Distinct E-Cadherin-Based Complexes Regulate Cell Behaviour Through Mirna Processing Or Src and P120 Catenin Activity

ARTICLES

Distinct E-cadherin-based complexes regulate cell behaviour through miRNA processing or Src and p120 catenin activity

Antonis Kourtidis1, Siu P. Ngok1,5, Pamela Pulimeno2,5, Ryan W. Feathers1, Lomeli R. Carpio1, Tiﬀany R. Baker1, Jennifer M. Carr1, Irene K. Yan1, Sahra Borges1, Edith A. Perez3, Peter Storz1, John A. Copland1, Tushar Patel1, E. Aubrey Thompson1, Sandra Citi4 and Panos Z. Anastasiadis1,6

E-cadherin and p120 catenin (p120) are essential for epithelial homeostasis, but can also exert pro-tumorigenic activities. Here, we resolve this apparent paradox by identifying two spatially and functionally distinct junctional complexes in non-transformed polarized epithelial cells: one growth suppressing at the apical zonula adherens (ZA), deﬁned by the p120 partner PLEKHA7 and a non-nuclear subset of the core microprocessor components DROSHA and DGCR8, and one growth promoting at basolateral areas of cell–cell contact containing tyrosine-phosphorylated p120 and active Src. Recruitment of DROSHA and DGCR8 to the ZA is PLEKHA7 dependent. The PLEKHA7–microprocessor complex co-precipitates with primary microRNAs (pri-miRNAs) and possesses pri-miRNA processing activity. PLEKHA7 regulates the levels of select miRNAs, in particular processing of miR-30b, to suppress expression of cell transforming markers promoted by the basolateral complex, including SNAI1, MYC and CCND1. Our work identiﬁes a mechanism through which adhesion complexes regulate cellular behaviour and reveals their surprising association with the microprocessor.

p120 catenin (p120) was identified as a tyrosine phosphorylation with this, E-cadherin is still expressed in several types of aggressive substrate of the Src oncogene1 and an essential component of the and metastatic cancer18–20. Therefore, despite their significance cadherin complex2. The interaction with p120 stabilizes E-cadherin in epithelial adhesion and cellular regulation, present knowledge junctional complexes by preventing E-cadherin endocytosis2–5. on the role of E-cadherin and p120 in cancer is conflicting p120 also regulates the activity of Rho-GTPases, and thus the and inconclusive. organization of the actomyosin cytoskeleton6–9. By stabilizing In the present study, we sought to reconcile the apparently E-cadherin, p120 is expected to act as a tumour suppressor, and contradictory observations and clarify the roles of p120 and mouse knockout studies support this notion10. However, p120 also E-cadherin in epithelial cell behaviour. Recently, the p120 binding exhibits tumour-promoting activities, as an essential mediator of partner PLEKHA7 was shown to specifically localize at the apical anchorage-independent growth and cell migration induced by EGFR, zonula adherens (ZA) but not along lateral surfaces of epithelial cells, HER2, Rac1 or Src (refs 11–13). This was partly attributed to the as for p120 or E-cadherin21,22. By using PLEKHA7 as a marker of the expression of diﬀerent cadherin family members14,15; however, p120 apical ZA in mature epithelial cells, we characterize two distinct p120- can induce tumour growth even in the presence of E-cadherin13,16 associated complexes with antagonistic functions and we describe a and is the essential intermediate for E-cadherin-mediated Rac1 microRNA (miRNA)-mediated mechanism through which the ZA activation and subsequent proliferation induction17. Consistent suppresses transformed cell growth.

1Department of Cancer Biology, Mayo Clinic Comprehensive Cancer Center, Mayo Clinic, 4500 San Pablo Road, Jacksonville, Florida 32224, USA. 2Department of Molecular Biology, University of Geneva, 30 quai Ernest-Ansermet, CH-1211, Geneva 4, Switzerland. 3Division of Hematology/Oncology, Mayo Clinic, 4500 San Pablo Road, Jacksonville, Florida 32224, USA. 4Department of Cell Biology and Institute of Genetics and Genomics of Geneva, University of Geneva, 30 quai Ernest-Ansermet, CH-1211, Geneva 4, Switzerland. 5Present addresses: Division of Hematology, Oncology, Stem Cell Transplantation and Cancer Biology, Department of Pediatrics, Stanford School of Medicine, Stanford, California 94305-5457, USA (S.P.N.); Department of Genetics and Complex Diseases, Harvard T. Chan School of Public Health, 665, Huntington Avenue, Boston, Massachusetts 02115, USA (P.P.). 6Correspondence should be addressed to P.Z.A. (e-mail: [email protected])

Received 19 March 2015; accepted 20 July 2015; published online 24 August 2015; DOI: 10.1038/ncb3227

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1145

RESULTS (ACTB), CKAP5, IQGAP1, ANXA2, MYL6, FLNA and ACTN1. In Two distinct p120-associated populations exist at epithelial contrast, the basolateral complex contained proteins involved in cell junctions cycle progression (CCAR1, CDC7, CDK5RAP2), signalling (S100A7, Double immunofluorescence (IF) carried out in intestinal (Caco2) S100A8), endocytosis (VPS33B, VIPAR) and cancer (MCC; Fig. 2c and and renal (MDCK) polarized monolayers confirmed previous results Supplementary Table 1). that PLEKHA7 co-localizes with p120 or E-cadherin only in a narrow Western blot of the isolated lysates confirmed the efficient area apically at the junctions, whereas p120 and E-cadherin are also depletion of PLEKHA7 from the basolateral complex and the found basolaterally (Fig. 1a and Supplementary Fig. 1a–c; refs 21, successful IP of p120 by PLEKHA7 in the apical fraction (Fig. 2d). 22). The ZA markers afadin, circumferential actin and myosin IIA pY228-p120 was absent from the apical complex lysates but abundant (refs 23,24) co-localized precisely with PLEKHA7 (Supplementary in the basolateral ones (Fig. 2d), in agreement with the IF data Fig. 1d), as previously shown22, verifying that PLEKHA7 labels the ZA (Fig. 1b and Supplementary Fig. 1e). Western blot of the separated in these monolayers. fractions also confirmed that E-cadherin, together with α- and Unlike PLEKHA7, tyrosine phosphorylation of p120 at the Src- β-catenin, co-precipitates with the apical complex (Supplementary targeted sites Tyr 96 and Tyr 228 (ref. 25), which has been associated Fig. 2a), as suggested by our IF data (Supplementary Fig. 1b,c) with cancer11,26,27, was abundant basolaterally but not apically and previously published results21. Indeed, PLEKHA7 localization to (Fig. 1b and Supplementary Fig. 1e,f). In contrast, phosphorylation the junctions is E-cadherin and p120 dependent, as indicated by of p120 at the non-Src-targeted Thr 310 site was both apical and loss of junctional PLEKHA7 after E-cadherin or p120 knockdown basolateral (Supplementary Fig. 1g). Total Src was distributed both (Supplementary Fig. 2b,c). Furthermore, only full-length murine basolaterally and apically (Fig. 1c), although active Src, denoted mp120-1A (1A), but not the mp120-4A (4A) isoform that lacks by auto-phosphorylation at Tyr 416, was absent from the ZA but the amino-terminal PLEKHA7-binding domain2,21, was able to present at basolateral areas of cell–cell contact (Fig. 1d), mirroring rescue junctional localization of PLEKHA7 in p120-depleted cells the distribution of tyrosine-phosphorylated p120. Furthermore, (Supplementary Fig. 2c). p130CAS, a Src target associated with increased cell mobility and In full agreement with the proteomics data, TRIM21, IQGAP1, decreased junction stability28, was excluded from the ZA and was ACTN1 and HNRNPA2B1 were detected only in the apical or total abundant basolaterally (Fig. 1e). p120 lysates, EWS in all lysates and CCAR1 solely in the basolateral We also examined the localization of total and active Rho and (Fig. 2d). In addition, IF of polarized cells showed strict apical Rac by co-staining with PLEKHA7. Total RhoA and Rho-GTP junctional co-localization of IQGAP1 with PLEKHA7 (Fig. 2e) and were restricted at the ZA, whereas total Rac1 and Rac-GTP were co-localization of G3BP1 with p120 along both apical and basolateral excluded from the ZA and were detected along basolateral cell– junctions (Fig. 2f), further validating the proteomics results (Fig. 2c). cell contacts (Fig. 1f,g and Supplementary Fig. 1h–j). p190RhoGAP, Together, the data confirm the existence of two distinct junctional a Src substrate that suppresses RhoA activity29, was also excluded complexes in polarized epithelial cells. from the ZA (Fig. 1h), further indicating that Rac1 and RhoA activities are mutually exclusive along areas of cell–cell contact. PLEKHA7 suppresses anchorage-independent growth and Together, the data suggest the presence of an apical p120 complex expression of transformation-related markers at the ZA associated with PLEKHA7, and a basolateral complex To define the functional role of the apical complex, we carried lacking PLEKHA7 and encompassing markers associated with a more out short hairpin RNA (shRNA)-mediated knockdown of PLEKHA7 aggressive cellular phenotype. (Supplementary Fig. 3a). Impedance measurements during junction assembly of PLEKHA7-depleted cells showed both a delay in resistance Proteomics identify two distinct junctional complexes in development and an overall lower transepithelial resistance of the polarized epithelial cells mature monolayer (Fig. 3a). PLEKHA7 knockdown also resulted To obtain further evidence for the existence of two distinct in fragmented circumferential actin (Fig. 3b) and a more flattened junctional complexes, we biochemically separated them on the basis cellular phenotype (Supplementary Fig. 3b). These results show that of the strictly ZA-specific PLEKHA7 localization and the p120 depletion of PLEKHA7 compromises the integrity of the apical ZA, as localization throughout cell–cell contacts in polarized cells (Fig. 1a and reported earlier21. Supplementary Fig. 1a–c; ref. 22). Fully polarized Caco2 monolayers We then examined the effects of disrupting the ZA on the were subjected to intracellular chemical cross linking to maintain the ability of Caco2 cells to form colonies on soft agar, an established interactions and then to either direct p120 immunoprecipitation (IP) assay for anchorage-independent growth. PLEKHA7-depleted to isolate total p120, or a two-step IP,initially with PLEKHA7 to isolate cells showed a threefold increase in colony formation (Fig. 3c the apical complex, followed by a sequential p120 IP to isolate the and Supplementary Fig. 3c). Furthermore, PLEKHA7 knockdown remaining p120 complexes (Fig. 2a). Western blot and silver staining of increased p120 phosphorylation at Tyr 96 and Tyr 228, Src these IPs indicated an efficient separation of the immunoprecipitated phosphorylation at Tyr 416, and p130CAS phosphorylation at proteins into two fractions (Fig. 2b). Mass spectrometry analysis Tyr 165 (Fig. 3d,e and Supplementary Fig. 3d). To account for the revealed 114 putative interactions, of which 47 were uniquely morphological changes and induction of growth on PLEKHA7 associated with the apical fraction, 35 with the basolateral and 32 were depletion, we also examined the levels of transformation-related common (Fig. 2c and Supplementary Table 1). The apical complex and mesenchymal markers15,30,31. PLEKHA7 knockdown resulted was enriched in structural and cytoskeletal proteins, such as actin in increased expression of SNAI1, cadherin 11 (Cad11), cyclin

1146 NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015

ab PLEKHA7 p120 Merged PLEKHA7 p120: Tyr228 Merged

z z Apical

x x

y y Basal Basal

x x cd PLEKHA7 Src Merged PLEKHA7 Src: Tyr 416 Merged

z z Apical Apical

x x

y y Basal Basal Apical

x x ef PLEKHA7 p130CAS Merged PLEKHA7 Rho-GTP Merged

z Apical

y y Basal Basal Apical

x x gh PLEKHA7 Rac-GTP Merged PLEKHA7 p190 Merged z Apical Apical x

y y Basal Basal

x x

Figure 1 Polarized epithelial cells show distinct p120-associated populations co-stained with PLEKHA7. In all cases, stained cells were imaged by at the junctions. Caco2 cells were grown for 21 days to polarize and confocal microscopy and image stacks were acquired, covering the entire subjected to IF for PLEKHA7 and (a) p120, (b) phosphorylated p120 polarized monolayer between the basal and the apical level. Representative Tyr 228, (c) Src, (d) phosphorylated Src Tyr 416; (e) p130CAS and x–y image stacks and merged composite x–z images are shown. Enlarged (h) p190RhoGAP. Also, Caco2 cells were transfected with (f) a green parts of merged images in f and g indicate areas of cell–cell contact. Scale fluorescent protein (GFP)–rGBD (rhotekin RhoA-binding domain) construct bars for x–y images, 20 µm; for x–z images, 5 µm; for enlarged parts of f to detect active Rho (Rho-GTP) or (g) a yellow fluorescent protein (YFP)– and g, 3 µm. PLEKHA7 background staining in f and g is an artefact of PBD (PAK-binding domain) construct to detect active Rac (Rac-GTP), and paraformaldehyde fixation.

