Lnx2 Ubiquitin Ligase Is Essential for Exocrine Cell Differentiation in the Early Zebrafish Pancreas

Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas

Minho Wona,1, Hyunju Rob, and Igor B. Dawida,2

aSection on Developmental Biology, National Institute of Child Health and Human Development, Bethesda, MD 20892-2790, and bDepartment of Biological Sciences, College of Bioscience and Biotechnology, Chungnam National University, Daejeon 305-764, Korea

Contributed by Igor B. Dawid, August 27, 2015 (sent for review February 25, 2015; reviewed by Didier Y. R. Stainier and Aaron Zorn)

The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X majorityofendocrinecellsinthematureorgan(13–15). These (Lnx)2a is expressed in the ventral-anterior pancreatic bud of studies conclude that cell differentiation in the pancreas de- zebrafish embryos in addition to its expression in the brain. Knock- pends on a reduction or cessation of Notch signaling, whereas, down of Lnx2a by using an exon 2/intron 2 splice morpholino in turn, precursor maintenance requires a Notch signal. Fur- resulted in specific inhibition of the differentiation of ventral bud ther, specific levels of Notch signaling can direct precursor cells derived exocrine cell types, with little effect on endocrine cell types. to distinct fates, and the Notch pathway affects cell proliferation A frame shifting null mutation in lnx2a did not mimic this pheno- in this system. type, but a mutation that removed the exon 2 splice donor site did. In previous work, we have studied the role of the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2b (16, 17) in embryonic We found that Lnx2b functions in a redundant manner with its – paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 development (18 20). We proceeded to explore possible func- skipping and leads to the production of an N-truncated protein that tions of the other lnx2 paralog in zebrafish, lnx2a. The lnx2a gene is expressed in the pancreas anlage in addition to the nervous acts as an interfering molecule. Thus, the phenotype characterized system, and lnx2a knockdown mediated by a splice morpholino by inhibition of exocrine cell differentiation requires inactivation of (MO) led to differential inhibition of exocrine cell differentia- both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, tion. Because the role of ubiquitylation and protein stability in and we show that inhibition of Numb expression rescues the Lnx2a/b- pancreas development has received little attention, we pursued deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in these observations further. A null mutation in lnx2a did not BIOLOGY the number of Notch active cells in the pancreas. We suggest that mimic the MO-induced phenotype because of redundancy of the DEVELOPMENTAL Lnx2a/b function to fine tune the regulation of Notch through Numb lnx2a and lnx2b genes. We could show that the splice MO led to in the differentiation of cell types in the early zebrafish pancreas. exon 2 skipping and the production of an N-truncated Lnx2a Further, the complex relationships among genotype, phenotype, and protein that acts as an interfering factor. This effect could be morpholino effect in this case may be instructive in the ongoing con- demonstrated most clearly by studying a mutation that deletes sideration of morpholino use. the exon 2 splice donor site targeted by the MO. The mutant contained the N-truncated protein also seen in the morphant and pancreas | Numb | Notch | morpholino | TALEN fully reproduced the exocrine deficiency phenotype. Further we provide evidence that Lnx2a and Lnx2b act in pancreas devel- he pancreas is a vertebrate-specific bifunctional organ that is opment by destabilizing Numb, thereby affecting Notch sig- Tcomposed of exocrine tissue for secretion of digestive en- naling. We conclude that regulation of protein stability is an zymes and endocrine tissue for production of hormones involved important mechanism in early pancreas development in zebra- in regulating glucose homeostasis. Morphogenesis of the devel- fish. Further, this example shows that nonreplication of an MO phenotype by a null mutation need not indicate off-target oping pancreas has been well characterized in amniotes and other vertebrates (1). The zebrafish has emerged as a useful model organism for studying pancreas formation. As in mammals, the Significance zebrafish pancreas develops from two distinct pancreatic anlagen of the endoderm, the dorsal-posterior bud and the ventral-anterior Pancreas differentiation is of interest as an example of or- bud, which subsequently fuse to form the definitive pancreas. In ganogenesis and for its medical implications. We report here zebrafish, the dorsal bud gives rise to the primary islet, whereas that regulation of protein stability is a player in the differen- the ventral bud gives rise to exocrine cells, the pancreatic duct, and tiation of certain cell lineages in the early zebrafish pancreas. secondary islets (2, 3). The related E3 ubiquitin ligases Ligand of Numb protein-X (Lnx)2a Pancreas development is regulated by a network of tran- and Lnx2b affect differentiation of exocrine cells, apparently by scription factors and signal transduction pathways. The Pdx1 destabilizing Numb in exocrine progenitor cells. Numb is an in- homeobox factor is of critical importance to pancreas formation hibitor of Notch, a key regulator of pancreatic development. We in the mouse (4, 5) and is the earliest marker for cells specified suggest that Lnx2a/b destabilize Numb to derepress Notch, as pancreatic precursors in all animals studied including the allowing precursors to proliferate and support subsequent dif- zebrafish (6). The basic helix-loop-helix factor Ptf1a is essential ferentiation. This study also highlights the fact that detailed for the development of exocrine precursor cells in the mouse (7) analysis of morpholino versus mutant phenotypes may be re- and zebrafish (8, 9) and, furthermore, represents a valuable quired for a full understanding of their relationship. early marker for exocrine precursors. Among multiple signaling pathways that have a role in the specification and differentiation Author contributions: M.W. and I.B.D. designed research; M.W. and H.R. performed re- of the pancreas, the Notch pathway has received particular search; M.W. and I.B.D. analyzed data; and M.W. and I.B.D. wrote the paper. attention. Studies in the mouse showed that artificial activation Reviewers: D.Y.S., Max Planck Institute of Heart and Lung Research; and A.Z., Cincinnati of the Notch pathway prevents precursors from differentiating Children’s Research Foundation. into functional pancreatic cell types (10). Further, manipula- The authors declare no conflict of interest. tion of Notch signaling affects the balance between endocrine 1Present address: Department of Pharmacology, College of Medicine, Chungnam National and exocrine differentiation in the pancreas (11, 12). Several University, Jung-gu, Daejeon 301-747, Korea. studies in zebrafish have focused on the secondary transition in 2To whom correspondence should be addressed. Email: [email protected]. which a specific population of ventral bud-derived cells differ- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. entiates into secondary islets that eventually account for the 1073/pnas.1517033112/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1517033112 PNAS Early Edition | 1of6 Downloaded by guest on September 29, 2021 in the development of the ventral pancreas but not the initial specification of the endoderm (SI Appendix, Fig. S2 C and D).

