Discovery of LEAFY Transcriptional Complex Components Necessary for Flower Formation in Arabidopsis Thaliana

Discovery of LEAFY Transcriptional Complex Components Necessary for Flower Formation in Arabidopsis thaliana

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Nirodhini Srimali Siriwardana, B.Sc.

Graduate Program in Department of Plant Cellular and Molecular Biology

The Ohio State University

2011

Dissertation Committee:

Dr. Rebecca Lamb, Advisor

Dr. David Somers

Dr. Iris Meier

Dr. Patrice Hamel

Nirodhini Srimali Siriwardana

2011

ABSTRACT

For successful reproduction, angiosperms must form fertile flowers in the appropriate positions and at the appropriate time. The timing of flower formation is especially important for annual plants, such as the model Arabidopsis thaliana used in this study.

Floral fate is controlled by a set of genes termed floral meristem identity genes, the most important of which is the plant-specific transcription factor LEAFY (LFY). LFY‟s function can be divided into two phases, which are both temporally and genetically separable. In the first phase, LFY controls the expression of genes, such as other floral meristem identity factors, that control phyllotaxy and organ number. In the second phase,

LFY is necessary for activation of the floral organ identity genes, which are responsible for differentiating the organs of the flower from each other.

LFY is a transcription factor that does not have transcriptional activation or repression activities on its own and therefore must act in multiprotein complexes. Region- and stage- specific control of LFY target genes is provided by co-factors. However, until very recently little information was available about other factors that are present in such LFY- containing complexes. This work aims to identify components of LFY transcriptional complexes and characterize their function(s) in flower development. We demonstrate that

LFY acts as a homodimer, which is mediated by a domain that is conserved across land ii

plant LFY orthologs, suggesting that dimerization is important for the function of the entire LFY family. We report the isolation of putative LFY-interacting proteins and their preliminary characterization. Finally, we present an in depth analysis of one such LFY- interacting protein, FRIEND OF LEAFY1 (FOL1), which is a novel C2H2 zinc finger transcription factor. FOL1 is expressed in inflorescence meristems, floral meristems, male and female gametophytes and in embryos. Based on gain of function and loss of function analyses, FOL1 appears to function in control of meristem size and gametophyte development. We also discuss FOL1‟s physical and genetic interactions with LFY.

The conservation of LFY sequence and functions across angiosperms suggests that most if not all of the LFY-interacting proteins identified in Arabidopsis will also function with

LFY orthologs in other plants, including important crops. Therefore this work will provide a basis for the development of new strategies to increase agronomical values such as increased yield by manipulating LFY-interacting proteins in economically important crops.

iii

Dedicated to the most amazing person in my life, my mother (‘amma’).

ACKNOWLEDGMENTS

I could not have done without the help, guidance and critical thinking of my advisor, Dr.

Rebecca Lamb. Her positive attitude towards my work and also a friendly atmosphere made my PhD possible. I would like to thank my committee, Drs. David Somers, Iris

Meier and Patrice Hamel for their constructive criticism and suggestions, which made my research work, stand strong.

Two past lab members Dr. Sachin Teotia and Andrew Moreo initiated this project in the lab and deserves a special note for their work. A special thanks to former graduate student Dr. Srilakshmi Makkena for moral support, for technical help and being there for me as a friend. I would like to thank a former undergraduate, Matthew Tegowski, who helped me tremendously with the work in Chapter 4 and especially for making me laugh in stressful times. I wish to thank undergraduates, Sterling Field, Irene Gentzel and

Alyssa Larue for helping me with my research work. My sincere thanks to Matteo

Citarelli for the help received with the alignment figures and with computer issues.

I am specially thankful to my Aronoff and Rightmire “friends in science”, especially to

Sowmya Venkatakrishnan my batch mate, not only for help in research work but also for being there for me every step of the way. Sivaramakrishnan Muthuswamy, Mintu Desai,

Joanna Boruc, Thushani Rodrigo-Peiris for encouraging words. I will never forget my dear friends Rosario Barbieri, Elisa Leyva-Guerrero, Vanessa Falcao and Zoee Gokhale with whom I spent most of my time in my first few years.

A special thanks to all the staff members of our department, especially to Rene Hickey,

Laurel Shannon and Eduardo Acosta for helping me whole-heartedly whenever I needed help. Also a special thanks to the Biological Sciences green house staff, Joan Leonard and Emily Yoders-Horn for help and support in growing plants.

I thank ABRC for supplying us with seeds and Drs. T. Nakagawa, John Lindbo and Keith

Slotkin for providing vectors.

Special thanks to my dear mother and my sister, without them I couldn‟t have done all this. To my “friends in life” Sharon, Indi, Mekhala, Chamika, Poorani, Shekar, Harshi and Suresh for their encouraging words, laughs and relaxing times which no doubt gave me strength and motivation, especially in the last few months of my PhD.

Above all to my love, my husband Ravindra Amunugama for helping me in my most stressful times, in every possible way. Most of all, by loving me and by taking care of our little son. And finally to my happiness, my son Rehan Luc Amunugama for making me the happiest mom on earth, you are the joy of my life!

VITA

2003...... B.Sc. Honors, Plant Biology, University of

Colombo, Sri Lanka

2003-2004………………………………….. Teaching Associate, Plant Biology,

University of Colombo, Sri Lanka

2004 to present ...... Graduate Teaching Associate, Department

of Plant Cellular and Molecular Biology,

The Ohio State University, U.S.A

FIELD OF STUDY

Major Field: Plant Cellular and Molecular Biology

vii

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGMENTS ...... v

VITA ...... vii

FIELD OF STUDY ...... vii

TABLE OF CONTENTS ...... viii

LIST OF TABLES ...... xii

LIST OF FIGURES ...... xiii

CHAPTER 1: The Poetry of Reproduction: Flower Formation in Arabidopsis thaliana ...... 1

1.1 Arabidopsis flower development ...... 2 1.1.1 Events at the transition to flowering ...... 2 1.1.1a Converting the VM to IM- the roles of flowering pathways, flowering time regulators and integrators ...... 4 1.1.1b FM initiation-the role of the floral meristem identity genes ...... 10 1.1.1c Flower organ development- the role of organ identity genes...... 14 1.1.2 Maintaining FM identity ...... 16

1.2 LEAFY (LFY) ...... 19 1.2.1 Evolution of LFY ...... 19 1.2.2 Role of LFY in flowering ...... 20 1.2.2.1 LFY is involved in precise timing of the floral transition as well as maintaining floral fate...... 22

viii

1.2.2.2 LFY controls floral homeotic gene expression and is necessary for floral organ identity and differentiation...... 24 1.2.3 LFY as a transcription factor ...... 24 1.2.4 LFY co-regulators ...... 25

1.3 Research Objectives ...... 28

1.4 Significance of this study ...... 30

REFERENCES ...... 40

CHAPTER 2: Flower Formation in Arabidopsis thaliana is Dependent on Dimerization of LEAFY ...... 52

2.1 INTRODUCTION...... 53

2.2 RESULTS ...... 56 2.2.1 LFY protein homodimerizes ...... 56 2.2.2 LFY dimerizes through a censerved region in its N-terminus ...... 57 2.2.3 Overexpressing LFY dimerization domain interferes with endogenous LFY function ...... 59 2.2.4 Mutations within the dimerization domain abrogate dimer formation ...... 62 2.2.5 Dimerization is essential for LFY function ...... 63

2.3 DISCUSSION ...... 65 2.3.1 LFY forms dimers ...... 65 2.3.2 LFY-LFY association is necessary for function ...... 68 2.3.3 Conclusion ...... 69

2.4 EXPERIMENTAL PROCEDURES ...... 70 2.4.1 Plant material and growth conditions ...... 70 2.4.2 Constructs and cloning ...... 70 2.4.3 Generation of Arabidopsis transgenic lines and transient infiltration of N.benthamiana leaves ...... 72 2.4.4 Yeast two-hybrid interaction assay ...... 73 2.4.5 Bimolecular Fluorescence Complementation Assay ...... 73 2.4.6 RNA isolation and quantitative Real Time-PCR ...... 74 2.4.7 Computational analysis ...... 74 2.4.8 In vitro transcription/translation, invitro binding and electrophoretic mobility shift assay ...... 75 2.4.9 Co-immunoprecipitation assay ...... 76 2.4.10 GUS staining ...... 77 2.4.11 lfy-6 mutant complementation experiments ...... 77 2.4.12 Phenotypic analysis of transgenic lines ...... 78

REFERENCES ...... 105

CHAPTER 3: Identification of LEAFY Complex Components in Arabidopsis thaliana ...... 108

3.1 INTRODUCTION...... 109

3.2 RESULTS ...... 115 3.2.1 35S::LFY-TAP compliments lfy-6 mutants ...... 115 3.2.2 Purification and identification of LFY complex components ...... 116 3.2.3 Putative LFY complex components selected ...... 118 3.2.4 LFY complex components are localized in the nucleus ...... 120 3.2.5 CHR9 interacts with LFY ...... 121 3.2.6 Loss of CHR9 causes seed lethality ...... 121 3.2.7 LMI1 interacts with LFY ...... 122 3.2.8 Overexpression of LMI1 causes floral defects ...... 123

3.3 DISCUSSION ...... 124 3.3.1 Putative LFY-interacting proteins identified by TAP purification ...... 124 3.3.2 LMI1 interacts with LFY ...... 127 3.3.3 Conclusions ...... 127

3.4 EXPERIMENTAL PROCEDURES ...... 129 3.4.1 Plant material and growth conditions ...... 129 3.4.2 Constructs and cloning ...... 129 3.4.3 TAP tag purification and detection ...... 130 3.4.4 Mass spectrometry analysis ...... 131 3.4.5 Yeast two-hybrid interaction assay ...... 131 3.4.6 Bimolecular Fluorescence Complementation Assay ...... 132 3.4.7 Computational analysis ...... 132 3.4.8 Genomic DNA preparation and genotyping ...... 132 3.4.9 Co-immunoprecipitation assay ...... 133 3.4.10 lfy-6 mutant complementation experiments ...... 133 3.4.11 Phenotypic analysis of transgenic lines ...... 133

REFERENCES ...... 146

CHAPTER 4: The C2H2 Zinc Finger Transcription Factor FRIEND OF LEAFY1 (FOL1) has Roles in Meristem Identity and Size Control in Arabidopsis thaliana . 152

4.1 INTRODUCTION...... 153

4.2 RESULTS ...... 158

4.2.1 FOL1 has orthologs across the land plants ...... 158 4.2.2 The spatial and temporal expression pattern of FOL1 marks the sites of cell proliferation...... 159 4.2.3 Phenotypic analysis of insertion mutant lines exhibits the necessity of FOL1 for gametophyte development ...... 161 4.2.4 Knock down of FOL1 causes meristem defects ...... 162 4.2.5 Ectopic expression of FOL1 suggests a meristem function ...... 166 4.2.6 FOL1 interacts with LFY ...... 167 4.2.7 FOL1 interacts genetically with LFY ...... 169

4.3 DISCUSSION ...... 171 4.3.1 FOL1 marks the sites of cell proliferation ...... 171 4.3.2 FOL1 is necessary for gametophyte development ...... 172 4.3.3 FOL1 controls inflorescence meristem size ...... 173 4.3.4 FOL1 controls floral meristem identity and size ...... 175 4.3.5 FOL1 is a LFY interacting partner ...... 177 4.3.6 Conclusions ...... 178

4.4 EXPERIMENTAL PROCEDURES ...... 179 4.4.1 Plant material and growth conditions ...... 179 4.4.2 Constructs and cloning ...... 179 4.4.3 Yeast two-hybrid interaction assay ...... 182 4.4.4 Bimolecular Fluorescence Complementation Assay (BiFC) ...... 182 4.4.5 Genomic DNA preparation and genotyping ...... 183 4.4.6 RNA isolation and semi quantitative Real Time-PCR (RT-PCR) ...... 183 4.4.7 Co-immunoprecipitation assay ...... 25 4.4.8 GUS staining ...... 184 4.4.9 Phenotypic analysis of transgenic lines ...... 184 4.4.10 Alexander Staining ...... 185 4.4.10 Computational Analysis ...... 185

REFERENCES ...... 206

A COMPLETE LIST OF REFERENCES ...... 210

APPENDIX A: A Complete list of proteins identified from TAP tag-purification ...... 230

LIST OF TABLES

2.1 Trangenic lines examined ...... 99

2.2 Both conserved domains and dimerization are required for LFY function ...... 100

2.3 List of primers used in Chapter 2 ...... 101

2.4 Probes used for EMSA ...... 104

3.1 Putative LFY-interacting proteins selected from TAP purification ...... 143

3.2 List of primers used in Chapter 3 ...... 144

4.1 List of primers used in Chapter 4 ...... 203

A.1 A complete list of proteins identified from TAP tag-purification ...... 230

xii

LIST OF FIGURES

1.1. The Arabidopsis thaliana reproductive transition ...... 31

1.2. Schematic representation of reproductive and floral transitions ...... 32

1.3. Integration of flowering time pathways to regulate the expression of floral

pathway integrators: FT, SOC1 and LFY ...... 33

1.4. Regulation of FM identity...... 34

1.5. The ABCE model of floral development ...... 35

1.6. Maintenance of FM identity ...... 36

1.7. LFY is a floral meristem identity gene ...... 37

1.8. Ectopic expression of LFY is sufficient to convert meristems into flowers ...... 38

1.9. LFY and its orthologs contain two conserved domains ...... 39

2.1. LFY homodimerizes in yeast ...... 79

2.2. LFY-LFY homodimers form in planta ...... 80

2.3. LFY homodimers exist in both N. benthamiana leaves and Arabidopsis

inflorescences ...... 81

2.4. Ectopic expression of LFY causes formation of solitary flowers ...... 82

2.5. A schematic representation of LFY deletion fragments used in this study ...... 83

2.6. The N-terminal conserved domain of LFY mediates homodimerization ...... 84

2.7. The entire conserved domain is necessary for LFY dimerization ...... 85

xiii

2.8. The N-terminal conserved domain mediates LFY homodimerization in vivo ...... 86

2.9 Overexpression of LFYΔ229-420-GFP causes a lfy-like phenotype ...... 87

2.10 LFYΔ229-420 forms a higher order DNA binding complex with LFY ...... 88

2.11 The dominant negative phenotype caused by 35S:: LFYΔ229-420-GFP is due to

reduced LFY target gene expression and correlates with transgene expression ... 89

2.12 The LFY dimerization domain is conserved across land plants and may form an

alpha helical structure ...... 91

2.13 Mutations within the LFY dimerization domain abrogate dimerization ...... 92

2.14 Mutations within the dimerization domain abrogate LFY interaction in yeast .... 93

2.15 Mutations within the dimerization domain abrogate LFY-LFY association in vivo

...... 94

2.16 Both conserved regions of LFY are required for function ...... 95

2.17 Overexpression of LFYL/A-GFP causes weak lfy-like phenotypes ...... 96

2.18 Dimerization is essential for LFY function in planta ...... 97

2.19 LFYL/A cannot activate AP3 expression ...... 98

3.1 Tandem affinity purification of LFY-containing complexes from Arabidopsis

inflorescences ...... 134

3.2 Gene structures of the genes encoding putative-LFY binding proteins ...... 135

3.3 Putative LFY-binding proteins are found in inflorescence and in same subcellular

compartments as LFY ...... 136

3.4 LFY and CHR9 physically associate in vivo ...... 137

3.5 Reduced fertility is observed in chr9-1 plants ...... 138

3.6 LMI1 interactions in Y2H assay ...... 139

xiv

3.7 LMI1 and LFY physically associate in vivo ...... 140

3.8 Overexpression of LMI1 causes floral development defects ...... 142

4.1 Structural features of FOL1 protein and gene ...... 186

4.2 Phylogenetic tree of FOL1 and its orthologs from selected land plants ...... 187

4.3 Alignment of FOL1 and its orthologs from selected land plants ...... 188

4.4 Expression pattern of FOL1 ...... 189

4.5 FOL1p::GUS expression in developing flowers and embryos ...... 190

4.6 FOL1 expression is confined to very young seedlings and reproductive tissues 191

4.7 fol1-1 and fol1-2 have gametophyte defects ...... 192

4.8 FOL1 amiRNA lines have reduced transcript accumulation ...... 193

4.9 FOL1 knockdown causes meristem defects ...... 194

4.10 FOL1 knockdown causes meristem size defects ...... 195

4.11 35S::FOL1 causes an arrested SAM in the L.er background ...... 196

4.12 Ectopic expression of FOL1 causes reduced stature and terminal flowers in the

Col-0 background...... 197

4.13 FOL1 homodimerizes ...... 198

4.14 FOL1-LFY interaction in planta ...... 199

4.15 FOL1 interacts with the N-terminus of LFY ...... 201

4.16 FOL1 and LFY interact genetically ...... 202

CHAPTER 1

The Poetry of Reproduction: Flower Formation in Arabidopsis thaliana

“The flower is the poetry of reproduction. It is an example of the eternal seductiveness of life.”

Jean Giraudoux

Reproduction is essential for all organisms. In angiosperms, the unit of reproduction is the flower. Flowering plants undergo a transition from a vegetative phase, during which leaves with associated lateral shoots are produced, to a subsequent reproductive phase, during which flowers are been made (Figure 1.1). Reproductive success depends on initiating flowering at the right time and maintaining reproductive fate until the plant successfully sets seeds. The precise timing of reproduction is especially important in annual plants, which only flower once. The transition to reproduction is influenced not only by internal developmental parameters but also by environmental signals the plant perceives. This introduction will concentrate on reproduction in Arabidopsis thaliana, a model annual angiosperm.

1.1 Arabidopsis flower development

1.1.1 Events at the transition to flowering

Plants, unlike animals, have indeterminate growth, which is mediated by meristems.

Meristems are groups of undifferentiated stem cells that give rise to the plant body. At germination, seedlings contain two such meristems, the shoot apical meristem (SAM) and the root apical meristem (RAM). The SAM produces lateral organs at its flanks as well as producing those cells that form the plant stem. During vegetative growth, the SAM 2

produces lateral leaves with associated axillary meristems. In Arabidopsis, the transition to reproduction can be broken into two phases. During the first phase, the vegetative meristem (VM) becomes an inflorescence meristem (IM; Figure 1.2a). This transformation of the VM into an IM is tightly regulated by both endogenous (hormones, age) and environmental (quality and quantity of light, temperature and day length) pathways. These pathways are integrated by a group of genes known as flowering time genes. The IM will produce several cauline leaves with axillary meristems that recapitulate the development of the primary IM. In addition, Arabidopsis has a rosette growth habit during its vegetative phase, but upon reproductive transition, internode elongation begins, giving rise to the bolt. In the second phase of Arabidopsis reproduction, the lateral organs produced by the IM become flowers. These flowers are not subtended by leaves (bracts); these structures are suppressed. Floral fate of the lateral meristems is due to the action of a number of floral meristem identity genes.

Unlike shoots, flowers are determinate structures that give rise to a set number of floral organs and then cease growth. Floral meristems (FMs) initially have a growth phase during which they increase in size. They then begin to produce floral organs in a whorled pattern, starting at their flanks. These organs are (in order of position from outside to inside) sepals, petals, stamens and carpels (Figure 1.2b). The identities of these organs are controlled by the activity of floral homeotic genes, which are activated by the floral meristem identity genes.

1.1.1a Converting the VM to IM- the roles of flowering pathways, flowering time regulators and integrators

The transition to reproduction and the pathways and signals that control this transition are well studied. Experiments beginning in the 1920s have demonstrated that different plants have varying requirements to trigger flowering (Garner and Allard, 1920). In

Arabidopsis, a number of forward genetic screens have identified many genes that are involved in control of flowering time. Subsequent genetic analysis has defined five pathways in Arabidopsis that control this process: photoperiod, vernalization, autonomous, gibberellic acid (GA) and developmental age pathways (Amasino, 2004;

Araki, 2001; Bastow and Dean, 2003; Boss et al., 2004; Jack, 2004; Martinez-Zapater,

1994; Mouradov et al., 2002; Simpson and Dean, 2002; Sung and Amasino, 2004). Given that there are multiple pathways that regulate the floral transition and feed into an integrated output (Parcy, 2005), it is important to understand how these pathways interact. A recent review (Srikanth and Schmid, 2011) summarizes all the players of these five pathways in depth. Here, I will only concentrate on the confluence of these pathways on the floral transition through the floral pathway integrators: FLOWERING LOCUS T

(FT), SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) and LEAFY

(LFY) as categorized in (Parcy, 2005). Expression of these floral integrators is controlled by multiple signals of the flowering time pathways. The combined input determines expression level, which in turns determines the time of reproduction.

Classical experiments revealed that the leaves are the site of signal perception in the photoperiodic pathway even though the events of floral invocation happen at the shoot apex (Garner and Allard, 1920; Garner and Allard, 1922; Zeevaart, 1976). These early experiments led to the investigation of the component(s) that perceive the signals in the leaves and get transported to the shoot apex to induce flowering, which were termed

„florigen‟. A key component of this mobile flowering signal is the highly conserved gene,

FT, which is one of the floral pathway integrators (Abe et al., 2005; Huang et al., 2005;

Wigge et al., 2005). Mutations in FT cause significant delays in flowering and, conversely, overexpression causes precocious flowering, demonstrating that FT is necessary and sufficient for the reproductive transition (Kardailsky et al., 1999;

Kobayashi et al., 1999; Koornneef, 1991). While a large number of genes are involved in triggering reproduction, the decision of when to flower largely depends on the level of FT expression. The FT gene encodes a small globular protein with similarities to Raf kinase inhibitory protein (RKIP) and a phosphatidylethanolamine-binding protein (PEBP)

(Kardailsky et al., 1999; Kobayashi et al., 1999). This protein is expressed in the vasculature of the leaves and translocates to the SAM (An et al., 2004; Corbesier et al.,

2007; Jaeger and Wigge, 2007; Lifschitz et al., 2006; Lin et al., 2007; Mathieu et al.,

2007; Takada and Goto, 2003; Wigge, 2011). In the SAM, FT interacts with

FLOWERING LOCUS D (FD; Abe et al., 2005; Wigge et al., 2005), a basic leucine zipper transcription factor that is expressed in shoot apex. FT and FD act in a transcriptional complex known to activate the floral meristem identity genes (Abe et al.,

2005; Wigge et al., 2005).

SOC1, another floral pathway integrator, encodes a MADS box transcription factor.

SOC1 is expressed in the leaves and in the shoot apex. Transcription of this gene undergoes a sharp increase in the shoot apex at the floral transition (Borner et al., 2000;

Lee et al., 2000; Samach et al., 2000). Many flowering pathway inputs activate SOC1

(Hepworth et al., 2002; Moon et al., 2003; Searle et al., 2006). SOC1 has been shown to promote activation of the master regulator of flower identity LFY (Lee et al., 2008).

The final floral pathway integrator discussed in this introduction is LFY. LFY is a plant specific transcription factor (Busch et al., 1999) that acts as a meristem identity gene and a regulator of organ identity genes (which will be discussed in detail later in this chapter).

It has been shown to regulate expression of other floral meristem identity genes (Busch et al., 1999; Parcy et al., 1998; Saddic et al., 2006; Wagner et al., 1999; William et al.,

2004; Winter et al., 2011), which is why it is considered a floral integrator gene as well as a floral meristem identity gene.

Control of floral integrator expression by flowering time pathways

The photoperiodic pathway- Arabidopsis is a facultative long day plant and has much accelerated time to flowering under long days. The critical day length for Arabidopsis is about 16 hours of light/ 8 hours of dark. The cascade of events that measure day length and subsequently signal the initiation of flowering are referred to as the photoperiod pathway. Light is perceived by several classes of photoreceptors (phototropins, cryptochromes and phytochromes) in the leaves (Lariguet and Dunand, 2005; Li and

Yang, 2007; Toth et al., 2001). These photoreceptors regulate the expression of many genes through the circadian clock (Fornara et al., 2009; Imaizumi et al., 2005; Sawa et al., 2007) and a recent review (Srikanth and Schmid, 2011) summarizes the players involved. These players then have both direct and indirect effects on CONSTANS (CO) mRNA expression as well as its protein stability and accumulation (Imaizumi et al.,

2005; Sawa et al., 2007; Suarez-Lopez et al., 2001; Valverde et al., 2004 and reviewed in

Srikanth and Schmid, 2011). CO encodes a zinc finger transcription factor (Putterill et al.,

1995), which is expressed in the vasculature of the leaves (Takada and Goto, 2003). It directly turns on FT expression in the leaves, thereby promoting flowering (Kobayashi et al., 1999; Samach et al., 2000; Takada and Goto, 2003; Wigge et al., 2005). CO is also known to induce expression of LFY (Nilsson et al., 1998a; Samach et al., 2000; Simon et al., 1996) and SOC1 (Lee et al., 2000; Samach et al., 2000), other floral pathway integrators (Figure 1.3).

Temperature controls time to flower- FT expression is regulated through temperature in two ways. Many plants need an exposure to a cold period (vernalization) to flower, including some ecotypes of Arabidopsis; in addition, the ambient temperature

Arabidopsis grows in has an effect on the timing to flower, with higher temperatures accelerating the reproduction transition. The well-studied gene FLOWERING LOCUS C

(FLC) is the key regulator in the vernalization pathway (Michaels and Amasino, 1999).

FLC is a MADS box transcription factor that directly binds to regulatory regions of FT and SOC1 and represses their expression, thereby delaying flowering (Figure 1.3;

(Helliwell et al., 2006; Hepworth et al., 2002; Searle et al., 2006; Sheldon et al., 1999)).

FLC is epigenetically silenced by vernalization, thus relieving the floral repression

(Gendall et al., 2001; Levy et al., 2002). As shown in Figure 1.3, repression of FLC removes the antagonistic effect on FT and SOC1 thereby allowing their expression.

The GA pathway- Under short days Arabidopsis will still flower, although it will take much longer. GA is crucial for flowering under these conditions (Blazquez et al., 1998;

Wilson et al., 1992). GA regulates the expression of FT (Figure 1.3; (Hisamatsu and

King, 2008)). In addition, when GA, which is mobile, enters the SAM it activates SOC1 and LFY (Figure 1.3) via the repression of the DELLA proteins, which are growth- suppressing factors and through MYB transcription factor expression (Blazquez et al.,

1998; Moon et al., 2003).

The autonomous pathway- The constitutive or autonomous pathway regulates flowering independently of day length. The major players in this pathway encode mostly chromatin remodeling and RNA processing factors (see review (Srikanth and Schmid, 2011)). These genes promote flowering indirectly by repressing FLC expression (Koornneef et al.,

1998) in both the leaf and SAM, thereby promoting expression of FT to trigger flowering

(Figure 1.3).

Developmental age - Compared to above discussed pathways, not much is known about the pathways that perceive developmental age. However, expression of a recently

discovered microRNA, miR156, decreases with increasing age of the plant, suggesting that this might be a mechanism by which age is measured (Wang et al., 2009; Wu et al.,

2009). The regulation of flowering by miR156 is thought to involve miRNA-mediated repression of a class of genes encoding transcription factors that activate important flowering genes, the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family.

The miR156 regulated SPLs are expressed in SAM, where it is thought they have an important FT-independent role in promotion of flowering though activation of SOC1

(Wang et al., 2009). Recent work also revealed that LFY is a direct target of miR156- regulated SPLs (Figure 1.3; (Yamaguchi et al., 2009)).

Floral pathway integrators

Overall, the above discussed flowering pathways converge mainly on three major floral pathway integrators, FT, SOC1 and LFY (Figure 1.3; (Blazquez and Weigel, 2000;

Kardailsky et al., 1999; Kobayashi et al., 1999; Lee et al., 2000; Lee et al., 2008; Liu et al., 2008; Simpson and Dean, 2002)). As discussed above, before the transition to flowering, FLC represses expression of SOC1 and FT, inhibiting reproductive development. Floral promoters act to increase the expression of FT either by repressing the expression of FLC and thereby activating FT and SOC1 expression or by directly activating the expression of FT and SOC1 to activate floral meristem identity genes

(Helliwell et al., 2006; Searle et al., 2006). FT might participate in the control of SOC1 expression, although the evidence is not conclusive (Schmid et al., 2003). Several of the flowering time pathways also directly regulate expression of LFY. These integrators are

not only convergence points for flowering time pathways, but also appear to regulate each other‟s expression. SOC1 binds to the LFY promoter in vivo to activate LFY expression directly (as shown in Figure 1.3 and Figure 1.4; (Lee et al., 2008; Liu et al.,

2008)). A gradual increase in SOC1 expression in the SAM promotes a gradual increase in LFY in primordia until a threshold is reached, leading to FM identity. Mutant and overexpression studies of FT support the finding that FT upregulates LFY as well

(Kardailsky et al., 1999; Schmid et al., 2003).

1.1.1b FM initiation-the role of the floral meristem identity genes

Once an IM is formed, it will begin generating FMs on its flanks after formation of 2-5 cauline leaves. Floral meristem identity genes are required to specify the lateral meristems as flowers. To date, the known meristem identity proteins in Arabidopsis are

LFY (Blazquez et al., 1997; Nilsson et al., 1998a; Weigel et al., 1992), the related MADS box transcription factors APETALA1 (AP1; (Bowman et al., 1993; Mandel et al., 1992)

(Ferrandiz et al., 2000b; Irish and Sussex, 1990)), CAULIFLOWER (CAL; (Ferrandiz et al., 2000b; Kempin et al., 1995)) and FRUITFUL (FUL; (Ferrandiz et al., 2000b)) and the class 1 HD-Zip transcription factor LATE MERISTEM IDENTITY1 and its paralogs

(Saddic et al., 2006). All of the genes encoding these proteins are expressed in FMs

(Hempel et al., 1997; Mandel et al., 1992; Saddic et al., 2006). In Arabidopsis, LFY and

AP1 are the two most important floral meristem identity regulators (Bowman et al., 1993;

Ferrandiz et al., 2000a; Huala and Sussex, 1992; Mandel and Yanofsky, 1995; Weigel et al., 1992). In addition to these positive promoters of floral identity, there is a negative

regulator of floral fate, TERMINAL FLOWER1 (TFL1), which is expressed in the IM and encodes a member of the CETS (CENTRORADIALIS (CEN), TFL1, FT) family, related to phosphatidylethonalamine binding proteins and FT (Liljegren et al., 1999; Ratcliffe et al., 1999). TFL1 prevents the IM from expressing floral meristem identity genes and becoming a flower, therefore maintaining its indeterminate nature.

LFY was first recognized for its function in flower meristem development. lfy mutants are slightly late flowering, produce extra cauline leaves and have abnormal floral-like structures in which there is homeotic transformation of floral organs to leaf-like structures (see Figure 1.7). LFY directly activates expression of the other floral meristem identity genes, AP1, CAL, FUL and LMI1 (Figure 1.4; (Saddic et al., 2006; William et al.,

2004; Winter et al., 2011)). Combining a mutation in LFY with AP1 and CAL mutations produces plants that have shoots in the place of flowers (Ferrandiz et al., 2000a). LFY will be discussed in more depth below.

The MADS box transcription factor-encoding gene AP1 is the other major floral meristem identity regulator. It is expressed throughout the very young FM before becoming confined to the outer two whorls at stage 3 of floral development (Mandel et al., 1992). AP1 expression is directly activated by LFY as well as by FT (Figure 1.4;

(Abe et al., 2005; Wagner et al., 1999; Wigge et al., 2005)). AP1 is involved in regulating genes promoting floral organ formation and repressing flowering time genes to maintain the floral fate of the meristem (Hill et al., 1998; Liu et al., 2007; Ng and Yanofsky, 2001;

Tilly et al., 1998; Yu et al., 2004). In ap1 mutants, extra cauline leaves are made before the formation of flowers. ap1 flowers have leaf-like sepals and no petals, although stamen and carpel development are normal. In addition, ectopic flowers form in the axils of the leaf-like sepals, a phenotype that has been interpreted as a floral meristem identity defect (Bowman et al., 1993; Irish and Sussex, 1990). Loss of AP1 function is not as severe as loss of its orthologs in other groups of angiosperms due to the presence of the

CAL gene. CAL is a paralog of AP1 found in Brassicas that is partially redundant with

AP1 (Kempin et al., 1995). ap1-1; cal-1 mutants show complete transformation of flowers into IMs, although loss of CAL alone has no phenotype (Bowman et al., 1993).

However, eventually the IMs of ap1-1; cal1-1 plants will form differentiated flowers that resemble the flowers of ap1 single mutants. This is due to the activity of FUL, the closest gene to AP1/CAL in the Arabidopsis genome (Ferrandiz et al., 2000b). Loss of all three of these genes leads to a severe meristem identity defect (Ferrandiz et al., 2000b). AP1,

CAL, FUL appear to be potential activators of LFY (Figure 1.4; (Ferrandiz et al.,

2000b)).

In addition to the genes discussed above, LMI1 and its paralogs are important for floral meristem identity (Saddic et al., 2006). An lmi1 mutant enhances the meristem defects of the weak lfy-10 allele, hence the name LATE MERISTEM IDENTITY1 (Saddic et al.,

2006). lmi1 mutants on their own have very subtle or no meristem defects. LMI1 acts upstream of CAL and together with LFY regulates CAL expression directly (Figure 1.4;

(Saddic et al., 2006)).

In Arabidopsis, the IM remains indeterminate and does not form a terminal flower. This is due to the activity of TFL1 in the IM. AP1 and LFY repress TFL1 expression in floral meristems, suppressing IM fate (Figure 1.4; (Liljegren et al., 1999; Parcy et al., 2002)).

TFL1 in turn suppresses the expression of AP1 and LFY in the IM (Ratcliffe et al., 1998).

The balance between these genes is what regulates shoot architecture (Bradley et al.,

1997). In fact, during the domestification of soybean (Glycine max), mutant alleles of the

GmTFL1 gene were selected because they conferred a determinate growth habit, an agronomically important trait (Tian et al., 2010).

Flower development stages

Morphological changes that take place during flower development have been well studied in Arabidopsis. Flower development can be divided into 12 stages (Smyth et al., 1990).

The initial setting aside of FM founder cells from the IM is considered stage 0 (Long and

Barton, 2000). At stage 1, the FM emerges as an outgrowth on the flanks of the IM, with each new FM forming at an angle of 1300-1500 to the one before. At stage 2, the FM develops further into a ball like structure, which is now morphologically distinguishable from the IM. At stage 3, the primordia of the sepals arise and thereafter the rest of the floral organs appear in order. At stage 5, the petal and stamen primordia become visible.

Stage 7 begins when primordial of the growing stamen becomes stalked at the base creating the filament. Stage 13 is when the buds open and anthesis takes place (Smyth et al., 1990).

1.1.1c Flower organ development- the role of organ identity genes.

Once the meristem has transitioned to a floral fate, it gives rise to a determinate floral structure, consisting of four whorls of organs: sepals, petals, stamens and carpels in a whorled phyllotaxy. The identity of the floral organs depends on the activity of floral homeotic genes, which can be divided into four classes, A, B, C and E (reviewed in

(Krizek and Fletcher, 2005)). The A, B and C genes act in a combinatorial manner to specify each organ type. The relatively recently identified SEPALLATA genes (SEP1-4) function redundantly with other homeotic genes in specifying floral organs (class E;

Figure 1.5; (Ditta et al., 2004; Pelaz et al., 2000)). Class A genes function alone to specify sepal identity in the outermost whorl. Class A and B genes together specify petals in the second whorl. Class B and C genes specify stamens in the third whorl and class C alone functions to specify carpal identity in the inner most whorl (Figure 1.5). A and C genes also negatively regulate each other (Bowman et al., 1991b; Coen and Meyerowitz,

1991; Weigel and Meyerowitz, 1994). All the floral homeotic genes encode MADS box transcription factors (Irish, 2010; Sablowski, 2010) with the exception of one APETALA2

(AP2), which encodes a founding member of a plant specific group of transcription factors, the AP2/EREBP family (Riechmann and Meyerowitz, 1998).

AP1 and AP2 are class A genes. As mentioned above, AP1 is also a floral meristem identity gene and is initially expressed throughout the floral meristem (Mandel et al.,

1992). However, due to the negative regulation by the C gene product AGAMOUS (AG),

AP1 expression is restricted to whorls 1 and 2 at stage 3 where it functions in sepal and

petal identity (Bowman et al., 1991a; Gustafson-Brown et al., 1994; Mandel et al., 1992).

AP2 is expressed throughout the floral meristem, but its mRNA gets restricted to whorl 1 and 2 through the action of a microRNA, miR172, which negatively regulates its accumulation in the 3rd and 4th whorls (Aukerman and Sakai, 2003; Chen, 2004).

In Arabidopsis, two B class genes, APETALA3 (AP3) and PISTILLATA (PI), function to specify petal and stamen identity. AP3 and PI and are expressed in whorls 2 and 3

(Bowman et al., 1989; Goto and Meyerowitz, 1994; Jack et al., 1992). Their gene products bind to DNA as an obligate heterodimer (Riechmann et al., 1996).

The C class gene AG’s expression is restricted to whorls 3 and 4. As mentioned above, A and C gene functions negatively regulate each other. AP1 together with two transcriptional repressors, LEUNIG (LUG) and SEUSS (SEU), binds to regulatory sequences of AG, preventing AG expression in the outer two whorls (Sridhar et al., 2004;

Sridhar et al., 2006).

The SEP genes (class E) are expressed throughout the floral meristem and are necessary to differentiate the floral organs from leaves. They encode four redundant MADS box transcription factors. A triple mutant of class E genes (sep1; sep2; sep3) has all floral organs replaced by sepals (Pelaz et al., 2000) while the quadruple mutant (sep1; sep2; sep3; sep4) has leaves in the place of floral organs (Ditta et al., 2004). These findings

suggest that the functions of class E genes are to pre-establish the floral context for the other organ identity genes to function in.

1.1.2 Maintaining FM identity

Once the FMs are made, it is important to maintain their identity so floral reversion is prevented. Floral reversion is the reinitiation of shoot growth from a partially formed flower and was first described in 1880 (Buckhout, 1880). In Arabidopsis, floral reversion has been observed in floral meristem identity mutants including lfy and ap1 under the noninductive short day photoperiod (Bowman et al., 1993). This phenotype is partially due to the inappropriate expression of three flowering time genes, AGAMOUS-LIKE 24

(AGL24), SHORT VEGETATIVE PHASE (SVP) and SOC1 (Liu et al., 2007; Yu et al.,

2004). Loss of function mutants in these three genes individually or in combination reduces reversion defects seen in ap1 mutants (Liu et al., 2007). It has been shown that

AP1 binds directly to promoters of these genes and represses their expression (Figure

1.6a; (Gregis et al., 2008; Liu et al., 2007)). Overexpression of AGL24 promotes the transformation of FMs into IMs, overexpression of SOC1 further enhances this and overexpression of SVP converts the FMs into vegetative shoots (Liu et al., 2007; Yu et al., 2004). In contrast to AP1, LFY might not have a direct effect on these flowering time genes (Gregis et al., 2008; Yu et al., 2004). It is possible LFY maintains FMs through its regulation of AP1 (Figure 1.6a; (William et al., 2004)). Clearly, an important function of floral meristem identity genes is to repress, directly or indirectly, expression of flowering time genes to maintain floral fate.

The class E organ identity genes also contribute in maintaining the FM identity by repressing flowering time gene activity. The study of the sep1; sep2; sep3; sep4 quadruple mutant has shown that in this background secondary meristems arise, similar to what is seen in ap1 mutants. This indicates that SEPs not only act as floral organ identity genes but also have a role in FM specification (Ditta et al., 2004). Chromatin immunoprecipitation has shown that SEP3 directly binds to the promoters of both AGL24 and SVP (Figure 1.6a; (Gregis et al., 2008)). sep mutants have AGL24 and SVP expressed in the FM beyond their normal time of expression. This data suggests that SEPs act as repressors of AGL24 and SVP to maintain FM identity (Figure 1.6a).

While flowering time genes must be turned off to ensure proper FM development, the plant needs to prevent early differentiation of the floral organs by controlling the expression of floral homeotic genes as well. Therefore, flowering time genes cooperate with floral meristem identity genes to repress floral homeotic gene expression until the proper time in FM development. The class B and C genes are repressed before stage 3 of floral development by the repression of SEP3 expression (necessary for their activation) by the direct activity of AGL24, SVP and SOC1 (Figure 1.6a; (Liu et al., 2009b)). In soc1; agl24; svp triple mutants, SEP3 together with LFY synergistically activates Class B and C genes early, resulting in floral defects (Liu et al., 2009b). Overall, maintaining

AGL24, SVP and SOC1 at appropriate levels at appropriate times is crucial to FMs.

Overexpression of these genes will cause floral reversion where as lower expression will cause precocious differentiation of floral organs.

Another group of regulators repressing floral organ identity gene expression are the chromatin regulators. Epigenetic control of organ identity genes is an area of study in which there is growing interest. Flower development is particularly sensitive to epigenetic control, possibly due to the strict regulation required. The Polycomb Group

(PcG) proteins inhibit transcription by maintaining a repressed chromatin state of inactive genes through the formation of multiprotein complexes that catalyze the tri-methylation of lysine 27 of histone H3 (H3K27me3) on target genes (Chanvivattana et al., 2004;

Farrona et al., 2008; Goodrich et al., 1997; Katz et al., 2004). (Liu et al., 2009a) gives a list of such proteins that inhibit the transcription of floral homeotic genes. The first plant polycomb protein indentified, CURLY LEAF (CLF), was found because of its function in repressing AG and AP3 expression in leaves (Goodrich et al., 1997) and AG in the inflorescence stem and in the first two whorls of the flower (Goodrich et al., 1997;

Schubert et al., 2006). EMRYONIC FLOWER 2 (EMF2) and FERTILIZATION

INDEPENDENT ENDOSPERM (FIE), which are also PcG proteins, repress AP3 and AG during vegetative growth (Chen et al., 1997; Kinoshita et al., 2001; Yoshida et al., 2001).

EMBRYONIC FLOWER 1 (EMF1) together with EMF2 represses AG expression during vegetative development (Calonje et al., 2008). TERMINAL FLOWER 2 (TFL2), also known as LIKE-HETEROCHROMATIN PROTEIN 1 (LHP1), is expressed in proliferating cells of meristems, including in the FM, and binds to chromatin marked with

H3K27me3 (Zhang et al., 2007). TFL2 directly associates with regulatory regions of

AP3, PI, AG and SEP3 and represses their expression during vegetative growth (Figure

1.6a; (Kotake et al., 2003; Turck et al., 2007; Zhang et al., 2007)). Clearly, epigenetic control of floral homeotic genes is essential for proper development.

Flowers are determinate structures. Therefore, they must stop organ production and growth after formation of the two carpels of the 4th whorl. The C class gene AG is necessary for this. WUSCHEL (WUS) is a homeobox transcription factor that is necessary to maintain all shoot meristems in an indeterminate state (Lenhard et al., 2001;

Lohmann et al., 2001). AG represses WUS expression in the FM, terminating meristematic identity of the floral meristem (Figure 1.6a; (Lenhard et al., 2001; Lohmann et al., 2001)).

1.2 LEAFY (LFY)

LFY is a plant-specific transcription factor that does not belong to any known transcription factor family (Busch et al., 1999). Unlike many other transcription factors that have evolved by gene duplication to form multigene families (Riechmann and

Ratcliffe, 2000), LFY is present as a single copy in most of the angiosperms. This makes

LFY unique among transcription factors in plants.

1.2.1 Evolution of LFY

The LFY gene is conserved throughout land plant species, from bryophytes (the moss

Physcomitrealla patens) to flowering plants (Maizel et al., 2005). In moss, the LFY

orthologs PpLFY1 and PpLFY2 regulate the first division of the zygote (Tanahashi et al.,

2005). In gymnosperms and angiosperms, LFY is associated with reproductive structure formation (cones and flowers, respectively). Studies in gymnosperms identified two LFY- like genes: LFY and NEEDLY (NLY) (Albert et al., 2002); at the base of the angiosperms, the NLY-like gene disappeared and only the LFY-like gene persisted (Albert et al., 2002).