D1 (CCND1), MYC, FAK and VIM (Fig. 3f and Supplementary (Supplementary Fig. 3f,g), suggesting that microtubules are not Fig. 3d), whereas re-expression of PLEKHA7 reversed these effects involved in the observed effects. Next, we tested whether the effects of and suppressed p120 phosphorylation (Fig. 3g). Indeed, ectopic PLEKHA7 knockdown are due to its loss from the ZA, by removing overexpression of SNAI1 in Caco2 cells at modest levels was adequate PLEKHA7 from the junctions but retaining its total levels in the to induce a twofold increase in soft agar colony formation (Fig. 3h cells. To do this, we transfected Caco2 cells with a p120 mutant and Supplementary Fig. 3e). that cannot bind E-cadherin and is cytoplasmic, because it lacks Knockdown of NEZHA, the intermediate link between PLEKHA7 the first armadillo repeat (mp120-1ARM1; ref. 2), but can bind and the microtubules21, retained PLEKHA7 at the ZA but failed to PLEKHA7, because it contains the N-terminal PLEKHA7-binding phenocopy the effects of PLEKHA7 depletion on marker expression domain21. Expression of this construct sequestered PLEKHA7 to the

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1147

a Then b Silver stain PLEKHA7: p120: Mr (K) Grow Caco2s Crosslink apical basolateral Lyse, 199 complex complex for 21 days complexes IP with: 116 to polarize p120 (total p120 to control) 79

52 AHNAK SHROOM3 MYO1D MCC c PPL OSTM1 IQGAP1 VAV2 PLUNC ACTB ACTN1 ANXA2 DSG1 TMEM128 ANXA4 37 FLG2 ANXA1 SNRPB CKAP5 ODZ2 TTN DPP4 FAT2 CLTC MYL6 ANXA5 LRP1 29 CES1 ODZ3 CTNNB1 CFTR FZD2 DSP SSR1 SPASTIN CTNNA1 JUP HPCAL1 ARPC5 PITPNB FLNA TRIM10 CCAR1 17 DYNC1H1 CDH1 VIPAR HSP90A1 TRIM21 ETAA1 PSPC1 S100A8 HSPA8 IgG EIF3D G3BP1 VPS33B VPS35 SCYL2 AHCY S100A7 HSPA1A NOS1 Apical Basolateral PLEKHA7 G3BP2 CDC7 Total p120 HSPA9 EIF3A SLC25A1 GLG1 PPP1CA WDR67 Basolateral p120 HNRNPA2B1 SFPQCAPRIN1 MLEC DCP1B KL KPRP IPs NCOA3 APOA4 SLC25A5 CLYBL DDX1 PGLS HNRNPH3 EWS FUS MSH5 RELN NDUFV1 HNRNPA3 YWHAE SERPINB12 DDX4 CDK5RAP2 HNRNPA1L2 SLC25A3 DNAH7 CYB5R3 WDR82 DDX17 NONO THOC4 RALY SYNE1 FEM1A LKAP ATP5C1 ALDH18A1DLGAP1 GAPDH C14orf166 SELT d WBs

PLEKHA7 e PLEKHA7 IQGAP1 Merged

p120 Apical

p-p120: pY228

y Basal TRIM21

IQGAP1 x f p120 G3BP1 Merged ACTN1

HNRNPA2B1 Apical

EWS

CCAR1 y Basal

IgG Input Caco2

PLEKHA7Total p120 x

Basolateral p120 IPs

Figure 2 Biochemical separation of two distinct junctional complexes protein–protein interactions. See Supplementary Table 1 for the list of by proteomics. (a) Outline of the methodology to isolate the apical and proteins and mass spectrometry peptide counts. (d) Western blot (WB) of basolateral complexes from polarized Caco2 cells. (b) SDS–polyacrylamide the lysates from the separated fractions for PLEKHA7, p120 and markers gel electrophoresis (SDS–PAGE) and silver stain of the isolated junctional identified in the apical (TRIM21, IQGAP1, ACTN1, HNRNPA2B1), the fractions; green arrowheads indicate examples of apical-specific bands, basolateral (CCAR1) and both fractions (EWS). The isolated fractions were whereas red arrowheads indicate basolateral-specific bands. (c) Schematic also blotted for phosphorylated p120 Tyr 228 (p-p120: pY228), another representation of the proteins identified after mass spectrometry of the basolateral marker (Fig. 1b). See Supplementary Fig. 8 for unprocessed blot isolated junctional fractions, identified in the apical (green outlines), the scans. (e,f) Polarized Caco2 cells were stained and imaged as in Fig. 1 for basolateral (red) or both fractions (yellow). Grey connections indicate known PLEKHA7 and IQGAP1 (e) and for p120 and G3BP1 (f). All scale bars: 20 µm. cytoplasm without altering its total levels and phenocopied the effects the PLEKHA7-associated apical ZA complex that results in induction of PLEKHA7 depletion on the levels of the same markers examined of growth-related signalling. Consistent with this, examination of above (Supplementary Fig. 3h,i). Therefore, it is the disruption of the expression and localization of PLEKHA7, p120 and E-cadherin

1148 NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015

a b PLEKHA7 Actin Apical actin Junctional integrity 14 ring intensity ∗ ∗ ∗ ∗ NT 120 12 ∗ 10 100 ∗ 8 80 ∗ PLEKHA7 shRNA NT 6 60 4 40

(normalized units) 2 20 Junctional resistance Percentage change 0 0 0 12243648607284 NT h PLEKHA7 shRNA PLEKHA7shRNA c de 4 PLEKHA7 ∗ PLEKHA7 3 ∗ p-p120: Y228 p-Src: Y416

p-p120: Y96 Src 2 p120 p-p130CAS: Y165 Fold change 1 Actin p130CAS NT No. 8 No. 10 0 PLEKHA7 shRNA Actin NT No. 8 No. 10 NTNo. 8 No. 10 PLEKHA7 shRNA PLEKHA7 shRNA fg PLEKHA7 PLEKHA7 h 2.5 ∗ SNAI1 p-p120: pY228 2.0 CCND1 p-p120: pY96 1.5 MYC p120 1.0 Cad11 Fold change 0.5 VIM SNAI1 0 FAK CCND1 SNAI1 1 2 MYC Actin α-tubulin NT No. 8 No. 10 Cad11 PLEKHA7 shRNA Actin adGFP adSNAI1 PLEKHA7 shRNA – + + LZRS-PLEKHA7 –+–

Figure 3 PLEKHA7 suppresses anchorage-independent growth and no. 8, no. 10) were quantified for colony formation on soft agar (mean ± s.d. expression of transformation-related markers. (a) Caco2 non-target control from n=3 independent experiments; ∗P <0.003, Student’s two-tailed t-test; shRNA (NT) and PLEKHA7 shRNA knockdown cells were measured for see Supplementary Fig. 3c for representative scan). (d–f) Caco2 control cell impedance using the ECIS apparatus to assess junctional resistance (NT) and PLEKHA7 knockdown cells using two shRNAs (no. 8, no. 10) (mean ± s.d. from n = 3 independent experiments calculated for 96 h and analysed by western blot for the indicated markers. Phosphorylation sites are ∼7,000 continuous time points from 40,000 cells per condition, NT or denoted by p-. Actin is the loading control. (g) Western blot of PLEKHA7 PLEKHA7 shRNA, per experiment; ∗P <0.03 is shown for every 12 h interval, knockdown Caco2 cells (PLEKHA7 shRNA) after ectopic re-expression of Student’s two-tailed t-test). (b) Caco2 control (NT) and PLEKHA7 knockdown PLEKHA7 (LZRS-PLEKHA7) for the markers shown. Actin is the loading (PLEKHA7 shRNA) cells co-stained for PLEKHA7 and actin (phalloidin) and control. (h) Western blot and soft agar assay quantification of Caco2 cells quantified (right panel) for apical ring phalloidin intensity (mean ± s.d. from infected with either vector control (adGFP) or a SNAI1-expressing construct n = 3 independent experiments, assessing 40 cells in total per condition, (adSNAI1) (mean ± s.d. from n = 3 independent experiments; ∗P = 0.006 NT or PLEKHA7 shRNA, ∗P = 0.01, Student’s two-tailed t-test; PLEKHA7 Student’s two-tailed t-test; see Supplementary Fig. 3e for representative background staining is an artefact of paraformaldehyde fixation for actin). scan). α-tubulin is the loading control. Source data for a–c,h are provided Scale bar for full images, 20 µm; for enlarged parts, 10 µm. (c) Caco2 control in Supplementary Table 2. See Supplementary Fig. 8 for unprocessed blot (NT) and PLEKHA7 knockdown cells using two shRNAs (PLEKHA7 shRNA scans of d–g. in normal and cancer samples of breast and kidney revealed that percentage in the same samples (Supplementary Fig. 4a,b). These PLEKHA7 is either mislocalized or lost in the tumour tissues, although data indicate the selective disruption of the ZA in tumour tissues, in p120 and E-cadherin are still expressed and junctional to a high agreement with our in vitro findings.

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1149

The basolateral complex promotes cell growth and expression the most abundant of the affected miRNAs, namely miR-30b, which of related markers was among those decreased (Fig. 5a). Quantitative PCRs with reverse Next, we examined whether the events induced by disruption of the transcription (qRT–PCRs) confirmed the NanoString results (Fig. 5b), apical complex are due to the activity of the basolateral complex. whereas PLEKHA7 re-expression rescued the altered miRNA levels In agreement, both the increased growth and the elevated levels (Supplementary Fig. 5e,f). of transformation-related markers in PLEKHA7-depleted cells were We then used anti-miRNAs to target miR-24, miR-30a, miR-30b abolished when p120 was simultaneously knocked down (Fig. 4a,b and let-7g in wild-type PLEKHA7-containing cells, to mimic the and Supplementary Fig. 4c). PLEKHA7 knockdown did not affect effect of PLEKHA7 knockdown on their expression. Indeed, the anti- E-cadherin levels; however, p120 depletion reduced E-cadherin levels, miRNA transfections resulted in increased levels of SNAI1, MYC and as expected2,5 (Supplementary Fig. 4d). Interestingly, simultaneous CCND1 (Fig. 5c), similar to the effect of PLEKHA7 depletion (Fig. 3f). knockdown of E-cadherin decreased the levels of SNAI1, CCND1, The miR-30 and let-7 miRNA families are validated suppressors of MYC and phosphorylation of p130CAS in PLEKHA7-depleted cells SNAI1 (refs 42–44), whereas miR-24 and the let-7 family are also (Fig. 4c), indicating that the effects observed in the absence of verified suppressors of MYC (refs 45–47). Re-expression of miR-30b in PLEKHA7 depend on E-cadherin-based junctions. Furthermore, PLEKHA7-depleted cells using a miR-30b mimic construct reversed suppression of Src activity using the PP2 inhibitor abolished p120 the increase of SNAI1, MYC and CCND1 (Fig. 5d), confirming that and p130CAS phosphorylation and also reversed the increased miR-30b is a mediator of PLEKHA7’s growth-suppressing signalling. expression of SNAI1, CCND1, MYC and cadherin 11 after PLEKHA7 Interestingly, anti-miR-30a and anti-miR-30b also increased Src and knockdown (Fig. 4d and Supplementary Fig. 4e). Re-expression of p120 phosphorylation, whereas the miR-30b mimic reversed their wild-type murine p120 (mp120-1A; ref. 25) in p120 knockdown increase in PLEKHA7-depleted cells (Supplementary Fig. 5g,h). In cells partially restored p120 phosphorylation as well as SNAI1 and addition, ectopic SNAI1 overexpression (Fig. 3h) induced p120 cadherin 11 levels, whereas expression of a non-phosphorylatable phosphorylation at Tyr 228 (Supplementary Fig. 5i), suggesting that p120 construct (mp120-8F; ref. 25) at similar levels failed to reproduce the effect of miR-30b on p120 phosphorylation is mediated by SNAI1. these effects (Fig. 4e). In summary the data reveal that a specific subset of miRNAs, and in Depletion of cadherin 11, which was previously implicated in particular miR-30b, are regulated by PLEKHA7 and mediate its effects p120-mediated growth and migration signalling14,15, also reversed the on proteins involved in transformed cell growth. increased levels of SNAI1, CCND1 and MYC on PLEKHA7 depletion (Fig. 4f). As E-cadherin levels are unaltered in the PLEKHA7-depleted The ZA associates with the microprocessor complex cells (Fig. 4c and Supplementary Fig. 4d), the data do not suggest a Although PLEKHA7 knockdown decreased levels of mature miR-30b cadherin switch, but rather that the effects of PLEKHA7 depletion are (Fig. 5a,b), it did not affect expression of the primary miR-30b mediated by the cadherin-based basolateral junctions. Indeed, p120 (pri-miR-30b) transcript (Fig. 6a); however, it resulted in decreased tyrosine phosphorylation occurs only at the junctions (Fig. 1b and levels of the next precursor, pre-miR-30b (Fig. 6a and Supplementary Supplementary Figs 1e,f and 4e; refs 32,33), and cadherin 11 exhibits Fig. 6a). This suggested that PLEKHA7 affects pri-miR-30b processing strong junctional staining after PLEKHA7 knockdown (Fig. 4g). Col- to pre-miR-30b, a step in miRNA biogenesis catalysed by the lectively, the results indicate that the basolateral complex acts through microprocessor complex and its two essential components DROSHA E-cadherin, cadherin 11, Src and p120 to promote transformation- and DGCR8 (refs 48–51). We tested whether PLEKHA7 depletion related signalling, after disruption of the apical complex. affects either the total levels of DROSHA or DGCR8, or their localization, because the microprocessor is thought to function in PLEKHA7 suppresses expression of SNAI1, MYC and CCND1 the nucleus. Whereas both the overall levels of the two proteins and through miRNAs their subcellular distribution remained unchanged, cell fractionation PLEKHA7 knockdown did not significantly alter the messenger RNA assays revealed the existence of a non-nuclear fraction of both (mRNA) levels of the examined markers (Supplementary Fig. 5a), DROSHA and DGCR8 (Fig. 6b). IF and confocal microscopy did not prolong protein stability after cycloheximide treatment confirmed their presence outside the nucleus, particularly at areas (Supplementary Fig. 5b) and did not alter the rate of stabilization after of cell–cell contact (Fig. 6c), and revealed their co-localization with MG-132 treatment (Supplementary Fig. 5c). PLEKHA7 knockdown PLEKHA7 and p120 strictly at the apical ZA of polarized epithelial also did not affect the phosphorylation of GSK3B, a dominant cells (Fig. 6d–g and Supplementary Fig. 6b–e). The use of alternative regulator of SNAI1 stability34,35 (Supplementary Fig. 5d). These antibodies for DROSHA and DGCR8 (Supplementary Fig. 6b,c) results suggest that PLEKHA7 is not affecting the examined markers as well as elimination of their staining after knockdown by short transcriptionally or post-translationally, but imply that it may suppress interfering RNAs (siRNAs) (Supplementary Fig. 6f,g) confirmed the mRNA expression. A core such mechanism is RNA interference specificity of their junctional localization. In agreement, DROSHA (RNAi), which involves the miRNA-mediated silencing of mRNA and DGCR8 co-precipitated with PLEKHA7 (Fig. 6h,i), p120 (Fig. 6i expression36–39 and is commonly deregulated in cancer40,41. To and Supplementary Fig. 6h) and E-cadherin (Supplementary Fig. 6h). examine this, we used the NanoString platform and found significant Notably, the interaction of PLEKHA7 with the microprocessor is RNA changes in the levels of 29 miRNAs out of 735 examined in PLEKHA7- independent (Fig. 6j), excluding the possibility that these interactions depleted cells: 15 of them were decreased and 14 miRNAs increased are due to non-specific isolation of large ribonucleoprotein granules (Fig. 5a). The strongest decrease was observed for miR-24, miR-30a from the cells. Proximity ligation assay confirmed that the interaction and let-7g, and the strongest increase for miR-19a. We also focused on of DROSHA and PLEKHA7 occurs only at the junctions (Fig. 6k).

