Sarawak Forestry Corporation, 2018)

Home , Bagroides, Balleh River, Cassius (crocodile), Crurotarsi, Heterixalus, Igan river

Faculty of Resource Science and Technology

Historical Perspective, Distribution, Ecology and Population Genetics of Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in Sarawak, Malaysian Borneo

Mohd Izwan Zulaini bin Abdul Gani

Doctor of Philosophy 2019

Historical Perspective, Distribution, Ecology and Population Genetics of Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in Sarawak, Malaysian Borneo

Mohd Izwan Zulaini bin Abdul Gani

A thesis submitted

In fulfillment of the requirements for the degree of Doctor of Philosophy

(Zoology)

Faculty of Resource Science and Technology UNIVERSITI MALAYSIA SARAWAK 2019

DECLARATION

I hereby declare that the thesis has not been accepted for any degree and is not concurrently submitted in candidature of any other degree.

………………………………………….

Mohd Izwan Zulaini bin Abdul Gani

15010191

Date:

ACKNOWLEDGEMENT

First of all, I would like to thank God for always giving me the strength and blessing during all these challenging times, as well as my beloved parents, Abdul Gani Abdullah and

Nasabah Ismawi, all family members and friends for giving me motivation and moral support to finish my research. I gratefully acknowledge my supervisor Associate Prof. Dr.

Ruhana Hassan for her continual encouragement, enthusiasm and support throughout my degree, and for providing constructive comments on all that I have written. I would like to express heartfelt thanks to my co-supervisor Mr. Rambli Ahmad for his invaluable advices that had greatly helped me to improve my research.

In addition, I also would like to convey my gratitude to Mr. Oswald Braken Tisen, Mr.

Engkamat Lading, Mr. Christoper Kri, Mr. Paschal Dagang, SWAT members and other staffs of Sarawak Forestry Corporation Bhd. (SFC) and Forest Department of Sarawak

(FDS) for providing supports during crocodile samplings and other technical aspects of the study. A special thanks to Dr. Rossazana for advices on currency matters and also to fellow colleagues in the Molecular Aquatic Laboratory for helping me in the field surveys as well as to the lab assistants for helping to prepare the equipment before going to the field.

Finally, I would like to express my special gratitude to the University Malaysia Sarawak

(UNIMAS) for providing funds for this research through Dana Pelajar Ph.D. Grant no.

F07/DPP53/1282/2015(28) and also the FDS for granting permit NCCD.907.4.4(jld.12)-193 and Permit No. NPW.907.4.4(JLD.14)-149 to conduct research on the crocodiles in

Sarawak. Last but not least, thanks to Ministry of Higher Education for financing my study under MyPhD Scholarship Program.

ABSTRACT

This study is designed to gather information on historical exploitation and ongoing HCC; recent distribution and ecology of crocodile and genetic relationship of crocodile population in Sarawak, to aid sustainable crocodile management and finding solutions for mitigating the HCC. Historical data saw a connection between the exploitation of crocodile with decreasing trend of HCC in Sarawak from the Rajah Brooke era (1900 – 1941) until the post- war period (1946 – 1979), and an increasing trend of HCC from 1980 until 2017 in response to the recovery of the animal populations. Since 1900, crocodile attacks had been occurred in 22 major river basins (RB) in Sarawak, suggesting that the reptile has been widely dispersed throughout all major river basins in the state. For 118 years (1900 – 2017), the highest number of crocodile attacks were recorded in Lupar RB (22.2%) and the attacks had happened up to the inland areas of Belaga and Pelagus in Rajang RB. Further analysis of incidents show crocodile attacks were associated with the human activities pattern, where more attacks involved male victims (84.4%) and adults from age 31 to 40 years old (19.3%).

The data also revealed that crocodile attacks in Sarawak could happen anytime regardless of the time, month, season, lunar cycle or tidal. However, more attacks were recorded during the daylight, in the months of March and April, during the Northeast monsoon, at the nights of the first quarter of the lunar cycle and at the time of high tide. Furthermore, fishing

(25.2%) and bathing (24.4%) possess the highest risk of crocodile attack in Sarawak, clearly showed that crocodiles are more likely to attack when the victim is in water. Crocodile survey in selected tributaries in Rajang RB showed the distribution of the reptiles throughout the river basin with higher crocodile density at the lower region, the highest density was in

Igan River (1.37 individuals/km); while in the middle and upper regions had recorded

iii relatively low density with the lowest density recorded was in Katibas River (0.06 individuals/km) and no crocodile was spotted in Kanowit River. Four out of eight surveyed rivers in Rajang RB recorded increase in the density of crocodile compare to previous survey suggesting that the crocodile population in the river basin is experiencing recovery. The presence of crocodile in different regions (lower, middle and upper) of Rajang RB indicated that C. porosus in Sarawak live in wide range of habitats; from large salt water river system and small tidal tributaries (near to estuary) in lower region into hypo-saline or fresh water non-tidal tributaries in the middle and upper regions. Variation in term of density and distribution of crocodile between the different regions are mainly influenced by the saline characteristic of the river, habitats and the abundance of food sources for crocodile. Based on the analysis of DNA microsatellite sequence data, distinctive subpopulations of C. porosus according to geographical area (river basin) could be observed. High gene flow (Nm) among the crocodile subpopulations suggests frequent movements of the reptile happen across the river basins throughout Sarawak. In general, populations of C. porosus in Sarawak are experiencing expansion as supported by the mismatch distribution and evolutionary neutrality test data, suggesting that populations of crocodile in Sarawak are panmictic population. The findings of the present study imply that increasing of crocodile attacks is associated with the recovery and increased distribution of the reptile in Sarawak, thus crocodile management should emphasis on mitigating HCC and simultaneously continue the efforts for conservation of crocodile and its habitat.

Keywords: Crocodylus porosus, human-crocodile conflict, recovery, expansion.

Perpektif Sejarah, Taburan, Ekologi dan Genetik Populasi Buaya Air Masin (Crocodylus porosus Schneider, 1801) di Sarawak, Borneo, Malaysia

ABSTRAK

Kajian ini direka untuk mengumpul maklumat berkaitan sejarah eksploitasi dan KMB; taburan terkini populasi dan ekologi buaya serta hubungan genetik antara populasi buaya di Sarawak, untuk membantu pengurusan buaya secara lestari serta mencari solusi untuk mengurangkan KMB. Data sejarah memperlihatkan hubungkait antara eksploitasi buaya dengan tahap penurunan bilangan kes KMB di Sarawak dari era Rajah Brooke (1900 –

1941) sehingga ke tempoh selepas perang (1946 – 1979), dan tahap peningkatan bilangan kes KMB dari 1980 sehingga 2017 hasil tindakbalas daripada pemulihan populasi buaya.

Semenjak tahun 1900, serangan buaya telah berlaku di 22 sungai utama di Sarawak, menunjukkan taburan luas reptilia tersebut di semua sungai utama di negeri ini. Dalam tempoh 118 tahun (1900 – 2017), serangan buaya tertinggi dicatatkan di Lembangan Sungai

Lupar (22.2%) dan serangan telah berlaku sehingga ke kawasan pedalam Belaga dan

Pelagus di Lembangan Sungai Rajang. Analisis lanjut insiden menunjukkan serangan buaya berkaitan dengan corak aktiviti manusia, dimana lebih banyak serangan melibatkan mangsa lelaki (84.4%) dan individu dewasa berumur dari 31 sehingga 40 tahun (19.3%). Data juga mendedahkan bahawa serangan buaya di Sarawak boleh berlaku bila-bila masa tanpa mengira masa, bulan, musim, kitaran bulan atau pasang surut air. Walau bagaimanapun, lebih banyak serangan telah direkodkan pada waktu siang, di bulan Mac dan April, semasa musim monsun Timur Laut, pada malam suku pertama kitaran bulan dan ketika air pasang.

Aktiviti memancing (25.2%) and mandi di sungai (24.4%) mempunyai risiko serangan buaya yang tertinggi menunjukkan buaya lebih suka menyerang ketika mangsa berada di air.

Survei buaya di sungai-sungai terpilih di Lembangan Sungai Rajang mendapati reptilia tersebut mendiami pelbagai habitat di sepanjang sungai, dengan kepadatan lebih tinggi di

v bahagian hilir, tertinggi dicatatkan di Sungai Igan (1.37 individu/km); sementara itu di bahagian tengah dan hulu mencatatkan kepadatan yang lebih rendah dengan catatan terendah di Sungai Katibas (0.06 individu/km) dan tiada buaya dijumpai di Sungai Kanowit.

Empat daripada lapan sungai yang disurvei di Lembagan Sungai Rajang mencatatkan peningkatan kepadatan buaya berbanding dengan survei terdahulu, menunjukkan bahawa populasi buaya di sungai ini sedang mengalami pemulihan. Kehadiran buaya di bahagian berbeza (bahagian hilir, tengah dan hulu) di Lembagan Sungai Rajang menunjukkan C. porosus, hidup di pelbagai habitat; dari sungai besar dan anak sungai (berhampiran muara) air masin di bahagian hilir sehinggalah kepada anak sungai air tawar yang tidak dipengaruhi pasang surut di bahagian tengah dan hulu lembagan sungai tersebut.

Kepelbagaian dari segi kepadatan dan taburan di antara bahagian-bahagian berbeza adalah banyak dipengaruhi oleh ciri kemasinan sungai, habitat dan kelimpahan sumber makanan untuk buaya. Berdasarkan analisis data jujukan DNA mirosatelit, subpopulasi C. porosus berdasarkan kawasan geografi (lembangan sungai) dapat diperhatikan. Aliran gen tinggi (Nm) di kalangan subpopulasi buaya mencadangkan terdapat pergerakan yang kerap oleh reptilia tersebut di antara sungai-sungai di seluruh Sarawak. Secara umumnya, populasi C. porosus di Sarawak mengalami pengembangan populasi disokong oleh data ujian mismatch distribution dan evolutionary neutrality, yang juga mencadangkan bahawa populasi buaya di Sarawak adalah populasi yang panmictic. Penemuan kajian ini boleh diterjemahkan sebagai wujud kaitan antara peningkatan serangan buaya dengan pemulihan dan peningkatan taburan populasi reptilia tersebut di Sarawak, oleh itu pengurusan buaya perlu memberi penekanan kepada usaha-usaha mengurangkan KMB namun pada masa yang sama tetap meneruskan usaha untuk pemuliharaan buaya dan habitatnya.

Kata kunci: Crocodylus porosus, konflik manusia dan buaya, pemulihan, pengembangan

TABLE OF CONTENTS

Page

DECLARATION i

ACKNOWLEDGEMENT ii

ABSTRACT iii

ABSTRAK v

TABLE OF CONTENTS vii

LIST OF TABLES xii

LIST OF FIGURES xv

LIST OF ABBREVIATIONS xix

CHAPTER 1: GENERAL INTRODUCTION 1

1.1 Background 1

1.2 Problem statements 4

1.3 Objectives 7

1.4 Hypotheses 8

CHAPTER 2: LITERATURE REVIEW 10

2.1 Evolutionary history and classification of crocodiles 10

vii

2.2 Distribution of crocodiles 13

2.3 Crocodylus porosus 14

2.3.1 Taxonomy 14

2.3.2 Habitat and distribution of C. porosus in Sarawak 16

2.3.3 Morphology and physiology of C. porosus 18

2.3.4 Historical literature about crocodile in Sarawak 26

2.3.5 Threats and conservation 29

2.3.6 Ecological and social importance of crocodiles 33

2.4 Human-crocodile conflicts (HCC) 35

2.5 Population ecology of crocodiles 37

2.6 Population genetics and its importance 39

2.7 Genetic studies of crocodiles 40

CHAPTER 3: REVIEW OF CROCODILE STATUS AND HUMAN- 42

CROCODILE CONFLICTS IN SARAWAK FROM 1900

UNTIL 2017

3.1 Introduction 42

3.2 Materials and Methods 44

3.2.1 Study area 44

viii

3.2.2 Information gathering and analyses 48

3.3 Results and Discussion 52

3.3.1 White Rajah era (1900-1941) 52

3.3.2 Post- war period (1946-1979) 63

3.3.3 Period when wild crocodile populations depleted and the law was 64 introduced to protect them from hunting (1980-1999)

3.3.4 Millennia era (2000-2017) 66

3.3.5 One hundred and eighteen (118) years comparison of human- 80 crocodile conflicts

3.4 Conclusion 89

CHAPTER 4: DISTRIBUTION AND ECOLOGY OF SALTWATER 91

CROCODILE, Crocodylus porosus IN RAJANG RIVER

BASIN, CENTRAL SARAWAK

4.1 Introduction 91

4.2 Materials and Methods 95

4.2.1 Study area 95

4.2.2 Crocodile survey 97

4.2.3 River characteristics and landscapes 100

4.2.4 Selected water quality parameters 104

4.2.5 Potential aquatic food resources for crocodiles 104

4.2.6 Data analysis 105

4.3 Results 107

4.3.1 Crocodile density 107

4.3.2 Distribution of crocodile in selected rivers of Rajang River Basin 110

4.3.3 River characteristics and landscapes 117

4.3.4 Selected water quality parameters 122

4.3.5 Aquatic food resources for crocodile 124

4.3.6 Relationship between crocodile density, habitat, water quality 127 parameter and the abundance of food resources for crocodiles 4.4 Discussion 131

4.5 Conclusion 142

CHAPTER 5: GENETIC RELATIONSHIP AMONG Crocodylus porosus 144

FROM DIFFERENT RIVER BASINS IN SARAWAK,

MALAYSIAN BORNEO

5.1 Introduction 144

5.2 Materials and Methods 147

5.2.1 Sample collection 147

5.2.2 Total genomic DNA extraction and Polymerase Chain Reaction (PCR) 152 amplification

5.2.3 DNA sequencing and alignment 154

5.2.4 Phylogenetic tree and NETWORK reconstruction analyses 154

5.2.5 Population genetics analyses 155

5.3 Results 156

5.3.1 Sequences characterization and Basic Local Alignment Search Tool 156 (BLAST) analysis 5.3.2 Combine genes and haplotype build 160

5.3.3 Phylogenetic analysis 162

5.3.4 NETWORK analysis 168

5.3.5 Population genetic analyses 171

5.4 Discussion 177

5.5 Conclusion 182

CHAPTER 6: GENERAL DISCUSSION 183

CHAPTER 7: CONCLUSION AND RECOMMENDATIONS 201

REFERENCES 204

APPENDICES 223

LIST OF TABLES

Page

Table 3.1 List of river basins in Sarawak, its main river and approximate length 46

(Tisen & Ahmad, 2010).

Table 3.2 Periods of time and sources of information on crocodile in Sarawak. 50

Table 3.3 Number and measurement of crocodiles and eggs brought to the 54

government and amount of bounty paid (extracted from half year

report in Sarawak gazette, 1901-1907).

Table 4.1 Details of surveys in eight rivers of Batang Rajang. 97

Table 4.2 Size class for crocodile survey (Bayliss, 1987; Robi, 2014). 100

Table 4.3 Field guide for river habitat assessment (modified from Barbour et 101

al., 1996; Iwata et al., 2003; Bolhen, 2017).

Table 4.4 Scores for stream habitat category (modified from Barbour et al., 102

1996; Iwata et al., 2003; Bolhen, 2017).

Table 4.5 Characteristics observed and recorded in each river during field 103

sampling (Montague, 1983; Messel & Vorlicek, 1986).

Table 4.6 Relative density of C. porosus in eight tributaries of Rajang River 108

Basin.

Table 4.7 Comparison density of crocodile between survey in 2014 and 2017 108

(present study).

Table 4.8 Stream habitat assessment and its score for each river in study area 117

of Rajang River Basin.

xii

Table 4.9 Selected water quality parameters measured in-situ for rivers and 123

tributaries of Rajang River Basin.

Table 4.10 List of fish and invertebrates caught in Rajang River Basin that may 126

be the potential food source of the C. porosus.

Table 4.11 Pearson’s correlation between crocodile density, water quality 128

parameters and the abundance of food resources for crocodile

(CPUE).

Table 4.12 Summary for PCA analysis for the crocodile density, water quality 128

parameters and CPUE.

Table 4.13 Summary for GLM analysis for the water quality parameters, habitat 130

and CPUE in response with crocodile density.

Table 5.1 Voucher codes for samples according to sampling area. 150

Table 5.2 Microsatellite primers used in this study (Isberg et al., 2004). 153

Table 5.3 Sequence characterization for the microsatellite markers. 157

Table 5.4 Average nucleotide base composition at the 1st, 2nd and 3rd codon 158

position for the three microsatellite markers in this study. All

frequencies are in percentage (%).

Table 5.5 Basic Local Alignment Search Tool (BLAST) result. 159

Table 5.6 Haplotype identity for 22 microsatellite sequences of C. porosus. 161

Table 5.7 Measures of Nucleotide Diversity (π) and Net Nucleotide Divergence 171

(Da) among populations of C. porosus analysed by locations.

Table 5.8 Summary statistics of Microsatellite Cj16 sequences variation in five 173

populations of C. porosus in Sarawak.

xiii

Table 5.9 Measures of geographical population differentiation in Crocodylus 175

porosus based on an analysis of Molecular Variance approach using

microsatellite sequences data.

Table 5.10 Genetic differentiation matrix of populations calculated by ϕST. p 175

values are shown in parenthesis (below the diagonal).

Table 5.11 Measures of Nucleotide Subdivision (Nst), Population Subdivision 176

(Fst) and Gene Flow (Number of Migrants, Nm) among populations

of C. porosus analyzed by locations.

xiv

LIST OF FIGURES

Page

Figure 2.1 Global crocodile species and its common name (De Silva, 2013). 12

Figure 2.2 Taxonomic hierarchy of Crocodylus porosus. 15

Figure 2.3 Head shape of C. porosus (Illustration adapted from Caldicott et al., 18

2005).

Figure 3.1 Map of river basins in Sarawak (Map modified from Official Website 47

of Department of Irrigation and Drainage Sarawak, 2017).

Figure 3.2 Number of crocodile attacks divided into 10-year periods during the 57

Rajah Brooke era, 1900-1941.

Figure 3.3 (a) Percentage of attacks according to victim’s gender, (b) Percentage 58

of attacks according to the time when the incident occurred.

*Unknown = no information available.

Figure 3.4 Number of crocodile attacks from 1900-1941 according to river basin 59

Figure 3.5 Number of crocodile attacks from 1900-1941 according to month and 60

season when the incident occurs.

Figure 3.6 Types of activities of the victims when crocodile attacked (1900- 62

1941).

Figure 3.7 Number of crocodile fatal and non-fatal attacks for each year from 68

2000 until 2017.

Figure 3.8 (a) Percentage of victims according to gender; (b) Percentage of 70

crocodile attack cases according to time when the incident occurred

in Sarawak from 2000 - 2017.

Figure 3.9 Proportion of the crocodile attacks in Sarawak between 2000 and 72

2017 plotted over the lunar cycle.

Figure 3.10 Proportion of the crocodile attacks in Sarawak between 2000 and 74

2017 plotted over the tidal cycle.

Figure 3.11 Number of fatal and non-fatal attacks from 2000-2017 according to 75

age of victims.

Figure 3.12 Number of crocodile attacks from 2000-2017 according to river 76

basin.

Figure 3.13 Number of crocodile attacks from 2000-2017 according to month and 77

season when the incident occurred.

Figure 3.14 Types of activities of the victims at the moment of crocodile attacked 79

(2000-2017).

Figure 3.15 Average number of crocodile attacks per year divided into 10-year 80

periods between 1900 and 2017 in Sarawak.

Figure 3.16 Number of crocodile attacks from 1900 until 2017 according to river 84

basin.

Figure 3.17 Average of monthly rainfall in Sarawak for the period 1980 - 2014 86

(adapted from Sa’adi et al., 2017).

Figure 4.1 Map of Rajang River Basin. 96

Figure 4.2 Map showing the survey area in Igan River. Each circle indicates the 110

location of crocodile sighted during the survey and different colours

in the circle represent different size class.

xvi

Figure 4.3 Map showing the survey area in Belawai River. Each circle indicates 111

the location of crocodile sighted during the survey and different

colours in the circle represent different size class.

Figure 4.4 Map showing the survey area in Sarikei River and Nyelong River. 112

Each circle indicates the location of crocodile sighted during the

survey and different colours in the circle represent different size class.

Figure 4.5 Map showing the survey area in Kanowit River. No crocodile 113

sighting was recorded during the survey.

Figure 4.6 Map showing the survey area in Poi River. Each circle indicates the 114

location of crocodile sighted during the survey and different colours

in the circle represent different size class.

Figure 4.7 Map showing the survey area in Ngemah River. Each circle indicates 115

the location of crocodile sighted during the survey and different

colours in the circle represent different size class.

Figure 4.8 Map showing the survey area in Katibas River. Each circle indicates 116

the location of crocodile sighted during the survey and different

colours in the circle represent different size class.

Figure 4.9 Catch per unit effort (CPUE) at eight rivers in Rajang River Basin. 125

Figure 4.10 PCA ordination bi-plot of eight rivers of Rajang River Basin with 129

crocodile density, habitat, water quality parameters (Salinity, pH and

Temperature) and food resources for crocodile (CPUE).