Studies done using 144 different species across the land plants demonstrated that the ability to complement the Arabidopsis lfy mutant decreases as the evolutionary difference from Arabidopsis increases and that this is due to changes in the DNA binding specificity of the more distantly related proteins (Maizel et al., 2005).

Although control of floral meristem identity is the core function of LFY genes in angiosperms, in some species additional roles have been acquired. Some of these functions include involvement in SAM development in tobacco (Ahearn et al., 2001), compound leaf development in legumes (Hofer et al., 1997) and tomato (Molinero-

Rosales et al., 1999) and panicle branching in rice (Kyozuka et al., 1998a). In this

Chapter, I will introduce only LFY‟s functions in flower formation, concentrating on the model angiosperm Arabidopsis thaliana.

1.2.2 Role of LFY in flowering

LFY plays two main roles in flowering, which are both temporal and genetically separable (Parcy et al., 1998). Firstly, LFY acts as a meristem identity regulator and activates other important floral meristem identity regulators. During this phase of

activity, LFY regulates phyllotaxy in the flower as well as meristem size and organ number. Secondly, LFY is necessary for activation of floral organ identity genes. LFY also directly or indirectly helps to maintain FM identity.

Loss of LFY function causes meristems that would normally make flowers to instead produce cauline leaves and associated lateral shoots (Figure 1.7a, b; (Weigel et al.,

1992)). Although flowering time is slightly delayed (Blazquez et al., 1997), LFY function is apparently not essential for the transition to reproduction, since this take place normally. Eventually lfy plants will form structures that have both shoot-like and flower- like characteristics and consist of many leaf-like organs and abnormal carpels in a partially spiral phyllotaxy (Figure 1.7f; (Weigel et al., 1992)). This is due to the fact that, in Arabidopsis, later-arising flowers have only a partial requirement for LFY because the

AP1 meristem identity gene, which shares some functions with LFY, can become activated independently (Bowman et al., 1993; Huala and Sussex, 1992; Wigge et al.,

2005). lfy mutant flower-like structures are subtended by bracts that normally are suppressed in Arabidopsis (Figure 1.7d; (Huala and Sussex, 1992; Schultz and Haughn,

1991; Weigel et al., 1992)). Conversely, overexpression of LFY leads to early flowering and causes all axillary meristems to produce solitary flowers and termination of the apical meristem in a flower (Figure 1.8; (Weigel and Nilsson, 1995)). Therefore, LFY is both necessary and sufficient for floral identity.

1.2.2.1 LFY is involved in precise timing of the floral transition as well as maintaining floral fate.

LFY expression is first detectable in leaf primordia at a very low level and increases until a certain threshold is reached; once the threshold is reached, the primordia are specified as flowers. In other words, the level of LFY in the plant is the trigger to produce flowers

(Blazquez et al., 1997; Hempel et al., 1997). Thus, when the number of copies of LFY is altered, timing of flower formation is changed (Blazquez et al., 1997). The level of LFY reflects the quantity and the quality of different flowering signals the plant perceives

(Blazquez et al., 1998; Blazquez and Weigel, 2000; Hempel et al., 1997; Lee et al., 2008;

Nilsson et al., 1998a). Previous studies done on flowering time mutants show that in late flowering mutants, LFY expression is delayed, while in early flowering mutants, its expression is accelerated (Nilsson et al., 1998a). Since LFY has been shown to be downstream of all the known pathways that control flowering time (Aukerman et al.,

1999; Blazquez et al., 1998; Nilsson et al., 1998b; Weigel et al., 2000) and expression of the other key meristem identity gene in Arabidopsis, AP1, is observed only after the floral transition has been initiated (Hempel et al., 1997; Mandel et al., 1992; Simon et al., 1996) and LFY is a direct activator of AP1 transcription (Wagner et al., 1999) as well as at least two other meristem identity genes, CAL (William et al., 2004) and LMI1 (Saddic et al.,

2006; Winter et al., 2011), LFY is the key player in the transition (Figure 1.4). This is supported by data from other angiosperms, where the orthologs of LFY are the predominant floral meristem identity genes and the AP1 orthologs have a much more minor role (for example, tomato FALSIFLORA (Molinero-Rosales et al., 1999) and

MACROCALYX (Vrebalov et al., 2002) and pea UNIFOLIATA (Hofer et al., 1997) and

PEAM4 (Berbel et al., 2001)).

Once the transition to flower formation has occurred, it is important to maintain this status for successful reproduction, especially in annual plants like Arabidopsis. Studies done in Arabidopsis shows that this is archived by the mutual feedback regulation of the meristem identity genes. LFY activates AP1 and CAL by binding their regulatory sequences (Wagner et al., 1999; William et al., 2004), while in turn AP1 and CAL further promote LFY expression (Figure 1.4). Another requirement to maintain floral identity is repression of the negative meristem identity regulator TFL1. This is achieved by direct repression of TFL1 in the floral meristems by LFY and AP1 and repression of LFY and

AP1 expression in the IM by TFL1 (Figure 1.4; (Bowman et al., 1993; Bradley et al.,

1997; Liljegren et al., 1999; Ratcliffe et al., 1998; Shannon and Meekswagner, 1993;

Weigel et al., 1992)). This balance between TFL1 and the floral meristem identity genes allow the plants to transit to flowering in a timely manner and to maintain a stable switch to flowering, which is important for the survival of the plant species. As discussed in the previous section, AP1 plays an important role in the precise timing of early events in the establishment of the floral meristem by repressing AGL24, SVP and SOC1 (Figure 1.6a;

(Gregis et al., 2008; Liu et al., 2007)). Therefore, a complex network exists between floral meristem identity genes, flowering time genes and inflorescence meristem identity genes to produce flowers in the correct time and place.

1.2.2.2 LFY controls floral homeotic gene expression and is necessary for floral organ identity and differentiation.

After initiating the meristem identity switch, LFY has a second role in flower development through activation of the floral organ identity genes, particularly class B genes (Figure 1.6a; (Weigel and Meyerowitz, 1994)). LFY directly activates the expression of the B class genes AP3 and PI (Lamb et al., 2002; Winter et al., 2011). AP1 also regulates these genes (Ng and Yanofsky, 2001). LFY directly activates the class C gene AG (Busch et al., 1999). However, LFY is not absolutely required for AG expression as lfy mutants have detectable amounts of AG expression (Weigel and

Meyerowitz, 1993). LFY also directly activates the SEP genes (Winter et al., 2011). As discussed previously, LFY is also necessary for full activation of AP1 expression

(Wagner et al., 1999). Therefore, LFY is required for proper expression of most of the known A, B, C and E genes, with the exception of AP2.

1.2.3 LFY as a transcription factor

LFY is a plant-specific transcription factor that directly binds to its target genes through a

DNA binding domain with similarity to helix-turn-helix motifs (Busch et al., 1999;

Hames et al., 2008). LFY has two highly conserved domains, a N-terminal domain had been hypothesized to be involved in transcriptional activation and a highly conserved, well-studied C-terminal DNA binding domain (Figure 1.9; (Coen et al., 1990; Maizel et al., 2005)). Outside of these regions there is very little similarity. Genome wide binding and expression studies have showed that LFY can act as both a transcriptional activator 24

and repressor (Wagner et al., 1999; William et al., 2004; Winter et al., 2011). However,

LFY does not seem to have either activation or repression activity on its own (R.S. Lamb, unpublished data; (Busch et al., 1999)). LFY regulates gene expression by recognizing pseudopalindromic sequence elements (CCANTGT/G) in the promoters of its target genes (Busch et al., 1999; Lamb et al., 2002; Lamb and Irish, 2003; Lohmann et al.,

2001; Parcy et al., 1998). The crystal structure of the LFY C-terminus bound to DNA, shows that the DNA binding domain comprises of seven helices and two short beta- strands connected by short loops (Hames et al., 2008). Helices 2 and 3 occupy the major grove and mediate most of the DNA contacts. This has more accurately defined the binding sequence as T/ANNNNCCANTGG/TNNNNT/A (with the center of the pseudo palindrome underlined; (Hames et al., 2008)). This motif has the previously defined consensus as the core. The three putative LFY binding sites described in the AP1 promoter (Benlloch et al., 2011) also conform well to this new definition. Several recent papers have also found this expanded consensus sequence for LFY binding sites in flowering-related genes (Moyroud et al., 2011; Winter et al., 2011).

1.2.4 LFY co-regulators

LFY and known LFY co-factors act together to regulate region/domain- and stage- specific floral homeotic gene expression. As discussed before, LFY is expressed during vegetative phase and increases gradually till floral transition and in young flower floral buds LFY is uniformly expressed (Blazquez et al., 1997). How does uniformly expressed

LFY lead to whorl-specific expression of organ identity genes? The results of the studies 25

done with LFY-VP16 (Parcy et al., 1998) suggested the involvement of LFY co-factors in activating organ identity genes. The current evidence shows that LFY is responsible for domain specific and stage specific activation of ABCE genes though acting together with co-factors.

UNUSUAL FLORAL ORGANS (UFO) was shown to physically interact with LFY both in vitro and in vivo. UFO is expressed in a domain similar to that of the B class genes

AP3 and PI. Even though LFY is uniformly expressed in young buds, because of the expression pattern of UFO, LFY activates B class genes only in the second and third whorls (Levin and Meyerowitz, 1995; Wilkinson and Haughn, 1995). Experimentally it was shown that LFY and UFO both were needed to activate AP3::GUS activity (Honma and Goto, 2000; Parcy et al., 1998). UFO is an F-box protein (Ingram et al., 1995;

Samach et al., 1999). F-box proteins form part of SCF ubiquitin ligase complexes that polyubiquitinate proteins, targeting them for destruction via the 26S proteasome (Ni et al., 2004; Sullivan et al., 2003; Wang et al., 2003). (Samach et al., 1999) proposed that

UFO might be degrading negative regulators of AP3 expression. However, the current model is that UFO is involved in modifying LFY in order to enhance its transcriptional activity, although no evidence has been found for ubiquitnation of LFY (Chae et al.,

2008). Similar activities for F-box proteins has been reported previously in yeast and mammals (Muratani and Tansey, 2003).

WUSCHEL is one of the key genes involved in maintaining stem cell populations of the meristems. In stage 6 flowers the termination of WUS expression is what causes floral meristem termination (Lenhard et al., 2001; Lohmann et al., 2001). In addition, WUS also functions as a co-factor of LFY in regulating expression of AG in the inner whorls. LFY and WUS bind very closely together on AG cis-elements but do not physically interact with each other (Busch et al., 1999; Hong et al., 2003; Lenhard et al., 2001; Lohmann et al., 2001). Both LFY and WUS have to bind to activate AG (Lohmann et al., 2001). WUS is expressed only in the center of the meristem (Mayer et al., 1998), giving spatial specificity to the activation of AG.

PERIANTHIA (PAN) is a bZIP protein that also activates AG (Maier et al., 2009; Das et al., 2009). LFY and PAN bind to binding sites in the AG second intron to promote AG expression and a lfy mutation enhances the floral defects of pan mutations, suggests PAN most likely acts as a co-factor of LFY (Maier et al., 2009; Das et al., 2009).

SEP3 was recently shown to be a LFY co-factor in addition to its function as an E-class gene (Castillejo et al., 2005; Liu et al., 2009b; Kaufmann et al., 2009). LFY and SEP3 work together to activate ABCE genes (Castillejo et al., 2005). LFY and SEP3 were shown to physically interact using in vitro GST-immunoprecipitation assay (Liu et al.,

2009c).

Another co-factor of LFY is encoded by SPLAYED (SYD). SYD is a member of the

Snf2p ATPase family of chromatin remodeling factors. It was identified though a genetic screen done to isolate enhancers of weak lfy mutant phenotypes (Wagner and

Meyerowitz, 2002). SYD acts as an LFY-dependent repressor of meristem identity switch although it is not known if they function in the same physical complexes.

A very recent publication (Winter et al., 2011) identified potential LFY cofactor motifs from a de novo bioinformatic motif analysis. Two such motifs, GA-repeat hexamers and octamers, were proposed to help recruit stage specific LFY co-factors. This type of repeats is often found in Polycomb Responsive Elements (PREs). It is already known that polycomb factors such as CLF regulate LFY targets, suggesting that these proteins also act as LFY co-factors.

Although effort has been made in identifying LFY co-factors, only two proteins (UFO and SEP3) have been shown to physically interact with LFY, making it likely that other factors in LFY transcriptional complexes remain to be identified.

1.3 Research Objectives

The research work carried out over the years on LFY has identified the roles LFY performs as a master regulator in flowering. However, until very recently little information was available about other factors that are present in LFY transcriptional

complexes. The research work described in this thesis will focus on understanding the protein composition and function of LFY-containing transcriptional complexes.

Chapter 2- Like many other transcription factors, LFY activates its target genes by recognizing a psedopalindromic region in the promoters of these genes (Benlloch et al.,

2011; Busch et al., 1999; Hong et al., 2003; Lamb et al., 2002; Lohmann et al., 2001;

Moyroud et al., 2011; Parcy et al., 1998; Winter et al., 2011). Binding to a palindromic region increases binding affinity for DNA as well as increases the specificity by having doubling the length of the binding site. We show that LFY homodimerizes and this homodimerization is important for its function in planta. The dimerization is mediated by the conserved N-terminal domain, which is a likely reason that this domain is conserved across land plants

Chapter 3- As described, LFY acts as a transcription factor at early and late stages of flower development. LFY does not have strong transcriptional activity by itself (R.S.

Lamb, unpublished data; (Busch et al., 1999)). LFY is expressed during vegetative phase and increases gradually till floral transition and in young flower stages 0-7 (Blazquez et al., 1997). How does uniformly expressed LFY lead to whorl-specific expression of organ identity genes? There is strong evidence that shows LFY acts with other regulatory factors in performing its functions in different stages and in different floral domains

(Chae et al., 2008; Lee et al., 1997; Lenhard et al., 2001; Lohmann et al., 2001; Parcy et al., 1998; Wagner and Meyerowitz, 2002). In Chapter 3, we report our biochemical

isolation of putative LFY-interacting proteins in Arabidopsis thaliana. We provide preliminary characterization of four of these proteins.

Chapter 4- From our biochemical isolation of LFY-containing complexes, we identified a novel C2H2 zinc finger transcription factor that we named FRIEND OF LFY1 (FOL1).

We present our characterization of this protein and the gene that encodes it. FOL1 is expressed in inflorescence meristems, floral meristems, male and female gametophytes, embryos and young seedlings. Based on gain of function and loss of function analysis,

FOL1 appears to function in control of meristem size and gametophyte development. We also discuss FOL1‟s physical and genetic interactions with LFY.

1.4 Significance of this study

The conservation of LFY across plant species suggests that most if not all of the LFY- interacting proteins identified in Arabidopsis will also function with LFY orthologs in other plants. LFY expression promotes early flowering in a number of commercially important crops, including rice (Orysa sativa) and poplar (Populus trichocarpa)

(Kyozuka et al., 1998a; Kyozuka et al., 1998b; Rottmann et al., 2000). Therefore unraveling the transcriptional complexes in which LFY performs its functions will provide a basis for the development of new strategies to increase agronomical values such as increased yield by manipulating LFY-interacting proteins in economically important crops.

Figure 1.1. The Arabidopsis thaliana reproductive transition. During the vegetative phase, rosette leaves are produced without internode elongation. Upon transition to reproduction, internode elongation is activated to form the bolt. Arrowheads indicate indeterminate growth.

Figure 1.2. Schematic representation of reproductive and floral transitions. (a) Conversion of a vegetative meristem (VM) into inflorescence meristem (IM) and the formation of floral meristem (FM) at the flanks of the IM. L- lateral leaf primordia. (b) Micrograph of a wild type flower showing floral organs: sepals, petals, stamens and carpels.

Figure 1.3. Integration of flowering time pathways to regulate the expression of the floral pathway integrators FT, SOC1 and LFY. The photoperiod pathway regulates CO, which activates FT, SOC1 and LFY expression. The vernalization pathway represses FLC, which is a repressor of FT and SOC1 expression, thereby promoting flowering. The autonomous pathway also represses FLC to regulate the expression of FT and SOC1. The GA pathway acts directly on LFY and SOC1 to promote flowering. The developmental age pathway acts through miRNA regulated SPL genes to activate SOC1 and LFY.

Figure 1.4. Regulation of FM identity (Figure modified from (Liu et al., 2009a)). Flowering pathway integrators FT, SOC1 and LFY activate meristem identity genes (LFY, AP1, FUL, CAL and LMI1). TFL1, a repressor of floral meristem identity is regulated through LFY and AP1. Blue arrows indicate promoting, red linkers indicates repressive effects. Asterisks indicate direct transcription regulation.

Figure 1.5. The ABCE model of floral development. Diagrams of flowers showing sepals, petals, stamens, and carpel in whorl 1-4, respectively. (a) Original ABC model. (b) ABCE model. Underneath the flower is the model aligned with the respective organ. The colors used in the ABC model for different classes and the colors marking the organs are color matched. Barred lines indicate mutual repression between A and C class genes.

Figure 1.6. Maintenance of FM identity (a) Schematic diagram representing the players in FM identity maintenance. Blue arrows indicate promoting activity, red lines indicates repressive effects. (b) Schematic representation of flower development stages and the players involved in FM identity maintenance. At each stage the active genes are given below. Stronger expression is indicated with larger, bold font. IM-inflorescence meristem. FM-floral meristem. FMi- incipient/ immature FM.

Figure 1.7. LFY is a floral meristem identity gene. Micrographs of Arabidopsis plants and flowers. (a) L. er plant. (b) lfy-6 plant. Numbers indicate cauline leaves with subtending branches along the primary stem. (c) Top of L. er inflorescence. (d) Top of lfy-6 inflorescence. (e) WT flower. (f) lfy-6 mutant flower. Note partially spiral phyllotaxy in (f). White arrows indicate bracts, red arrows indicate partially fused carpel- like organs, yellow arrowhead indicates leaf-like sepals.

Figure 1.8. Ectopic expression of LFY is sufficient to convert meristems into flowers. Micrographs of 35S::LFY plants. Black arrows indicate solitary flowers formed by axillary meristems, red arrows indicate terminal flowers.

Figure 1.9. LFY and its orthologs contain two conserved domains. Amino acid alignment of selected LFY orthologs from across land plants. The conserved N- terminal region is marked with a red bar. The conserved C- terminal DNA binding domain is marked with a blue bar. At, Arabidopsis thaliana; Pt, Populus trichocarpa; Vv, Vitis vinifera; FALSIFLORA. Solanum lycopersicon LFY ortholog; FLO, Antirrhinum majus LFY ortholog; RFL, Oryza sativa LFY ortholog; Nymod, Nymphea odorata; PRFLL, Pinus radiata LFY ortholog; Wel, Welwitscia mirabilis; Cr, Ceratopteris thalictroides; Sel, Selaginella moellendorfi; Pp, Physcomitrella patens.

REFERENCES

Abe, M., Y. Kobayashi, S. Yamamoto, Y. Daimon, A. Yamaguchi, Y. Ikeda, H. Ichinoki, M. Notaguchi, K. Goto, and T. Araki. 2005. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science. 309:1052-1056. Ahearn, K.P., H.A. Johnson, D. Weigel, and D.R. Wagner. 2001. NFL1, a Nicotiana tabacum LEAFY-like gene, controls meristem initiation and floral structure. Plant Cell Physiol. 42:1130-1139. Albert, V.A., D.G. Oppenheimer, and C. Lindqvist. 2002. Pleiotropy, redundancy and the evolution of flowers. Trends Plant Sci. 7:297-301. Amasino, R. 2004. Vernalization, competence, and the epigenetic memory of winter. The Plant cell. 16:2553-2559. An, H., C. Roussot, P. Suarez-Lopez, L. Corbesier, C. Vincent, M. Pineiro, S. Hepworth, A. Mouradov, S. Justin, C. Turnbull, and G. Coupland. 2004. CONSTANS acts in the phloem to regulate a systemic signal that induces photoperiodic flowering of Arabidopsis. Development. 131:3615-3626. Araki, T. 2001. Transition from vegetative to reproductive phase. Current opinion in plant biology. 4:63-68. Aukerman, M.J., I. Lee, D. Weigel, and R.M. Amasino. 1999. The Arabidopsis flowering-time gene LUMINIDEPENDENS is expressed primarily in regions of cell proliferation and encodes a nuclear protein that regulates LEAFY expression. Plant J. 18:195-203. Aukerman, M.J., and H. Sakai. 2003. Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell. 15:2730-2741. Bastow, R., and C. Dean. 2003. Plant sciences. Deciding when to flower. Science. 302:1695-1696. Benlloch, R., M.C. Kim, C. Sayou, E. Thevenon, F. Parcy, and O. Nilsson. 2011. Integrating long-day flowering signals: a LEAFY binding site is essential for proper photoperiodic activation of APETALA1. The Plant journal : for cell and molecular biology. Berbel, A., C. Navarro, C. Ferrandiz, L.A. Canas, F. Madueno, and J.P. Beltran. 2001. Analysis of PEAM4, the pea AP1 functional homologue, supports a model for AP1-like genes controlling both floral meristem and floral organ identity in different plant species. The Plant journal : for cell and molecular biology. 25:441-451.

Blazquez, M.A., R. Green, O. Nilsson, M.R. Sussman, and D. Weigel. 1998. Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter. Plant Cell. 10:791-800. Blazquez, M.A., L. Soowal, I. Lee, and D. Weigel. 1997. LEAFY expression and flower initiation in Arabidopsis. Development. 124:3835-3844. Blazquez, M.A., and D. Weigel. 2000. Integration of floral inductive signals in Arabidopsis. Nature. 404:889-892. Borner, R., G. Kampmann, J. Chandler, R. Gleissner, E. Wisman, K. Apel, and S. Melzer. 2000. A MADS domain gene involved in the transition to flowering in Arabidopsis. The Plant journal : for cell and molecular biology. 24:591-599. Boss, P.K., R.M. Bastow, J.S. Mylne, and C. Dean. 2004. Multiple pathways in the decision to flower: enabling, promoting, and resetting. The Plant cell. 16 Suppl:S18-31. Bowman, J.L., J. Alvarez, D. Weigel, E.M. Meyerowitz, and D.R. Smyth. 1993. Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development. 119:721-743. Bowman, J.L., G.N. Drews, and E.M. Meyerowitz. 1991a. Expression of the Arabidopsis floral homeotic gene agamous is restricted to specific cell types late in flower development. The Plant Cell. 3:749-758. Bowman, J.L., D.R. Smyth, and E.M. Meyerowitz. 1989. Genes directing flower development in Arabidopsis. Plant Cell. 1:37-52. Bowman, J.L., D.R. Smyth, and E.M. Meyerowitz. 1991b. Genetic interactions among floral homeotic genes of Arabidopsis. Development. 112:1-20. Bradley, D., O. Ratcliffe, C. Vincent, R. Carpenter, and E. Coen. 1997. Inflorescence commitment and archnitecture in Arabidopsis. Science. 275:80-83. Buckhout, W.A. 1880. Reversion in Floral Parts. Science. 1:310-311. Busch, M.A., K. Bomblies, and D. Weigel. 1999. Activation of a floral homeotic gene in Arabidopsis. Science. 285:585-587. Calonje, M., R. Sanchez, L. Chen, and Z.R. Sung. 2008. EMBRYONIC FLOWER1 participates in polycomb group-mediated AG gene silencing in Arabidopsis. The Plant cell. 20:277-291. Castillejo, C., M. Romera-Branchat, and S. Pelaz. 2005. A new role of the Arabidopsis SEPALLATA3 gene revealed by its constitutive expression. The Plant journal : for cell and molecular biology. 43:586-596. Chae, E., Q.K. Tan, T.A. Hill, and V.F. Irish. 2008. An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development. Development. 135:1235-1245. Chanvivattana, Y., A. Bishopp, D. Schubert, C. Stock, Y.H. Moon, Z.R. Sung, and J. Goodrich. 2004. Interaction of Polycomb-group proteins controlling flowering in Arabidopsis. Development. 131:5263-5276. Chen, L., J.C. Cheng, L. Castle, and Z.R. Sung. 1997. EMF genes regulate Arabidopsis inflorescence development. Plant Cell. 9:2011-2024. Chen, X. 2004. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science. 303:2022-2025.

Coen, E.S., and E.M. Meyerowitz. 1991. The war of the whorls: genetic interactions controlling flower development. Nature. 353:31-37. Coen, E.S., J.M. Romero, S. Doyle, R. Elliot, G. Murphy, and R. Carpenter. 1990. Floricaula : a homeotic gene required for flower development in Antirrhinum majus. Cell. 63:1311-1322. Corbesier, L., C. Vincent, S. Jang, F. Fornara, Q. Fan, I. Searle, A. Giakountis, S. Farrona, L. Gissot, C. Turnbull, and G. Coupland. 2007. FT protein movement contributes to long-distance signaling in floral induction of Arabidopsis. Science. 316:1030-1033. Das, P., T. Ito, F. Wellmer, T. Vernoux, A. Dedieu, J. Traas, and E.M. Meyerowitz. 2009. Floral stem cell termination involves the direct regulation of AGAMOUS by PERIANTHIA. Development. 136:1605-1611. Ditta, G., A. Pinyopich, P. Robles, S. Pelaz, and M.F. Yanofsky. 2004. The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr Biol. 14:1935-1940. Farrona, S., G. Coupland, and F. Turck. 2008. The impact of chromatin regulation on the floral transition. Semin Cell Dev Biol. 19:560-573. Ferrandiz, C., Q. Gu, R. Martienssen, and M.F. Yanofsky. 2000a. Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development. 127:725-734. Ferrandiz, C., Q. Gu, R. Martienssen, and M.F. Yanofsky. 2000b. Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development. 127:725-734. Fornara, F., K.C. Panigrahi, L. Gissot, N. Sauerbrunn, M. Ruhl, J.A. Jarillo, and G. Coupland. 2009. Arabidopsis DOF transcription factors act redundantly to reduce CONSTANS expression and are essential for a photoperiodic flowering response. Dev Cell. 17:75-86. Garner, W.W., and H.A. Allard. 1920. Effect of the relative length of day and night on flowering and fruiting of plants. Garner, W.W., and H.A. Allard. 1922. Photoperiodism, the Response of the Plant to Relative Length of Day and Night. Science. 55:582-583. Gendall, A.R., Y.Y. Levy, A. Wilson, and C. Dean. 2001. The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell. 107:525-535. Goodrich, J., P. Puangsomlee, M. Martin, D. Long, E.M. Meyerowitz, and G. Coupland. 1997. A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature. 386:44-51. Goto, K., and E.M. Meyerowitz. 1994. Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes and Development. 8:1548-1560. Gregis, V., A. Sessa, L. Colombo, and M.M. Kater. 2008. AGAMOUS-LIKE24 and SHORT VEGETATIVE PHASE determine floral meristem identity in Arabidopsis. Plant J. 56:891-902.

Gustafson-Brown, C., B. Savidge, and M.F. Yanofsky. 1994. Regulation of the Arabidopsis homeotic gene APETALA1. Cell. 76:131-143. Hames, C., D. Ptchelkine, C. Grimm, E. Thevenon, E. Moyroud, F. Gerard, J.L. Martiel, R. Benlloch, F. Parcy, and C.W. Muller. 2008. Structural basis for LEAFY floral switch function and similarity with helix-turn-helix proteins. EMBO J. 27:2628- 2637. Helliwell, C.A., C.C. Wood, M. Robertson, W. James Peacock, and E.S. Dennis. 2006. The Arabidopsis FLC protein interacts directly in vivo with SOC1 and FT chromatin and is part of a high-molecular-weight protein complex. Plant J. 46:183-192. Hempel, F.D., D. Weigel, M.A. Mandel, G. Ditta, P.C. Zambryski, L.J. Feldman, and M.F. Yanofsky. 1997. Floral determination and expression of floral regulatory genes in Arabidopsis. Development. 124:3845-3853. Hepworth, S.R., F. Valverde, D. Ravenscroft, A. Mouradov, and G. Coupland. 2002. Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs. The EMBO journal. 21:4327-4337. Hill, T.A., C.D. Day, S.C. Zondlo, A.G. Thackeray, and V.F. Irish. 1998. Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development. 125:1711-1721. Hisamatsu, T., and R.W. King. 2008. The nature of floral signals in Arabidopsis. II. Roles for FLOWERING LOCUS T (FT) and gibberellin. Journal of experimental botany. 59:3821-3829. Hofer, J., L. Turner, R. Hellens, M. Ambrose, P. Matthews, A. Michael, and N. Ellis. 1997. UNIFOLIATA regulates leaf and flower morphogenesis in pea. Current biology : CB. 7:581-587. Hong, R.L., L. Hamaguchi, M.A. Busch, and D. Weigel. 2003. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing. The Plant cell. 15:1296-1309. Honma, T., and K. Goto. 2000. The Arabidopsis floral homeotic gene PISTILLATA is regulated by discrete cis-elements responsive to induction and maintenance signals. Development. 127:2021-2030. Huala, E., and I.M. Sussex. 1992. LEAFY interacts with floral homeotic genes to regulate Arabidopsis floral development. The Plant Cell. 4:901-913. Huang, T., H. Bohlenius, S. Eriksson, F. Parcy, and O. Nilsson. 2005. The mRNA of the Arabidopsis gene FT moves from leaf to shoot apex and induces flowering. Science. 309:1694-1696. Imaizumi, T., T.F. Schultz, F.G. Harmon, L.A. Ho, and S.A. Kay. 2005. FKF1 F-box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis. Science. 309:293-297. Ingram, G.C., J. Goodrich, M.D. Wilkinson, R. Simon, G.W. Haughn, and E.S. Coen. 1995. Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell. 7:1501-1510.

Irish, V.F. 2010. The flowering of Arabidopsis flower development. Plant J. 61:1014- 1028. Irish, V.F., and I.M. Sussex. 1990. Function of the apetala-1 gene during Arabidopsis floral development. The Plant cell. 2:741-753. Jack, T. 2004. Molecular and genetic mechanisms of floral control. The Plant cell. 16 Suppl:S1-17. Jack, T., L.L. Brockman, and E.M. Meyerowitz. 1992. The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell. 68:683-697. Jaeger, K.E., and P.A. Wigge. 2007. FT protein acts as a long-range signal in Arabidopsis. Current biology : CB. 17:1050-1054. Kardailsky, I., V.K. Shukla, J.H. Ahn, N. Dagenais, S.K. Christensen, J.T. Nguyen, J. Chory, M.J. Harrison, and D. Weigel. 1999. Activation tagging of the floral inducer FT. Science. 286:1962-1965. Katz, A., M. Oliva, A. Mosquna, O. Hakim, and N. Ohad. 2004. FIE and CURLY LEAF polycomb proteins interact in the regulation of homeobox gene expression during sporophyte development. Plant J. 37:707-719. Kaufmann, K., J.M. Muino, R. Jauregui, C.A. Airoldi, C. Smaczniak, P. Krajewski, and G.C. Angenent. 2009. Target genes of the MADS transcription factor SEPALLATA3: integration of developmental and hormonal pathways in the Arabidopsis flower. PLoS biology. 7:e1000090. Kempin, S., B. Savidge, and M.F. Yanofsky. 1995. Molecular basis of the cauliflower phenotype in Arabidopsis. Science. 267:522-525. Kinoshita, T., J.J. Harada, R.B. Goldberg, and R.L. Fischer. 2001. Polycomb repression of flowering during early plant development. Proceedings of the National Academy of Sciences of the United States of America. 98:14156-14161. Kobayashi, Y., H. Kaya, K. Goto, M. Iwabuchi, and T. Araki. 1999. A pair of related genes with antagonistic roles in mediating flowering signals. Science. 286:1960- 1962. Koornneef, M. 1991. Isolation of higher plant developmental mutants. Symposia of the Society for Experimental Biology. 45:1-19. Koornneef, M., C. Alonso-Blanco, H. Blankestijn-de Vries, C.J. Hanhart, and A.J. Peeters. 1998. Genetic interactions among late-flowering mutants of Arabidopsis. Genetics. 148:885-892. Kotake, T., S. Takada, K. Nakahigashi, M. Ohto, and K. Goto. 2003. Arabidopsis TERMINAL FLOWER 2 gene encodes a heterochromatin protein 1 homolog and represses both FLOWERING LOCUS T to regulate flowering time and several floral homeotic genes. Plant & cell physiology. 44:555-564. Krizek, B.A., and J.C. Fletcher. 2005. Molecular mechanisms of flower development: an armchair guide. Nat Rev Genet. 6:688-698. Kyozuka, J., S. Konishi, K. Nemoto, T. Izawa, and K. Shimamoto. 1998a. Down- regulation of RFL, the FLO/LFY homolog of rice, accompanied with panicle branch initiation. Proc Natl Acad Sci U S A. 95:1979-1982.

Kyozuka, J., S. Konishi, K. Nemoto, T. Izawa, and K. Shimamoto. 1998b. Down- regulation of RFL, the FLO/LFY homolog of rice, accompanied with panicle branch initiation. Proceedings of the National Academy of Sciences of the United States of America. 95:1979-1982. Lamb, R.S., T.A. Hill, Q.K. Tan, and V.F. Irish. 2002. Regulation of APETALA3 floral homeotic gene expression by meristem identity genes. Development. 129:2079- 2086. Lamb, R.S., and V.F. Irish. 2003. Functional divergence within the APETALA3/PISTILLATA floral homeotic gene lineages. Proc Natl Acad Sci U S A. 100:6558-6563. Lariguet, P., and C. Dunand. 2005. Plant photoreceptors: phylogenetic overview. J Mol Evol. 61:559-569. Lee, H., S.S. Suh, E. Park, E. Cho, J.H. Ahn, S.G. Kim, J.S. Lee, Y.M. Kwon, and I. Lee. 2000. The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis. Genes Dev. 14:2366-2376. Lee, I., D.S. Wolfe, O. Nilsson, and D. Weigel. 1997. A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Current Biology. 7:95-104. Lee, J., M. Oh, H. Park, and I. Lee. 2008. SOC1 translocated to the nucleus by interaction with AGL24 directly regulates leafy. Plant J. 55:832-843. Lenhard, M., A. Bohnert, G. Jürgens, and T. Laux. 2001. Termination of Stem Cell Maintenance in Arabidopsis Floral Meristems by Interactions between WUSCHEL and AGAMOUS. Cell. 105:805-814. Levin, J.Z., and E.M. Meyerowitz. 1995. UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell. 7:529-548. Levy, Y.Y., S. Mesnage, J.S. Mylne, A.R. Gendall, and C. Dean. 2002. Multiple roles of Arabidopsis VRN1 in vernalization and flowering time control. Science. 297:243- 246. Li, Q.H., and H.Q. Yang. 2007. Cryptochrome signaling in plants. Photochem Photobiol. 83:94-101. Lifschitz, E., T. Eviatar, A. Rozman, A. Shalit, A. Goldshmidt, Z. Amsellem, J.P. Alvarez, and Y. Eshed. 2006. The tomato FT ortholog triggers systemic signals that regulate growth and flowering and substitute for diverse environmental stimuli. Proc Natl Acad Sci U S A. 103:6398-6403. Liljegren, S.J., C. Gustafson-Brown, A. Pinyopich, G.S. Ditta, and M.F. Yanofsky. 1999. Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate. Plant Cell. 11:1007-1018. Lin, M.K., H. Belanger, Y.J. Lee, E. Varkonyi-Gasic, K. Taoka, E. Miura, B. Xoconostle-Cazares, K. Gendler, R.A. Jorgensen, B. Phinney, T.J. Lough, and W.J. Lucas. 2007. FLOWERING LOCUS T protein may act as the long-distance florigenic signal in the cucurbits. The Plant cell. 19:1488-1506. Liu, C., H. Chen, H.L. Er, H.M. Soo, P.P. Kumar, J.H. Han, Y.C. Liou, and H. Yu. 2008. Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development. 135:1481-1491.

Liu, C., Z. Thong, and H. Yu. 2009a. Coming into bloom: the specification of floral meristems. Development. 136:3379-3391. Liu, C., W. Xi, L. Shen, C. Tan, and H. Yu. 2009b. Regulation of floral patterning by flowering time genes. Dev Cell. 16:711-722. Liu, C., W. Xi, L. Shen, C. Tan, and H. Yu. 2009c. Regulation of floral patterning by flowering time genes. Developmental cell. 16:711-722. Liu, C., J. Zhou, K. Bracha-Drori, S. Yalovsky, T. Ito, and H. Yu. 2007. Specification of Arabidopsis floral meristem identity by repression of flowering time genes. Development. 134:1901-1910. Lohmann, J.U., R.L. Hong, M. Hobe, M.A. Busch, F. Parcy, R. Simon, and D. Weigel. 2001. A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell. 105:793-803. Long, J., and M.K. Barton. 2000. Initiation of axillary and floral meristems in Arabidopsis. Dev Biol. 218:341-353. Maier, A.T., S. Stehling-Sun, H. Wollmann, M. Demar, R.L. Hong, S. Haubeiss, D. Weigel, and J.U. Lohmann. 2009. Dual roles of the bZIP transcription factor PERIANTHIA in the control of floral architecture and homeotic gene expression. Development. 136:1613-1620. Maizel, A., M.A. Busch, T. Tanahashi, J. Perkovic, M. Kato, M. Hasebe, and D. Weigel. 2005. The floral regulator LEAFY evolves by substitutions in the DNA binding domain. Science. 308:260-263. Mandel, M.A., C. Gustafson-Brown, B. Savidge, and M.F. Yanofsky. 1992. Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature. 360:273-277. Mandel, M.A., and M.F. Yanofsky. 1995. A gene triggering flower formation in Arabidopsis. Nature. 377:522-524. Martinez-Zapater, J.M., Coupland, G., Dean, C., and Kooenneef, M. F. . 1994. The Transition to flowering in Arabidopsis. . New-York: Cold Spring Harbor Laboratory Press. 404-434 pp. Mathieu, J., N. Warthmann, F. Kuttner, and M. Schmid. 2007. Export of FT protein from phloem companion cells is sufficient for floral induction in Arabidopsis. Current biology : CB. 17:1055-1060. Mayer, K.F.X., H. Schoof, A. Haecker, M. Lenhard, G. Jurgens, and T. Laux. 1998. Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell. 95:805-815. Michaels, S.D., and R.M. Amasino. 1999. FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell. 11:949- 956. Molinero-Rosales, N., M. Jamilena, S. Zurita, P. Gomez, J. Capel, and R. Lozano. 1999. FALSIFLORA, the tomato orthologue of FLORICAULA and LEAFY, controls flowering time and floral meristem identity. Plant J. 20:685-693. Moon, J., S.S. Suh, H. Lee, K.R. Choi, C.B. Hong, N.C. Paek, S.G. Kim, and I. Lee. 2003. The SOC1 MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis. Plant J. 35:613-623.

Mouradov, A., F. Cremer, and G. Coupland. 2002. Control of flowering time: interacting pathways as a basis for diversity. The Plant cell. 14 Suppl:S111-130. Moyroud, E., E.G. Minguet, F. Ott, L. Yant, D. Pose, M. Monniaux, S. Blanchet, O. Bastien, E. Thevenon, D. Weigel, M. Schmid, and F. Parcy. 2011. Prediction of regulatory interactions from genome sequences using a biophysical model for the arabidopsis LEAFY transcription factor. The Plant cell. 23:1293-1306. Muratani, M., and W.P. Tansey. 2003. How the ubiquitin-proteasome system controls transcription. Nat Rev Mol Cell Biol. 4:192-201. Ng, M., and M.F. Yanofsky. 2001. Activation of the Arabidopsis B class Homeotic Genes by APETALA1. Plant Cell. 13:739-753. Ni, W., D. Xie, L. Hobbie, B. Feng, D. Zhao, J. Akkara, and H. Ma. 2004. Regulation of flower development in Arabidopsis by SCF complexes. Plant Physiol. 134:1574- 1585. Nilsson, O., I. Lee, M.A. Blazquez, and D. Weigel. 1998a. Flowering time genes modulate the response to LEAFY activity. Genetics. 150:403-410. Nilsson, O., E. Wu, D.S. Wolfe, and D. Weigel. 1998b. Genetic ablation of flowers in transgenic Arabidopsis. Plant J. 15:799-804. Parcy, F. 2005. Flowering: a time for integration. The International journal of developmental biology. 49:585-593. Parcy, F., K. Bomblies, and D. Weigel. 2002. Interaction of LEAFY, AGAMOUS and TERMINAL FLOWER1 in maintaining floral meristem identity in Arabidopsis. Development. 129:2519-2527. Parcy, F., O. Nilsson, M.A. Busch, I. Lee, and D. Weigel. 1998. A genetic framework for floral patterning. Nature. 395:561-566. Pelaz, S., G.S. Ditta, E. Baumann, E. Wisman, and M.F. Yanofsky. 2000. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature. 405:200-203. Putterill, J., F. Robson, K. Lee, R. Simon, and G. Coupland. 1995. The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell. 80:847-857. Ratcliffe, O.J., I. Amaya, C.A. Vincent, S. Rothstein, R. Carpenter, E.S. Coen, and D.J. Bradley. 1998. A common mechanism controls the life cycle and architecture of plants. Development. 125:1609-1615. Ratcliffe, O.J., D.J. Bradley, and E.S. Coen. 1999. Separation of shoot and floral identity in Arabidopsis. Development. 126:1109-1120. Riechmann, J.L., and E.M. Meyerowitz. 1998. The AP2/EREBP family of plant transcription factors. Biol. Chem. 379:633-646. Riechmann, J.L., and O.J. Ratcliffe. 2000. A genomic perspective on plant transcription factors. Curr Opin Plant Biol. 3:423-434. Riechmann, J.L., M. Wang, and E.M. Meyerowitz. 1996. DNA-binding properties of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS. Nucl. Acids Res. 24:3134-3141. Rottmann, W.H., R. Meilan, L.A. Sheppard, A.M. Brunner, J.S. Skinner, C. Ma, S. Cheng, L. Jouanin, G. Pilate, and S.H. Strauss. 2000. Diverse effects of

overexpression of LEAFY and PTLF, a poplar (Populus) homolog of LEAFY/FLORICAULA, in transgenic poplar and Arabidopsis. Plant J. 22:235- 245. Sablowski, R. 2010. Genes and functions controlled by floral organ identity genes. Semin Cell Dev Biol. 21:94-99. Saddic, L.A., B. Huvermann, S. Bezhani, Y. Su, C.M. Winter, C.S. Kwon, R.P. Collum, and D. Wagner. 2006. The LEAFY target LMI1 is a meristem identity regulator and acts together with LEAFY to regulate expression of CAULIFLOWER. Development. 133:1673-1682. Samach, A., J.E. Klenz, S.E. Kohalmi, E. Risseeuw, G.W. Haughn, and W.L. Crosby. 1999. The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F- box protein required for normal patterning and growth in the floral meristem. Plant J. 20:433-445. Samach, A., H. Onouchi, S.E. Gold, G.S. Ditta, Z. Schwarz-Sommer, M.F. Yanofsky, and G. Coupland. 2000. Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science. 288:1613-1616. Sawa, M., D.A. Nusinow, S.A. Kay, and T. Imaizumi. 2007. FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis. Science. 318:261-265. Schmid, M., N.H. Uhlenhaut, F. Godard, M. Demar, R. Bressan, D. Weigel, and J.U. Lohmann. 2003. Dissection of floral induction pathways using global expression analysis. Development. 130:6001-6012. Schubert, D., L. Primavesi, A. Bishopp, G. Roberts, J. Doonan, T. Jenuwein, and J. Goodrich. 2006. Silencing by plant Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine 27. Embo J. 25:4638-4649. Schultz, E.A., and G.W. Haughn. 1991. LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. Plant Cell. 3:771-781. Searle, I., Y. He, F. Turck, C. Vincent, F. Fornara, S. Krober, R.A. Amasino, and G. Coupland. 2006. The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis. Genes Dev. 20:898-912. Shannon, S., and D.R. Meekswagner. 1993. Genetic interactions that regulate inflorescence development in arabidopsis. Plant Cell. 5:639-655. Sheldon, C.C., J.E. Burn, P.P. Perez, J. Metzger, J.A. Edwards, W.J. Peacock, and E.S. Dennis. 1999. The FLF MADS box gene: a repressor of flowering in Arabidopsis regulated by vernalization and methylation. The Plant cell. 11:445-458. Simon, R., I.M. Igeno, and G. Coupland. 1996. Activation of floral meristem identity genes in Arabidopsis. Nature. 384:59-62. Simpson, G.G., and C. Dean. 2002. Arabidopsis, the Rosetta stone of flowering time? Science. 296:285-289. Smyth, D.R., J.L. Bowman, and E.M. Meyerowitz. 1990. Early flower development in Arabidopsis. Plant Cell. 2:755-767. Sridhar, V.V., A. Surendrarao, D. Gonzalez, R.S. Conlan, and Z. Liu. 2004. Transcriptional repression of target genes by LEUNIG and SEUSS, two

interacting regulatory proteins for Arabidopsis flower development. Proc Natl Acad Sci U S A. 101:11494-11499. Sridhar, V.V., A. Surendrarao, and Z. Liu. 2006. APETALA1 and SEPALLATA3 interact with SEUSS to mediate transcription repression during flower development. Development. 133:3159-3166. Srikanth, A., and M. Schmid. 2011. Regulation of flowering time: all roads lead to Rome. Cell Mol Life Sci. 68:2013-2037. Suarez-Lopez, P., K. Wheatley, F. Robson, H. Onouchi, F. Valverde, and G. Coupland. 2001. CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature. 410:1116-1120. Sullivan, J.A., K. Shirasu, and X.W. Deng. 2003. The diverse roles of ubiquitin and the 26S proteasome in the life of plants. Nature reviews. Genetics. 4:948-958. Sung, S., and R.M. Amasino. 2004. Vernalization and epigenetics: how plants remember winter. Current opinion in plant biology. 7:4-10. Takada, S., and K. Goto. 2003. Terminal flower2, an Arabidopsis homolog of heterochromatin protein1, counteracts the activation of flowering locus T by constans in the vascular tissues of leaves to regulate flowering time. The Plant cell. 15:2856-2865. Tanahashi, T., N. Sumikawa, M. Kato, and M. Hasebe. 2005. Diversification of gene function: homologs of the floral regulator FLO/LFY control the first zygotic cell division in the moss Physcomitrella patens. Development. 132:1727-1736. Tian, Z., X. Wang, R. Lee, Y. Li, J.E. Specht, R.L. Nelson, P.E. McClean, L. Qiu, and J. Ma. 2010. Artificial selection for determinate growth habit in soybean. Proceedings of the National Academy of Sciences of the United States of America. 107:8563-8568. Tilly, J., D.W. Allen, and T. Jack. 1998. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development. 125:1647-1657. Toth, R., E. Kevei, A. Hall, A.J. Millar, F. Nagy, and L. Kozma-Bognar. 2001. Circadian clock-regulated expression of phytochrome and cryptochrome genes in Arabidopsis. Plant physiology. 127:1607-1616. Turck, F., F. Roudier, S. Farrona, M.L. Martin-Magniette, E. Guillaume, N. Buisine, S. Gagnot, R.A. Martienssen, G. Coupland, and V. Colot. 2007. Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27. PLoS Genet. 3:e86. Valverde, F., A. Mouradov, W. Soppe, D. Ravenscroft, A. Samach, and G. Coupland. 2004. Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science. 303:1003-1006. Vrebalov, J., D. Ruezinsky, V. Padmanabhan, R. White, D. Medrano, R. Drake, W. Schuch, and J. Giovannoni. 2002. A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science. 296:343-346. Wagner, D., and E.M. Meyerowitz. 2002. SPLAYED, a novel SWI/SNF ATPase homolog, controls reproductive development in Arabidopsis. Curr Biol. 12:85-94.