1150 NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015

© 2015 Macmillan Publishers Limited. All rights reserved ARTICLES a bcd PLEKHA7 PLEKHA7 PLEKHA7 ∗ 2.0 p-p120: Y228 p120 Ecad p120 1.5 p-p130CAS: Y165 p-p130CAS: Y165 p-p130CAS: Y165 1.0 p130CAS p130CAS p130CAS SNAI1 Fold change SNAI1 0.5 SNAI1 CCND1 CCND1 CCND1 1 2 3 Cad11 MYC PLEKHA7 shRNA –++ MYC MYC p120 shRNA –+– Cad11 Actin Actin Actin PLEKHA7 shRNA –++ PLEKHA7 shRNA –++ PLEKHA7 shRNA ––+ + p120 shRNA –+– Ecad shRNA –+– Src inh: PP2 – + – +

efg p120 PLEKHA7 PLEKHA7 Cad11 Cad11 NT p-p120: Y228

shRNA SNAI1 SNAI1 NT p120 CCND1 Cad11 MYC

Actin Actin

PLEKHA7 shRNA ––++ PLEKHA7 shRNA Cad11 shRNA –++ – Vector mp120-1Amp120-8F

Figure 4 The basolateral junctional complex promotes anchorage- is the loading control. (d) Western blot of Caco2 control or PLEKHA7 independent growth and expression of transformation-related markers. knockdown (PLEKHA7 shRNA) cells after treatment with vehicle control (a) Caco2 control, PLEKHA7 knockdown (PLEKHA7 shRNA) and PLEKHA7– (dimethylsulphoxide, DMSO) or 10 µM Src inhibitor PP2; actin is the p120 double knockdown (PLEKHA7 shRNA, p120 shRNA) cells were loading control (see also Supplementary Fig. 4e). (e) Western blot of p120 grown on soft agar and quantiﬁed for colony formation (mean ± s.d. knockdown Caco2 cells (p120 shRNA) after ectopic expression of either from n = 3 independent experiments; ∗P = 0.0008, Student’s two-tailed vector control (vector), murine full-length (isoform 1A) wild-type p120 t-test; see Supplementary Fig. 4c for representative scan). Source (mp120-1A) or murine full-length non-phosphorylatable p120 (mp120- data are provided in Supplementary Table 2. (b) Control, PLEKHA7 8F) for the markers shown. Actin is the loading control. (f) Western blot knockdown (PLEKHA7 shRNA) and PLEKHA7–p120 double knockdown of single and double PLEKHA7 (PLEKHA7 shRNA) and cadherin 11 (PLEKHA7 shRNA, p120 shRNA) Caco2 cells were analysed by western blot (Cad11 shRNA) knockdown Caco2 cells for the markers shown. Actin for the markers shown. Actin is the loading control (see also Supplementary is the loading control. (g) IF of control (NT) or PLEKHA7 knockdown Fig. 4d). (c) Control, PLEKHA7 knockdown (PLEKHA7 shRNA) and (PLEKHA7 shRNA) cells for PLEKHA7 and cadherin 11 (Cad11). Scale PLEKHA7/E-cadherin (PLEKHA7 shRNA, Ecad shRNA) double knockdown bar: 20 µm. See Supplementary Fig. 8 for unprocessed blot scans Caco2 cells were analysed by western blot for the markers shown. Actin of b–f.

The junctional localization of DROSHA and DGCR8 was disrupted recovers rapidly after re-addition of calcium, and is not affected in PLEKHA7-depleted cells, indicating that it is PLEKHA7 dependent by dissolution of microtubules by nocodazole (Fig. 7f–i). Similarly, (Fig. 7a,b). Removal of PLEKHA7 from the junctions by the neither prolonged nocodazole treatment (Supplementary Fig. 7f), nor mp120-1ARM1 mutant also resulted in compromised junctional NEZHA knockdown (Supplementary Fig. 7g,h) affected the junctional localization of DROSHA and DGCR8 (Supplementary Fig. 7a–c). localization of PLEKHA7, DROSHA or DGCR8. Although both Furthermore, depletion of p120, which is required for PLEKHA7 miR-30b (Fig. 5d) and p120 or cadherin 11 knockdown (Fig. 4b,f) recruitment to the junctions (Supplementary Fig. 2c), also negatively rescue the levels of pro-tumorigenic markers in PLEKHA7-depleted affected DROSHA junctional localization (Supplementary Fig. 7d) cells, simultaneous knockdown of either p120 or cadherin 11 with and decreased the levels of the examined miRNAs (Supplementary PLEKHA7 did not reverse either the decreased miRNA levels Fig. 7e), mimicking the effects of PLEKHA7 depletion. Conversely, (Supplementary Fig. 7i) or the compromised junctional localization strengthening of the junctions by Src inhibition33 increased junctional of DROSHA and DGCR8 (Supplementary Fig. 7j–m), indicating that localization of PLEKHA7, DROSHA and DGCR8 (Fig. 7c–e). As these events are PLEKHA7 specific and that p120 and cadherin 11 PLEKHA7 tethers the ZA to the microtubules21, we examined induce cell transforming markers through a separate pathway. Taken whether the localization of DROSHA and DGCR8 at the ZA together, the data reveal the association of the microprocessor complex is microtubule dependent. Calcium switch assays showed that with the apical ZA in non-transformed epithelial cells, in a PLEKHA7- the junctional localization of PLEKHA7, DROSHA and DGCR8 dependent manner.

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1151

a 3 NanoString: PLEKHA7 shRNA versus NT

1 Relative abundance < 0.05) P 0 344 196 554 146 108 193 35 171 161 2331 32 599 852 291 121 31 61 39 46 24 36 94 21 34 38 16 29 110 272 –1 Relative abundance Fold change ( –2

–3

302b R-223 R-619 hsa-let-7g hsa-let-7i miR-302a hsa-miR-24 hsa-miR-30a hsa-miR-183 hsa-miR-30d hsa-miR-30bhsa-miR-30ehsa-miR-15bhsa-miR-103hsa-miR-221hsa-miR-203 hsa-mi hsa-mi hsa-miR-934 hsa-miR-19a hsa-miR-450ahsa-miR-148bhsa-miR-301a hsa-miR-130b hsa-miR-1246 hsa-miR-hsa- hsa-miR-302d hsa-miR-296-5p hsa-miR-423-3p hsa-miR-1274b hsa-miR-331-3p hsa-miR-450b-5p

b 2.2 d NT ∗ NT PLEKHA7 shRNA 2.0 PLEKHA7 shRNA no. 8 1.8 PLEKHA7 shRNA no. 10 PLEKHA7 c 1.6 ∗ 1.4 SNAI1 SNAI1 1.2 1.0 MYC MYC ∗ ∗ Fold change ∗ ∗ 0.8 ∗ ∗ 0.6 CCND1 CCND1 ∗ 0.4 ∗

0.2 Actin Actin 0

let-7g miR-24 Control Control miR-30a miR-30b miR-19a Control a-let-7g miR-30b miR-30b a-miR-24a-miR-30aa-miR-30b

Figure 5 PLEKHA7 suppresses protein expression through miRNAs. (a) Caco2 knockdown (PLEKHA7 shRNA no. 8, no. 10) cells for the indicated miRNAs control (NT) and PLEKHA7 knockdown (PLEKHA7 shRNA) cells analysed (mean ± s.d. from n = 3 independent experiments; ∗P < 0.01, Student’s for miRNA expression using NanoString. Results shown are statistically two-tailed t-test). Source data are provided in Supplementary Table 2. signiﬁcant changes (mean ± s.d. from n = 3 independent experiments; (c) Western blot of Caco2 cells transfected with the indicated anti-miRNAs P < 0.05, Student’s two-tailed t-test) shown as average fold change of for the markers shown; actin is the loading control. (d) Caco2 control (NT) PLEKHA7 shRNA versus control cells. Numbers on each bar are NanoString and PLEKHA7 knockdown (PLEKHA7 shRNA) cells were transfected with counts indicating relative abundance of the respected miRNAs (see also either control or miR-30b mimic and blotted for the markers shown; actin Methods). Source data are deposited at Gene Expression Omnibus, accession is the loading control. See Supplementary Fig. 8 for unprocessed blot scans number GSE61593.(b) qRT–PCR analysis of Caco2 control (NT) or PLEKHA7 of b–d.

PLEKHA7 regulates processing of pri-miR-30b at the junctions In summary, the data support a model whereby the apical ZA Subcellular fractionation revealed the existence of at least three complex recruits the microprocessor through PLEKHA7 to suppress pri-miRNAs, pri-miR-30b, pri-let-7g and pri-miR-19a, outside the growth-related signalling promoted by the basolateral junctional nucleus (Fig. 8a), and RNA-IPs indicated that PLEKHA7 is enriched complex, hence maintaining the normal epithelial architecture and in these pri-miRNAs (Fig. 8b). In vitro processing assays using behaviour (Fig. 8g). pri-miR-30b as a template showed that the PLEKHA7-associated complex possesses pri-miRNA processing activity (Fig. 8c). PLEKHA7 DISCUSSION depletion decreased in vitro processing of pri-miR-30b by about 30% Our work shows that the dual p120 and E-cadherin behaviour (Fig. 8d,e), similar to the decrease observed in endogenous pri-miR- in epithelial cell growth can be explained by the existence of 30b processing after PLEKHA7 knockdown (Fig. 6a). Finally, in situ two distinct p120 complexes with opposing functions: an apical hybridization (ISH) confirmed the localization of pri-miR-30b at complex at the ZA that suppresses growth-related signalling the junctions (Fig. 8f). Collectively, our results demonstrate that the through PLEKHA7-mediated regulation of select miRNAs and ZA-localized microprocessor complex is active and that PLEKHA7 a basolateral complex that promotes anchorage-independent regulates processing at least of pri-miR-30b at the ZA. growth and increased expression of markers such as SNAI1, MYC

1152 NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015

abNon- c NT Total nuclear Nuclear DROSHA DGCR8 PLEKHA7 shRNA no. 8 1.2 DROSHA 1.0 ∗ DGCR8 0.8 0.6 Lamin A/C DAPI Merged

0.4 Histone H3 Non-polarized Fold change 0.2 0 GAPDH Actin NT NT h WBs shRNA shRNA pri-miR-30bpre-miR-30b NT PLEKHA7 shRNA p120 PLEKHA7PLEKHA7 DROSHA PLEKHA7 d DGCR8

IgG Input p120 DAPI PLEKHA7 DROSHA Merged PLEKHA7 IPs z i WBs

Apical x PLEKHA7

p120

DROSHA y

Basal DGCR8

IgG Input x DroshaDGCR8 e IPs j WBs DAPI PLEKHA7 DGCR8 Merged PLEKHA7 z DROSHA DGCR8 Apical x