Figure 5.1 Map of Sarawak showing locations of C. porosus sample collected in 151

the present study.

xvii

Figure 5.2 Microsatellite-based phylogenetic relationship for 22 C. porosus in 164

Sarawak inferred using Neighbour-joining (NJ) analysis. Support

value next to the node are bootstrap values.

Figure 5.3 Microsatellite-based phylogenetic relationship for 22 C. porosus in 165

Sarawak inferred using Maximum Parsimony (MP) analysis. Support

value next to the node are bootstrap values.

Figure 5.4 Microsatellite-based phylogenetic relationship for 22 C. porosus in 166

Sarawak inferred using Maximum likelihood (ML) analysis. Support

value next to the node are bootstrap values.

Figure 5.5 Bayesian inference of the 50% majority rule consensus tree of 167

Combine microsattelite genes of C. porosus. Bayesian posterior

probabilities are accordingly indicated besides the branch nodes.

Figure 5.6 The median-joining Network generated by NETWORK software 170

version 5.0.0.3 illustrating the relationship of the saltwater crocodile,

C. porosus from different localities in Sarawak. Each circle

represents a haplotype and the diameter of the circle is scale to the

haplotype frequency. Different colours in the circle represent

different localities. Bold number next the lines connecting the

haplotypes indicate number of mutation step(s).

Figure 5.7 Mismatch distribution of C. porosus at (a) Sarawak RB, (b) 174

Samarahan/Sadong RB, (c) Saribas/Krian RB, (d) Rajang RB and (e)

Bintulu/Miri RB population. The dark line represents the observed

and light lines represent the expected distribution for each model.

xviii

LIST OF ABBREVIATIONS

ºC Degree Celsius

μL Microliter

AMOVA Analysis of Molecular Variance

ANOVA Analysis of Variance bp Base pairs

CITES Convention on International Trade in Endangered Species of Wild Fauna

and Flora cm Centimeter

DNA Deoxyribonucleic acid

FDS Forest Department of Sarawak ft Feet

HCC Human-crocodile conflict

HL Head Length hp Horse power

ICT Information and communication technologies

IUCN International Union for Conservation Nature

KMB Konflik manusia dan buaya km2 Square kilometres km Kilometer

L Liter m Meter mL Milliliter

xix mm Milimeter

MCF Miri Crocodile Farm

MYR Malaysian Ringgit

NEM Northeast monsoon ppt parts per thousand psi pounds per square inch

RB River Basin

SFC Sarawak Forestry Corporation Sdn. Bhd.

SWM Southwest monsoon

TL Total length

TTB Tumbina Park, Bintulu

UK United Kingdom

UNIMAS Universiti Malaysia Sarawak

USA United States of America

WWII World War 2

CHAPTER 1

GENERAL INTRODUCTION

1.1 Background

The saltwater crocodile, Crocodylus porosus (Schneider, 1801) is the most geographically widespread and the most resilient among all the crocodile species. The distribution covers

Indo-pacific region, including several countries in Southeast Asia, Australia, Papua New

Guinea, Bangladesh, India, Sri Lanka, Palau, Solomon Islands and Vanuatu (Webb et al.,

2010). This species typically occupies tidal rivers of the coastline and associated freshwater swamps. However, C. porosus could also live in total freshwater habitats, and may move hundreds of kilometers upstream from the sea, well beyond saline water and tidal influence.

In Malaysia, C. porosus is abundant in Sarawak and Sabah, the two states located in the island of Borneo compared to the Peninsular (Sarawak Forestry Corporation, 2018). In

Peninsular Malaysia, C. porosus populations can be found in Rembau-Linggi Estuary (Nazli et al., 2009) and Setui-Chalok-Bari River Basin (RB) on the east coast of Terengganu (Webb et al., 2010). In Sabah, C. porosus inhabit Kinabatangan RB and its associated wetland

(Evans et al., 2017). Small population of crocodile had also been reported in the Klias River

(Stuebing et al., 1994), Segama River (Kaur, 2006) and Kawang River (Jet et al., 2011).

Sarawak supports the largest population of C. porosus in Malaysia, where they could be found in almost all major river basins in the state including large or small river systems, mangroves estuaries and inland freshwater swamps (Tisen & Ahmad, 2010; Hassan &

Abdul-Gani, 2013; Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014;

Sarawak Forestry Corporation, 2018). This species are also found in Logan Bunut, the

Sarawak’s largest natural lake which drains into Teru riverine system in Miri Division (Cox

& Gombek, 1985).

Majority of the C. porosus populations in the range countries are listed in Appendix I in the

Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) except for the populations in Papua New Guinea, Australia, Indonesia and Malaysia (wild harvest restricted to the state of Sarawak and a zero quota for wild specimens for the other states of Malaysia), which are currently in Appendix II (CITES, 2018). In Appendix I, international trade for the specimens from the wild populations are not allowed except for those whose had been issued with permit from CITES. Meanwhile, CITES Appendix II listing allows utilization of wild caught animals in manners not detrimental to the survival of the species and that the specimens were legally obtained. The implementation of CITES in Malaysia is mandated under the International Trade in Endangered Species Act 2008 [Act

686] as well as the individual state’s wildlife laws (Sarawak Forestry Corporation, 2018).

C. porosus in Malaysia is listed as a protected species under state’s wildlife laws; for the states in peninsular Malaysia, the crocodile is protected by the Wildlife Conservation Act

2010 [Act 716], meanwhile Wild Life Protection Ordinance of Sarawak 1998 and Sabah

Wildlife Conservation Enactment 1997 protect the crocodile in Sarawak and Sabah, respectively. These laws prohibited any activities of hunting or killing of wild crocodiles in any states of Malaysia. In addition, any activities involving trades or import-export either in

2 the form of life crocodile or crocodile-based products in Malaysia are illegal except for those who have license and permit from the authority (Sarawak Forestry Corporation, 2018).

During the Rajah Brooke’s era in Sarawak, crocodiles were considered as pest because this animal had terrorized people and caused much problem to the government. Thus, the government offers bounty for each crocodile that had been caught (Hornaday, 1885). The local community started to hunt this animal for the prize and a huge number of crocodiles had been reported caught during the time. After the World War 2 (WWII), demand and prize for crocodile’s skin worldwide, especially for C. porosus skin, had been increased and consequently led to the intensive hunting of crocodiles in rivers of Sarawak. Besides hunting for its skin, the local community in Sarawak also consumed crocodile’s meat and use its organs and body parts for medicine to cure asthma and other sickness (Hassan & Abdul-

Gani, 2013). Hunting activities and exploitation of crocodiles in Sarawak were at its peak in the late 80’s, leading to the reduction in the number of crocodiles in rivers of Sarawak.

According to the survey by Cox and Gombek (1985), prior to the introduction of a law that prohibited any crocodile hunting activity, the density of crocodile in several rivers in

Sarawak were less than 1 individual/ km and in some rivers, no crocodile could be sighted.

After more than three decades protected by the laws that prohibits any hunting activities of crocodiles in the wild, populations of C. porosus in Sarawak are recovering. Simultaneously, the human-crocodile conflicts (HCC) in Sarawak are also on the rise, possibly due to the growing crocodile populations as well as the expanding of human populations in the state

(Lading, 2013; Tisen et al., 2013). Increasing in the number of crocodiles in the river would intensify competition among crocodiles for a shrinking habitat (Amarasinghe et al., 2015),

3 which could lead to the expansion of crocodile population including towards further upriver. The local people claimed that C. porosus can be seen as far as Kapit town at the Rajang

RB, which is more than 160 km from its river mouth and the waterway is not affected by the tidal influence (Tisen & Ahmad, 2010).

1.2 Problem statements

Conflicts between human and crocodile (HCC) in Sarawak showed an increasing trend, most notably after the year 2010 (Tisen et al., 2013; Abdul-Gani, 2014) which led to the assumption that the recovery of crocodile population in the rivers might be one of the major factor contributing to the problem. Meanwhile, at least eight major rivers in Sarawak recorded a marked increase in density of crocodiles (Tisen & Ahmad, 2010; Sarawak

Forestry Corporation, 2018), hence further reaffirm the assumption. Increasing in the density of crocodiles in the river could trigger the competition for space, food sources and mating companions as more crocodiles are living in the limited stretch of the river. Fierce competition among the crocodiles sometimes affect the level of aggressiveness of the animal which could lead to attacks on human.

C. porosus, the crocodile species that is identified as the main perpetrator for almost all attacks in Sarawak, is known for its territorial behavior which mean a crocodile especially the adult cannot tolerate with other crocodiles or other animals including human entering its territory (Campbell et al., 2013). A very large adult crocodile typically dominates large section of the river that has the best spot for food hunting, basking and resting, while smaller crocodiles that are unable to access the area guarding by the dominant crocodile usually will

4 forage into other places resulting in habitat range expansion of this species (Hanson et al.,

2015). In finding new area for living, there is a possibility that this crocodile will travel further upstream and end up staying in the upper side of the river.

Several sightings of C. porosus in the upper region of Batang Rajang (about 160 km from river mouth and no tidal influence) rise question about the movement pattern of this animal.

The ability to travel in long range movement (Read et al., 2007; Campbell et al., 2010;

Campbell et al., 2013) and also highly adapted to new environment as it possesses functional lingual salt glands and other organs (Grigg & Gans, 1993) could facilitate the dispersion of

C. porosus not just along the coastline of Sarawak, but also possibility towards further upstream of large river basins. This population expansion theory has never been tested in

Sarawak, leading to the difficulties for the authority to manage crocodile populations in a sustainable manner for the benefit of local people and the state.

Despite reports on the presence of C. porosus in the upper part of Batang Rajang, information about the distribution, ecology and habitat of this reptile in the particular region are largely unknown. Prior to 2010, majority of the crocodile’s survey in Sarawak focused in the rivers within the coastal region. Cox and Gombek (1985) had first initiated preliminary surveys on populations and distributions of C. porosus and T. schlegelii in Sarawak in mid-1980’s. The surveys involved several large rivers in Sarawak including Samarahan River, Batang Lupar,

Batang Rajang, Baram River and Kuching mangrove wetland.

The Sarawak Forestry Corporation (SFC) and Forest Department of Sarawak (FDS) had been conducting surveys on crocodile population in several major rivers of Sarawak since

1994 (Tisen & Ahmad, 2010; Sarawak Forestry Corporation, 2018). However, due to the vast areas of rivers in Sarawak and the high cost needed to conduct a survey, earlier crocodile surveys only involved rivers in the western part of Sarawak, such as Sarawak River, Kuching wetland, Batang Sadong, Batang Samarahan, and Batang Lupar. Only in 2012 to 2014, the agencies have started a comprehensive state-wide crocodile surveys that cover 40 rivers throughout Sarawak including the Rajang RB (Robi, 2014; Sarawak Forestry Corporation,

2018). Surveys by Cox and Gombek (1985) and Robi (2014) in Rajang RB reported an increase of 2150% (from 0.02 individuals/km in 1985 to 0.43 individuals/km in 2014) in the density of crocodiles. However, the data have set back such as survey by Cox and Gombek

(1985) only examined the lower part of the river, including tributaries such as Sarikei River,

Belawai River, Paloh River and few smaller tributaries near to the mouth of the river basin, while survey by Robi (2014) cover up to nine rivers from lower to upper side of the river basin. Therefore, using the Rajang RB as a model river basin, this study uses combination of survey and genetic data to shed light on the possible expansion of crocodiles in Sarawak.

To ensure successful wildlife management, all historical information, ecological and genetic components need to be examined (Bradshaw et al., 2006). Historical information on crocodiles including exploitation of the animal, crocodile attacks data and distribution could help in understanding the timeline of events related to the crocodile population in Sarawak and the data could assist crocodile management in deciding better actions for the better future of the reptile in the state. Genetic data are important as it allow inferences about the geographic patterns and extent of historical isolation of one species (Moritz, 1999).

Therefore, this study is designed to assess genetic relationship among crocodile populations in order to resolve population structure of C. porosus in Sarawak. The ecological and habitat

6 data collected in this study will also help in providing clues concerning the potential movement of crocodiles and the possible risk of danger posed by them in Rajang RB. Habitat use by a particular species can be best understood by monitoring its movements, which ultimately would reflect its behaviour or responses to the habitat (Taigor & Rao,

2014).

1.3 Objectives

Objectives of this study are:

i. To gather and examine the historical information on crocodile in Sarawak including

the exploitation of the animal and conflicts between human and crocodile from the

year 1900 to 2017.

ii. To analyze data on crocodile attacks incidents in Sarawak from the year 1900 to

2017.

iii. To assess the density and distribution of C. porosus in eight rivers representing the

upper, middle and lower part of Rajang River Basin.

iv. To compare the current density of C. porosus in eight selected rivers in Rajang River

Basin with previous survey.

v. To determine the crocodile habitats, selected water quality parameters and the

abundance of potential food sources for crocodile in the eight rivers of Rajang River

Basin.

vi. To determine relationship between crocodile density and distributions with habitats,

selected water quality parameters and the abundance of food sources for crocodile. vii. To investigate the genetic relationship among crocodile populations from 13

localities in Sarawak using DNA microsatellite marker. viii. To examine population expansion and migrations (gene flow) between the crocodile

populations in Sarawak.

6.1 Hypotheses

At the beginning of this study, the hypotheses suggested were as follows:

Chapter 3

H0: There is no change in terms of number of human-crocodile conflicts (HCC) in Sarawak

within the period of 1900 until 2017.

Ha: There is fluctuation in terms of number of human-crocodile conflicts (HCC) in Sarawak

within the period of 1900 until 2017.

Chapter 4

H0: There is no difference in ecological characteristics and river habitats supporting

populations of C. porosus in the estuary, middle and upper regions of Rajang River

Basin.

Ha: There are differences in ecological characteristics and river habitats supporting

populations of C. porosus in the estuary, middle and upper regions of Rajang River

Basin.

Chapter 5

H0: Microsatellite markers are unable to clarify to the population structure of C. porosus in

Sarawak and are not useful to explain the expansion of the animal population in the state.

Ha: Microsatellite markers could clarify the population structure of C. porosus in Sarawak

and could explain the expansion of the animal population in the state.

CHAPTER 2

LITERATURE REVIEW

2.1 Evolutionary history and classification of crocodiles

All crocodiles belong to Order Crocodilia under the Class Reptilia. Reptiles first appeared around 320 million years ago and arose directly from the amphibians, a diverse group of animals at that time. At the time that reptiles evolved, the world's fauna consisted of invertebrates, fish and amphibians. Between 320 and 220 million years ago, reptile came in many different body forms where some of them were large, others were small, some dominated the land surfaces, others the sea. This marked the "Age of Reptiles" had arrived, and reptiles were to flourish for the next 155 million years. However, about 65 million years ago the group suddenly suffered mass extinction, about the same period of time that saw the end of the dinosaur. During the event, most of the known reptiles entered the fossil record.

Today’s crocodilian including crocodile, alligator, caimans and gharials are thus considered

“living fossils” that survived the mass extinction (De Silva, 2013).

Crocodilians are thought to share common ancestor with the dinosaurs and birds (Seymour et al., 2004). The birds are said to split off from dinosaur ancestor later than the crocodiles.

This group that share the same lineages is called Archosauria. Even when looking at modern crocodilians, their biology and behavior are closely similar to the dinosaurs. While for birds, there are some traits shared with the crocodiles such as the presence of gastroliths in the stomach of extant crocodilians (Brazaitis, 1969; Brazaitis & Watanabe, 2011). These are

10 among the evidences that connecting crocodiles with dinosaur and birds which share common ancestor.

According to Seymour et al. (2004), one of the oldest complete basal archosaur fossils came from the Early Triassic, the 1.5 m long Proterosuchus, which resembled modern crocodiles.

Then it was followed by the Orthosuchus, a terrestrial crocodilian in the Middle Triassic, which at that time became the most important predators. It was believed that all crocodilians were terrestrial before they invaded the seas, lakes and swamps. Then came Euparkeria, a small archosaur that is considered to be closed to the common ancestor of crocodilians and dinosaurs (De Silva, 2013). Approaching the Middle Triassic, archosaurs split into two lineages: Crurotarsi (crocodilians and relatives) and Ornithodira (dinosaurs, birds, pterosaurs and relatives).

During the Tertiary periods (approximately 65 million years ago), the periods after the mass extinction of reptiles, all surviving crocodilians were widely distributed in the world with the help of favorable weather conditions. These crocodilians are in the Order Crocodylia, which is divided into three discrete Families (Crocodylidae, Alligatoridae, Gavialidae), which have been separated from each other for at least 60 million years (De Silva, 2013).

However, several factors including severe climate change has contributed to the extinction of several species of crocodiles. According to De Silva (2013), all periods of expansion in diversity of crocodiles in the fossil record coincided with periods of warm global temperature, which explained why some species were extinct and also because of this, crocodiles are restricted to certain geographical area.

There are at least 24 species of modern crocodilian that still exist on the present day, disperse around the world under Order Crocodylia. They are grouped under three extant families and nine genera (Figure 2.1).

Class Reptilia Order Crocodylia Family Alligatoridae Genus Alligator A. mississippiensis - American alligator A. sinensis - Chinese alligator Genus Caiman – the true caimans C. crocodilus – spectacled or common caiman C. yacare – Yacaré caiman C. latirostris – broad-snouted caiman Genus Melanosuchus M. niger – black caiman Genus Paleosuchus – the dwarf caimans P. palpebrosus – Cuvier’s dwarf, or dwarf caiman P. trigonatus – Schneider’s dwarf, or smooth-fronted caiman Family Crocodylidae Genus Crocodylus – the true crocodiles C. acutus – American crocodile C. intermedius – Orinoco crocodile C. rhombifer – Cuban crocodile C. moreletii – Morelet’s crocodile C. niloticus – Nile crocodile C. siamensis – Siamese crocodile C. palustris – mugger crocodile C. porosus – estuarine or saltwater crocodile C. mindorensis – Philippine crocodile C. novaeguineae – New Guinea crocodile C. johnstoni – Australian freshwater crocodile C. cataphractus – African slender-snouted crocodile Genus Mecistops – the African slender-snouted crocodiles M. cataphractus – African slender-snouted crocodile Genus Osteolaemus O. tetraspis – African dwarf crocodile Family Gavialidae – the gharials Genus Gavialis G. gangeticus – true or Indian gharial Genus Tomistoma T. schlegelii – false gharial/Malayan gharial

Figure 2.1: Global crocodile species and its common name (De Silva, 2013).

2.2 Distribution of crocodiles

Extant modern crocodilians are distributed geographically throughout tropical, sub-tropical and warmer temperature wetlands regions of the world (Martin, 2008). This is because crocodiles are unable to survive and reproduce successfully in cold climates (Grigg & Gans,

1993; De Silva, 2013). However, Genus Alligator (the American alligator and Chinese alligator) are the most cold-tolerant and are both found in the highest latitudes of any species

(Grigg & Seebacher, 2000).

Crocodiles can live in various aquatic habitats such as forest streams, rivers, marshes, swamps and elbow lakes. They can be found in over 90 of the world's countries and islands

(Martin, 2008). Alligators and caimans (Family Alligatoridae) are found almost exclusively in North, Central and South America. The sole exception is the Chinese alligator which is found in the eastern China. There are a few members from the Family Crocodylidae (true crocodiles) in the Americas, but the majority of them can be found throughout Africa and

Asia. One member of the Family Gavialidae (the Indian gharial), is found in India and adjacent countries, while another family member, the false gharial is distributed in few countries in the Southeast Asia (Martin, 2008).

Majority of crocodiles species are restricted to certain part of the worlds. Among them are

Chinese alligator (Alligator sinensis), can only be found in Yangtze River, China; Orinoco crocodile (Crocodylus intermedius), in Orinoco water system in Venezuela and Colombia and the Philippines crocodile (Crocodylus mindorensis) which live only in the archipelago of the Philippines (Martin, 2008). In addition, some species are distributed widely and can

13 be found in specific continent or region such as the Nile crocodile (Crocodylus niloticus) in

Africa, the saltwater crocodile (Crocodylus porosus) in the Indo-Pacific region or the spectacled caiman (Caiman crocodilus) in South America.

Out of 24 species of crocodiles in the world, only two species can be found in Sarawak, the saltwater crocodile, Crocodylus porosus and the Malayan false gharial, Tomistoma schlegellii (Abdul-Gani, 2014; Hassan et al., 2016; Sarawak Forestry Corporation, 2018).

Both species can be easily distinguished as both crocodiles have a distinctive snout feature.

The false gharials have elongated and slender snouts compared to those of the saltwater crocodiles, which are shorter and blunt (Grigg & Gans, 1993). Both species live in different habitats; C. porosus mainly occupying waterway areas near to the coast, meanwhile the T. schlegellii is can only be found in further inland freshwater rivers with peat swamps habitat and black water (Hassan et al., 2016). C. porosus are more abundance and aggressive, perpetrator for almost all crocodile attacks in Sarawak, compare to the T. schlegellii, hence the literature review chapter will mainly focus on C. porosus.

