance on different host plants of an alien and an indigenous Bemisia tabaci from China. Journal of Applied Entomology, 135(10), 771-779. Yamada, T., Takahashi, H., & Hatano, R. (1999). A novel insecticide, acetamiprid Nicotinoid insecticides and the nicotinic acetylcholine receptor (pp. 149-176): Springer. Yamamoto, T., Iketani, H., Ieki, H., Nishizawa, Y., Notsuka, K., Hibi, T., & Matsuta, N. (2000). Transgenic grapevine plants expressing a rice chitinase with enhanced resistance to fungal pathogens. Plant Cell Reports, 19(7), 639-646. Yang, J., Tian, B., Liang, L., & Zhang, K. Q. (2007). Extracellular enzymes and the pathogenesis of nematophagous fungi. Applied microbiology and biotechnology, 75(1), 21-31. Yeo, S. F., & Wong, B. (2002). Current status of nonculture methods for diagnosis of invasive fungal infections. Clinical microbiology reviews, 15(3), 465-484.

206

Ying, J., Jian, H., Ruiyan, M., & Jucai, H. (2003). Host plant preferences of Bemisia tabaci Gennadius. Insect Science, 10(2), 109-114. Yoshioka, H., Numata, N., Nakajima, K., Katou, S., Kawakita, K., Rowland, O., & Doke, N. (2003). Nicotiana benthamiana gp91phox homologs NbrbohA and NbrbohB participate in H2O2 accumulation and resistance to Phytophthora infestans. The Plant Cell, 15(3), 706-718. Yuan, W. M., & Crawford, D. L. (1995). Characterization of Streptomyces lydicus WYEC108 as a potential biocontrol agent against fungal root and seed rots. Applied and Environmental Microbiology, 61(8), 3119-3128. Zang, L. S., & Liu, T. X. (2009). Food-deprived host-feeding parasitoids kill more pest insects. Biocontrol Science and Technology, 19(6), 573-583. Zang, L. S., & Liu, T. X. (2010). Effects of food deprivation on host feeding and parasitism of whitefly parasitoids. Environmental entomology, 39(3), 912-918. Zang, L. S., Chen, W. Q., & Liu, S. S. (2006). Comparison of performance on different host plants between the B biotype and a non B biotype of Bemisia tabaci from Zhejiang, China. Entomologia Experimentalis et Applicata, 121(3), 221-227. Zang, L. S., Liu, T. X., & Wan, F.-H. (2011). Reevaluation of the value of autoparasitoids in biological control. PloS one, 6(5), e20324. Zare, R., Gams, W., & Evans, H. C. (2001). A revision of Verticillium section Prostrata. The genus Pochonia, with notes on Rotiferophthora. Nova Hedwigia, 73(1/2), 51-86. Zattau, W. C., & McInnis, T. (1987). Life cycle and mode of infection of Leptolegnia chapmanii (Oomycetes) parasitizing Aedes aegypti. Journal of invertebrate pathology, 50(2), 134-145. Zhou, M., Sun, J., Wang, Q. H., Song, L. Q., Zhao, G., Wang, H. Z., & Li, X. (2011). Genome wide analysis of clustering patterns and flanking characteristics for plant microRNA genes. FEBS journal, 278(6), 929-940. Zhu, B., Chen, T. H., & Li, P. H. (1996). Analysis of late-blight disease resistance and freezing tolerance in transgenic potato plants expressing sense and antisense genes for an osmotin-like protein. Planta, 198(1), 70-77.

207

Zhu, Y., Pan, J., Qiu, J., & Guan, X. (2008). Isolation and characterization of a chitinase gene from entomopathogenic fungus Verticillium lecanii. Brazilian Journal of Microbiology, 39(2), 314-320. Zimmerman, B. J. (2008). Investigating self-regulation and motivation: Historical background, methodological developments, and future prospects. American Educational Research Journal, 45(1), 166-183. Zimmermann, G. (1986). The „Galleria bait method‟for detection of entomopathogenic fungi in soil. Journal of Applied Entomology, 102(15), 213- 215. Zimmermann, G. (2007). Review on safety of the entomopathogenic fungi Beauveria bassiana and Beauveria brongniartii. Biocontrol Science and Technology, 17(6), 553-596. Zupan, J. R., & Zambryski, P. (1995). Transfer of T-DNA from Agrobacterium to the plant cell. Plant Physiology, 107(4), 1041.