IgG Input

PLEKHA7PLEKHA7 + RNAse y IPs Basal

k PLEKHA7+ PLEKHA7+ x DROSHA p120 Neg. control

fgDROSHA DGCR8

p120 p120 z z Proximityligation

x x

–

–DAPI

Phase

proximity ligation

Figure 6 PLEKHA7 associates with DROSHA and DGCR8 at the ZA. Abcam; DGCR8, Abcam; see also Supplementary Fig. 6b–e for a second (a) qRT–PCR analysis of pri-miR-30b and pre-miR-30b in Caco2 control (NT) set of antibodies used and Supplementary Table 3 for antibody details). or PLEKHA7 knockdown (PLEKHA7 shRNA) cells (mean ± s.d. from n = 3 DAPI is the nuclear stain. (f,g) Composite x–z images of polarized Caco2 independent experiments; ∗P = 0.02, Student’s two-tailed t-test). Source cells co-stained by IF for p120 and DROSHA or DGCR8 (see Supplementary data are provided in Supplementary Table 2. (b) Western blot of either Fig. 6b,c, respectively, for x–y set of image stacks). (h,i) Western blots of total cell lysates or of nuclear and non-nuclear lysates after subcellular PLEKHA7, p120, DROSHA and DGCR8 IPs for the markers shown. IgG is fractionation of Caco2 NT or PLEKHA7 shRNA cells for the indicated the negative IP control. (j) Western blot of PLEKHA7 IPs with and without markers. Lamin A/C and histone H3 are the nuclear and GAPDH the RNAse treatment; IgG is the negative control. (k) Proximity ligation assay cytoplasmic markers; actin is the total loading control. (c) IF of non- using PLEKHA7 and DROSHA antibodies, PLEKHA7 and p120 antibodies polarized Caco2 cells, co-stained for DROSHA and DGCR8; 4,6-diamidino- (assay positive control) or a p120 antibody only (assay negative control); the 2-phenylindole (DAPI) is the nuclear stain. (d,e) IF of polarized Caco2 composite phase contrast–DAPI–proximity ligation images are also shown. cells co-stained for PLEKHA7 and DROSHA or DGCR8. Enlarged details in Scale bars for x–y images, 20 µm; for x–z images, 5 µm; for enlarged parts boxes are shown above the apical ﬁelds; a composite x–z merged image is of d and e, 3 µm. See Supplementary Fig. 8 for unprocessed blot scans shown at the side of the x–y image stack (antibodies used here: DROSHA, of b,h–j.

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1153

abPLEKHA7 DROSHA p120 DGCR8

NT NT

PLEKHA7 shRNA PLEKHA7 shRNA

c p120 PLEKHA7 dep120 DROSHA p120 DGCR8

Control Control Control

PP2 PP2 PP2

fgα-tubulin PLEKHA7 Ca2+: 0 min Ca2+: 30 min Ca2+: 60 min Ca2+: 0 min Ca2+: 30 min Ca2+: 60 min

Control Control

Nocodazole Nocodazole hiDROSHA DGCR8 Ca2+: 0 min Ca2+: 30 min Ca2+: 60 min Ca2+: 0 min Ca2+: 30 min Ca2+: 60 min

Control Control

Nocodazole Nocodazole

Figure 7 Localization of DROSHA and DGCR8 at the ZA is PLEKHA7 switch assay of Caco2 cells for the indicated times after Ca2+ re-addition dependent. (a,b) IF of control (NT) or PLEKHA7 knockdown (Ca2+: 0 min indicates Ca2+ depleted cells immediately before Ca2+ re- (PLEKHA7 shRNA) Caco2 cells for DROSHA and DGCR8, co-stained for addition), treated with vehicle (control) or with 10 µM nocodazole, and PLEKHA7 or p120. PLEKHA7 background intracellular staining in a is an stained by IF for α-tubulin, PLEKHA7, DROSHA and DGCR8. Enlarged artefact of paraformaldehyde fixation. (c–e) Caco2 cells treated either with image details are shown in yellow boxes on the right-hand side of the image vehicle control (DMSO) or the Src inhibitor PP2 (10 µM) were stained by IF stacks in a, b, d and e. Scale bars for full images, 20 µm; for enlarged for PLEKHA7, DROSHA and DGCR8 and co-stained with p120. (f–i) Calcium parts, 8 µm. and CCND1 through activated Src and tyrosine-phosphorylated confluent epithelial monolayers. Importantly, the interaction of p120 (Fig. 8g). PLEKHA7 with DROSHA (Fig. 6k) or pri-miR-30b (Fig. 8b,f) DROSHA and DGCR8 are thought to regulate miRNA processing occurs exclusively at the ZA, whereas depletion of PLEKHA7 in the nucleus48–50. However, these proteins have not been studied dissociates DROSHA and DGCR8 from the ZA and reduces miR- in the context of non-transformed, polarized mammalian epithelial 30b processing, without affecting nuclear DROSHA and DGCR8 cells. Our data reveal that, in these cells, a functional subset of the levels (Figs 6b, 7a,b and 8d,e). Therefore, the present study does microprocessor is recruited by PLEKHA7 to the ZA (Figs 6d–k and not dispute the general model of miRNA biogenesis, but uncovers 7a,b). PLEKHA7 does not globally regulate miRNA expression in a mechanism whereby PLEKHA7 recruits a subpopulation of the the cells examined, but affects only a specific subset of miRNAs microprocessor to the ZA and regulates processing of select miRNAs (29 out of 735 examined; Fig. 5a) in a confluence-independent to suppress the expression of markers involved in transformed manner, because all experiments herein were carried out in fully cell growth.

1154 NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015

a b Nuclear pri-miR-30b 40 pri-let-7g DROSHA 38 Non-nuclear 36 ) 1,000 pri-miR-19a DGCR8 34 10 32

values 30 Lamin A/C t 100

C 28 26 24 Histone H3 22 10 qPCR: 20 18 GAPDH 16 Fold enrichment (log 1 0

ACTB IgG Nuclear pri-let-7g DGCR8 pri-miR-30b pri-miR-19a PLEKHA7 Non-nuclear

c Low exposure d NT PLEKHA7 shRNA

IPs: IPs: IgG DGCR8DGCR8 e Relative IgG DGCR8IgG DGCR8 nt: nt: PLEKHA7 PLEKHA7 pre-miR-30b 1,000 1.2 1,000 500 500 300 pri- 1.0 300 pri- 150 miR-30b 0.8 ∗ 150 miR-30b 0.6 80 80 pre- 0.4

pre- Fold change 50 miR-30b 0.2 50 miR-30b 0

IgG 21 21 DGCR8DGCR8 NT PLEKHA7 shRNA

f pri-miR-30b g Ecad DAPI ! Apical

ZA PLEKHA7 ZA DROSHA–DGCR8 pri-miR-30b p120–Ecad p120–Ecad miR-30b DapB PPIB p120–Cad11 Ecad Ecad DAPI DAPI p-p120 SNAI1 AIG

Lateral MYC CCND1 p-Src

Negative cont. Positive cont. p130CAS p190RhoGAP

Basal

Figure 8 PLEKHA7 regulates pri-miR-30b processing at the junctions. PLEKHA7 shRNA Caco2 cells; IgG is the negative control. (e) Quantiﬁcation (a) qRT–PCR of isolated nuclear and non-nuclear subcellular fractions of pre-miR-30b band intensities from n=3 independent in vitro processing of Caco2 cells for the indicated pri-miRNAs (right panel). Successful activity assays, carried out as in d (mean ± s.d.; ∗P <0.001, Student’s two- fractionation is demonstrated by western blot for the indicated markers tailed t-test). (f) ISH of Caco2 cells for pri-miR-30b; a bacterial DapB RNA

(left panel). Ct values are shown (mean ± s.d. from n = 3 independent probe was used as the negative and the endoplasmic-reticulum-speciﬁc PPIB experiments); actin (ACTB) is the positive qRT–PCR control. Lamin A/C and as the positive control. Merged images are shown. An enlarged area in the histone H3 are the nuclear and GAPDH the cytoplasmic markers for the yellow box in the top right panel is shown for the pri-miR-30b ISH. Arrows western blot. See Supplementary Fig. 8 for unprocessed blot scans. (b) qRT– indicate hybridization signals. Scale bars for full images, 20 µm; for enlarged PCR of the eluates from the IgG (negative control), PLEKHA7 and DGCR8 part, 12 µm. Source data are provided in Supplementary Table 2 for a,b and (positive control) RNA-IPs for the indicated pri-miRNAs (a representative e.(g) Schematic diagram summarizing the ﬁndings of the present study. Two is shown from two independent experiments). (c) In vitro pri-miR-30b distinct junctional complexes exist in polarized epithelial cells: a basolateral processing activity assay of Caco2 lysates for PLEKHA7, DGCR8 (positive complex lacking PLEKHA7 promotes growth signalling and anchorage- control) and IgG (negative control) IPs. A lower exposure image of the pri-miR- independent growth (AIG) through cadherins, Src and p120 activity, whereas 30b template is presented to show the actual loading amount. nt, nucleotides. an apical ZA complex suppresses these events through PLEKHA7, by locally (d) In vitro pri-miR-30b processing activity assay for DGCR8 IPs of NT or recruiting the microprocessor at the ZA to regulate processing of miR-30b.