2.3 Crocodylus porosus

2.3.1 Taxonomy

Crocodylus porosus SCHNEIDER 1801 was first discovered and described as new species by a German naturalist Johann Gottlob Schneider (Schneider, 1801). This species is classified in the Family of “true crocodile”, Crocodylidae, and Order Crocodilia (Figure 2.2).

Kingdom Animalia Phylum Chordata Subphylum Vertebrata Class Reptilia Laurenti, 1768 Order Crocodylia Family Crocodylidae Genus Crocodylus Laurenti, 1768 Species Crocodylus porosus Schneider, 1801

Figure 2.2: Taxonomic hierarchy of Crocodylus porosus.

Worldwide, C. porosus is commonly known as saltwater crocodile or estuarine crocodile.

The crocodile species was given a nickname “saltie” by the Australian as it is widely distributed in the coastal areas and rivers in the Northern Territory of Australia (Webb et al.,

2010). Another name for this crocodile is “Naked-neck” crocodile, because this is the only species without large scales on the back of its neck. With a reputation as human killer and causing more fatalities to human when compared to the other crocodile species, C. porosus had earned a fearsome name as the “man-eating crocodiles”.

In general, local people in Sarawak called the saltwater crocodile ‘buaya katak’ or ‘buaya tembaga’ (translated as frog crocodile or copper crocodile, respectively), basically based on observation that crocodiles can jump like a frog or leap out of water and also because of the copper-like brownish colour on the body of the crocodiles found in certain rivers. In native

Iban language, the crocodile is referred as ‘baya’. Yet, when talking about crocodile in

Sarawak, the infamously huge crocodile known as ‘Bujang Senang’, once shook fear among people in Sarawak as many victims fall into the mouth of the crocodile, is the most remembered crocodile by the people in the state. Historically, the name of Bujang Senang literally means a happy bachelor came from a crocodile that inhabited Batang Lupar in Sri

Aman, Sarawak, Malaysia. The word “Bujang” in Malay means bachelor, which refers to the crocodile while “Senang” refers to the Senang River, which is one of the tributaries in

Batang Lupar, a place where the first known attack by this crocodile had happened (Ritchie

& Jong, 2002). It had been a custom in Sarawak when a large and ferocious crocodile that had been kill or captured to be given a name according to the name of a river where it was found such as “Bujang Samarahan”, “Bujang Tisak” and “Bujang Seblak” (Abdul-Gani,

2014).

2.3.2 Habitat and distribution of C. porosus in Sarawak

Sarawak is situated on the north-eastern part of Borneo Island, geographically separated from Peninsular Malaysia by the South China Sea, sharing the island with the Malaysian state of Sabah, the Sultanate of Brunei Darulsalam and the Indonesian’s Kalimantan. The topography of the state is generally flat closer to the coast to gently undulating hills and rugged mountains towards the borders in the west and south (Tisen et al., 2013). The tidal portions of the rivers are typically linked with mangrove in the coastal area and the rivers flow through great distances over broad flood plains, giving rise to the extensive crocodile habitats. The waterways of Sarawak are comprising of 22 major river basins and its cover

16 an area of 12 million hectares, in which the saltwater crocodile, C. porosus, is reported to occur in all of the river basins in the state (Sarawak Forestry Corporation, 2018).

In Sarawak, C. porosus are majorly abundant in the large river systems, mangrove floodplains and inland freshwater swamps (Tisen & Ahmad, 2010). The highest crocodile densities in Sarawak are usually found in estuary and mid-river areas of medium sized to large rivers (Tisen & Ahmad, 2010; Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014; Sarawak Forestry Corporation, 2018). Crocodiles in Sarawak particularly the female ones prefer to build nest in small and secluded tributaries connected to the major rivers. Juvenile crocodiles can be found abundant in these tributaries especially after the nesting season (Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014).

C. porosus can be seen in Logan Bunut, the Sarawak’s largest natural lake, situated approximately 130 km from the city of Miri (Cox & Gombek, 1985). The lake is mainly surrounded by peat swamp and the water drains into Sungai Teru. The species have also been spotted in several locations in the upper region of river basin, hundreds kilometers away from sea such as Belaga in the upper Rajang RB and Kelauh, a small freshwater tributary of

Lupar RB (Tisen & Ahmad, 2010). There are also reports received by authorities about the sighting of crocodiles in man-made waterbodies such as in water drainages, agriculture canals, community lakes and private ponds (Sarawak Forestry Corporation, Unpublished report).

2.3.3 Morphology and physiology of C. porosus

The saltwater crocodile, C. porosus has a large triangular head with broad and long snout and round eyes at the top of the head. The C. porosus is the only species without large scales on the back of its neck, a unique feature distinct the species from other species in

Crocodylidae (Figure 2.3) (Grigg & Gans, 1993). There is a pair of ridges along the centre of the snout and it becomes more distinct with age. The upper surface of the top jaw becomes more shrunken in large adult males. Juveniles C. porosus have more oval scales than other crocodile species, although belly scales are rectangular, even and relatively small (Isberg et al., 2006). C. porosus are normally green or pale tan in colour with black stripes and spots on the body and tail but they became paler and less colourful after reaching adult stage. This happens because the crocodile’s body usually covered with mud, grime and algae. The ventral surface or belly is creamy yellow to white in colour, except the tail which tends to be greyer on the underside nearer to the tip (Grigg & Gans, 1993).

Figure 2.3: Head shape of C. porosus (Illustration adapted from Caldicott et al., 2005).

C. porosus possess a set of 64 to 66 teeth which designed to grab and hold onto prey and the size of the teeth can be from 10 to 13 cm long according to the size of the crocodile (O'Shea

& Halliday, 2002; Caldicott et al., 2005). They also have powerful pterygoid muscles in its jaw which enable this crocodile species to crush hard-shell or larger preys. Saltwater crocodiles have the strongest bite of any living animal with 3,700 pounds per square inch

(psi) bite force, even beating the bite force of the great white sharks (Erickson et al., 2012).

The crocodilian eye possesses a set of relatively large lens, retina and tapetum lucidum, all features commonly associated with optimized sensitivity in dim light environments (Nagloo et al., 2016). When the spotlight or flashlight directed to crocodile’s eyes, the tapetum lucidum, will reflect distinctive orange or red color (depending on the angle and intensity of lights) allowing crocodiles to be detected easily at night. A semi-transparent membrane, slit pupil, control the amount of light that reaches the retina during the day as well as protected crocodile eyes when they submerge under water (Grigg & Gans, 1993; Nagloo et al., 2016).

Among all the extant crocodilians, C. porosus is the largest living crocodile species based on confirmed measurements and also the world's largest living reptile in terms of mass. The species can growth up to 6 - 7 meters length and weight perhaps could reach a ton or 1,000 kg. Crocodilians display a pronounced sexual dimorphism where males grow larger and often more rapidly than females (Grigg & Gans, 1993). Generally, the size of adult male saltwater crocodiles is over 5 m in length, but in rare occasion they can grow bigger and their size can reach more than 6 m. In contrary, the length of female C. porosus is relatively smaller and the normal maximum adult size is between 2.5 m to 3 m. For the maximum

19 weight, it varies according to its size. Usually, less than 5 meters adults are closer to 400 to

500 kg in weight.

The largest wild crocodile ever captured alive and properly measured is a male C. porosus called ‘Lolong’ with a size of 6.17 m (20.24 ft) (Britton et al., 2012). The exceptionally large saltwater crocodile was captured in September 2011 from a small creek in Mindanao island,

Philippines. Meanwhile in Sarawak, the infamous white back crocodile, Bujang Senang, killed in early 1990’s, was measured at 5.87 m (19.24 ft) and weighed more than 2000 pounds (907.2 kg) (Ritchie & Jong, 2002). Although there are some unconfirmed reports claimed about the sighting of huge crocodiles in the rivers of Sarawak, until now, no crocodiles were capture or killed that a have size greater than the Bujang Senang.

Majority of crocodilians can live for a long time (Cooper-Preston & Jenkins, 1993). The saltwater crocodiles are known to live for over 70 years and may even reach 100 years.

Crocodiles who live over 50 years are considered old. A crocodile in captivity at a farm in

Australia called “Cassius” is estimated to be 110 years old. “Cassius” was captured in 1984 from a river in the Northern Territory, Australia, has been in captivity for more than 26 years and still alive at the farm until today. With the death of “Lolong” in 2013, “Cassius” now has been named as the world's largest crocodile in captivity (Britton et al., 2012).

Crocodiles are amphibious animals, thus they can move both in land and in water. However, crocodilians travel more easily in the water. The saltwater crocodile is an excellent swimmer, under water or at water surface and sometime utilizing water current to facilitate its movement (Campbell et al., 2010). The reptile uses its long muscular tail to propel itself in

20 the water, holding the limbs at the sides. This massive tail also came in handy when crocodile attack its preys (Grigg & Gans, 1993). Crocodile can stay under water for 4-5 hours long, however, this ability is very much reliant on the size; larger crocodile can stay under water longer than the small one (Rodgers et al., 2015). When submerge, crocodile's eye is covered by the slit pupils and flaps of skin seal its nostrils and ears against water inflow. They also can control their heart beat by virtually slowing it into 2 or 3 beats per minute so that they can stay longer underwater without the need to come to the surface for air (Axelsson &

Franklin, 2011). On land, crocodiles have several ways of walking or gaits including the

“belly crawl”, walking in which the crocodile slides using its legs to push itself along on its belly over a slippery mud. Another crocodile gait is high walking with the body held clear of the ground and they can walk faster or running. They are also had been seen sliding down steep slope at the riverbank before entering water (Grigg & Gans, 1993).

Breeding season for crocodiles typically coincide with the wet season. C. porosus in Sarawak started to mate at the end of the dry season (Stuebing et al., 1985). During the courting process, a male crocodile may display his dominancy and fight with other males for potential mate before mating takes place briefly after the courtship. In general, crocodile mating occurs entirely in the water where male and female swim together, often in circles, make body contact frequently and rub their head over one another (Cooper-Preston & Jenkins,

1993). Stuebing et al. (1985) suggested that crocodiles in Sarawak are actively build their nest and lay eggs in two periods of the year, from March to May and from October to

November, based on the data collected in a crocodile farm. The months of these two periods match with the months when the transition between the two monsoon seasons (NEM and

SWM) or inter-monsoon in Sarawak. Stuebing et al. (1985) also reported that the breeding

21 season of crocodiles in Sarawak concur with the prawn season, hence suggest that the abundance of prawn as the food supply for the crocodiles may be one of the environment cues that trigger the breeding season.

During the nesting period, female crocodiles can travel up to hundreds kilometers to find suitable place to build nest (Campbell et al., 2013). Crocodile’s nest is typically builds in an open area not far from river or water sources, but in some occasions the nest were found up to hundreds of meter from waterbody, but the access to freshwater is still available close to the nest (Webb et al., 1983; Fukuda & Cuff, 2013; Evans et al., 2016). The female crocodile built nest from available plants in the surrounding area especially grasses or shrub and used mud to mound the plants together (Fukuda & Cuff, 2013). On average, a female C. porosus could lay between 50 to 60 eggs and incubation period took about 60 to 100 days before the eggs hatch. The sex of the hatchling is determined by the temperature of the nest; if the nest temperature is around 32°C to 33°C, the egg is most likely hatch as male, whereas when temperature above or below that, female will be produced (Cooper-Preston & Jenkins, 1993).

In wild population, only about 25% off the eggs will hatch and less than 1% of hatchlings will survive to reach maturity. Others might be killed by other animals including human or other crocodiles. After hatch, young crocodile tends to stay near to its nest for few months.

Adult females are said to remain near the nest up to several months, assisting hatchlings out from the nests and protecting them from predators (Webb et al., 1977).

Crocodilians are carnivorous and opportunistic predators (Webb et al., 1991). They eat a wide range of preys depend on their developmental stage, habitats and potential prey diversity. C. porosus, from hatchling to adult, eat primarily at the water edge, however, the

22 size of preys varies according the crocodile age. Young and small crocodiles eat small animals like fish, crabs, prawns, frogs and insects. When they grow bigger the crocodiles are capable to hunt and eat larger preys like turtles, mammals, snakes, primates, wild pigs and livestock (Webb et al., 1991; Hanson et al., 2015). Stuebing et al. (1985) have listed potential preys of C. porosus in rivers of Sarawak, particularly Batang Lupar. Younger C. porosus feeds majorly on Penaeus and Caridina prawns, while larger adult diet varies from aquatic preys like fish and crabs into large terrestrial vertebrate such as tortoise, monkey or other animals that come to drink at the river’s edge (Stuebing et al., 1985).

Saltwater crocodiles especially the adults hunt their preys alone and as a nocturnal animals, they are mostly active hunting preys at night (Emerling, 2017; Evans et al., 2017). They tend to ‘sit and wait’ in shallow water or at water edge for suitable prey to come within striking distance (Caldicott et al., 2005). Sometimes, the crocodile submerges underwater to sneak near the potential prey. Once in the range the crocodile rapidly attacks the prey with powerful bite and immobilise it before it is swallowed. A large prey may be stored until it starts to disintegrate before it consumes by the crocodile (Grigg & Gans, 1993). Crocodiles swallow stones frequently but the purpose of this action or the function of the gastroliths are still unclear. Some researchers said that the stone are ingested incidentally and serve no function.

Others suggest that stones have an important role in buoyancy and digestion (Brazaitis, 1969;

Cooper-Preston & Jenkins, 1993; Grigg & Gans, 1993). It is believed that a gastrolith can remain inside the crocodile’s stomach for years.

C. porosus is highly territorial animal. Large male adult crocodiles may able to monopolize specific parts of the river that provide them with access to key resources, such as riverbanks,

23 foods and mates (Hanson et al., 2015). The crocodiles often cannot tolerate with anything that tried to trespass and they can be quite violent in defending their territories or nests during the breeding season. Crocodilians are ectothermic where they exploit the external environment to regulate body temperature through behaviours such as basking, movement in and out of water, and mouth gaping (Cooper-Preston & Jenkins, 1993). In colder months, the saltwater crocodile typically spends the morning basking under the sun. When their body became too hot, the crocodile will move into the water or sometimes they seem to noticeably avoid the sun and use the shade of mangroves when out of the water (Evans et al., 2017). In warmer months, the saltwater crocodile avoids heat by remaining in the water during the day and comes up on the banks at night, often burying itself in the mud of tidal areas. During basking, crocodile open their mouths in a behaviour called “mouth gaping” in order to reduce impact of heat on its brain (Grigg & Gans, 1993).

Ambient temperature is among the strong factor that could influence the distribution of ectothermic animals like crocodiles as the temperature affects the behaviour and physiology of crocodiles. The saltwater crocodile can tolerate with a wide range of water temperature, but the optimal temperature for crocodile is around 28 0C to 30 0C (Rodgers et al., 2015).

When the temperature is outside of the optimal range, crocodiles commonly seek to maintain body temperatures through behaviours such as basking, shade-seeking, and shifts into and out of water (Grigg & Gans, 1993). The temperature is also a determinant for breeding and nesting season. Heavy rains and rapid increase in the temperature in the late dry season to the early wet season seems to trigger reproductive activities in C. porosus (Stuebing et al.,

1985). The temperature in Sarawak is relatively uniform throughout the year with an average daily temperature ranging from 23oC during the early hours of the morning to 32oC during

24 the day, but the average temperatures could vary between SWM and NEM (Sa’adi et al.,

2017).

Whereas most of crocodilians species are found in fresh water, C. porosus occur routinely in hyperosmotic estuarine habitats and the species respond behaviourally to changes in environmental salinity. The presence of lingual salt glands in C. porosus plays a crucial role in osmoregulation that allows the species to live in saline water (Cramp et al., 2008).

Movement between marine habitat and freshwater is thought to be common in C. porosus, particularly nomadic male juveniles or female crocodiles during nesting (Campbell et al.,

2013). Although crocodile prefers to build nest in freshwater habitat, C. porosus is also able to nesting in hypo-saline habitats in estuary or coastal floodplain (Fukuda & Cuff, 2013).

Even, hatchlings of C. porosus are also able to survive and grow without access to fresh water (Cramp et al., 2008). The influence of salinity on the abundance and distribution of crocodile is also related to the waterbody habitat and riverbank vegetation. Brackish water bodies such as saline floodplain and mangroves near to estuaries are the common habitat for

C. porosus in Sarawak (Tisen & Ahmad, 2010; Sarawak Forestry Corporation, 2018), and these habitats support diverse fauna including fish, crustaceans, insects, mammals and birds

(Nagelkerken et al., 2008). Hence, a high productivity in the habitats may contribute to the higher abundance of crocodiles.

2.3.4 Historical literature about crocodile in Sarawak

Historical information regarding crocodiles in the island of Borneo, particularly Sarawak can be found in records or journals by European explorers who had visited this part of the world. Majority of them came after the arrival of an English adventurer, James Brooke in

1839 who was helping the Sultan of Brunei in quelling a local rebellion in Sarawak and later on he was awarded the territory. He then proclaimed himself as the Rajah of Sarawak and started to rule the north-western territory of Borneo. As the result of the political stability and also with the supports and invitation from the Rajah himself, soon it began to attract, among others, the natural historians, botanist and collectors of the flora and fauna came to

Sarawak.

Among the first checklist of animals in Borneo appeared in an appendix of a book published in 1848 by Hugh Low. Hugh Low, a botanist from Scotland, who was known as a person closed and admirer of Rajah Brooke wrote the checklist of animals he found during his stay in Sarawak. The species checklist listed a number of mammals, birds, fish, insects, amphibians and also reptiles (Low, 1848). Among the reptiles listed by Huge Low are two species of crocodiles, Crocodilus (Gavialis) schlegelii MÜLLER 1838 and Crocodilus biporcatus CUVIER 1807, which are later known by then name Tomistoma schlegelii and

Crocodylus porosus, respectively (Low, 1848).

In 1868, an Italian botanist, Odoardo Beccari arrived in Sarawak to collect samples for his botanical collections and during his visit, he had made some significant collections of amphibians and reptiles. In one of his trips to the interior of Borneo, Beccari had reported

26 that he found a polustrine crocodile, possibly the enigmatic and mysterious Crocodylus raninus Muller & Schlegel, 1844 (refer as Boaya Katak or frog crocodile by Beccari) in

Kanowit River (Beccari, 1904). However, he never mentioned if a specimen was actually secured.

Of all the visits by well-known naturalists to Borneo, Sir Alfred Russel Wallace perhaps is the most celebrated collector. According to Das (2004), Wallace arrived in Sarawak after his visit to Singapore on 1st November 1856 and left Sarawak on 25th January 1856. His visit to

Sarawak was recorded in his famous work, The Malay Archipelago (Wallace, 1869).

Wallace’s collecting activities in Sarawak only covered Sadong River area (Simunjan and

Sadong) and his main primary targets are insects and orang utan, also known as “Mias” in the book. From the information told by the Dayaks community in that area, Mias are very strong that no animals dare to attack them except for two, the crocodile and the phyton

(Wallace, 1869). In the book, Wallace once saw a crocodile tried to seize Mias when the animal went to seek foods on the riverbank but with his strong hands and feet the Mias was able to beat the crocodile out and killed it.

The establishment of Sarawak Museum in 1886 by Rajah Brooke that further flourished and developed much interest on studying and collecting specimens of flora and fauna in Sarawak.

It was believed that Sir Alfred Russel Wallace had influenced Rajah Brooke to establish the museum with the intention to collect and study the natural flora and fauna of Sarawak. Even after the death of the first Rajah Brooke, the Sarawak Museum continued to develop further with the encouragement of his successor, Charles Brooke and Charles Vyner Brooke (Das,

2004). They started to hire professional curators and started to publish scientific findings in

27 their own publications, the Sarawak Museum Journal. The first two curators of the Sarawak

Museum were John E. A. Lewis and George Darby Haviland (1888 to 1895) where both of them were primarily interested in botany and ornithology, hence there were not much research and information related to crocodile in the state during that time.

It was only when Edward Barlett appointed as the curator, zoological collections in the museum started to grow. He served with the Sarawak Museum only for two years from 1895 to 1897. His most important contribution was a 24 page accounts of crocodiles and lizards of Borneo and all the specimens that he collected were deposited in the Sarawak Museum

(Bartlett, 1895). Interestingly in his paper, he listed a large number of lizard species that can be found in Sarawak which eight of them described as new species. While for crocodile, he listed two species similar to what had been described by Low (1848) earlier, Crocodylus porosus and Tomistoma schlegelii, but in his writing, Bartlett described further details about the distribution of the crocodiles in Sarawak during that time. According to Bartlett (1895),

C. porosus can be found abundantly along the sea coast and in all rivers of Borneo while T. schlegelii was only restricted to the estuary and Sadong River. He also had mentioned about

Crocodylus polustris which was reported to be found in some parts of Sarawak, but he did not find any physical difference from the specimens in the museum. One specimen of C. porosus from Baram River and one specimen of T. schlegelii from Sadong River were kept in the Sarawak Museum (Bartlett, 1895).

