DOCSLIB.ORG

Genetic Analysis of Novel Models of Thrombocytopenia and Leucopenia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Analysis of Novel Models of Thrombocytopenia and Leucopenia GENETIC ANALYSIS OF NOVEL MODELS OF THROMBOCYTOPENIA AND LEUCOPENIA by ERNEST RICKY CHAN Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Thesis Adviser: Mark D. Adams, Ph.D. Department of Genetics CASE WESTERN RESERVE UNIVERSITY August 2009 Case Western Reserve University School of Graduate Studies We hereby approve the thesis/dissertation of Ernest Ricky Chan candidate for the Doctor of Philosophy degree.* Ron Conlon (Chair of the Committee) Mark Adams (Mentor) Brian Bai Kevin Bunting Keith McCrae Joseph Nadeau June 23, 2009 *We also certify that written approval has been obtained for any proprietary material contained therein. Contents LIST OF TABLES ........................................................................................................................................ III LIST OF FIGURES ...................................................................................................................................... IV ACKNOWLEDGEMENTS AND DEDICATION ................................................................................................ V THESIS ABSTRACT .................................................................................................................................... VI CHAPTER 1: INTRODUCTION..................................................................................................................... 1 HEMATOPOIESIS ....................................................................................................................................... 2 THROMBOPOIESIS ..................................................................................................................................... 3 Platelets ........................................................................................................................................... 3 TPO, MPL, and major pathways of platelet development- ................................................................. 6 Thrombocytopenia and Platelet Disorders ....................................................................................... 11 Models of thrombocytopenia .......................................................................................................... 21 ENU MUTAGENESIS AND THE HLBS STRAINS .................................................................................................. 22 CHAPTER 2: THROMBOCYTOPENIC STRAIN HLB219 ............................................................................... 25 ABSTRACT ............................................................................................................................................. 26 INTRODUCTION ....................................................................................................................................... 27 MATERIALS AND METHODS ....................................................................................................................... 30 Mapping ........................................................................................................................................ 30 Platelet lifespan assay .................................................................................................................... 30 Sequencing ..................................................................................................................................... 31 Circulating TPO concentration ........................................................................................................ 31 Assay for colony forming units of hematopoietic progenitors .......................................................... 32 Competitive repopulation assay ...................................................................................................... 32 hlb219 Construction of Mpl or Mpl vectors .......................................................................................... 33 Stable transformation of Ba/F3 cells with Mpl, Mplhlb219, or MGIN ............................................... 33 Proliferation assay .......................................................................................................................... 34 Downstream signaling pathways .................................................................................................... 35 RESULTS ............................................................................................................................................... 36 Phenotypic Characterization of the HLB219 Strain ........................................................................... 36 Identifying the mutation ................................................................................................................. 38 Supporting evidence for a mutation in Mpl ..................................................................................... 40 hlb219 Mpl supports TPO-independent proliferation in Ba/F3 cells ...................................................... 43 hlb219 Mpl downstream signaling ...................................................................................................... 45 DISCUSSION ........................................................................................................................................... 48 ACKNOWLEDGEMENTS.............................................................................................................................. 52 CHAPTER 3: THROMBOCYTOPENIC STRAIN HLB381 ............................................................................... 53 ABSTRACT ............................................................................................................................................. 54 INTRODUCTION ....................................................................................................................................... 55 MATERIALS AND METHODS ....................................................................................................................... 58 Intercross, whole genome scan, and interval mapping .................................................................... 58 Candidate-gene and interval sequencing ........................................................................................ 59 Blood phenotype and general characterization ............................................................................... 61 Circulating TPO concentration ........................................................................................................ 61 Bleeding time ................................................................................................................................. 62 CFU assays ..................................................................................................................................... 62 Competitive repopulation and bone marrow transplant .................................................................. 63 i Platelet lifespan assay .................................................................................................................... 64 Splenectomy ................................................................................................................................... 64 Serum Injection .............................................................................................................................. 65 IVIg Treatment ............................................................................................................................... 65 Western blot of platelet proteins .................................................................................................... 66 Rasa3 mutation confirmation and expression ................................................................................. 66 RESULTS ............................................................................................................................................... 68 General characterization ................................................................................................................ 68 Genetic mapping and sequencing ................................................................................................... 70 Examining hematopoiesis ............................................................................................................... 79 Examining platelet turnover ........................................................................................................... 82 DISCUSSION ........................................................................................................................................... 87 HLB381 hematopoietic development .............................................................................................. 87 HLB381 platelet survival ................................................................................................................. 88 Searching for the mutation ............................................................................................................. 91 Compare and contrast HLB381 and scat.......................................................................................... 94 CHAPTER 4: LEUCOPENIC STRAIN HLB156 .............................................................................................. 99 ABSTRACT ........................................................................................................................................... 100 INTRODUCTION ....................................................................................................................................