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1155

The miRNAs regulated by PLEKHA7 provide a mechanistic COMPETING FINANCIAL INTERESTS link to the essential function of the ZA in maintaining epithelial The authors declare no competing financial interests. homeostasis. The miR-30 and let-7 families are well established Published online at http://dx.doi.org/10.1038/ncb3227 guardians of the epithelial phenotype and epithelial–mesenchymal Reprints and permissions information is available online at www.nature.com/reprints transition suppressors42–44. In contrast, the most strongly increased miR-19a after PLEKHA7 depletion is a key component of the 1. Reynolds, A. B., Roesel, D. J., Kanner, S. B. & Parsons, J. T. Transformation- polycistronic miR-17-92 miRNA oncogene52,53. Our data support a specific tyrosine phosphorylation of a novel cellular protein in chicken cells expressing oncogenic variants of the avian cellular src gene. Mol. Cell. Biol. 9, model whereby individual cells within an epithelial monolayer sense 629–638 (1989). the status of their apical ZA by regulating the levels of a subset of 2. Ireton, R. C. et al. A novel role for p120 catenin in E-cadherin function. J. Cell Biol. 159, 465–476 (2002). miRNAs to accordingly suppress or promote growth (Fig. 8g). 3. Ishiyama, N. et al. Dynamic and static interactions between p120 catenin and E- Co-localization of phosphorylated p120 with activated Src and cadherin regulate the stability of cell–cell adhesion. Cell 141, 117–128 (2010). 4. Yap, A. S., Niessen, C. M. & Gumbiner, B. M. The juxtamembrane region of the Rac1 was observed specifically at the basolateral complex, similar cadherin cytoplasmic tail supports lateral clustering, adhesive strengthening, and to the case of p190RhoGAP, which suppresses RhoA signalling and interaction with p120ctn. J. Cell Biol. 141, 779–789 (1998). 5. Davis, M. A., Ireton, R. C. & Reynolds, A. B. A core function for p120-catenin in induces transformed cell growth in a Rac1- and Src-dependent cadherin turnover. J. Cell Biol. 163, 525–534 (2003). manner7,13 (Figs 1b,d,g,h, 2d, and Supplementary Fig. 1e,f,h,i). 6. Anastasiadis, P. Z. p120-ctn: A nexus for contextual signaling via Rho GTPases. Therefore, it is the basolateral complex that exerts the previously Biochim. Biophys. Acta 1773, 34–46 (2007). 7. Wildenberg, G. A. et al. p120-catenin and p190RhoGAP regulate cell–cell adhesion described Src- and Rac1-induced transforming activity of p120 by coordinating antagonism between Rac and Rho. Cell 127, 1027–1039 (2006). (refs 13,15). In agreement, we show that E-cadherin, Src activation 8. Smith, A. L., Dohn, M. R., Brown, M. V. & Reynolds, A. B. Association of Rho- associated protein kinase 1 with E-cadherin complexes is mediated by p120-catenin. and p120 tyrosine phosphorylation are required for increased growth Mol. Biol. Cell 23, 99–110 (2012). signalling in the absence of PLEKHA7 (Fig. 4b–e). Therefore, 9. Schackmann, R. C. et al. Cytosolic p120-catenin regulates growth of metastatic lobular carcinoma through Rock1-mediated anoikis resistance. J. Clin. Invest. 121, the growth-suppressing or growth-promoting functions of p120 3176–3188 (2011). and E-cadherin are fine-tuned by binding to PLEKHA7. Further 10. Stairs, D. B. et al. Deletion of p120-catenin results in a tumor microenvironment 54 55 with inflammation and cancer that establishes it as a tumor suppressor gene. Cancer interactions of PLEKHA7 with paracingulin , afadin , ZO-1 and Cell 19, 470–483 (2011). cingulin56, may also play a role in PLEKHA7 function, although the 11. Mariner, D. J., Davis, M. A. & Reynolds, A. B. EGFR signaling to p120-catenin through phosphorylation at Y228. J. Cell Sci. 117, 1339–1350 (2004). interaction with p120 is essential for modulating cell behaviour by 12. Johnson, E. et al. HER2/ErbB2-induced breast cancer cell migration and invasion regulating miRNA processing. require p120 catenin activation of Rac1 and Cdc42. J. Biol. Chem. 285, 29491–29501 (2010). Taken together, our data untangle the complicated roles of 13. Dohn, M. R., Brown, M. V. & Reynolds, A. B. An essential role for p120-catenin E-cadherin and p120 in the context of distinct junctional complexes, in Src- and Rac1-mediated anchorage-independent cell growth. J. Cell Biol. 184, 437–450 (2009). spatially separating their functions and providing an explanation for 14. Yanagisawa, M. & Anastasiadis, P. Z. p120 catenin is essential for mesenchymal their conflicting behaviour in cell growth. In addition, they identify cadherin-mediated regulation of cell motility and invasiveness. J. Cell Biol. 174, PLEKHA7 as a specific marker of ZA that mediates suppression of 1087–1096 (2006). 15. Soto, E. et al. p120 catenin induces opposing effects on tumor cell growth depending growth-related signalling. Finally, they reveal an interaction of the ZA on E-cadherin expression. J. Cell Biol. 183, 737–749 (2008). with the microprocessor complex, and uncover a mechanism whereby 16. Silvera, D. et al. Essential role for eIF4GI overexpression in the pathogenesis of inflammatory breast cancer. Nat. Cell Biol. 11, 903–908 (2009). the ZA regulates a set of miRNAs to suppress cellular transformation 17. Liu, W. F., Nelson, C. M., Pirone, D. M. & Chen, C. S. E-cadherin engagement and maintain the epithelial phenotype. stimulates proliferation via Rac1. J. Cell Biol. 173, 431–441 (2006). 18. Lewis-Tuffin, L. J. et al. Misregulated E-cadherin expression associated with an aggressive brain tumor phenotype. PLoS ONE 5, e13665 (2010). METHODS 19. Rodriguez, F. J., Lewis-Tuffin, L. J. & Anastasiadis, P. Z. E-cadherin’s dark side: Possible role in tumor progression. Biochim. Biophys. Acta 1826, 23–31 (2012). Methods and any associated references are available in the online 20. Kuphal, S. & Bosserhoff, A. K. E-cadherin cell–cell communication in melanogenesis version of the paper. and during development of malignant melanoma. Arch. Biochem. Biophys. 524, 43–47 (2012). 21. Meng, W., Mushika, Y., Ichii, T. & Takeichi, M. Anchorage of microtubule minus Note: Supplementary Information is available in the online version of the paper ends to adherens junctions regulates epithelial cell–cell contacts. Cell 135, 948–959 (2008). ACKNOWLEDGEMENTS 22. Pulimeno, P., Bauer, C., Stutz, J. & Citi, S. PLEKHA7 is an adherens junction This work was supported by NIH R01 CA100467, R01 NS069753, P50 CA116201 protein with a tissue distribution and subcellular localization distinct from ZO-1 and (P.Z.A.); NIH R01 GM086435, Florida Department of Health, Bankhead-Coley E-cadherin. PLoS ONE 5, e12207 (2010). 10BG11 (P.S.); NIH/NCI R01CA104505, R01CA136665 (J.A.C.); BCRF (E.A.P.); the 23. Miyoshi, J. & Takai, Y. Structural and functional associations of apical junctions with Swiss Cancer League (S.C., Project KLS-2878-02-2012). A.K. is supported by the Jay cytoskeleton. Biochim. Biophys. Acta 1778, 670–691 (2008). and Deanie Stein Career Development Award for Cancer Research at Mayo Clinic. 24. Smutny, M. et al. Myosin II isoforms identify distinct functional modules that support We thank Mayo Clinic’s Proteomics Core and B. Madden for assistance with mass integrity of the epithelial zonula adherens. Nat. Cell Biol. 12, 696–702 (2010). spectrometry, B. Edenfield for immunohistochemistry, M. Takeichi, D. Radisky and 25. Mariner, D. J. et al. Identification of Src phosphorylation sites in the catenin p120ctn. M. Cichon for constructs, and D. Radisky, L. Lewis-Tuffin, J. C. Dachsel, B. Necela J. Biol. Chem. 276, 28006-28013 (2001). 26. Ma, L. W., Zhou, Z. T., He, Q. B. & Jiang, W. W. Phosphorylated p120-catenin and the late G. Hayes for suggestions and comments. expression has predictive value for oral cancer progression. J. Clin. Pathol. 65, AUTHOR CONTRIBUTIONS 315–319 (2012). A.K. designed the study, conceived and designed experiments, carried out all 27. Kourtidis, A., Ngok, S. P. & Anastasiadis, P. Z. p120 catenin: an essential regulator experiments except those described below, analysed the data and wrote the of cadherin stability, adhesion-induced signaling, and cancer progression. Prog. Mol. Biol. Transl. Sci. 116, 409–432 (2013). manuscript. S.P.N. made constructs. P.P. and S.C. developed antibodies and 28. Tikhmyanova, N. & Golemis, E. A. NEDD9 and BCAR1 negatively regulate E-cadherin constructs. R.W.F. provided technical support. L.R.C. assisted with IF. T.R.B., J.M.C. membrane localization, and promote E-cadherin degradation. PLoS ONE 6, and E.A.T. carried out the NanoString experiment and assisted with qRT–PCRs. e22102 (2011). I.K.Y. and T.P. assisted with the ISH assay. E.A.P., P.S., S.B. and J.A.C. developed and 29. Chang, J. H., Gill, S., Settleman, J. & Parsons, S. J. c-Src regulates the simultaneous provided tissue micro-arrays. P.Z.A. conceived and designed the study, conceived rearrangement of actin cytoskeleton, p190RhoGAP, and p120RasGAP following and designed experiments and wrote the manuscript. epidermal growth factor stimulation. J. Cell Biol. 130, 355–368 (1995).

1156 NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015

30. Wang, Y. et al. Synergistic effect of cyclin D1 and c-Myc leads to more aggressive and 44. Zhang, J. et al. miR-30 inhibits TGF-β1-induced epithelial-to-mesenchymal invasive mammary tumors in severe combined immunodeficient mice. Cancer Res. transition in hepatocyte by targeting Snail1. Biochem. Biophys. Res. Commun. 417, 67, 3698–3707 (2007). 1100–1105 (2012). 31. Eiseler, T. et al. Protein kinase D1 mediates anchorage-dependent and -independent 45. Buechner, J. et al. Tumour-suppressor microRNAs let-7 and mir-101 target the proto- growth of tumor cells via the zinc finger transcription factor Snail1. J. Biol. Chem. oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br. 287, 32367–32380 (2012). J. Cancer 105, 296–303 (2011). 32. Thoreson, M. A. et al. Selective uncoupling of p120(ctn) from E-cadherin disrupts 46. Lan, F. F. et al. Hsa-let-7g inhibits proliferation of hepatocellular carcinoma cells strong adhesion. J. Cell Biol. 148, 189-202 (2000). by downregulation of c-Myc and upregulation of p16(INK4A). Int. J. Cancer 128, 33. Ozawa, M. & Ohkubo, T. Tyrosine phosphorylation of p120(ctn) in v-Src transfected 319–331 (2011). L cells depends on its association with E-cadherin and reduces adhesion activity. 47. Lal, A. et al. miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other J. Cell Sci. 114, 503–512 (2001). cell-cycle genes via binding to "seedless" 30UTR microRNA recognition elements. 34. Zhou, B. P. et al. Dual regulation of Snail by GSK-3β-mediated phosphorylation in Mol. Cell 35, 610–625 (2009). control of epithelial-mesenchymal transition. Nat. Cell Biol. 6, 931–940 (2004). 48. Ha, M. & Kim, V. N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell. Biol. 35. Yook, J. I. et al. A Wnt-Axin2-GSK3β cascade regulates Snail1 activity in breast 15, 509–524 (2014). cancer cells. Nat. Cell Biol. 8, 1398-1406 (2006). 49. Gregory, R. I. et al. The microprocessor complex mediates the genesis of microRNAs. 36. Fabian, M. R., Sonenberg, N. & Filipowicz, W. Regulation of mRNA translation and Nature 432, 235–240 (2004). stability by microRNAs. Annu. Rev. Biochem. 79, 351–379 (2010). 50. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 37. Krol, J., Loedige, I. & Filipowicz, W. The widespread regulation of microRNA 425, 415–419 (2003). biogenesis, function and decay. Nat. Rev. Genet. 11, 597–610 (2010). 51. Han, J. et al. The Drosha-DGCR8 complex in primary microRNA processing. Genes 38. Meijer, H. A. et al. Translational repression and eIF4A2 activity are critical for Dev. 18, 3016–3027 (2004). microRNA-mediated gene regulation. Science 340, 82–85 (2013). 52. He, L. et al. A microRNA polycistron as a potential human oncogene. Nature 435, 39. Pillai, R. S. et al. Inhibition of translational initiation by Let-7 MicroRNA in human 828–833 (2005). cells. Science 309, 1573–1576 (2005). 53. Olive, V. et al. miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 23, 40. Croce, C. M. Causes and consequences of microRNA dysregulation in cancer. Nat. 2839–2849 (2009). Rev. Genet. 10, 704–714 (2009). 54. Pulimeno, P., Paschoud, S. & Citi, S. A role for ZO-1 and PLEKHA7 in recruiting 41. Adams, B. D., Kasinski, A. L. & Slack, F. J. Aberrant regulation and function of paracingulin to tight and adherens junctions of epithelial cells. J. Biol. Chem. 286, MicroRNAs in cancer. Curr. Biol. 24, R762-R776 (2014). 16743–16750 (2011). 42. Joglekar, M. V. et al. The miR-30 family microRNAs confer epithelial phenotype to 55. Kurita, S., Yamada, T., Rikitsu, E., Ikeda, W. & Takai, Y. Binding between the human pancreatic cells. Islets 1, 137–147 (2009). junctional proteins afadin and PLEKHA7 and implication in the formation of adherens 43. Watanabe, S. et al. HMGA2 maintains oncogenic RAS-induced epithelial- junction in epithelial cells. J. Biol. Chem. 288, 29356–29368 (2013). mesenchymal transition in human pancreatic cancer cells. Am. J. Pathol. 174, 56. Paschoud, S., Jond, L., Guerrera, D. & Citi, S. PLEKHA7 modulates epithelial tight 854–868 (2009). junction barrier function. Tissue Barriers 2, e28755 (2014).