Besides attracting explorers and collectors from Europe, the richness in nature and biodiversity found in Borneo had also attracted explorers from the American continent.

Among the early American collector who came to Borneo was William Temple Hornaday.

Arrived in Sarawak in 1878, Hornaday concentrated all his collecting activities only in

Sarawak (Hornaday, 1885), with his primary targets were orang utan, crocodiles, amphibians and reptiles. Hornaday expressed a great interest in crocodilians and one of his specimens now kept in the Museum of Comparative Zoology, Harvard which was believed to be a specimen of Crocodylus raninus. Although this specimen was retrieved by Hornday from an unknown Borneo locality, but many presumed that the specimen was collected in

Sarawak. In his journal book, Hornaday told a story in his book about the Brooke government waging a war to exterminate crocodiles specifically species C. porosus that infested all the rivers of Sarawak and had been terrorizing people (Hornaday, 1885). During that time too, Hornaday found out that true gavial (T. schlegelii) was growing to a great size in the Sarawak River and the Rajang River. He also obtained a very large skull from the upper Sarawak River, which he described as much rarer than the other, but did not succeed in securing a fresh specimen.

2.3.5 Threats and conservation

When CITES was established and came into force in 1975, all populations of the saltwater crocodile (C. porosus) were listed in Appendix II. However, in 1979, global population of

C. porosus was shifted from Appendix II to Appendix I in the CITES except for those in

Papua New Guinea, on the grounds that the species was at risk of imminent extinction due to excessive harvesting and trade of wild crocodiles (Jalden, 2004). Few years later, in 1985, populations of C. porosus in Australia and Indonesia had been recovering and these countries had successfully down listed back their C. porosus population from CITES Appendix I into

Appendix II. Recently in 2016, proposal to transfer the C. porosus in Malaysia from

Appendix I to Appendix II, with wild harvest restricted to the state of Sarawak and a zero quota for wild specimens for the other states of Malaysia (Sabah and Peninsular Malaysia) had been approved by the CITES (Sarawak Forestry Corporation, 2018). The International

Union for Conservation of Nature and Natural Resources (IUCN) Red List of Threaten

Species also had been categorized C. porosus as lower risk / least concerned due to the news on the recovery of this species in several countries.

Saltwater crocodile populations in Sarawak was once seriously depleted due to unregulated hunting and overexploitation in the late 1980’s, primarily for their lucrative hide and meat

(Cox & Gombek, 1985). Hunting and killing of crocodiles were started back during the time when Sarawak was governed by the White Rajahs. At that periods of time, crocodiles had been a big problem to the Brooke’s government and the animals were considered as vermin, due to the terror that are brought by the reptile as they had killed many people in Sarawak.

Therefore, the government at that time encouraged the locals in Sarawak to hunt and kill the crocodile and offer rewards for those who brought the animal to the government (Hornaday,

1885).

The booming of tanning industry especially after the World War 2 (WWII) had increased the demand for crocodile skins globally (Thorbjarnarson, 1999). As the result, crocodiles hunting in Sarawak increased as the local hunters ran for the well-paid offers by the hide companies for the crocodile skins. Crocodile hunting activities in Sarawak are believed to reach its peak in between 1954 to 1964 and during that period, it was estimated that more than 80,000 crocodiles were killed and on average more than 10,000 skins were exported from Sarawak every year (Cox & Gombek, 1985). At that time, skins export from Sarawak

30 were tax exempted, hence attracted more companies including those from outside Sarawak to involve in hide industry in the state, eventually resulted in the increasing hunting activities. Besides hunting for skin, crocodile’s hatchlings and eggs were taken by the locals from their nest and sold to crocodile farms.

Thereafter, the effect of unregulated hunting and overexploitation rapidly manifested themselves. Surveys by Cox and Gombek (1985) in several major rivers and their tributaries in Sarawak had recorded only 56 sightings of crocodile from 1,043 km survey distance, revealing a very low density of crocodiles, ranging from 0.014 to 0.231 individual/km. In three of the rivers surveyed, there was no sighting of crocodile at all. In response with the depleting number of crocodile populations in Sarawak, the state government has listed both species of crocodiles, C. porosus and T. schlegellii, as protected animals under Wild Life

Protection Ordinance 1990 in conjunction with the listing of the animals into the Appendix

I of CITES. After the law being introduced to protect the crocodiles, conservation efforts were carried out by the relevant agencies in the state and among them by illegalise any hunting or selling activities related to crocodiles. The government also helps the former crocodile hunters in finding other jobs to support themselves and their families.

After three decades protected by the law, crocodile populations in Sarawak are recovering and several rivers in the state recorded a marked increase in the density of crocodile compared to survey result in 1985 (Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Robi,

2014; Zaini et al., 2014). Comprehensive surveys by the relevant agencies from 2012 to 2014 reported that there were estimated more than 13,000 crocodiles live in over 40 rivers in

Sarawak (Sarawak Forestry Corporation, 2018). However, the recovery of crocodile

31 population has resulted in a marked increase in conflict between human and crocodile (Tisen et al., 2013).

In recent years, hunting pressure is not the major threat to crocodile populations in Sarawak, instead they are facing greater threats as the reptile have come increasingly into conflict with human because of their need for undisturbed nesting and foraging habitats (Lading, 2013).

Growing human population especially in riverbank areas has contributed to the increasing encounters between human and crocodile, frequently lead to crocodile attacks on human. As the response to the attack incidents, culling activities had been carried out by the related government agencies. In the efforts to find the culprit, sometimes, large number of crocodiles were taken out from the river to ease public concern and to ensure the safety of surrounding community. In some cases, the relatives of the victim are taking the matter into their own hands by hunting the crocodile using any available methods. These untrained hunters are not only endangered themselves but also could result in the death of younger crocodiles which are most likely not responsible for the attack.

Residential developments and land clearing for plantations areas that has been expanded in riverbank areas could contribute to potential loss of riparian vegetation, hence destroy natural habitats and nesting areas for crocodiles. Furthermore, constant encroachment into crocodile habitat and high impact land use could indirectly affect the ecology of the rivers, hence change the nature of the waterways (Fukuda et al., 2008). Man-made drainage system for residential area and also water gate for the agricultural purpose could alter the dynamic of water flow, leading to habitat fragmentations and at the same time could cause pollution to the rivers as sewage are most likely be discharged into the waterways. Dam construction

32 on water streams has blocked seasonal migration of aquatic species, hence limit the potential food sources for the crocodile (Martin, 2008). Heavy pour of rain in monsoonal season in

Sarawak could increase the water level inside the dam, thus when it reaches the limit capacity, the dam will discharge the excess water consequently increase the water level in lower part of the river (Sa’adi et al., 2017). Flood water could destroy crocodile nests and kill their eggs.

Increasing in human population and tourism activities near the river eventually lead to more human activities like bathing, swimming and fishing to happen along the river during the day and night. In addition, more people are using boats to travel from one place to another, hence increase the traffic in the rivers. All these disturbances could affect the behaviour of the crocodile (e.g., increase wariness or aggressiveness of crocodile) and also could drive the animals away from the rivers (Webb & Messel, 1979; Grant & Lewis, 2010; Fukuda et al., 2015). Meanwhile, expanding in the fishing activities could endanger crocodiles as nets that are abundantly setup along the river could trap crocodiles especially the younger ones.

These crocodiles will end up dead entangled on the nets or kill by the fishermen (Shaney et al., 2017).

2.3.6 Ecological and social importance of crocodiles

For centuries, the local people in Sarawak have been living side by side in harmony with the crocodiles in riverine areas. The reptiles play parts in the oral tradition and custom of indigenous tribes in Sarawak (Datan et al., 2012). Therefore, they are respected by the native communities, and some still regard crocodiles as their protectors, hence the animal should

33 not be disturbed or killed (Ritchie & Jong, 2002). There is a taboo among the people in

Sarawak saying that if a crocodile was disturbed or killed, it will come back to inflict revenge on human. The story about the mighty Bujang Senang, a huge saltwater crocodile that has a white stripe on its back and who is said to be responsible for numerous of attacks towards local peoples and livestock in Batang Lupar in 1980’s and 1990’s, had been used to justify the taboo. In May 21, 1992, a woman from the Iban ethnic had become the victim of this crocodile in a tributary of Batang Lupar. A day after the attack, a group of police snipers and

Iban hunters successfully killed the crocodile after hours of struggling due to the ability of the crocodile to dodge harpoons and bullets aim for it (Ritchie & Jong, 2002). The story had become household words among the local people in Sarawak and some still believe that crocodile attacks happened afterward were inflicted by the descendant of the Bujang Senang

(Ritchie & Jong, 2002).

Ecologically, crocodiles play key roles as an apex predator at the top of the food chain, thus they help in guarding the balance in the complex web of life in wetland ecosystems by feeding on wide range of prey (Hanson et al., 2015). The crocodiles also help in raising genetic quality and keeping the ecosystem healthy by feeding on weak, sick and injured animals. When a wetland habitat is healthy, the fishery is considered to be healthy too. It has been claimed that the presence of crocodiles had brought positive impact on fisheries by feeding on predators of commercially valuable fish such as catfish, turtle, water birds and others (Whitaker, 1984).

Crocodiles also play important roles in boosting the economy of the local community through eco-tourism. The eco-tourism activities like wildlife-viewing have become popular

34 globally especially among new generation as people will be able to experience the thrill watching wild animals closely in their own habitats. The presence of crocodiles in rivers in

Sarawak could be utilized by the local community to generate income, as example through crocodile watching activities (Hassan et al., 2018). There are two crocodile farms currently operated in Sarawak, Jong’s Crocodile Farm (in Kuching) and Miri Crocodile Farm (MCF) own by a private company, Benaya Sdn. Bhd. Both of the farms are registered with CITES, once primarily for the purpose of the crocodile skins production and exported to other countries, but now majorly involved in tourism and in situ conservation as they now offer a wide range of experiences from watching crocodiles in captivity, crocodile feeding demonstration, research/educational displays as well as selling souvenirs to visitors.

2.4 Human-crocodile conflicts (HCC)

During the 1950’s to 1980’s, global crocodilian species are exposed to extinction due to overexploitation and habitat loss (Martin, 2008), but protection by the international and countries laws along with the implementation of effective conservation programs have seen some populations in several countries achieve extensive recovery (Platt & Thorbjarnarson,

2000; Mazzotti et al., 2007; Fukuda et al., 2011; Balaguera-Reina et al., 2017). Recovery of the crocodile’s populations had brought along a new set of problem, increasing in negative interactions between people and crocodilians (human-crocodile conflicts, HCC) (Webb,

2008). Thus, this situation urges the crocodile managements in finding solutions to tackle the growing problem by collecting and analysing crocodile attacks data as the data could inform the managements about the HCC trends as well as helping them in formulating ways to mitigate attacks of crocodile on people (Sideleau et al., 2016).

While HCC have become an increasing issue, numerous attacks by crocodilians go unreported or are poorly documented in many countries where crocodilians are distributed

(Sideleau & Britton, 2013). Analysis of attacks by American alligators (Alligator mississippiensis) are well documented, although fatal attacks by the crocodile species are uncommon due to their smaller size and more passive nature compare to other crocodilian species (Langley, 2010; Woodward et al., 2014). On the other hand, more aggressive crocodile species such as Nile crocodiles (Crocodylus niloticus) and saltwater crocodile (C. porosus) are responsible for much higher fatality of human compared to the rest of crocodilian species. It is estimated that 494 attacks by C. porosus were reported worldwide in between January 2008 to July 2013, resulting in 285 fatalities, meanwhile, 428 attacks resulting in 309 fatalities were attributed to C. niloticus during the same period (Sideleau &

Britton, 2013). Based on combine attack data for both species, it was found out that C. niloticus and C. porosus had been responsible for almost 75% of all reported crocodilian attacks and 88% of all reported crocodilian fatalities around the world.

Statistics of attacks on humans by crocodilians have been documented reasonably well in several countries in the last few decades. In Australia, crocodile attacks from different parts of the country including in Northern Territory and Queensland, were analysed in detail by researchers and the data had been helpful for crocodile management in the country (Fukuda et al., 2014; Brien et al., 2017). Moreover, attacks data from other countries were also had been analysed and documented including in African nations such as Mozambique, South

Africa and Swaziland, and also Asian countries like Iran, Indonesia, Timor Leste, India and

Sri Lanka (Dunham et al., 2010; Pooley, 2014; Stevenson et al., 2014; Amarasinghe et al.,

2015; Ardiantiono et al., 2015; Sideleau et al., 2016; Das & Jana, 2018). Meanwhile, in

Malaysia particularly in the state of Sarawak where most of the crocodile attacks occurred, there is still lack of proper analysis on the HCC, although several studies had documented attacks data that occurred in recent years (Lading, 2013; Tisen et al., 2013; Abdul-Gani,

2014). By analysing the crocodile attacks data, researchers will be able to understand the pattern of attacks including hotspot areas, peak time or month of the attacks, victim’s gender and age group as well as activities that associated with high risk of attack (Caldicott et al.,

2005).

2.5 Population ecology of crocodiles

Increased HCC may be related to the increasing and expanding of crocodile populations as well as the growing human populations, urbanisation and encroachment by humans into crocodile habitats (Webb, 2008). Fukuda et al. (2008) had examined the broad-scale influences of the environment and anthropogenic pressures on the contemporary population abundance of C. porosus in northern Australia. Their study identified several factors as most likely to influence the abundance and distribution of C. porosus, among them are temperature, salinity, riverbank vegetations, riverbank land-use and human population density (Fukuda et al., 2008).

Human population and riverbank land-use are among the factors that have adverse impact on the distribution and abundance of crocodiles. It is thought that increasing in human population contributed to the increasing activities (e.g., tourism, fishing, boating etc.) in the waterbodies and also lead to riverbank clearing for residential, industrial and agricultural developments (Fukuda et al., 2008). Several studies suggested that these anthropogenic

37 pressures appeared to keep the crocodile population low in the waterways. For example,

Read et al. (2004) suggested that intensive development and clearing of riparian vegetation corridors for agricultural, pastoral and urban expansion had contributed to the low densities of crocodile in Queensland, Australia. In Indonesia, a study by Shaney et al. (2017) found out that the abundance of both crocodiles species in the country, C. porosus and T. schlegelii, is correlated negatively with proximity to humans, even though C. porosus still could be spotted in disturbed areas. They also claimed that common fish-trapping methods had contributed to the less abundance of crocodiles in the waterbodies. Similar situation also had been reported in Thailand where widespread fishing activities had affected the density and abundance of the Siamese Crocodile, C. siamensis (Kanwatanakid-Savini et al., 2012).

Meanwhile in Sarawak, degradation of rivers due to the expansion of human population and intensive usage of the river for fishing and transportation are among the contributing factors to the depletion of wild crocodile population in 1950’s to 1980’s (Cox & Gombek, 1985).

Furthermore, constant encroachment into crocodile habitat and high impact land use could indirectly affect the ecology of the rivers, hence change the nature of the waterways.

Pollution from industrial and agricultural activities could change the quality of water in the rivers by increasing its acidity and the addition of chemical that could be harmful to the crocodiles and their eggs. A study by Woodward et al. (2011) shows that there was negative effect of pesticide pollution from agricultural activities towards the poor reproductivity of

American alligator (Alligator mississsippiensis) in Florida, USA. Furthermore, the environmental pollution could also affect the abundance of preys for crocodile, hence drive them away from the waterbodies.

2.6 Population genetics and its importance

Population genetics is the study of genetic variation within and among the populations, and it involves the examination and modelling of changes in the frequencies of genes and alleles in populations over space and time (Keats & Sherman, 2013). Population genetics study also enable us to understand the evolutionary factors that might cause the genetic variation. The variation in genes or alleles is found throughout the genome, and by examining this genetic diversity, evolutionary patterns can be inferred. Genetic variation within the populations and species can be analyzed at the level of nucleotide sequences in DNA (genome analysis) and the amino acid sequences of proteins (proteome analysis). This can now be done through automated technology designed for genotyping and sequencing the genome and analyze using bioinformatic software in computer. With the help of the technologies, population geneticist is able to map and examine genetic variation within and among the populations with histories of bottlenecks, admixture, and migration, and for advancing understanding of wildlife (Keats & Sherman, 2013).

Management and conservation of wildlife are predicted to be more efficient with the incorporation of population genetic information of the species (Shafiei-Astani et al., 2015).

Assessment of genetic diversity in wild population is an important step for better understanding of the population structure and demography history, mainly through application of genetic markers. The use of genetic markers to obtain data on genetic variation is valuable for the species management as high genetic variation within a population reflects a healthy population and the species is more adaptive to environmental changes, but if otherwise, low genetic variation could lead to extinction of the species (Shafiei-Astani et al.,

2015). Genetic markers has been used to evaluate population structure and historical information of numerous species of animals as well as elucidate their geographical distribution (phylogeography) (Maltagliati et al., 2010; Zainudin et al., 2010; Gehring et al.,

2012).

2.7 Genetic studies of crocodiles

For crocodilians, several common types of genetic markers had been used in genetic studies such as mitochondrial DNA (mtDNA) and Short Sequence Repeats (SSRs) or also known as microsatellite. However, the selection of microsatellites markers for population genetics is preferred, since they are known to have high mutation rates that lead to higher allelic variability and high levels of polymorphism. Microsatellite markers are ubiquitous in most eukaryote genomes and provide hyper-variable sequenced tagged single locus markers which capable of providing relatively contemporary estimates of migration and relatedness among individuals (Miles et al., 2009a). For these reasons, the markers have been widely used by many researchers to assess population structure and diversity, mating behaviour, hybridisation, as well as dispersal systems, in a variety species of crocodile (Isberg et al.,

2004; Lewis et al., 2013; Hekkala et al., 2015; Lapbenjakul et al., 2017; Mauger et al., 2017).

At the same time, a sufficiently large source microsatellite primers for various species of crocodiles had been constructed for research purposes and have facilitated many researches on crocodilians genetic studies. Miles et al. (2009a) developed 253 novel polymorphic microsatellite markers derived from the saltwater crocodile (C. porosus), and the markers had successfully tested for cross-species amplification in 18 other species of crocodiles

(Miles et al., 2009b). Since then, the markers had been used by researchers for genetic studies in much less known crocodilian species such as T. schlegelii. C. rhombifer and C. intermedius (Bashyal et al., 2014; Shafiei-Astani et al., 2015).

In Sarawak, although several genetic studies have provided some clues about the population structure of C. porosus, however these aspects remain unclear. Studies using Cytochrome b and 12S Ribosomal gene were unable to resolve genetic structure among population from different areas in Sarawak (Shoon, 2009; Abdullah, 2010). Further analysis then utilized nuclear gene markers such as randomly amplified polymorphic DNA (RAPD) and microsatellite, and successfully identified genetic differentiation in saltwater crocodile sample from Miri, Sibu and Bako (Kasim, 2011; Sulaiman, 2011). However, Sulaiman

(2011) and Kasim (2011) only used small sample size (one or two samples from each locality), hence the result might be less reliable. Meanwhile, a recent study by Abdul-Gani

(2014) used more samples from localities representing western (Bako), central (Sibu) and northern (Miri) part of Sarawak and able to map genetic structure among the populations using microsatellite genes. However, there are questions about the genetic of crocodile populations in areas in between the three parts of the state. Population genetic analyses of crocodile populations in the three parts of Sarawak reveal genetic bottlenecks that had been occurred in the populations, probably due to overexploitation in 1950’s to 1980’s and also high gene flow among the population, suggesting frequent migration of the reptile throughout the state (Abdul-Gani, 2014).

CHAPTER 3

REVIEW OF CROCODILE STATUS AND HUMAN-CROCODILE CONFLICTS

IN SARAWAK FROM 1900 UNTIL 2017

3.1 Introduction

Crocodiles have been long living in rivers of Sarawak even before the arrival of James

Brooke. This can be proven by the presence of ‘Baya Tanah’, crocodile’s effigies or earthen crocodile replicas, found in Engkilili, Skrang, Kanowit and Kapit. These effigies are believed to be between 50 to 200 years old (Datan et al., 2012). The Baya Tanah played an important role in the lives of native Iban farmers in the past, who held ‘mali umai’ ceremony

(ritual at paddy farms) in October or November each year. The main purpose for the construction of the Baya Tanah is for the protection of the paddy farms against pests, rodents and locusts. Crocodiles are regarded as special animals by the Ibans, especially those who are still practising traditional beliefs. It is believed that the spirits of crocodiles will arise and devour all the pests in the paddy field after the ‘mali umai’ ceremony and the Ibans are not allowed to leave their longhouses for three nights as the spirit will harm them if they do so

(Datan et al., 2012).

However, the earliest documentation and the historical information regarding crocodile in north-western of Borneo or Sarawak only came after the territory rule by the first White

Rajah, James Brooke. After Sarawak had been awarded to him in 1841, the Englishmen brought peace and political stability to the state by ending the resistance and piracy (Baring-

Gould & Bampfylde, 1909). Soon it began to attract, among others, the historians, botanists

42 and collectors of the flora and fauna to come to visit Sarawak. A number of famous explorers cum naturalists also had been invited and welcomed with great hospitality by the Rajah himself to see the richness of biodiversity in Sarawak (Low, 1848; Wallace, 1869). Many explorations by these collectors had been mentioned in The Sarawak Gazette, however not much in details being provided as what had been written by the explorers in their books.