A lnx2a Null Mutant Does Not Recapitulate the Morphant Phenotype. The validity of MO-induced phenotypes has been questioned recently (21), yet the high regional precision of the lnx2a-MO– induced defects seems to argue against a nonspecific effect. To investigate this issue, we generated lnx2a null mutants by using Δ TALEN-mediated gene targeting (22). The lnx2a 70 mutation has a frame shift early in the protein coding region, leading to early termination of translation (Fig. 3 A and B), and contains no detectable Lnx2a protein (Fig. 3C and SI Appendix, Fig. S3A). Δ Thus, lnx2a 70 is almost certainly a null mutation, yet the mutant embryos displayed no pancreatic phenotype (Fig. 3 D1, D3, and E). Further, homozygous mutant fish are morphologically normal, and are viable and fertile. Thus, we investigated the possible functional redundancy of lnx2a with lnx2b, a paralog encoding a similar protein (SI Appendix, Fig. S3B); lnx2b is expressed in the Fig. 1. lnx2a is expressed in the ventral pancreas during early pancreas spec- endoderm including the pancreas in zebrafish embryos (SI Ap- ification. Lateral views (A and I), dorsal views (B–E), and ventral views (F–H). pendix, Fig. S3C). To test for possible redundancy, we injected a (A) lnx2a transcripts (blue) are detected in regions of the endoderm (arrow), validated (18) MO against lnx2b (SI Appendix, Fig. S3 D and E) Δ70 forebrain (arrowhead), and the spinal cord at 24 hpf. Expression of pdx1 (B, D, into WT and lnx2a mutant embryos, and found that the MO and G), ins (C, E,andI)andfoxa3 (F) are in red. lnx2a expression is observed in generated a ventral pancreas deficiency phenotype in mutant but the antero-ventral part of pdx1-positive pancreas precursors at 21 (B)and26 not in WT embryos (Fig. 3 D2, D4, and E). Thus, redundant + (D) hpf, but excluded from β-cells (ins ) in the dorsal pancreas at 21 (C), 26 (E), lnx2b function may account for the fact that lnx2a is dispensable and 48 (I) hpf. At 48 hpf, lnx2a expression is detected in the ventral pancreas for pancreatic development. but not in the intestine, swim bladder, or liver (F–H). SB, swim bladder; In, in- μ Because a block to exon 2/3 splicing disconnects the standard testine; Li, liver; Pa, pancreas; VP, ventral pancreas. (Scale bars: 50 m.) initiation site in exon 2 from downstream coding, the lnx2a morphant cannot produce full-length Lnx2a protein (Fig. 2A and effects but, in this case, helped reveal a more complex underlying SI Appendix, Fig. S2 A and B). Nevertheless, RT-PCR and an- mechanism. tibody blotting showed that morphant embryos produce exon 2 skipped RNA (Fig. 3 F and H) and, importantly, abundant levels Results Early Differential Expression of lnx2a in the Ventral Pancreatic Bud. In the context of our interest in the function of Lnx family E3 ubiquitin ligases in embryonic development (18–20), we examined the expression of lnx2a in the zebrafish embryo. In addition to expression in the CNS, lnx2a is transiently expressed in the ventral, but not in the dorsal pancreatic bud from 19 h after fertilization (hpf; 20–25 somites) to 55 hpf. In addition to an embryo overview, Fig. 1 illustrates the relative expression domains of lnx2a and the marker genes pdx1 (pan-pancreas), insulin (β-cells), foxa3 (endoderm), and ptf1a (exocrine cells). SI Ap- pendix, Fig. S1 shows a time course of lnx2a expression and a drawing of zebrafish pancreas development illustrating the lnx2a expression pattern. Ptf1a, the earliest ventral pancreas-specific transcription factor, is expressed from 33 hpf on (refs. 8 and 9). Lnx2a seems to be the earliest gene differentially expressed in the ventral pancreatic bud and, therefore, we tested whether lnx2a has a role in the specification of different pancreatic domains in the zebrafish embryo.