Wagner, D., R.W.M. Sablowski, and E.M. Meyerowitz. 1999. Transcriptional activation of APETALA1 by LEAFY. Science. 285:582-584. Wang, J.W., B. Czech, and D. Weigel. 2009. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell. 138:738- 749. Wang, X., S. Feng, N. Nakayama, W.L. Crosby, V. Irish, X.W. Deng, and N. Wei. 2003. The COP9 signalosome interacts with SCF UFO and participates in Arabidopsis flower development. The Plant cell. 15:1071-1082. Weigel, D., J.H. Ahn, M.A. Blazquez, J.O. Borevitz, S.K. Christensen, C. Fankhauser, C. Ferrandiz, I. Kardailsky, E.J. Malancharuvil, M.M. Neff, J.T. Nguyen, S. Sato, Z.Y. Wang, Y. Xia, R.A. Dixon, M.J. Harrison, C.J. Lamb, M.F. Yanofsky, and J. Chory. 2000. Activation tagging in Arabidopsis. Plant Physiol. 122:1003-1013. Weigel, D., J. Alvarez, D.R. Smyth, M.F. Yanofsky, and E.M. Meyerowitz. 1992. LEAFY controls floral meristem identity in Arabidopsis. Cell. 69:843-859. Weigel, D., and E.M. Meyerowitz. 1993. Activation of floral homeotic genes in Arabidopsis. Science. 261:1723-1726. Weigel, D., and E.M. Meyerowitz. 1994. The ABCs of floral homeotic genes. Cell. 78:203-209. Weigel, D., and O. Nilsson. 1995. A developmental switch sufficient for flower initiation in diverse plants. Nature. 377:495-500. Wigge, P.A. 2011. FT, a mobile developmental signal in plants. Current biology : CB. 21:R374-378. Wigge, P.A., M.C. Kim, K.E. Jaeger, W. Busch, M. Schmid, J.U. Lohmann, and D. Weigel. 2005. Integration of spatial and temporal information during floral induction in Arabidopsis. Science. 309:1056-1059. Wilkinson, M.D., and G.W. Haughn. 1995. UNUSUAL FLORAL ORGANS controls meristem identity and organ primordia fate in Arabidopsis. Plant Cell. 7:1485- 1499. William, D.A., Y. Su, M.R. Smith, M. Lu, D.A. Baldwin, and D. Wagner. 2004. Genomic identification of direct target genes of LEAFY. Proc Natl Acad Sci U S A. 101:1775-1780. Wilson, R.N., J.W. Heckman, and C.R. Somerville. 1992. Gibberellin is required for flowering in arabidopsis-thaliana under short days. Plant Physiol. 100:403-408. Winter, C.M., R.S. Austin, S. Blanvillain-Baufume, M.A. Reback, M. Monniaux, M.F. Wu, Y. Sang, A. Yamaguchi, N. Yamaguchi, J.E. Parker, F. Parcy, S.T. Jensen, H. Li, and D. Wagner. 2011. LEAFY target genes reveal floral regulatory logic, cis motifs, and a link to biotic stimulus response. Dev Cell. 20:430-443. Wu, G., M.Y. Park, S.R. Conway, J.W. Wang, D. Weigel, and R.S. Poethig. 2009. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell. 138:750-759. Yamaguchi, A., M.F. Wu, L. Yang, G. Wu, R.S. Poethig, and D. Wagner. 2009. The microRNA-regulated SBP-Box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1. Developmental cell. 17:268-278.

Yoshida, N., Y. Yanai, L. Chen, Y. Kato, J. Hiratsuka, T. Miwa, Z.R. Sung, and S. Takahashi. 2001. EMBRYONIC FLOWER2, a novel polycomb group protein homolog, mediates shoot development and flowering in Arabidopsis. The Plant cell. 13:2471-2481. Yu, H., T. Ito, F. Wellmer, and E.M. Meyerowitz. 2004. Repression of AGAMOUS- LIKE 24 is a crucial step in promoting flower development. Nat Genet. 36:157- 161. Zeevaart, J. 1976. Physiology of flower formation. . Annu. Rev. Plant Physiol. . 27:321- 348. Zhang, X., S. Germann, B.J. Blus, S. Khorasanizadeh, V. Gaudin, and S.E. Jacobsen. 2007. The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation. Nat Struct Mol Biol. 14:869-871.

CHAPTER 2

Flower Formation in Arabidopsis thaliana is Dependent on Dimerization of LEAFY

2.1 INTRODUCTION

Coordinated control of eukaryotic gene expression is mediated by the action of transcription factors (TFs). Many studies in different systems have revealed that TFs have modular structures, consisting of DNA-binding domains as well as transcription activation domains, dimerization domains (homo- or hetero-dimer interfaces) and/or nuclear localization domains (Frankel and Kim, 1991; Lee, 1992). TFs are classified into families by their DNA-binding domains and potential for dimerization. For example, the bHLH TF family is characterized by a helix-loop-helix (HLH) region that mediates dimerization and an alpha-helical basic region that binds DNA ((Amoutzias et al., 2004;

Amoutzias et al., 2008) and references therein). bZIP TFs have a basic region that binds

DNA and a coiled-coil leucine zipper (LZ) domain that directs dimerization (Amoutzias et al., 2008; Vinson et al., 2006).

In order to function, many TFs must form homodimers and/or heterodimers with a family member (Marianayagam et al., 2004). In such transcription factors, dimerization is the key for both DNA binding affinity and specificity and biological activity. In general, TFs carry their DNA binding and dimerization activities in highly conserved domains.

Usually, the DNA binding region has the most conservation while the dimerization domain has less similarity (Amoutzias et al., 2004; Amoutzias et al., 2008; Simionato et al., 2007). Controlling nuclear localization of the TF (Glass, 1994; Jiang et al., 1997), 53 improving stability of TFs and generating new protein binding interfaces (Marianayagam et al., 2004) are some of the ways dimerization can facilitate transcriptional activity.

Dimerization in eukaryotes is known to regulate many processes including the cell cycle, reproduction, development, cellular homeostasis, signaling, metabolism and cell death

(Amoutzias et al., 2008; Desvergne et al., 2006; Levy and Darnell, 2002; Wietek and

O'Neill, 2007).

Arabidopsis thaliana LFY is a unique, plant-specific transcription factor that cannot be grouped with any well-studied TF families. LFY and its orthologs from other land plants contain a DNA binding domain in their C-termini. A crystal structure of the C-terminus of Arabidopsis LFY bound to DNA revealed structural similarities with the DNA binding domains of helix-turn-helix (HTH) proteins such as homeodomain TFs (Hames et al.,

2008). However, the structure and function of the rest of the LFY protein is not known.

Alignment of LFY and its orthologs across land plants reveals the presence of two conserved regions (Figure 1.9), the highly conserved DNA binding domain in the C- terminus and another conserved region in the N-terminus that has been hypothesized to contribute to transcriptional activation (Maizel et al., 2005).

Like many other transcription factors, LFY activates its target genes by recognizing a pseudopalindromic region in the promoters of these genes with the consensus sequence

CCANTGT/G (Busch et al., 1999; Hill et al., 1998; Hong et al., 2003; Lamb et al., 2002;

Lohmann et al., 2001; Parcy et al., 1998). Binding to a palindromic region not only increases the binding affinity for DNA but also, by having double the length of the 54 binding site, increases specificity. We hypothesized that LFY forms homodimers that bind DNA and that this dimerization is important for its function in planta. In this study, we show that LFY homodimerizes. We demonstrate that the conserved N-terminal region of LFY mediates this interaction. Most importantly, studies done in Arabidopsis thaliana demonstrates that dimerization of LFY is important for its function as a transcription factor.

2.2 RESULTS

2.2.1 LFY protein homodimerizes

It is known that LFY binding sites in the promoters of its direct target genes consist of pseudopalindromic sequence elements (Busch et al., 1999; Lamb et al., 2002; Lohmann et al., 2001; Parcy et al., 1998), which led us to investigate LFY protein dimerization. We used yeast two-hybrid assays (Y2H), Bimolecular Fluorescence Complementation (BiFC) and co-immunoprecipitation (co-IP) assays to investigate this association. LFY interacted with itself strongly in yeast (Figure 2.1). To confirm LFY homodimerization in planta, we carried out BiFC assays in transiently transformed Nicotiana benthamiana leaves. LFY was able to bring the two halves of YFP together, indicating dimerization.

YFP fluorescence could be seen in the nucleus and in punctate points in the cytoplasm

(Figure 2.2a). The fluorescence in the cytoplasm may represent staining at plasmadesmata, since LFY has been shown to traffic through these structures (Wu et al.,

2003). The background florescence signal from the negative controls used is negligible

(Figure 2.2b).

In order to confirm and extend the yeast and BiFC results, co-IP assays were performed.

Proteins extracted from N. benthamiana leaves transiently co-transformed with

35S::LFY-GFP and 35S::LFY-MYC or 35S::CBF3-GFP (C-REPEAT BINDING

FACTOR 3 (Gilmour et al., 2000), a nuclear-localized transcription factor) and 56 35S::LFY-MYC were used to perform co-IP studies. Anti-GFP antibody was used to immunoprecipitate LFY-GFP or CBF3-GFP (Figure 2.3a). As expected based on the yeast two-hybrid and BiFC results, only LFY-GFP was able to co-IP LFY-MYC, supporting the presence of higher order LFY complexes. Immunoprecipitation of LFY-

MYC using an anti-MYC antibody also brought down LFY-GFP but not CBF3-GFP

(data not shown). Further co-IP experiments were done using stable transgenic

Arabidopsis plants co-expressing 35S::LFY-GFP and 35S::LFY-TAP or 35S::GFP and

35S::LFY-TAP. Overexpression of LFY in Arabidopsis causes precocious flowering and converts the primary shoot meristem into a terminal flower and axillary meristems into solitary flowers (Weigel and Nilsson, 1995), which was also visible in lines we used

(Figure 2.4). In addition, the LFY fusion protein lines used had been crossed into the lfy-6 null mutant background and shown to complement the mutation (shown in other sections-

Figure 2.16 and Figure 3.1). IPs using anti-GFP antibody was done on proteins extracted from inflorescences. The LFY-TAP protein was co-IPed with LFY-GFP, but not with

GFP alone (Figure 2.3b). Taken together, these results support the existence of higher order LFY complexes in plants.

2.2.2 LFY dimerizes through a conserved region in its N-terminus

LFY orthologs are found across the land plants. Earlier work has identified two conserved regions within LFY-like proteins, one at the N-termini and one at the C-termini of the proteins (Figure 1.9; (Maizel et al., 2005)). The C-terminal conserved region has been shown to be the DNA binding domain. The N-terminal conserved region has some function in strengthening DNA binding, but is not essential for this process. Its function 57 is currently unknown. We hypothesized that this region might mediate homodimerization of LFY and its orthologs.

To further investigate the domain(s) involved in LFY dimerization, a series of LFY deletion variants was made, as shown in Figure 2.5. Initially, we used the Y2H system to identify the domain(s) mediating homodimerization. Analysis by both growth on selection plates (Figure 2.6a) and quantitative assay (Figure 2.6b) was done. Those constructs that include the conserved N-terminal domain (LFY∆229-420, LFY∆121-420 and

LFY∆∆) exhibit strong homodimerization activity, while no construct that does not contain amino acids 46-121 dimerizes. In fact, as shown in Figure 2.6b, the LFY∆229-420 protein interacts more strongly than full length LFY. This suggests that the full length protein may be present in a conformation that hinders dimerization. We determined the minimal N-terminal fragment required for the dimerization by developing further deletions of the N-terminal half of LFY. LFY∆∆, which includes only amino acids 46-121, still homodimerizes (Figure 2.6). We deleted a further 20 amino acids from the C- terminus of LFY∆∆ (Figure 2.7a) to determine if residues at the end of the conserved domain are necessary for dimerization. This construct has lost the ability to form dimers

(Figure 2.7b), indicating that the entire conserved domain is essential for LFY-LFY interactions.

In order to validate these findings in planta, we performed co-IP studies using transient transfections in N. benthamiana. 35S:: LFY∆229-420-GFP or 35S:: LFY∆1-229-GFP were co- infiltrated with 35S::LFY-MYC. Both deletion constructs, like full length LFY, localize in 58 the nucleus (Figure 2.8c). However, only LFY∆229-420-GFP was able interact with

LFY∆229-420-MYC and LFY-MYC (Figure 2.8a, b), supporting the conclusion that the N- terminal half of LFY contains the dimerization domain.

2.2.3 Overexpressing the LFY dimerization domain interferes with endogenous LFY function.

If dimerization is important for LFY function, interfering with this should reduce function. Therefore, we overexpressed the N-terminal half of LFY containing the dimerization domain using the 35S promoter in a wild type background to examine the effect on endogenous LFY function. These plants displayed lfy-like phenotypes suggesting that the function of endogenous LFY is reduced. 20 independent transgenic lines were examined, of which 14 (70%) displaced such phenotypes (Table 2.1). The transgenic lines had extra branches subtended by cauline leaves (Figure 2.9a) and their flowers consisted largely of leaf-like sepals, petals and stamens were absent and the carpels partially unfused (Figure. 2.9c). Most of the lines recovered were sterile and could not be propagated past the T0 generation. These sterile lines were classified as having severe phenotypes (Table 2.1; Figure 2.11f, j, m). We also recovered several moderate and mild lines (Table 2.1; Fig. 2.11g, k, n). The LFY∆229-420 protein can interact with full length protein to form a LFY-LFY∆229-420 complex (Figures 2.8a and 2.6). These results suggest that LFY∆229-420 acts dominant negatively, titrating wild type LFY away from functional transcriptional complexes.

59 At least three possible mechanisms could explain the reason for the dominant negative effect observed with LFY∆229-420. First, the transgenes could be silencing the endogenous

LFY gene. Given the number of transgenic lines examined and the high percentage that have an lfy-like phenotype, this is unlikely. Second, the heterodimer or higher order complex that is formed when LFY∆229-420 is expressed might be nonfunctional or less functional. This could be due to lack of dimerization affecting DNA binding and/or stability or ability to activate transcription. Thirdly, overexpression of LFY∆229-420 might titrate some essential binding partner(s) of LFY. The second and third possibilities are not mutually exclusive. The third possibility is difficult to test, as there has been no report of a protein that binds to the N-terminus of LFY to date. To test the second model by which

LFY∆229-420 might interfere with endogenous LFY function, we performed

Electrophoretic Mobility Shift Assay (EMSA) and quantitative real time-PCR (qRT-

PCR).

In order to examine DNA binding, we used EMSA assays with a DNA probe containing a previously characterized LFY binding site from the APETELA1 (AP1) promoter (Busch et al., 1999; Hames et al., 2008; Parcy et al., 1998). In our hands, LFY forms two complexes on DNA (Figure 2.10b). The lower complex we assume to be an LFY-LFY homodimer. The upper band is a LFY oligomer of unknown stoichiometry. Although

LFY∆229-420 does not bind to DNA alone (Figure 2.10a), when increasing amounts of it were added to the LFY binding reaction, a higher order complex was formed and eventually essentially replaced the LFY-LFY lower complex (Figure 2.10a). The fact that this complex runs higher than the upper band present with LFY alone suggests either that 60 this is an oligomer of unknown composition rather than a LFY- LFY∆229-420 dimer or that the confirmation of the LFY- LFY∆229-420 dimer is retarding its progress through the gel.

This demonstrates that LFY∆229-420 does not interfere with LFY DNA binding in vitro and furthermore than its dominant negative activity in planta is unlikely to be due to an inability to bind target promoters. In order to determine if the LFY- LFY∆229-420 complex is less stable or has weaker DNA binding than the LFY-LFY complex, we performed competition EMSAs with increasing amounts of cold probe (Figure 2.10b right half).

Surprisingly, the LFY- LFY∆229-420 complex was less sensitive to competition, suggesting that this complex may bind DNA more strongly than LFY-LFY and/or that it is more stable.

The LFY∆229-420-containing complex can bind DNA at least as strongly as the LFY complex, suggesting that its ability to interfere with LFY function in vivo is not due to lack of ability to bind to target promoters when bound to endogenous LFY. Therefore, we examined the expression of endogenous LFY and two LFY target genes, AP1 and AP3, as well as the transgene in planta using qRT- PCR. For all lines examined, which included some exhibiting severe (plant lines 3 and 21) and moderate or mild (plant lines 26 and 1-

2) lfy-like phenotypes, the transgene was robustly expressed (Fig. 2.11a). Expression of endogenous LFY was reduced in almost all lines examined (Fig. 2.11b). This can be explained by the feedback loops on LFY expression by downstream targets, particularly

AP1 (Liljegren et al., 1999). Transgenic lines with severe lfy-like phenotypes had less expression of AP3 than the plants with intermediate or mild phenotypes (Figure 2.11d) and lower expression of AP1 as well (Figure 2.11c). In other words the severity of the 61 phenotype can be explained by lowered LFY target gene expression. Taken together, the

EMSA and qRT-PCR data supports the hypothesis that the dominant negative phenotype seen when LFY∆229-420 is overexpressed is likely caused by the shorter protein interacting with endogenous LFY, forming a complex less able to activate transcription of target genes and outcompeting transcriptionally competent LFY complexes.

2.2.4 Mutations within the dimerization domain abrogate dimer formation

Our work has demonstrated that, in Arabidopsis, LFY amino acids 46-120 are essential for dimerization. This region is highly similar across land plants (Figure 2.12). Within this region there are five conserved leucine residues (positions 69, 77, 84, 91 and 99 in

Arabidopsis LFY), which appear in a X7X8X7X8 pattern. This pattern has some similarity to the spacing of leucines in leucine zippers, suggesting these residues may be essential for protein-protein contact. Therefore we mutated these leucines to alanines

(within the context of the full length LFY protein) singly, in pairs and in total and tested the effect on dimerization using yeast two-hybrid assays. In addition, two non-leucine but still conserved residues, arginine 59 (R59) and methionine 79 (M79), were also mutated to alanine (Figure 2.12). When single leucine residues were substituted with alanine, the strength of the dimerization interactions was significantly reduced (Figure 2.13a). When either two leucine residues (Figure 2.13b) or all five residues (LFYL/A) were mutated

(Figure 2.14a and b), no interaction above background could be detected. Interestingly, as shown in Figure 2.14a, LFYL/A could not interact with wild type LFY. These results support the hypothesis that the leucines are important for LFY dimerization. Mutation of

R59 and M79 also abolished dimerization in Y2H assay (Figure 2.14c), suggesting that the 62 structure of the dimerization domain is very sensitive to changes in sequence. To confirm the yeast two-hybrid results, co-IP experiments done with LFYL/A in transiently infiltrated N. benthamiana leaves. LFYL/A-GFP, although localized to the nucleus (Fig.

2.15b) was unable to immunoprecipitate LFYL/A-MYC (Figure 2.15a), supporting the hypothesis that the leucine residues are important for dimerization.

Although the DNA binding domain of LFY has been crystallized and its structure determined (Hames et al., 2008), the same has not been done for either the dimerization domain or full length LFY. The sequence of the dimerization domain (amino acids 46-

121) was analyzed using the Phyre structural prediction program (Kelley and Sternberg,

2009) and the I-TASSER protein modeling program (Roy et al., 2010; Zhang, 2007). The results suggest that this region consists of four alpha helices (Figure 2.12 a and b), which would create a large protein-protein interaction interface.

2.2.5 Dimerization is essential for LFY function

We have shown that LFY forms homodimers or oligomers in vivo and this is mediated by a conserved region in the N-terminus of the protein. To test the functional significance of this domain and dimerization in vivo, we generated transgenic plants expressing various

LFY deletions and missense mutations in the background of the null lfy-6 allele and analyzed the ability of the transgenes to complement (Table 2.2). Full length LFY-GFP driven by the 35S promoter is able to partially rescue the lfy-6 mutant (Figure 2.16a).

However, deletion of either the N-terminal dimerization domain or the C-terminal DNA binding domain produces a non-functional protein unable to complement (Figure 2.16a), 63 although the proteins accumulate (Figure 2.16b). As expected, both conserved regions of

LFY are essential for function.

In order to study the functional consequence of LFY-LFY interactions in vivo,

35S::LFYL/A-GFP transgenic lines were generated. Surprisingly, in the L. er background most of the transformants (Table 2.1) showed weak lfy-like mutant phenotypes, similar to those shown by the partial loss of function lfy-5 allele (Figure 2.17; (Maizel et al., 2005;

Weigel et al., 1992)). This suggests that this variant may interfere weakly with the endogenous LFY protein, perhaps by titrating an interacting protein. However, the

35S::LFYL/A-GFP transgene could not complement the lfy-6 allele (Figure 2.18; Table

2.2). This supports the hypothesis that dimerization is essential for LFY function in planta.

In order to study the AP3 target gene expression driven by 35S::LFYL/A-GFP, we used

Arabidopsis AP3p::GUS; lfy-6 lines. AP3p::GUS; lfy-6 lines will show residual AP3 promoter driven expression at the base of the second and third whorl of the floral organs

(Lamb et al., 2002), as seen in Figure 2.19b. Introduction of 35S::LFY-GFP into this background induces expression of AP3::GUS (Fig. 2.19a); however, introduction of

35S::LFYL/A-GFP does not (Fig. 2.19b). This further supports that dimerization is essential for LFY function in planta.

2.3 DISCUSSION

Proper flower formation is essential for plant reproduction and has been the focus of much interest since Goethe (Goethe, 1790). Floral meristem identity is controlled by several transcription factors, the most important of which is LFY, a plant specific factor.

LFY orthologs are found across the land plants (Maizel et al., 2005) and two conserved regions characterize these proteins, a C-terminal DNA binding domain and a N-terminal region of unknown function. Although primary sequence did not reveal any similarity to known transcription factor families, recent structural work has shown that the DNA binding of Arabidopsis thaliana LFY has similarity to helix-turn-helix (HTH) proteins

(Hames et al., 2008). The HTH domain is widely used, especially in prokaryotes where it may be the most widely used DNA-binding motif (Harrison and Aggarwal, 1990;

Huffman and Brennan, 2002). In this study we analyze the function of the N-terminal conserved domain and find it mediates dimerization of LFY and that this is essential for

LFY function in planta.

2.3.1 LFY forms dimers

Previous work had shown that the C-terminal LFY DNA binding domain exists as a monomer in solution and that, when bound to DNA, although two DNA binding domains are found at the LFY pseudopalindromic binding sequence, only a few amino acids of these are in contact (Hames et al., 2008). Therefore, it was hypothesized that LFY exists 65 as a monomer (Hames et al., 2008). However, we have found that full length LFY exists as a dimer in yeast and in planta, and this dimerization is not dependent on DNA (Figures

2.1, 2.2 and 2.3). We hypothesized that the N-terminal conserved domain of LFY mediates this interaction. This is fact the case (Figures 2.6 and 2.7). Interestingly, in the yeast two-hybrid system, the strength of the self-interaction between LFY∆229-420 is stronger than that of full length LFY (Figure 2.6b). This suggests that the confirmation of

LFY is such that, in the absence of DNA and/or cofactor binding, the DNA binding domain partially inhibits dimerization.

LFY is a plant specific factor. Its dimerization domain is conserved among all the LFY orthologs, but does not have extensive primary sequence similarity to any known domain.

Our deletion analysis demonstrates that the entire conserved N-terminal region is necessary for LFY-LFY interaction, as deletions from either the N or C-terminus eliminate binding (Figure 2.8). In addition, although residues outside of 46-121 are not necessary for dimerization, they do contribute to interaction strength, as constructs that remove residues between 121 and 220 do not interact as strongly in yeast (Figure 2.6).

Examination of amino acids 46-121 reveals that they contain conserved leucines spaced in a similar manner to leucine zippers (Figure 2.12), suggesting that this region may form a similar structure. Mutation of these leucines within the dimerization domain eliminated

LFY-LFY association (Figures 2.13, 2.14 and 2.15), supporting the importance of these residues. However, mutation of two non-leucine conserved residues, R59 and M79, also eliminated self-interaction (Figure 2.14c), suggesting that all or most of the conserved residues are important, at least in yeast. Modeling of the LFY dimerization domain using 66 two different modeling programs, Phyre (Kelley and Sternberg, 2009) and I-TASSER

(Roy et al., 2010), suggest that it forms four alpha helices that would provide a large interaction face (Figure 2.12). The accuracy of these predictions remains to be tested.

Overexpression in the wild type background of a LFY construct consisting of only the N- terminal half of the protein (LFY∆229-420) caused lfy-like phenotypes (Figures 2.9), suggesting that this protein can interfere with endogenous LFY function. This protein can interact with full-length LFY protein (Figures 2.6 and 2.7), supporting the idea that the complexes containing LFY∆229-420-LFY dimers are made and further that they must be nonfunctional. DNA binding studies revealed that the N-terminal half of LFY does not interfere with binding; this is not surprising, as it has been previously demonstrated that monomers of the LFY DNA binding domain can associate with DNA (Hames et al.,

2008). In fact, if anything, mixing full length LFY and LFY∆229-420-GFP creates a complex that binds DNA more strongly that LFY alone (Figure 2.10). Examination of

LFY target gene expression in 35S::LFY∆229-420 transgenic plants revealed that expression of AP1 and AP3 is reduced (Figure 2.11). This suggests that the LFY- LFY∆229-420-GFP heterodimer may bind to LFY binding sites and prevent functional LFY-LFY complexes from activating transcription. The heterodimer is likely to be nonfunctional due to a paucity of other factors that need the C-terminal region of LFY to be recruited to the complex and/or due to the presence of only one LFY DNA binding domain. A similar situation has been seen with fusion proteins associated with acute lymphoblastoid leukemia, which consist of the DNA binding domain of PAX5 (without its activation domain) fused to the C-terminus of C20orf112, a protein of unknown function. These 67 fusion proteins multimerize at PAX5 binding sites and remain bound very stably, preventing wild type PAX5 binding and target gene regulation (Kawamata et al., 2011).

We hypothesize that a similar situation is seen when LFY∆229-420-GFP is overexpressed; this deletion stabilizes DNA binding through an unknown mechanism and prevents functional LFY transcriptional complexes from binding to activate transcription.

2.3.2 LFY-LFY association is necessary for function

We have demonstrated that LFY can associate with itself. This association is necessary in planta. Point mutations that eliminate the ability of LFY to dimerize in yeast (LFYL/A) are unable to complement the lfy-6 null mutation (Figure 2.18). This lack of complementation is not due to an inability of the protein to accumulate or properly localize to the nucleus (Figure 2.18d). The role of the N-terminal domain of LFY in dimerization is likely to at least partially explain the evolutionary conservation of this region of the protein across land plants. However, the N-terminus may have other functions in addition to mediating LFY-LFY interactions. For example, there maybe other factors that form part of LFY-containing transcriptional complexes that bind to the

N-terminal region. In fact, we have identified such a factor (FOL1; see Chapter 4). In addition, other LFY cofactors may need to interact with a dimer of LFY and may not interact with LFY monomers. The fact that the only positive result from a yeast two- hybrid screen with LFY as a bait was LFY itself may support this (A. Moreo and R.S.

Lamb, unpublished data). Regardless of any other functions mediated by this conserved region, dimerization of LFY is essential and the domain is necessary for this function.

68 Further work will be necessary to extend the function of this region beyond LFY-LFY association.

2.3.3 Conclusion

LFY can associate with itself and this association is necessary in planta. In vitro and in vivo assays identified N-terminal conserved region as the domain involved in dimerization. This domain is conserved among all LFY orthologs in land plants, but does not have extensive primary sequence similarity to any known domain. The minimal region competent to dimerize comprises amino acids 46-121. Structural predictions suggest this region consists of alpha helical structures, which are capable of making an interaction surface. Overexpression of the N-terminus of LFY interferes with endogenous

LFY. EMSAs suggest that complexes containing this truncated protein bind DNA more stably than wild type complexes, but are unable to activate target gene expression.

Mutants of the residues abolishing dimerization in planta are also unable to complement the lfy-6 null mutation, supporting the idea that LFY-LFY association is necessary for

LFY’s function in Arabidopsis.

2.4 EXPERIMENTAL PROCEDURES

2.4.1 Plant material and growth conditions

All Arabidopsis plants used in this study were in the L. er ecotype. The lfy-6 and lfy-5 alleles have been previously described (Weigel et al., 1992). Seeds were vernalized for 3-

5 days before growth in soil (Fafard-2 Soil Mix-Superior growers supply Inc. http://www.superiorgrowers.com). Seeds from transgenic lines were sterilized with 70% ethanol and 10% (v.v) sodium hypochlorite and were plated on Murashige and Skoog

(MS- PhytoTechnology Laboratories, http://www.phytotechlab.com) medium containing sucrose (10g/L), MES (0.5g/L) and agar (6g/L) with kanamycin (50µg/ml) for selection.

The plates were incubated at 40C in the dark for 3 days before placing in a CU-36L plant growth chamber (Percival Scientific, http://percival-scientific.com) under long day conditions (16 hours light at 80 mol m-2s-1 irradiance). Resistant seedlings were then transferred to soil. All plants were grown at 220C under long day conditions with 50% relative humidity in controlled growth chambers (Enconair Ecological Chambers, http://biochambers.com). Nicotiana benthamiana seeds were also grown in above described soil and growth conditions.

2.4.2 Constructs and cloning

The LFY coding region was cloned into pENTR/D-TOPO Gateway entry vector

(Invitrogen, http://www.invitrogen.com) following the manufacturer’s protocol and this 70 was subsequently used as a template to generate deletion variants and mutations used in this study. The primers used are listed in Table 2.3. PCR was done using Platinum Pfx

DNA Polymerase (Invitrogen). The PCR products introduced to pENTR/D-TOPO vector were sequenced at the Plant-Microbial Genomics Facility (PMGF) at The Ohio State

University. Individual residues were mutated using QuickChange Site-Directed

Mutagenesis Kit and QuickChange MultiSite Directed Mutagenesis Kit (Agilent, http://www.genomic.agilent.com) according to the instructions provided. Plasmids carrying the mutations were sequenced at the PMGF. LFY deletion and mutation variants in pENTR/D-TOPO vector were then recombined with binary destination vectors pGWB5 and pGWB6 with a GFP tag and pGWB20 and pGWB21 with a MYC tag at the C- and N- termini, respectively (binary destination vectors were a gift from T. Nakagawa, Shimane

University, Matsue, Japan); these were then introduced into Argobacterium tumefaciens strain GV3101.

For yeast two-hybrid assays, the relevant pENTR/D clones were recombined with pDEST22 and pDEST32 destination vectors containing the GAL4 Activation Domain

(AD) and DNA Binding Domain (BD), respectively (ProQuest Two-Hybrid system,

Invitrogen). These plasmids were transformed into yeast strain PJ694A (James, 2001) following the protocol in the Clontech Yeast Protocol Handbook.

In vitro protein production vectors were produced by creating PCR products of full length

LFY and LFY 229-420 with EcoR1 and XhoI flanking sites (primers in Table 2.3) and cloning them into the pTNT vector (Promega, http://www.promega.com) using restriction 71 digests and ligation. The restriction enzymes were obtained from New England BioLabs

(NEB; http://www.neb.com). Digestions were done at 370C overnight. The cut DNA was subsequently treated with alkaline phosphatase (CIP; NEB) and ligated using T4 DNA

Ligase Kit (Invitrogen) overnight at room temperature.

BiFC vectors p2YN (amino acids 1-158), p2YC (amino acid 159-238) and pYN-1 and pYC-1 carrying either fragment of split YFP in C- and N- terminal positions, respectively, were used (vectors from Dr. John A. Lindbo, The Ohio State University, Wooster, OH).

For cloning the gene into these vectors, restriction sites and regions overlapping with

BiFC vectors were added to the LFY coding region through PCR (primers are provided in

Table 2.3). Cloning into the vectors was done using In-Fusion cloning (Clonetech, http://www.clontech.com).

2.4.3 Generation of Arabidopsis transgenic lines and transient infiltration of Nicotiana benthamiana leaves

A. tumefaciens strain GV3101 carrying insertion plasmids were selected on LB plates containing 50 g/ml kanamycin, 50 g/ml gentamycin and 25 g/ml rifampicin.

Arabidopsis wild type plants were transformed by the floral dip method (Clough and

Bent, 1998). Transformants were selected on MS plates with 50 g/ml kanamycin.

Transgenic Arabidopsis plants expressing LFY-GFP and LFY-TAP or GFP alone and

LFY-TAP under the 35S promoter was generated by performing crosses between individual lines. N. benthamiana plant leaves were co-infiltrated transiently with

Agrobacterium as described in (Voinnet et al., 2003). 72 2.4.4 Yeast two-hybrid interaction assay

Yeast competent cell preparation and transformations were performed as in (Dohmen et al., 1991). pDEST22-LFY deletion and mutant variants were co-transformed with pDEST32-LFY variants studied. As negative controls, empty vectors were co-transformed with above vectors carrying LFY variants. The positive control used in this experiment was a well-studied strong interaction between Krev1 and RalGDS that was included with the ProQuest two-hybrid system. Transformants were selected on double dropout media

(SD-leucine-tryptophan). Interactions were selected on triple dropout selection plates

(SD-leucine-tryptophan-histidine). Three independent colonies from each transformation were selected to perform quantitative ß-galactosidase liquid assays as described (Lamb et al., 2002).

2.4.5 Bimolecular Fluorescence Complementation Assay (BiFC)

BiFC was performed in transiently transformed N. benthamiana leaves. Agrobacterium with BiFC vectors carrying full-length LFY along with split YFP were co-infiltrated using the protocol published in (Ohad et al., 2007). Empty vectors with one half of the

YFP together with the vector carrying LFY gene fused to the other half of the YFP was used as negative controls as well as the two empty vectors. The presence of YFP was observed and photographed three days after infiltrations using a confocal laser scanning microscope (Nikon D-ECLIPSE C1 90i and Camera- Nikon C1-SHS, http://www.nikoninstruments.com) using the GFP filter.

73 2.4.6 RNA isolation and quantitative Real Time-PCR (qRT-PCR)

Total RNA was extracted from inflorescence apices using RNeasy Plant Mini Kit following the manufacture’s protocol (Qiagen, http://www.qiagen.com). Total cDNA was synthesized from 1 g of RNA using the BluePrint 1st Strand cDNA Synthesis Kit with oligo (dT) primers (TaKaRa, http://www.takara-bio.us). qRT-PCR was carried out using four independent transgenic lines carrying 35S::LFY∆229-420-GFP that had varying phenotypic severity as well as lfy-6 mutant and wild type plants. qRT-PCR was done with

TaqMan Gene Expression Assays (Applied Biosystems, http://www.appliedbiosystems.com) with FAM probes made for LFY (At02270390_m1),

AP3 (At02188782_g1), AP1 (At02226242_g1), GFP (AII1L79), ACT2 (At02329915_s1) and RAD23 (At02163241_g1). The LFY probe used only detected endogenous LFY. The

GFP probe was used to quantify the transgene. TaqMan probes for ACT2 and RAD23 were used as reference genes. Three Biological replicates of qRT-PCR were performed in technical triplicates. qRT-PCR was performed in a 96- well plate with 3 l cDNA (1:3 diluted) and 5 l master mix (TaqMan Gene Expression Master Mix- Applied

Biosystems) in a total reaction volume of 10 l. The reactions were done at the PMGF in a BioRad CFX96 (http://www.bio-rad.com).

2.4.7 Computational analysis

Coiled-coil prediction was carried out using Multicoil software available on-line ((Wolf et al., 1997); http://groups.csail.mit.edu/cb/multicoil/cgi-bin/multicoil.cgi). The putative secondary structure of the LFYΔΔ was examined using the Protein homology/analogy

74 recognition engine (Phyre; Kelley and Sternberg, 2009). The sequence alignment of

LFYΔΔ was done using the MUSCLE3.8.31 multiple alignment tool, using default settings (Edgar, 2004). The alignment picture was generated suing TEXshade (Beitz,

2000) and Jalview2.0 (Waterhouse et al., 2009). 3D structure predictions were done by submitting LFY sequence to I-TASSER (http://zhanglab.ccmb.med.umich.edu/I-

TASSER; (Roy et al., 2010; Zhang, 2007)). PyMOL software (www.pymol.org) was used to mark the putative helices of the dimerization region in red.

2.4.8 In vitro transcription/translation, in vitro binding and EMSAs

Full length LFY and LFY 229-420 polypeptides were synthesized using the TNT T7 Quick

Coupled Transcription/ Translation System (Promega) as specified by the manufacturer.

The LFY 229-420 protein was concentrated using Amicon Ultra 0.5 ml Centrifugal Filters

(Millipore, www.millipore.com) using manufacturer’s guidelines. Synthesized proteins were run on a 10% SDS-PAGE gel, blotted onto nitrocellulose membrane (Bio-Rad) and probed with polyclonal anti-LFY antibody (aV-16, 1:300, Santa Cruz Biotechnology, http://www.scbt.com) and with anti-goat IgG- horseradish peroxidase (HRP; Sigma-

Aldrich, http://www.sigmaaldrich.com) used at 1:10,000. Protein amounts were quantified on film using a densitometer (Molecular Dynamics 375) and ImageQuant

Software (GE, http://www.gelifesciences.com).

To carryout EMSAs, 5’-Cy5 labeled single stranded oligonucleotide probes from Sigma-

Aldrich (listed in Table 2.4) were annealed to non-fluorescent complimentary oligonucleotides in annealing buffer (10mM Tris pH7.5, 150mM NaCl and 1mM EDTA) 75 according to (Lamb et al., 2002). Protein and probe binding reactions were carried out in binding buffer according to (Lamb et al., 2002), at room temperature for 20 min and run on 6% polyacrylamide gels. Gels were scanned using Typhoon 9400 Scanner (GE, http://www.gelifesciences.com). Cy-5 scanning mode (633nm wavelength) was used and the image was saved and analyzed using ImageQuant TL software.

2.4.9 Co-immunoprecipitation assays

Arabidopsis inflorescence apices and infiltrated leaves of N. benthamiana were collected and ground in liquid nitrogen into fine powder. Cold buffer containing 50mM Tris-HCl, pH7.5, 150mM NaCl, 0.5% Nonidet P-40, 1mM EDTA, 3mM DTT, 1mM phenylmethylsulphonyl fluoride and protease inhibitor cocktail (1:100, Sigma-Aldrich) was used to extract proteins followed by 14,000rpm centrifugation. Immunoprecipitations were done using polyclonal anti-GFP antibody (abcam-290, Abcam, http://www.abcam.com) bound overnight to Protein A Agarose beads (Invitrogen).

Protein extracts were incubated with the above preparation for 1.5 hours. All experiments were done at 40C. After washing four times with the above cold buffer, immunoprecipitates were resuspended in 50µl of 2X SDS-PAGE loading buffer. Proteins were separated on a 10% SDS-PAGE gel (Sambrook et al., 1989), transferred to nitrocellulose membranes and probed with alkaline phosphatase (AP)-conjugated anti-

GFP antibody (1:1500, Rockland, http://www.rockland-inc.com) or monoclonal anti- cMYC antibody (1:500, Sigma-Aldrich). Anti-mouse IgG-peroxidase (1:10,000, Sigma-

Aldrich) was used as the secondary antibody. SuperSignal West Pico Chemiluminescent

Substrate (Thermo Scientific, http://www.piercenet.com) and Immune-Star AP Substrate 76 Pack (BioRad) were used to detect AP- and peroxidase-conjugated antibodies, respectively. GeneMate Blue Lite Autorad Film (Bioexpress, http://www.bioexpress.com) was used to detect signal and developed on a KONICA

MINOLTA SRX-101A film developer.

2.4.10 GUS staining

AP3p::GUS lines (Hill et al., 1998) were crossed with lfy-6/lfy-6 plants. F1 seed was selected for the transgene with kanamycin and allowed to self. F2 AP3p::GUS; lfy6-6/lfy-

6 lines were isolated and analyzed. These confirmed lines were then crossed with

35S::LFY-GFP lines and 35S::LFYL/A-GFP lines. -glucoronidase (GUS) enzymatic activity was detected as described (Hill et al., 1998). GUS stained inflorescences were observed under a Nikon SMZ745T (Nikon, http://www.nikoninstruments.com) dissecting microscope and photographed using OmniVID Camera (LW Scientific, http://www.lwscientific.com).