Charles Brooke, the second Rajah of Sarawak had established The Government Printing

Office of Sarawak in 1870 and one of its first publications was The Sarawak Gazette. This publication was intended to promulgate the Rajah’s orders and reports from outstation officers. The first issue of Sarawak Gazette was on 26th August 1870, with only three pages leaflet. Later in late 1800’s, this publication had increased in the number of printed pages as many other issues and news being reported including matters related with administrations, trade, agriculture, sport, law, commodity prices as well as reports from each division in

Sarawak. The Sarawak Gazette was an essential source of historical information on Sarawak affairs, but the publication was suspended during the Japanese occupation (1942 until 1946).

Information on crocodiles in Sarawak can be found in the Sarawak Gazette such as crocodile skin trade, bounty payment for killing crocodiles and cases of crocodile attacks on people.

Thus, this chapter examine the information on crocodiles from the year 1900 until 2017, gathered from the Sarawak Gazette and other sources. The information is valuable to assess the historical distribution of crocodile in Sarawak as well as to investigate the possible expansion of the animal in the major river basins in the state. In addition, analysis of crocodile attacks in Sarawak could identify trends of human crocodile conflicts (HCC) in the state which could provide clues for formulating ways to solve the HCC in the future.

Therefore, the objectives of this chapter are;

i. To gather and examine the historical information on crocodile in Sarawak including

the exploitation of the animal and conflicts between human and crocodile from the

year 1900 to 2017.

ii. To analyze data on crocodile attacks incidents in Sarawak from the year 1900 to

2017.

3.2 Materials and Methods

3.2.1 Study area

Sarawak is one of the two Malaysian states located in the north-western part of the Borneo

Island, the third largest island in the world. The state of Sarawak is neighbouring with another Malaysian state in Borneo, Sabah and the state also bordering to a small nation of

Brunei and an Indonesian province of Kalimantan (Figure 3.1). Sarawak has an area of

124,450 square kilometers (km2), located immediately north of the equator between latitude

0º0’ and 5ºN and longitude 109º 36’ and 115º 40’. The coastal line of Sarawak stretches over

700 km along the north-eastern coast of the island of Borneo and the inland is generally over

300 m above sea levels with certain areas exceeding 1,200 m, particularly the mountainous area in central region of the Borneo that form border between Sarawak and Kalimantan.

Sarawak has a tropical rainforest climate, with annual rainfall ranging between 3,300 mm near the coastland and 4,600 mm further inland (Sa’adi et al., 2017). Average temperature in Sarawak is around 26 ºC, but it can vary according to location. Highland areas like Bario

44 in north-eastern corner of Sarawak where the place lying at an altitude of about 1,100 m above sea level, the temperature in that place is a bit lower. The state experiences two monsoonal seasons (Northeast and Southwest monsoons) and two shorter periods of inter- monsoon seasons. The Northeast monsoon (NEM) is more prominent because of the sudden surge in the rainfall amounts, which typically occurs from months of November until March.

Meanwhile, the Southwest monsoon (SWM) extends from April to September is on the contrary associated with relatively dry period and less rainy days during the active monsoon months. The inter-monsoon periods occur during the transition between the two monsoon seasons and it usually happen in April and October respectively (Sa’adi et al., 2017). Despite the monsoon seasons, the climate in Sarawak remains fairly stable with rain occurrence throughout the year.

As the largest state in Malaysia, Sarawak has a vast area of waterways, comprising of 22 major river basins that originating from highland in the centre of Borneo and flow across the state into South China Sea (Figure 3.1). Out of all river basins in Sarawak, two river basins have a distance more than 500 km in length including Rajang River which is the longest river in Malaysia (Table 3.1). Another important river basin in Sarawak are Samarahan,

Sarawak River, Sadong, Lupar, Saribas, Baram and Limbang. There are also large number of tributaries, mangrove and peat swamp areas that are linked to the major river basins throughout Sarawak such as Kuching wetland in Sarawak RB and Belawai mangroves delta in Rajang RB.

Table 3.1: List of river basins in Sarawak, its main river and approximate length (Tisen & Ahmad, 2010).

No Basin Main River Length, km

1 Kayan Batang Kayan 125 2 Sarawak Sungai Sarawak 120 3 Samarahan Batang Samarahan 115 4 Sadong Batang Sadong 150 5 Lupar Batang Lupar 275 6 Saribas Batang Saribas 160 7 Krian Sungai Krian 120 8 Rajang Batang Rajang 760 9 Oya Batang Oya 240 10 Mukah Batang Mukah 205 11 Balingian Batang Balingian 160 12 Tatau Batang Tatau 270 13 Kemena Batang Kemena 190 14 Similajau Sungai Similajau 65 15 Suai Batang Suai 130 16 Niah Sungai Niah 105 17 Sibuti Sungai Sibuti 80 18 Baram Batang Baram 635 19 Limbang Sungai Limbang 275 20 Trusan Batang Trusan 205 21 Lawas Batang Lawas 75 22 Miri Sungai Miri 56 *“Batang”, refer as a large river by local people in Sarawak.

Sabah Brunei

Sarawak

Kalimantan (Indonesia)

Figure 3.1: Map of river basins in Sarawak (Map modified from Official Website of Department of Irrigation and Drainage Sarawak, 2017).

3.2.2 Information gathering and analyses

The Sarawak Gazette was published on monthly basis except from 1908-1920 whereas it was published twice monthly. It contained source materials on economic history, coastal trade returns, commodity prices, agricultural information, mineral and oil production statistics, anthropology and archaeology. The publications of Sarawak Gazette were suspended during the war time (Japanese occupation) in 1942. The Sarawak Gazette resumed its publication after the end Japanese occupation in 1946 and the publication still continue until now. However, since the transition of administration from the Brooke Government to

Crown Colony and later, forming Malaysia with Malaya and Sabah in 1964, the Sarawak

Gazette had changed and now it covers various topics and events that occurred in Sarawak including government and administration, district annual reports, travelling reports, confrontation and the emergency period, development, peoples and culture, history, towns, education, agriculture, medical and health, natural history and wildlife, environment and forestry, tourism, sports, music, law, aspects of religious life and perspectives from the young. Due to strong competition with other media, today the role of The Sarawak Gazette as mass media had become less important.

In this study, a total of 613 volumes of the Sarawak Gazette publications from 1900 to 1941 were examined in the Sarawak Museum archive. Certain volumes, from 1907 to 1941 (not all available), can also be accessed online through e-Sarawak Gazette website

(http://www.pustaka-sarawak.com/gazette/home.php). However, the Sarawak Gazette volumes for the years 1923, 1930 and 1940 were absent (not available in the Sarawak

Museum archive). All the volumes were read thoroughly and information regarding crocodiles in Sarawak were collected and recorded.

Besides the Sarawak Gazette, the information on crocodile in Sarawak especially crocodile attacks incidents were accessed from other sources such as records kept by local agencies, publications like books and journals, media (newspapers, online news and social media platform) and through an online database known as CrocBITE (http://www.crocodile- attack.info). The CrocBITE is an online database of recording attacks by crocodilians on humans worldwide, developed by researchers from Charles Darwin University. The main goal of the database is to improve understanding on the crocodile attacks trend for safety of humans as wells as to assist conservation of crocodilians by providing data for research purpose. New cases of crocodile attacks are being added to the database by contributors, mostly officials or researchers from the countries or regions where the attacks occurred.

Information related to crocodile in Sarawak from 1900 until 2017 was divided into four periods of time as in Table 3.2.

Table 3.2: Periods of time and sources of information on crocodile in Sarawak from 1900 until 2017.

Years Period Sources 1900 – 1941 White Rajahs era • Sarawak Gazette • Books, journals, e.g.: i) Two years in the jungle. The experiences of a hunter and naturalist in India, Ceylon, the Malay Peninsula and Borneo by Hornaday (1885) ii) My Life in Sarawak, by The Ranee of Sarawak by Brooke (1913) iii) A History of Sarawak under its Two White Rajahs, 1839-1908 by Baring-Gould and Bampfylde (1909)

1946 – 1979 Post-war period • Sarawak Gazette • Books, journals, e.g.: i) A preliminary survey of the crocodile resources in Sarawak, East Malaysia by Cox and Gombek (1985) ii) Man-eating Crocodiles of Borneo by Ritchie and Jong (2002)

1980 – 1999 Period when wild • Reports from crocodile management agencies crocodile (e.g., SFC, FDS) populations depleted • CrocBITE database and the law was • Books, journals e.g.: introduced to protect i) A preliminary survey of the crocodile them from hunting resources in Sarawak, East Malaysia by Cox and Gombek (1985) ii) Man-eating Crocodiles of Borneo by Ritchie and Jong (2002)

2000 - 2017 Millennia era • Reports from crocodile management agencies (e.g., SFC, FDS) • CrocBITE database • Online and mass media (newspaper, online news portal etc.)

All incidents of crocodile attacks reported in Sarawak from 1900 until 2017 were compiled into database created in Microsoft Excel. The details of the victims were collected when available including their sex, age, activity of victim during the incident, time of attack, and outcome from the attack incidents (fatal or non-fatal). Geographic information such as location and river basin where the incident happened as well as the month when the attack occurred were determined from the sources. Information on the tide of the river when the incident occurred were collected from the sources, but if the information was absent the tide was estimated from the Sarawak tide tables (2000 to 2017) based on the time and locations of the attacks. For attacks that occurred at night from year 2000 to 2017, information about moon phase on the date of the incidents were also collected from website

(https://www.timeanddate.com/moon/malaysia/kuching) and the Sarawak tide table. The moon phase was defined as four moon phases of seven-day period blocks. For instance, a

`new moon' phase was defined as the period from three days prior to new moon to three days after new moon. A similar seven-day block was used for full moon, first and third (last) quarter of moon. All the incidents were considered unprovoked attacks and only attacks confirm caused by the crocodile were included in this analysis.

Minitab 17 (Minitab Inc., USA) and OriginPro 9.0 (OriginLab Corporation, USA) were used in this study for statistical analyses and preparation of figures based on the attack data. For statistical analyses, crocodile attacks were grouped into 10-year periods between 1900 and

2017, except for 2010 – 2017, grouped as one period. Then, the average attack per years

(mean attacks) was calculated in each period and plotted in a graph along with standard deviation. The trend of the crocodile attacks in Sarawak from 1900 until 2017 were examined by fitting linear regression to the mean attacks (average attacks per year) for each period

(Fukuda et al., 2014). Statistical analysis of T-test and ANOVA were used to compare variation of attacks in between river basin and months as well as to compare mean attacks between two monsoon seasons (SWM and NEM). Chi-square tests of independence (χ2) were applied to see whether moon phase and tidal cycle had influence on frequency of crocodile attacks in Sarawak using Minitab 17 (Minitab Inc., USA).

3.3 Results and Discussion

3.3.1 White Rajah era (1900-1941)

During the reign of Rajah Brooke in Sarawak, crocodiles were considered as pest by the government. William Hornaday, an American collector, in his book told stories about the government waging a war of extermination against crocodiles specifically C. porosus that infested all the rivers of Sarawak territory and had terrorized people during his visit to

Sarawak (Hornaday, 1885). According to him, in 1878 alone a total of 266 crocodiles had been caught from Samarahan River and Sarawak River (Hornaday, 1885). The Ranee of

Sarawak, Margaret Brooke also mentioned in her book about the numerous loss of life caused by crocodile and she herself experienced the terror of the creature as a man was attacked in front of her eyes (Brooke, 1913).

To encourage people in Sarawak to catch crocodiles, the government offered rewards for every crocodile that had been captured (Baring-Gould & Bampfylde, 1909). In order to claim the reward, each crocodile that had been captured or killed must be brought to the government or they must provide the crocodile’s skin (from back of its head to the end of its

52 tail) as proofs. The government will measure the crocodile or the skin and for each foot

(approx. 30 cm), they will pay 36 cents. In addition, the government also paid money to people that brought crocodile eggs to them. Extra rewards were given for those who had successfully captured crocodiles that were responsible for attacking people.

Table 3.3 shows the number of crocodiles and eggs that have been brought to the government and amount of money paid for bounty from 1901 to 1907. There is no specific detail on species of crocodile in the reports, however it is believed that the crocodiles were C. porosus.

It was estimated that at least 1,244 crocodiles and 187 eggs were brought to the government from 1900 to 1907. There is an increase trend in terms of number of crocodiles captured at that period of time, except from 1903 until 1905, where the number dropped from 181 crocodiles and 36 eggs to 121 crocodiles and 29 eggs. The data also shows contrast trends between the number of crocodiles captured with the cumulative measurement of the crocodile, as well as the amount of reward money in certain years. As an example, in 1901, a total of 124 crocodiles were presented to the government with cumulative measurement of

721’4” and total bounty of S$ 259.68, while in 1902, higher number of crocodiles were brought in, 133 crocodiles, but with less cumulative measurement (664’14”) and total bounty

(S$ 239.46). This data suggest that a higher number of large crocodiles were caught in 1901 compared to in 1902. This document evidently shows a relatively large number of crocodiles was taken out from the rivers during that time. The amount of money spent by the Brooke government to pay local hunter for catching crocodile in Sarawak from 1901 to 1907 were estimated to be around MYR 268,245.05 to MYR 610,935.36 in current day currency.

Table 3.3: Number and measurement of crocodiles and eggs brought to the government and amount of bounty paid (extracted from half year report in Sarawak Gazette, 1901- 1907).

Year Number of Cumulative Amount of Value in current crocodiles / measurement, money day (estimation), eggs collected inches paid, S$*a MYR*b January-June 1901 70 crocodiles 358’3” S$128.97 MYR167,652.15 July-December 1901 54 crocodiles 363’1” S$130.71 MYR171,634.20 Total 1901 124 crocodiles 721’4” S$259.68 MYR341,006.81 January-June 1902 61 crocodiles 327’6” S$117.90 MYR154,817.86 July-December 1902 72 crocodiles 337’8” S$121.56 MYR159,611.19 Total 1902 133 crocodiles 664’14” S$239.46 MYR314,471.50 January-June 1903 101 crocodiles 472’11” S$170.25 MYR221,172.54 July-December 1903 98 crocodiles, 514’2” S$185.79 MYR241,389.34 23 eggs Total 1903 199 crocodiles, 986’13” S$356.04 MYR462,589.95 23 eggs January-June 1904 123 crocodiles 564’10” S$203.34 MYR264,207.44 July-December 1904 58 crocodiles, 335’5” S$121.11 MYR157,355.36 36 eggs Total 1904 181 crocodiles, 899’15” S$324.45 MYR421,552.22 36 eggs January-June 1905 59 crocodiles 269’0” S$96.84 MYR125,831.74 July-December 1905 62 crocodiles, 302’1” S$109.62 MYR142,432.62 29 eggs Total 1905 121 crocodiles, 571’1” S$206.46 MYR268,245.05 29 eggs January-June 1906 70 crocodiles 322’9” S$116.19 MYR150,968.56 July-December 1906 143 crocodiles 394’4” S$141.96 MYR184,457.00 Total 1906 213 crocodiles 716’13” S$258.75 MYR336,204.24 January-June 1907 162 crocodiles, 707’6” S$256.20 MYR329,333.81 50 eggs July-December 1907 111 crocodiles, 604’11” S$219.09 MYR281,636.99 44 eggs Total 1907 273 crocodiles, 1311’17” S$475.29 MYR610,935.36 99 eggs 1,244 5,868’77” S$2,120.13 MYR2,755,005.13 TOTAL 1901-1907 crocodiles, 187 eggs *a S$, Sarawak dollar, the currency used in Sarawak at the period of time. *b Estimations for value of bounty paid in current day were calculated using United Kingdom (UK) Inflation Calculator website (https://www.officialdata.org/1900-GBP-in-2017?amount=1) based on formula by UK Office for National Statistics (2019). Currency exchange for Sarawak Dollar (S$) and British Pound (£) at the period of time (1901-1907) were based on information by Kemmerer (1904). Currency converter website (https://www.xe.com/currencyconverter) was used for converting the current value from British Pound (£) to Malaysian Ringgit (MYR).

Rewards for catching crocodiles had attracted many people in Sarawak to involve in hunting the reptile, which led to the bloom of professional crocodile catchers. Crocodile catchers in

Sarawak were known as Pengalir or crocodile charmer, as most of them use some sort of chanting alongside with tools such as hook or trap to captured crocodile (Cox & Gombek,

1985). Some of the professional crocodile catchers were very good in their work and they could capture up to 60 crocodiles in a month (Sarawak Gazette, July 1, 1929). Crocodile hunting activities in the early 1900 were mainly occurred in Samarahan, Lupar, Sadong,

Krian and Bakong rivers. The Brooke government during that time sometimes employed professional crocodile catchers to hunt crocodiles that had killed the public.

In the early 1900’s to 1930’s, not many people were interested in harvesting crocodile skins as the skin was not as important or lucrative as today. Thus, crocodiles that had been brought to the government were destroyed including their skin. Only flesh or meats were sold to those who were interested to buy such as the Japanese people (Ritchie & Jong, 2002). When the wars started in Europe and other regions in 1930’s and 1940’s, the demand for crocodile skin increased. The huge number of crocodiles living in the river of Sarawak had attracted foreign companies involvement in harvesting crocodiles activities from rivers. For instance, in a report from Sarawak Gazette (June 1, 1933), an agent from Eastern Tanneries requested permission from Brooke government to catch crocodiles in rivers between Bintulu to Miri and Baram. To ensure a plentiful supply for the company, they also employed local people to catch the crocodiles and willing to pay more money for high quality crocodiles skin that were brought to them from those rivers. The price for the skin at this time was approximately

40 cents per inch, while for meat and gallbladders the price was around 50 cents per kilogram

(Cox & Gombek, 1985). Crocodile gallbladders were mainly used by people at that time for medicinal purposes (Cox & Gombek, 1985).

Riverine communities in Sarawak during the era of Rajah Brooke lived in terror of killer crocodile especially the one that had once having tasted human flesh (Brooke, 1913). From

1900 to 1941, a total number of 232 cases of crocodile attacks were reported in the Sarawak

Gazette. During this period of time, on average 5 cases of crocodile attack occurred every year. Almost three quarter (73.7%) of the cases claimed the life of the victims while 26.3% survived from the attack. In some of the cases, victims who survived after the attacks were severely wounded and without immediate proper treatment, the victims later ended up dead due to the injuries. During that period of time, hospitals or medical facilities were only available in towns. In rural areas, people who needed immediate medical attention like victims of crocodile attacks, has to travel to the towns and it usually took a long time to reach the facilities.

The limitations of any data set must be considered and, as noted earlier, reports of crocodile attack on human in Sarawak during the colonial era of Rajah Brooke (1900-1941) had likely been influenced by the reports of the assigned district officers. Brooke government assigned outstation officers into every district in Sarawak territory and among their tasks were to monitor and report things that happened in their areas. Cases of crocodile attack could be higher than this, as there is a possibility that some cases had not been reported in the Sarawak

Gazette.

The highest number of crocodile attack cases had been recorded from 1900 to 1909 with 68 cases (Figure 3.2). The number of crocodile attacks in Sarawak showed decreasing trend in the following years, recorded 65 cases from 1910 to 1919 and 53 cases from 1920 to 1929.

The lowest number of crocodile attack was recorded from 1930 to 1941, with only 46 cases.

In general, less frequency of crocodile attack typically associated with the fewer number of crocodiles in the river (Fukuda et al., 2011). Thus, it is very likely that the introduction of reward system had caused relatively large number of crocodiles being taken out of the rivers, and this could be the reason of the decreasing trend in crocodile attacks in Sarawak.

100 Total case 90 Non-fatal Fatal 80

Number of case of Number 30

0 1900 - 1909 1910 - 1919 1920 - 1929 1930 - 1941 Year

Figure 3.2: Number of crocodile attacks divided into 10-year periods during the Rajah Brooke era, 1900-1941.

The analysis of attacks reveals that more male victims (67.7%) were involved in the crocodile attacks in Sarawak during the period of time compared to female (25.9%) (Figure

3.3a) and attacks occurred more common during daylight (55.2%) compared to night (7.3%)

(Figure 3.3b);

(a) (b) Unknown 6.5% Unknown 37.5% Female Day 25.9% 55.2% Male 67.7% Night 7.3%

Figure 3.3: (a) Percentage of attacks according to victim’s gender, (b) Percentage of attacks according to the time when the incident occurred. *Unknown = no information available.