lnx2a Knockdown Using a Splice MO Inhibits Exocrine Pancreas Differentiation. To explore the pancreatic role of Lnx2a, we used a splice MO (hereafter named lnx2a-MO) that effectively blocks splicing between the first coding exon, exon 2, and exon 3 (Fig. 2A and SI Appendix, Figs. S2 and S3). Whole-mount in situ hybridization (WISH) using markers for ventral/exocrine (trypsin, ptf1a) and dorsal/endocrine cells (insulin, glucagon) revealed that injection of lnx2a-MO causes a severe deficit in ventral but not Fig. 2. lnx2a knockdown causes defects in the exocrine pancreas. (A)Sche- dorsal markers (Fig. 2 B–E). Reduction in ventral pancreas matic drawing of the lnx2a locus containing 11 exons, and the Lnx2a protein formation was confirmed by using WISH with additional markers (737 aa) containing a RING-finger domain (RF), the Numb binding NPAF motif at different stages of development (SI Appendix, Fig. S2 C and (F), and four PDZ domains. The translation initiation site is located in exon 2, which encodes the RING-finger domain. The lnx2a-MO targets the splice donor D). Using the transgenic strain Tg(ptf1a:EGFP), cell type-specific site of exon 2. Primers in exon 1 (F1) and exon 11 (R1) are shown, as is the antibodies, and confocal laser scanning microscopy, we illustrate epitope for the Lnx2a antibody in the third PDZ domain. (B and C)Thelnx2a-MO the reduction in ventral pancreatic markers at the protein level (5 ng) leads to inhibition of exocrine markers (try, ptf1a), but not endocrine as well (SI Appendix, Fig. S2E). In contrast to the strong re- markers (ins, glu), as seen by two-color WISH at 60 hpf. (D and E) Quantification duction of ventral pancreatic cells, other organ precursors in the of marker expression; effects were classified as strong, partial, and unaffected. endoderm formed normally, suggesting that Lnx2a is involved MO, lnx2a-MO; UN, uninjected. (Scale bar: 100 μm.)

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1517033112 Won et al. Downloaded by guest on September 29, 2021 of Lnx2a immunoreactive protein with a molecular size smaller than the wild type (Fig. 3G). Using mass spectrometry, we showed that the short form of Lnx2a represents an N-terminally truncated form that is initiated from a cryptic start site in exon 3 (Fig. 3H and SI Appendix,Fig.S4). Truncated Lnx2a has lost the RING domain that has been shown previously to be required for E3 ubiquitin ligase activity of Lnx proteins (16–18), as confirmed in SI Appendix,Fig.S5A and B. The N-truncated protein retains the NPAF motif and the PDZ domains that mediate protein–protein interactions (Figs. 2A and 3H), suggesting that it could act as a negative interfering form. This suggestion is borne out by the Δ observation that injection of the truncated mRNA into lnx2a 70 mutant embryos re-created the loss of exocrine marker phenotype (Fig. 3 I and J). A weak phenotype was seen after truncated mRNA injection into WT embryos, most likely because the truncated protein has only a moderately strong interfering effect. We conclude that lnx2a and lnx2b have redundant function in pancreas development so that loss of expression of one paralog has no phenotype but sensitizes the organism to further interference with Lnx2 protein function.

Δ329 The lnx2a Mutant Recapitulates the Morphant Phenotype. Using the same TALEN pair described above, we isolated a larger Δ deletion, lnx2a 329 (Fig. 4 A and B). In this mutation, the exon 2 splice donor site has been lost, providing a definitive genetic model for the putative effect of the lnx2a-MO. As predicted, Δ lnx2a 329 mutant embryos express the same truncated form of

Lnx2a protein as the morphant (Fig. 4C and SI Appendix,Fig. BIOLOGY Δ329

S4). Most critically, lnx2a mutants shows the same pan- DEVELOPMENTAL creatic phenotype as the morphant, with specific inhibition of exocrine marker expression, whereas endocrine markers are es- sentially unaffected (Fig. 4 D and E). This fact is true for both zygotic and maternal/zygotic mutants (Fig. 4E). It should be noted Δ that homozygous lnx2a 329 zebrafish show high embryonic le- thality, but some mutant fish survive, allowing the cross illustrated Δ in bars 2 and 3 of Fig. 4E. The behavior of the lnx2a 329 mutant provides support for the conclusion that the phenotype is due to loss of functional Lnx2a combined with interference with the function of Lnx2b, and that the lnx2a morphant phenotype is based on the same mechanism. These results legitimize the use and interpretation of the lnx2a-MO.