NATURE CELL BIOLOGY VOLUME 17 | NUMBER 9 | SEPTEMBER 2015 1157

METHODS were removed and tissue samples were de-identified. The Mayo Clinic Institutional Cell culture, reagents and chemicals. In all comparisons, cells were used strictly at Review Board assessed the protocol 09-001642 as minimal risk and waived the the same confluences. All cell lines were obtained from ATCC, used at low passage need for further consent. Renal tissue samples were collected for the Mayo Clinic (<20), and tested negative for mycoplasma contamination. Caco2 colon epithelial Renal Tissue Registry under protocol 14-03, with the approval of the Mayo Clinic cells were cultured in MEM (Cellgro) supplemented with 10% FBS (Invitrogen), Institutional Review Board. Written informed consent for the use of these tissues 1 mM sodium pyruvate (Invitrogen) and 1× non-essential amino-acid supplement in research was obtained from all participants to the Registry. Renal tissue samples (Mediatech). MDCK canine kidney epithelial cells, HEK 293FT human embryonic used here were obtained from the Renal Tissue Registry under the Mayo Clinic kidney cells, and Phoenix-Ampho cells were cultured in DMEM supplemented Institutional Review Board protocol 675-05. All unique patient identifiers and with heat-inactivated 10% FBS. PP2 was obtained from Calbiochem; nocodazole, confidential data were removed and tissue samples were de-identified. The Mayo cycloheximide and MG-132 from Sigma. Clinic Institutional Review Board assessed the 675-05 protocol as minimal risk and waived the need for further consent. All data were analysed anonymously. Constructs. Full-length human PLEKHA7 was cloned in the XbaI–HindII sites Paraffin-embedded tissues on slides were placed in xylene and rehydrated in a of pcDNA3.1myc–His and then the PLEKHA7–Myc fragment was cut out by graded ethanol series, rinsed in water, subjected to heat antigen retrieval according PmeI and sub-cloned to the AfeI site of the retroviral LZRS vector to obtain the to the manufacturer’s instructions (Dako), incubated with primary antibody and LZRS-PLEKHA7–Myc construct. The PLEKHA7–GFP construct was a gift of the finally with either anti-rabbit (for PLEKHA7) or anti-mouse (for Ecad, p120) M. Takeichi laboratory (RIKEN, Japan; ref. 21). The mp120-1A, mp120-4A, mp120- labelled polymer horseradish peroxidase (Dako). Slides were scanned using Aperio 8F and mp120-1ARM1 constructs have been previously described2,25. The adSNAI1 ScanScope XT and viewed using Aperio ImageScope v11.1.2.752. and adGFP adenoviruses were a gift of the D. Radisky laboratory (Mayo Clinic, FL, USA). The YFP–PBD (plasmid 11407) and GFP–rGBD (plasmid 26732) constructs Junction resistance measurements. ECIS Z (Electric Cell-substrate Impedance were obtained from Addgene. System, Applied Biophysics) was used to measure impedance of Caco2 cells. 4×104 cells were plated on electrode arrays (8W10E, Applied Biophysics). Measurements shRNAs, siRNAs, anti-miRNAs and miR-mimics. Cells were transfected using were made every 180 s at the 4,000 Hz frequency that measures junctional impedance Lipofectamine 2000 (Invitrogen) or Lipofectamine RNAiMAX (Invitrogen) for and at 64,000 Hz that corresponds to cell density. The 4,000 Hz values were anti-miRNA, miR-mimic and siRNA transfection, according to the manufacturer’s normalized to the 64,000 Hz values to account for cell density variations. protocols. Lentiviral shRNAs were derived from the pLKO.1-based TRC1 (Sigma–RNAi Consortium) shRNA library (pLKO.1-puro non-target shRNA Soft agar assay. Six-well plates (Costar 3516) were first covered with a layer of control, SHC016; PLEKHA7 no. 8, TRCN0000146289; PLEKHA7 no. 10, 0.75% agarose, prepared by mixing 1.5% of sterile agarose (Seakem) in a 1:1 ratio TRCN0000127584; Cad11, TRCN0000054334; Ecad no. 21, TRCN0000039664; with ×2 concentrated Caco2 culture medium made from powder MEM (Invitrogen, Ecad no. 23, TRCN0000039667) and the pLKO.5-based TRC2 library (pLKO.5-puro catalogue no. 61100061) and double addition of each supplement (see above). The non-target shRNA control, SHC216; NEZHA no. 72, TRCN0000268676; NEZHA, basal layer was left to solidify for 30 min. Cells were trypsinized, counted and no. 73: TRCN0000283758). Lentiviruses were produced in HEK 293FT cells and resuspended in ×2 Caco2 medium. The cell suspension was mixed in a 1:1 ratio used to infect cells according to standard protocols. Retroviruses were prepared in with 0.7% sterile agarose to make a final layer of 0.35% agarose, which was added Phoenix-Ampho cells, as described previously15. SMARTpool (Dharmacon) siRNAs on top of the basal layer. 5×104 Caco2 cells were seeded per well. The top layer was used: DROSHA, M-016996-02-0005; DGCR8, M-015713-01-0005; non-target, left to solidify for another 30 min and was covered with 1× Caco2 culture medium. D-001206-14-05 mirVana (Life Technologies catalogue no. 4464084). Anti-miRNAs Cultures were maintained for 4 weeks with medium renewal on top of agar every used: anti-hsa-miR-30a, ID MH11062; anti-hsa-let-7g, ID MH11758; anti-hsa- three days until colonies were visible, and then stained with 0.02% crystal violet miR-30b, ID MH10986; anti-hsa-miR-24, ID MH10737; negative control no. 1, (Fisher) in 20% ethanol and PBS, washed three times with distilled H2O, scanned catalogue no. 4464076. MISSION (Sigma) miR-mimics used: miR-30b, catalogue and counted for colonies. no. HMI0456; negative control 1 (catalogue no. HMC0002). Calcium switch assay. Caco2 cells were grown on coverslips until confluency, pre- Antibodies. For detailed information on all the antibodies used in the study, as well treated with either DMSO (control) or 10 µM nocodazole for 1 h to dissolve micro- as working dilutions for each assay, see Supplementary Table 3. tubules, then washed three times with calcium-free PBS and incubated in calcium- free Caco2 medium (Life, 11380-037, supplemented with glutamine, 10%FBS, Immunofluorescence. MDCK and Caco2 cells were grown on Transwell inserts sodium pyruvate and MEM) containing 4 mM EGTA for 30 min, until cells were (Costar 3413) for 7 or 21 days respectively, until they polarized, or on sterile glass rounded, while being kept in either DMSO or 10 µM nocodazole, respectively. Cells coverslips until they reached full confluence. Cells were washed once with PBS were then washed three times with PBS, returned to regular Caco2 medium, again and then fixed with either 100% methanol (Fisher) for 7 min; or 4% formaldehyde with DMSO or nocodazole respectively, and fixed for IF, for the indicated times. (EMS) for 20 min, followed by 0.02% Triton X-100 permeabilization for 10 min; or 10% TCA (Sigma) for 15 min on ice, particularly for RhoA co-staining, and IPs. Cells were grown on 10 cm plates until fully confluent, washed twice with PBS permeabilized as above. Cells were blocked with either 3% non-fat milk (Carnation) and lysed using a Triton X-100 lysis buffer (150 mM NaCl, 1 mM EDTA, 50 mM in PBS or Protein-Block reagent (Dako, X090930-2) for 30 min and stained with Tris pH 7.4, 1% Triton X-100) containing twice the amount of protease (Cocktail III, primary antibodies diluted either in milk or antibody diluent (Dako, S302281-2) RPI) and phosphatase inhibitors (Pierce). Four 10 cm plates (∼3–4×106 cells) were for 1 h. Cells were then washed three times with PBS, stained with the fluorescent- used per IP. In parallel, 4 µg of antibody or IgG control (Jackson ImmunoResearch, labelled secondary antibodies for 1 h, washed three times with PBS, co-stained with 011-000-003) was incubated with 40 µl Protein G Dynabeads (Invitrogen) overnight DAPI (Sigma) to visualize the nuclei, mounted (Aqua Poly/Mount, Polysciences) and then washed three times with IP lysis buffer. Cell lysates were incubated with and imaged using a Zeiss LSM 510 META laser confocal microscope, under a ×63 the bead-conjugated antibodies overnight. Beads were then washed three times with objective, with a further ×1.6 zoom. z-stacks were acquired at 0.5 µm intervals. IP lysis buffer and eluted using 50 mM dithiothreitol (Sigma) in lysis buffer at 37 ◦C Images, stacks and x–z representations of the image stacks were processed using for 45 min, with constant agitation. For RNAse-treated IPs, beads were distributed the Zen software (Zeiss). equally after the final wash into two tubes with either 1.5 ml PBS or PBS containing 100 mg ml−1 RNAse A (Sigma). After incubation at 4 ◦C for 1.5 h, beads were washed Immunoblotting. Whole-cell extracts were obtained using RIPA buffer (Tris, three times with PBS, and proteins were eluted as above. pH 7.4, 50 mM NaCl, 150 mM, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS) supplemented with protease (Cocktail III, RPI) and phosphatase inhibitors (Pierce). Lysates Proteomics. Caco2 cells were grown on 10 cm Transwell inserts (Costar 3419) were homogenized through a 29 g needle and cleared by full-speed centrifugation for 21 days to polarize. Cells were then washed twice with PBS and proteins were for 5 min. Protein extracts were mixed with LSB and separated by SDS–PAGE, cross linked as previously described57, using 0.75 mM of the reversible cross linker transferred to nitrocellulose membranes (Bio-Rad), blotted according to standard DSP (Lomant’s reagent; Pierce) for 3 min at room temperature, which was then protocols, detected by luminescence using ECL (GE Healthcare) and imaged using neutralized using 20 mM Tris pH 7.5 for 15 min. Cells were finally lysed using X-ray films (Pierce). See Supplementary Fig. 8 for original scans of western blots. RIPA (see recipe above, immunoblotting section) containing twice the amount of protease (Cocktail III, RPI) and phosphatase inhibitors (Pierce) and 1 mM EDTA. Immunohistochemistry—ethics statements. Breast tissue samples were initially Four 10 cm Transwells (∼3–4 × 106 cells) were used per IP. In parallel, 4 µg of collected under protocol MC0033, with the approval of the Mayo Clinic Institutional antibody or IgG control (Jackson ImmunoResearch, 011-000-003) was incubated Review Board. Written informed consent for the use of these tissues in research was with 40 µl protein G Dynabeads (Invitrogen) overnight and cross linked to the beads obtained from all participants. Generation of the tissue micro-arrays was carried using 5 mM BS (ref. 3; Pierce) according to the manufacturer’s protocol. Cross linked out under protocol 09-001642. All unique patient identifiers and confidential data lysates were incubated with the bead-conjugated antibodies overnight. Beads were

NATURE CELL BIOLOGY

then washed three times with lysis buffer and proteins were eluted as described KCl, 7 mM MgCl2, 20 mM creatine phosphate, 1 mM ATP, 0.2 mM phenylmethyl above and separated by SDS–PAGE. Gels were silver-stained (Pierce SilverSnap kit), sulphonyl fluoride, 5 mM dithiothreitol, 10% glycerol, 2 U µl−1 RNAse inhibitor and according to the manufacturer’s protocol. Gel slices were selected and excised using 3 µg FITC-labelled pri-miR-30b. The labelled probe was denatured for 2 min at 95 ◦C sterile scalpels and destained, reduced and alkylated before digestion with trypsin and left to gradually cool down and refold before the assay. The processing assay (Promega). Samples were analysed using nanoHPLC-electrospray tandem mass was carried out for 90 min at 37 ◦C in the dark with constant gentle rocking. RNA spectrometry (nanoLC-ESI-MS/MS) in a ThermoFinnigan LTQ Orbitrap hybrid was eluted with RNA elution buffer (2% SDS, 0.3 M NaOAc pH 5.2) purified with mass spectrometer (ThermoElectron Bremen). Mascot (Matrix Sciences London) phenol–chloroform–IAA (25:24:1) pH 5.5 (Fisher), and precipitated overnight at was used to search the Swissprot database to identify isolated peptides. Common −80 ◦C using NaOAc 0.3 M pH 5.2, 1 µl glycogen (Invitrogen) and 4:1 100% EtOH. contaminants such as trypsin, casein, keratin and microbial-specific proteins were The RNA was recovered by full-speed centrifugation for 30 min at 4 ◦C, washed with removed from analysis. Results were visualized using Cytoscape 2.8.2 (ref. 58). 75% EtOH, resuspended in 7.5 µl DEPC–H2O, denatured in 1:1 Gel Loading Buffer II (Life Technologies) for 5 min at 95 ◦C, and loaded onto a 12% denaturing PAGE Total RNA isolation and qRT–PCR. Cells were lysed using Trizol (Invitrogen) and RNA gel (SequaGel; National Diagnostics). The gel was scanned using a Typhoon subjected to the Trizol Plus total transcriptome isolation protocol of the PureLink 9400 (GE Healthcare) and quantification of bands was carried out using ImageJ. RNA mini kit (Ambion—Life Technologies) specified to isolate both mRNAs and miRNAs. Final RNA concentrations were determined using a NanoDrop spec- ISH. For ISH of pri-miR-30b, Caco2 cells were grown on slides, fixed with 10% trophotometer. RNA was converted to complementary DNA using a high capacity formalin (Protocol; Fisher), dehydrated and rehydrated in a series of 50–70– cDNA reverse transcriptase kit (Applied Biosystems). qPCR reactions were carried 100–70–50% EtOH solutions, pretreated with protease and hybridized using the out using the TaqMan FAST Universal PCR master mix (Applied Biosystems), in a RNAscope 2.0 HD Brown assay (Advanced Cell Diagnostics, ACD), according to 7900 HT or ViiA 7 thermocycler (Applied Biosystems). Data were analysed using RQ the manufacturer’s instructions. Probes used: human pri-miR-30b, ACD, 415331; Manager (Applied Biosystems). U6 was used as a control for miRNA expression nor- positive control probe Hs-PPIB, ACD, 313906; negative control probe DapB, ACD, malization and GAPDH, β-actin for mRNA and pri/pre-miRNA normalization. Taq- 310048. After ISH, cells were rinsed twice with PBS and blocked with Protein- Man assays used for miRNAs (Applied Biosystems, catalogue no. 4427975): hsa-miR- Block reagent (Dako, X090930-2) for 10 min, and IF was carried out with an Ecad 24, 000402; hsa-miR-30a, 000417; hsa-miR-30b, 000602; hsa-let-7g, 002282; hsa- antibody (BD) diluted in antibody diluent (Dako, S302281-2) for 30 min; Ecad was miR-19a, 000395; U6, 001973. TaqMan assays for miRNA precursors: pri-miR-30b, the junctional marker used here because it resisted protease treatment and did not Applied Biosystems, catalogue no. 4427012, Hs03303066_pri; pre-miR-30b, Custom produce background due to formalin fixation. Cells were then washed three times Plus TaqMan RNA assay catalogue no. 4441114, assay ID AJN1E56, context se- with PBS and stained with a fluorescent-labelled secondary antibody and DAPI for quence 50-CTGTAATACATGGATTGGCTGGGAG-30. TaqMan assays for mRNAs 30 min. Cells were finally washed three times with PBS, mounted (Aqua Poly/Mount, (Applied Biosystems, catalogue no. 4331182): PLEKHA7, Hs00697762_m1; SNAI1, Polysciences) and imaged using a Leica DM5000B microscope under bright (ISH) Hs00195591_m1; MYC, Hs00153408_m1; CCND1, Hs00277039_m1; GAPDH, and fluorescent light (protein IF). All images were pseudocoloured and merged Hs99999905_m1; actin (ACTB), Hs99999903_m1. images were created using the microscope’s Leica suite software.