From 1900 to 1941, crocodile attacks occurred in 20 out of 22 major river basins in Sarawak

(Figure 3.4). The highest number of crocodile attacks were reported in the Rajang RB with

35 cases (15.1%). The second and third highest number of crocodile attacks were recorded in Lupar RB and Baram RB with 28 cases (12.1%) and 25 cases (10.8%), respectively. The lowest number of crocodile attack was in Similajau RB and Niah RB, where both of the river basins recorded only one case (0.4%). There was no report of crocodile attack from Suai RB and Sibuti RB in Sarawak Gazette from 1900 to 1941 (Figure 3.4). The Rajang RB has the highest reports of crocodile attacks on human from 1900 to 1941 probably due to relatively

58 high number of human settlements that have already been established along the river at that time. During the Rajah Brooke era, several major towns and villages could be found from the lower region up to the upper region of the Rajang RB such as Sarikei, Sibu, Kanowit and Kapit, and the settlements are navigable by steamers (Baring-Gould & Bampfylde,

1909). Furthermore, in early 1900’s, two outstation officers were assigned in Rajang, each one of them was responsible to report things that happened in lower and upper regions of the river basin, respectively. Hence, more crocodile attacks were reported from Rajang RB in the Sarawak Gazette. Interestingly, crocodile attacks in Rajang RB at that period of time were reported as far as Belaga and Pelagus, which is located more than 200 km distance from its river mouth (Sarawak Gazette, November 1, 1927).

40 38 36 34 32 30 28 26 24 22 20 18 16 14

Number of case of Number 12 10 8 6 4 2 0

Oya Miri Niah Suai LuparBaram Kayan Krian Tatau TrusanLawas Sibuti Rajang Sadong MukahKemena Saribas Limbang Sarawak Balingian Similajau Samarahan River Basin

Figure 3.4: Number of crocodile attacks from 1900-1941 according to river basin.

From 1900 to 1941, incidents of crocodile attacks had occurred in monthly basis with the highest attacks recorded in April (Figure 3.5). There were 27 cases of crocodile attacks in

April, representing 11.6% of the total cases. The second highest was in September with 22 cases (9.5%) and closely followed by May, July and October (21 cases, 9.1%). December had recorded the least number of attacks with 12 cases (5.2%). Crocodile attacks in Sarawak during the Rajah Brooke era occurred relatively higher during the dry season (southwest monsoon, SWM). The SWM in Sarawak occurs approximately from April to September, recorded 56.5% of crocodile attacks compared to the northeast monsoon (NEM), 43.5%.

Unlike SWM, rains typically occur in most of the days during NEM and the rainy season could be lasting from October to March (Figure 3.5).

30 Total cases 28 Non-fatal 26 Fatal 24 22 20 18 16 14 12 10

Number of case of Number 8 6 4 2 0

April May June July March August October January February September NovemberDecember Northeast monsoon Southwest monsoon (SWM) Northeast monsoon (NEM) (NEM) Month

Figure 3.5: Number of crocodile attacks from 1900-1941 according to month and season when the incident occurs.

The highest number of victims were taken or attacked by crocodiles while they were bathing or defecating in the river or landing stage (pangkalan) with 25.9% of the cases (Figure 3.6).

This followed by the victims that were grabbed from their boats by the crocodiles (14.7%) and victims were taken by crocodile while fishing (6.9%). Approximately 14.2% of the crocodile attacks happened while the victims were working or playing or fishing at riverbanks or area near to the rivers. Victims attacked by crocodiles while swimming or crossing the river (or small stream) recorded 3.4% of the cases. One case (0.4%) of suicide reported where the victim threw himself into the river and was devoured by crocodile. The activity of victims for 34.1% of the crocodile attack cases was not stated or explained in the reports in the Sarawak Gazette from 1900 to 1941.

Bathing / defecating 25.9% Unknown 29.7%

Swimming / wadding / crossing river 3.4% Suicide 0.4%

Washing / Boat overturn / performing capsize ablutions 5.6% 3.4%

Fishing 6.9% Slip into water 0.4% Working at rivebank Grab from boat Playing at Walking at 6.0% 14.7% riverbank / landing rivebank or road stage 0.4% 3.0%

Figure 3.6: Types of activities of the victims when crocodile attacked (1900-1941).

3.3.2 Post-war period (1946-1979)

After the World War II (WWII) and Japanese occupation, Sarawak was ceded to the British government by the last Rajah Brooke and became one of their colonies. A governor was appointed by the British to administer Sarawak before the state was given independence and formed Malaysia with Malaya and North Borneo in 1963. Under the new government, rewards for capturing crocodile were continued. It is believed that the activities of crocodile hunting during this period of time were more intensive as demand for the crocodile skin increased globally. Since WWII, demand for crocodile leather shoes, handbags, luggage, wallets, watchbands, and other expensive luxury articles has far exceeded supply.

The crocodile trade peaked in the mid-1960s, when world markets absorbed more than 2 million crocodile skins each year (National Research Council of United State of America,

1983).

In Sarawak, hunting of crocodile already at its full swing started in 1954 with large harvests were produced until mid-1960’s. Cox and Gombek (1985) reported that more than 10,000 skins were exported out from Sarawak annually between the years 1957 and 1961. It did not take a long time for the effect of overhunting showed result. Skins export from Sarawak was reported plummeted more than 90% within a decade, from 7,245 kg in 1961 to only 692 kg in 1971 (Cox & Gombek, 1985). Sarawak skin export started to rise again around 1983-1984 primarily due to successful captive breeding by Jong Joon Soon Crocodile Farm. Jong Joon

Soon Crocodile Farm (now known as Jong’s Crocodile Farm) is the first crocodile farm opened in Sarawak. The farm started their operation in 1963 with the first batch of 6 hatchling crocodiles acquired from the wild. In 1979, the farm move into larger area at

Siburan, about 18 miles from Kuching and they started to breed their crocodiles. After a few years of successful in the breeding activities, the farm had started to export crocodile skins out of Sarawak.

There was not much information about crocodile attacks from 1947 until 1979 collected in the present study due to unavailable records kept by the authority on this matter. After the

Sarawak Gazette resumed it publications in 1946, less coverages of crocodile attack incidents were reported, probably due to the need of reporting other important affairs of

Sarawak or because crocodile attacks in the state were increasingly rare. The available attacks data show not less than 31 cases of attacks were known to occur in Sarawak from

1947 until 1979, where 58% of the incidents happened in Lupar RB.

3.3.3 Period when wild crocodile populations depleted and the law was introduced

to protect them from hunting (1980-1999)

When Sarawak was under the rule of the White Rajahs and later being a colony of the British, crocodiles were considered as vermin to the government as well as to the local people. The crocodiles had no value and always terrorizing them, thus they wanted the animals to be destroyed. Rewards offered for capturing the crocodiles and high demand for crocodile skins had encouraged hunting activities. The importance of retaining the populations of crocodiles during that time was also not recognised.

Aggressive hunting activities for the skins in Sarawak continued after the Japanese occupation from 1950’s to 1970’s, resulting in significant depletion of crocodile populations

(Cox & Gombek, 1985). There was also no monitoring of harvesting impact and management plan for the species or its habitat during that period of time. It is believed that the number of crocodiles in Sarawak was reduced tremendously and it was not easy to find the animal in the wild during this period of time. Pak Deris, one of the known crocodile hunter in Samarahan River revealed that it was very hard to find crocodiles in the river and last crocodile caught by him was in 1974 (Cox & Gombek, 1985).

The first comprehensive survey of crocodile population in Sarawak was conducted by Cox and Gombek (1985). Their surveys covered a distance of 1,043 km of main rivers including selected tributaries in Kuching wetland area, Samarahan, Samunsam, Lupar, Baram, lower

Rajang, Suai and Limbang River. The survey results showed that the average density of crocodile in Sarawak was at 0.054 individual per km (almost 6 crocodiles for every 100 km).

In Samarahan River, among the river where crocodiles were intensively hunt since the era of Rajah Brooke, Cox and Gombek (1985) were surprised to find only one hatchling in the river during their survey (71 km of survey distance). Three rivers surveyed by Cox and

Gombek (1985) recorded zero sighting of crocodile, namely Tisak, upper Lupar and middle

Baram River. They also reported that the crocodile habitats were seriously disturbed and degraded while waterways were intensively used for fishing and transporting goods and people. They claimed that the use of cross-netted fishing techniques caused not only entanglement and drowning but also halt mobility and recruitment of crocodiles in the rivers.

This report led to the recommendations of the Special Select Committee for Flora and Fauna to accord crocodile as protected animals in Sarawak under the Wild Life Protection

Ordinance in 1990, and also accordance with the listing of the animals in the Appendix I of

CITES. Hence, starting from 1990 onwards, any hunting or selling activities related to wild crocodiles in the state without permits are prohibited. A fine of MYR 10,000 and one year jail will be applied to those guilty of breaking the law.

The information on crocodile attacks within the period from 1980 to 1999 were limited, due to lack of records were collected by the authority on this matter. Incidents of crocodile attacks were commonly been reported in the local newspapers, but it is difficult to access the reports as majority of the reports were not been digitised, unlike today’s news where information are easy to access as the news are both published on paper and online. Ritchie and Jong (2002) had compiled a number of attack incidents from 1980 to 1999 in their book and several attack cases were also added into CrocBITE database by contributors. Between the year 1980 to 1999, not less than 39 cases of crocodile attacks were known to happened in Sarawak, whereas most of the attacks occurred in Lupar RB (59%).

3.3.4 Millennia era (2000-2017)

After more than three decades the law was introduced (Section 3.3.3), crocodile populations in Sarawak are on the road of recovery. Local agencies, Forestry Department of Sarawak

(FDS) and Sarawak Forestry Corporation (SFC), started patchy surveys on crocodile populations back in 1994, covering selected rivers in Sarawak and Lupar RB (Tisen &

Ahmad, 2010). Comprehensive surveys on crocodile populations by the agencies were only started in the years 2000 - 2001, covering more river basins in the state including Krian,

Sadong, Baram, Miri, Sibuti, Niah and Similaju. The survey results showed that the densities of crocodiles in Sarawak were in the range of 0.1 to 1.9 individuals/km.

From 2012 to 2014, FDS and SFC conducted intensive surveys on crocodile population throughout Sarawak in conjunction with the intention of Sarawak government to down list

C. porosus from Appendix I into Appendix II CITES. The surveys covered a distance of almost 2,200 km of all 22 river basins in the state, including their tributaries and small streams. The surveys recorded the density of crocodile in the range from 0.05 to 3.37 individuals/km. From the survey, the number of crocodiles live in rivers in Sarawak was estimated around 13,000 individuals (Sarawak Forestry Corporation, 2018).

With the development of information and communication technologies (ICT), communications are easier and more effective. Thus, report or information on crocodile attacks can be received faster and more accurate, compared to more than 20 or 30 years ago.

New cases of crocodile attacks in Sarawak can be reported instantly and the public could be aware about the incidents in the same day. Every known details of the attack incidents can be recorded in the database and the information can be used for research purposes.

From 2000 to 2017, a total of 135 cases of crocodile attack on human reported in Sarawak, with the average of 7.5 cases per year. The number of crocodile attack cases for each year per annual period showed a marked increase (regression analysis, DF = 1, p = 0.000 [p <

0.05], R2 = 55.5%, F = 19.92) especially between the year 2003 and 2015 (Figure 3.7).

20 19 Non-fatal 18 Fatal 17 Total 16 15 14 13 12 11 10 9 8

7 Number of case of Number 6 5 4 3 2 1 0 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017

Year Figure 3.7: Number of crocodile fatal and non-fatal attacks for each year from 2000 until 2017.

The average of crocodile attacks in Sarawak from 2000 to 2017 (7.5 cases/year) is higher when compared with the nearby countries or regions such as Timor Leste with the average attacks of 6.4 cases/year in between 2007 until 2014 (Sideleau et al., 2016) and Queensland,

Australia with average 0.8 cases/year (Brien et al., 2017). In addition, the average number of attacks in Sarawak is also not far less when compare to Sundarban, India where the average attacks recorded 9.1 cases/year in 2000 until 2013 (Das & Jana, 2018).

C. porosus was identified as the culprit for almost all the attacks reported in Sarawak from

2000 until 2017. The crocodile attacks claimed the life of a slightly more than half (50.4%) of the victims, while another 49.6% of the victims survived through the attacks. The fatality

68 rate associated with crocodile attack in Sarawak (50.4%) is considered high compared to nearby countries or regions. In Queensland, Australia, 34.3% of attacks by crocodile since

1971 have been fatal (Brien et al., 2017), while fatality rate of 48.8% have been reported in

Indonesia from 2000 until 2014 (Ardiantiono et al., 2015). In comparison, relatively high fatality rate was recorded in Surdarban, India with 62.2% of attacks (Das & Jana, 2018) and 82.2% for Timor Leste (Sideleau et al., 2016). Meanwhile in other part of the world, fatality rates of 60% caused by saltwater crocodile and 51% caused by mugger crocodile have been recorded in South Asia and Iran (Stevenson et al., 2014). In Mozambique, mortality rates of 79% was observed among people attacked by crocodiles (Dunham et al.,

2010).

The frequency of male became the victims to crocodiles is higher with 84.4% when compared to female which recorded only 15.6% from total number of crocodile attack cases

(Figure 3.8a). More male victims involved in crocodile attack in Sarawak compared to female, most likely be attributed to the prevalence of specified gender roles within the community in Sarawak with the occupation or activities related to water body. Occupation or activities like fishing, collecting shrimp and crab during low tide and collecting plants or woods (e.g., rumbia, sago) at the riverbank in Sarawak are mostly dominated by men.

Conversely in Sundarban, India where tiger prawn and crab collections are among the important activities, there were fewer male victims of crocodile attack than females. This is because in Sundarban, more women than men are involved in the collection of tiger prawn and crabs (Das & Jana, 2018).

(a) (b) 0000 - Female 0559 0600 - 15.6% hours 6.3% 1159 hours 1800 - 25.9% 2359 hours Male 34.8% 1200 - 84.4% 1759 hours 33.0%

Figure 3.8: (a) Percentage of victims according to gender; (b) Percentage of crocodile attack cases according to time when the incident occurred in Sarawak from 2000 - 2017.

Crocodile attacks in Sarawak from 2000 until 2017 (n = 135) happened more in daylight

(58.9%) compared to night (41.1%) (Figure 3.8b). The timing of attacks seems to associate with human activity pattern. Local people in Sarawak are more likely to use rivers for daily chores, travel or working during daylight (Hassan & Abdul-Gani, 2013). Further analysis shows that the highest proportion of the attacks happened in late evening to midnight, between 1800 to 2359 hours (6.00 – 11.59 pm) with 34.8% (39 cases), closely followed the time period between 1200 to 1959 hours (12.00 – 5.59 pm) whereas 33.0% (37 cases) of attacks taking place in that period of time. Almost 25.9% (29 cases) of attacks occurred in the morning from 0600 to 1159 hours (6.00 – 11.59 am), while crocodile attacks were rarely occurred between midnight to early morning, 0000 to 0559 hours (12.00 – 5.59 am) with only 6.3% (7 cases) (Figure 3.8b).

Although most of the activities are done during the day, some people prefer to do activities like bathing or washing tools in the river at dusk or night. Certain activities such as fishing

70 and collecting mangrove crabs could also be carried out during night. At night, human is more vulnerable to crocodile and risk of attacks are greater compared to the daylight as crocodile could hardly be seen by human naked eyes in the dark. On the other hand, crocodile is a nocturnal animal and they actively hunt preys at night (Campbell et al., 2013; Emerling,

2017; Evans et al., 2017), hence contribute to the attack on human. In addition, the crocodile has advantages in the dark situation as they possess a relatively large lens, a retina and a tapetum lucidum in its eyes which enhance vision in dim light environments (Grigg & Gans,

1993).

Several studies have found that lunar cycle and the availability of moonlight has an influence on wildlife activity and conflicts with humans, especially when it involves nocturnal predators like lion and cheetah or large herbivores like elephant (Packer et al., 2011; Cozzi, et al., 2012; Gunn et al., 2014; Lamichhane et al., 2018). In the present study, the is no significant relationship on the frequency of attacks caused by crocodiles with the moon phase

(χ2 = 2.866, df = 3, p = 0.413[p > 0.05]) where more attacks were reported during the first quarter of the lunar cycle with 34.8% (16 cases) of total attack incidents that were known occurred at night (n = 46) (Figure 3.9). Attacks that occur during full moon were the second highest with 26.1% (12 cases), followed by the new moon (21.7%, 10 cases) and the least crocodile attacks happened in the third quarter of the lunar cycle with 17.4% (8 cases).

Therefore, there is not enough evidence to suggest that lunar cycle had influence on the frequency of crocodile attack on human in Sarawak. Other nocturnal predators like lion and cheetah in Africa were found more aggressive leading to more attacks on humans during the dark nights following the full moon (Packer et al., 2011; Cozzi, et al., 2012). However, these terrestrial animals have better chance on encountering human compare to crocodile.

Crocodile encounter with human only happen when human go down to the river or doing activities in the riverbank. It is not known whether the lunar cycle influence the usage of river by people in Sarawak, but for activities like fishing, some fishermen or anglers like to fish on the days when sunrise or sunset and moonrise or moonset coincide with new or full moon phases. It is believed that during that periods, combine with good river condition, the chance for the fishermen to get a good fishing catch will increase (Sulaiman, 2018).

0.5

0.4

0.3

0.2

Proportionattacks of 0.1

0.0 New moon First quarter Full moon Third quarter

Moon phase

Figure 3.9: Proportion of the crocodile attacks in Sarawak between 2000 and 2017 plotted over the lunar cycle.

River tidal seems to have no influence on the frequency of crocodile attacks on people in

Sarawak as there is no significant relationship between the two variables (χ2 = 3.204, df =

3, p = 0.361 [p > 0.05]). Majority of attacks occurred when the tide in the river was high with 43.4% or 49 cases out of total number of crocodile attacks reported in Sarawak from

2000 until 2017 (Figure 3.10). Then, it was followed by low tide where 27.4% (31 cases) of crocodile attacks occurred in that period. Ebb tide, the period between high and low tide during which water flows away from the shore and flood tide, the reverse flow, occurring during rising tides from low to high tide were the third highest and the last with

15.0% (17 cases) and 14.2% (16 cases), respectively.

Although the statistical analysis showed lack of significant influence of river tidal on frequency of attacks, high proportion of attack occurred during high tide indicating high risk of crocodile attack during the particular period. River will be flooded with water during high tide allowing the reptile travel further to area near to human. During the spring tides, the water level becoming exceptionally high and the phenomenon which also known as “king tide” when collided with heavy rain in monsoon season could lead to flood in lowland areas

(Sa’adi et al., 2017). During the flood, crocodile could swim closer to people’s houses and potentially attacks them. There has been reports of crocodile attacks occurred during the flood including an incident in 2016 where a man was attack by a crocodile while removing woods under his house during flood. High frequency of attacks during high tide could also associated with the behaviour of crocodile. A study by Mohd-Azlan et al. (2016) suggested that crocodiles prefer to stay near riverbanks during high tides or incoming tides, therefore, increase the possibility of crocodile encounter human. Furthermore, crocodiles are in advantages when water level is high as the animals could easily approaching victims

73 unnoticed, especially those who are doing activities in water edge or at riverbank, before the crocodiles launch a sneak attack on the victims (Caldicott et al., 2005). During low tide, activities like knee-deep fishing in shallow water and collecting foods or materials in the riverbanks are common for people in Sarawak, therefore they could face danger of attacks by crocodiles when doing those activities. The reptile could be lurking near to the victims waiting to attack or when walking along the riverbank, they could bump into crocodiles while the animals are resting or possibly guarding their nest.

0.5

0.4

0.3

0.2 Proportionattacks of

0.1 Low tide Flood tide High tide Ebb tide

Tide

Figure 3.10: Proportion of the crocodile attacks in Sarawak between 2000 and 2017 plotted over the tidal cycle.

Adults (31 to 40 years old) were the most common victims to crocodile attacks with 19.3%, followed by adult from the age of 41 to 50 years old (16.3%). Meanwhile, kids from the age of less than 10 years old and old people (aged more than 60 years old) were the least common

74 victims to crocodile attack with 5.2% of total number of cases (Figure 3.11). Higher proportions of attacks in Sarawak involving adult (age between 31 to 40 years old and age between 41 to 50 years old) are likely be attributed to the occupation or activities. Adult person especially in the riverine communities typically takes the responsibility to find income and foods for their families (Department of Statistics Malaysia, 2017), mostly with river-related activities for example fishing using active and passive techniques. All seven cases (100%, Figure 3.11) of crocodile attacks involving children below 10 years old were resulting death to the victim, showing how much vulnerable this age group when they were attacked by the crocodiles. Children usually unaware about the danger they face when come near to the water body. Furthermore, children when were attack by crocodiles, they were powerless to escape, even the attack came from a small crocodile (Fukuda et al., 2015).

Non-fatal 30 Fatal 28 26 24 22 20 18 16 14 12 10 Number of case of Number 8 6 4 2 0 0 - 10 11 - 20 21 - 30 31 - 40 41 - 50 51 - 60 > 60 Unknown Age (years old)

Figure 3.11: Number of fatal and non-fatal attacks from 2000 to 2017 according to age of victims.