Load more

Recommended publications
  • Broad Poster Vivek
    A novel computational method for finding regions with copy number abnormalities in cancer cells Vivek, Manuel Garber, and Mike Zody Broad Institute of MIT and Harvard, Cambridge, MA, USA Introduction Results Cancer can result from the over expression of oncogenes, genes which control and regulate cell growth. Sometimes oncogenes increase in 1 2 3 activity due to a specific genetic mutation called a translocation (Fig 1). SMAD4 – a gene known to be deleted in pancreatic COX10 – a gene deleted in cytochrome c oxidase AK001392 – a hereditary prostate cancer protein This translocation allows the oncogene to remain as active as its paired carcinoma deficiency, known to be related to cell proliferation gene. Amplification of this mutation can occur, thereby creating the proper conditions for uncontrolled cell growth; consequently, each Results from Analysis Program Results from Analysis Program Results from Analysis Program component of the translocation will amplify in similar quantities. In this mutation, the chromosomal region containing the oncogene displaces to Region 1 Region 2 R2 Region 1 Region 2 R2 Region 1 Region 2 R2 a region on another chromosome containing a gene that is expressed Chr18:47044749-47311978 Chr17:13930739-14654741 0.499070821478475 Chr17:13930739-14654741 Chr18:26861790-27072166 0.47355172850856 Chr17:12542326-13930738 Chr8:1789292-1801984 0.406208680312004 frequently. Actual region containing gene Actual region containing gene Actual region containing gene chr18: 45,842,214 - 48,514,513 chr17: 13,966,862 - 14,068,461 chr17: 12,542,326 - 13,930,738 Fig 1. Two chromosomal regions (abcdef and ghijk) are translocating to create two new regions (abckl and ghijedf).
    [Show full text]
  • Methylation Patterns of RASA3 Associated with Clinicopathological
    Journal of Cancer 2018, Vol. 9 2116 Ivyspring International Publisher Journal of Cancer 2018; 9(12): 2116-2122. doi: 10.7150/jca.24567 Research Paper Methylation patterns of RASA3 associated with clinicopathological factors in hepatocellular carcinoma Hui Lin*1,2, Xiaoxiao Fan*1,2, LiFeng He1,2, Daizhan Zhou1,2,3,4 1. Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China 2. Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China. 3. Bio-X Center, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Disorders (Ministry of Education), Shanghai Jiao Tong University, Shanghai, China. 4. Present address: Key Laboratory of Arrhythmias of the Ministry of Education of China, East Hospital, Tongji University School of Medicine; Institute of Medical Genetics, Tongji University, Shanghai, China. * Hui Lin and Xiaoxiao Fan contributed equally for this work. Corresponding author: Daizhan Zhou, Phd, Biomedical Research Center, Sir Run Run Shaw Hospital, Zhejiang University School of Medicine. 3 East Qingchun Rd, Hangzhou 310016, China. Tel: 86-13738055489; Fax: 86-571-86044817; Email: [email protected]/[email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2017.12.26; Accepted: 2018.03.31; Published: 2018.05.25 Abstract Hepatocellular carcinoma (HCC) is the sixth most common tumor worldwide. The relationship between the gene methylation accumulation and HCC has been widely studied.