2.4.11 lfy-6 mutant complementation experiments

35S::LFY-TAP/+, 35S::LFY-GFP/+, 35S::LFY 1-129-GFP/+, 35S::LFY 229-420-GFP/+ and 35S::LFY L/A-GFP/+ lines were crossed to lfy-6 mutants. F2 generation plants were selected for presence of the transgene and genotyped. dCAPS genotyping using the primers listed in Table 2.1 and restriction digest with BstAP1 (NEB) was used to screen plants. In the F2 generation, phenotypic analysis was done to check for complementation of lfy-6 null mutants. Lines were analyzed to look for floral defects and number of branches formed before flower formation. Presence of petals and stamens, presence of 77 fused carpels and number of sepals in the outer most whorl of the flower were some of the characters analyzed. We compared phenotypes of these lines with lfy-6 null mutants and wild type grown in the same growth area at the same time.

2.4.12 Phenotypic analysis of transgenic lines

Phenotypic analysis of the over expression transgenic lines were done using homozygous lines except for 35S::LFY 229-420-GFP lines, which could not be propagated. Solitary flower formation was the phenotype scored in LFY overexpression plants. 35S::LFY 229-

420-GFP and 35S::LFYL/A-GFP plants were analyzed mainly for number of branches and flower phenotypes. Wild type plants typically make 2-3 branches before flower formation, whereas lfy-6 mutant makes more branches (Weigel et al., 1992). lfy flower- like structures also are often subtended by bracts (Weigel et al., 1992), a feature also scored in transgenic lines. Other features scored were the replacement of sepals with leaf- like organs with an increased number of trichomes and branched trichomes and the absence or reduction in number of petals and stamens in flower-like structures. In addition, the amount of carpel fusion in the pistil was observed.

Figure 2.1. LFY homodimerizes in yeast. Vector combinations used to co-transform yeast cells are given as prey/bait. Three independent transformants were analyzed for each combination. The interaction between Krev1 and RalGDS was used as a positive control. Empty prey and bait vectors in above shown combinations were used as negative controls. Error bars indicate standard deviations.

Figure 2.2. LFY-LFY homodimers form in planta. Micrographs of N. benthamiana leaves (bright field, epifluorescence and merged images). (a) LFY tagged at either the C- terminus (LFY-2YC/LFY-2YN) or the N-terminus (YC1-LFY/YN1-LFY) form homodimers. (b) Negative controls consisting of two empty vectors or one empty vector with one LFY fusion protein did not show any fluorescence. Arrowheads indicate nuclei and arrows indicate punctuate staining in the cytoplasm. Scale bars indicate 50μm.

Figure 2.3. LFY homodimers exist in both N. benthamiana leaves and Arabidopsis inflorescences. (a) Transiently transfected N. benthamiana leaves transformed with 35S::LFY-MYC and 35S::LFY-GFP or 35S::LFY-MYC and 35S::CBF3-GFP were used for GFP immunoprecipitations. (b) Transgenic Arabidopsis lines carrying 35S::LFY-GFP and 35S::LFY-TAP or 35S::LFY-TAP and 35S::GFP were used for GFP immunoprecipitations. Asterisks mark non-specific bands.

Figure 2.4. Ectopic expression of LFY causes formation of solitary flowers. (a) 35S::LFY-GFP; 35S::LFY-TAP plant. (b) 35S::LFY-GFP plant. (c) 35S::LFY-TAP plant. Arrowheads indicate solitary flowers while red arrow indicates terminal flower.

Figure 2.5. A schematic representation of LFY deletion fragments used in this study. The red boxes represent the conserved N-terminal region (amino acids 46-121). The cyan boxes represent the conserved DNA binding domain (amino acids 229-388). represents the amino acid range deleted. represents deletion of amino acids 1-46 and 121-420.

Figure 2.6. The N-terminal conserved domain of LFY mediates homodimerization. (a) LFY dimerization can support growth on -Leu-Trp-His media. 1: AD-LFY construct/BD-LFY construct; 2: AD/BD-LFY construct; 3: AD-LFY construct/BD. (b) Quantitative yeast two-hybrid assays of LFY deletion fragments. Vector combinations used to co-transform yeast cells are given as prey (AD)/bait (BD). Three independent transformants were analyzed for each combination. Positive control: LFY homodimerization. Negative controls: empty vector combinations. Error bars indicate standard deviation.

Figure 2.7. The entire conserved domain is necessary for LFY dimerization. (a) Schematic representation of constructs used, as in Figure 2.5. (b) Yeast two-hybrid assays done as in Figure 2.6. Error bars indicate standard deviation.

Figure 2.8. N-terminal conserved domain mediates LFY homodimerization in vivo. Transiently transfected N. benthamiana leaves with (a) 35S::LFY 229-420-GFP and (b) 35S::LFY 1-229-GFP along with 35S::LFY-MYC were subjected to Co-IP with anti-GFP antibody and the pull downed proteins were detected using anti-GFP and anti-MYC antibodies. LFY homodimerization was used as a positive control. (c) Nuclear localization of LFY 229-420-GFP and LFY 1-229-GFP in N. benthamiana leaves. The scale bars indicate 50μm.

Figure 2.9. Overexpression of 35S::LFY 229-420-GFP causes a lfy-like phenotype. Light micrographs of Arabidopsis plants. (a) Adult plants as indicated. (b-d) Close ups of the tops of inflorescences of lfy-6 (b) 35S::LFY 229-420-GFP (c) and L. er. (wild type) (d). Insets are individual flowers. Arrows point to leaf-like sepals, while arrowheads indicate exposed ovules. (e) Western blot showing LFY 229-420-GFP expression in a representative transgenic line (1) and in wild type (2). Asterisks indicate non-specific bands.

Figure 2.10. LFY 229-420 forms a higher order DNA binding complex with LFY. (a) Increasing amounts of LFY 229-420 to LFY results in switch to a higher order complex but addition of a nonspecific protein Oct2A does not. (b) Probe competition assays. Red arrowheads indicate a higher order complex while black asterisk indicate a presumed LFY-LFY dimer.

Continued

Figure 2.11. The dominant negative phenotype caused by 35S::LFYΔ229-420-GFP is due to reduced LFY target gene expression and correlates with transgene expression.

89 Figure 2.11: continued

(a-d) Gene expression studies done with wild type, lfy-6 and four independent 35S::LFYΔ229-420-GFP transgenic lines (line 3, 21, 26 and 1-2). Line 3 and 21 show severe phenotypes. Line 26 and 1-2 show milder phenotypes. Expression was normalized to that of both ACTIN2 and RAD23. (a) Transgene expression. (b) LFY expression. (c) AP1 expression. (d) AP3 expression. (e-l) Micrographs of Arabidopsis plants. (e and i) lfy-6. (f and j) 35S::LFYΔ229-420-GFP plants with severe phenotype (line 21). (g and k) 35S::LFYΔ229-420-GFP plants with milder phenotype (line 1-2). (h and l) L. er (wild type). (m and n) Close-up of flowers of 35S::LFYΔ229-420-GFP plants with severe phenotype (line 21; m) and with milder phenotype (line 1-2; n).

90 (a)

(b)

Figure 2.12. The LFY dimerization domain is conserved across land plants and may form an alpha helical structure. (a) Alignment of the LFY dimerization domain from LFY orthologs from select land plants. Amino acids mutated in this study are indicated. The predicted secondary structure of Arabidopsis LFY is shown below the alignment. The predictions were done using Phyre (Kelley and Sternberg, 2009) and MultiCoil (Wolf et al., 1997). At, Arabidopsis thaliana; Pt, Populus trichocarpa; Vv, Vitis vinifera; FALSIFLORA. Solanum lycopersicon LFY ortholog; FLO, Antirrhinum majus LFY ortholog; RFL, Oryza sativa LFY ortholog; Nymod, Nymphea odorata; PRFLL, Pinus radiata LFY ortholog; Wel, Welwitscia mirabilis; Cr, Ceratopteris thalictroides; Sel, Selaginella moellendorfi; Pp, Physcomitrella patens. (b) The predicted 3D structure of LFY protein modeled using I-TASSER (Roy et al., 2010; Zhang, 2007). Indicated in red are the helices predicted to form from the LFY dimerization domain (amino acid residues 46-121).

Figure 2.13. Mutations within the LFY dimerization domain abrogate dimerization. (a and b) Quantitative Y2H assays. Vector combinations used to co-transform yeast cells are given as pray/bait. Three independent colonies were used. Positive control: homodimerization of LFY. Negative controls: empty prey and bait vectors in above shown combinations. Error bars indicate standard deviation. 92

Figure 2.14. Mutations within the dimerization domain abrogate LFY interaction in yeast. (a, b) Y2H assays on -Leu-Trp-His selection media. (a) LFYL/A does not associate with itself or wild type LFY. (b) Quantitative Y2H liquid assay as described in Figure 2.6. Error bars indicate standard deviation. (c) Dimerization is lost when arginine 59 or methionine 79 are replaced by alanines. 1: AD-LFY construct/ BD-LFY construct. 2: AD/ BD-LFY construct. 3: AD-LFY construct/ BD.

Figure 2.15. Mutations within the dimerization domain abrogate LFY-LFY association in vivo. (a) IPs done from transiently transformed N. benthamiana leaves as indicated. (b) LFYL/A-GFP localizes to the nucleus in the N. benthamiana leaf.

Figure 2.16. Both conserved regions of LFY are required for function. (a) Micrographs of adult plants. Insets are individual flowers. A: Wild type; B: 35S::LFY- GFP; lfy-6; C: 35S::LFY∆1-229-GFP; lfy-6; D: 35S::LFY∆229-420-GFP; lfy-6; E: lfy-6. (b) Western blots with anti-GFP antibody showing the expression of the GFP-tagged proteins from representative transgenic lines. 1: Wild type; 2: lfy-6; 3: 35S::LFY∆229-420-GFP; lfy- 6; 4: 35S::LFY∆1-229-GFP; lfy-6; 5: 35S::LFY-GFP; lfy-6. Asterisks indicate a non- specific band recognized by the anti-GFP antibody.

Figure 2.17. Overexpression of LFYL/A-GFP causes weak lfy-like phenotypes. (a) Micrographs of adult plants as indicated. (b) Close up of 35S::LFYL/A-GFP inflorescence. (c) Close up of a 35S::LFYL/A-GFP flower. Arrowhead indicates an unfused carpel. (d) Western blot probed with anti-GFP antibody showing expression of LFYL/A protein from a representative transgenic line. 1: 35S::LFYL/A-GFP. 2: Wild type. Red asterisk indicates LFYL/A while the black asterisk indicates a non-specific bind recognized by the anti-GFP antibody.

Figure 2.18. Dimerization is essential for LFY function in planta. Micrographs of Arabidopsis plants. (a) Adult plants as indicated. 35S::LFYL/A-GFP did not complement the lfy-6 mutant phenotype. (b and c). Close up of the inflorescence (b) and a flower (c) of a 35S::LFYL/A-GFP plant. Red arrowhead indicates exposed ovules in the carpelloid structure. White arrowhead indicates bracts. Arrow indicates extra trichomes on the sepals. (d) Micrograph of GFP expression in transgenic plants, which did not complement.

Figure 2.19. LFYL/A cannot activate AP3 expression. Micrographs of GUS stained inflorescences with indicated genotypes. Insets show micrographs of GFP expression in transgenic plants of the same lines.

98 Table 2.1. Transgenic lines examined.

Genotype Ecotype Background Number of Number of lines lines examined with phenotype Severe Mild 35::LFYΔ229-420-GFP L.er Wild type 20 8 6 35::LFYL/A-GFP L.er Wild type 16 5 4 Initial (T0) transgenic lines were analyzed due to sterility. See text and Figure 2.11 for definition of phenotypic severity.

99 Table 2.2. Both conserved domains and dimerization are required for LFY function.

Genotype Ecotype Background Complemented

35S::LFY-GFP L. er lfy-6 Yes (75%) 35::LFYΔ1-229-GFP L. er lfy-6 No 35::LFYΔ229-420-GFP L. er lfy-6 No 35::LFYL/A-GFP L. er lfy-6 No At least 3 independent lines were analyzed in these studies in the F2 generation.

100 Table 2.3. List of primers used in Chapter 2.

Purpose Primer name Primer Sequence (5’-3’) Source

LFY BiFC LFYp2YCF TACGAACGATAGTTAATTAACATGGATCCTGAAGGTTTCACGAG This Study cloning LFYp2YCR CACCTCCTCCACTAGTGAAACGCAAGTCGTCGCCGCCGC This Study

LFYp2YNF TACGAACGATAGTTAATTAACATGGATCCTGAAGGTTTCACGAG This Study

LFYp2YNR CACCTCCTCCACTAGTGAAACGCAAGTCGTCGCCGCCGC This Study

LFYpYC-1F CTGGAGGAGGCGGCCGCATGGATCCTGAAGGTTTCACGAG This Study

101 LFYpYC-1R ATTTGCGGACTCTAGACTAGAAACGCAAGTCGTCGCCGCCGC This Study

LFYpYN-1F CTGGAGGAGGCGGCCGCATGGATCCTGAAGGTTTCACGAG This Study

LFYpYN-1R ATTTGCGGACTCTAGACTAGAAACGCAAGTCGTCGCCGCCGC This Study

LFY variants LFYGWF CACCATGGATCCTGAAGGTTTCAC This Study cloning LFYGWR-S CTAGAAAACGCAAGTCGTCGCC This Study

LFYGWR GAAACGCAAGTCGTCGCC This Study

LFY229F CACCATGGAGAGACAGAGGGAGCATCCG This Study

LFY121F CACCATGGAGGAAGAGGAATCTTCTAGACGC This Study

LFY121R-S CTACTCTTCTTGCAATCGTCTCCGTTCAGC This Study

Continued

1 Table 2.3: continued

LFY 229R-S CTATGTCCCCAAACCACTACCTCCGTTGCC This Study

LFY44F CACCATGCGACTTGGTGGTTTAGAGGG This Study

LFY 46:121F GCTGCTTTTGGGATGCGACTTGAGGAAGAGGAATCTTCTAGA This Study

LFY46:121RS TCTAGAAGATTCCTCTTCCTCAAGTCGCATCCCAAAAGCAGC This Study

LFY 101R-S CTACAAGAAGCTCCCAACGAAAGATATG This Study

LFY 81R-S CTAGTCCTTCATACCCACAAGCGTGCTCG This Study

LFY 61R-S CTAGTAGAAACGTATACCGTACGGACCG This Study

102 LFY 51R-S CTATCCCTCTAAACCACCAAGTCGCATCCC This Study

LFY Site L69A GGCGAAGATAGCGGAGGCAGGTTTTACGGCGAGC This Study Directed Mutagenesis This Study L69A_antisense GCTCGCCGTAAAACCTGCCTCCGCTATCTTCGCC This Study L76A GTTTTACGGCGAGCACGGCTGTGGGTATGAAGGACG

This Study L76A_antisense CGTCCTTCATACCCACAGCCGTGCTCGCCGTAAAAC This Study L84A GGGTATGAAGGACGAGGAGGCTGAAGAGATGATGAATAGT

This Study L84A_antisense ACTATTCATCATCTCTTCAGCCTCCTCGTCCTTCATACCC This Study L91A GCTTGAAGAGATGATGAATAGTACCTCTCATATCTTTCGTTGGGAG

Continued 1 Table 2.3: continued

This Study L91A_antisense CTCCCAACGAAAGATATGAGAGGCACTATTCATCATCTCTTCAAGC This Study L99A TCATATCTTTCGTTGGGAGGCTCTTGTTGGTGAACGGTAC This Study L99A_antisense GTACCGTTCACCAACAAGAGCATCCCAACGAAAGATATGA This Study M79A GAGCACGCTTGTGGGTGCGAAGGACGAGGAGCTT This Study M79A_antisense AAGCTCCTCGTCCTTCGC This Study R59A CGGTCCGTACGGTATAGCTTTCTACACGGCGGC This Study R59A_antisense GCCGCCGTGTAGAAAGCTATACCGTACGGACCG This Study

103 LFY in vitro TATACTCGAGATGGATCCTGAAGGTTTC This Study Transcriptio pTNT-LFYF n/translation This Study pTNT-LFYR TATAGAATTCTTATTAGAAACGCAAGTCGTC TATAGAATTCTTATTATGTCCCCAAACCAC This Study pTNT-229R

This Study T7EEV AAGGCTAGAGTACTTAATACGA This Study T7 TERM GCCCCAAGGGGTTATGCTAG dCAPS AAGCAGCCGTCTGCGGTGTCAGCTGTT lfy-6F http://www.weige TATGGATCCTGAAGGTTTCACG lworld.org/resourc lfy-6R es/mutants/caps

2 Table 2.4: Probes used for EMSA

Probe Name Sequence (5’-3’)

AP1WT’ ‘TTGGGGAAGGACCAGTGGTCCGTACAATGT

AP1WT ACATTGTACGGACCACTGGTCCTTCCCCAA

104

REFERENCES

Amoutzias, G.D., D.L. Robertson, S.G. Oliver, and E. Bornberg-Bauer. 2004. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes. EMBO reports. 5:274-279. Amoutzias, G.D., D.L. Robertson, Y. Van de Peer, and S.G. Oliver. 2008. Choose your partners: dimerization in eukaryotic transcription factors. Trends in biochemical sciences. 33:220-229. Beitz, E. 2000. TEXshade: shading and labeling of multiple sequence alignments using LATEX2 epsilon. Bioinformatics. 16:135-139. Busch, M.A., K. Bomblies, and D. Weigel. 1999. Activation of a floral homeotic gene in Arabidopsis. Science. 285:585-587. Clough, S.J., and A.F. Bent. 1998. Floral dip: A simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J. 16:735-743. Desvergne, B., L. Michalik, and W. Wahli. 2006. Transcriptional regulation of metabolism. Physiol Rev. 86:465-514. Dohmen, R.J., A.W. Strasser, C.B. Honer, and C.P. Hollenberg. 1991. An efficient transformation procedure enabling long-term storage of competent cells of various yeast genera. Yeast. 7:691-692. Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32:1792-1797. Frankel, A.D., and P.S. Kim. 1991. Modular structure of transcription factors: implications for gene regulation. Cell. 65:717-719. Gilmour, S.J., A.M. Sebolt, M.P. Salazar, J.D. Everard, and M.F. Thomashow. 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124:1854-1865. Glass, C.K. 1994. Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev. 15:391-407. Goethe, J.W. 1790. Goethe's Botany: The Metamorphosis of Plants. In Chron. Bot. Vol. 10. T.A.A. (1946), editor. 63-126. Hames, C., D. Ptchelkine, C. Grimm, E. Thevenon, E. Moyroud, F. Gerard, J.L. Martiel, R. Benlloch, F. Parcy, and C.W. Muller. 2008. Structural basis for LEAFY floral switch function and similarity with helix-turn-helix proteins. EMBO J. 27:2628- 2637. Harrison, S.C., and A.K. Aggarwal. 1990. DNA recognition by proteins with the helix- turn-helix motif. Annual review of biochemistry. 59:933-969. 105 Hill, T.A., C.D. Day, S.C. Zondlo, A.G. Thackeray, and V.F. Irish. 1998. Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development. 125:1711-1721. Hong, R.L., L. Hamaguchi, M.A. Busch, and D. Weigel. 2003. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing. The Plant cell. 15:1296-1309. Huffman, J.L., and R.G. Brennan. 2002. Prokaryotic transcription regulators: more than just the helix-turn-helix motif. Curr Opin Struct Biol. 12:98-106. James, P. 2001. Yeast two-hybrid vectors and strains. Methods Mol Biol. 177:41-84. Jiang, G., U. Lee, and F.M. Sladek. 1997. Proposed mechanism for the stabilization of nuclear receptor DNA binding via protein dimerization. Molecular and cellular biology. 17:6546-6554. Kawamata, N., M.A. Pennella, J.L. Woo, A.J. Berk, and H.P. Koeffler. 2011. Dominant- negative mechanism of leukemogenic PAX5 fusions. Oncogene. Kelley, L.A., and M.J. Sternberg. 2009. Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc. 4:363-371. Lamb, R.S., T.A. Hill, Q.K. Tan, and V.F. Irish. 2002. Regulation of APETALA3 floral homeotic gene expression by meristem identity genes. Development. 129:2079- 2086. Lee, K.A. 1992. Dimeric transcription factor families: it takes two to tango but who decides on partners and the venue? Journal of cell science. 103 ( Pt 1):9-14. Levy, D.E., and J.E. Darnell, Jr. 2002. Stats: transcriptional control and biological impact. Nature reviews. Molecular cell biology. 3:651-662. Liljegren, S.J., C. Gustafson-Brown, A. Pinyopich, G.S. Ditta, and M.F. Yanofsky. 1999. Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate. Plant Cell. 11:1007-1018. Lohmann, J.U., R.L. Hong, M. Hobe, M.A. Busch, F. Parcy, R. Simon, and D. Weigel. 2001. A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell. 105:793-803. Maizel, A., M.A. Busch, T. Tanahashi, J. Perkovic, M. Kato, M. Hasebe, and D. Weigel. 2005. The floral regulator LEAFY evolves by substitutions in the DNA binding domain. Science. 308:260-263. Marianayagam, N.J., M. Sunde, and J.M. Matthews. 2004. The power of two: protein dimerization in biology. Trends in biochemical sciences. 29:618-625. Ohad, N., K. Shichrur, and S. Yalovsky. 2007. The analysis of protein-protein interactions in plants by bimolecular fluorescence complementation. Plant Physiol. 145:1090-1099. Parcy, F., O. Nilsson, M.A. Busch, I. Lee, and D. Weigel. 1998. A genetic framework for floral patterning. Nature. 395:561-566. Roy, A., A. Kucukural, and Y. Zhang. 2010. I-TASSER: a unified platform for automated protein structure and function prediction. Nature protocols. 5:725-738. Sambrook, J., E.F. Fritch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press., Cold Spring Harbor, NY. Simionato, E., V. Ledent, G. Richards, M. Thomas-Chollier, P. Kerner, D. Coornaert, B.M. Degnan, and M. Vervoort. 2007. Origin and diversification of the basic 106 helix-loop-helix gene family in metazoans: insights from comparative genomics. BMC evolutionary biology. 7:33. Vinson, C., A. Acharya, and E.J. Taparowsky. 2006. Deciphering B-ZIP transcription factor interactions in vitro and in vivo. Biochimica et biophysica acta. 1759:4-12. Voinnet, O., S. Rivas, P. Mestre, and D. Baulcombe. 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33:949-956. Waterhouse, A.M., J.B. Procter, D.M. Martin, M. Clamp, and G.J. Barton. 2009. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics. 25:1189-1191. Weigel, D., J. Alvarez, D.R. Smyth, M.F. Yanofsky, and E.M. Meyerowitz. 1992. LEAFY controls floral meristem identity in Arabidopsis. Cell. 69:843-859. Weigel, D., and O. Nilsson. 1995. A developmental switch sufficient for flower initiation in diverse plants. Nature. 377:495-500. Wietek, C., and L.A. O'Neill. 2007. Diversity and regulation in the NF-kappaB system. Trends in biochemical sciences. 32:311-319. Wolf, E., P.S. Kim, and B. Berger. 1997. MultiCoil: a program for predicting two- and three-stranded coiled coils. Protein science : a publication of the Protein Society. 6:1179-1189. Wu, X., J.R. Dinneny, K.M. Crawford, Y. Rhee, V. Citovsky, P.C. Zambryski, and D. Weigel. 2003. Modes of intercellular transcription factor movement in the Arabidopsis apex. Development. 130:3735-3745. Zhang, Y. 2007. Template-based modeling and free modeling by I-TASSER in CASP7. Proteins. 69 Suppl 8:108-117.

107 CHAPTER 3

Identification of LEAFY Complex Components in Arabidopsis thaliana.

108

3.1 INTRODUCTION

Transcriptional regulation is one of the fundamental processes in biology governing the development of an organism in every aspect, including morphology, function and behavior and thus the survival of the organism. In eukaryotes, transcriptional regulation of gene expression is a complex process, partly due to the highly condensed packing of

DNA into chromatin. DNA is tightly wrapped around an octameric core of histone proteins, arranged in repeating units called nucleosomes (Kornberg, 1974; Kornberg and

Thomas, 1974; Luger et al., 1997; Thomas and Kornberg, 1975). Depending on the degree of compaction, DNA may be accessible and able to be transcribed or be present in heterochromatin that maintains the genes in an inactive state (Kornberg, 1974). To coordinate development, genes are turned on and off in a pre-programmed fashion giving proper spatial and temporal gene expression patterns and specificity. This is mainly controlled by DNA binding transcription factors (TFs) that recruit other regulatory proteins in a combinatorial manner, including chromatin remodeling factors to help increase or decrease accessibility of the locus to the RNA polymerase II complex, in order to regulate expression in different regulatory contexts (Britten and Davidson,

1969). This is especially true for TFs that play roles during development.

Many different regulatory proteins combine to form multi-protein transcriptional complexes or enhanceosomes in eukaryotic systems (Wolffe and Drew, 1989) reviewed 109 in (Merika and Thanos, 2001)). The particular activity of the complex depends on the components of the complex. TFs can be present in vivo in several varyingly composed complexes; by interacting with different components TFs can broaden their spectrum of recognized DNA target sequences (Garvie and Wolberger, 2001; Klemm et al., 1998). In addition, interactions with different regulatory proteins allow a TF to regulate different genes at different development stages and act as either an activator or a repressor of gene expression. Many examples of such complexes are described and well studied in animal systems (Merika and Thanos, 2001; Vanden Berghe et al., 2006). In plants, even though many TFs have been identified, much less information is available about the complexes in which they act. However, the recent advances in the use of interaction proteomics, tandem affinity purification methods, and computational analysis have accelerated discoveries in this field (Van Leene et al., 2011; Van Leene et al., 2007; Van Leene et al.,

2008).

As discussed in Chapter 1, LFY is a novel plant-specific TF. Currently limited information is available on how it acts to regulate transcription of its direct targets. LFY acts as a TF both in early and late stages of flower development. At early stages LFY acts to specify floral meristem identity (Liljegren et al., 1999; Weigel et al., 1992). Later, LFY plays a role in regulating organ identity homeotic genes (Busch et al., 1999; Lamb et al.,

2002; Wagner et al., 1999; Wagner et al., 2004; Weigel and Meyerowitz, 1993). LFY’s involvement in early and late stages can be genetically separated (Parcy et al., 1998).

LFY does not have strong transcriptional activation activity by itself (R.S. Lamb, unpublished data; (Busch et al., 1999)) and strong evidence exists that shows that LFY 110 acts with other regulatory factors in performing its functions (Chae et al., 2008; Lee et al.,

1997; Lenhard et al., 2001; Lohmann et al., 2001; Parcy et al., 1998; Wagner and

Meyerowitz, 2002). Considering the ubiquitous early floral meristem expression of LFY

(Blazquez et al., 1997; Parcy et al., 1998) and the fact that LFY activates different classes of homeotic genes in different domains/whorls of the flower, it is obvious LFY performs its functions in different complexes recruiting different proteins to activate different genes.

To date, some information is available on LFY co-regulators/interacting proteins during floral organ identity specification. As mentioned in Chapter 1, LFY acts synergistically with the homeodomain protein WUSCHEL (WUS) to activate AGAMOUS (AG), a C class gene responsible for carpel development and floral determinacy (Lenhard et al.,

2001; Lohmann et al., 2001). The AG regulatory sequence carries adjacent LFY and

WUS binding sites suggesting they could be binding simultaneously or in a common complex (Hong et al., 2003; Lohmann et al., 2001), although this has not been demonstrated. Since WUS is expressed only in the center the meristem, AG is only transcribed in the inner two whorls of the flower (Lenhard et al., 2001; Lohmann et al.,

2001). Another TF that has a binding site near that of LFY and is known to genetically interact with LFY is the direct LFY target LATE MERISTEM IDENTITY1 (LMI1), which encodes a Class I homeodomain-leucine zipper (HD-Zip) TF. LMI1 has been shown to act together with LFY to activate CAL expression (Saddic et al., 2006). The LFY binding site and LMI1 binding site in CAL promoter are around 100 bp apart, suggesting a

111 possible interaction between these proteins LFY and LMI1 (Saddic et al., 2006), although it has not been demonstrated.

SEP3 was recently shown to be a LFY co-factor in addition to its function as an E-class gene (Castillejo et al., 2005; Liu et al., 2009b) (Kaufmann et al., 2009). LFY and SEP3 work together to activate ABCE genes (Castillejo et al., 2005). LFY and SEP3 were shown to physically interact using in vitro GST-immunoprecipitation assay (Liu et al.,

2009a)

LFY directly activates APETALA3 (AP3), a B class gene responsible for petal and stamen development (Lamb et al., 2002). In lfy mutants, petal and stamen identity is severely affected (Weigel and Meyerowitz, 1993). AP3 expression is confined to whorls two and three and in a small group of cells at the base of the first whorl (Jack et al., 1992). LFY has been shown to require UNUSUAL FLORAL ORGANS (UFO) to activate AP3 transcription (Ingram et al., 1995; Lee et al., 1997; Levin and Meyerowitz, 1995;

Wilkinson and Haughn, 1995). LFY and UFO physically interact at the AP3 promoter

(Chae et al., 2008) and UFO overexpression phenotypes require functional LFY, suggesting that UFO is a co-factor of LFY (Lee et al., 1997; Samach et al., 1999).

In addition to these other TFs, LFY has also been shown to need chromatin remodeling factors for function (Wagner and Meyerowitz, 2002). TFs need to bind to the core promoter of the gene and recruit other transcriptional machinery into a compacted chromatin structures. Chromatin remodeling factors will loosen the chromatin using ATP 112 hydrolysis to allow transcriptional regulators to bind; other factors will modify histones to influence chromatin state (Carlson and Laurent, 1994). Examples of such modifications are phosphorylation, methylation, acetylation, glycosylation, ADP- ribosylation, sumoylation and ubiquitination. Recent work in plants has identified a number of chromatin factors that are recruited to transcriptionally active sites by TFs (for example, (Hernandez et al., 2007; Yu et al., 2008)). SPLAYED (SYD) is a member of the

SWI/SNF ATPase family. It has been shown to be necessary for LFY to activate class B gene expression, although no physical interaction between these proteins has been seen

(Wagner and Meyerowitz, 2002). That the state of chromatin at LFY active sites is important for their regulation is also supported by the fact that mutations in the CURLY

LEAF (CLF) gene, which encodes a polycomb group protein involved in repression of gene expression, cause misexpression of several of these targets, including AP3

(Goodrich et al., 1997).

As discussed above, only two proteins, UFO and SEP3, have been shown to bind to LFY physically and be in a transcriptional complex with it. Identification of components of

LFY transcriptional complex(s) will provide us more insight into the function of LFY and transcriptional regulation in plants. Preliminary FPLC gel filtration experiments demonstrated that LFY migrates in a higher order complex or complexes, suggesting that other LFY-interacting proteins remain to be identified (R.S. Lamb, unpublished data). To begin to identify these complexes, we have taken a biochemical approach to identify

LFY-interacting partners in Arabidopsis thaliana. Tandem affinity purification (TAP) combined with mass spectrometry (MS)-based protein identification has been a powerful 113 tool in genome-wide screens for protein complexes in plants (Brown et al., 2006; Rohila et al., 2004; Rohila et al., 2009; Van Leene et al., 2007). Therefore, we used this approach to elute possible LFY transcriptional complex components and identified them using LC/MS/MS analysis. We identified four possible LFY-interacting proteins:

At1g03750/CHROMATIN REMODELING FACTOR9 (CHR9), At5g22610,

At3g48430/RELATIVE OF EARLY FLOWERING6 (REF6) and At4g06634 and describe preliminary characterization of the first three in this chapter. In addition, we have tested the possible interaction of LMI1 and LFY, based on genetic evidence and demonstrate that these proteins interact together.

114

3.2 RESULTS

3.2.1 35S::LFY-TAP complements lfy-6 mutants

In order to perform a biochemical isolation of a protein complex, you need a very good antibody. The anti-LFY antibodies available to us at the beginning of this study, including one generated in our laboratory, did not have a high enough specificity for use in such a purification. Therefore, we decided to take a tandem affinity purification (TAP) approach to isolation LFY-containing complexes and generated a construct containing the

LFY coding sequence cloned in frame to a TAP tag. TAP tag purification has been used successfully to identify interacting proteins in many systems (Doolittle et al., 2009;

Rohila et al., 2004; Van Leene et al., 2007), especially because of the capability of purifying proteins using two sequential steps, to eliminate non-specific binding and enrich for targets. LFY is expressed at low levels. We were concerned that using the LFY native promoter would not enable us to isolate enough protein to proceed with. Therefore, we generated LFY-TAP overexpression lines using the 35S constitutive promoter

(35S::LFY-TAP). These plants display the LFY gain of function phenotype as described in Chapter 2 (Figure 2.4c). The LFY-TAP line used was crossed into the lfy-6 null background and shown to partially complement the mutant phenotype (Figure 3.1a), in a similar manner to untagged LFY driven under the 35S promoter.

115 3.2.2 Purification and identification of LFY complex components

The TAP procedure relies on two sequential purifications using two different affinity steps. The tandem affinity purification (TAP) tag we used is composed of a calmodulin binding domain (CBD) and two IgG binding domains from Staphylococcus aureus

Protein A, separated by a TEV protease cleavage site (Figure 3.1b; (Rigaut et al., 1999)).

This allows an initial purification using IgG beads followed by release of product by proteolysis and a second purification using calmodulin, thus enriching for product.

Since LFY is expressed in young floral buds, we purified proteins from inflorescence tissues containing floral buds that were still closed, which includes the inflorescence meristem as well as young floral buds. Initially, small-scale TAP tag purifications were done to standardize the protocol, to minimize the loss of LFY-TAP proteins as well as to minimize false positive bindings. As seen in Figure 3.1c, this procedure allowed an enrichment of the LFY-TAP product. The shift in the size of the band is due to the LFY-

TAP protein being cleaved through the TEV cleavage site, eliminating the IgG binding domain. Staining of all the proteins present in the gel revealed that other proteins were coming down with LFY-TAP (Figure 3.1d). Two prominent bands corresponding to the

IgG heavy and light chains, at 50 and 25 kDa respectively are seen (Figure 3.1d). In addition, several other bands were observed. The sample was then sent to Proteomic

Research Services (Ann Arbor, MI), which performed the protein isolation and mass spectrometry (MS) after in gel digestion with trypsin. LC/MS/MS was done on the samples to identify the proteins present. Seven bands (band A-E and L-H) excised from

116 the gel were analyzed (Figure 3.1d). The raw data sent from Proteomic Research Services is listed in Appendix A.

From the initial list of putative LFY-interacting proteins, we used proteomic (quality and the quantity of MS data; number of unique peptides, number of occurrences, sum ion score) and bioinformatics tools (expressions pattern, subcellular localization, biological activity) to prioritize those proteins most likely to be bona fide LFY-binding proteins

(Appendix A). First, we used a published list of contaminating proteins found in 46 different TAP purifications in Arabidopsis (Rohila et al., 2006) and eliminated those on our list that were contained on that list (Appendix A - highlighted in yellow). Examples of these proteins include HSP-70-related proteins, RUBISCO and ATP synthase. Since the TAP tag used in our experiment also contains a calmodulin-binding module (Figure

3.1b), we also eliminated all calmodulins and related proteins from our list (Appendix A

– highlighted in green). Once these assumed containments were eliminated, we took into account several properties to further prioritize the proteins. Only proteins with multiple peptide hits were considered. We further considered predicted subcellular localization of the proteins and predicted biological functions. From these considerations, we came up with a short list of putative LFY-interacting proteins (Table 3.1). Encouragingly, the

LFY-TAP protein itself was identified as a top pick. In addition as expected, transcription factors, chromatin remodeling factors, and other regulatory proteins were identified. It is quite possible that we have only identified some of the interacting partners of LFY. We collected floral buds at different stages of development, which contain different LFY- containing complexes, diluting any one such complex. In addition, due to the size 117 increase that occurs as flower development proceeds, older developmental stages are biased for in any such collection. In addition, only relatively highly expressed and stable proteins are likely to be isolated. Despite these limitations, we have identified LFY- interacting proteins (see below).

3.2.3 Putative LFY complex components selected

At1g03750 (CHR9- CHROMATIN REMODELING 9)- This poorly characterized gene is a member of SWI/SNF ATPase chromatin remodeling factor family. This family is large in Arabidopsis and includes the previously described SYD protein, known to be necessary for some of LFY’s function (Wagner and Meyerowitz, 2002). This family is characterized by the SNF2 domain and helicase domains (Figure 3.2a) found in proteins involved in transcriptional regulation, DNA-repair and other nuclear functions (Eisen et al., 1995). Examples of some of the other SWI2/SNF2 members that play a role in development include PICKLE (also known as GYNOS) that controls differentiation of carpels and regulates the transition from embryonic to vegetative state in Arabidopsis

(Eshed et al., 1999; Ogas et al., 1999). PIE1 controls flowering time in Arabidopsis (Noh and Amasino, 2003), BRAHAMA (BRM) controls flowering and shoot development

(Farrona et al., 2004) and CHR11 controls female gametophyte development (Huanca-

Mamani et al., 2005). SYD is relatively distantly related to CHR9, but in the same family as BRM (Bezhani et al., 2007). The expression profile of CHR9 in different developmental tissues, according to the AtGenExpress atlas ((Schmid et al., 2005);

(http://www.weigelworld.org/resources/microarray/AtGenExpress/)) includes senescing leaves, floral organs and seeds, with the highest expression in pollen. The Arabidopsis 118 Electronic Fluorescent Pictograph Browser (eFP Browser- (Winter, 2007); http://www.bbc.botany.utoronto.ca/efp/) also shows CHR9 expression in floral organs, the highest being in the pollen and seed. Our preliminary RT-PCR data indicates expression in the inflorescence (Figure 3.3a).

At5g22610- This uncharacterized protein belongs to the F-box (FBX) protein family, characterized by the F-box and functioning in SCF E3 ubiquitin ligase complexes

(Cardozo and Pagano, 2004). In A. thaliana alone 700 FBX proteins have been reported

(Gagne et al., 2002; Risseeuw et al., 2003; Xu et al., 2009). In addition to the F-box,

At5g22610 contains both leucine-rich-repeats (LRRs), often involved in protein-protein interactions, and a plant specific domain of unknown function, the F-box associated domain (FBD; Figure 3.2b; (Gagne et al., 2002)). The previously characterized LFY- interacting protein UFO is also an F-box protein; however, it is not closely related to

At5g22610 (Gagne et al., 2002). At5g22610 is a member of a small subfamily of F-box proteins that includes five other F-box proteins, none of which are characterized (Gagne et al., 2002). At5g22610 is not represented on the Affymetrix ATH1 microarray; therefore, public expression databases were not helpful. Our preliminary RT-PCR data indicates expression in the inflorescence but not in seedling and roots (Figure 3.3b).

At3g48430 (REF6- Relative of Early Flowering 6)- REF6 is a JmjC and N domain containing histone demethylase involved in epigenetic control of gene expression (Noh et al., 2004b). There are 15 potentially active Jumonji (Jmj) domain histone demethylases in

Arabidopsis (Lu et al., 2008). REF6 contains four C2H2 zinc finger domains in addition 119 to the Jmj domains (Figure 3.2c). REF6 has been shown to demethylate H3K27me3/2 when overexpressed (Lu et al., 2011). Histone H3 lysine 27 trimethylation (H3K27me3) imparts gene repression (Lu et al., 2011). By demethylating this residue, REF6 helps control flowering time by activating FT and SOC1, leading to accelerated flowering (Noh et al., 2004b). EARLY FLOWERING 6 (ELF6), a paralog of REF6, also functions in flowering time regulation but in an opposite manner (Noh et al., 2004a). Recently it was shown that REF6 interacts with BES1 in brassinosteroid (BR) signaling and biosynthesis.

BES1 is a TF and recruits ELF6 and REF6 to regulate target gene expression (Yu et al.,

2008). BRs are known to regulate flowering time as well, linking the known functions of this protein (Domagalska et al., 2007).

At4g03364- At4g03364 is a novel uncharacterized C2H2-type zinc finger TF. The characterization of this protein will be described in detail in Chapter 4.

3.2.4 LFY complex components are localized in the nucleus

As discussed above, the genes encoding the putative LFY-interacting proteins CHR9,

At5g22610 and REF6 are expressed in floral tissues, overlapping the expression pattern of LFY. In order for these proteins to interact with LFY, they must be present in the same subcellular compartment as well. We created GFP fusion proteins of the selected genes driven by the 35S promoter and performed transient transfection into tobacco leaves to examine subcellular distribution. As discussed previously, LFY-GFP is found in the nucleus and also in cytoplasmic punctate structures that might represent plasmadesmata

(Figure 3.3c). Both CHR9 (Figure 3.3d) and At5g22610 (Figure 3.3e) are found in both 120 the nucleus and cytoplasm, overlapping the localization of LFY. This would allow interaction between these proteins and LFY. REF6 has been shown to localize to the nucleus previously (Yu et al., 2008).

3.2.5 CHR9 interacts with LFY

We isolated the putative LFY-interacting proteins through biochemical purification. In order to confirm physical interactions between these proteins and LFY, co-IP assays with proteins expressed in N. benthamiana leaves were performed. When 35S::LFY-GFP and

35S::CHR9-MYC were co-transformed, LFY-GFP was able to co-IP CHR9-MYC (Figure

3.4). Therefore, CHR9 is a true LFY-interacting protein.

3.2.6 Loss of CHR9 causes seed lethality

In order to study the function of CHR9, loss of function mutants are necessary. Three independent SALK insertion lines (Alonso et al., 2003), SALK_064383 (chr9-1; Figure

3.5d), SALK_064382 (chr9-2) and SALK_087472 (chr9-3) were screened. All alleles produced homozygous plants, which appeared relatively normal. Transcript levels have not been assessed for these lines. In chr9-1 homozygous plants, the first 5-10 siliques on every branch are abnormally small compared with wild type. These siliques contain misshapen and shrunken seeds (Figure 3.5a, c). Later formed siliques develop to a normal size with fewer shrunken seeds (Figure 3.5b). This phenotype is similar to that of syd and brm single mutants and the syd; brm double mutant (Bezhani et al., 2007). The lack of full expressivity may be explained if proper seed development depends on SWI/SNF chromatin-remodeling factors and/or that chr9-1 is only a partial loss of function allele. 121 Insertion lines were also identified for the other loci encoding putative LFY-interacting proteins. Three insertion lines, SALK_117573, SALK_123361 and SALK_029402, were available for the F-box encoding locus At5g22610. The first two produced homozygous plants. One insertion line, SALK_133806, was studied for REF6, which also produced homozygous plants. These lines have not been further characterized.

3.2.7 LMI1 interacts with LFY

As mentioned in the Chapter1, LMI1 encodes a class I homeodomain ZIP TF and is a direct target of LFY. It then cooperates with LFY in the transcriptional activation of CAL.

We hypothesized that LMI1 might interact with LFY. To test this, we first did yeast two- hybrid assays. LMI is able to homodimerize (Figure 3.6a) as has been reported for other class I HD-ZIP proteins (Johannesson et al., 2001; Meijer et al., 2000; Sessa et al., 1993).

In addition, LMI1 can interact with LFY in yeast (Figure 3.6b).

In order to confirm the interaction between LMI1 and LFY in vivo, we performed co-IP studies using transient transfections in N. benthamiana. When 35S::LMI1-GFP was co- infiltrated with 35S::LFY-MYC, LMI-GFP was able to IP LFY-MYC with LMI-GFP

(Figure 3.7a). This results supports an interaction between LFY and LMI1 in vivo. In order to confirm the co-IP results, we performed BiFC experiments in tobacco leaves.

YFP fluorescence is seen in the nucleus when the LFY and LMI1 constructs are present together (Figure 3.7b), confirming the physical interaction between these two proteins.

122 LMI1 localizes to the nucleus (Figure 3.7d), overlapping the subcellular localization of

LFY. According to (Saddic et al., 2006), LMI1 shows expression in the bract primordial during bolting, and strongly expressed in the incipient flower primordial after bolting, overlapping with LFYs expression pattern. Thereafter, the expression proceeds to the young floral primordia to stage 1 and 2 flowers, where LFY is still expressed. Later in floral development LMI1 is expressed in sepals and stamens at stage 7 and in petals in at stage 9.