RNA-IPs. RNA-IPs were carried out as described above for standard IPs, but NanoString miRNA analysis. Total RNA was isolated as above and global miRNA with the addition of 100 U ml−1 RNAse inhibitor (Promega) in the lysis buffer. analysis was carried out using the nCounter Human v2 miRNA expression assay After the final wash, RNA was eluted from the beads using Trizol (Invitrogen) (NanoString) containing 735 miRNAs. Data were collected using the nCounter and purified as described above. qRT–PCRs were then carried out as above and Digital Analyzer (NanoString). miRNAs were first elongated by a sequence-specific the results were analysed using the Sigma RIP-qRT–PCR data analysis calculation ligation and were then hybridized with specific, barcoded probes. The raw units shell, associated with the Sigma Imprint RIP kit (http://www.sigmaaldrich.com/ that result from the NanoString reaction reflect the number of times each probe is life-science/epigenetics/imprint-rna.html and references therein). counted in a sample of the total hybridization reaction and represent the frequency of each miRNA, without amplification of starting material. The raw units were then Cell fractionation. To separate the nuclear fraction, cells were first lysed using a normalized for RNA input and background noise to internal positive and negative buffer containing 25 mM Tris pH 7.4, 150 mM NaCl, 5 mM MgCl2, 0.5% NP-40, controls according to the manufacturer’s instructions. miRNAs with low counts at protease (Cocktail III, RPI), phosphatase (Pierce) and RNAse (100 U ml−1; Promega) the level of the negative controls were excluded. inhibitors for 10 min on ice. The lysates were centrifuged at 300g for 5 min at 4 ◦C to pellet the nuclei and the supernatant was carefully transferred to a fresh tube. Northern blot. 10–20 µg of total RNA or the Low Range ssRNA Ladder (NEB) The nuclear pellet was lysed using RIPA (see recipe above, immunoblotting section) were mixed in a 1:1 volume ratio with Gel Loading Buffer II (Life Technologies), with protease, phosphatase and RNAse inhibitors for 10 min on ice, homogenized denatured at 95 ◦C for 5 min and loaded onto 12% denaturing PAGE RNA through a 29 g needle and cleared by centrifugation for 5 min at 12,000g. Half of gels (SequaGel; National Diagnostics). RNAs were then transferred to Hybond each lysate was used for SDS–PAGE, whereas the other half was mixed with Trizol N+ membranes (Amersham, GE Healthcare) for 2 h at 250 mA using a semi- and used to extract total RNA and cary out qRT–PCRs, as described above. dry apparatus (Hoefer TE70) and cross linked using a Stratalinker (Stratagene). Northern blot was carried out using the DIG Northern Starter Kit (Roche) and the Proximity ligation. The Duolink In Situ Red Starter Kit Mouse/Rabbit (Sigma) was DIG Wash and Block Buffer Set (Roche) according to the manufacturer’s protocol. used according to the manufacturer’s instructions. Hybridization and stringent washes were carried out at 50 ◦C; probes were used at 5 nM final concentration. Probes used: hsa-miR-30b miRCURY LNA Detection In vitro pri-miRNA processing assay. Total cDNA from Caco2 cells was obtained probe, DIG labelled, Exiqon, 18143-15; U6 hsa/mmu/rno control, miRCURY LNA as described above (qRT–PCR section) and was used to amplify the pri-miR- detection probe, DIG Labelled, Exiqon, 99002-01. 30b transcript. The pri-miR-30b cDNA was then subcloned into the pBluescript SK+ vector, downstream of the T7 promoter, between the EcoRI and XhoI sites. Statistics and reproducibility. For all quantitative experiments, averages and s.d. Primers used: pri-30bF-XhoI, 50 -ATTAACTCGAGGTGAATGCTGTGCCTGTT were calculated and presented as error bars, whereas the number of independent C-30; pri-30bR-EcoRI, 50 -ACGTTGAATTCGCCTCTGTATACTATTCTTGC-30. experiments carried out and the related statistics are indicated in each figure The cloned pri-miR-30b sequence is as follows (the pre-mRNA sequence is shown legend. Student’s two-tailed t-test was employed for P-value calculations because in capital letters): 50-gtgaatgctgtgcctgttctttttttcaacagagtcttacgtaaagaaccgtacaaactta all comparisons were between two groups, control and experimental condition. For gtaaagagtttaagtcctgctttaaACCAAGTTTCAGTTCATGTAAACATCCTACACTC all other experiments, at least three independent experiments were carried out and a AGCTGTAATACATGGATTGGCTGGGAGGTGGATGTTTACTTCAGCTGAC representative is shown in Figs 1a–h, 2b,d–f, 3b (left panel), 3d–g, 4b–g, 5c,d, 6b–k, TTGGAatgtcaaccaattaacattgataaaagatttggcaagaatagtatacagaggc-30. The pri-miR- 7a–i and 8a,c,d,f; and Supplementary Figs 1a–j, 2a–c, 3b–i, 4c–e, 5b–d,g–i, 6a–h and 30b construct was linearized using SmaI and in vitro transcription was carried out 7a–d,f–h,j–m. using T7 polymerase (Roche) and fluorescein isothiocyanate (FITC) RNA labelling mix (Roche), according to the manufacturer’s instructions. The FITC-labelled pri- Accession numbers. The NanoString data generated for this manuscript were miR-30b was gel-purified and stored at −20 ◦C in the dark for no more than a submitted to the Gene Expression Omnibus database, accession number GSE61593. week. For the in vitro processing assay, IPs on Caco2 lysates were carried out as 57. Smith, A. L., Friedman, D. B., Yu, H., Carnahan, R. H. & Reynolds, A. B. ReCLIP described above using IgG (negative control), a PLEKHA7 (Sigma) or a DGCR8 (reversible cross-link immuno-precipitation): an efficient method for interrogation of (Sigma) (positive control) antibody. For the PLEKHA7 knockdown experiment, labile protein complexes. PLoS ONE 6, e16206 (2011). control (NT) or PLEKHA7 shRNA cells were used and IPs were carried out using 58. Smoot, M. E., Ono, K., Ruscheinski, J., Wang, P. L. & Ideker, T. Cytoscape 2.8: an IgG (negative control), or a DGCR8 (Sigma) antibody. After the final wash, the new features for data integration and network visualization. Bioinformatics 27, beads were mixed with a reaction mixture containing 20 mM Tris at pH 8.0, 100 mM 431–432 (2011).

NATURE CELL BIOLOGY

DOI: 10.1038/ncb3227

a b PLEKHA7 p120 PLEKHA7 Ecad merged z z apical apical x x

y y basal basal

MDCK Caco2 x x c d PLEKHA7 e PLEKHA7 Ecad PLEKHA7 p120:Y228 Afadin z z apical apical x x Actin

y basal

basal Myosin z IIA MDCK Caco2 MDCK x x x f g PLEKHA7 p120:Y96 PLEKHA7 p120:T310 merged z y apical x x

y y basal

Caco2 Caco2 x x h i j PLEKHA7 Rac1 PLEKHA7 Rac1 PLEKHA7 RhoA apical apical apical

y y y basal basal basal

Caco2 MDCK Caco2 x x x

Supplementary Figure 1

Supplementary Figure 1 Distinct complexes exist at the junctions of phosphorylated p120: Y96; (g) phosphorylated p120: T310; (h,i) Rac1; (j) epithelial cells. Caco2 or PLEKHA7-GFP transfected MDCK cells were RhoA. Stained cells were imaged by confocal microscopy and image stacks grown to polarize, subjected to IF for PLEKHA7 or GFP respectively were acquired, as in Figure 1. Representative x-y image stacks are shown and co-stained for (a) p120; (b,c) E-cadherin (Ecad); (d) Afadin, and/or the merged composite x-z images. Scale bars for x-y images: 20 μM; Actin (phalloidin), Myosin IIA; (e) phosphorylated p120: Y228; (f) for x-z images: 5 μM.

WWW.NATURE.COM/NATURECELLBIOLOGY 1

a b WBs Ecad PLEKHA7 merged Ecad

α-catenin NT

β-catenin

shEcad

IPs

c p120 PLEKHA7 merged

shp120

sh120+1A

sh120+4A

Supplementary Figure 2 PLEKHA7 localization to the junctions is (c) p120 and PLEKHA7 IF stainings of Caco2 control (NT) cells, p120 E-cadherin- and p120-dependent. (a) Western blot of the lysates from the knockdown (shp120) cells, and of p120 knockdown cells transfected either separated apical and basolateral fractions shown in Figure 2 for E-cadherin with the full length murine mp120-1A isoform (shp120+1A) or the murine (Ecad), α-catenin, and β-catenin. (b) Caco2 control (NT) or E-cadherin mp120-4A isoform that lacks the N-terminal PLEKHA7-binding domain knockdownSupplementary (shEcad) cells, stained Figure by IF for E-cadherin 2 and PLEKHA7. (shp120+4A). All scale bars: 20 μM.

2 WWW.NATURE.COM/NATURECELLBIOLOGY

a b NT shPLEKHA7 c soft agar colonies 1.2 PLEKHA7 mRNA 1 0.8 PLEKHA7 0.6 NT #8 #10 * shPLEKHA7

fold change 0.4 * 0.2 0 p120 d NT #8 #10 MDCK shPLEKHA7 PLEKHA7 y p120 merged p-p120: z Y228 x Src e f g p-Src: PLEKHA7 NEZHA NEZHA Y416 soft agar colonies SNAI1 p120 p-p120: NT Actin adGFP Y228 Src p-Src: adSNAI1 Y416 shNEZHA Cad11

SNAI1 h i PLEKHA7 mp120 MYC PLEKHA7 * ** p120 CCND1 Src Actin 1A p-Src:Y416 NT #72 #73 shNEZHA SNAI1

ΔARM1 MYC

CCND1

Actin

Supplementary Figure 3

Supplementary Figure 3 PLEKHA7 loss from the junctions results in of Caco2 cells infected with either vector control (adGFP) or a SNAI1- increased anchorage-independent growth and related signalling. (a) expressing construct (adSNAI1) (images are in 2x magnification; see Fig. Demonstration of the PLEKHA7 mRNA knockdown by qRT-PCR after 3h for quantitation). (f) Western blot of control (NT) or NEZHA knockdown infection of Caco2 cells with two PLEKHA7 shRNAs (shPLEKHA7 #8 and (shNEZHA#72 and #73 shRNAs) Caco2 cells for the markers shown; Actin is #10) or non-target control shRNA (NT) (mean ± s.d. from n=3 independent the loading control. (g) IF of control (NT) or NEZHA knockdown (shNEZHA) experiments; *P<0.0001, Student’s two-tailed t-test). Source data are Caco2 cells for PLEKHA7 and NEZHA. (h) IF of Caco2 cells transfected provided in Supplementary Table 2. (b) Caco2 control (NT) and PLEKHA7 with either wild type murine mp120-1A (1A) or the murine mp120-ΔARM1 shRNA knockdown (shPLEKHA7) cells were stained and imaged for (ΔARM1) construct that cannot bind E-cadherin, stained with the murine- PLEKHA7 and p120. (c) Caco2 control (NT) or PLEKHA7 knockdown cells specific p120 antibody 8D11 (mp120) and co-stained with PLEKHA7. (shPLEKHA7 #8, #10) grown on soft agar and imaged for colony formation (i) Western blot of pcDNA (vector control), mp120-ΔARM1, or mp120-1A (images are in 2x magnification; see Fig. 3c for quantitation). (d) MDCK cells transfected cells, for the markers shown; Actin is the loading control. Single were infected with either control (NT) or PLEKHA7 shRNA (shPLEKHA7#8) and double stars on the p120 blot indicate the 1A and ΔARM1 bands, and subjected to western blot for the markers shown. Phosphorylation respectively, right above the endogenous p120 bands. Scale bars for x-y sites are denoted by p-. Actin is the loading control. (e) Soft agar assay images: 20 μM; for x-z images: 2.5 μM; for panels c and e: 2 mm.

WWW.NATURE.COM/NATURECELLBIOLOGY 3

a BC normal DCIS Triple neg. absent mislocalized normal 100%

80% PLEKHA7 60%

40% % cases %

p120 20%

0% Ecad

PLEKHA7 p120 Ecad

b RCC normal stage 2 stage 3

absent mislocalized normal 100% 80% PLEKHA7 60% 40% % cases %

p120 20% 0%

PLEKHA7 p120 Ecad Ecad

c d e soft agar colonies p120 p120:Y228 PLEKHA7 p120 control Ecad shPLEKHA7 - + + shp120 - - + α-Tubulin shPLEKHA7 - - + + shp120 - + - + PP2 Supplementary Figure 4

Supplementary Figure 4 PLEKHA7 is mis-localized or lost in breast and Matched normal, n=119; stage 1, n=71; stage 2, n=20; stage 3, n=22; renal tumour tissues. Representative immunohistochemistry images of stage 4, n=6. (c) Caco2 control (NT), PLEKHA7 knockdown (shPLEKHA7), (a) breast and (b) kidney (renal), normal and cancer tissues stained for and PLEKHA7, p120 (shPLEKHA7, shp120) double knockdown cells were PLEKHA7, p120 and E-cadherin (Ecad) (left panels) and the percentage grown on soft agar for colony formation assay (images are shown in 2x of tissues that exhibit presence, absence, or mis-localization of the three magnification; see Fig. 4a for quantitation) and (d) examined by western markers examined (right panels). BC: breast cancer; RCC: renal cell blot for E-cadherin (Ecad) levels; α-Tubulin is the loading control. (e) Caco2 carcinoma. Scale bars: 20 μM. Number of tissues examined per cancer cells treated with either vehicle (DMSO) or the Src inhibitor PP2 (10 μM) type/stage; BC TMA: Benign, n=8; DCIS, n=12; ILC ER+ Her-, n=10; IDC were stained for p120 and phosphorylated p120: Y228. Scale bars 20 μM; ER+, Her-, n=16; IDC Her+, n=16; IDC Triple Negative, n=13; RCC TMA: for panel c: 2 mm.