    [Show full text]
  • Impairment of Social Behaviors in Arhgef10 Knockout Mice
    Lu et al. Molecular Autism (2018) 9:11 https://doi.org/10.1186/s13229-018-0197-5 RESEARCH Open Access Impairment of social behaviors in Arhgef10 knockout mice Dai-Hua Lu1, Hsiao-Mei Liao2, Chia-Hsiang Chen3,4, Huang-Ju Tu1, Houng-Chi Liou1, Susan Shur-Fen Gau2* and Wen-Mei Fu1* Abstract Background: Impaired social interaction is one of the essential features of autism spectrum disorder (ASD). Our previous copy number variation (CNV) study discovered a novel deleted region associated with ASD. One of the genes included in the deleted region is ARHGEF10. A missense mutation of ARHGEF10 has been reported to be one of the contributing factors in several diseases of the central nervous system. However, the relationship between the loss of ARHGEF10 and the clinical symptoms of ASD is unclear. Methods: We generated Arhgef10 knockout mice as a model of ASD and characterized the social behavior and the biochemical changes in the brains of the knockout mice. Results: Compared with their wild-type littermates, the Arhgef10-depleted mice showed social interaction impairment, hyperactivity, and decreased depression-like and anxiety-like behavior. Behavioral measures of learning in the Morris water maze were not affected by Arhgef10 deficiency. Moreover, neurotransmitters including serotonin, norepinephrine, and dopamine were significantly increased in different brain regions of the Arhgef10 knockout mice. In addition, monoamine oxidase A (MAO-A) decreased in several brain regions. Conclusions: These results suggest that ARHGEF10 is a candidate risk gene for ASD and that the Arhgef10 knockout model could be a tool for studying the mechanisms of neurotransmission in ASD.
    [Show full text]
  • A Upf3b-Mutant Mouse Model with Behavioral and Neurogenesis Defects
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Mol Psychiatry Manuscript Author . Author Manuscript Author manuscript; available in PMC 2018 September 27. Published in final edited form as: Mol Psychiatry. 2018 August ; 23(8): 1773–1786. doi:10.1038/mp.2017.173. A Upf3b-mutant mouse model with behavioral and neurogenesis defects L Huang1, EY Shum1, SH Jones1, C-H Lou1, J Dumdie1, H Kim1, AJ Roberts2, LA Jolly3,4, J Espinoza1, DM Skarbrevik1, MH Phan1, H Cook-Andersen1, NR Swerdlow5, J Gecz3,4, and MF Wilkinson1,6 1Department of Reproductive Medicine, School of Medicine, University of California, San Diego, La Jolla, California, USA 2Department of Molecular and Cellular Neuroscience, The Scripps Research Institute, 10550 North Torrey Pines Road, MB6, La Jolla, CA 92037, USA 3School Adelaide Medical School and Robison Research Institute, University of Adelaide, Adelaide, SA 5005, Australia 4South Australian Health and Medical Research Institute, Adelaide, SA, 5005, Australia 5Department of Psychiatry, School of Medicine, University of California, San Diego, La Jolla, California, USA 6Institute of Genomic Medicine, University of California, San Diego, La Jolla, CA Abstract Nonsense-mediated RNA decay (NMD) is a highly conserved and selective RNA degradation pathway that acts on RNAs terminating their reading frames in specific contexts. NMD is regulated in a tissue-specific and developmentally controlled manner, raising the possibility that it influences developmental events. Indeed, loss or depletion of NMD factors have been shown to disrupt developmental events in organisms spanning the phylogenetic scale. In humans, mutations in the NMD factor gene, UPF3B, cause intellectual disability (ID) and are strongly associated with autism spectrum (ASD), attention deficit hyperactivity disorder (ADHD), and schizophrenia (SCZ).
    [Show full text]
  • Gene Ontology Functional Annotations and Pleiotropy
    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
    [Show full text]
  • An ARHGEF10 Deletion Is Highly Associated with a Juvenile-Onset Inherited Polyneuropathy in Leonberger and Saint Bernard Dogs
    An ARHGEF10 Deletion Is Highly Associated with a Juvenile-Onset Inherited Polyneuropathy in Leonberger and Saint Bernard Dogs Kari J. Ekenstedt1.*, Doreen Becker2., Katie M. Minor1, G. Diane Shelton3, Edward E. Patterson4, Tim Bley5, Anna Oevermann6, Thomas Bilzer7, Tosso Leeb2, Cord Dro¨ gemu¨ ller2", James R. Mickelson1" 1 Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, Minnesota, United States of America, 2 Institute of Genetics, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 3 Comparative Neuromuscular Laboratory, Department of Pathology, University of California San Diego, La Jolla, California, United States of America, 4 Department of Veterinary Clinical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, Minnesota, United States of America, 5 Small Animal Clinic, Neruology, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 6 Neurocenter, Department of Clinical Research and Veterinary Public Health, Vetsuisse Faculty, University of Bern, Bern, Switzerland, 7 Institute of Neuropathology, Heinrich-Heine-University Du¨sseldorf, Du¨sseldorf, Germany Abstract An inherited polyneuropathy (PN) observed in Leonberger dogs has clinical similarities to a genetically heterogeneous group of peripheral neuropathies termed Charcot-Marie-Tooth (CMT) disease in humans. The Leonberger disorder is a severe, juvenile- onset, chronic, progressive, and mixed PN, characterized by exercise intolerance, gait abnormalities and muscle atrophy of the pelvic limbs, as well as inspiratory stridor and dyspnea. We mapped a PN locus in Leonbergers to a 250 kb region on canine 210 chromosome 16 (Praw =1.16610 ,Pgenome, corrected = 0.006) utilizing a high-density SNP array. Within this interval is the ARHGEF10 gene, a member of the rho family of GTPases known to be involved in neuronal growth and axonal migration, and implicated in human hypomyelination.