From 2000 until 2017, crocodile attacks occurred in 18 out of 22 major river basins in

Sarawak. The highest crocodile attacks were recorded in the Lupar RB with 28 cases (20.7%) from the total number of cases, followed by the Saribas RB and Samarahan RB with 18 cases

(13.3%) and 15 cases (11.1%), respectively. The Kayan, Tatau, Limbang and Lawas RBs recorded the lowest cases of crocodile attack with only one case (0.7%) for each river basin.

No attack was recorded in Mukah, Balingian, Trusan and Miri RBs (Figure 3.12).

40 38 36 34 32 30 28 26 24 22 20 18 16 14

12 Number of case of Number 10 8 6 4 2 0

Niah Suai Oya Miri Lupar Baram Krian Sibuti Lawas Kayan Tatau Trusan Saribas Sadong Rajang Kemena Mukah Sarawak Similajau Limbang Balingian Samarahan River Basin

Figure 3.12: Number of crocodile attacks from 2000-2017 according to river basin.

The peak month for a crocodile attack in Sarawak from 2000 to 2017 was in March with 23 of attacks (17%). The number of attacks in May was the second highest with 16 cases

(11.9%), followed by July (12 cases, 8.9%). October recorded the lowest number of attacks with only 6 cases or 4.4% (Figure 3.13). Meanwhile in term of monsoon season, the attack occurred slightly higher during the NEM (October to March), with 52.2% of the total number of cases, while another 47.8% of crocodile attacks occurred during the SWM (April to

September).

30 28 Total cases 26 Non-fatal 24 Fatal 22 20 18 16 14 12 10

Number of case of Number 8 6 4 2 0

April May June July March August October January February September NovemberDecember

Northeast monsoon Southwest monsoon (SWM) Northeast monsoon (NEM) (NEM) Month

Figure 3.13: Number of crocodile attacks from 2000-2017 according to month and season when the incident occurred.

The most common case of crocodile attacks in Sarawak from 2000 until 2017 occurred while the victims were fishing with 25.2% from the total attacks, followed by bathing or defecating

(24.4%) and working at the riverbank (9.6%) (Figure 3.14). Besides that, crocodile attacks were also occurred while the victims were washing or performing ablutions (wuduk) (8.1%), grab from boat (6.7%), swimming or wadding in the river (5.2%) and playing at the riverbank or near the river (1.5%). Meanwhile, victim slipped into water from the boat, their boat overturned or collides and attack while walking at the riverbank recorded the least incidents, with only one case or 0.7%. Incomplete information about the activities of the victim when the crocodile attack comprised 17.0% of the cases occurred from 2000 to 2017.

The data also clearly shows that activities in water like fishing, swimming, bathing and washing possess the highest risk of crocodile attacks (combine 63%, Figure 3.14) compare to the ones on the land. Fishermen frequently use cast net (jala) as the methods of fishing and they are commonly thrown the cast net in waist or knee-deep water during the low tide, exposing themselves to the crocodile attack. Meanwhile, activities like swimming, bathing or washing where the persons will be in the water completely or at the water’s edge, they are vulnerable to an attack by crocodile as the reptiles are capable to swim or submerge underwater and sneak near the victim undetected before they launch an attack (Caldicott et al., 2005). In a number of reports, victims were having no idea of the presence of a crocodile near them before the attack.

Attacks on people in boats are of particular interest. Although the number is less compared to fishing and bathing, the incidents concerned the public as it could indicate that travelling using boat is unsafe. People are worried about the crocodiles that responsible for attacking

78 people in boat will repeat the behaviour and strike again (Ritchie & Jong, 2002). Typically, large and aggressive crocodiles are the one who responsible for attacking people on boat as they are capable to overturn boat or leap out of water and grab victims from boat (Caldicott et al., 2005).

unknown 17.0% Boat overturn / collide 0.7% Bathing / defecating 24.4% Slip into water 0.7%

Grab from boat 6.7%

Playing at Swimming / riverbank / landing wadding stage 5.2% 1.5%

Walking at rivebank or road Washing / 0.7% performing ablutions 8.1%

Working at rivebank Waist / knee-deep 9.6% fishing 25.2%

Figure 3.14: Types of activities of the victims at the moment of crocodile attacked (2000- 2017).

3.3.5 One hundred and eighteen (118) years comparison of human-crocodile conflicts

Between 1900 and 2017, there were at least 437 cases of crocodile attacks on humans occurred throughout Sarawak. The average cases per year from 1900 until 2017 were represented in Figure 3.15;

12 DF = 1 F = 118.53 10 R2 = -95.2% DF = 1 P = 0.00 F = 13.59 8 R2 = 81.9% P = 0.03 6

2 Averageyear per attacks

-2

1900 - 19091910 - 19191920 - 19291930 - 19391940 - 19491950 - 19591960 - 19691970 - 19791980 - 19891990 - 19992000 - 20092010 - 2017

Year

*Japanese occupy Sarawak from 1942 until 1946 Figure 3.15: Average number of crocodile attacks per year divided into 10-year periods between 1900 and 2017 in Sarawak.

The average number of crocodile attacks showed a decreasing trend starting from year 1900-

1909 until 1970-1979 (regression analysis, DF = 1, p = 0.000 [p < 0.05], R2 = - 95.2%, F =

118.53) before bounce back from 1970-1979 until 2000-2017 (regression analysis, DF = 1, p = 0.035 [p < 0.05], R2 = 81.9%, F = 13.59) (Figure 3.15). The trend seems related to the trend of crocodile exploitation in Sarawak. The period between 1950-1959 and 1970-1979 where the lowest average number of crocodile attack per year recorded, were the time when crocodile hunting activities in Sarawak at its peak. Over hunting of crocodiles during that period had reduced the number of the animal in the wild. Hence, less chance for people to encounter crocodiles which led to less number of crocodile attacks. However, starting from

1980-1989, number of reported crocodile attacks on people in the state have increased significantly, which led to the assumption that the population of crocodile in the wild are recovering. The law that protect crocodile from hunting introduced in early 1990’s helped the recovery of the animal and several rivers in Sarawak had recorded noted increase in crocodile density (Sarawak Forestry Corporation, 2018). Recovery of crocodile population in Sarawak along with other contributing factors such as increasing in human population in the state could be related to the increasing number of crocodile attacks. In 2010-2017, the average number of crocodile attacks was 11 cases / year, more than twice the average of crocodile attacks in 2000-2009 (4.7 cases / year).

The proportion of fatal attacks in Sarawak were reduced from 73.7% in 1900 – 1941 to

50.4% in 2000 – 2017, indicating the improving survival rates of the victims. According to

Caldicott et al. (2005), massive blood loss due to injury and drowning are among the cause of death in a large number of crocodilian attacks, indicating the importance of immediate medical treatments. Immediate medical treatments are vital for crocodile attack victims as

81 the wound inflicted by the crocodile could be infected by bacteria or the victims might lose too much blood (Caldicott et al., 2005), hence it is essential to have nearby medical facilities.

The higher rate of fatality in the 1900 – 1941 period (73.7%) compare to 2000 – 2017 period

(50.4%) reflected the lack of medical facilities and transportation at that time. During the time of White Rajah administration (1900-1941), medical facilities were only available in major towns such as Kuching and Sibu, thus, for people from rural areas who need for medical attentions, they have to travel to the towns which at that time took days before reaching hospitals (Baring-Gould & Bampfylde, 1909). Nowadays, with the availability of medical facilities like clinics and hospitals in almost every district in Sarawak (Department of Statistics Malaysia, 2017), crocodile attack victims were able to receive treatments faster.

Thus, this could contribute to the lower percentage of fatality among the crocodile attack victims.

For 118 years, crocodile attacks had occurred in all 22 river basins in Sarawak, suggesting that the crocodiles are dispersed in all river basins in the state (Figure 3.16). There is a significant difference (p = 0.002 [p < 0.05]) between river basins in term of number of crocodile attacks in Sarawak from 1900 until 2017, where the highest number of attacks was recorded in Lupar RB. Batang Lupar, famously known with the story of a huge crocodile known as Bujang Senang who is said to be responsible for a number of attacks on humans, recorded 97 cases or 22.2% of total crocodile attacks in Sarawak. The second highest number of crocodile attacks occurred in Rajang RB with 45 cases (10.3%), followed by Baram RB with 38 cases (8.7%). The lowest cases of crocodile attack reported in Suai RB and Similajau

RB with only 3 cases (0.7%). Statistical analysis also showed significant correlation between number of attacks with the length of the river (Pearson correlation = 0.454, p = 0.034 [p <

0.05]), indicating that a large area of waterways contributes to the high number of crocodile attacks. Large river basin that have long stretch of waterways such as Rajang RB (river length, 760 km), Baram RB (635 km) and Lupar RB (275 km) are among the river basins that recorded high number of crocodile attacks in Sarawak.

Two rivers, Rajang RB and Lupar RB, are the two ‘hotspot’ river basins for human-crocodile conflicts in Sarawak since 1900. During the era of the White Rajah (1900 – 1941), the highest crocodile attacks was recorded in the Rajang RB (15.1%), while the Lupar RB (12.1%) was the second highest (Figure 3.4). However, the Lupar RB (20.7%) had overtaken the Rajang

RB (3.7%) as the river basin that had the highest number of attacks from the year 2000 until

2017 (Figure 3.12). Moreover, the attack data in 118 years (1900 – 2017) showed that the total number of crocodile attacks in Lupar RB (97 cases) were more than double the number of attacks in Rajang RB (45 cases). The high variation between the number of crocodile attacks in Lupar RB with the rest of the river basins in Sarawak is particularly interesting, hence further studies need to be carried out in the Lupar RB in future to investigate factors that influence high frequency of attacks.

100

Number of case of Number 30

Oya Miri Niah Suai Lupar Baram KrianKayan Tatau TrusanLawas Sibuti Rajang SaribasSadong KemenaMukah Sarawak Limbang Balingian Similajau Samarahan River Basin

Figure 3.16: Number of crocodile attacks from 1900 until 2017 according to river basin.

The crocodile attacks cases from 1947 - 1979 and 1980-1999 did not have complete details of the months and activities of victims. Thus, comparison only can be made between the

White Rajahs era (1900-1941) and Millennium era (2000-2017). In the 1900-1941 and 2000-

2017 periods, incidents of crocodile attacks had occurred in every month of the year with no significant different among the months (p = 0.998 [p > 0.05]). Although the crocodile attacks had occurred in monthly basis, the peak attacks were happened in April for 1900-1941

(Figure 3.5) and March for 2000 – 2017 (Figure 3.13), which are coincided with the end of wet season in Sarawak. Similarly, in nearby countries such as Indonesia and Australia, more crocodile attacks tend to happen at the end of the wet season (Fukuda et al., 2014;

Ardiantiono et al., 2015). The increasing attacks on human during the wet season most likely associated with the breeding season of crocodiles. The crocodiles tend to be aggressive

84 during mating and nesting, where the male crocodiles compete for potential mating partner, while the female ones can be hostile to any animals or humans that try to approach or disturb their nests (Webb et al., 1977; Campbell et al., 2013).

There is a slightly difference, although not statistically significant (p = 0.219 [p > 0.05]), in proportion of crocodile attacks during the Southwest and Northeast monsoon seasons between the 1900-1941 and 2000-2017 periods. From 1900 to 1941, crocodile attacks in

Sarawak occurred relatively higher in Southwest monsoon compared to Northeast monsoon

(SWM, 56.5% : NEM, 43.5%), while from 2000 until 2017, attacks occurred more in

Northeast monsoon compared to Southwest monsoon (SWM, 47.7% : NEM, 52.3%). This slight change carries the same notion that crocodile attacks could happen anytime regardless of the season. However, historical change in the months of each season might also explained the difference in proportion of crocodile attacks during the NEM and SWM. According to a study by Sa’adi et al. (2017), there is no significant shift or change in between wet and dry season corresponds to the month of the season occurred in Sarawak. Based on the rainfall data from 1980 to 2014 (Figure 3.17), high amounts of rainfall were recorded in Sarawak starting from month of October until March, signalling the NEM. On the contrary, the SWM which extends from April to September, recorded lower amount of rainfall and associated with relatively dry period (Figure 3.17).

500

450

400

350

300

250

200

Rainfall (mm) Rainfall 150

100

April May June July March August January February October September NovemberDecember Month

Figure 3.17: Average of monthly rainfall in Sarawak for the period 1980 - 2014 (adapted from Sa’adi et al., 2017).

The changing pattern of crocodile attacks in the two monsoon seasons might be influenced by the improvement in the quality of life in Sarawak. During SWM, less rain usually occurred in most of the days in the months leading to the hotter and drier conditions (Sa’adi et al., 2017). During the White Rajah era, majority of the people in Sarawak depended on water from the river for daily chores like bathing and washing clothes or tools (Brooke,

1913). Another source of water is from water reservoirs like wells or lakes, but it could dried out during dry season especially when draught happened for a long period of time, hence the local people turn into river for water sources. The earliest water supply system in Sarawak was established in the early 1900’s. However, at that time the water supply to houses only available in Kuching area and the water was obtained from nearby streams (Mahyan &

Selaman, 2016). After Sarawak join others states to form Malaysia in 1960’s, the water

86 supply has been expanded into other cities and the water supply connected to more areas in

Sarawak (Mahyan & Selaman, 2016). The local people also used river frequently during

SWM for traveling to other places and going out fishing as the condition is usually good for these two activities. Dependency on the river increased the frequency of encountering with crocodiles and it could lead to risk of attack by the animal.

In contrast, rainfalls frequently occurred during the months in NEM and the rainy season is lasting from October to March. As the rain pour heavily, water levels in the river become higher and rivers are usually in rough condition as the currents are running fast (Baring-

Gould & Bampfylde, 1909). These conditions are dangerous for those who used small wooden canoes or perahu, which is comonly used by majority of riverine communities in

Sarawak at that time (Brooke, 1913), hence most people avoid using river during this time of the year.

The data clearly show that activities in the water or at the riverbank are posing a higher risk of crocodile attacks. Majority of the attacks in both periods (1900-1941 and 2000-2017) happened while victims were bathing and defecating, washing or fishing in the river (or water edge) and landing stage (pangkalan) (Figure 3.6 and 3.14). During the period of 1900 to 1941, bathing or washing in the river are common for local people who live near the river as it is the main source of water for them. From the years 2000 until 2017, people in some rural areas were still using water from the river for daily chores as their areas may have not been supplied with clean pipe water yet. Based on data by Department of Statistics Malaysia

(2017), as of 2017, it is estimated that 81% of the area in Sarawak has been supplied with treated water through pipe line system while the rest of the area are not yet connected with

87 the system. Meanwhile, lack of proper bathing and toilet facilities provided by some of the plantations owners to their workers also contributed to the crocodile attacks. In between

2000 to 2017, there are at least 8 cases of plantation workers attacked by crocodile while bathing, washing cloths and defecating in the waterways near their dormitory were reported in Sarawak. High percentage of attacks involving fishermen (about 25.2%) is major concern as this indicate that there is still lack awareness among them about safety precautions and the danger they facing especially for those who are fishing in the waist or knee deep water.

The majority of crocodile attack incidents in countries like Australia, Indonesia, Timor-

Leste, India and Sri Lanka were also occurred when the victims were in the middle of doing water-bound activities like bathing, washing and fishing (Fukuda et al., 2014; Amarasinghe et al., 2015; Ardiantiono et al., 2015; Sideleau et al., 2016; Das & Jana, 2018). According to

Caldicott et al. (2005), humans are most vulnerable to crocodile attack when doing activities in the water or at water’s edge as this reptile is capable to sneak near to the victims undetected before attack them.

Attacks on people in boats are of particular interest as the percentage decreases from 19.8%

(1900-1941) to 6.3% (2000-2017). In the White Rajahs era (1900-1941), most of people travelled in the river using small wooden canoes (sampan or perahu). A large crocodile is capable of grabbing victim from the sampan, in some case the reptile run rampage crushing or overturn the sampan before seizing the victim. From 2000 until 2017, most of the people had already used fibre or metal motorize boats and these types of boats are safer compared to wooden sampan. However, in certain cases when the victims are careless, a crocodile was able to leap out of water and grabbed the victim from the boat or using its powerful tails to

88 knock the victims into the river. There is one bizarre case of a person intentionally jumped into the river infest with crocodile in the Rajah Brooke era (1900-1941) and get himself killed by the reptile (Sarawak Gazette, May 2, 1908). This one case is an exceptional, compared to other case where crocodile aggressively attacked human.

3.4 Conclusion

From 1900 until 2017, number of human-crocodile conflicts in Sarawak were fluctuated and based on the attacks data, it was noted that the trend of crocodile attacks on human in the

Sarawak was associated with the exploitation trend and recovery of the crocodiles in the state. From the colonial era of Rajah Brookes (1900 - 1941) until post World War II periods

(1946 - 1979), crocodiles were hunted and heavily exploited resulting the number of the animals in wild were depleted. In the same period, HCC in Sarawak recorded constant decrease in number of attacks incidents. Population of crocodiles in Sarawak started to recover after the law protected the animal was introduced in 1980’s and at the same time frequency of crocodile attacks on human began to increase. Based on the 118 years record, crocodile attacks had taken place in all 22 river basins in Sarawak, indicating that crocodiles are well distributed in all river basins throughout the state since 1900. Further analysis showed that human-crocodile conflicts pattern in Sarawak is most likely associated with human activities pattern. The water-bound activities possess a higher risk of crocodile attack in Sarawak compared to inland activities. Crocodile attacks occurred more during daylight compare to night as human do most of their daily activities at that period. Meanwhile, most common victims fall into crocodile mouth were adult men as this group of age are using river more frequent as source of foods and incomes for their family. Furthermore, crocodile

89 attacks happened in all months of the year, while monsoon season, moon phase and tidal cycle had a minor influence on the frequency of attacks. The analysis of crocodile attacks in

Sarawak in this chapter had shed lights on the conflicts between human and crocodile in the state, and it is hoped that the information could help in improving human safety, especially for riverine communities.

CHAPTER 4

DISTRIBUTION AND ECOLOGY OF SALTWATER CROCODILE, Crocodylus

porosus IN RAJANG RIVER BASIN, CENTRAL SARAWAK

4.1 Introduction

Crocodylus porosus can live in various type of habitats (Webb et al., 2010). This species, commonly known as estuarine or saltwater crocodile due to their existence in marine ecosystem, typically inhabit tidal rivers and small tributaries in the coastal area where salinity changes according to seasons and the distance upstream. The C. porosus regularly moves between rivers around the coast and in few cases they were found occupying offshore islands (Webb et al., 2010). Interestingly, contrary to its common name ‘saltwater’ crocodile, the crocodile species also can be found in non-tidal freshwater sections of the rivers and inland freshwater lakes, swamps and marshes associated with rivers (Letnic et al., 2011).

One of the important major river basin (RB) in Sarawak that supports high number of crocodiles is the Rajang RB (Sarawak Forestry Corporation, 2018). The main river of Rajang or Batang Rajang (Batang, refer as a large river by local people in Sarawak) is the longest river in Sarawak (and also in Malaysia) with approximate length of 760 km. The Rajang RB originates from the Nieuwenhuis Mountain Range and the upper Kapuas Mountains in the border of Sarawak-Kalimantan, flowing across major cities and towns such as Kapit, Song,

Kanowit, Sibu, Bintangor and Sarikei before reaching the South China Sea.

C. porosus are abundant in the lower and middle region of Batang Rajang (Robi, 2014) but this species could also be found in the upper region of Batang Rajang. Reports stated that C. porosus were sighted as far as Kapit town, which is more than 200 km from Batang Rajang’s river mouth (Tisen et al., 2013). Local people also claimed that C. porosus can be found in several non-tidal and less saline tributaries of Batang Rajang in Kanowit and Song Districts.

Despite reports about the presence of C. porosus in the upper part of several major river basins in Sarawak including Rajang, there is still lack of information regarding their distribution and ecology in the area. Up to date, research on crocodile focused on coastal region of Sarawak (Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Zaini et al., 2014;

Azreen, 2015; Hassan et al., 2018). Cox and Gombek (1985) had first initiated preliminary surveys on populations and distributions of C. porosus and T. schlegelii in Sarawak, involving several major rivers including Batang Rajang. However, their survey only covered the lower part of Batang Rajang. The local agencies, SFC and FDS has been conducting surveys on crocodile populations in several major rivers of Sarawak since 1994. However, due to the vast areas of rivers in Sarawak and the high cost needed to conduct the surveys, most of the surveys only involved rivers in the western part of Sarawak (Tisen & Ahmad,

2010). Only in 2014, the agencies have started to conduct comprehensive surveys in Batang

Rajang in conjunction with state-wide crocodile population survey programs to provide important data for CITES appendix down-listing proposal (Robi, 2014).

Sarawak’s extensive crocodile habitats are found in the mangroves estuaries and middle region of large river system and recent surveys data showed that this area have the highest crocodile densities (Sarawak Forestry Corporation, 2018). Fukuda et al. (2008) had outlined

92 several environmental factors that could influence the abundance and distribution of crocodile in the waterways, among them are temperature, salinity, riverbank vegetations as well as anthropogenic pressures like riverbank land-use and human activities.