208

Annexure: 1

Detailed Sampling sites of different Agroecological Zones for the collection of insects

Sr. Agroecological Localities Sampling Month Climate during Latitude Longitud Lat long No. Zones and Year Sampling e 1 Hot Arid Field Sites No. 01 Chak No. 463/ TDA, Layyah July, 2013 Hot and Dry, 30° 47' N 71° 17' E 30.798195, Bellowing wind 71.297992 02 Chak no. 153/ TDA, Layyah from south to north 30° 54' N 71° 5' E 30.901302, Temperature 71.097245 average: 35 °C 03 Chak no. 156/ TDA, Layyah Humidity Average: 30° 52' N 71° 5' E 30.872805, 57 % 71.084113 04 Across MM road, Rehmat Abad, 30° 46' N 71° 13' E 30.776628, Annual Rainfall: Muzzafargarh 40 mm 71.224408 05 Across MM road, Chowk Sarwar 30° 45' N 71° 13' E 30.766073, Shaheed, Muzzafargarh 71.227310 06 Across MM road, Qazi abad, Layyah 31° 5' N 71° 12' E 31.087660, 71.214473 07 Across MM road North side, Fatehpur, 31° 12' N 71° 13' E 31.200752, Layyah 71.221898 08 Across MM road south side, Fatehpur, 31° 10' N 71° 11' E 31.168884, Layyah 71.194990 09 Kot Murad, Layyah 30° 57' N 71° 8' E 30.956923, 71.148652 10 Rafiq Abad, layyah 30° 56' N 71° 18' E 30.943434, 71.309735 2 Central Mixed 11 Cotton field, IAGS research station, PU, August, 2013 Hot and humid, 31° 29' N 74° 17' E 31.493891, Lahore Bellowing wind 74.296771 12 Cotton field, Multan road near Sundar from south to north 31° 20' N 74° 7' E 31.347163, Temperature Ada, Lahore 74.124144 average: 29 °C 13 Cotton field, Hostel Area, PU, Lahore Humidity Average: 31° 29' N 74° 18' E 31.488724, 79 % 74.304619 14 Mehmood Booti, north side of ring road, 31° 36' N 74° 23' E 31.612142, Annual Rainfall: Lahore 130 mm 74.396721 15 Chak no. 42/2L, Okara 30° 43' N 73° 26' E 30.718018, 73.442134 16 Chak no. 40/3R, Okara 30° 49' N 73° 22' E 30.823638, 73.379810 17 Chak no. 20/G-D, Okara 30° 53' N 73° 23' E 30.885164, 73.397791

18 Village Husain khan wala, Kasoor 31° 0' N 74° 24' E 31.007936, 74.409703 19 Ganda singh wala, Kasoor 31° 2' N 74° 30' E 31.043060, 74.509921 20 Village Hardo Sahari, Kasoor 31° 5' N 74° 21' E 31.093509, 74.360093 3 Cotton 21 Chak no. 90/6R, Sahiwal August, 2013 Hot and Dry, 30° 41' N 73° 2' E 30.690173, Bellowing wind 73.040178 22 Cotton field near Yousafwala, Sahiwal from south to north 30° 40' N 73° 12' E 30.679847, Temperature 73.201384 average: 34 °C 23 Cotton field near bypass chowk, Humidity Average: 29° 23' N 71° 36' E 29.388116, Bahawalpur 66 % 71.616354 24 Cotton field near Baqirpur, Bahawalpur 29° 26' N 71° 42' E 29.435364, Annual Rainfall: 71.703494 25 Cotton field Chak Hotiyana, 50 mm 30° 1' N 73° 13' E 30.029994, Bahawalnagar 73.227525 26 Village Tibba Bodla, Bahawalnagar 29° 56' N 73° 14' E 29.949756, 73.249347 27 Cotton field Chak RS, Multan 29° 56' N 71° 19' E 29.942324, 71.322888 28 Field area Central Cotton Research 30° 8' N 71° 26' E 30.148091, Institute (CCRI) , Multan 71.437129 29 Village Chanwala, Jalalpur pirwala, 29° 28' N 71° 20' E 29.478262, Multan 71.342189 30 Village Sariwala, Multan 30° 3' N 71° 30' E 30.052852, 71.507928

Annexure 2: Ingredients of Sabouraud Dextrose Peptone Yeast Extract Agar Media (SDAY)

Sr. No Ingredient SDAY full Strength SDAY Quarter strength 1 Sobauraud dextrose 40 gram 10 gram 2 Peptone 10 gram 2.5 gram 3 Yeast Extract 10 gram 2.5 gram 4 Agar 15 gram 15 gram

Annexure 3

Promega™ 1kb DNA Ladder PromegaTM 1 kb Plus DNA Ladder