    [Show full text]
  • HHS Public Access Author Manuscript
    HHS Public Access Author manuscript Author Manuscript Author ManuscriptGenet Epidemiol Author Manuscript. Author Author Manuscript manuscript; available in PMC 2016 June 01. Published in final edited form as: Genet Epidemiol. 2015 December ; 39(8): 664–677. doi:10.1002/gepi.21932. Multiple SNP-sets Analysis for Genome-wide Association Studies through Bayesian Latent Variable Selection Zhaohua Lu, Hongtu Zhu, Rebecca C Knickmeyer, Patrick F. Sullivan, Williams N. Stephanie, and Fei Zou for the Alzheimer’s Disease Neuroimaging Initiative* Departments of Biostatistics, Psychiatry, and Genetics and Biomedical Research Imaging Center, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA Abstract The power of genome-wide association studies (GWAS) for mapping complex traits with single SNP analysis may be undermined by modest SNP effect sizes, unobserved causal SNPs, correlation among adjacent SNPs, and SNP-SNP interactions. Alternative approaches for testing the association between a single SNP-set and individual phenotypes have been shown to be promising for improving the power of GWAS. We propose a Bayesian latent variable selection (BLVS) method to simultaneously model the joint association mapping between a large number of SNP-sets and complex traits. Compared to single SNP-set analysis, such joint association mapping not only accounts for the correlation among SNP-sets, but also is capable of detecting causal SNP- sets that are marginally uncorrelated with traits. The spike-slab prior assigned to the effects of SNP-sets can greatly reduce the dimension of effective SNP-sets, while speeding up computation. An efficient MCMC algorithm is developed. Simulations demonstrate that BLVS outperforms several competing variable selection methods in some important scenarios.
    [Show full text]
  • UPF3A Rabbit Pab
    Leader in Biomolecular Solutions for Life Science UPF3A Rabbit pAb Catalog No.: A15893 Basic Information Background Catalog No. This gene encodes a protein that is part of a post-splicing multiprotein complex involved A15893 in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with Observed MW truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). 55kDa When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and Calculated MW remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It 17kDa/51kDa/54kDa forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding Category different isoforms have been found for this gene. Primary antibody Applications WB,IF Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 65110 Q9H1J1 IF 1:50 - 1:200 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 327-476 of human UPF3A (NP_075387.1). Synonyms UPF3A;HUPF3A;RENT3A;UPF3 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of mouse testis, using UPF3A antibody (A15893) at 1:1000 dilution.