Δ329 The Ventral Pancreas Defects in lnx2a Mutants and lnx2a Morphants Are Rescued by Knockdown of Numb. Lnx is known to target Numb for ubiquitylation and degradation (16), and Numb is an inhibitor Fig. 3. Generation of lnx2aΔ70 mutant using TALENs, and the functional re- of Notch signaling (23–26). Because Notch signaling has a major dundancy of lnx2 genes. (A) Schematic representation of the lnx2a locus and the role in the specification and differentiation of various pancreatic TALEN target site in the first protein coding exon (exon 2). TALEN targets (left, – Δ cell types (10, 13 15) we asked whether the Lnx2a morphant and orange and right, green), and the lnx2a 70 mutation are shown below the Δ mutant phenotype is due to a change in the activity of Numb. drawing. Next, the protein sequences of WT and the lnx2a 70 frameshift allele Δ70 Numb is expressed in the embryonic endoderm including the are shown. Genotype of lnx2a mutant was analyzed by the genomic PCR (B), pancreas, but whereas numb RNA could be detected in the entire and immunoblotting of endogenous Lnx2a protein (C). For validation of the anti-Lnx2a antibody, see SI Appendix,Fig.S2F.(D) Marker gene (try and glu) pancreas, the protein was detected only in the dorsal bud-derived Δ expression shows little effect in lnx2a 70 null mutants, and in lnx2b-MO–injected primary islet (SI Appendix,Fig.S5C and D). Because the known Δ embryos at 60 hpf. However, lnx2b-MO injection into lnx2a 70 mutant embryos ubiquitylation and degradation of Numb by Lnx proteins (16, 18) shows suppression of exocrine markers. (E) Quantification of pancreatic defects was confirmed for zebrafish Lnx2a (SI Appendix,Fig.S5A and B), by analysis of trypsin expression, classified as in Fig. 2D.SeeSI Appendix,Fig.S3D it seemed possible that Lnx2a reduces the level of Numb protein and E for effectiveness of lnx2b-MO.(F–H) lnx2a-MO leads to production of in the ventral pancreas where Lnx2a is expressed (Fig. 1). The N-truncated Lnx2a protein. (F) RT-PCR using primers F1 and R1 (defined in Fig. lnx2a mutant/morphant phenotype might then be due to abnormal 2A) and 48 hpf embryo RNA, followed by sequencing, shows that lnx2a-MO stabilization of Numb; we illustrate in the next section that there injection results in exon 2 skipping and stabilization of the resulting transcript. is, in fact, an increase of Numb-positive cells in lnx2a morphants. lnx2b expression was not changed by lnx2a-MO injection. (G) Endogenous Lnx2a Therefore, we tested whether reduction of Numb expression could showed the expected size in controls, but a smaller protein was seen in lnx2a- rescue the lnx2a-deficient phenotype. This prediction proved – Δ MO injected embryos, which was identified by mass spectrometry (SI Appendix, correct: Both lnx2a 329 mutant and lnx2a morphant phenotypes Fig. S4) as an N-truncated protein (587 aa) arising from an alternate start site in were substantially rescued by injection of numb-MO (Fig. 5 and SI exon 3. (H) Schematic drawing of exon 2 skipping, alternate translation start site, and N-truncated protein in lnx2a-MO–injected embryos. (I) N-truncated Lnx2a Appendix,Fig.S5E). The absence of a gross morphological effect (exon 2-skipped, as shown in F–H) has interfering effect. Tr-mRNA was injected of the numb-MO itself is consistent with the work of Bresciani Δ into the WT and lnx2a 70 mutant embryos and analyzed at 48 hpf. (J)Quanti- et al. (27). This agreement, and the fact that we observe a specific fication of pancreatic defects in I by analysis of ptf1a expression. Injection of rescue phenotype rather than developmental malformation, should Tr-mRNA into WT embryos has little effect, but leads to the exocrine pancreas help alleviate concerns regarding the validity of the numb-MO in phenotype in lnx2aΔ70 mutants. (Scale bars: D,100μm; I,50μm.) this context. These results support the view that Lnx2a and Lnx2b