3.2.8 Overexpression of LMI1 causes floral defects

Loss of function mutations in LMI1 have been described (Saddic et al., 2006). We generated overexpression lines to examine gain of function phenotypes, which show severe floral defects (8/10 independent lines). Abnormalities were seen in all floral organs (Figure 3.8a-g). The inflorescence structure is different from wild type, as there is less internode elongation between flowers, resulting in a clump of flowers at the top of the inflorescence (Figure 3.8a-c). This might reflect production of more flowers or more rapid production of flowers in addition to or instead of problems with internode elongation. Sepals and petals of 35S::LMI1 flowers are serrated and vary in number and size (Figure 3.8d-f). In most of the flowers, petals are entirely absent (Figure 3.8g).

Stamens are underdeveloped (Figure 3.8d-g). Carpels are stunted and protrude from the undeveloped sepals, petals and stamens (Figure 3.8a-g). This suggests that floral development is sensitive to the dose of LMI1.

123

3.3 DISCUSSION

The floral meristem identity gene LFY encodes a plant specific transcription factor.

Previously, very little information has been available about what other proteins may function together with LFY to regulate gene expression. Here we describe the identification and initial characterization of CHR9, REF6, At5g22610 and LMI1, putative components of LFY transcriptional complexes.

3.3.1 Putative LFY-interacting proteins identified by TAP purification

We used TAP purification to isolate LFY-containing protein complexes. This method has been previously used successfully to isolate protein complexes in Arabidopsis (Rohila et al., 2004; Rubio et al., 2005). From this purification, we identified several putative LFY- interacting proteins, which are discussed below.

CHR9 is a member of the helicase/SWI/SNF chromatin remodeling factor family

(Shaked et al., 2006). This family uses the energy of ATP hydrolysis to remodel chromatin structures, allowing transcription factors access to DNA and also functions in

DNA repair. At least 39 proteins in the Arabidopsis genome encode members of the

SWI/SNF family (Verbsky and Richards, 2001). CHR9 has been classified as being more related to SWI/SNF family members with roles in DNA repair; however, RNAi studies revealed that this is not its likely function (Shaked et al., 2006). Another member of the 124 SWI/SNF family, SYD, has previously been shown to work in cooperation with LFY

(Wagner and Meyerowitz, 2002). SYD acts as a repressor of LFY activity before floral transition under non-inductive conditions and acts as a co-activator in induction of B and

C class floral homeotic genes. The closest related protein to SYD in the Arabidopsis genome, BRM, also acts to activate floral homeotic gene expression (Hurtado et al.,

2006).

Our expression studies demonstrate that CHR9 is expressed in floral organs, pollen and seeds. We identified 3 putative insertional mutants in the CHR9 locus; one of these, chr9-

1, contains an insertion close to the 5’ end of the gene (Figure 3.5d). chr9-1 homozygous plants had aborted ovules or undeveloped seeds in their fruit, suggesting that its function may be necessary in ovule or seed development or both. This phenotype resembles the phenotype of syd; brm double mutants (Bezhani et al., 2007). It is possible that seed development depends on many SWI/SNF chromatin remodeling factors, which explains the incomplete expressivity observed. The interaction of CHR9 with LFY was validated by co-IP, suggesting that it is present in an LFY-containing transcriptional complex. As described for other SWI/SNF factors in plants (Farrona et al., 2004; Hurtado et al., 2006;

Kwon et al., 2005; Sarnowski et al., 2005; Su et al., 2006; Wagner and Meyerowitz,

2002), CHR9 could be acting as either a co-activator or a repressor in transcriptional complexes. It is possible that CHR9 is acting as such in LFY-containing complex by ensuring accessibility to DNA through chromatin remodeling. However, the function of

CHR9 in LFY-dependent gene expression remains to be elucidated.

125 We also identified another factor that acts at the chromatin level, REF6, which is known to function in flowering time regulation (Noh et al., 2004b). REF6 is a histone H3 lysine

27 demethylase that specifically demethylates H3K27me3 and H3K27me2. H3K27me3 methylation is mediated by polycomb group proteins (reviewed in (Ito and Sun, 2009)), promoting gene repression. REF6 acts to reverse this mark, relieving repression and allowing gene expression (Lu et al., 2011). Ectopic expression of REF6 allows expression of several direct targets of LFY, including AP1, AP3 and AG, in seedlings where they are not normally expressed (Lu et al., 2011). This is similar to the loss of function phenotype of CLF, a polycomb group histone methyltransferase, known to repress expression of these genes (Katz et al., 2004). This suggests that REF6 is acting with LFY to activate its target genes. Although we have not confirmed the physical interaction between LFY and REF6, there is other unpublished evidence that REF6 is interacting with LFY (personal communication-Dr. Doris Wagner). Further work needs to be done to explore the relationship between REF6 and LFY.

UFO has been shown to be physically associated with LFY (Chae et al., 2008) and be necessary to activate B class genes (Ingram et al., 1995; Lee et al., 1997; Levin and

Meyerowitz, 1995; Wilkinson and Haughn, 1995). UFO belongs to the F-box family of

E3 ubiquitin ligases. We identified another F-box protein in our TAP purification,

At5g22610. At5g22510 contains LRR repeats and a FBD domain in addition to the F- box and belongs to a subfamily containing at least three other proteins (At5g22730,

At5g44490, At5g22720; (Gagne et al., 2002)). None of these proteins have been

126 characterized. At5g22610 is expressed in floral tissues (Figure 3.3b). No further work has been done on this protein to date.

3.3.2 LMI1 interacts with LFY.

LMI1 was originally identified as a target gene of LFY and encodes a transcription factor that cooperates with LFY in the transcriptional activation of CAL (Saddic et al., 2006). In the CAL promoter the identified LMI1 and LFY binding sites are only 100 bp apart

(Saddic et al., 2006). We hypothesized that LMI1 and LFY might physically interact to regulate transcription. These two proteins can interact directly in yeast 2-hybrid analysis

(Figure 3.6b) and in planta by co-IPs and BiFC (Figure 3.7). LMI1 is strongly expressed in bract primordia during bolting and in incipient flower primordia, overlapping with the expression of both LFY and CAL. It is expressed throughout stage 1 and 2 flowers but is expressed only in sepals and stamens at stage 7 and in petals at stage 9 (Saddic et al.,

2006). Our data suggests that LMI1 may form a subunit of LFY-containing transcriptional complexes that act early in floral development,

3.3.3 Conclusions

We have used biochemical approaches to identify components of LFY-containing complexes. As might be expected, we recovered other transcription factors as well as chromatin remodeling and modifying enzymes. Interestingly, of the four genes encoding proteins identified by TAP purification (CHR9, REF6, At5g22610 and FOL1 (see

Chapter 4)), only CHR9 is represented on the ATH1 GeneChip. Therefore, these genes would be not be identified by expression data mining approaches. In addition, mutations 127 in two of the genes, chr9-1 and fol1 (see Chapter 4) appear to be either gametophytic or embryonic lethal. This means that mutations in these genes would be unlikely to be isolated in traditional genetic screens for factors acting in floral development. At5g22610 is a member of a multigene family; it may be redundant with other members of its family, making isolation based on mutant phenotype less likely. Therefore, using the TAP approach to identify LFY-interactors has proven to be successful in identifying novel actors in floral development.

128

3.4 EXPERIMENTAL PROCEDURES

3.4.1 Plant material and growth conditions

The SALK lines (Alonso et al., 2003) used in this study were obtained from the

Arabidopsis Biological Resource Center (ABRC; http://www.arabidopsis.org/abrc) at

The Ohio State University, Columbus, OH. lfy-6; 35S::LFY-TAP lines were created by crossing lfy-6 mutant lines with homozygous 35S::LFY-TAP lines. Arabidopsis plants used in this study were in Landsberg erecta (L. er) background and all SALK lines used were in Columbia (Col-0) background. The lfy-6 allele was previously described (Weigel et al., 1992).

Plant growth conditions for Arabidopsis and N. benthamiana are as described in Chapter

2. Arabidopsis transformants were selected on selection plates as described in Chapter 2.

3.4.2 Constructs and cloning

Cloning of CHR9, At5g22610, REF6 and LMI1 coding regions into pENTR/D-TOPO

Gateway entry vector was done as described in Chapter 2. The primers used are listed in

Table 3.2. The PCR products were sequenced at the PMGF and were then recombined into binary destination vectors pGWB5 (GFP tag at C-terminus) and into pGWB20 (MYC tag at C- terminus). The entry vector carrying the LFY coding region was recombined into pGWB29 (TAP tag C-terminus; a gift from T. Nakagawa, Shimane University, 129 Matsue, Japan). These were then introduced into Argobacterium tumefaciens strain

GV3101 for Arabidopsis plant stable transformation and N. benthamiana transient co- infiltrations. The 35S::empty-GFP vector in Agrobacterium was obtained from Dr. Iris

Meier, The Ohio State University, Columbus, OH.

BiFC vectors p2YN (YFP amino acids 1-158), p2YC (YFP amino acid 159-238) and pYN-

1 and pYC-1 carrying either fragment of split YFP in C- and N- termini respectively were used as in Chapter 2. The procedure described in Chapter 2 for cloning LMI1 into these vectors was used using the primers provided in Table 3.2. Cloning into the vectors and transformation in to Agrobacterium was done as in Chapter 2. Previously cloned LFY in

BiFC vectors were used for this experiment (Chapter 2).

For yeast two-hybrid assays, the pENTR/D clones with LMI1 coding region were recombined with pDEST22 and pDEST32 destination vectors with GAL4 Activation

Domain (AD) and DNA Binding Domain (BD), respectively (ProQuest Two-Hybrid system, Invitrogen). Transformation into yeast strain PJ694A and Y2H assay was done as in Chapter 2.

3.4.3 TAP tag purification and detection

Inflorescence tissue containing primarily unopened buds was collected. Twenty-five grams (fresh weight) was used for this study. Total proteins were extracted using 1:1(v/v) of extraction buffer as in (Zhao et al., 2008) with the following modifications: 0.1% NP-

40 instead of 0.25% dodecyl maltoside. The TAP tag purification using Protein A 130 Agarose beads (Invitrogen) and Calmodulin Affinity Resin (Stratagene) was performed as described in (Zhao et al., 2008). Western blots to detect the enriched LFY-TAP protein was done as described in Chapter 2 using Peroxidase Anti-Peroxidase (anti-PAP) (Sigma,

P-1291) antibody to detect protein A. Proteins were separated using SDS-PAGE gels and silver stained with Silver Stain Plus (Bio-Rad).

3.4.4 Mass spectrometry analysis

Mass spectrometry analysis was performed by Proteomic Research Services, Inc. (Ann

Arbor, MI, http://www.prsproteomics.com). In-gel digestion was performed on a ProGest workstation, incubating at 370C for four hours with trypsin. The resulting peptide mix were analyzed by nano LC/MS/MS on a Micromass Q-Tof 2 and/or a Finnigan LTQ.

15μl of hydrolysate were processed on a 75μm C18 column at a flow-rate of 200nL/min.

MS/MS data were searched using MASCOT (http://www.matrixscience.com) according to specified parameters. A detailed protocol is provided in http://www.prsproteomics.com).

3.4.5 Yeast two-hybrid interaction assay

Yeast competent cells preparation and transformations, and interaction studies were performed as described in Chapter 2. pDEST22-LMI1 were co-transformed with pDEST32-LMI1 and pDEST22-LMI1 was co-transformed with pDEST32-LFY and vice versa. As negative controls, empty vectors were co-transformed with above vectors carrying LMI1 or LFY.

131 3.4.6 Bimolecular Fluorescence Complementation Assay (BiFC)

BiFC was performed in transiently transformed N. benthamiana leaves and observations were done as described in Chapter 2. Agrobacterium with BiFC vectors carrying LFY and

LMI1 were co-infiltrated. Empty vectors with one half of the YFP together with the vector carrying LMI1 gene fused to the other half of the YFP was used as negative controls as well as the two empty vectors.

3.4.7 Computational analysis

On-line tools were utilized to study the available and predicted information on CHR9,

At5g22610 and REF6. Gene information was gathered from The Arabidopsis

Information Resource (TAIR) database (http://www.arabidopsis.org). Protein domains were identified using National Center for Biotechnology Information (NCBI)

(http://www.ncbi.nlm.nih.gov) and Universal Protein Resource (UniProt) databases

(http://www.uniprot.org).

3.4.8 Genomic DNA preparation and genotyping

Genomic DNA was extracted from leaves as described in (Teotia and Lamb, 2009). This was used as template in PCR reactions, to verify the presence of the T-DNA insertion in plants from SALK collection. LBb1 and RP primers were used to genotype the insertion and LP and RP was used to amplify the wild type locus (for primers refer to Table 3.2).

The sequence for above primers was obtained from SALK website

(http://signal.salk.edu/). PCR was done using Choice-Taq Blue DNA Polymerase

132 (Denville Scientific Inc., http://www.denvillescientific.com/) using a BioRAD iCycler version 4.006.

3.4.9 Co-immunoprecipitation assay

Co-IP assays with transiently transformed N. benthamiana leaves were done following the protocol in Chapter 2.

3.4.10 lfy-6 mutant complementation experiments

35S::LFY-TAP lines were crossed to lfy-6 mutants. F2 generation plants were genotyped. dCAPS primers (Neff et al., 1998) were used to screen for lfy-6; 35S::LFY-TAP lines

(listed in Table 3.2). In the F2 generation phenotypic analysis was done to check for complementation of lfy-6 null mutants. Complimented lines were analyzed to look for floral defects and number of branches formed before flower formation. The presence of petals and stamens, fused carpels and four sepals in the outer most whorl of the flower were some of the characters analyzed. We compared phenotypes of these lines with lfy-6 null mutants and wild type grown in the same growth area at the same time.

3.4.11 Phenotypic analysis of transgenic lines

Homozygous overexpression lines of LMI1 were screened for floral defects. Phenotypic analysis was attempted on chr9-1. Plants were observed at all stages, looking mostly for floral development defects. Siliques were dissected to observe the misshapen and shrunken seeds.

133

Figure 3.1. Tandem affinity purification of LFY-containing complexes from Arabidopsis inflorescences. (a) Micrographs of flowers of the indicated genotypes. (b) Amino acid sequence of the TAP tag fused in frame to LFY with important motifs indicated. (c) Western blot showing results of TAP purification. Anti-PAP antibody was used to develop Western. Size of the product is shown on the right of the blot. (d) Representative silver stained gel of final product of the large-scale TAP purification. Size (in kiloDaltons) is indicated on the right. The letters refer to the areas of the gel that were excised and processed further.

134

Figure 3.2. Gene structures of the genes encoding putative LFY-binding proteins. Predicted protein domains are shown below the exons (boxes) that encode them and final protein product size in amino acids is shown at right. (a) CHR9. (b) At5g22610. (c) REF6.

135

Figure 3.3. Putative LFY-binding proteins are found in inflorescences and in the same subcellular compartments as LFY. (a and b) RT-PCR showing expression in inflorescence. (a) CHR9. (b) At5g22610. ACTIN was used as the reference gene. IN- inflorescence SE-seedling RT-root (c-e) Subcellular localization in N. benthaminana leaves (c) LFY-GFP. (d) CHR9-GFP. (e) At5g22610-GFP. Arrowheads indicate the nuclei and the arrows indicate the cytoplasm.

136

Figure 3.4. LFY and CHR9 physically associate in vivo. Western blots showing the result of co-immunoprecipitation from transiently transfected N. benthamiana leaves. LFY-GFP was able to bring down CHR9-MYC and LFY-MYC (red arrowheads). Co-IP done with At4g06634 (white arrowhead) will be discussed in Chapter 4.

137

Figure 3.5. Reduced fertility is observed in chr9-1 plants. (a-c) Micrographs of siliques. (a) Early arising siliques from wild type (upper silique) and chr9-1 (lower silique) plants. The silique from chr9-1 has misshapen and shrunken seeds indicated by an arrowhead. Wild type has fully developed seeds and few unfertilized ovules, marked by an arrow. (b) A later arising chr9-1 silique with several misshapen and shrunken seeds (arrowheads) and unfertilized ovules (arrow) and normal developed seeds (asterisks) (c) Mature, fully desiccated chr9-1 showing shrunken seeds (arrowhead). (d) Schematic representation of CHR9 locus indicating insertion site of T-DNA in chr9-1 allele. Filled boxes represent exons and lines introns. Inverted triangle represents the T-DNA insertion position, in the first exon.

138

Figure 3.6. LMI1 interactions in Y2H assays. (a) LMI1 homodimerizes. (b) LMI1 interacts with LFY. Yeast transformed with constructs marked above the figure. Selected on SD-Leu-Trp-His dropout selection media.

139

Figure 3.7. LMI1 and LFY physically associate in vivo. (a) Western blots showing the results of co-immunoprecipitation from transiently transfected N. benthamiana leaves. Only LMI-GFP was able to bring down LFY-MYC (red arrowhead) but not GFP alone.

Continued 140 Figure 3.7: continued

Asterisk mark non-specific bands. (b-d) Confocal micrographs of transfected N. benthamiana leaves. Constructs used are indicated at the right or at the bottom of the panel. (b) LFY and LMI1 interact, creating fluorescence in the nucleus. Inset is magnification of the nucleus. (c) No fluorescence is detected when empty vectors are used. (d) LMI1-GFP is localized to the nucleus.

141

Figure 3.8. Overexpression of LMI1 causes floral development defects. (a-g) Micrographs of 35S::LMI1-GFP transgenic plants. (a-c) Inflorescences. (d-g) Flowers. (g) Sepals were removed to reveal absence of petals and poorly developed stamens and carpels. Yellow arrowheads indicate sepals, red arrowheads indicate petals and arrow indicate stamens. Protruding carpels marked with asterisks.

142 Table 3.1. Putative LFY-interacting proteins selected from TAP-purification.

Category AGI ID Gene Name Gene Product Transcription At5g61850 LFY Factors At4g06634 Unknown C2H2-type Zinc finger

Chromatin At3g48430 REF6 Histone demethylase Remodeling At1g03750 CHR9 SWI/SNF chromatin remodeling F-box At5g22610 Unknown F-box/LRR

143 Table 3.2. List of primers used in Chapter 3.

Experiment Primer name Primer Sequence (5’-3’) Source

LMI1 BiFC LMI1p2YCF TACGAACGATAGTTAATTAACATGGAGTGGTCAACAAC This study cloning GAGCAAC

LMI1p2YCR CACCTCCTCCACTAGTGGGGTATGACGGCCAGCCAGAG This study

LMI1pYC-1F CTGGAGGAGGCGGCCGCATGGAGTGGTCAACAACGAG This study CAAC LMI1pYC-1R ATTTGCGGACTCTAGATCAGGGGTATGACGGCCAGCCA This study GAG 144

CHR9 coding CHR9GWF CACCATGTCGTTGTTACACACTTTCAAAGAGA This study region cloning CHR9GWR TTACTTGACTCTTTCTAAAAAGTC This study

REF6 coding pDNRREF6F GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGCGG This study region cloning TTTCAGAGCAGAGTC pDNRREF6R GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTTTTGTT This study GGTCTTCTTAACCG At5g22610 FBGWF CACCATGGAGGAAAATATAGAGAAAAAGAATATGCG This study coding region cloning FBGWR ACTCACAATGGCACCATAATAGGATTCAGCAAC This study

LMI1 coding LMI1F CACCATGGAGTGGTCAACAACGAGC This study region cloning LMI1R TCAGGGGTATGACGGCCAGCC This study

144 Continued Table 3.2: continued

dCAPS lfy-6F AAG CAG CCG TCT GCG GTG TCA GCA GCT GTT http://www.weigelwo rld.org/resources/mut lfy-6R CTG TCA ATT TCC CAG CAA GAC AC ants/caps SALK line GCCTTGTTACTCTGATGAACTCTC http://signal.salk.edu/ S133806LP genotyping S133806RP AAGCCATGGAAACACATCTTG http://signal.salk.edu/

S087472LP GATAGGTTTCTCCATTTCGGG http://signal.salk.edu/

S087472RP CGGAATATCTGCAAGCAAGAG http://signal.salk.edu/

145 S117573LP GAAGAGAATCCATGCTTGCAC http://signal.salk.edu/

S117573RP ATTTGGAAGTTGGTGCAAGTC http://signal.salk.edu/

S064382LP CGAGAGAATTCTCCAAAACCG http://signal.salk.edu/

S064382RP TCCAGAATTTGAGAAGAACCATC http://signal.salk.edu/

S064383LP CACAGAAAGAAGGTGTCTGTGTC http://signal.salk.edu/

S064383RP TCGGAATCTCTCCAATTGATG http://signal.salk.edu/

S029402LP CATTGGTCTCTCGTTGCATTG http://signal.salk.edu/

S029402RP ACCCTTGAAATCTTTATGGGG http://signal.salk.edu/

S123361LP TTGTGATTGATGCCCCTAGAC http://signal.salk.edu/

S123361RP GCTAGTCTCGGGTCATAGCACC http://signal.salk.edu/

LBb1 GCGTGGACCGCTTGCTGCAACT http://signal.salk.edu/

145

REFERENCES

Alonso, J.M., A.N. Stepanova, T.J. Leisse, C.J. Kim, H. Chen, P. Shinn, D.K. Stevenson, J. Zimmerman, P. Barajas, R. Cheuk, C. Gadrinab, C. Heller, A. Jeske, E. Koesema, C.C. Meyers, H. Parker, L. Prednis, Y. Ansari, N. Choy, H. Deen, M. Geralt, N. Hazari, E. Hom, M. Karnes, C. Mulholland, R. Ndubaku, I. Schmidt, P. Guzman, L. Aguilar-Henonin, M. Schmid, D. Weigel, D.E. Carter, T. Marchand, E. Risseeuw, D. Brogden, A. Zeko, W.L. Crosby, C.C. Berry, and J.R. Ecker. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301:653-657. Bezhani, S., C. Winter, S. Hershman, J.D. Wagner, J.F. Kennedy, C.S. Kwon, J. Pfluger, Y. Su, and D. Wagner. 2007. Unique, shared, and redundant roles for the Arabidopsis SWI/SNF chromatin remodeling ATPases BRAHMA and SPLAYED. Plant Cell. 19:403-416. Blazquez, M.A., L. Soowal, I. Lee, and D. Weigel. 1997. LEAFY expression and flower initiation in Arabidopsis. Development. 124:3835-3844. Britten, R.J., and E.H. Davidson. 1969. Gene regulation for higher cells: a theory. Science. 165:349-357. Brown, A.P., V. Affleck, T. Fawcett, and A.R. Slabas. 2006. Tandem affinity purification tagging of fatty acid biosynthetic enzymes in Synechocystis sp. PCC6803 and Arabidopsis thaliana. Journal of experimental botany. 57:1563-1571. Busch, M.A., K. Bomblies, and D. Weigel. 1999. Activation of a floral homeotic gene in Arabidopsis. Science. 285:585-587. Cardozo, T., and M. Pagano. 2004. The SCF ubiquitin ligase: insights into a molecular machine. Nature reviews. Molecular cell biology. 5:739-751. Carlson, M., and B.C. Laurent. 1994. The SNF/SWI family of global transcriptional activators. Curr. Op. Cell Biol. 6:396-402. Castillejo, C., M. Romera-Branchat, and S. Pelaz. 2005. A new role of the Arabidopsis SEPALLATA3 gene revealed by its constitutive expression. The Plant journal : for cell and molecular biology. 43:586-596. Chae, E., Q.K. Tan, T.A. Hill, and V.F. Irish. 2008. An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development. Development. 135:1235-1245. Domagalska, M.A., F.M. Schomburg, R.M. Amasino, R.D. Vierstra, F. Nagy, and S.J. Davis. 2007. Attenuation of brassinosteroid signaling enhances FLC expression and delays flowering. Development. 134:2841-2850.

146 Doolittle, M.H., O. Ben-Zeev, S. Bassilian, J.P. Whitelegge, M. Peterfy, and H. Wong. 2009. Hepatic lipase maturation: a partial proteome of interacting factors. J Lipid Res. 50:1173-1184. Eisen, J.A., K.S. Sweder, and P.C. Hanawalt. 1995. Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions. Nucleic acids research. 23:2715-2723. Eshed, Y., S.F. Baum, and J.L. Bowman. 1999. Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell. 99:199-209. Farrona, S., L. Hurtado, J.L. Bowman, and J.C. Reyes. 2004. The Arabidopsis thaliana SNF2 homolog AtBRM controls shoot development and flowering. Development. 131:4965-4975. Gagne, J.M., B.P. Downes, S.H. Shiu, A.M. Durski, and R.D. Vierstra. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in Arabidopsis. Proc Natl Acad Sci U S A. 99:11519-11524. Garvie, C.W., and C. Wolberger. 2001. Recognition of specific DNA sequences. Molecular cell. 8:937-946. Goodrich, J., P. Puangsomlee, M. Martin, D. Long, E.M. Meyerowitz, and G. Coupland. 1997. A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature. 386:44-51. Hernandez, J.M., A. Feller, K. Morohashi, K. Frame, and E. Grotewold. 2007. The basic helix loop helix domain of maize R links transcriptional regulation and histone modifications by recruitment of an EMSY-related factor. Proc Natl Acad Sci U S A. Hong, R.L., L. Hamaguchi, M.A. Busch, and D. Weigel. 2003. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing. The Plant cell. 15:1296-1309. Huanca-Mamani, W., M. Garcia-Aguilar, G. Leon-Martinez, U. Grossniklaus, and J.P. Vielle-Calzada. 2005. CHR11, a chromatin-remodeling factor essential for nuclear proliferation during female gametogenesis in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America. 102:17231-17236. Hurtado, L., S. Farrona, and J.C. Reyes. 2006. The putative SWI/SNF complex subunit BRAHMA activates flower homeotic genes in Arabidopsis thaliana. Plant molecular biology. 62:291-304. Ingram, G.C., J. Goodrich, M.D. Wilkinson, R. Simon, G.W. Haughn, and E.S. Coen. 1995. Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell. 7:1501-1510. Ito, T., and B. Sun. 2009. Epigenetic regulation of developmental timing in floral stem cells. Epigenetics. 4:564-567. Jack, T., L.L. Brockman, and E.M. Meyerowitz. 1992. The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell. 68:683-697.

147 Johannesson, H., Y. Wang, and P. Engstrom. 2001. DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro. Plant molecular biology. 45:63-73. Katz, A., M. Oliva, A. Mosquna, O. Hakim, and N. Ohad. 2004. FIE and CURLY LEAF polycomb proteins interact in the regulation of homeobox gene expression during sporophyte development. Plant J. 37:707-719. Kaufmann, K., J.M. Muino, R. Jauregui, C.A. Airoldi, C. Smaczniak, P. Krajewski, and G.C. Angenent. 2009. Target genes of the MADS transcription factor SEPALLATA3: integration of developmental and hormonal pathways in the Arabidopsis flower. PLoS biology. 7:e1000090. Klemm, J.D., S.L. Schreiber, and G.R. Crabtree. 1998. Dimerization as a regulatory mechanism in signal transduction. Annu Rev Immunol. 16:569-592. Kornberg, R.D. 1974. Chromatin structure: a repeating unit of histones and DNA. Science. 184:868-871. Kornberg, R.D., and J.O. Thomas. 1974. Chromatin structure; oligomers of the histones. Science. 184:865-868. Kwon, C.S., C. Chen, and D. Wagner. 2005. WUSCHEL is a primary target for transcriptional regulation by SPLAYED in dynamic control of stem cell fate in Arabidopsis. Genes & development. 19:992-1003. Lamb, R.S., T.A. Hill, Q.K. Tan, and V.F. Irish. 2002. Regulation of APETALA3 floral homeotic gene expression by meristem identity genes. Development. 129:2079- 2086. Lee, I., D.S. Wolfe, O. Nilsson, and D. Weigel. 1997. A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Current Biology. 7:95-104. Lenhard, M., A. Bohnert, G. Jürgens, and T. Laux. 2001. Termination of Stem Cell Maintenance in Arabidopsis Floral Meristems by Interactions between WUSCHEL and AGAMOUS. Cell. 105:805-814. Levin, J.Z., and E.M. Meyerowitz. 1995. UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell. 7:529-548. Liljegren, S.J., C. Gustafson-Brown, A. Pinyopich, G.S. Ditta, and M.F. Yanofsky. 1999. Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate. Plant Cell. 11:1007-1018. Liu, C., W. Xi, L. Shen, C. Tan, and H. Yu. 2009a. Regulation of floral patterning by flowering time genes. Developmental cell. 16:711-722. Liu, C., W. Xi, L. Shen, C. Tan, and H. Yu. 2009b. Regulation of floral patterning by flowering time genes. Dev Cell. 16:711-722. Lohmann, J.U., R.L. Hong, M. Hobe, M.A. Busch, F. Parcy, R. Simon, and D. Weigel. 2001. A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell. 105:793-803. Lu, F., X. Cui, S. Zhang, T. Jenuwein, and X. Cao. 2011. Arabidopsis REF6 is a histone H3 lysine 27 demethylase. Nature genetics. 43:715-719. Lu, F., G. Li, X. Cui, C. Liu, X.J. Wang, and X. Cao. 2008. Comparative analysis of JmjC domain-containing proteins reveals the potential histone demethylases in Arabidopsis and rice. Journal of integrative plant biology. 50:886-896.

148 Luger, K., A.W. Mader, R.K. Richmond, D.F. Sargent, and T.J. Richmond. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389:251- 260. Meijer, A.H., R.J. de Kam, I. d'Erfurth, W. Shen, and J.H. Hoge. 2000. HD-Zip proteins of families I and II from rice: interactions and functional properties. Molecular & general genetics : MGG. 263:12-21. Merika, M., and D. Thanos. 2001. Enhanceosomes. Current opinion in genetics & development. 11:205-208. Neff, M.M., J.D. Neff, J. Chory, and A.E. Pepper. 1998. dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J. 14:387-392. Noh, B., S.H. Lee, H.J. Kim, G. Yi, E.A. Shin, M. Lee, K.J. Jung, M.R. Doyle, R.M. Amasino, and Y.S. Noh. 2004a. Divergent roles of a pair of homologous jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis flowering time. Plant Cell. 16:2601-2613. Noh, B., S.H. Lee, H.J. Kim, G. Yi, E.A. Shin, M. Lee, K.J. Jung, M.R. Doyle, R.M. Amasino, and Y.S. Noh. 2004b. Divergent roles of a pair of homologous jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis flowering time. The Plant cell. 16:2601-2613. Noh, Y.S., and R.M. Amasino. 2003. PIE1, an ISWI family gene, is required for FLC activation and floral repression in Arabidopsis. The Plant cell. 15:1671-1682. Ogas, J., S. Kaufmann, J. Henderson, and C. Somerville. 1999. PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc Natl Acad Sci U S A. 96:13839- 13844. Parcy, F., O. Nilsson, M.A. Busch, I. Lee, and D. Weigel. 1998. A genetic framework for floral patterning. Nature. 395:561-566. Rigaut, G., A. Shevchenko, B. Rutz, M. Wilm, M. Mann, and B. Seraphin. 1999. A generic protein purification method for protein complex characterization and proteome exploration. Nature biotechnology. 17:1030-1032. Risseeuw, E.P., T.E. Daskalchuk, T.W. Banks, E. Liu, J. Cotelesage, H. Hellmann, M. Estelle, D.E. Somers, and W.L. Crosby. 2003. Protein interaction analysis of SCF ubiquitin E3 ligase subunits from Arabidopsis. Plant J. 34:753-767. Rohila, J.S., M. Chen, R. Cerny, and M.E. Fromm. 2004. Improved tandem affinity purification tag and methods for isolation of protein heterocomplexes from plants. The Plant journal : for cell and molecular biology. 38:172-181. Rohila, J.S., M. Chen, S. Chen, J. Chen, R. Cerny, C. Dardick, P. Canlas, X. Xu, M. Gribskov, S. Kanrar, J.K. Zhu, P. Ronald, and M.E. Fromm. 2006. Protein-protein interactions of tandem affinity purification-tagged protein kinases in rice. The Plant journal : for cell and molecular biology. 46:1-13. Rohila, J.S., M. Chen, S. Chen, J. Chen, R.L. Cerny, C. Dardick, P. Canlas, H. Fujii, M. Gribskov, S. Kanrar, L. Knoflicek, B. Stevenson, M. Xie, X. Xu, X. Zheng, J.K. Zhu, P. Ronald, and M.E. Fromm. 2009. Protein-protein interactions of tandem affinity purified protein kinases from rice. PloS one. 4:e6685.

149 Rubio, V., Y. Shen, Y. Saijo, Y. Liu, G. Gusmaroli, S.P. Dinesh-Kumar, and X.W. Deng. 2005. An alternative tandem affinity purification strategy applied to Arabidopsis protein complex isolation. Plant J. 41:767-778. Saddic, L.A., B. Huvermann, S. Bezhani, Y. Su, C.M. Winter, C.S. Kwon, R.P. Collum, and D. Wagner. 2006. The LEAFY target LMI1 is a meristem identity regulator and acts together with LEAFY to regulate expression of CAULIFLOWER. Development. 133:1673-1682. Samach, A., J.E. Klenz, S.E. Kohalmi, E. Risseeuw, G.W. Haughn, and W.L. Crosby. 1999. The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F- box protein required for normal patterning and growth in the floral meristem. Plant J. 20:433-445. Sarnowski, T.J., G. Rios, J. Jasik, S. Swiezewski, S. Kaczanowski, Y. Li, A. Kwiatkowska, K. Pawlikowska, M. Kozbial, P. Kozbial, C. Koncz, and A. Jerzmanowski. 2005. SWI3 subunits of putative SWI/SNF chromatin-remodeling complexes play distinct roles during Arabidopsis development. The Plant cell. 17:2454-2472. Schmid, M., T.S. Davison, S.R. Henz, U.J. Pape, M. Demar, M. Vingron, B. Scholkopf, D. Weigel, and J.U. Lohmann. 2005. A gene expression map of Arabidopsis thaliana development. Nat Genet. 37:501-506. Sessa, G., G. Morelli, and I. Ruberti. 1993. The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities. The EMBO journal. 12:3507-3517. Shaked, H., N. Avivi-Ragolsky, and A.A. Levy. 2006. Involvement of the Arabidopsis SWI2/SNF2 chromatin remodeling gene family in DNA damage response and recombination. Genetics. 173:985-994. Su, Y., C.S. Kwon, S. Bezhani, B. Huvermann, C. Chen, A. Peragine, J.F. Kennedy, and D. Wagner. 2006. The N-terminal ATPase AT-hook-containing region of the Arabidopsis chromatin-remodeling protein SPLAYED is sufficient for biological activity. The Plant journal : for cell and molecular biology. 46:685-699. Teotia, S., and R.S. Lamb. 2009. The paralogous genes RADICAL-INDUCED CELL DEATH1 and SIMILAR TO RCD ONE1 have partially redundant functions during Arabidopsis development. Plant Physiol. 151:180-198. Thomas, J.O., and R.D. Kornberg. 1975. An octamer of histones in chromatin and free in solution. Proceedings of the National Academy of Sciences of the United States of America. 72:2626-2630. Van Leene, J., D. Eeckhout, G. Persiau, E. Van De Slijke, J. Geerinck, G. Van Isterdael, E. Witters, and G. De Jaeger. 2011. Isolation of transcription factor complexes from Arabidopsis cell suspension cultures by tandem affinity purification. Methods in molecular biology. 754:195-218. Van Leene, J., H. Stals, D. Eeckhout, G. Persiau, E. Van De Slijke, G. Van Isterdael, A. De Clercq, E. Bonnet, K. Laukens, N. Remmerie, K. Henderickx, T. De Vijlder, A. Abdelkrim, A. Pharazyn, H. Van Onckelen, D. Inze, E. Witters, and G. De Jaeger. 2007. A tandem affinity purification-based technology platform to study the cell cycle interactome in Arabidopsis thaliana. Molecular & cellular proteomics : MCP. 6:1226-1238.

150 Van Leene, J., E. Witters, D. Inze, and G. De Jaeger. 2008. Boosting tandem affinity purification of plant protein complexes. Trends in plant science. 13:517-520. Vanden Berghe, W., M.N. Ndlovu, R. Hoya-Arias, N. Dijsselbloem, S. Gerlo, and G. Haegeman. 2006. Keeping up NF-kappaB appearances: epigenetic control of immunity or inflammation-triggered epigenetics. Biochem Pharmacol. 72:1114- 1131. Verbsky, M.L., and E.J. Richards. 2001. Chromatin remodeling in plants. Current opinion in plant biology. 4:494-500. Wagner, D., and E.M. Meyerowitz. 2002. SPLAYED, a novel SWI/SNF ATPase homolog, controls reproductive development in Arabidopsis. Curr Biol. 12:85-94. Wagner, D., R.W.M. Sablowski, and E.M. Meyerowitz. 1999. Transcriptional activation of APETALA1 by LEAFY. Science. 285:582-584. Wagner, D., F. Wellmer, K. Dilks, D. William, M.R. Smith, P.P. Kumar, J.L. Riechmann, A.J. Greenland, and E.M. Meyerowitz. 2004. Floral induction in tissue culture: a system for the analysis of LEAFY-dependent gene regulation. Plant J. 39:273- 282. Weigel, D., J. Alvarez, D.R. Smyth, M.F. Yanofsky, and E.M. Meyerowitz. 1992. LEAFY controls floral meristem identity in Arabidopsis. Cell. 69:843-859. Weigel, D., and E.M. Meyerowitz. 1993. Activation of floral homeotic genes in Arabidopsis. Science. 261:1723-1726. Wilkinson, M.D., and G.W. Haughn. 1995. UNUSUAL FLORAL ORGANS controls meristem identity and organ primordia fate in Arabidopsis. Plant Cell. 7:1485- 1499. Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G.V., Provart, N.J. 2007. An "Electronic Fluorescent Pictograph" Browser for Exploring and Analyzing Large- Scale Biological Data Sets. PLoS One. 2. Wolffe, A.P., and H.R. Drew. 1989. Initiation of transcription on nucleosomal templates. Proceedings of the National Academy of Sciences of the United States of America. 86:9817-9821. Xu, G., H. Ma, M. Nei, and H. Kong. 2009. Evolution of F-box genes in plants: different modes of sequence divergence and their relationships with functional diversification. Proc Natl Acad Sci U S A. 106:835-840. Yu, X., L. Li, M. Guo, J. Chory, and Y. Yin. 2008. Modulation of brassinosteroid- regulated gene expression by Jumonji domain-containing proteins ELF6 and REF6 in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 105:7618-7623. Zhao, Q., J. Brkljacic, and I. Meier. 2008. Two distinct interacting classes of nuclear envelope-associated coiled-coil proteins are required for the tissue-specific nuclear envelope targeting of Arabidopsis RanGAP. The Plant cell. 20:1639- 1651.

151 CHAPTER 4

The C2H2 Zinc Finger Transcription Factor FRIEND OF LEAFY1 (FOL1) has Roles in Meristem Identity and Size Control in Arabidopsis thaliana

152

4.1 INTRODUCTION

As discussed in the previous chapter, we used Tandem Affinity Purification (TAP) followed by mass spectrometry to identify individual components of LFY complexes.

One protein identified was a novel C2H2-type zinc finger protein, which we have named

FRIEND OF LEAFY1 (FOL1).

Zinc finger proteins (ZFPs) play a critical role in many cellular functions, including DNA binding, RNA binding and protein-protein interactions. In general, zinc finger proteins can be classified based on the number and the order of the cysteine (C) and histidine (H) residues that bind zinc ions. Classes include C2H2, C2C2, C2HC, C2C2C2C2 and

C2HCC2C2 (Klug and Schwabe, 1995; Mackay and Crossley, 1998; Sanchez-Garcia and

Rabbitts, 1994). Among these, the C2H2-type ZFPs are one of the best-studied classes

(Laity et al., 2001). These proteins act as transcription factors with the zinc fingers binding DNA (Pabo et al., 2001). C2H2 proteins constitute one of the largest families of transcription factors in plants (Englbrecht et al., 2004).

The C2H2-type motif was first identified in the transcription factor TFIIIA in studies of

Xenopus laevis oocytes (Miller et al., 1985). Some C2H2-type ZFPs are still referred to as TFIIIA-type proteins or are sometimes referred to as Kruppel-type proteins, based on

153 the Drosophila Kruppel protein (Miller et al., 1985; Ollo and Maniatis, 1987). C2H2-type

ZFPs display a wide range of functions through DNA or RNA binding, and through involvement in protein-protein interactions (Grishin, 2001). C2H2-type ZFPs contain one of the best-characterized DNA binding motifs found in eukaryotes. This 28-30 amino acid motif contains two conserved C and two conserved H residues binding to one zinc atom tetrahedrally (Pabo et al., 2001). This zinc-dependent structure is required for the

DNA binding interaction. In the absence of the zinc ion or if the zinc fingers loss their ability to fold through residue mutations, DNA binding is abolished (Frankel et al., 1987;

Lee et al., 1989; Miller et al., 1985; Pavletich and Pabo, 1991). Each finger forms two beta-strands and one alpha helix (Wolfe et al., 2000) and has an amino acid sequence motif of X2-Cys-X2, 4-Cys-X12-His-X3, 4, 5-His (Pabo et al., 2001). The C2H2 zinc finger motif recognizes the DNA sequence by binding in the major grove through its alpha helix (Wolfe et al., 2000). Transcription factors (TFs) typically contain several zinc fingers (each with the beta/beta/alpha structure), facilitating multiple contacts along the

DNA, increasing binding specificity.

In Arabidopsis thaliana, an in silico analysis identified 176 C2H2 ZFPs, constituting one of the most abundant families of putative TFs in this organism (Englbrecht et al., 2004).

Only a minority of these is conserved in other eukaryotes while 81% are plant-specific

(Englbrecht et al., 2004). Two structural features distinguish most of the plant C2H2

ZFPs. In plants, the zinc fingers are parted by long spacers that vary in length and sequence (Sakamoto et al., 2004; Takatsuji, 1999), whereas in yeast and mammals the

154 zinc fingers are clustered and separated by short spacers (6-8 amino acids) known as H-C linkers (Klug and Schwabe, 1995). In addition, most of C2H2-type ZFPs in plants have an invariant QALGGH motif within the finger, which is lacking in other organisms

(Takatsuji, 1999). It has been shown that this motif is critical for DNA binding activity in those proteins that contain it and mutating any of these residues reduces or completely abolishes DNA binding ability (Kubo et al., 1998). For example, the Arabidopsis

SUPERMAN protein necessary for the proper spatial development of reproductive floral tissues, which contains one C2H2 zinc finger, losses its function when the second glycine of the QALGGH motif was mutated to aspartic acid (Sakai et al., 1995). Englbrecht et al.,

2004 further subdivided the C2H2 type ZFPs of Arabidopsis into three different sets (A,

B and C), each divided into subsets (C1, C2 and C3), which in turn were further divided into different families and subclasses. Set A consists of ZFPs with tandem ZF arrays containing up to five ZFs. Set B consists of tandem ZF arrays with more than five ZFs.

Set C contains a single ZF or several dispersed ZFs. This set can be further classified depending on the spacing between the two invariant zinc coordinating H residues by 3

(C1), four (C2) or five (C3) amino acid residues. A complete list of all Arabidopsis proteins categorized into these classes is given in (Englbrecht et al., 2004). Many ZFPs in plants have already been characterized and shown to be involved in many processes such as the regulation of floral organogenesis, gametogenesis, leaf initiation, lateral shoot initiation and stress response (Takatsuji, 1999).

FOL1 is a novel unknown C2H2-type ZFP encoded by locus At4g06634, and has five

155 zinc finger motifs, out of which four are placed in a tandem array and one separated from this array (Figure 4.1). All five zinc fingers contain the amino acid sequence motifs typically found in C2H2-type ZFPs. FOL1 falls into set A according to (Englbrecht et al.,

2004) and has at least two putative orthologs in maize, TRANSCRIPTION REPRESSOR

MAIZE 1 (TRM1) and YIN-YANG1 (YY1; (Xu et al., 2001)), which are members of the

YY1-family. The founding member of this family is an animal protein, YY1, which has been shown to act as either a transcriptional activator or repressor depending on context.