4 WWW.NATURE.COM/NATURECELLBIOLOGY

a b NT shPLEKHA7 2.5 NT CHX (min): 0 15 30 60 120 240 0 15 30 60 120 240 shPLEKHA7 2 PLEKHA7

1.5 SNAI1 1 fold change MYC 0.5 CCND1 0 SNAI1 CCND1 c-Myc Actin mRNAs

c d e miR-30b NT shPLEKHA7 1.2 MG-132 (min): 0 15 30 60 120 240 0 15 30 60 120 240 PLEKHA7 1 PLEKHA7 p-GSK3β 0.8 * SNAI1 0.6

GSK3β fold change 0.4 MYC Actin NT #8 #10 0.2

CCND1 shPLEKHA7 NT shPLEKHA7 shPLEKHA7+LZRS-PLEKHA7 0 shPLEKHA7 - + + Actin LZRS-PLEKHA7 - - +

miR-19a f 4 g h i 3.5 * NT shPLEKHA7 p-p120: 3 p-p120: Y228 Y228 p-p120: 2.5 Y228 p120 p120 2 p-Src: p120

fold change p-Src: 1.5 Y416 Y416 1 Actin Src Src 0.5

0 NT shPLEKHA7 shPLEKHA7+LZRS-PLEKHA7 shPLEKHA7 - + + LZRS-PLEKHA7 - - + anti-miRs miR-mimics

SupplementarySupplementary Figure 5 PLEKHA7 acts Figure via miRNAs 5 but not post- Caco2 cells after ectopic re-expression of PLEKHA7 (LZRS-PLEKHA7) translational modification mechanisms. (a) qRT-PCR analysis for the (mean ± s.d. from n=3 independent experiments; *P<0.05, Student’s indicated mRNAs of Caco2 control (NT) or PLEKHA7 knockdown cells two-tailed t-test) (g) Caco2 cells transfected with the indicated anti-miRs (shPLEKHA7) (mean ± s.d. from n=3 independent experiments). (b) (a-miR) were subjected to western blot for the markers shown. (h) Caco2 Western blot for the markers shown (Actin: loading control) of control (NT) control (NT) and PLEKHA7 knockdown (shPLEKHA7) cells were transfected or PLEKHA7 knockdown (shPLEKHA7) Caco2 cells treated with 20 μg/ml with either control or miR-30b mimic and blotted for the markers shown. cycloheximide (CHX) or (c) 10 μM MG-132, for the indicated time points. (i) Caco2 cells infected with either vector control (adGFP) or a SNAI1- (d) Western blot of control (NT) or PLEKHA7 knockdown (shPLEKHA7) expressing construct (adSNAI1) were subjected to western blot for the Caco2 cells for the markers shown; Actin is the loading control. (e,f) miR- markers shown; Actin is the loading control. Source data for panels a, e, f 30b and miR-19a qRT-PCR analysis of PLEKHA7-knockdown (shPLEKHA7) are provided in Supplementary Table 2.

WWW.NATURE.COM/NATURECELLBIOLOGY 5

a b *2nd ab c *2nd ab nt: 80

pre- merged 50 miR-30b p120 DROSHA* merged p120 DGCR8* apical apical 21 mature miR-30b

U6 basal basal

Caco2 Caco2

d p120 DROSHA merged e p120 DGCR8 merged apical apical basal basal MDCK MDCK

f g kDa p120 DROSHA kDa p120 DGCR8 202 202 DROSHA 113 113 DGCR8 73 NT 73 NT 47 37 Actin 37 Actin

siDROSHA siDGCR8

h WBs

PLEKHA7

p120

Ecad

Supplementary Figure 6 IPs

Supplementary Figure 6 The microprocessor complex localizes at the IF of polarized MDCK cells for p120 and DROSHA (antibody: Abcam) or ZA. (a) Northern blot analysis of control (NT) or PLEKHA7 knockdown DGCR8 (antibody: Abcam). (f,g) siRNA-mediated knockdown of DROSHA (shPLEKHA7) Caco2 cells using a miR-30b probe, indicating the pre- (siDROSHA) and DGCR8 (siDGCR8) in Caco2 cells, shown both by IF (left miR-30b and the mature miR-30b. U6 is the loading control. (b,c) IF of side of each panel), and western blot (right side of each panel). Non-target polarized Caco2 cells for p120 and DROSHA or DGCR8. Antibodies used (NT) siRNA is the control. p120 was used as a co-stain for the IF; Actin is here: DROSHA: Sigma and DGCR8: Sigma. The indication *2nd ab refers to the loading control for the blots; molecular weights (kDa) are indicated on the use here of a different antibody for DROSHA and DGCR8, compared to the left side of each blot. (h) Western blots of PLEKHA7, p120, DROSHA, the antibodies used in Fig. 6d,e (for antibody details, see Supplementary and DGCR8 IPs for PLEKHA7, p120 and E-cadherin (Ecad). IgG is the Table 3). Enlarged details in boxes are shown on top of apical fields. The negative IP control. Scale bars: 20 μM; for enlarged parts of panels b and x-z composite image of panel b is shown in Fig. 6f and of c in Fig. 6g. (d,e) c: 3 μM.

6 WWW.NATURE.COM/NATURECELLBIOLOGY

a mp120 PLEKHA7 b mp120 DROSHA c mp120 DGCR8

1A 1A 1A

ΔARM1 ΔARM1 ΔARM1

d e f DROSHA DGCR8 p120 DROSHA 1.2 NT shp120 PLEKHA7 1.0 * 0.8 * * * NT 0.6 control 0.4 fold change 0.2 0.0 shp120 Nocodazole g h NEZHA DROSHA NEZHA DGCR8 i

NT NT

shNEZHA shNEZHA j k l m p120 DROSHA p120 DGCR8 Cad11 DROSHA Cad11 DGCR8

NT NT NT NT

shPLEKHA7 shPLEKHA7 shPLEKHA7 shPLEKHA7

shPLEKHA7 + shp120 shPLEKHA7 + shp120 shPLEKHA7 + shCad11 shPLEKHA7 + shCad11 Supplementary Figure 7 Supplementary Figure 7 Regulation of the microprocessor at the ZA is of control (NT), PLEKHA7 knockdown (shPLEKHA7), PLEKHA7+p120 PLEKHA7-depended. (a-c) IF of Caco2 cells transfected with either the wild (shPLEKHA7+shp120), and PLEKHA7+Cadherin-11 (shPLEKHA7+shCad11) type murine mp120-1A (1A) construct or the murine mp120-ΔARM1 (ΔARM1) double knockdown Caco2 cells for the indicated miRNAs (individual data construct that cannot bind E-cadherin, both stained with the murine-specific points and mean from n=2 independent experiments are shown). (j,k) IF of p120 antibody 8D11 (mp120) and co-stained with PLEKHA7, DROSHA, or control (NT), PLEKHA7 knockdown (shPLEKHA7), and PLEKHA7+p120 DGCR8. Arrows indicate affected junctional staining of the indicated markers double knockdown (shPLEKHA7+shp120) Caco2 cells for DROSHA in transfected cells. (d) IF of control (NT) or p120 knockdown (shp120) and DGCR8, co-stained with p120. (l,m) IF of control (NT), PLEKHA7 Caco2 cells for DROSHA and p120. (e) qRT-PCR of control (NT) and p120 knockdown (shPLEKHA7), and PLEKHA7+Cadherin-11 double knockdown knockdown (shp120) Caco2 cells for the miRNAs shown (mean ± s.d. from (shPLEKHA7+Cad11) Caco2 cells for DROSHA and DGCR8, co-stained with n=3 independent experiments; *P<0.05, Student’s two-tailed t-test). (f) IF of Cadherin 11 (Cad11). Non-specific cytoplasmic or nuclear background appears control (DMSO) or Nocodazole (10 μΜ for 8h) treated Caco2 cells for PLEKHA7, respectively for the two Cadherin-11 antibodies used in the IF (see Methods DROSHA, or DGCR8. (g,h) IF of control (NT) or NEZHA knockdown (shNEZHA) for antibody details). All scale bars: 20 μM. Source data for panels e and i are Caco2 cells for DROSHA and DGCR8, co-stained with NEZHA. (i) qRT-PCR provided in Supplementary Table 2.

WWW.NATURE.COM/NATURECELLBIOLOGY 7

kDa Fig. 2d kDa Fig. 3d Fig. 3e kDa 202 206 206 PLEKHA7 118 PLEKHA7 97 118 PLEKHA7 114 97 97 202 54 Actin 114 p120 206 37 118 p130CAS 73 NT #8#10 97 shPLEKHA7 54 Src 202 206 37 p- 118 114 97 p120 97 p120:Y228 p-p130CAS: 54 54 73 Actin Y165 37 37 53 TRIM21 29 206 p-Src: 36 118 97 Y416 28 206 p-p120:Y228 118 54 97 Actin 37 202 IQGAP1 54 29 114 206 p-p120:Y96 17 73 118 97 NT #8#10 202 NT #8#10 shPLEKHA7 114 shPLEKHA7 73 ACTN1 53 kDa Fig. 3f kDa Fig. 3g 203 36 HNRNP PLEKHA7 202 117 A2B1 114 PLEKHA7 28 52 72 36 114 28 SNAI1 202 EWS 114 p120 73 72 203 202 Cad11 47 CCAR1 117 Actin 114 77 33 73 27 52 202 36 CCND1 114 Cad11 28 72 shPLEKHA7 - + + 77 LZRS-PLEKHA7-myc - - + IPs 52 MYC (~62kDa) 36 202 72 28 MYC 114 p-p120: 47 77 72 Y228 47 52 VIM short 47 Fig. 3h 33 exposure 33 SNAI1 78 α-Tubulin 27 CCND1 203 53 27 117 FAK 36 77 28 SNAI1 52 202 36 114 p-p120: Actin 28 72 Y96

NT #8#10 shPLEKHA7

Supplementary Figure 8 Supplementary Figure 8 Full western blot scans. Multiple experiments are shown here per case. Molecular weights are indicated on the left; the were routinely run on every gel and the membranes were cut and blotted for cropped images shown in the respected Figure panels are indicated in yellow multiple antibodies for each experiment. The cut blots for each antibody boxes.

8 WWW.NATURE.COM/NATURECELLBIOLOGY

kDa Fig. 4b Fig. 4c kDa Fig. 4d 211 PLEKHA7 202 PLEKHA7 118 114 205 72 p-p120:Y228 78 PLEKHA7 113 p120 202 211 79 202 114 118 p120 114 78 72 72 205 Ecad 113 33 211 79 33 27 118 p130CAS 27 78 SNAI1 CCND1 34 SNAI1 72 27 211 47 Cad11 p-p130CAS: 202 118 Y165 33 78 17 114 27 72 34 MYC 36 SNAI1 CCND1 28 27 202 202 17 114 36 114 72 72 79 p-p130CAS: 28 CCND1 p130CAS Y165 MYC 47 211 (~62kDa) 118 Cad11 78 37 47 78 33 MYC 53 27 205 Actin p-p130CAS: Y165 53 113 --+ + Actin 79 shPLEKHA7 36 PP2 - + - + - + + shPLEKHA7 - - + shp120 205 113 p130CAS 79 Fig. 5c Fig. 4e kDa kDa 50 211 47 37 118 SNAI1 p120 Actin 78 25 37 - + + shPLEKHA7 - - + shEcad 75 MYC 50 (~62kDa) 211 118 Fig. 4f 78 p120 50 PLEKHA7 Cad11 53 kDa 37 CCND1 36 SNAI1 211 25 28 118 78

211 Actin SNAI1 118 p-p120: Y228 CCND1 78 53 36 anti- miRs: 211 28 118 Cad11 17 78 53 Actin 36 Actin MYC 78 53 36 53 28 36 shPLEKHA7 - - + + - - + + Supplementary Figure 8 shCad11 - + - + - + - + (part 2)

Supplementary Figure 8 continued

WWW.NATURE.COM/NATURECELLBIOLOGY 9

Fig. 5d Fig. 6b Fig. 6h kDa kDa kDa 201 DROSHA PLEKHA7 202 114 114 202 PLEKHA7 74 114 DGCR8 114 47 73 34 73 Lamin A/C SNAI1 47 114 27 77 p120 17 Histone H3 73 6 47 MYC 202 114 DROSHA 47 77 33 GAPDH 202 34 27 CCND1 114 DGCR8 77 47 27 Actin 33 47 Actin 34 IPs 27

miR-mimics total non- nuclear nuclear NT shPLEKHA7

Fig. 6i Fig. 8a kDa Fig. 6j kDa kDa 202 202 DROSHA PLEKHA7 202 PLEKHA7 114 114 DGCR8 114 73 202 p120 short exposure: 202 202 114 DROSHA DROSHA 114 77 114 DGCR8 73 202 114 DGCR8 DROSHA 73 73 Lamin A/C 114 47 114 DGCR8 17 Histone H3 77 6 IPs 47 33 GAPDH IPs 27

Supplementary Figure 8 continued

Supplementary Figure 8 (part 3)

10 WWW.NATURE.COM/NATURECELLBIOLOGY

Supplementary Table Legends

Supplementary Table 1 The proteins identified by proteomics of junctional fractions. Supplementary Table 2 The source data file. Supplementary Table 3 The antibodies used in the study.