Won et al. PNAS Early Edition | 3of6 Downloaded by guest on September 29, 2021 Tg(Tp1:VenusPest) in which a Notch-responsive element drives expression of stable nuclear mCherry and unstable Venus (13). In this strain, red nuclei signify cells in which Notch signaling was previously active but has now been turned off, whereas green and double-positive cells are active for Notch signaling when examined. We find that lnx2a-MO increased Numb-positive cells and reduced Notch-active cells in the pancreas (Fig. 6 A, 2 and B, 1 and 2). Furthermore, coinjection of numb-MO rescues the effect of lnx2a-MO on the abundance of Tg(Tp1:VenusPest) expressing Notch-ON cells (Fig. 6 A, 4 and B). We propose that numb is transcribed in the entire pancreatic anlage, but the protein is destabilized by Lnx2 in the ventral bud. Loss of Lnx2 allows Numb accumulation in the ventral bud, interfering with Notch regulation and cell differentiation. To test how Lnx2 affects ventral bud precursor populations, we tested Notch activity and Numb accumulation at earlier stages. In Lnx2a morphants at 36 hpf, the number of Tg(Tp1: VenusPest)-positive cells is reduced but not as strongly as at 48 + hpf, and the number of Numb cells is increased (Fig. 6 and SI Appendix, Fig. S6). At 24 hpf, before the ventral bud marker ptf1a is expressed, no difference between wild type and morphant embryos was seen (SI Appendix, Fig. S6). Δ Fig. 4. The lnx2a 329 mutant recapitulates the morphant phenotype. (A)Se- Δ quence of the lnx2a 329 mutation (Fig. 3A). The lowercase sequence in the Reduced Cell Proliferation in Lnx2a-Deficient Pancreas. Notch sig- Δ mutant indicates that it is in intron 2, with lnx2a 329 having lost the exon 2 naling affects the cell cycle in the early pancreas (13, 14). We splice donor site. (B and C) Genotyping of lnx2aΔ329 by genomic PCR (Δ329), used Tg(ptf1a:EGFP) embryos to visualize ventral pancreatic RT-PCR (Δ510 equaling exon 2) (B), and by Western blotting of embryo extracts cells and BrdU to mark proliferating cells. Injection of lnx2a-MO showing the presence of N-truncated protein (C). (D) Phenotypic analysis of + Δ resulted in a substantial reduction in EGFP cells and an increase lnx2a 329 mutants at 48 hpf. (Scale bar: 50 μm.) (E) The quantification of + in Numb cells, in agreement with the phenotype described earlier pancreatic defects by analysis of ptf1a expression, classified as in Fig. 2D.De- + + Δ329 (Fig. 7 A, 1 and 3 and B). Further, the number of BrdU /EGFP velopment of the exocrine pancreas is specifically suppressed in lnx2a . + cells decreased in concert with the reduction of total EGFP cells, consistent with the view that proliferation of Ptf1a-expresssing function in early pancreas development to limit the extent and cells is reduced in the Lnx2-deficient pancreas (Fig. 7). area of Numb protein accumulation and activity. Are fewer ventral bud precursors specified in mutants/ morphants, or does the initial population fail to proliferate nor- Loss of Lnx2 Activity Causes a Reduction of Notch-Responsive Cells in mally? Early ventral bud markers, ptf1a and mnr2a, are already the Pancreas. Notch signaling is a key regulator of pancreas for- reduced in the morphants at the earliest time when they can be mation, affecting specification of different cell types and control- detected, but the degree of reduction appears to increase as de- ling their quiescence or proliferation (10, 13–15, 28). We asked velopment proceeds (SI Appendix,Fig.S7). This fact suggests that whether Lnx2a, through its modulation of Numb protein stability, Lnx2a regulates both the entry of cells into the ventral pancreas can affect Notch activity in the embryonic pancreas. For this precursor pool and the expansion of this population during purpose, we used the transgenic strain Tg(Tp1:H2BmCherry); development.

Δ Fig. 5. Ventral pancreas defects in lnx2a 329 mutant and lnx2a-MO–injected embryos can be rescued by knockdown of Numb. (A) The translation blocking Δ MO for Numb (5 ng) was injected into WT, lnx2a 329-, and lnx2a-MO–injected embryos, and pancreatic phenotype was examined at 60 hpf. (Scale bar: 50 μm.) (B) Quantification of pancreatic defects by analysis of ptf1a expression. Exocrine pancreas defects were substantially rescued by knockdown of Numb; numb-MO had little effect in WT embryos. (C) Immunoblotting of embryo extracts with Numb antibody shows the efficiency of the numb-MO.

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1517033112 Won et al. Downloaded by guest on September 29, 2021 Numb stability. Numb has an inhibitory effect on Notch signaling (23–26, 38), and the Notch pathway has a major role in pancreas development. In the mouse, interfering with Notch activity in the early pancreas led to accelerated differentiation of endocrine cell types while inhibiting formation of exocrine cells (11), whereas overexpression of the constitutively active Notch intercellular domain led to inhibition of differentiation of all pancreatic cell types (10, 28). These observations led to the view that Notch signaling maintains precursor populations, whereas down-regulation of the pathway allows differentiation to proceed. In the formation of secondary islets in zebrafish, Notch activation inhibits exocrine differentiation (39), and specification of particular cell types depends on different Notch ligands (12). Secondary islet formation requires cells that are initially Notch active but un- dergo Notch down-regulation before differentiation (13, 14). Further, specific levels of Notch activity control quiescence or proliferation of precursor cells and their eventual entry into the endocrine differentiation pathway (13). In our context, the above conclusions may be summarized as (i) Notch signaling is required in pancreatic cell differentiation; (ii) high Notch activity maintains precursor pools, lower activity allows differentiation, in certain cases preceded by proliferation; and (iii) cells that down-regulate Notch cannot maintain their precursor status. Our observations suggest that Lnx2a, together with Lnx2b, destabilizes Numb in ventral bud-derived cells, allowing Notch activity, which may affect specification and expansion of BIOLOGY DEVELOPMENTAL