TRM1 was shown to bind to YY1-like DNA binding sites and to two other sites with no sequence similarity to the YY1 site. Like TRM1, FOL1’s four tandem zinc fingers are of the Kruppel-type. Members belonging to Kruppel/ TFIIIA group contain finger structures with (Tyr/Phe)-X-Cys-X2, 4-Cys-X3-Phe-X5-Leu-X2-His-X3, 5-His conserved sequence

(Berg, 1990). According to (Englbrecht et al., 2004), TRM1 and FOL1 have tandem fingers with rare spacing and unusually short linkers, features that are conserved in the putative orthologs from beyond plants. FOL1’s zinc finger regions do not contain the

QALGGH motif characteristic of most plant C2H2-type ZFPs.

In addition to its five zinc fingers, FOL1 also contains a putative SFP1 domain, which is a transcriptional repressor domain regulating the G2/M transistion, and a glutamic acid rich region near its C-terminus that might function as a transcriptional activation domain

(Figure 4.1; domains as annotated at the National Center for Biotechnology Information -

NCBI). In addition, a phosphoserine at residue 284 is predicted.

156

The FOL1 gene produces at least three splice variants identified (Figure 4.1c), with the first variant the most abundant (TAIR). The gene consists of six exons (Figure 4.1c). The only other Arabidopsis thaliana protein similar to FOL1 is At5g04240, a C2H2-type zinc finger family protein/jumonji family protein. This match is only due to the conserved zinc finger motifs and is unlikely to reflect similar function. Therefore, FOL1 is a unique gene in the Arabidopsis genome, facilitating its study.

This chapter presents our work characterizing the unique and important FOL1 gene in

Arabidopsis thaliana. FOL1 is expressed in the inflorescence and floral meristems, in developing floral organs, male and female gametophytes and developing embryos and young seedlings. It is not expressed in vegetative tissues. Loss and gain of function studies suggest that FOL1 functions in meristem size control and gametophyte development. In addition, FOL1 interacts with LFY, both physically and genetically, and has both LFY-dependent and independent functions. We demonstrate that FOL1 is an essential gene in Arabidopsis and is necessary for proper reproductive meristem development.

157

4.2 RESULTS

4.2.1 FOL1 has orthologs across the land plants.

FOL1 is a single copy gene in Arabidopsis; however, it has orthologs across the land plants. As shown in Figure 4.2, the FOL1 family of proteins is found from the moss

Physcometrella patens into angiosperms. In these orthologs, the four tandem zinc fingers and the isolated 5th zinc finger are highly conserved (Figure 4.3). The putative SPF repression domain detected in FOL1 overlaps with the 5th zinc finger and is also conserved in all the identified plant FOL1 orthologs. However, the Glu-rich region found at the C-terminus is only conserved in the angiosperm orthologs, and not in the moss or

Selaginella proteins (Figure 4.3). Currently, no orthologs have been identified in the vascular and seed plants between Selaginella and angiosperms; therefore it is unclear when the FOL1 clade acquired this sequence. Although there is some similarity between

FOL1 and the human YY1 transcription factor, this similarity is confined to the four tandem zinc fingers (which are found at the C-terminus of YY1 (Shi et al., 1991)). It is unclear if FOL1-like proteins are true orthologs of YY1. However, the conservation of this FOL1-like proteins in all land plants is consistent with a role in LFY ortholog function, since LFY-like proteins are also found in all land plants (Maizel et al., 2005).

158

4.2.2 The spatial and temporal expression pattern of FOL1 marks sites of cell proliferation

FOL1 is an uncharacterized gene; therefore, there is no available experimental data. In addition, FOL1 is not represented on the Affymetrix ATH1 chip, the most common microarray used generate the publically available expression data for Arabidopsis thaliana. Expression pattern information for this gene thus had to be generated de novo.

RT-PCR data indicates FOL1 is expressed in inflorescence and siliques (Figure 4.4a); however, this does not provide spatial expression data. We generated a construct consisting of a 2.6kb region 5’ upstream from the transcription start site of FOL1 fused to the coding region of the beta-glucoronidase (GUS) encoding gene (FOL1p::GUS). Ten independent initial transformation events were analyzed. Staining was observed only in the reproductive tissues, in young inflorescences and siliques (Figure 4.4b, d), with reduced expression in mature flowers and siliques. Within the flower, expression of

FOL1p::GUS is present in developing petals (Figure 4.5a inset), stamens and carpels

(Figure 4.5a). This data is consistent with the RT-PCR data. Intense staining was present in the male and female gametophytes (Figure 4.5a-c) and in the very young developing embryo inside the young seed (Figure 4.5d).

In the next generation (T1), we examined FOL1p::GUS expression throughout the lifecycle of Arabidopsis. For this, a time course experiment was performed from germination to 27-day-old plants. Staining was done every 2 days starting 3 days after the break from vernalization. As Figure 4.6a clearly shows, we observed FOL1p::GUS

159 expression in 3-day-old germinating seedlings. By day 5-7 the expression has diminished, with some staining, perhaps an artifact due to the long half life of the GUS product, observed in the vasculature in the leaves (Figure 4.6b, c). No FOL1p::GUS expression was observed during the rest of the vegetative phase of the plant (Figure 4.6d-f). This appears to contradict the RT-PCR data presented earlier; however, 10-day-old seedlings had been the source of the cDNA used in that experiment. This explains why no FOL1 expression was seen in those seedlings using RT-PCR. At day 15, FOL1p::GUS expression was observed in the shoot meristem area (Figure 4.6g), which by now has transformed into an inflorescence meristem, and also in the incipient floral meristems, suggesting that FOL1 is either involved in the transition from VM identity to IM identity or its expression is activated shortly after IM initiation. At day 25 (Figure 4.6l) and 27

(Figure 4.6m) FOL1 expression was observed at the base of the inflorescence axis where the axillary buds are forming branches. This further supports the observation that FOL1 is expressed at the initiation or just after the inflorescence meristem is formed.

Overall, the expression pattern of FOL1::GUS suggests that FOL1 is expressed at sites of cell proliferation, including male and female gametopytes, the embryo and in the inflorescence and young floral meristems.

160

4.2.3 Phenotypic analysis of insertion mutant lines exhibits the necessity of FOL1 for gametophyte development

In order to determine the function of FOL1, it is important to identify loss of function mutants. Two T-DNA insertional mutants in this locus were identified in the publically available mutant collections (SALK_040806C and SALK_041031; http://www.signalsalk.edu). FOL1 has 6 exons; in both the lines the insertion was predicted to be near the end of the fifth exon, which we confirmed through sequencing

(Figure 4.7a).

The SALK_040806C line, hereafter referred to as fol1-1, is homozygous for the insertion in FOL1. RT-PCR data revealed that a truncated FOL1 transcript is made in these plants

(Figure 4.7b). This transcript is predicted to form a protein of about 21kD, which is half the size of the full-length protein. We predict that fol1-1 would be a hypomorphic allele, but not a null allele. Although fol1-1 appears to be phenotypically normal, examination of the siliques formed revealed the presence of a large number of aborted or unfertilized ovules (Figure 4.7c). Furthermore, Alexander staining of the anthers of the stamen revealed inviable pollen compared to wild type (Figure 4.7d). This preliminary data suggest that FOL1 may be necessary for gametophyte development, consistent with its expression during this process.

Unlike fol1-1, homozygous plants were not observed for the SALK_041031 line, hereafter referred to as fol1-2. This could be due to gametophytic or embryonic lethality of the

161 allele. Alexander staining (Figure 4.7d) shows a lot of inviable pollen in anthers of fol1-

2/+ plants. In addition, preliminary germination counts done with this line revealed a germination rate of only 36.2% compared of that of wild type, 75.29%. These results suggest that FOL1 is necessary for gametophytic and/or embryo development. In order to determine whether the insertion in FOL1 is responsible for these phenotypes or if another linked mutation causes the lethality, a rescue construct carrying FOL1 gene under its native promoter (FOL1p::gFOL1) was introduced into these plants heterozygous for the insertion. If this construct compliments the phenotype observed, this would support the hypothesis that lack of functional FOL1 causes lethality in Arabidopsis and that it is an essential gene.

4.2.4 Knock down of FOL1 causes meristem defects

The inconsistent results seen with the insertional alleles of FOL1, and possible gametophytic defects and embryo lethality involved, makes it difficult to study the functionality of the FOL1 gene. Therefore, we took a different approach to knockdown

FOL1 gene expression through artificial microRNAs (amiRNAs; (Ossowski et al., 2008;

Schwab et al., 2006).

Three different amiRNA constructs (C1, C2 and C3) were used that would target three different regions of the FOL1 mRNA (see experimental procedure and Figure 4.8a). Two promoters were used to drive expression of the amiRNAs: the constitutive 35S promoter

162

(Benfey and Chua, 1990; Benfey et al., 1990) and an estradiol inducible promoter (Curtis and Grossniklaus, 2003).

The number of transformants recovered carrying amiRNA constructs driven by the 35S constitutive promoter was unusually low in number, especially with the C1 and C2 constructs. With C1, we were able to recover 13 independent transformants and with C2 only 3 transformants, compared to C3 and inducible constructs for which we were able to recover 32 or more transformants from comparable amounts of seeds plated on selection.

Plants used to transform were grown in controlled conditions in growth chambers at the same time and transformation replicates were performed with C1 and C2, eliminating the possibility of defects in the parent plants as an explanation for the low recovery. It is possible this transformation efficiency is due to the lethality issue previously observed with fol1-1 and fol1-2. To date, only 35S lines have been analyzed.

The inflorescences of second generation (T2) of transgenic plants carrying 35S::amiRNA constructs were used to analyze the expression levels of FOL1 in these lines. As shown in

Figure 4.8, four lines had significant knockdown of expression from C1 (amiRC1b-d) and

C2 (amiRC2c) constructs compared to wild type. These knockdown lines had altered development compared to wild type. The phenotypes we observed could be largely categorized into inflorescence meristem development defects, floral meristem identity defects and flower development defects.

163

We first examined inflorescence development, since FOL1 is strongly expressed in the inflorescence meristem. All amiRNA knockdown plants observed had extra branches subtended by cauline leaves before producing flowers. Typically, a wild type plant will have 2-3 branches before lateral meristems become floral. FOL1 knock down plants had as many as 5-7 branches before making flowers. In addition, many of these plants had branches coming from the stem where there were no visible cauline leaves (Figure 4.9b- e), which is never observed in wild type Arabidopsis. Branches arise from axillary meristems formed in association with leaves and not independently. FOL1 knockdown plant inflorescences also occasionally formed cauline leaves with no visible branch

(Figure 4.9c). These defects suggest a defect in lateral meristem identity and development. Some FOL1 knockdown plants also appeared to have floral meristem identity problems, since several times the inflorescence produced a leaf with a branch, then a flower and then another leaf with a branch, suggesting that the lateral meristems produced from the flank had mixed identity (Figure 4.9e). Taken together, these defects suggest that FOL1 functions in floral meristem identity.

In addition to these defects in lateral meristem identity, knockdown of FOL1 also caused changes in the inflorescence meristem itself. Some of the 35S::amiRNA plants had fasciated stems (Figure 4.10a, b), often thought to be caused by changes in the size of the meristem. Those plants also had a short inflorescence stem (Figure 4.10a, b). Some of these plants had a fused stem that appeared as 2-3 stems forming a helix that spiraled around each other (Figure 4.9c). There were phyllotaxy problems observed for all FOL1

164 knockdown plants (Figure 4.9 and Figure 4.10a, b). On a wild type Arabidopsis inflorescence, flowers arise in a regular spiral pattern with approximately equal internode lengths between them upon maturity (Figure 4.9a). However, on FOL1 knockdown plants, flowers were not placed in such a manner, resulting in an irregular pattern of flowers/siliques with reduced internode elongation that was more variable in length between nodes (Figure 4.9b-e and 4.10a, b). This was also seen for the branches of many of the 35S::amiRNA lines (Figure 4.9b, c). Sometimes, more than one lateral meristem appeared to form at a single node, resulting in as many as 7 branches growing from a single node (Figure 4.9b, d). Similar defects have been observed in Arabidopsis mutants with enlarged inflorescence meristems, suggesting FOL1 is necessary for regulation of the size of meristems.

In addition to floral meristem identity defects, FOL1 knock down plants had abnormal flowers. Some flowers had extra petals and sepals (Figure 4.10c). Similar to some of the inflorescence defects described above, extra floral organs can arise from a larger than normal floral meristem. In addition, the sepals of 35S::amiRNA plants had many more trichomes present than seen on wild type sepals (Figure 4.10c). This can be an indication that the sepals have a partial leaf-like identity.

165

4.2.5 Ectopic expression of FOL1 suggests a meristem function.

FOL1 overexpression/ectopic expression lines (FOL1OX) were generated as another approach to characterize this novel gene (35S::FOL1). We transformed both Colombia-0

(Col-0) and L. erecta (L.er) ecotypes.

The most striking phenotype observed in the L. er background was an arrested SAM

(Figure 4.11). These plants only developed a couple of abnormal leaves before the SAM produced pin-like organs and then arrested. Based on severity, we grouped the lines into classes. Class I is the most severe, with an arrested SAM that lead to lethality without any further development (Figure 4.11a, b). The SAM of these plants appears to differentiate.

Fifty percent of the transformants from independent transformation events belonged to

Class I (4/8 independent transformants). Class II plants had an arrested SAM but eventually axillary buds grew out and the plants developed relatively normally (Figure

4.11c-e). Class III plants had no observed abnormalities. Quantitative RT-PCR was not done to relate the expression levels to the severity of the phenotype. These phenotypes suggest that FOL1, when ectopically expressed in the SAM, can compromise the function of this meristem.

35S::FOL1 expressed in Col-0 showed two phenotypes we did not observe in the L. er background. Some of the transgenic lines displayed short stature (2/6 lines from independent transformation events). The dwarf plants observed did not grow pass 36mm in height (Figure 4.12a, b). The extremely small stature suggests defects in cell

166 proliferation in the plant. In addition, cell elongation may be less than wild type, although this was not examined. This meristematic deficiency is also shown in the flowers of these plants, which were infertile and missing floral organs, suggesting a smaller meristem.

Several other independent 35S::FOL1 lines appeared normal during vegetative development. However, these lines had floral defects including incorrect numbers of organs as well as organ identity defects. As shown in Figure 4.12c and e, some branches ended in a terminal flower or even several incomplete flowers. These flowers had fewer organs than wild type and showed homeotic transformation of the outer whorl sepals into carpelloid structures as well as more than one carpel (Figure 4.12c-e).

Ectopic overexpression of FOL1 caused different phenotypes in the two different backgrounds. This suggests that unique modifiers of FOL1 function may exist in the two backgrounds. It is interesting to note, however, that the phenotypes observed in both cases suggests that FOL1 functions in meristem size and identity.

4.2.6 FOL1 interacts with LFY

FOL1 was isolated from the biochemical analysis we performed (discussed in Chapter 3) to identify interacting partners of LFY. This interaction was not observed with Y2H assay, possibly due to an indirect interaction of FOL1 with LFY or due to the requirement of LFY and/ or FOL1 homodimerization for the interaction, since we know that LFY homodimerizes (Chapter 2) and that FOL1 dimerizes in yeast and in BiFC analysis done in N. benthamiana leaves (Figure 4.13). To confirm a physical interaction between FOL1

167 and LFY in planta, we used BiFC and co-IP assays from transiently transformed N. benthamiana leaves. Both of these assays demonstrated that these two proteins interact in vivo (Figures 4.14 and 4.15). In the BiFC assay, YFP fluorescence could be seen in the nucleus in distinct speckles/subnuclear foci when the FOL1 and LFY fusion proteins were co-expressed (Figure 4.14a). This is an interesting observation as LFY-GFP and

FOL1-GFP alone (Figure 4.14c) do not localize in to speckles as distinct as those formed when the two proteins are together. Although the identity and significance of these speckles/foci remains to be determined, the specificity of the interaction could indicate an important process FOL1 and LFY perform together. LFY-GFP alone is diffuse in the nucleoplasm and also forms cytoplasmic puncta (Figure 4.14c), which are likely to represent plasmadesmata, as LFY as been shown to traffic through these structures (Wu et al., 2003). FOL1-GFP is found only in the nucleus where there is some speckling, but not as dramatic as when it is co-expressed with LFY (Figure 4.14c). To confirm that the relocalization of LFY within the nucleus is caused by an association with FOL1 and not an artifact of the BiFC system, we co-expressed LFY-GFP with FOL1-MYC. In these cells, LFY is found at the plasmadesmata and in nuclear speckles, consistent with the

BiFC results (Figure 4.14d).

To further confirm the interaction between FOL1 and LFY, co-IPs were performed.

Proteins extracted from N. benthamiana leaves co-transformed with 35S::LFY-MYC and

35S::FOL1-GFP or 35S::CBF3-GFP were used. An anti-GFP antibody was used to immunoprecipitate FOL1-GFP or CBF3-GFP (Figure 4.15a). LFY-MYC was able to co-

168

IP with FOL1-GFP but not with CBF3-GFP. This further confirms the interaction of

FOL1 with LFY. To delineate the region of LFY that interacts with FOL1, LFY deletion variants were used in co-IP studies. 35S::LFY∆229-420-MYC or 35S::LFY∆1-229-MYC were co-infiltrated with 35S::FOL1-GFP. As shown in figure 4.15b, only LFY∆229-420-MYC was pulled down with FOL1-GFP (Figure 4.15b). This suggests that LFY interaction with

FOL1 is though the N-terminal half of LFY, which includes the conserved LFY dimerization domain.

4.2.7 FOL1 interacts genetically with LFY

We demonstrated the physical interaction of LFY and FOL1 in vivo using BiFC and co-

IP studies. In addition, knockdown of FOL1 causes floral meristem identity defects, similar to some aspects of the lfy phenotype. We therefore took a genetic approach to determine if the physical interactions between FOL1 and LFY are important for their functions in planta. For this, we crossed plants with altered levels of LFY and FOL1. Two

LFY alleles were used, the null allele lfy-6 and a weak hypomorphic allele lfy-5. These were crossed with 35S::FOL1-GFP lines. Crosses done with lfy-6 are yet to be analyzed.

In plants heterozygous for both lfy-5 and 3S::FOL1-GFP we observed a number of phenotypes not seen in either lfy-5 mutant plants or 35S::FOL-GFP plants. One such phenotype was the solitary flower formation in the axils of cauline leaves instead of the expected branch (Figure 4.16a, c, d). This indicates that a determinate floral meristem developed where an indeterminate inflorescence meristem should be. A similar phenotype is seen in 35S::LFY plants (Weigel and Nilsson, 1995). Observation of a

169 phenotype characteristic of higher LFY expression in a reduced LFY background was not an expected result. In addition to the axillary meristem defect, we also observed suppression of internode elongation in the inflorescence compared with wild type and lfy-

5 (Figure 4.16a), which resulted in short, stunted plants. The transheterozygotes we observed suggests that the two genes may act in a common genetic pathway, and this interaction is probably dependent on the ratio of FOL1/LFY.

170

4.3 DISCUSSION

FRIEND OF LFY1 (FOL1) is a novel C2H2-type zinc finger protein, which we identified through a biochemical assay done to discover components of LFY transcriptional complexes. This gene is not represented on the Affymetrix ATH1 chip, and there is no other experimental data available. In this study we describe the characterization of FOL1, a new player in flower development, in addition to understanding the role it performs together with LFY in a transcriptional complex in planta.

4.3.1 FOL1 marks the sites of cell proliferation

In order to understand the function of a gene, it is important to understand its expression pattern. Expression pattern information for this gene had to be generated de novo. Results using FOL1p::GUS transgenic lines indicate that FOL1 is expressed in the developing embryo within the young seed (Figure 4.5d). Expression continued until 3 days after germination and was not observed during vegetative development (Figure 4.6). FOL1 is expressed again at day 15 in the SAM, which has now transitioned to inflorescence identity, and also in incipient floral meristems (Figure 4.5a), suggesting that FOL1 is either involved in transition from VM to IM identity or activated shortly after IM initiation. FOL1 is also expressed in developing axillary buds (which make secondary inflorescence branches), supporting the interpretation that it is involved in IM fate or

171 activated just after the IM is formed (Figure 4.6l,m). In the flower, expression was observed in developing petals, male and female gametophytes in young flower buds

(Figure 4.5) and in siliques (Figure 4.4d) and the expression diminishes as the flower matures. By and large, our RT- PCR and FOL1p::GUS expression studies show that

FOL1 expression is prominent in sites of cell proliferation. This expression pattern is consistent with functional studies we have done, as FOL1 has been involved in meristem development and gametophyte development.

FOL1 was isolated as an interacting partner of LFY. The expression of LFY is found at low levels in leaves (see Chapter 1) and then confined to early flower meristems where it is ubiquitously expressed (Weigel et al., 1992). We have shown FOL1 expression in floral meristems (Figure 4.4b and 4.5a). In other words the expression pattern of FOL1 overlaps with that of LFY consistent with the interaction observed. The broader expression pattern of FOL1 suggests it has LFY-independent functions in addition to any roles with LFY.

4.3.2 FOL1 is necessary for gametophyte development

In order to examine gene function, we obtained two putative loss of function FOL1 alleles from publically available T-DNA insertion collections. However, the study of fol1-1 and fol1-2 was difficult due to a low germination rate of homozygous fol1-1 seeds and due to possible gametophytic or embryonic lethality of fol1-2. Alexander staining of anthers of fol1-2/+ plants revealed a high number of inviable pollen compared to wild

172 type (Figure 4.7d). fol1-2/+ siliques also contained a high percentage of aborted ovules or unfertilized ovules (Figure 4.7c). In fol1-2, homozygous mutant plants were never recovered. These observations suggest that FOL1 is necessary for gametophytic and/or embryo development. This correlates with the FOL1 expression pattern we observed in gametophytes in anthers and carpels and in young developing siliques (Figure 4.5).

Due to the difficulty we encountered working with the putative insertional alleles of

FOL1, we generated amiRNA lines to knock down FOL1 expression to examine function of this gene. Preliminary analysis of these plants and 35S::FOL1 ectopic expression plants suggests that FOL1 functions in controlling meristem proliferation.

4.3.3 FOL1 controls inflorescence meristem size

FOL1 amiRNA lines had a number of developmental defects. FOL1 is expressed in inflorescence meristems (Figures 4.4b and Figure 4.5a), suggesting it may function there.

A prominent defect observed in FOL1 knockdown plants was stem fasciation, where the stem resembled 2-3 stems fused and spiraled around each other (Figure 4.9 and 4.10). A similar phenotype has been described in mutants, such as clv1, where the inflorescence meristem is enlarged (Leyser and Furner, 1992). Knockdown plants also displayed irregular phyllotaxy along the bolt and reduced internode elongation, also associated with increases in meristem size (Leyser and Furner, 1992). The axillary IMs formed in association with cauline leaves sometimes bifurcated, producing two branches, which can happen when the meristem size is large. Taken together, this suggests that FOL1

173 functions to restrict the size of IMs. Since LFY is not expressed in IMs, this would be a

LFY-independent function of FOL1.

FOL1 involvement in meristem size control is further supported by the phenotype of

FOL1 overexpression transgenic plants. These 35S::FOL1 lines drive higher expression of the gene and also ectopic expression, for example in vegetative meristems. The most striking phenotype observed in 35S::FOL1 lines in the L.er background was an arrested

SAM (Figure 4.11). 50% of the independent transgenic lines isolated produced a couple of leaves or pin-like structures and arrested. This suggests that ectopic FOL1 in VMs caused them to stop proliferating and producing lateral organs. In the Col-0 background we observed different abnormalities in 35S::FOL1 lines, but they are still in line with

FOL1 being involved in regulation of meristem proliferation. Two of the independent lines were severely dwarfed (Figure 4.12a,b), suggesting cell proliferation and/or elongation defects. These lines were sterile and could not be propagated. The other lines were normal in height but had inflorescence and floral defects. Some of the inflorescence branches ended with a terminal flower or with several incomplete flowers, suggesting that the IM had transitioned to a floral meristem. Sepals of these terminal flowers were transformed into carpelloid structures. Often these terminal flowers did not maintain this floral fate, but rather made floral organs, then sent out a branch, and then continued making floral organs (Figure 4.12c-e), suggesting that the IM was not completely transformed to a flower.

174

4.3.4 FOL1 controls floral meristem identity and size

The phenotypes of 35S::FOL1 lines in the Col-0 background suggested that FOL1 may function in floral meristem identity. This is also supported by loss of function studies. An increase in the number of secondary branches subtended by cauline leaves before producing flowers has been previously observed in lfy mutants (Weigel et al., 1992), ufo mutants (Levin and Meyerowitz, 1995) and in bop1; bop2 mutants (Xu et al., 2010), all of which are known to be involved in floral meristem identity. We also observed this phenotype in amiRNA plants, suggesting that FOL1 may function in floral meristem identity. In addition, many FOL1 knock down plants made branches that were not subtended by a cauline leaf (Figure 4.9 b-e) or a cauline leaf without an axillary branch

(Figure 4.9c). The absence of a cauline leaf from the base of shoots preceding the first flower has also been observed in mutants with floral meristem identity defects (Xu et al.,

2010). Further indication that FOL1 functions in floral meristem identity is the fact that in some knockdown lines we observed a branch then a flower and then another branch

(Figure 4.9e), suggesting that the switch to making flowers was not complete. Together these phenotypes indicate that FOL1 function is necessary for floral meristem identity.

Since LFY also functions in floral meristem identity, this maybe an LFY-dependent function of FOL1. FOL1 amiRNA lines also have floral defects. These flowers contain extra sepals and petals (Figure 4.10c). This phenotype has been associated with mutations in genes that regulate floral meristem size (Fletcher et al., 1999; Leyser and Furner, 1992) and suggests that FOL1 knock down plants have larger flower meristems and that FOL1 functions in floral meristem size control.

175

How FOL1 functions in meristem size control is still not clear. We can speculate that it may be involved in regulating WUS, a homeodomain transcription factor important for meristem functions. Strong wus mutants die at the seedling stage without a SAM (Laux et al., 1996). In the SAM and IM, WUS functions to maintain the stem cells in an undifferentiated state and control of its expression is essential to regulate meristem size

(Mayer et al., 1998). Too little WUS will lead to small meristems while too much leads to large meristems. Expression of WUS is controlled by a feedback loop with the CLV pathway. WUS activates expression of the CLV genes (Brand et al., 2000; Fletcher et al.,

1999; Schoof et al., 2000). CLV1 and CLV2 form a receptor kinase complex at the plasma membrane, which recognizes the CLV3 peptide ligand. The CLV3 signal transduction pathway represses WUS expression in a feedback loop, regulating meristem size (reviewed in (Carles and Fletcher, 2003)). We can speculate that FOL1 maybe inhibiting the function of WUS or is responsive to signals from CLV in order to regulate size. Further work is needed to resolve this.

In the flower, WUS expression needs to be turned off at stage 5/6 in order for determinate growth (Lenhard et al., 2001; Lohmann et al., 2001). During floral development, WUS and LFY together activate AG expression by binding to adjacent sites on the AG regulatory region (Busch et al., 1999; Lenhard et al., 2001; Lohmann et al., 2001). AG is required for stamen and carpel development and determinate growth of the floral meristem (Bowman et al., 1991; Bowman et al., 1989; Yanofsky et al., 1990). In a negative feedback loop, AG directly represses WUS expression, causing the floral

176 meristem to terminate (Lenhard et al., 2001; Lohmann et al., 2001). Therefore, in the flower WUS activates its own negative regulator. This suggests a possible role for FOL1 with LFY in the floral meristem in regulating AG and/or WUS expression. However, this remains to be explored.

4.3.5 FOL1 is a LFY interacting partner

Biochemical isolation of LFY containing complexes identified FOL1 as a putative component of such complexes. We confirmed this physical interaction between FOL1 and LFY using BiFC (Figure 4.14) and co-IP (Figure 4.15) in planta. In the BiFC assay, the relocalization of LFY from a general nuclear localization into distinct loci in the nucleus, perhaps marking sites of transcription, when associating with FOL1 was an intriguing observation. Interestingly, FOL1 interacts with the N-terminal region of LFY

(Figure 4.15), in the area necessary for dimerization (see Chapter 2). To our knowledge,

FOL1 is the first protein identified to interact with the N-terminus of LFY.

The physical interaction between FOL1 and LFY, the overlap in their expression patterns and the commonalities between FOL1 knockdown phenotypes and lfy phenotypes suggests that these proteins may regulate transcription together during floral development. This interaction is also supported by a genetic interaction between the two genes. 35S::FOL1/+; lfy-5/+ plants displayed meristem identity issues in which an axillary IM was occasionally replaced with a floral meristem (Figure 4.16). Shoot conversion to a solitary flower is observed in LFY overexpression lines (Figures 1.8 and

177

2.4). It is unclear how the meristems of 35S::FOL1/+; lfy-5/+ plants are acquiring this unexpected identity change in a reduced LFY background. The phenotypes we observed are not seen either in lfy-5, lfy-5/+ or in FOL1 overexpression lines. These transheterozygotes suggests the two genes may act in a common genetic pathway, and their interaction probably depends on the ratio of FOL1/LFY.

4.3.6 Conclusions

Our biochemical isolation work identified a novel C2H2-type zinc finger protein as an interacting partner of LFY, FRIEND OF LFY1 (FOL1), whose transcript is not represented on the ATH1 microarray. fol1 mutations appear to be either gametophytic or embryonic lethal. Therefore, these genes would be not identified by expression data mining approaches or by traditional genetic screens for factors acting in floral meristem identity. Our analyses demonstrate that FOL1 has roles in gametophytic and embryonic development, in inflorescence and flower meristem size control and floral meristem identity in Arabidopsis thaliana. Its role in floral meristem identity is likely to be at least partially LFY-dependent, as supported by the genetic interaction between the two genes.

However, FOL1 also functions independently of LFY, particularly in the gametophyte, embryo and inflorescence meristem.

178

4.4 EXPERIMENTAL PROCEDURES

4.4.1 Plant material and growth conditions

The fol1-1 (SALK_040806C) and fol1-2 (SALK_041031) lines used in this study were obtained from the ABRC and are T-DNA insertion lines from the SALK collection

(Alonso et al., 2003). lfy-6/+; 35S::FOL1-GFP and lfy-5/+; 35S::FOL1-GFP lines were created by crossing mutant lines with homozygous 35S::FOL1-GFP lines. Arabidopsis plants used in this study were in the L.er and Col-0 ecotypes. The lfy-6 and lfy-5 alleles were previously described (Weigel et al., 1992).

Plant growth conditions are as described in Chapter 2.

4.4.2 Constructs and cloning

The FOL1 coding region was cloned into pENTR/D-TOPO Gateway entry vector

(Invitrogen) as described in Chapter 2. The primers used are listed in Table 4.1. The PCR products introduced to pENTR/D-TOPO vector were sequenced at the PMGF. FOL1 in pENTR/D-TOPO vector was then recombined into binary destination vectors pGWB5

(introducing a C-terminal GFP tag) and into pGWB20 (introducing a C-terminal MYC tag) (binary destination vectors were a gift from T. Nakagawa, Shimane University,

179

Matsue, Japan). Constructs containing LFY coding sequence and the deletions were the same used in Chapter 2.

The promoter region of FOL1, a 2615 bp region 5’ of the transcription start site, was amplified from genomic DNA using Phusion HF DNA Polymerase (NEB). The primers used to clone the promoter region are given in Table 4.1. This region was cloned into pDONR221 Gateway entry vector (Invitrogen) using the manufacturer’s protocol. After sequencing at the PMGF, this was recombined in the pGWB3 binary destination vector to drive expression of the GUS gene.

The FOL1 genomic region, including the 5’ and 3’ UTRs, was amplified using genomic

DNA as template and the primers listed in Table 4.1, using Phusion HF DNA polymerase as above. The FOL1 promoter and the genomic region were inserted into pDONR221P1-

P5r and pDONR221P5-P2, respectively (Invitrogen) and recombined together into the pGWB4 binary destination vector (to introduce a C-terminal GFP tag) using the MultiSite

Gateway Pro Kit (Invitrogen) following the manufacturer’s instructions. In order to clone the FOL1 ‘rescue construct’ carrying the promoter and the genomic region, the pGWB1 binary destination vector (no tag) was used instead.

The amiRNA constructs targeted against FOL1 were designed using the WMD3 tool

(http://wmd.weigelworld.org). Three sequences with high confident levels and one mismatch were selected. These sequences only targeted FOL1 and not other locus in the

180

Arabidopsis genome. The constructs chosen were: C1-

TTAAGGGCATGCGTACGGCCG, C2-TAAGGGCATGCGTATGCCCGA and C3-

TTTAAGGATGGGTCGCCTCTA (see Figure 4.7a for the target location). The plasmid pRS300, which contains a MIR319a precursor sequence, was obtained from Dr. Keith

Slotkin, The Ohio State University. PCR to obtain the amiRNA fragments were done using Pfu DNA Polymerase (Stratagene). For every construct, four fragments were generated; the primers used are listed in Table 4.1. These fragments were then fused into one precursor using PCR with the primers amiRNA modA and modB as in Table 4.1.

These fused constructs were then cloned into the pENTRD/TOPO (Invitrogen) vector according to the manufacturer’s instructions. These were sequenced at the PMGF and recombined using manufacturer’s guidelines into pGWB2 to drive expression under the

35S constitutive promoter or into pMDC7 to drive expression under an estradiol inducible element. All the above cloned plasmids were then introduced into Argobacterium tumefaciens strain GV3101 and was used to transform Arabidopsis wild type plants as described in Chapter 2.

For yeast two-hybrid assays, the FOL1-pENTR/D clone was recombined with pDEST22 and pDEST32 destination vectors with the GAL4 Activation Domain (AD) and DNA

Binding Domain (BD), respectively (ProQuest Two-Hybrid System, Invitrogen). These plasmids were transformed into yeast strain PJ694A (James, 2001) following the protocol published in the Clontech Yeast Protocol Handbook.

181

For BiFC, vectors p2YN (YFP amino acids 1-158), p2YC (YFP amino acids 159-238) and pYN-1 and pYC-1 carrying either fragment of split YFP in C- and N- termini respectively were used (vectors were from Dr. John A. Lindbo, The Ohio State University, Wooster,

OH). The procedure described in Chapter 2 for cloning LFY into these vectors was used to clone FOL1 using the primers provided in Table 4.1 These fusion constructs were transformed into Agrobacterium for N. benthamiana infiltrations. Generation of

Arabidopsis transgenic lines and transient infiltration of N. benthamiana leaves were done as described in Chapter 2.

4.4.3 Yeast two-hybrid interaction assay

Yeast competent cell preparation, transformations and interaction studies were performed as described in Chapter 2. pDEST22-FOL1 was co-transformed with pDEST32-FOL1. As negative controls, empty vectors were co-transformed with above vectors carrying FOL1.

4.4.4 Bimolecular Fluorescence Complementation Assay (BiFC)

BiFC was performed in transiently transformed N. benthamiana leaves and observations were done as described in Chapter 2. Agrobacterium with BiFC vectors carrying full- length LFY and FOL1 along with split YFP were co-infiltrated. Empty vectors with one half of the YFP together with the vector carrying FOL1 gene fused to the other half of the

YFP was used as negative controls as well as the two empty vectors.

182

4.4.5 Genomic DNA preparation and genotyping

Genomic DNA was extracted from leaves as described in (Teotia and Lamb, 2009). This was used as template in PCR reactions, to verify the presence of the T-DNA insertion in plants from the SALK collection. LBb1 and RP primers were used to genotype the insertion and LP and RP was used to amplify the wild type locus (for primers refer Table

4.1). The sequence for above primers was obtained from SALK website (Alonso et al.,

2003). PCR was done using Choice-Taq Blue DNA Polymerase (Denville Scientific Inc) using a BioRAD iCycler version 4.006.

4.4.6 RNA isolation and semi quantitative Real Time-PCR (RT-PCR)

Total RNA extraction and cDNA synthesis from inflorescence apices of amiRNA transgenic plants were done using the protocol described in Chapter 2. RT-PCR on amiRNA lines was performed using primers listed in Table 4.1. The ACTIN2 gene was used as the reference gene in RT-PCRs performed. PCR was done using Choice-Taq Blue

DNA Polymerase using the BioRAD iCycler version 4.006.

4.4.7 Co-immunoprecipitation assay

Co-IP assays with infiltrated leaves of N. benthamiana were done using the protocol described in detail in Chapter 2.

183

4.4.8 GUS staining

Rosette leaves, stems, cauline leaves, whole inflorescences and siliques were collected from initial (T0) FOL1::GUS transgenic lines. In the next generation (T1), every 2 days starting on day 3 after the break from vernalization, the seedlings or the plants were collected and stained. -glucoronidase (GUS) enzymatic activity was detected as described in (Hill et al., 1998). GUS stained inflorescences were observed under a Nikon

SMZ745T (Nikon) dissecting microscope and photographed using an OmniVID Camera

(LW Scientific).

4.4.9 Phenotypic analysis of transgenic lines amiRNA knockdown lines were scored for plant height, phyllotaxy defects, number of cauline leaves before the first flower, number of petals on flowers, presence of cauline leaves with no branches and vice versa, and number of axillary meristems.

Overexpression lines in the Col-0 ecotype were screened in the first generation. Floral development defects, plant height, and occurrence of terminal flowers were scored.

Overexpression lines in the L. er ecotype were scored in first generation for growth arrest. Homozygous lines in this ecotype background were also analyzed for phenotypes in the next generation.

For the loss of function studies, phenotypic analysis was done on homozygous fol1-1

(SALK_040806C) and heterozygous fol1-2 (SALK_041031) plants. Plants were observed

184 at all stages, looking mostly for floral development or identity defects, branching defects, plant height, aborted ovules and pollen viability. All seed germination rate experiments were conducted on MS media by counting the number of seeds plated, and then how many germinated.

lfy5/+; 3S::FOL1-GFP/+ plants were scored for solitary flower formation instead of a branch at the axils of the cauline leaf as well as the height and internode length.

4.4.10 Alexander Staining

Pollen viability of wild type and SALK lines were examined using the method described in (Alexander, 1969).

4.4.11 Computational Analysis

The sequence alignment was done as described in Chapter 2. The multiple alignment was subjected to a maximum-likelihood analysis as described in (Citarelli et al., 2010) to create the phylogenetic tree.

185

Figure 4.1. Structural features of FOL1 protein and gene. (a) Amino acid sequence of the longest isoform of FOL1. The five zinc finger motifs are in red (residues 79-103, 108- 132, 138-162, 168-193 and 230-255), the putative SFP1 domain is underlined, and the glutamic acid rich region is in blue (residue 341-386). The circled residue is the predicted phoshoserine residue at 284. (b) Schematic diagram of FOL1 protein showing five zinc fingers (red boxes), four tandemly spaced and one isolated and glutamic acid rich region (blue box). (c) Splice variants of FOL1. At4g06634.1 is considered the primary isoform. The filled boxes denote exons, the lines denote introns and the unfilled boxes are the untranslated regions (UTRs). Arrow above points to 5’ to 3’ direction.

186

Pt_ABK96475 0.999 Pt_XP_002328766 0.946 Rc_XP_002529014 0.992 Rc_XP_002529013

Gm_ACU21216 0.876 0.952 Gm_ACU24549 0.218

0.949 Mt_ACK38191

Vv_XP_002265428

0.91 0.238 Al_XP_002874477 0.938 At_FOL1 1

Br_ADK63417

Nt_BAA75685

Osj_Os02g0551900 0.999 0.109 Hv_BAJ88175

Zm_TRM 0.997 0.992 Zm_ACR37588 0.847

0.994 Sb_XP_002452252 0.96 Zm_YY1

Hv_BAJ90402

1 Osj_Os05g0106000

0.816 Zm_NP_001136556 0.998 Sb_XP_002439119

Sm_XP_002966727 0.989 Sm_XP_002978019 0.999

Pp_XP_001760438

0.3

Figure 4.2. Phylogenetic tree of FOL1 and its orthologs from selected land plants. Graphical representation of the maximum-likelihood phylogenetic tree of FOL1 orthologs. This tree is based on multiple alignments shown in Figure 4.3. Branch supports values are indicated at the nodes as computed in PhyML using an aLRT non-parametric Shimodaira-Hasegawa-like procedure and a midpoint rooting method.

187

Figure 4.3. Alignment of FOL1 and its orthologs from selected land plants. The zinc finger (ZnF) motifs are marked with a red bar and the glutamic acid rich region is marked with a blue bar. The putative SPF1 domain marked with a black bar. At, Arabidopsis thaliana; Al, Arabidopsis lyrata; Pt, Populus trichocarpa; Rc, Ricinus communis; Gm, Glycine max; Mt, Medicago truncatula; Vv, Vitis vinifera; Br, Brassica rapa; Nt, Nicotiana tabacum; Osj, Oryza sativa Japonica; Hv, Hordeum vulgare; Zm, Zea mays; Sb, Sorghum bicolor ; Sm, Selaginella moellendorffii; Pp, Physcomitrella patens.

188

Figure 4.4. Expression pattern of FOL1. (a) RT-PCR showing expression of FOL1 only in whole inflorescence and siliques. ACTIN was used as the reference gene. IN- inflorescence RL-rosette leaves SE-seedling SI-silique RT-root. (b-k) GUS expression; (b) Whole inflorescence showing expression in developing areas where cell division is still occurring. (d) Developing siliques showing expression in ovules at the ends of the siliques. (b, d, f, h, j) FOL1::GUS lines. (c, e, g, i, k) wild type. (b, c-inflorescence; d, e- silique; f, g-cauline leaves; h, i-stem; j, k-rosette leaves).

189

Figure 4.5. FOL1p::GUS expression in developing flowers and embryos. (a) Inflorescence with early (red arrowheads) and later stage flowers showing expression in petals (inset-asterisk), anthers (black arrow) and developing carpel (black arrowhead). (b) At later stages, FOL1 expression is confined to developing gametophytes. Insets: male gametophyte/pollen (left) and female gametophyte (right). (c) Expression within the ovule continues into embryo development (red arrow). (d) Developing embryo within an immature seed coat with FOL1p::GUS expression.

190

Figure 4.6. FOL1 expression is confined to very young seedlings and reproductive tissues. (a) FOL1p::GUS expression is seen at the root tip, hypocotyl and cotyledon of a 3-day-old seedling. (b) 5-day-old seedling. (c) 7-day-old seedling. (d) 9-day-old seedling. (e) 11-day-old plant. (f) 13-day-old plant. (g) By 15 days, FOL1 expression is seen in the apical meristem (circle). (h) 17-day-old plant FOL1 expression seen in inflorescence and floral meristems. (i) 19-day-old plant. (j) 21-day-old plant with expression in developing anthers and carpels. (k) 23-day-old plant. (l) 25-day-old plant with expression in co- inflorescence meristems. (m) 27-day-old plant FOL1 expression seen at the axillary buds (circle).

191

Figure 4.7. fol1-1 and fol1-2 have gametophyte defects. (a) Diagrammatic representation of the FOL1 gene, inverted triangle indicating the insertion site for fol1-1 and fol1-2. The filled boxes represents exons and the lines introns. Primer pairs used to amplify transcripts are marked below the diagram. (d) RT-PCR showing only the transcript before the insertion is made. (c) fol1-1 siliques (right) have a large number of aborted ovules (arrowheads) compared to wild type (left). (d) Alexander staining of genotypes as indicated. Insets show viable pollen (stained pink) and inviable pollen (stained blue). Asterisks mark inviable pollen in fol1-1.

192

Figure 4.8. FOL1 amiRNA lines have reduced transcript accumulation. (a) Schematic representation depicting the regions amiRNA constructs are targeted to. Primers used in RT-PCR are shown below the diagram. (b) RT-PCR of amiRNA transgenic lines (C1 and C2) and wild type. Asterisks marks the bands of knockdown lines selected for further analysis. ACTIN was used as the reference gene.