    [Show full text]
  • 8P23.2-Pter Microdeletions: Seven New Cases Narrowing the Candidate Region and Review of the Literature
    G C A T T A C G G C A T genes Article 8p23.2-pter Microdeletions: Seven New Cases Narrowing the Candidate Region and Review of the Literature Ilaria Catusi 1,* , Maria Garzo 1 , Anna Paola Capra 2 , Silvana Briuglia 2 , Chiara Baldo 3 , Maria Paola Canevini 4 , Rachele Cantone 5, Flaviana Elia 6, Francesca Forzano 7, Ornella Galesi 8, Enrico Grosso 5, Michela Malacarne 3, Angela Peron 4,9,10 , Corrado Romano 11 , Monica Saccani 4 , Lidia Larizza 1 and Maria Paola Recalcati 1 1 Istituto Auxologico Italiano, IRCCS, Laboratory of Medical Cytogenetics and Molecular Genetics, 20145 Milan, Italy; [email protected] (M.G.); [email protected] (L.L.); [email protected] (M.P.R.) 2 Department of Biomedical, Dental, Morphological and Functional Imaging Sciences, University of Messina, 98100 Messina, Italy; [email protected] (A.P.C.); [email protected] (S.B.) 3 UOC Laboratorio di Genetica Umana, IRCCS Istituto Giannina Gaslini, 16147 Genova, Italy; [email protected] (C.B.); [email protected] (M.M.) 4 Child Neuropsychiatry Unit—Epilepsy Center, Department of Health Sciences, ASST Santi Paolo e Carlo, San Paolo Hospital, Università Degli Studi di Milano, 20142 Milan, Italy; [email protected] (M.P.C.); [email protected] (A.P.); [email protected] (M.S.) 5 Medical Genetics Unit, Città della Salute e della Scienza University Hospital, 10126 Turin, Italy; [email protected] (R.C.); [email protected] (E.G.) 6 Unit of Psychology, Oasi Research Institute-IRCCS,
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • UC Berkeley UC Berkeley Electronic Theses and Dissertations
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Networks of Splice Factor Regulation by Unproductive Splicing Coupled With NMD Permalink https://escholarship.org/uc/item/4md923q7 Author Desai, Anna Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Networks of Splice Factor Regulation by Unproductive Splicing Coupled With NMD by Anna Maria Desai A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Comparative Biochemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Steven E. Brenner, Chair Professor Donald Rio Professor Lin He Fall 2017 Abstract Networks of Splice Factor Regulation by Unproductive Splicing Coupled With NMD by Anna Maria Desai Doctor of Philosophy in Comparative Biochemistry University of California, Berkeley Professor Steven E. Brenner, Chair Virtually all multi-exon genes undergo alternative splicing (AS) to generate multiple protein isoforms. Alternative splicing is regulated by splicing factors, such as the serine/arginine rich (SR) protein family and the heterogeneous nuclear ribonucleoproteins (hnRNPs). Splicing factors are essential and highly conserved. It has been shown that splicing factors modulate alternative splicing of their own transcripts and of transcripts encoding other splicing factors. However, the extent of this alternative splicing regulation has not yet been determined. I hypothesize that the splicing factor network extends to many SR and hnRNP proteins, and is regulated by alternative splicing coupled to the nonsense mediated mRNA decay (NMD) surveillance pathway. The NMD pathway has a role in preventing accumulation of erroneous transcripts with dominant negative phenotypes.
    [Show full text]
  • A GJA9 Frameshift Variant Is Associated with Polyneuropathy in Leonberger Dogs Doreen Becker1†, Katie M
    Becker et al. BMC Genomics (2017) 18:662 DOI 10.1186/s12864-017-4081-z RESEARCHARTICLE Open Access A GJA9 frameshift variant is associated with polyneuropathy in Leonberger dogs Doreen Becker1†, Katie M. Minor2†, Anna Letko1†, Kari J. Ekenstedt2,3, Vidhya Jagannathan1, Tosso Leeb1, G. Diane Shelton4, James R. Mickelson2† and Cord Drögemüller1*† Abstract Background: Many inherited polyneuropathies (PN) observed in dogs have clinical similarities to the genetically heterogeneous group of Charcot-Marie-Tooth (CMT) peripheral neuropathies in humans. The canine disorders collectively show a variable expression of progressive clinical signs and ages of onset, and different breed prevalences. Previously in the Leonberger breed, a variant highly associated with a juvenile-onset PN was identified in the canine orthologue of a CMT-associated gene. As this deletion in ARHGEF10 (termed LPN1) does not explain all cases, PN in this breed may encompass variants in several genes with similar clinical and histopathological features. Results: A genome-wide comparison of 173 k SNP genotypes of 176 cases, excluding dogs homozygous for the ARHGEF10 variant, and 138 controls, was carried out to detect further PN-associated variants. A single suggestive significant association signal on CFA15 was found. The genome of a PN-affected Leonberger homozygous for the associated haplotype was sequenced and variants in the 7.7 Mb sized critical interval were identified. These variants were filtered against a database of variants observed in 202 genomes of various dog breeds and 3 wolves, and 6 private variants in protein-coding genes, all in complete linkage disequilibrium, plus 92 non-coding variants were revealed.
    [Show full text]