Fig. 6. lnx2a-MO injection causes a reduction of Notch-responsive cells in the pancreas. (A) Tg(Tp1:H2BmCherry); Tg(Tp1:VenusPest) embryos were injected with lnx2a-MO (A2), numb-MO (A3), or both (A4). At 48 hpf, embryos were stained with anti-Numb antibody and analyzed by confocal microscopy; Z projections are shown. (Scale bar: 10 μm.) (B) Total number of + + Notch-OFF (Tp1:H2BmCherry ) and Notch-ON (Tp1:H2BmCherry and Tp1: + VenusPest ) cells, as well as Numb-positive cells, were counted in all Z sec- tions of four embryos for each category. **P < 0.005; ***P < 0.002.

Discussion Functional Redundancy Between Lnx2a and Lnx2b. The mammalian LNX family is composed of five members, but only LNX1 and LNX2 share an N-terminal RING-finger domain, a NPAY/F motif for NUMB binding, and four PDZ domains (29, 30). The in vivo functions of LNX1/2 remain incompletely known. Mammalian LNX1 was shown to act as an E3 ubiquitin ligase that mediates ubiquitylation and degradation of Numb in cultured cells (16, 17). Lnx1 and Lnx2 are expressed in the nervous system and may have a role in neuronal cell proliferation and differentiation (31, 32). Further, interactions of Lnx1/2 have been analyzed with individual proteins or at a global proteomic level (33–35). However, to our knowledge, no genetic test of Lnx1/2 function has been reported. In zebrafish, three LNX1/2 homologs (lnx1, lnx2a, and lnx2b) have been identified (18), and Lnx2b affects dorso-ventral pat- terning by modulation of Dharma (Bozozok, Nieuwkoid) stability (18, 19). In eutherian mammals, LNX-2b has been lost by pseudogenization, contributing several exons to the noncoding Xist RNA (36, 37). We show here that zebrafish Lnx2a, like human LNX1, can mediate Numb ubiquitylation and degradation. In studying the zebrafish pancreas, we show that Lnx2a is expressed in the ventral bud at an early stage of embryogenesis. Further, Lnx2a and Lnx2b function redundantly in zebrafish pancreas development through the destabilization of Numb. It remains to Fig. 7. lnx2a-MO injection results in impaired cell proliferation in the ventral pancreas. (A) Tg(ptf1a:EGFP) embryos were incubated in 10 mM BrdU be tested whether the single Lnx2 gene in mammals carries out from 46 to 47 hpf, fixed, stained with anti-BrdU and anti-Numb antibodies, an analogous function. and analyzed by confocal microscopy. For clarity, the same plane of the BrdU channel is shown separately in addition to the merged images. (Scale bar: + + + + Control of Protein Stability as a Regulatory Mechanism in Pancreas 10 μm.) (B) The average number of ptf1:EGFP ,Numb and ptf1:EGFP /BrdU Formation. Our results support the view that Lnx2a and Lnx2b double-positive cells in the pancreas of 10 uninjected and lnx2a-MO–injected mediate the specification of exocrine pancreatic cells by limiting embryos are shown (***P < 0.001).