193

Figure 4.9. FOL1 knockdown causes meristem defects. (a) Wild type plant. (b) FOL1 knockdown line amiRC1b. (c, d and e) FOL1 knockdown line amiRC1b, amiRC1c. Phyllotaxy problems can be seen in all plants. A red arrowhead marks a branch without a subtending cauline leaf. Yellow arrowheads mark cauline leaves without a branch. White arrowhead marks the unusual alternation of a branch, a flower and a branch. White arrows marks multiple branches at a single node.

194

Figure 4.10. FOL1 knockdown causes meristem size defects. (a and b) Knockdown lines showing stem fasciation and short inflorescence stem. (c) Flower from a knockdown plant (right) next to a wild type flower (left) showing more petals and a plump phenotype. Asterisks marks the petals. White color arrow marks the fasciated stem. Red arrow points to extra trichomes on the sepals.

195

Figure 4.11. 35S::FOL1 causes an arrested SAM in the L.er background. (a and b) Class I severe phenotype, showing arrested SAM and plants completely arrest growth. (c, d, e) Class II phenotype with arrested SAM but the axillary buds grow out and plant grow successfully. Arrows point to arrested SAMs. Red arrowheads point to the leaf-like abnormal organs. White arrowheads points to axillary buds growing out in class II plants.

196

Figure 4.12. Ectopic expression of FOL1 causes reduced stature and terminal flowers in the Col-0 background. (a and b) Dwarfed plants. (c, d and e) Terminal flower phenotype in the apices of inflorescence. Arrow points to the dwarf plant in (a). Numbers indicate pistils of the terminal flowers. Red arrowheads points to carpelloid organs/sepal- like structures. White arrowheads point to exposed ovules on these carpelloid organs.

197

Figure 4.13. FOL1-FOL1 homodimerizes. (a) Y2H interaction assay showing homodimerization on selection plate. Vector combinations used to co-transform yeast cells are given as bait/prey. (b) Micrographs of BiFC analysis done in N. benthamiana leaves, showing interaction with C-terminal tagged YFP. The negative controls with the two empty vectors, or one empty with one FOL1 fused protein did not show fluorescence. The scale bars indicate 50 μm.

198

Figure 4.14. FOL1-LFY interaction in planta. Micrographs of N. benthamiana leaves: bright field, epifluorescence and merged images, from left to right.

Continued 199

Figure 4.14: continued

(a) FOL1 and LFY tagged at either the C-terminus or the N-terminus interact. Fluorescence is seen in distinct speckles in the nucleus (red arrowheads), which is not seen with either protein alone. (b) Negative controls consisting of two empty vectors or one empty vector with one FOL1 fusion protein did not show any fluorescence. (c) FOL1-GFP and LFY-GFP showing nuclear localization. FOL1-GFP shows speckled nature in the nucleus but not distinct as when FOL1 interacts with LFY. LFY-GFP marks the nucleoplasm and also shows the punctate points in the cytoplasm (white arrowheads). (d) LFY-GFP forms speckles in the nucleus when FOL1-MYC is present with LFY-GFP. The scale bars indicate 50μm.

200

Figure 4.15. FOL1 interacts with N-terminus of LFY. (a and b) Western blots of co- immunoprecipitations done using transiently transformed N. benthamiana leaves. (a) FOL1-GFP was able to bring down LFY-MYC (red arrowhead) but CBF3-GFP could not. (b) FOL1-GFP was able to pull down LFYΔ229-420-MYC (red arrowhead) but not LFYΔ1-229-MYC showing FOL1 interaction with N-terminal domain of LFY.

201

Figure 4.16. FOL1 and LFY interact genetically. (a) Compared to wild type the lfy- 5/+; 35S::FOL1/+ plants have reduced internode elongation. (b) lfy-5 plant. (c, d) Close ups of solitary flower in axil of cauline leaf (circles).

202

Table 4.1. List of primers used in Chapter 4.

Experiment Primer name Primer Sequence (5’-3’) Source FOL1 BiFC ZnFp2YCF TACGAACGATAGTTAATTAACATGGATCATCAAAATTATCAATAC This Study cloning ZnFp2YCR CACCTCCTCCACTAGTATCTTCATACTCGGTCTCTTCATC This Study

ZnFp2YNF TACGAACGATAGTTAATTAACATGGATCATCAAAATTATCAATAC This Study

ZnFp2YNR CACCTCCTCCACTAGTATCTTCATACTCGGTCTCTTCATC This Study

ZnFpYC-1F CTGGAGGAGGCGGCCGCATGGATCATCAAAATTATCAATAC This Study

ZnFpYC-1R ATTTGCGGACTCTAGACTAATCTTCATACTCGGTCTCTTC This Study

ZnFpYN-1F CTGGAGGAGGCGGCCGCATGGATCATCAAAATTATCAATAC This Study 203

ZnFpYN-1R ATTTGCGGACTCTAGACTAATCTTCATACTCGGTCTCTTC This Study

FOL1 coding ZnFGWF CACCATGGATCATCAAAATTATCAATACC This Study region cloning ZnFGWR ATCTTCATACTCGGTCTCTTCATCGTCGTC This Study

FOL1 genomic ZnFGenomicF GGGGACAACTTTGTATACAAAAGTTGCCAACCGGGACTCCATTAT This Study region cloning CAAAGTAT ZnFGenomicR GGGGACCACTTTGTACAAGAAAGCTGGGTAATCTTCATACTCGGTC This Study TCTT FOL1 promoter ZnFPromoterF GGGGACAAGTTTGTACAAAAAAGCAGGCTCACCGCCCTTGATGGT This Study region cloning GACAG Continued

203

Table 4.1: continued

ZnFPromoterR GGGGACAACTTTTGTATACAAAGTTGGGGTAAAGGTGGTTCCTTTG This Study TGAG FOL1 amiRNA amiRNAC1-1 GATTAAGGGCATGCGTACGGCCGTCTCTCTTTTGTATTCC This Study cloning amiRNAC1-2 GACGGCCGTACGCATGCCCTTAATCAAAGAGAATCAATGA This Study

amiRNAC1-3 GACGACCGTACGCATCCCCTTATTCACAGGTCGTGATATG This Study

amiRNAC1-4 GAATAAGGGGATGCGTACGGTCGTCTACATATATATTCCT This Study

amiRNAC2-1 GATAAGGGCATGCGTATGCCCGATCTCTCTTTTGTATTCC This Study

amiRNAC2-2 GATCGGGCATACGCATGCCCTTATCAAAGAGAATCAATGA This Study

amiRNAC2-3 GATCAGGCATACGCAAGCCCTTTTCACAGGTCGTGATATG This Study

204 amiRNAC2-4 GAATAAGGGGATGCGTACGGTCGTCTACATATATATTCCT This Study

amiRNAC3-1 GATTTAAGGATGGGTCGCCTCTATCTCTCTTTTGTATTCC This Study

amiRNAC3-2 GATAGAGGCGACCCATCCTTAAATCAAAGAGAATCAATGA This Study

amiRNAC3-3 GATAAAGGCGACCCAACCTTAATTCACAGGTCGTGATATG This Study

amiRNAC3-4 GAATTAAGGTTGGGTCGCCTTTATCTACATATATATTCCT This Study

amiRNAModA CACCCGATAAGCTTGATATCGAATTCCT This Study

amiRNAModB CGGCCGCTCTAGAACTAGTGGAT This Study

Continued 204

Table 4.1: Continued

amiRNA RT- ActinF GGCGATGAAGCTCAATCCAAA This Study PCR ActinR GGTCACGACCAGCAAGATCAA This Study

RTZnF1502F AATGGTGGTGGAGAGACTCCCAAATATAC http://signal.salk.edu/

RTZnF2050R CTAATCTTCATACTCGGTCTCTTCATCGTCG http://signal.salk.edu/

SALK line LBb1 GCGTGGACCGCTTGCTGCAACT http://signal.salk.edu/ genotyping SALK_041031LP TTGTGTTGTTGTTATTACCAGAGG http://signal.salk.edu/

SALK_041031RP GAACCGATGCAAAGTTCTGTC http://signal.salk.edu/

205 SALK_040806CLP AATGGGTCACAGGTGAAATTG http://signal.salk.edu/

SALK_040806CRP GAACCGATGCAAAGTTCTGTC http://signal.salk.edu/

205

REFERENCES

Alexander, M.P. 1969. Differential staining of aborted and nonaborted pollen. Stain Technol. 44:117-122. Alonso, J.M., A.N. Stepanova, T.J. Leisse, C.J. Kim, H. Chen, P. Shinn, D.K. Stevenson, J. Zimmerman, P. Barajas, R. Cheuk, C. Gadrinab, C. Heller, A. Jeske, E. Koesema, C.C. Meyers, H. Parker, L. Prednis, Y. Ansari, N. Choy, H. Deen, M. Geralt, N. Hazari, E. Hom, M. Karnes, C. Mulholland, R. Ndubaku, I. Schmidt, P. Guzman, L. Aguilar-Henonin, M. Schmid, D. Weigel, D.E. Carter, T. Marchand, E. Risseeuw, D. Brogden, A. Zeko, W.L. Crosby, C.C. Berry, and J.R. Ecker. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301:653-657. Benfey, P.N., and N.H. Chua. 1990. The Cauliflower Mosaic Virus 35S Promoter: Combinatorial Regulation of Transcription in Plants. Science. 250:959-966. Benfey, P.N., L. Ren, and N.H. Chua. 1990. Combinatorial and synergistic properties of CaMV 35S enhancer subdomains. The EMBO journal. 9:1685-1696. Berg, J.M. 1990. Zinc fingers and other metal-binding domains. Elements for interactions between macromolecules. The Journal of biological chemistry. 265:6513-6516. Bowman, J.L., G.N. Drews, and E.M. Meyerowitz. 1991. Expression of the Arabidopsis floral homeotic gene agamous is restricted to specific cell types late in flower development. The Plant Cell. 3:749-758. Bowman, J.L., D.R. Smyth, and E.M. Meyerowitz. 1989. Genes directing flower development in Arabidopsis. Plant Cell. 1:37-52. Brand, U., J.C. Fletcher, M. Hobe, E.M. Meyerowitz, and R. Simon. 2000. Dependence of stem cell fate in Arabidopsis on a feedback loop regulated by CLV3 activity. Science. 289:617-619. Busch, M.A., K. Bomblies, and D. Weigel. 1999. Activation of a floral homeotic gene in Arabidopsis. Science. 285:585-587. Carles, C.C., and J.C. Fletcher. 2003. Shoot apical meristem maintenance: the art of a dynamic balance. Trends in plant science. 8:394-401. Citarelli, M., S. Teotia, and R.S. Lamb. 2010. Evolutionary history of the poly(ADP- ribose) polymerase gene family in eukaryotes. BMC evolutionary biology. 10:308. Curtis, M.D., and U. Grossniklaus. 2003. A gateway cloning vector set for high- throughput functional analysis of genes in planta. Plant physiology. 133:462-469.

206

Englbrecht, C.C., H. Schoof, and S. Bohm. 2004. Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC genomics. 5:39. Fletcher, J.C., U. Brand, M.P. Running, R. Simon, and E.M. Meyerowitz. 1999. Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science. 283:1911-1914. Frankel, A.D., J.M. Berg, and C.O. Pabo. 1987. Metal-dependent folding of a single zinc finger from transcription factor IIIA. Proceedings of the National Academy of Sciences of the United States of America. 84:4841-4845. Grishin, N.V. 2001. Treble clef finger--a functionally diverse zinc-binding structural motif. Nucleic acids research. 29:1703-1714. Hill, T.A., C.D. Day, S.C. Zondlo, A.G. Thackeray, and V.F. Irish. 1998. Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development. 125:1711-1721. James, P. 2001. Yeast two-hybrid vectors and strains. Methods Mol Biol. 177:41-84. Klug, A., and J.W. Schwabe. 1995. Protein motifs 5. Zinc fingers. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 9:597-604. Kubo, K., A. Sakamoto, A. Kobayashi, Z. Rybka, Y. Kanno, H. Nakagawa, and H. Takatsuji. 1998. Cys2/His2 zinc-finger protein family of petunia: evolution and general mechanism of target-sequence recognition. Nucleic acids research. 26:608-615. Laity, J.H., B.M. Lee, and P.E. Wright. 2001. Zinc finger proteins: new insights into structural and functional diversity. Curr Opin Struct Biol. 11:39-46. Laux, T., K.F. Mayer, J. Berger, and G. Jurgens. 1996. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development. 122:87-96. Lee, M.S., G.P. Gippert, K.V. Soman, D.A. Case, and P.E. Wright. 1989. Three- dimensional solution structure of a single zinc finger DNA-binding domain. Science. 245:635-637. Lenhard, M., A. Bohnert, G. Jürgens, and T. Laux. 2001. Termination of Stem Cell Maintenance in Arabidopsis Floral Meristems by Interactions between WUSCHEL and AGAMOUS. Cell. 105:805-814. Levin, J.Z., and E.M. Meyerowitz. 1995. UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell. 7:529-548. Leyser, H.M.O., and I.J. Furner. 1992. Characterisation of three shoot apical meristem mutants of Arabidopsis thaliana. Development. 116:397-403. Lohmann, J.U., R.L. Hong, M. Hobe, M.A. Busch, F. Parcy, R. Simon, and D. Weigel. 2001. A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell. 105:793-803. Mackay, J.P., and M. Crossley. 1998. Zinc fingers are sticking together. Trends in biochemical sciences. 23:1-4. Maizel, A., M.A. Busch, T. Tanahashi, J. Perkovic, M. Kato, M. Hasebe, and D. Weigel. 2005. The floral regulator LEAFY evolves by substitutions in the DNA binding domain. Science. 308:260-263.

207

Mayer, K.F.X., H. Schoof, A. Haecker, M. Lenhard, G. Jurgens, and T. Laux. 1998. Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell. 95:805-815. Miller, J., A.D. McLachlan, and A. Klug. 1985. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. The EMBO journal. 4:1609-1614. Ollo, R., and T. Maniatis. 1987. Drosophila Kruppel gene product produced in a baculovirus expression system is a nuclear phosphoprotein that binds to DNA. Proceedings of the National Academy of Sciences of the United States of America. 84:5700-5704. Ossowski, S., R. Schwab, and D. Weigel. 2008. Gene silencing in plants using artificial microRNAs and other small RNAs. The Plant journal : for cell and molecular biology. 53:674-690. Pabo, C.O., E. Peisach, and R.A. Grant. 2001. Design and selection of novel Cys2His2 zinc finger proteins. Annual review of biochemistry. 70:313-340. Pavletich, N.P., and C.O. Pabo. 1991. Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science. 252:809-817. Sakai, H., L.J. Medrano, and E.M. Meyerowitz. 1995. Role of SUPERMAN in maintaining Arabidopsis floral whorl boundaries. Nature. 378:199-203. Sakamoto, H., K. Maruyama, Y. Sakuma, T. Meshi, M. Iwabuchi, K. Shinozaki, and K. Yamaguchi-Shinozaki. 2004. Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant physiology. 136:2734-2746. Sanchez-Garcia, I., and T.H. Rabbitts. 1994. The LIM domain: a new structural motif found in zinc-finger-like proteins. Trends Genet. 10:315-320. Schoof, H., M. Lenhard, A. Haecker, K.F.X. Mayer, G. Jurgens, and T. Laux. 2000. The stem cell population of Arabidopsis shoot meristems is maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell. 100:635-644. Schwab, R., S. Ossowski, M. Riester, N. Warthmann, and D. Weigel. 2006. Highly specific gene silencing by artificial microRNAs in Arabidopsis. The Plant cell. 18:1121-1133. Shi, Y., E. Seto, L.S. Chang, and T. Shenk. 1991. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell. 67:377-388. Takatsuji, H. 1999. Zinc-finger proteins: the classical zinc finger emerges in contemporary plant science. Plant molecular biology. 39:1073-1078. Teotia, S., S. Muthuswamy, and R.S. Lamb. 2010. RADICAL-INDUCED CELL DEATH1 and SIMILAR TO RCD ONE1 and the Stress-Induced Morphogenetic Response. Plant Signal Behav. 5. Weigel, D., J. Alvarez, D.R. Smyth, M.F. Yanofsky, and E.M. Meyerowitz. 1992. LEAFY controls floral meristem identity in Arabidopsis. Cell. 69:843-859. Weigel, D., and O. Nilsson. 1995. A developmental switch sufficient for flower initiation in diverse plants. Nature. 377:495-500.

208

Wolfe, S.A., L. Nekludova, and C.O. Pabo. 2000. DNA recognition by Cys2His2 zinc finger proteins. Annu Rev Biophys Biomol Struct. 29:183-212. Wu, X., J.R. Dinneny, K.M. Crawford, Y. Rhee, V. Citovsky, P.C. Zambryski, and D. Weigel. 2003. Modes of intercellular transcription factor movement in the Arabidopsis apex. Development. 130:3735-3745. Xu, M., T. Hu, S.M. McKim, J. Murmu, G.W. Haughn, and S.R. Hepworth. 2010. Arabidopsis BLADE-ON-PETIOLE1 and 2 promote floral meristem fate and determinacy in a previously undefined pathway targeting APETALA1 and AGAMOUS-LIKE24. Plant J. 63:974-989. Xu, T., M. Purcell, P. Zucchi, T. Helentjaris, and L. Bogorad. 2001. TRM1, a YY1-like suppressor of rbcS-m3 expression in maize mesophyll cells. Proceedings of the National Academy of Sciences of the United States of America. 98:2295-2300. Yanofsky, M.F., H. Ma, J.L. Bowman, G.N. Drews, K.A. Feldmann, and E.M. Meyerowitz. 1990. The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature. 346:35-39.

209

A COMPLETE LIST OF REFERENCES

Abe, M., Y. Kobayashi, S. Yamamoto, Y. Daimon, A. Yamaguchi, Y. Ikeda, H. Ichinoki, M. Notaguchi, K. Goto, and T. Araki. 2005. FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science. 309:1052-1056. Ahearn, K.P., H.A. Johnson, D. Weigel, and D.R. Wagner. 2001. NFL1, a Nicotiana tabacum LEAFY-like gene, controls meristem initiation and floral structure. Plant Cell Physiol. 42:1130-1139. Albert, V.A., D.G. Oppenheimer, and C. Lindqvist. 2002. Pleiotropy, redundancy and the evolution of flowers. Trends Plant Sci. 7:297-301. Alexander, M.P. 1969. Differential staining of aborted and nonaborted pollen. Stain Technol. 44:117-122. Alonso, J.M., A.N. Stepanova, T.J. Leisse, C.J. Kim, H. Chen, P. Shinn, D.K. Stevenson, J. Zimmerman, P. Barajas, R. Cheuk, C. Gadrinab, C. Heller, A. Jeske, E. Koesema, C.C. Meyers, H. Parker, L. Prednis, Y. Ansari, N. Choy, H. Deen, M. Geralt, N. Hazari, E. Hom, M. Karnes, C. Mulholland, R. Ndubaku, I. Schmidt, P. Guzman, L. Aguilar-Henonin, M. Schmid, D. Weigel, D.E. Carter, T. Marchand, E. Risseeuw, D. Brogden, A. Zeko, W.L. Crosby, C.C. Berry, and J.R. Ecker. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301:653-657. Amasino, R. 2004. Vernalization, competence, and the epigenetic memory of winter. The Plant cell. 16:2553-2559. Amoutzias, G.D., D.L. Robertson, S.G. Oliver, and E. Bornberg-Bauer. 2004. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes. EMBO reports. 5:274-279. Amoutzias, G.D., D.L. Robertson, Y. Van de Peer, and S.G. Oliver. 2008. Choose your partners: dimerization in eukaryotic transcription factors. Trends in biochemical sciences. 33:220-229. An, H., C. Roussot, P. Suarez-Lopez, L. Corbesier, C. Vincent, M. Pineiro, S. Hepworth, A. Mouradov, S. Justin, C. Turnbull, and G. Coupland. 2004. CONSTANS acts in the phloem to regulate a systemic signal that induces photoperiodic flowering of Arabidopsis. Development. 131:3615-3626. Araki, T. 2001. Transition from vegetative to reproductive phase. Current opinion in plant biology. 4:63-68. Aukerman, M.J., I. Lee, D. Weigel, and R.M. Amasino. 1999. The Arabidopsis flowering-time gene LUMINIDEPENDENS is expressed primarily in regions of

210

cell proliferation and encodes a nuclear protein that regulates LEAFY expression. Plant J. 18:195-203. Aukerman, M.J., and H. Sakai. 2003. Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell. 15:2730-2741. Bastow, R., and C. Dean. 2003. Plant sciences. Deciding when to flower. Science. 302:1695-1696. Beitz, E. 2000. TEXshade: shading and labeling of multiple sequence alignments using LATEX2 epsilon. Bioinformatics. 16:135-139. Benfey, P.N., and N.H. Chua. 1990. The Cauliflower Mosaic Virus 35S Promoter: Combinatorial Regulation of Transcription in Plants. Science. 250:959-966. Benfey, P.N., L. Ren, and N.H. Chua. 1990. Combinatorial and synergistic properties of CaMV 35S enhancer subdomains. The EMBO journal. 9:1685-1696. Benlloch, R., M.C. Kim, C. Sayou, E. Thevenon, F. Parcy, and O. Nilsson. 2011. Integrating long-day flowering signals: a LEAFY binding site is essential for proper photoperiodic activation of APETALA1. The Plant journal : for cell and molecular biology. Berbel, A., C. Navarro, C. Ferrandiz, L.A. Canas, F. Madueno, and J.P. Beltran. 2001. Analysis of PEAM4, the pea AP1 functional homologue, supports a model for AP1-like genes controlling both floral meristem and floral organ identity in different plant species. The Plant journal : for cell and molecular biology. 25:441-451. Berg, J.M. 1990. Zinc fingers and other metal-binding domains. Elements for interactions between macromolecules. The Journal of biological chemistry. 265:6513-6516. Bezhani, S., C. Winter, S. Hershman, J.D. Wagner, J.F. Kennedy, C.S. Kwon, J. Pfluger, Y. Su, and D. Wagner. 2007. Unique, shared, and redundant roles for the Arabidopsis SWI/SNF chromatin remodeling ATPases BRAHMA and SPLAYED. Plant Cell. 19:403-416. Blazquez, M.A., R. Green, O. Nilsson, M.R. Sussman, and D. Weigel. 1998. Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter. Plant Cell. 10:791-800. Blazquez, M.A., L. Soowal, I. Lee, and D. Weigel. 1997. LEAFY expression and flower initiation in Arabidopsis. Development. 124:3835-3844. Blazquez, M.A., and D. Weigel. 2000. Integration of floral inductive signals in Arabidopsis. Nature. 404:889-892. Borner, R., G. Kampmann, J. Chandler, R. Gleissner, E. Wisman, K. Apel, and S. Melzer. 2000. A MADS domain gene involved in the transition to flowering in Arabidopsis. The Plant journal : for cell and molecular biology. 24:591-599. Boss, P.K., R.M. Bastow, J.S. Mylne, and C. Dean. 2004. Multiple pathways in the decision to flower: enabling, promoting, and resetting. The Plant cell. 16 Suppl:S18-31. Bowman, J.L., J. Alvarez, D. Weigel, E.M. Meyerowitz, and D.R. Smyth. 1993. Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development. 119:721-743.

211

Bowman, J.L., G.N. Drews, and E.M. Meyerowitz. 1991a. Expression of the Arabidopsis floral homeotic gene agamous is restricted to specific cell types late in flower development. The Plant Cell. 3:749-758. Bowman, J.L., D.R. Smyth, and E.M. Meyerowitz. 1989. Genes directing flower development in Arabidopsis. Plant Cell. 1:37-52. Bowman, J.L., D.R. Smyth, and E.M. Meyerowitz. 1991b. Genetic interactions among floral homeotic genes of Arabidopsis. Development. 112:1-20. Bradley, D., O. Ratcliffe, C. Vincent, R. Carpenter, and E. Coen. 1997. Inflorescence commitment and archnitecture in Arabidopsis. Science. 275:80-83. Brand, U., J.C. Fletcher, M. Hobe, E.M. Meyerowitz, and R. Simon. 2000. Dependence of stem cell fate in Arabidopsis on a feedback loop regulated by CLV3 activity. Science. 289:617-619. Britten, R.J., and E.H. Davidson. 1969. Gene regulation for higher cells: a theory. Science. 165:349-357. Brown, A.P., V. Affleck, T. Fawcett, and A.R. Slabas. 2006. Tandem affinity purification tagging of fatty acid biosynthetic enzymes in Synechocystis sp. PCC6803 and Arabidopsis thaliana. Journal of experimental botany. 57:1563-1571. Buckhout, W.A. 1880. Reversion in Floral Parts. Science. 1:310-311. Busch, M.A., K. Bomblies, and D. Weigel. 1999. Activation of a floral homeotic gene in Arabidopsis. Science. 285:585-587. Calonje, M., R. Sanchez, L. Chen, and Z.R. Sung. 2008. EMBRYONIC FLOWER1 participates in polycomb group-mediated AG gene silencing in Arabidopsis. The Plant cell. 20:277-291. Cardozo, T., and M. Pagano. 2004. The SCF ubiquitin ligase: insights into a molecular machine. Nature reviews. Molecular cell biology. 5:739-751. Carles, C.C., and J.C. Fletcher. 2003. Shoot apical meristem maintenance: the art of a dynamic balance. Trends in plant science. 8:394-401. Carlson, M., and B.C. Laurent. 1994. The SNF/SWI family of global transcriptional activators. Curr. Op. Cell Biol. 6:396-402. Castillejo, C., M. Romera-Branchat, and S. Pelaz. 2005. A new role of the Arabidopsis SEPALLATA3 gene revealed by its constitutive expression. The Plant journal : for cell and molecular biology. 43:586-596. Chae, E., Q.K. Tan, T.A. Hill, and V.F. Irish. 2008. An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development. Development. 135:1235-1245. Chanvivattana, Y., A. Bishopp, D. Schubert, C. Stock, Y.H. Moon, Z.R. Sung, and J. Goodrich. 2004. Interaction of Polycomb-group proteins controlling flowering in Arabidopsis. Development. 131:5263-5276. Chen, L., J.C. Cheng, L. Castle, and Z.R. Sung. 1997. EMF genes regulate Arabidopsis inflorescence development. Plant Cell. 9:2011-2024. Chen, X. 2004. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science. 303:2022-2025. Citarelli, M., S. Teotia, and R.S. Lamb. 2010. Evolutionary history of the poly(ADP- ribose) polymerase gene family in eukaryotes. BMC evolutionary biology. 10:308.

212

Clough, S.J., and A.F. Bent. 1998. Floral dip: A simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J. 16:735-743. Coen, E.S., and E.M. Meyerowitz. 1991. The war of the whorls: genetic interactions controlling flower development. Nature. 353:31-37. Coen, E.S., J.M. Romero, S. Doyle, R. Elliot, G. Murphy, and R. Carpenter. 1990. Floricaula : a homeotic gene required for flower development in Antirrhinum majus. Cell. 63:1311-1322. Corbesier, L., C. Vincent, S. Jang, F. Fornara, Q. Fan, I. Searle, A. Giakountis, S. Farrona, L. Gissot, C. Turnbull, and G. Coupland. 2007. FT protein movement contributes to long-distance signaling in floral induction of Arabidopsis. Science. 316:1030-1033. Curtis, M.D., and U. Grossniklaus. 2003. A gateway cloning vector set for high- throughput functional analysis of genes in planta. Plant physiology. 133:462-469. Das, P., T. Ito, F. Wellmer, T. Vernoux, A. Dedieu, J. Traas, and E.M. Meyerowitz. 2009. Floral stem cell termination involves the direct regulation of AGAMOUS by PERIANTHIA. Development. 136:1605-1611. Desvergne, B., L. Michalik, and W. Wahli. 2006. Transcriptional regulation of metabolism. Physiol Rev. 86:465-514. Ditta, G., A. Pinyopich, P. Robles, S. Pelaz, and M.F. Yanofsky. 2004. The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr Biol. 14:1935-1940. Dohmen, R.J., A.W. Strasser, C.B. Honer, and C.P. Hollenberg. 1991. An efficient transformation procedure enabling long-term storage of competent cells of various yeast genera. Yeast. 7:691-692. Domagalska, M.A., F.M. Schomburg, R.M. Amasino, R.D. Vierstra, F. Nagy, and S.J. Davis. 2007. Attenuation of brassinosteroid signaling enhances FLC expression and delays flowering. Development. 134:2841-2850. Doolittle, M.H., O. Ben-Zeev, S. Bassilian, J.P. Whitelegge, M. Peterfy, and H. Wong. 2009. Hepatic lipase maturation: a partial proteome of interacting factors. J Lipid Res. 50:1173-1184. Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32:1792-1797. Eisen, J.A., K.S. Sweder, and P.C. Hanawalt. 1995. Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions. Nucleic acids research. 23:2715-2723. Englbrecht, C.C., H. Schoof, and S. Bohm. 2004. Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC genomics. 5:39. Eshed, Y., S.F. Baum, and J.L. Bowman. 1999. Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell. 99:199-209. Farrona, S., G. Coupland, and F. Turck. 2008. The impact of chromatin regulation on the floral transition. Semin Cell Dev Biol. 19:560-573.

213

Farrona, S., L. Hurtado, J.L. Bowman, and J.C. Reyes. 2004. The Arabidopsis thaliana SNF2 homolog AtBRM controls shoot development and flowering. Development. 131:4965-4975. Ferrandiz, C., Q. Gu, R. Martienssen, and M.F. Yanofsky. 2000a. Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development. 127:725-734. Ferrandiz, C., Q. Gu, R. Martienssen, and M.F. Yanofsky. 2000b. Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development. 127:725-734. Fletcher, J.C., U. Brand, M.P. Running, R. Simon, and E.M. Meyerowitz. 1999. Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science. 283:1911-1914. Fornara, F., K.C. Panigrahi, L. Gissot, N. Sauerbrunn, M. Ruhl, J.A. Jarillo, and G. Coupland. 2009. Arabidopsis DOF transcription factors act redundantly to reduce CONSTANS expression and are essential for a photoperiodic flowering response. Dev Cell. 17:75-86. Frankel, A.D., J.M. Berg, and C.O. Pabo. 1987. Metal-dependent folding of a single zinc finger from transcription factor IIIA. Proceedings of the National Academy of Sciences of the United States of America. 84:4841-4845. Frankel, A.D., and P.S. Kim. 1991. Modular structure of transcription factors: implications for gene regulation. Cell. 65:717-719. Gagne, J.M., B.P. Downes, S.H. Shiu, A.M. Durski, and R.D. Vierstra. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in Arabidopsis. Proc Natl Acad Sci U S A. 99:11519-11524. Garner, W.W., and H.A. Allard. 1920. Effect of the relative length of day and night on flowering and fruiting of plants. Garner, W.W., and H.A. Allard. 1922. Photoperiodism, the Response of the Plant to Relative Length of Day and Night. Science. 55:582-583. Garvie, C.W., and C. Wolberger. 2001. Recognition of specific DNA sequences. Molecular cell. 8:937-946. Gendall, A.R., Y.Y. Levy, A. Wilson, and C. Dean. 2001. The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell. 107:525-535. Gilmour, S.J., A.M. Sebolt, M.P. Salazar, J.D. Everard, and M.F. Thomashow. 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124:1854-1865. Glass, C.K. 1994. Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev. 15:391-407. Goethe, J.W. 1790. Goethe's Botany: The Metamorphosis of Plants. In Chron. Bot. Vol. 10. T.A.A. (1946), editor. 63-126.

214

Goodrich, J., P. Puangsomlee, M. Martin, D. Long, E.M. Meyerowitz, and G. Coupland. 1997. A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature. 386:44-51. Goto, K., and E.M. Meyerowitz. 1994. Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes and Development. 8:1548-1560. Gregis, V., A. Sessa, L. Colombo, and M.M. Kater. 2008. AGAMOUS-LIKE24 and SHORT VEGETATIVE PHASE determine floral meristem identity in Arabidopsis. Plant J. 56:891-902. Grishin, N.V. 2001. Treble clef finger--a functionally diverse zinc-binding structural motif. Nucleic acids research. 29:1703-1714. Gustafson-Brown, C., B. Savidge, and M.F. Yanofsky. 1994. Regulation of the Arabidopsis homeotic gene APETALA1. Cell. 76:131-143. Hames, C., D. Ptchelkine, C. Grimm, E. Thevenon, E. Moyroud, F. Gerard, J.L. Martiel, R. Benlloch, F. Parcy, and C.W. Muller. 2008. Structural basis for LEAFY floral switch function and similarity with helix-turn-helix proteins. EMBO J. 27:2628- 2637. Harrison, S.C., and A.K. Aggarwal. 1990. DNA recognition by proteins with the helix- turn-helix motif. Annual review of biochemistry. 59:933-969. Helliwell, C.A., C.C. Wood, M. Robertson, W. James Peacock, and E.S. Dennis. 2006. The Arabidopsis FLC protein interacts directly in vivo with SOC1 and FT chromatin and is part of a high-molecular-weight protein complex. Plant J. 46:183-192. Hempel, F.D., D. Weigel, M.A. Mandel, G. Ditta, P.C. Zambryski, L.J. Feldman, and M.F. Yanofsky. 1997. Floral determination and expression of floral regulatory genes in Arabidopsis. Development. 124:3845-3853. Hepworth, S.R., F. Valverde, D. Ravenscroft, A. Mouradov, and G. Coupland. 2002. Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs. The EMBO journal. 21:4327-4337. Hernandez, J.M., A. Feller, K. Morohashi, K. Frame, and E. Grotewold. 2007. The basic helix loop helix domain of maize R links transcriptional regulation and histone modifications by recruitment of an EMSY-related factor. Proc Natl Acad Sci U S A. Hill, T.A., C.D. Day, S.C. Zondlo, A.G. Thackeray, and V.F. Irish. 1998. Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development. 125:1711-1721. Hisamatsu, T., and R.W. King. 2008. The nature of floral signals in Arabidopsis. II. Roles for FLOWERING LOCUS T (FT) and gibberellin. Journal of experimental botany. 59:3821-3829. Hofer, J., L. Turner, R. Hellens, M. Ambrose, P. Matthews, A. Michael, and N. Ellis. 1997. UNIFOLIATA regulates leaf and flower morphogenesis in pea. Current biology : CB. 7:581-587. Hong, R.L., L. Hamaguchi, M.A. Busch, and D. Weigel. 2003. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing. The Plant cell. 15:1296-1309.

215

Honma, T., and K. Goto. 2000. The Arabidopsis floral homeotic gene PISTILLATA is regulated by discrete cis-elements responsive to induction and maintenance signals. Development. 127:2021-2030. Huala, E., and I.M. Sussex. 1992. LEAFY interacts with floral homeotic genes to regulate Arabidopsis floral development. The Plant Cell. 4:901-913. Huanca-Mamani, W., M. Garcia-Aguilar, G. Leon-Martinez, U. Grossniklaus, and J.P. Vielle-Calzada. 2005. CHR11, a chromatin-remodeling factor essential for nuclear proliferation during female gametogenesis in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America. 102:17231-17236. Huang, T., H. Bohlenius, S. Eriksson, F. Parcy, and O. Nilsson. 2005. The mRNA of the Arabidopsis gene FT moves from leaf to shoot apex and induces flowering. Science. 309:1694-1696. Huffman, J.L., and R.G. Brennan. 2002. Prokaryotic transcription regulators: more than just the helix-turn-helix motif. Curr Opin Struct Biol. 12:98-106. Hurtado, L., S. Farrona, and J.C. Reyes. 2006. The putative SWI/SNF complex subunit BRAHMA activates flower homeotic genes in Arabidopsis thaliana. Plant molecular biology. 62:291-304. Imaizumi, T., T.F. Schultz, F.G. Harmon, L.A. Ho, and S.A. Kay. 2005. FKF1 F-box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis. Science. 309:293-297. Ingram, G.C., J. Goodrich, M.D. Wilkinson, R. Simon, G.W. Haughn, and E.S. Coen. 1995. Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell. 7:1501-1510. Irish, V.F. 2010. The flowering of Arabidopsis flower development. Plant J. 61:1014- 1028. Irish, V.F., and I.M. Sussex. 1990. Function of the apetala-1 gene during Arabidopsis floral development. The Plant cell. 2:741-753. Ito, T., and B. Sun. 2009. Epigenetic regulation of developmental timing in floral stem cells. Epigenetics. 4:564-567. Jack, T. 2004. Molecular and genetic mechanisms of floral control. The Plant cell. 16 Suppl:S1-17. Jack, T., L.L. Brockman, and E.M. Meyerowitz. 1992. The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell. 68:683-697. Jaeger, K.E., and P.A. Wigge. 2007. FT protein acts as a long-range signal in Arabidopsis. Current biology : CB. 17:1050-1054. James, P. 2001. Yeast two-hybrid vectors and strains. Methods Mol Biol. 177:41-84. Jiang, G., U. Lee, and F.M. Sladek. 1997. Proposed mechanism for the stabilization of nuclear receptor DNA binding via protein dimerization. Molecular and cellular biology. 17:6546-6554.

216

Johannesson, H., Y. Wang, and P. Engstrom. 2001. DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro. Plant molecular biology. 45:63-73. Kardailsky, I., V.K. Shukla, J.H. Ahn, N. Dagenais, S.K. Christensen, J.T. Nguyen, J. Chory, M.J. Harrison, and D. Weigel. 1999. Activation tagging of the floral inducer FT. Science. 286:1962-1965. Katz, A., M. Oliva, A. Mosquna, O. Hakim, and N. Ohad. 2004. FIE and CURLY LEAF polycomb proteins interact in the regulation of homeobox gene expression during sporophyte development. Plant J. 37:707-719. Kaufmann, K., J.M. Muino, R. Jauregui, C.A. Airoldi, C. Smaczniak, P. Krajewski, and G.C. Angenent. 2009. Target genes of the MADS transcription factor SEPALLATA3: integration of developmental and hormonal pathways in the Arabidopsis flower. PLoS biology. 7:e1000090. Kawamata, N., M.A. Pennella, J.L. Woo, A.J. Berk, and H.P. Koeffler. 2011. Dominant- negative mechanism of leukemogenic PAX5 fusions. Oncogene. Kelley, L.A., and M.J. Sternberg. 2009. Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc. 4:363-371. Kempin, S., B. Savidge, and M.F. Yanofsky. 1995. Molecular basis of the cauliflower phenotype in Arabidopsis. Science. 267:522-525. Kinoshita, T., J.J. Harada, R.B. Goldberg, and R.L. Fischer. 2001. Polycomb repression of flowering during early plant development. Proceedings of the National Academy of Sciences of the United States of America. 98:14156-14161. Klemm, J.D., S.L. Schreiber, and G.R. Crabtree. 1998. Dimerization as a regulatory mechanism in signal transduction. Annu Rev Immunol. 16:569-592. Klug, A., and J.W. Schwabe. 1995. Protein motifs 5. Zinc fingers. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 9:597-604. Kobayashi, Y., H. Kaya, K. Goto, M. Iwabuchi, and T. Araki. 1999. A pair of related genes with antagonistic roles in mediating flowering signals. Science. 286:1960- 1962. Koornneef, M. 1991. Isolation of higher plant developmental mutants. Symposia of the Society for Experimental Biology. 45:1-19. Koornneef, M., C. Alonso-Blanco, H. Blankestijn-de Vries, C.J. Hanhart, and A.J. Peeters. 1998. Genetic interactions among late-flowering mutants of Arabidopsis. Genetics. 148:885-892. Kornberg, R.D. 1974. Chromatin structure: a repeating unit of histones and DNA. Science. 184:868-871. Kornberg, R.D., and J.O. Thomas. 1974. Chromatin structure; oligomers of the histones. Science. 184:865-868. Kotake, T., S. Takada, K. Nakahigashi, M. Ohto, and K. Goto. 2003. Arabidopsis TERMINAL FLOWER 2 gene encodes a heterochromatin protein 1 homolog and represses both FLOWERING LOCUS T to regulate flowering time and several floral homeotic genes. Plant & cell physiology. 44:555-564.

217

Krizek, B.A., and J.C. Fletcher. 2005. Molecular mechanisms of flower development: an armchair guide. Nat Rev Genet. 6:688-698. Kubo, K., A. Sakamoto, A. Kobayashi, Z. Rybka, Y. Kanno, H. Nakagawa, and H. Takatsuji. 1998. Cys2/His2 zinc-finger protein family of petunia: evolution and general mechanism of target-sequence recognition. Nucleic acids research. 26:608-615. Kwon, C.S., C. Chen, and D. Wagner. 2005. WUSCHEL is a primary target for transcriptional regulation by SPLAYED in dynamic control of stem cell fate in Arabidopsis. Genes & development. 19:992-1003. Kyozuka, J., S. Konishi, K. Nemoto, T. Izawa, and K. Shimamoto. 1998a. Down- regulation of RFL, the FLO/LFY homolog of rice, accompanied with panicle branch initiation. Proceedings of the National Academy of Sciences of the United States of America. 95:1979-1982. Kyozuka, J., S. Konishi, K. Nemoto, T. Izawa, and K. Shimamoto. 1998b. Down- regulation of RFL, the FLO/LFY homolog of rice, accompanied with panicle branch initiation. Proc Natl Acad Sci U S A. 95:1979-1982. Laity, J.H., B.M. Lee, and P.E. Wright. 2001. Zinc finger proteins: new insights into structural and functional diversity. Curr Opin Struct Biol. 11:39-46. Lamb, R.S., T.A. Hill, Q.K. Tan, and V.F. Irish. 2002. Regulation of APETALA3 floral homeotic gene expression by meristem identity genes. Development. 129:2079- 2086. Lamb, R.S., and V.F. Irish. 2003. Functional divergence within the APETALA3/PISTILLATA floral homeotic gene lineages. Proc Natl Acad Sci U S A. 100:6558-6563. Lariguet, P., and C. Dunand. 2005. Plant photoreceptors: phylogenetic overview. J Mol Evol. 61:559-569. Laux, T., K.F. Mayer, J. Berger, and G. Jurgens. 1996. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development. 122:87-96. Lee, H., S.S. Suh, E. Park, E. Cho, J.H. Ahn, S.G. Kim, J.S. Lee, Y.M. Kwon, and I. Lee. 2000. The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis. Genes Dev. 14:2366-2376. Lee, I., D.S. Wolfe, O. Nilsson, and D. Weigel. 1997. A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Current Biology. 7:95-104. Lee, J., M. Oh, H. Park, and I. Lee. 2008. SOC1 translocated to the nucleus by interaction with AGL24 directly regulates leafy. Plant J. 55:832-843. Lee, K.A. 1992. Dimeric transcription factor families: it takes two to tango but who decides on partners and the venue? Journal of cell science. 103 ( Pt 1):9-14. Lee, M.S., G.P. Gippert, K.V. Soman, D.A. Case, and P.E. Wright. 1989. Three- dimensional solution structure of a single zinc finger DNA-binding domain. Science. 245:635-637. Lenhard, M., A. Bohnert, G. Jürgens, and T. Laux. 2001. Termination of Stem Cell Maintenance in Arabidopsis Floral Meristems by Interactions between WUSCHEL and AGAMOUS. Cell. 105:805-814.