Won et al. PNAS Early Edition | 5of6 Downloaded by guest on September 29, 2021 Δ precursor cells. Loss of Lnx2 activity in the lnx2a 329 mutants or Tg(Tp1bglob:H2BmCherry)S939 abbreviated Tg(Tp1:H2BmCherry),and lnx2a morphants stabilizes Numb to inhibit Notch in cells where Tg(Tp1bglob:venusPest)S940 abbreviated Tg(Tp1:venusPest) (13). it is normally active, ultimately interfering with the normal developmental progression of these cells. We suggest that in nor- TALEN Construction. TALENs were designed by using the TAL Effector- mal development, the regulation of Numb protein stability by Nucleotide Targeter (TALE-NT) 2.0 (43) and assembled with Golden gate kits Lnx2a/b is an important component of the system that controls (22). Modified destination vectors, pCS2TAL3 KKR/ELD, were constructed by the levels of Notch activity during pancreas formation and the replacing RR and DD FokI domains in pCS2TAL3 RR/DD vectors (44) with KKR assignment of cells to different pancreatic lineages. and ELD FokI domains by using site-directed mutagenesis of pMLM 290/292 (KK/EL) vectors (45) (Addgene nos. 21872/21873). Morphant Versus Mutant Phenotypes. Recent publications (21, 40) and much informal discussions have raised doubts about the MO Injection. MOs were purchased from Gene Tools: lnx2a splice MO, TTGA- GAACTTTACCTGTGTTTGAGA, 5 ng per embryo; lnx2b splice MO, TGCAG- validity of morphant phenotypes. Although this suspicion is un- CATGCACTAACCTGTTGTGC, as described (20); numb translation MO, AAC- doubtedly well founded in certain instances, we show here that TCTGCCGTAGCTTATTCATCGC, 5 ng per embryo. Random sequence MO from failure of a null mutant to replicate a morphant phenotype may Gene Tools was used for control injections, and we also used uninjected have complex and ultimately insightful reasons. It should be embryos for comparison. noted that Kok et al. (21) considered the possibility of functional For additional materials and methods, see SI Appendix, SI Materials redundancy of paralogs and possible effects of exon skipping in and Methods. the interpretations. Our example emphasizes the need to con- sider these and possibly other effects in evaluating mutant versus ACKNOWLEDGMENTS. We thank Greg Palardy and Damian Dalle Nogare for morphant phenotypes. advice on microscopy; John Gonzales and Allisan Aquilina-Beck for help with fish husbandry; T.-Y. Choi and Jin-Gu Lee for helpful discussion; and T.-Y. Choi, Materials and Methods N. Ninov, D. Y. Stainier, C.V. Wright, and L. Godinho for reagents and zebrafish lines. This work has been supported by the Intramural Research Program of the Animals. Zebrafish AB* were maintained as described (41). Embryos were National Institute of Child Health and Human Development, National Institutes treated with 0.003% Phenylthiourea (Sigma) at 22–24 hpf to prevent of Health, and by the Basic Science Research Program of the National Research pigmentation. Transgenic lines were as follows: Tg(ptf1a:EGFP) (42), Foundation of Korea, Ministry of Education (NRF-2015R1D1A4A01016532).

1. Slack JM (1995) Developmental biology of the pancreas. Development 121(6):1569–1580. 25. Beres BJ, et al. (2011) Numb regulates Notch1, but not Notch3, during myogenesis. 2. Field HA, Dong PD, Beis D, Stainier DY (2003) Formation of the digestive system in Mech Dev 128(5-6):247–257. zebrafish. II. Pancreas morphogenesis. Dev Biol 261(1):197–208. 26. Zhao C, et al. (2014) Numb family proteins are essential for cardiac morphogenesis 3. Kinkel MD, Prince VE (2009) On the diabetic menu: Zebrafish as a model for pancreas and progenitor differentiation. Development 141(2):281–295. development and function. BioEssays 31(2):139–152. 27. Bresciani E, et al. (2010) Zebrafish numb and numblike are involved in primitive 4. Jonsson J, Carlsson L, Edlund T, Edlund H (1994) Insulin-promoter-factor 1 is required erythrocyte differentiation. PLoS One 5(12):e14296. – for pancreas development in mice. Nature 371(6498):606 609. 28. Hald J, et al. (2003) Activated Notch1 prevents differentiation of pancreatic acinar 5. Offield MF, et al. (1996) PDX-1 is required for pancreatic outgrowth and differenti- cells and attenuate endocrine development. Dev Biol 260(2):426–437. – ation of the rostral duodenum. Development 122(3):983 995. 29. Dho SE, et al. (1998) The mammalian numb phosphotyrosine-binding domain. Char- 6. Argenton F, Zecchin E, Bortolussi M (1999) Early appearance of pancreatic hormone- acterization of binding specificity and identification of a novel PDZ domain-con- expressing cells in the zebrafish embryo. Mech Dev 87(1-2):217–221. taining numb binding protein, LNX. J Biol Chem 273(15):9179–9187. 7. Krapp A, et al. (1998) The bHLH protein PTF1-p48 is essential for the formation of the 30. Rice DS, Northcutt GM, Kurschner C (2001) The Lnx family proteins function as mo- exocrine and the correct spatial organization of the endocrine pancreas. Genes Dev lecular scaffolds for Numb family proteins. Mol Cell Neurosci 18(5):525–540. 12(23):3752–3763. 31. Lenihan JA, Saha O, Mansfield LM, Young PW (2014) Tight, cell type-specific control 8. Lin JW, et al. (2004) Differential requirement for ptf1a in endocrine and exocrine of LNX expression in the nervous system, at the level of transcription, translation and lineages of developing zebrafish pancreas. Dev Biol 274(2):491–503. – 9. Zecchin E, et al. (2004) Evolutionary conserved role of ptf1a in the specification of protein stability. Gene 552(1):39 50. exocrine pancreatic fates. Dev Biol 268(1):174–184. 32. Yin FT, et al. (2014) Caspr4 interaction with LNX2 modulates the proliferation and 10. Murtaugh LC, Stanger BZ, Kwan KM, Melton DA (2003) Notch signaling controls multiple neuronal differentiation of mouse neural progenitor cells. Stem Cells Dev 24(5): – steps of pancreatic differentiation. Proc Natl Acad Sci USA 100(25):14920–14925. 640 652. ’ 11. Apelqvist A, et al. (1999) Notch signalling controls pancreatic cell differentiation. 33. D Agostino M, et al. (2011) Ligand of Numb proteins LNX1p80 and LNX2 interact with Nature 400(6747):877–881. the human glycoprotein CD8α and promote its ubiquitylation and endocytosis. J Cell 12. Zecchin E, et al. (2007) Distinct delta and jagged genes control sequential segregation Sci 124(Pt 21):3545–3556. of pancreatic cell types from precursor pools in zebrafish. Dev Biol 301(1):192–204. 34. Wolting CD, et al. (2011) Biochemical and computational analysis of LNX1 interacting 13. Ninov N, Borius M, Stainier DY (2012) Different levels of Notch signaling regulate qui- proteins. PLoS One 6(11):e26248. escence, renewal and differentiation in pancreatic endocrine progenitors. Development 35. Guo Z, et al. (2012) Proteomics strategy to identify substrates of LNX, a PDZ domain- 139(9):1557–1567. containing E3 ubiquitin ligase. J Proteome Res 11(10):4847–4862. 14. Parsons MJ, et al. (2009) Notch-responsive cells initiate the secondary transition in 36. Duret L, Chureau C, Samain S, Weissenbach J, Avner P (2006) The Xist RNA gene evolved larval zebrafish pancreas. Mech Dev 126(10):898–912. in eutherians by pseudogenization of a protein-coding gene. Science 312(5780): 15. Shih HP, et al. (2012) A Notch-dependent molecular circuitry initiates pancreatic en- 1653–1655. – docrine and ductal cell differentiation. Development 139(14):2488 2499. 37. Flynn M, Saha O, Young P (2011) Molecular evolution of the LNX gene family. BMC 16. Nie J, Li SS, McGlade CJ (2004) A novel PTB-PDZ domain interaction mediates isoform- Evol Biol 11:235. – specific ubiquitylation of mammalian Numb. J Biol Chem 279(20):20807 20815. 38. Guo M, Jan LY, Jan YN (1996) Control of daughter cell fates during asymmetric di- 17. Nie J, et al. (2002) LNX functions as a RING type E3 ubiquitin ligase that targets the vision: Interaction of Numb and Notch. Neuron 17(1):27–41. cell fate determinant Numb for ubiquitin-dependent degradation. EMBO J 21(1-2): 39. Esni F, et al. (2004) Notch inhibits Ptf1 function and acinar cell differentiation in 93–102. developing mouse and zebrafish pancreas. Development 131(17):4213–4224. 18. Ro H, Dawid IB (2009) Organizer restriction through modulation of Bozozok stability 40. Schulte-Merker S, Stainier DY (2014) Out with the old, in with the new: Reassessing by the E3 ubiquitin ligase Lnx-like. Nat Cell Biol 11(9):1121–1127. morpholino knockdowns in light of genome editing technology. Development 19. Ro H, Dawid IB (2010) Lnx-2b restricts gsc expression to the dorsal mesoderm by 141(16):3103–3104. limiting Nodal and Bozozok activity. Biochem Biophys Res Commun 402(4):626–630. 41. Westerfield M (2000) The zebrafish book. A Guide for the Laboratory Use of Zebrafish 20. Ro H, Dawid IB (2011) Modulation of Tcf3 repressor complex composition regulates cdx4 expression in zebrafish. EMBO J 30(14):2894–2907. (Danio rerio) (Univ Oregon Press, Eugene, OR), 4th Ed. 21. Kok FO, et al. (2015) Reverse genetic screening reveals poor correlation between 42. Godinho L, et al. (2005) Targeting of amacrine cell neurites to appropriate synaptic – morpholino-induced and mutant phenotypes in zebrafish. Dev Cell 32(1):97–108. laminae in the developing zebrafish retina. Development 132(22):5069 5079. 22. Cermak T, et al. (2011) Efficient design and assembly of custom TALEN and other TAL 43. Doyle EL, et al. (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: Tools for TAL – effector-based constructs for DNA targeting. Nucleic Acids Res 39(12):e82. effector design and target prediction. Nucleic Acids Res 40(Web Server issue):W117 23. McGill MA, Dho SE, Weinmaster G, McGlade CJ (2009) Numb regulates post-endocytic W122. trafficking and degradation of Notch1. J Biol Chem 284(39):26427–26438. 44. Dahlem TJ, et al. (2012) Simple methods for generating and detecting locus-specific 24. McGill MA, McGlade CJ (2003) Mammalian numb proteins promote Notch1 receptor mutations induced with TALENs in the zebrafish genome. PLoS Genet 8(8):e1002861. ubiquitination and degradation of the Notch1 intracellular domain. J Biol Chem 45. Miller JC, et al. (2007) An improved zinc-finger nuclease architecture for highly spe- 278(25):23196–23203. cific genome editing. Nat Biotechnol 25(7):778–785.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1517033112 Won et al. Downloaded by guest on September 29, 2021