218

Levin, J.Z., and E.M. Meyerowitz. 1995. UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell. 7:529-548. Levy, D.E., and J.E. Darnell, Jr. 2002. Stats: transcriptional control and biological impact. Nature reviews. Molecular cell biology. 3:651-662. Levy, Y.Y., S. Mesnage, J.S. Mylne, A.R. Gendall, and C. Dean. 2002. Multiple roles of Arabidopsis VRN1 in vernalization and flowering time control. Science. 297:243- 246. Leyser, H.M.O., and I.J. Furner. 1992. Characterisation of three shoot apical meristem mutants of Arabidopsis thaliana. Development. 116:397-403. Li, Q.H., and H.Q. Yang. 2007. Cryptochrome signaling in plants. Photochem Photobiol. 83:94-101. Lifschitz, E., T. Eviatar, A. Rozman, A. Shalit, A. Goldshmidt, Z. Amsellem, J.P. Alvarez, and Y. Eshed. 2006. The tomato FT ortholog triggers systemic signals that regulate growth and flowering and substitute for diverse environmental stimuli. Proc Natl Acad Sci U S A. 103:6398-6403. Liljegren, S.J., C. Gustafson-Brown, A. Pinyopich, G.S. Ditta, and M.F. Yanofsky. 1999. Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate. Plant Cell. 11:1007-1018. Lin, M.K., H. Belanger, Y.J. Lee, E. Varkonyi-Gasic, K. Taoka, E. Miura, B. Xoconostle-Cazares, K. Gendler, R.A. Jorgensen, B. Phinney, T.J. Lough, and W.J. Lucas. 2007. FLOWERING LOCUS T protein may act as the long-distance florigenic signal in the cucurbits. The Plant cell. 19:1488-1506. Liu, C., H. Chen, H.L. Er, H.M. Soo, P.P. Kumar, J.H. Han, Y.C. Liou, and H. Yu. 2008. Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development. 135:1481-1491. Liu, C., Z. Thong, and H. Yu. 2009a. Coming into bloom: the specification of floral meristems. Development. 136:3379-3391. Liu, C., W. Xi, L. Shen, C. Tan, and H. Yu. 2009b. Regulation of floral patterning by flowering time genes. Developmental cell. 16:711-722. Liu, C., W. Xi, L. Shen, C. Tan, and H. Yu. 2009c. Regulation of floral patterning by flowering time genes. Dev Cell. 16:711-722. Liu, C., J. Zhou, K. Bracha-Drori, S. Yalovsky, T. Ito, and H. Yu. 2007. Specification of Arabidopsis floral meristem identity by repression of flowering time genes. Development. 134:1901-1910. Lohmann, J.U., R.L. Hong, M. Hobe, M.A. Busch, F. Parcy, R. Simon, and D. Weigel. 2001. A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell. 105:793-803. Long, J., and M.K. Barton. 2000. Initiation of axillary and floral meristems in Arabidopsis. Dev Biol. 218:341-353. Lu, F., X. Cui, S. Zhang, T. Jenuwein, and X. Cao. 2011. Arabidopsis REF6 is a histone H3 lysine 27 demethylase. Nature genetics. 43:715-719. Lu, F., G. Li, X. Cui, C. Liu, X.J. Wang, and X. Cao. 2008. Comparative analysis of JmjC domain-containing proteins reveals the potential histone demethylases in Arabidopsis and rice. Journal of integrative plant biology. 50:886-896.

219

Luger, K., A.W. Mader, R.K. Richmond, D.F. Sargent, and T.J. Richmond. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 389:251- 260. Mackay, J.P., and M. Crossley. 1998. Zinc fingers are sticking together. Trends in biochemical sciences. 23:1-4. Maier, A.T., S. Stehling-Sun, H. Wollmann, M. Demar, R.L. Hong, S. Haubeiss, D. Weigel, and J.U. Lohmann. 2009. Dual roles of the bZIP transcription factor PERIANTHIA in the control of floral architecture and homeotic gene expression. Development. 136:1613-1620. Maizel, A., M.A. Busch, T. Tanahashi, J. Perkovic, M. Kato, M. Hasebe, and D. Weigel. 2005. The floral regulator LEAFY evolves by substitutions in the DNA binding domain. Science. 308:260-263. Mandel, M.A., C. Gustafson-Brown, B. Savidge, and M.F. Yanofsky. 1992. Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature. 360:273-277. Mandel, M.A., and M.F. Yanofsky. 1995. A gene triggering flower formation in Arabidopsis. Nature. 377:522-524. Marianayagam, N.J., M. Sunde, and J.M. Matthews. 2004. The power of two: protein dimerization in biology. Trends in biochemical sciences. 29:618-625. Martinez-Zapater, J.M., Coupland, G., Dean, C., and Kooenneef, M. F. . 1994. The Transition to flowering in Arabidopsis. . New-York: Cold Spring Harbor Laboratory Press. 404-434 pp. Mathieu, J., N. Warthmann, F. Kuttner, and M. Schmid. 2007. Export of FT protein from phloem companion cells is sufficient for floral induction in Arabidopsis. Current biology : CB. 17:1055-1060. Mayer, K.F.X., H. Schoof, A. Haecker, M. Lenhard, G. Jurgens, and T. Laux. 1998. Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell. 95:805-815. Meijer, A.H., R.J. de Kam, I. d'Erfurth, W. Shen, and J.H. Hoge. 2000. HD-Zip proteins of families I and II from rice: interactions and functional properties. Molecular & general genetics : MGG. 263:12-21. Merika, M., and D. Thanos. 2001. Enhanceosomes. Current opinion in genetics & development. 11:205-208. Michaels, S.D., and R.M. Amasino. 1999. FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell. 11:949- 956. Miller, J., A.D. McLachlan, and A. Klug. 1985. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. The EMBO journal. 4:1609-1614. Molinero-Rosales, N., M. Jamilena, S. Zurita, P. Gomez, J. Capel, and R. Lozano. 1999. FALSIFLORA, the tomato orthologue of FLORICAULA and LEAFY, controls flowering time and floral meristem identity. Plant J. 20:685-693.

220

Moon, J., S.S. Suh, H. Lee, K.R. Choi, C.B. Hong, N.C. Paek, S.G. Kim, and I. Lee. 2003. The SOC1 MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis. Plant J. 35:613-623. Mouradov, A., F. Cremer, and G. Coupland. 2002. Control of flowering time: interacting pathways as a basis for diversity. The Plant cell. 14 Suppl:S111-130. Moyroud, E., E.G. Minguet, F. Ott, L. Yant, D. Pose, M. Monniaux, S. Blanchet, O. Bastien, E. Thevenon, D. Weigel, M. Schmid, and F. Parcy. 2011. Prediction of regulatory interactions from genome sequences using a biophysical model for the arabidopsis LEAFY transcription factor. The Plant cell. 23:1293-1306. Muratani, M., and W.P. Tansey. 2003. How the ubiquitin-proteasome system controls transcription. Nat Rev Mol Cell Biol. 4:192-201. Neff, M.M., J.D. Neff, J. Chory, and A.E. Pepper. 1998. dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J. 14:387-392. Ng, M., and M.F. Yanofsky. 2001. Activation of the Arabidopsis B class Homeotic Genes by APETALA1. Plant Cell. 13:739-753. Ni, W., D. Xie, L. Hobbie, B. Feng, D. Zhao, J. Akkara, and H. Ma. 2004. Regulation of flower development in Arabidopsis by SCF complexes. Plant Physiol. 134:1574- 1585. Nilsson, O., I. Lee, M.A. Blazquez, and D. Weigel. 1998a. Flowering time genes modulate the response to LEAFY activity. Genetics. 150:403-410. Nilsson, O., E. Wu, D.S. Wolfe, and D. Weigel. 1998b. Genetic ablation of flowers in transgenic Arabidopsis. Plant J. 15:799-804. Noh, B., S.H. Lee, H.J. Kim, G. Yi, E.A. Shin, M. Lee, K.J. Jung, M.R. Doyle, R.M. Amasino, and Y.S. Noh. 2004a. Divergent roles of a pair of homologous jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis flowering time. The Plant cell. 16:2601-2613. Noh, B., S.H. Lee, H.J. Kim, G. Yi, E.A. Shin, M. Lee, K.J. Jung, M.R. Doyle, R.M. Amasino, and Y.S. Noh. 2004b. Divergent roles of a pair of homologous jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis flowering time. Plant Cell. 16:2601-2613. Noh, Y.S., and R.M. Amasino. 2003. PIE1, an ISWI family gene, is required for FLC activation and floral repression in Arabidopsis. The Plant cell. 15:1671-1682. Ogas, J., S. Kaufmann, J. Henderson, and C. Somerville. 1999. PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc Natl Acad Sci U S A. 96:13839- 13844. Ohad, N., K. Shichrur, and S. Yalovsky. 2007. The analysis of protein-protein interactions in plants by bimolecular fluorescence complementation. Plant Physiol. 145:1090-1099. Ollo, R., and T. Maniatis. 1987. Drosophila Kruppel gene product produced in a baculovirus expression system is a nuclear phosphoprotein that binds to DNA. Proceedings of the National Academy of Sciences of the United States of America. 84:5700-5704.

221

Ossowski, S., R. Schwab, and D. Weigel. 2008. Gene silencing in plants using artificial microRNAs and other small RNAs. The Plant journal : for cell and molecular biology. 53:674-690. Pabo, C.O., E. Peisach, and R.A. Grant. 2001. Design and selection of novel Cys2His2 zinc finger proteins. Annual review of biochemistry. 70:313-340. Parcy, F. 2005. Flowering: a time for integration. The International journal of developmental biology. 49:585-593. Parcy, F., K. Bomblies, and D. Weigel. 2002. Interaction of LEAFY, AGAMOUS and TERMINAL FLOWER1 in maintaining floral meristem identity in Arabidopsis. Development. 129:2519-2527. Parcy, F., O. Nilsson, M.A. Busch, I. Lee, and D. Weigel. 1998. A genetic framework for floral patterning. Nature. 395:561-566. Pavletich, N.P., and C.O. Pabo. 1991. Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science. 252:809-817. Pelaz, S., G.S. Ditta, E. Baumann, E. Wisman, and M.F. Yanofsky. 2000. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature. 405:200-203. Putterill, J., F. Robson, K. Lee, R. Simon, and G. Coupland. 1995. The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell. 80:847-857. Ratcliffe, O.J., I. Amaya, C.A. Vincent, S. Rothstein, R. Carpenter, E.S. Coen, and D.J. Bradley. 1998. A common mechanism controls the life cycle and architecture of plants. Development. 125:1609-1615. Ratcliffe, O.J., D.J. Bradley, and E.S. Coen. 1999. Separation of shoot and floral identity in Arabidopsis. Development. 126:1109-1120. Riechmann, J.L., and E.M. Meyerowitz. 1998. The AP2/EREBP family of plant transcription factors. Biol. Chem. 379:633-646. Riechmann, J.L., and O.J. Ratcliffe. 2000. A genomic perspective on plant transcription factors. Curr Opin Plant Biol. 3:423-434. Riechmann, J.L., M. Wang, and E.M. Meyerowitz. 1996. DNA-binding properties of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS. Nucl. Acids Res. 24:3134-3141. Rigaut, G., A. Shevchenko, B. Rutz, M. Wilm, M. Mann, and B. Seraphin. 1999. A generic protein purification method for protein complex characterization and proteome exploration. Nature biotechnology. 17:1030-1032. Risseeuw, E.P., T.E. Daskalchuk, T.W. Banks, E. Liu, J. Cotelesage, H. Hellmann, M. Estelle, D.E. Somers, and W.L. Crosby. 2003. Protein interaction analysis of SCF ubiquitin E3 ligase subunits from Arabidopsis. Plant J. 34:753-767. Rohila, J.S., M. Chen, R. Cerny, and M.E. Fromm. 2004. Improved tandem affinity purification tag and methods for isolation of protein heterocomplexes from plants. The Plant journal : for cell and molecular biology. 38:172-181. Rohila, J.S., M. Chen, S. Chen, J. Chen, R. Cerny, C. Dardick, P. Canlas, X. Xu, M. Gribskov, S. Kanrar, J.K. Zhu, P. Ronald, and M.E. Fromm. 2006. Protein-protein

222

interactions of tandem affinity purification-tagged protein kinases in rice. The Plant journal : for cell and molecular biology. 46:1-13. Rohila, J.S., M. Chen, S. Chen, J. Chen, R.L. Cerny, C. Dardick, P. Canlas, H. Fujii, M. Gribskov, S. Kanrar, L. Knoflicek, B. Stevenson, M. Xie, X. Xu, X. Zheng, J.K. Zhu, P. Ronald, and M.E. Fromm. 2009. Protein-protein interactions of tandem affinity purified protein kinases from rice. PloS one. 4:e6685. Rottmann, W.H., R. Meilan, L.A. Sheppard, A.M. Brunner, J.S. Skinner, C. Ma, S. Cheng, L. Jouanin, G. Pilate, and S.H. Strauss. 2000. Diverse effects of overexpression of LEAFY and PTLF, a poplar (Populus) homolog of LEAFY/FLORICAULA, in transgenic poplar and Arabidopsis. Plant J. 22:235- 245. Roy, A., A. Kucukural, and Y. Zhang. 2010. I-TASSER: a unified platform for automated protein structure and function prediction. Nature protocols. 5:725-738. Rubio, V., Y. Shen, Y. Saijo, Y. Liu, G. Gusmaroli, S.P. Dinesh-Kumar, and X.W. Deng. 2005. An alternative tandem affinity purification strategy applied to Arabidopsis protein complex isolation. Plant J. 41:767-778. Sablowski, R. 2010. Genes and functions controlled by floral organ identity genes. Semin Cell Dev Biol. 21:94-99. Saddic, L.A., B. Huvermann, S. Bezhani, Y. Su, C.M. Winter, C.S. Kwon, R.P. Collum, and D. Wagner. 2006. The LEAFY target LMI1 is a meristem identity regulator and acts together with LEAFY to regulate expression of CAULIFLOWER. Development. 133:1673-1682. Sakai, H., L.J. Medrano, and E.M. Meyerowitz. 1995. Role of SUPERMAN in maintaining Arabidopsis floral whorl boundaries. Nature. 378:199-203. Sakamoto, H., K. Maruyama, Y. Sakuma, T. Meshi, M. Iwabuchi, K. Shinozaki, and K. Yamaguchi-Shinozaki. 2004. Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant physiology. 136:2734-2746. Samach, A., J.E. Klenz, S.E. Kohalmi, E. Risseeuw, G.W. Haughn, and W.L. Crosby. 1999. The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F- box protein required for normal patterning and growth in the floral meristem. Plant J. 20:433-445. Samach, A., H. Onouchi, S.E. Gold, G.S. Ditta, Z. Schwarz-Sommer, M.F. Yanofsky, and G. Coupland. 2000. Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science. 288:1613-1616. Sambrook, J., E.F. Fritch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press., Cold Spring Harbor, NY. Sanchez-Garcia, I., and T.H. Rabbitts. 1994. The LIM domain: a new structural motif found in zinc-finger-like proteins. Trends Genet. 10:315-320. Sarnowski, T.J., G. Rios, J. Jasik, S. Swiezewski, S. Kaczanowski, Y. Li, A. Kwiatkowska, K. Pawlikowska, M. Kozbial, P. Kozbial, C. Koncz, and A. Jerzmanowski. 2005. SWI3 subunits of putative SWI/SNF chromatin-remodeling complexes play distinct roles during Arabidopsis development. The Plant cell. 17:2454-2472.

223

Sawa, M., D.A. Nusinow, S.A. Kay, and T. Imaizumi. 2007. FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis. Science. 318:261-265. Schmid, M., T.S. Davison, S.R. Henz, U.J. Pape, M. Demar, M. Vingron, B. Scholkopf, D. Weigel, and J.U. Lohmann. 2005. A gene expression map of Arabidopsis thaliana development. Nat Genet. 37:501-506. Schmid, M., N.H. Uhlenhaut, F. Godard, M. Demar, R. Bressan, D. Weigel, and J.U. Lohmann. 2003. Dissection of floral induction pathways using global expression analysis. Development. 130:6001-6012. Schoof, H., M. Lenhard, A. Haecker, K.F.X. Mayer, G. Jurgens, and T. Laux. 2000. The stem cell population of Arabidopsis shoot meristems is maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell. 100:635-644. Schubert, D., L. Primavesi, A. Bishopp, G. Roberts, J. Doonan, T. Jenuwein, and J. Goodrich. 2006. Silencing by plant Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine 27. Embo J. 25:4638-4649. Schultz, E.A., and G.W. Haughn. 1991. LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. Plant Cell. 3:771-781. Schwab, R., S. Ossowski, M. Riester, N. Warthmann, and D. Weigel. 2006. Highly specific gene silencing by artificial microRNAs in Arabidopsis. The Plant cell. 18:1121-1133. Searle, I., Y. He, F. Turck, C. Vincent, F. Fornara, S. Krober, R.A. Amasino, and G. Coupland. 2006. The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis. Genes Dev. 20:898-912. Sessa, G., G. Morelli, and I. Ruberti. 1993. The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities. The EMBO journal. 12:3507-3517. Shaked, H., N. Avivi-Ragolsky, and A.A. Levy. 2006. Involvement of the Arabidopsis SWI2/SNF2 chromatin remodeling gene family in DNA damage response and recombination. Genetics. 173:985-994. Shannon, S., and D.R. Meekswagner. 1993. Genetic interactions that regulate inflorescence development in arabidopsis. Plant Cell. 5:639-655. Sheldon, C.C., J.E. Burn, P.P. Perez, J. Metzger, J.A. Edwards, W.J. Peacock, and E.S. Dennis. 1999. The FLF MADS box gene: a repressor of flowering in Arabidopsis regulated by vernalization and methylation. The Plant cell. 11:445-458. Shi, Y., E. Seto, L.S. Chang, and T. Shenk. 1991. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell. 67:377-388. Simionato, E., V. Ledent, G. Richards, M. Thomas-Chollier, P. Kerner, D. Coornaert, B.M. Degnan, and M. Vervoort. 2007. Origin and diversification of the basic helix-loop-helix gene family in metazoans: insights from comparative genomics. BMC evolutionary biology. 7:33. Simon, R., I.M. Igeno, and G. Coupland. 1996. Activation of floral meristem identity genes in Arabidopsis. Nature. 384:59-62.

224

Simpson, G.G., and C. Dean. 2002. Arabidopsis, the Rosetta stone of flowering time? Science. 296:285-289. Smyth, D.R., J.L. Bowman, and E.M. Meyerowitz. 1990. Early flower development in Arabidopsis. Plant Cell. 2:755-767. Sridhar, V.V., A. Surendrarao, D. Gonzalez, R.S. Conlan, and Z. Liu. 2004. Transcriptional repression of target genes by LEUNIG and SEUSS, two interacting regulatory proteins for Arabidopsis flower development. Proc Natl Acad Sci U S A. 101:11494-11499. Sridhar, V.V., A. Surendrarao, and Z. Liu. 2006. APETALA1 and SEPALLATA3 interact with SEUSS to mediate transcription repression during flower development. Development. 133:3159-3166. Srikanth, A., and M. Schmid. 2011. Regulation of flowering time: all roads lead to Rome. Cell Mol Life Sci. 68:2013-2037. Su, Y., C.S. Kwon, S. Bezhani, B. Huvermann, C. Chen, A. Peragine, J.F. Kennedy, and D. Wagner. 2006. The N-terminal ATPase AT-hook-containing region of the Arabidopsis chromatin-remodeling protein SPLAYED is sufficient for biological activity. The Plant journal : for cell and molecular biology. 46:685-699. Suarez-Lopez, P., K. Wheatley, F. Robson, H. Onouchi, F. Valverde, and G. Coupland. 2001. CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature. 410:1116-1120. Sullivan, J.A., K. Shirasu, and X.W. Deng. 2003. The diverse roles of ubiquitin and the 26S proteasome in the life of plants. Nature reviews. Genetics. 4:948-958. Sung, S., and R.M. Amasino. 2004. Vernalization and epigenetics: how plants remember winter. Current opinion in plant biology. 7:4-10. Takada, S., and K. Goto. 2003. Terminal flower2, an Arabidopsis homolog of heterochromatin protein1, counteracts the activation of flowering locus T by constans in the vascular tissues of leaves to regulate flowering time. The Plant cell. 15:2856-2865. Takatsuji, H. 1999. Zinc-finger proteins: the classical zinc finger emerges in contemporary plant science. Plant molecular biology. 39:1073-1078. Tanahashi, T., N. Sumikawa, M. Kato, and M. Hasebe. 2005. Diversification of gene function: homologs of the floral regulator FLO/LFY control the first zygotic cell division in the moss Physcomitrella patens. Development. 132:1727-1736. Teotia, S., and R.S. Lamb. 2009. The paralogous genes RADICAL-INDUCED CELL DEATH1 and SIMILAR TO RCD ONE1 have partially redundant functions during Arabidopsis development. Plant Physiol. 151:180-198. Teotia, S., S. Muthuswamy, and R.S. Lamb. 2010. RADICAL-INDUCED CELL DEATH1 and SIMILAR TO RCD ONE1 and the Stress-Induced Morphogenetic Response. Plant Signal Behav. 5. Thomas, J.O., and R.D. Kornberg. 1975. An octamer of histones in chromatin and free in solution. Proceedings of the National Academy of Sciences of the United States of America. 72:2626-2630. Tian, Z., X. Wang, R. Lee, Y. Li, J.E. Specht, R.L. Nelson, P.E. McClean, L. Qiu, and J. Ma. 2010. Artificial selection for determinate growth habit in soybean.

225

Proceedings of the National Academy of Sciences of the United States of America. 107:8563-8568. Tilly, J., D.W. Allen, and T. Jack. 1998. The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development. 125:1647-1657. Toth, R., E. Kevei, A. Hall, A.J. Millar, F. Nagy, and L. Kozma-Bognar. 2001. Circadian clock-regulated expression of phytochrome and cryptochrome genes in Arabidopsis. Plant physiology. 127:1607-1616. Turck, F., F. Roudier, S. Farrona, M.L. Martin-Magniette, E. Guillaume, N. Buisine, S. Gagnot, R.A. Martienssen, G. Coupland, and V. Colot. 2007. Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27. PLoS Genet. 3:e86. Valverde, F., A. Mouradov, W. Soppe, D. Ravenscroft, A. Samach, and G. Coupland. 2004. Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science. 303:1003-1006. Van Leene, J., D. Eeckhout, G. Persiau, E. Van De Slijke, J. Geerinck, G. Van Isterdael, E. Witters, and G. De Jaeger. 2011. Isolation of transcription factor complexes from Arabidopsis cell suspension cultures by tandem affinity purification. Methods in molecular biology. 754:195-218. Van Leene, J., H. Stals, D. Eeckhout, G. Persiau, E. Van De Slijke, G. Van Isterdael, A. De Clercq, E. Bonnet, K. Laukens, N. Remmerie, K. Henderickx, T. De Vijlder, A. Abdelkrim, A. Pharazyn, H. Van Onckelen, D. Inze, E. Witters, and G. De Jaeger. 2007. A tandem affinity purification-based technology platform to study the cell cycle interactome in Arabidopsis thaliana. Molecular & cellular proteomics : MCP. 6:1226-1238. Van Leene, J., E. Witters, D. Inze, and G. De Jaeger. 2008. Boosting tandem affinity purification of plant protein complexes. Trends in plant science. 13:517-520. Vanden Berghe, W., M.N. Ndlovu, R. Hoya-Arias, N. Dijsselbloem, S. Gerlo, and G. Haegeman. 2006. Keeping up NF-kappaB appearances: epigenetic control of immunity or inflammation-triggered epigenetics. Biochem Pharmacol. 72:1114- 1131. Verbsky, M.L., and E.J. Richards. 2001. Chromatin remodeling in plants. Current opinion in plant biology. 4:494-500. Vinson, C., A. Acharya, and E.J. Taparowsky. 2006. Deciphering B-ZIP transcription factor interactions in vitro and in vivo. Biochimica et biophysica acta. 1759:4-12. Voinnet, O., S. Rivas, P. Mestre, and D. Baulcombe. 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33:949-956. Vrebalov, J., D. Ruezinsky, V. Padmanabhan, R. White, D. Medrano, R. Drake, W. Schuch, and J. Giovannoni. 2002. A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science. 296:343-346. Wagner, D., and E.M. Meyerowitz. 2002. SPLAYED, a novel SWI/SNF ATPase homolog, controls reproductive development in Arabidopsis. Curr Biol. 12:85-94.

226

Wagner, D., R.W.M. Sablowski, and E.M. Meyerowitz. 1999. Transcriptional activation of APETALA1 by LEAFY. Science. 285:582-584. Wagner, D., F. Wellmer, K. Dilks, D. William, M.R. Smith, P.P. Kumar, J.L. Riechmann, A.J. Greenland, and E.M. Meyerowitz. 2004. Floral induction in tissue culture: a system for the analysis of LEAFY-dependent gene regulation. Plant J. 39:273- 282. Wang, J.W., B. Czech, and D. Weigel. 2009. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell. 138:738- 749. Wang, X., S. Feng, N. Nakayama, W.L. Crosby, V. Irish, X.W. Deng, and N. Wei. 2003. The COP9 signalosome interacts with SCF UFO and participates in Arabidopsis flower development. The Plant cell. 15:1071-1082. Waterhouse, A.M., J.B. Procter, D.M. Martin, M. Clamp, and G.J. Barton. 2009. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics. 25:1189-1191. Weigel, D., J.H. Ahn, M.A. Blazquez, J.O. Borevitz, S.K. Christensen, C. Fankhauser, C. Ferrandiz, I. Kardailsky, E.J. Malancharuvil, M.M. Neff, J.T. Nguyen, S. Sato, Z.Y. Wang, Y. Xia, R.A. Dixon, M.J. Harrison, C.J. Lamb, M.F. Yanofsky, and J. Chory. 2000. Activation tagging in Arabidopsis. Plant Physiol. 122:1003-1013. Weigel, D., J. Alvarez, D.R. Smyth, M.F. Yanofsky, and E.M. Meyerowitz. 1992. LEAFY controls floral meristem identity in Arabidopsis. Cell. 69:843-859. Weigel, D., and E.M. Meyerowitz. 1993. Activation of floral homeotic genes in Arabidopsis. Science. 261:1723-1726. Weigel, D., and E.M. Meyerowitz. 1994. The ABCs of floral homeotic genes. Cell. 78:203-209. Weigel, D., and O. Nilsson. 1995. A developmental switch sufficient for flower initiation in diverse plants. Nature. 377:495-500. Wietek, C., and L.A. O'Neill. 2007. Diversity and regulation in the NF-kappaB system. Trends in biochemical sciences. 32:311-319. Wigge, P.A. 2011. FT, a mobile developmental signal in plants. Current biology : CB. 21:R374-378. Wigge, P.A., M.C. Kim, K.E. Jaeger, W. Busch, M. Schmid, J.U. Lohmann, and D. Weigel. 2005. Integration of spatial and temporal information during floral induction in Arabidopsis. Science. 309:1056-1059. Wilkinson, M.D., and G.W. Haughn. 1995. UNUSUAL FLORAL ORGANS controls meristem identity and organ primordia fate in Arabidopsis. Plant Cell. 7:1485- 1499. William, D.A., Y. Su, M.R. Smith, M. Lu, D.A. Baldwin, and D. Wagner. 2004. Genomic identification of direct target genes of LEAFY. Proc Natl Acad Sci U S A. 101:1775-1780. Wilson, R.N., J.W. Heckman, and C.R. Somerville. 1992. Gibberellin is required for flowering in arabidopsis-thaliana under short days. Plant Physiol. 100:403-408. Winter, C.M., R.S. Austin, S. Blanvillain-Baufume, M.A. Reback, M. Monniaux, M.F. Wu, Y. Sang, A. Yamaguchi, N. Yamaguchi, J.E. Parker, F. Parcy, S.T. Jensen,

227

H. Li, and D. Wagner. 2011. LEAFY Target Genes Reveal Floral Regulatory Logic, cis Motifs, and a Link to Biotic Stimulus Response. Dev Cell. 20:430-443. Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G.V., Provart, N.J. 2007. An "Electronic Fluorescent Pictograph" Browser for Exploring and Analyzing Large- Scale Biological Data Sets. PLoS One. 2. Wolf, E., P.S. Kim, and B. Berger. 1997. MultiCoil: a program for predicting two- and three-stranded coiled coils. Protein science : a publication of the Protein Society. 6:1179-1189. Wolfe, S.A., L. Nekludova, and C.O. Pabo. 2000. DNA recognition by Cys2His2 zinc finger proteins. Annu Rev Biophys Biomol Struct. 29:183-212. Wolffe, A.P., and H.R. Drew. 1989. Initiation of transcription on nucleosomal templates. Proceedings of the National Academy of Sciences of the United States of America. 86:9817-9821. Wu, G., M.Y. Park, S.R. Conway, J.W. Wang, D. Weigel, and R.S. Poethig. 2009. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell. 138:750-759. Wu, X., J.R. Dinneny, K.M. Crawford, Y. Rhee, V. Citovsky, P.C. Zambryski, and D. Weigel. 2003. Modes of intercellular transcription factor movement in the Arabidopsis apex. Development. 130:3735-3745. Xu, G., H. Ma, M. Nei, and H. Kong. 2009. Evolution of F-box genes in plants: different modes of sequence divergence and their relationships with functional diversification. Proc Natl Acad Sci U S A. 106:835-840. Xu, M., T. Hu, S.M. McKim, J. Murmu, G.W. Haughn, and S.R. Hepworth. 2010. Arabidopsis BLADE-ON-PETIOLE1 and 2 promote floral meristem fate and determinacy in a previously undefined pathway targeting APETALA1 and AGAMOUS-LIKE24. Plant J. 63:974-989. Xu, T., M. Purcell, P. Zucchi, T. Helentjaris, and L. Bogorad. 2001. TRM1, a YY1-like suppressor of rbcS-m3 expression in maize mesophyll cells. Proceedings of the National Academy of Sciences of the United States of America. 98:2295-2300. Yamaguchi, A., M.F. Wu, L. Yang, G. Wu, R.S. Poethig, and D. Wagner. 2009. The microRNA-regulated SBP-Box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1. Developmental cell. 17:268-278. Yanofsky, M.F., H. Ma, J.L. Bowman, G.N. Drews, K.A. Feldmann, and E.M. Meyerowitz. 1990. The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature. 346:35-39. Yoshida, N., Y. Yanai, L. Chen, Y. Kato, J. Hiratsuka, T. Miwa, Z.R. Sung, and S. Takahashi. 2001. EMBRYONIC FLOWER2, a novel polycomb group protein homolog, mediates shoot development and flowering in Arabidopsis. The Plant cell. 13:2471-2481. Yu, H., T. Ito, F. Wellmer, and E.M. Meyerowitz. 2004. Repression of AGAMOUS- LIKE 24 is a crucial step in promoting flower development. Nat Genet. 36:157- 161.

228

Yu, X., L. Li, M. Guo, J. Chory, and Y. Yin. 2008. Modulation of brassinosteroid- regulated gene expression by Jumonji domain-containing proteins ELF6 and REF6 in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 105:7618-7623. Zeevaart, J. 1976. Physiology of flower formation. . Annu. Rev. Plant Physiol. . 27:321- 348. Zhang, X., S. Germann, B.J. Blus, S. Khorasanizadeh, V. Gaudin, and S.E. Jacobsen. 2007. The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation. Nat Struct Mol Biol. 14:869-871. Zhang, Y. 2007. Template-based modeling and free modeling by I-TASSER in CASP7. Proteins. 69 Suppl 8:108-117. Zhao, Q., J. Brkljacic, and I. Meier. 2008. Two distinct interacting classes of nuclear envelope-associated coiled-coil proteins are required for the tissue-specific nuclear envelope targeting of Arabidopsis RanGAP. The Plant cell. 20:1639- 1651.

229

APPENDIX A: A complete list of proteins identified from TAP tag-purification

Table A.1. Proteins are listed based on the score; top most is the highest score. Highlighted in red are the proteins selected to investigate. Highlighted in greenare proteins likely to have bound to calmodulin binding peptide moiety of the TAP tag. Highlighted in yellow are some of the commonly found cellular proteins found in TAP- tagged preparations, which are taken as common contaminants, unless supported by independent data.

Band NCBI ID and protein description Abb. AGI ID Total Name score A, B, gi|20563223 leafy [Arabidopsis thaliana] 832 C, D, L A gi|397482 heat shock protein 70 cognate [Arabidopsis 559 thaliana] A gi|3962377 heat shock protein 70 [Arabidopsis thaliana] 345 B gi|15241847 ATP binding [Arabidopsis thaliana] HSC70-2 AT5G02490 337 D gi|1944432 ribulosebisphosphate carboxylase [Arabidopsis 205 C gi|18402186 ABF4 (ABRE BINDING FACTOR 4); DNA ABF2 AT3G19290 189 binding / transcription factor/ transcriptional activator [Arabid L gi|25365080 hypothetical protein At2g25180 - Arabidopsis ARR12 At2g25180 159 E gi|15229784 CAM7 (CALMODULIN 7); calcium ion binding 143 [Arabidopsis thaliana] L gi|6714410 unknown protein [Arabidopsis thaliana] DCL2 AT3G03300 138 L gi|4204312 Hypothetical protein [Arabidopsis thaliana] CHR9 AT1G03750 131 B gi|19759469 unnamed protein product [Arabidopsis thaliana] MDH9.2 At5g42330 125 L gi|9502367 T12C24.2 [Arabidopsis thaliana] F5O11.22 AT1G12470 108 B gi|18400540 unknown protein [Arabidopsis thaliana] At2g24420 105 C gi|15226197 ATP binding / kinase/ protein serine/threonine 104 kinase [Arabidopsis thaliana] L gi|15238990 XRN2 (EXORIBONUCLEASE 2); 5'-3' XRN2 AT5G42540 102 exonuclease/ exonuclease/ nucleic acid binding B gi|3297824 bZIP transcription factor-like protein [Arabidopsis ABF3 At4g3400 101 L gi|2577957 ABI3 protein [Arabidopsis thaliana] RAV1 AT1G13260 100 D gi|7525040 ATP synthase CF1 beta chain [Arabidopsis thaliana] F9K20.5 AT5G08690 99 L gi|15231799 transcription factor [Arabidopsis thaliana] MAG2.16 AT3G14180 99 H gi|30680251 nucleic acid binding / zinc ion binding [Arabidopsis At4g06634 99 A gi|79586698 REF6 (RELATIVE OF EARLY FLOWERING 6); REF6 At3g48430 98 nucleic acid binding / transcription factor/ zinc ion binding L gi|62320602 hypothetical protein [Arabidopsis thaliana] T1G16.80 AT5G27750 97 L gi|3036812 ATM-like protein [Arabidopsis thaliana] NA AT4G36080 96

Continued

230

Table A.1: continued

L gi|9759469 unnamed protein product [Arabidopsis thaliana] MDH9.2 AT5G42330 94 gi|15233850 ATP binding / nucleoside-triphosphatase/ nucleotide D binding [Arabidopsis thaliana] T15G18_1 AT4G09360 93 L gi|15239811 unknown protein [Arabidopsis thaliana] MNL12_5 AT5G43230 87 H gi|15239835 unknown protein [Arabidopsis thaliana] At5g12010 83 A gi|15230484 unknown protein [Arabidopsis thaliana] At3g44690 82 gi|18396508 hydrolase/ protein serine/threonine phosphatase E [Arabidopsis thaliana] 82 L gi|9989051 Similar to DNAJ proteins [Arabidopsis thaliana] F19K19.3 AT1G16680 80 L gi|4678213 hypothetical protein [Arabidopsis thaliana] At2g16180 78 D gi|15225467 unknown protein [Arabidopsis thaliana] F12L6.10 AT2G39440 77 H gi|2464858 putative protein [Arabidopsis thaliana] C7A10.120 AT4G37240 77 A gi|12322632 unknown protein, 5' partial [Arabidopsis thaliana] At1g42470 76 gi|25411423 probable retroelement pol polyprotein [imported] - L Arabidopsis thaliana F23M2_11 At2g11950 76 H gi|15219364 unknown protein [Arabidopsis thaliana] Atg16800 76 B gi|10178235 unnamed protein product [Arabidopsis thaliana] At5g22610 74 H gi|18394319 DNA binding / transcription factor [Arabidopsis At1g16060 74 D gi|2244755 hypothetical protein [Arabidopsis thaliana] DL3035W AT4G13990 73 H gi|15221662 unknown protein [Arabidopsis thaliana] At1g31290 73 C gi|15241656 unknown protein [Arabidopsis thaliana] T7H20.20 AT5G01970 72 E gi|15224645 unknown protein [Arabidopsis thaliana] F16D14.11 AT2G31270 72 gi|30680811 RNA binding / RNA methyltransferase L [Arabidopsis thaliana] F6F22.10 AT2G19870 71 L gi|9279636 unnamed protein product [Arabidopsis thaliana] MOJ10.20 AT3G27120 70 D gi|295789 elongation factor 1-alpha [Arabidopsis thaliana] MUF9.8 AT5G60390 70 L gi|12323390 hypothetical protein; 73483-63403 [Arabidopsis At1g77600 69 L gi|2660674 hypothetical protein [Arabidopsis thaliana] REV1 At5g44750 64 gi|15231105 DNA binding / transcription coactivator H [Arabidopsis thaliana] At3g58680 68 gi|12320751 calcium-transporting ATPase, putative [Arabidopsis C thaliana] F28B23.19 AT1G26130 67 B gi|30693433 unknown protein [Arabidopsis thaliana] At1g38065 67 H gi|4467359 Phosphatidylinositol 4-kinase [Arabidopsis thaliana] 67 B gi|15219109 HSP70B; ATP binding [Arabidopsis thaliana] HSP70 AT1G16030 66 gi|52354231 hypothetical protein AT1G75150 [Arabidopsis L thaliana] At1g52410 66 A gi|15237334 unknown protein [Arabidopsis thaliana] At5g53030 65 gi|3834306 EST gb|R65024 comes from this gene. [Arabidopsis L thaliana] 65 SNC1- L gi|40846341 SNC1-like protein [Arabidopsis thaliana] like,SNW AT1G77180 65 C gi|9294381 unnamed protein product [Arabidopsis thaliana] MIE1.9 AT3G14590 64 B gi|3763925 putative clathrin binding protein (epsin) [Arabido 64 gi|18406032 DNA binding / transcription coactivator H [Arabidopsis thaliana] MBF1A At2g42680 63 H gi|15227892 DNA binding [Arabidopsis thaliana] At2g42150 63 H gi|15233358 DNA binding [Arabidopsis thaliana] At4g11400 60 A gi|5042434 Hypothetical protein [Arabidopsis thaliana] At1g65010 57 D gi|15235468 unknown protein [Arabidopsis thaliana] 57 D gi|4803928 putative XAP-5 protein (Homo sapiens) [Arabidopsis 57 D gi|15240096 unknown protein [Arabidopsis thaliana] 57 L gi|20198135 putative chromosome associated protein 57 Continued 231

Table A.1: continued

L gi|17065024 Unknown protein [Arabidopsis thaliana] 55 L gi|15219789 lupeol synthase [Arabidopsis thaliana] 54 H gi|6630454 F23N19.18 [Arabidopsis thaliana] F23N19.18 AT1G62810 53 gi|18409633 ubiquitin conjugating enzyme/ ubiquitin-like H activating enzyme [Arabidopsis thaliana] 53 L gi|14916970 ATP synthase subunit alpha, mitochondrial 53 C gi|15225561 unknown protein [Arabidopsis thaliana] 52 L gi|5541663 putative helicase, fragment [Arabidopsis thaliana] 52 C gi|9280321 unnamed protein product [Arabidopsis thaliana] 51 gi|12325155 unknown protein; 58745-68005 [Arabidopsis H thaliana] 50 D gi|15236573 transporter [Arabidopsis thaliana] 50 L gi|4056495 putative kinesin heavy chain [Arabidopsis thaliana] 50 gi|4432796 putative VSF-1-like b-ZIP transcription factor A [Arabidopsis thaliana] 50 C gi|15219625 unknown protein [Arabidopsis thaliana] 49 D gi|7288013 putative protein [Arabidopsis thaliana] 49 gi|8569097 Contains strong similarity to rapamycin associated E protein FRAP2 from Homo sapiens gb|U88966 and co 48 L gi|4415919 hypothetical protein [Arabidopsis thaliana] 47 L gi|15218016 unknown protein [Arabidopsis thaliana] 47 L gi|8843818 unnamed protein product [Arabidopsis thaliana] 47 gi|15241928 AtSerat1;1 (SERINE ACETYLTRANSFERASE H 52); serine O-acetyltransferase [Arabidopsis thaliana] 46 C gi|4704662 uracil phosphoribosyltransferase 1 [Arabidop 46 gi|30690461 ATP binding / ATP-dependent helicase/ helicase/ L nucleic acid binding [Arabidopsis thaliana] 46 B gi|9759303 protein phosphatase 2C-like [Arabidopsis thaliana] 45 gi|3335344 Similar to serpin gene homolog gb|Z49890 from A. D thaliana. [Arabidopsis thaliana] 45 E gi|2245104 retrotransposon like protein [Arabidopsis thaliana] 45 E gi|15219846 unknown protein [Arabidopsis thaliana] 45 L gi|4204276 Hypothetical protein [Arabidopsis thaliana] 44 D gi|8885606 retroelement pol polyprotein-like [Arabidopsi F16F17.4 AT5G38040 43 B gi|12321345 jasmonate inducible protein, putative [Arabidopsis 42 gi|5733879 ESTs gb|N97074, gb|T13943 and gb|R89965 come D from this gene. [Arabidopsis thaliana] 42 gi|8920636 Strong similarity to wall-associated kinase 1 from C Arabidopsis thaliana gb|AJ009696 and contains Eu F16F4.8 AT1G21240 41 D gi|5091557 T10O24.26 [Arabidopsis thaliana] 41 gi|22327062 ATP binding / kinase/ protein kinase/ protein L serine/threonine kinase/ protein-tyrosine kinase [Ara 41 H gi|10121909 T7N9.24 [Arabidopsis thaliana] 41 H gi|15231810 PIP2A; water channel [Arabidopsis thaliana] 40 H gi|4309763 putative retroelement pol polyprotein [Arabidopsis 40 gi|8570446 Contains similarity to a kinesin homolog from A Arabidopsis thaliana gb|T06733 and contains a Kinesin 40 L gi|9294330 unnamed protein product [Arabidopsis thaliana] 40 gi|3047096 similar to eukaryotic protein kinase domains (Pfam: L pkinase.hmm, score: 189.74) [Arabidopsis thalia 40 L gi|15912233 At2g41680/T32G6.20 [Arabidopsis thaliana] 40 L gi|15227902 ARAC1; GTP binding [Arabidopsis thaliana] 40 D gi|15238905 protein binding / zinc ion binding [Arabidopsis 39 Continued 232

Table A.1: continued

E gi|8778301 F14J16.5 [Arabidopsis thaliana] 39 L gi|2827718 retrotransposon - like protein [Arabidopsis thaliana] 39 B gi|42564994 unknown protein [Arabidopsis thaliana] 38 gi|30678047 aspartic-type endopeptidase/ pepsin A [Arabidopsis L thaliana] 38 L gi|7576220 putative protein [Arabidopsis thaliana] 38 L gi|9294677 unnamed protein product [Arabidopsis thaliana] 38 D gi|6562000 hypothetical protein [Arabidopsis thaliana] 37 L gi|42569280 unknown protein [Arabidopsis thaliana] 37 L gi|18402131 unknown protein [Arabidopsis thaliana] 37 L gi|15236141 unknown protein [Arabidopsis thaliana] 36 L gi|15224349 unknown protein [Arabidopsis thaliana] 36 L gi|4185129 At14a, putative [Arabidopsis thaliana] 35 L gi|15233088 unknown protein [Arabidopsis thaliana] 35 D gi|42569161 unknown protein [Arabidopsis thaliana] 34 D gi|18414574 unknown protein [Arabidopsis thaliana] 34 L gi|15081709 At1g52410/F19K6_14 [Arabidopsis thaliana] 34 L gi|15225116 unknown protein [Arabidopsis thaliana] 32 L gi|4678944 putative protein [Arabidopsis thaliana] 32 gi|22329713 ATP binding / kinase/ protein kinase/ protein L serine/threonine kinase/ protein-tyrosine kinase [Ara 31 gi|9758971 ABC transporter, ATP-binding protein-like A [Arabidopsis thaliana] 30 L gi|8778646 F5O11.15 [Arabidopsis thaliana] 30 L gi|12230770 Probable N(2),N(2)-dimethylguanosine 30 L gi|15220095 DNA binding [Arabidopsis thaliana] 27 gi|4587572 Similar to gb|U70015 lysosomal trafficking regulator H from Mus musculus and contains 2 PF|00400 WD40 27 gi|9187883 mitochondrial half-ABC transporter [Arabidopsis L thaliana] 25 B gi|9759216 subtilisin-like serine protease [Arabidopsis thaliana] 23

233