The influence of salinity on the abundance and distribution of crocodile is mainly linked to the waterbody habitats and riverbank vegetations. Brackish waterbodies such as saline floodplain and mangroves near to estuaries are the common habitat for C. porosus as these habitats have high productivities and support diverse fauna of fish, crustaceans, insects, mammals and birds (Nagelkerken et al., 2008). The C. porosus could adapt to hyperosmotic environment with the help of functional organ, lingual salt glands (Cramp et al., 2008), and the species regularly move between marine habitat and freshwater especially when the season change. For ectothermic animals like crocodiles, their behaviour and physiology are influence by ambient and water temperature. The optimal temperature for crocodile is around

28 0C to 30 0C (Rodgers et al., 2015) and when the temperature is outside of the optimal range, crocodiles commonly seek to maintain body temperatures through behaviours such as basking, shade-seeking, and moving in and out of water (Grigg & Gans, 1993).

Human activities and riverbank land-use could influence the distribution and abundance of crocodile and these anthropogenic pressures appeared to keep the crocodile population low in the waterways (Read et al., 2004; Kanwatanakid-Savini et al., 2012; Shaney et al., 2017).

Furthermore, constant encroachment into crocodile habitat and high impact land use could indirectly affect the ecology of the rivers, hence change the nature of the waterways.

Degradation of rivers due to the expansion of human population and intensive usage of the river for fishing and transportation are among the contributing factors to the depletion of

93 wild crocodile population in 1950’s to 1980’s (Cox & Gombek, 1985). In addition, pollution from industrial and agricultural activities could change the quality of water in the rivers and affect the abundance of preys for crocodile, hence in a way could influence the distribution of the crocodiles in certain areas.

Although C. porosus typically occur at very low densities in non-tidal rivers and upstream reaches the freshwater rivers, their presence has a significant impact on the use of rivers and riparian areas by the people and livestock. Increasing in frequency of the crocodile sightings in the upper region of Batang Rajang for the past few years had brought concern to the people who live near the river. The people also claimed that the crocodiles were spotted in the area where the animal was not seen before such as in the freshwater section, several kilometers upstream of non-tidal tributaries in upper Batang Rajang. Majority of riverine communities in Rajang RB still rely on the river as a mean of transportation, source of food and incomes.

Therefore, the objectives of this chapter are;

1. To assess the density and distribution of C. porosus in eight rivers representing upper,

middle and lower part of Rajang River Basin.

2. To compare the current density of C. porosus in eight selected rivers in Rajang River

Basin with previous survey.

3. To determine the crocodile habitats, selected water quality parameters and the

abundant of potential food sources for crocodile in the eight rivers of Rajang River

Basin.

4. To determine relationship between crocodile density and distributions with habitats,

selected water quality parameters and the abundant of food sources for crocodile.

4.2 Materials and Methods

4.2.1 Study area

The Rajang River Basin (RB) has drainage area of approximately 51,153 km2 and the length of its main river, Batang Rajang is approximately 760 km. The river basin is located in northwest of Borneo Island and in the central part of Sarawak, next to the Saribas RB and

Oya RB. The Rajang RB originates from the Nieuwenhuis Mountain Range and the upper

Kapuas Mountains in the border of Sarawak-Kalimantan. The main trunk of the Rajang

River flows a relatively straight path before begins to separate into several tributaries starting at the approximate position of the town of Sibu. The distributaries are, from the southwest to northeast, the Rajang, Belawai, Paloh, Lassa, and Igan and these tributaries flow directly into South China Sea (Figure 4.1). Among the major cities and towns can be found along the

Rajang River are Kapit, Song, Kanowit, Sibu, Bintangor and Sarikei. Some other important tributaries of Batang Rajang are the Balleh River, Balui River, Katibas River, Ngemah River and Kanowit River. Large areas of swampy delta can be found in the lower part of Rajang

RB including in Tanjung Manis and Belawai.

The eight rivers and tributaries from upper, middle and lower region of Rajang RB were selected in this study, namely:

1. Igan River 2. Belawai River Lower region 3. Sarikei River 4. Nyelong River 5. Kanowit River Middle region 6. Poi River 7. Ngemah River Upper region 8. Katibas River

A Igan

Rajang River Basin

B Sibu

C Belawai D Sarikei Kanowit E F G

Song Kapit

Lower region

Middle region µ Upper region Kilometers 0 5 10 20 30 40

FigureFigure 4.1: 4.1: Map of of Rajang Rajang River River Basin. Basin (A, Kuala (A ,Igan; Igan B ,River Belawai; B River;, Belawai C, Sarikei River; and NyelongC, Sarikei River; and D, KanowitNyelong River; River; E, Poi D ,River; Kanowit F, River; E, Poi River;Ngemah F, RiverNgemah and G River, Katibas and River) G, Katibas River).

4.2.2 Crocodile survey

Crocodile surveys in eight rivers of Rajang RB were held in Southwest Monsoon (SWM), from the month of March to September 2017. The surveys covered the distance ranged from

10.2 km to 18.0 km, totalling 106 km of linear distance of the rivers (Table 4. 1).

Table 4.1: Details of surveys in eight rivers of Rajang River Basin.

River Date GPS coordinates Survey linear distance (km)

Igan 22nd and 23rd *1 2°49'58.83"N, 111°40'47.36"E 10.2 April 2017 *2 2° 48'05.39"N, 111°44'43.05"E Belawai 25th and 26th *1 2°11'39.87"N, 111°15'55.24"E 10.3 April 2017 *2 2° 16'05.88"N, 111°17'03.34"E Sarikei 24th and 25th *1 2°8'0.1650"N, 111°30'50.51"E 13.8 March 2017 *2 2°2'55.13"N, 111°29'37.70"E Nyelong 26th and 27th *1 2°8'4.97"N, 111°31'30.73"E 11.5 March 2017 *2 2° 4'5.69"N, 111°35'11.32"E Kanowit 30th and 31st *1 2°5'53.16"N, 112°9'28.99"E 18.0 July 2017 *2 2°1'7.70"N, 112°4'28.40"E Poi 2nd and 3rd *1 2°3'31.79"N, 112°16'50.19"E 12.8 August 2017 *2 1°59'20.00"N, 112°15'27.70"E Ngemah 21st and 22nd *1 2°1'28.40"N, 112°23'52.57"E 12.4 September 2017 *2 1° 57'41.48"N, 112°23'53.65"E Katibas 19th and 20th *1 2°0'36.13"N, 112°33'14.10"E 17.0 September 2017 *2 1° 54'32.78"N, 112°33'37.92"E * GPS reading coordinates for (*1) starting point and (*2) end point of the survey

When planning a crocodile survey, several factors need to be considered before choosing the date and time for the survey including tides, moon phase and weather. Hence, daily tides table, information on moon phase periods and weather forecast were assessed carefully. The survey was conducted in spring tide during full moon (or almost full moon). The spring tides

97 are preferable to the neap tide because they exposed more of the riverbank for longer periods.

The survey began on a falling tide (one or two hours before the lowest tide) as this will give the surveyor more time for scanning the bare riverbank. Maximum exposure of bare riverbanks without vegetation during low tide are important as vegetations like nipa and mangrove trees could shields crocodiles from surveyor’s view and spotlight (Abdul-Gani,

2014). Furthermore, a good weather condition with clear sky (although sky in some areas were cloudy) allowed the survey to be carried out smoothly. Heavy rain could disturb the survey process and the visibility are limited in this condition which could resulting crocodiles miss spotted by the surveyors (Fukuda et al., 2013a).

Two days of night survey were carried out in each selected river in the Rajang RB. The survey was started from the starting point in the downstream (the river mouth) and moved towards the designated end point in the upstream (inland). The survey took about 2 to 4 hours to complete, thus counter direction survey from the end point to the starting point was not be able to carry out after the first survey as water level in the river were higher due to incoming tide. The crocodile counting during high tide periods are typically lower as juveniles (hatchling and yearling) normally retire amongst flooded nipa and mangroves while the adult ones might stay in the water or in the higher ground which is more difficult to spot (Abdul-Gani, 2014). After survey in the first night was carried out, the survey was repeated in the next night, covered the same river stretch and distance with the first night survey. Repetitive survey on the consecutive nights could reduce the possibility of double counting of crocodile (Fukuda et al., 2013a). For wider rivers (>500m width) like Belawai and Igan, each sides of the bank were surveyed separately, where the survey commenced

98 from the left side of the bank, then once reached the coordinates of the end points of the survey, the boat turned back and continued the survey along the right side of the bank.

The night spotting technique adapted from Bayliss (1987) and Fukuda et al. (2013a) was used in the survey. The technique involved direct counting of the crocodile at night from the boat using 12 Volt Quartz-Halogen handholds spotlight powered by 12V Fujiya NS60 car battery. A fibreglass boat (size 5m length x 1.2m width x 0.5m height) with a single 30 horse power (hp) engine was used during the survey, operated by an experience boatman. The boat was cruised slowly at 10 to 15 knots throughout the survey distance. Two spotters were assigned to scan both side of riverbank and middle of the river simultaneously, looking for eyes shine. The crocodile’s eye usually will reflect distinctive orange or red colour when the spotlight directed to them. The light beam directed to the glowing eyes often mesmerises crocodile and discourage the animal from moving off. When eye shine was detected, the spotters will slowly and quietly direct the boat towards the eye shine, allowing them to approach the crocodile as close as possible for capturing or at least the observer can approximate the size (total length, TL) or age cohort of the crocodiles. To minimise conflict and bias, only one observer was given the task to estimate the size of the crocodile in all studied rivers.

All crocodiles spotted were categorized according to size class adapted from Bayliss (1987) and Robi (2014) (Table 4.2). If the observer is unable to accurately estimate the size class, the sightings will be recorded as “eyes only” (EO). For crocodile that were detected swimming in the water, estimation of TL only can be made if the whole body (from the head to end of the tail) is visible. If only the crocodile’s head and anterior neck are visible, the

99 head length (HL) / total length (TL) ratio of 1:7 were used to estimate the size of the crocodile, meaning that TL is around 7 times of HL (Fukuda et al., 2013b). Each location of crocodile spotted during the survey were recorded using Global Positioning System

(Garmin GPSmap 60CSX, 2005).

Table 4.2: Size class for crocodile survey (Bayliss, 1987; Robi, 2014).

Class Approximate size Cohort (total body length, m) Hatchling < 0.5 Hatchling 2 0.5 – 1.0 Yearling 3 1.0 – 1.5 Sub-adult 4 1.5 – 2.0 Sub-adult 5 2.0 – 3.0 Adult 6 > 3.0 Adult EO Eyes only Eyes only

4.2.3 River characteristics and landscapes

River characteristic surveys were conducted during daylight involving both left and right sides of the riverbank as in Table 4.1, using stream and habitat assessment data sheets

(Barbour et al., 1996; Iwata et al., 2003; Bolhen, 2017). Five habitat parameters which are bank vegetation, verge vegetation, in-stream cover, bank erosion and stability and the presence of riffles, pools and bends were scored from very poor to excellent for each river.

Related form used in the survey is as in Appendix A1. The guide for scoring is shown in

Table 4.3.

100

Table 4.3: Field guide for river habitat assessment (modified from Barbour et al., 1996; Iwata et al., 2003; Bolhen, 2017).

Habitat Habitat Survey Field Guide parameter Excellent Good Fair Poor Very poor (score = 10) (score = 8) (score = 6) (score = 4) (score = 2) A1 Mainly Mainly native Medium Introduced Introduced (Bank undisturbed vegetation. cover, ground cover, ground cover vegetation) nature Little mixed little native with lots of vegetation. disturbance or native/ under storey bare ground No sign of no sign of introduced. or over storey, occasional site recent site Or one side predominantly tree. Also alteration. disturbance. cleared the introduced includes site other vegetation. with concrete- undisturbed. lined channels.

B1 Mainly Well-vegetated Wide- Very narrow Bare cover or (Verge undisturbed wide verge corridor of corridor of introduced vegetation) nature corridor. mixed native or grass cover vegetation on Mainly native and introduced such as pasture both sides undisturbed exotic, or vegetation. land. river. Verge native one side more than 30 vegetation on cleared, and m wide. both sides of other wide river; some corridor of introduced or native reduced cover vegetation. of native vegetation.

C1 Abundant A good cover Some snags Only slight No cover. No (in-stream cover. of snags, logs or boulders cover. The snags, boulders cover) Frequent or boulders present river is largely submerged or snags, logs or with and/or cleared, with overhanging boulders with considerable occasional occasional vegetation. No extensive areas of in- areas of in- snags and undercut areas of in- stream and stream or very little in- banks. Site stream, overhanging overhanging stream may have rock aquatic vegetation. vegetation. vegetation. or concrete vegetation Generally, no lining. and overhanging overhanging vegetation. bank.

101

Table 4.3 continued

D1 Stable, no Only spot Localized Significant Extensive or (Bank erosion/ erosion erosion active erosion almost erosion sedimentation occurring. evident. A evident continuous and evident. No Little relatively especially erosion. Over stability) undercutting undercutting good during high 50% of bank of banks, of bank, good vegetation flows. have some usually vegetation cover. No Unstable form of gently bank cover, usually continuous extensive erosion; very slopes, lower gently bank damage to areas of bare unstable with banks slopes, no bank banks, little little covered with significant structure or vegetation vegetation roots mat damage to vegetation. cover. cover. grasses, reed bank structure. or shrubs.

E1 Wide variety Good variety Some Only slight Uniform (Riffles, of habitats. of habitat - variety of variety of habitat. pools and Riffles and e.g., riffles and habitat- e.g., habitat. All Straight bends) pools present pools or bends occasional riffle or pool stream, all of varying and pools. riffle or with only shallow riffle depths. Bends Variation in bend. Some slight in or pool of present. depth of riffle variation in depth. uniform- e.g., and pool. depth. channelled stream or irrigation channel.

All scores then were sum up and each river was categorized according to the total score. The stream habitat category is shown in Table 4.4.

Table 4.4: Scores for stream habitat category (modified from Barbour et al., 1996; Iwata et al., 2003; Bolhen, 2017).

Scores Stream Habitat Category 36 – 40 Excellent – Site in natural or virtually natural condition; excellent condition. 29 – 35 Good – Some alteration from natural state; good condition. 20 – 28 Fair – Significant alteration from the natural state but still offering moderate habitat; stable. 12 – 19 Poor – Significant alteration from the natural state, with reduced habitat value; may have erosion or sedimentation problems. 8 - 11 Very poor – Very degraded, often with severe erosion or sedimentation problems.

102

Other characteristics were observed and determined during the field sampling (Montague,

1983; Messel & Vorlicek, 1986) as in Table 4.5.

Table 4.5: Characteristics observed and recorded in each river during field sampling (Montague, 1983; Messel & Vorlicek, 1986).

Characteristic Details i. Type of river/ The river surveyed was categorized either as main river, tributary water or small stream. Water type of the river was also determined either it is salt water, brackish water, black water or freshwater. ii. Distance from Coordinates for the river/ tributary were recorded using GPS. sea These coordinates were used to estimate the distance of the river/tributary from sea. iii. Width and depth Width and depth of the rivers were measured using Bushnell Elite of the river 1500 range finder and Hondex PS-7 portable depth sounder. iv. Tidal influence Influence of tide toward the river was determined (tidal or non- tidal). v. Riverbank Riverbank characteristics include riparian vegetation and major characteristics forest types (mangroves, peat swamp, limestone, Kerangas, Mixed dipterocarp forest) along the riverbank of the river were determined and recorded including dominant plants species. Canopy covers of the river were also observed (shaded, open, or partly shaded/open). vi. Land use Activities which can directly and indirectly give impact upon river habitats such as human settlements (city, small towns, villages, longhouses, schools), agricultural areas (estates, farms, aquaculture plots), industrial (factory, saw mill, logging site) and developments (bridges, boat/ferry terminal or jetty, waterfronts, shops) were recorded in each river.

103

4.2.4 Selected water quality parameters

Salinity, water temperature and pH were measured in situ using portable equipment at all study sites (rivers and tributaries) in the Rajang RB including the intersection of tributary from the main river up to the upper stream of the tributary. In each river, five stations were selected for water quality assessment. The temperature and pH were measured using Hanna

HI 8314 pH meter, and salinity was measured using Atago PAL-06S refractometer. Latitude and longitude of the site for water sampling were recorded using Global Positioning System

(Garmin GPSmap 60CSX, 2005).

4.2.5 Potential aquatic food resources for crocodiles

The abundance of possible food resources for crocodile in the river was estimated via Catch per Unit Effort (CPUE) approach (Hassan et al., 2016). Fish captured method used three- layer gill net (length and drop: 15m x 1.5m; stretch mesh size: 1.2 cm and 7.5 cm; deployment time: depends on tide) had been carried out accordingly in each studied river.

The gill net was deployed for 2 to 5 hours and the duration of deployment was recorded. The samplings were repeated three times in all of the 8 studied rivers except for Ngemah and

Katibas River where the samplings were repeated twice. Locations of the gill nets deployed were recorded using Global Positioning System (Garmin GPSmap 60CSX, 2005). The coordinates of the location where the gill nets were deployed are as in Appendix A5 (see page 236).

104

Fish catch were examined and identified to species level using FishBase database

(http://www.fishbase.org) and other available references (Parenti & Lim, 2005). The value of CPUE was calculated using formula:

Catch per unit effort, CPUE = Total catch (kg) Sampling duration (hours)

4.2.6 Data analysis

Analysis of the crocodile density followed Bayliss (1987) and Fukuda et al. (2013). The mean relative density was calculated using formula;

푛 Mean relative Density = 푑

Where,

n = total number of crocodiles d = total linear distance of surveyed waterway

Comparison of crocodile density in Rajang RB was carried out between the data obtained during this study and data surveys by Robi (2014). Robi (2014) had conducted surveys in several rivers in Rajang RB covering the same six rivers with the present study, namely Igan,

Sarikei, Nyelong, Poi, Ngemah and Katibas Rivers.

105

Maps of crocodile distribution in each surveyed river were generated using ArcMap in

ArcGIS 10.2 software (ESRI Inc, USA). Each GPS coordinates of crocodile sighting were plotted into the maps along with the locations of human settlements (towns, villages and longhouses), agricultural areas and riverbank land use developments, e.g., bridge, constructions, ferry terminal, logging camps etc. observed during the survey.

All ecological data collected in this study were recorded in the Microsoft Excel and used in generating descriptive statistics (mean and standard deviation). One-way ANOVA were performed using Minitab version 17 (Minitab Inc., USA) to determine if there is any significant difference of the mean of selected water quality parameters among the rivers and tributaries in the Rajang RB. If significant different is found, post-hoc based on Tukey’s was used in the analysis to compare the variation in selected water quality parameters among the rivers.

The principal component analysis (PCA) was performed using OriginPro version 9

(OriginLab Corporation, USA) to assess the relationship between the density of crocodile with selected environmental variables, habitat and food abundance. To determined which combination of variables that could have influence on the density of crocodiles, General

Linear Model (GLM) analysis was performed using Minitab version 17 (Minitab Inc., USA).

The environmental variables were represented by three physicochemical parameters namely salinity, pH and temperature. In addition, the potential food abundance and habitat for crocodile used data CPUE and habitat scoring recorded in the surveys were also involved in

PCA and GLM analyses.

106

4.3 Results

4.3.1 Crocodile density

A total of 100 crocodiles were spotted during the surveys in eight rivers and tributaries of

Rajang RB (Table 4.6). The crocodiles were found (at least one individual) in all surveyed rivers except for the Kanowit River where no crocodile was spotted during the two night surveys. The highest number of crocodiles spotted in the survey was in Igan and Sarikei

River both with 14 individuals, respectively.

The highest number of crocodiles belonged to size class ‘Hatchling’ (TL < 0.5m) with 33 individuals, significantly higher (p < 0.05) compared to other size class except for the ‘Eye

Only’ (EO) (p = 1.000) and ‘Class 2’ (p = 0.166) (Table 4.6). The EO was the second highest with 31 individuals, followed by ‘Class 2’ (0.5m < TL < 1.0m) (n = 16 individuals), ‘Class

3’ (1.0m < TL < 1.5m) (n = 12 individuals) and ‘Class 4’ (1.5m < TL < 2.0m) (n = 4 individuals). The Crocodile in Class 5 with size (TL) from 2 m – 3 m was the lowest number of individuals sighted in this study with 3 individuals. There is no crocodile found in the surveys has the size (TL) more than 3 m (Class 6).

The mean relative density of crocodile in the surveyed rivers (except for Kanowit River) was ranged from 0.06 to 1.32 individuals/km (Table 4.6). Igan River recorded the highest density of crocodile with 1.32 ± 0.07 individuals/km and significantly different (p < 0.05) with other rivers except for Belawai River (p = 0.087). While, the lowest density of crocodile recorded in Katibas River with the value of 0.06 ± 0.00 individuals/km, significantly different (p <

0.05) with other rivers except for Ngemah River (p = 1.000) and Poi River (p = 0.832).

107

Table 4.6: Relative density of C. porosus in eight tributaries of Rajang River Basin.

River Survey Number of crocodiles Total Relative Average day according to size class* number of density density H 2 3 4 5 6 E individuals (individual (individual O s/km) s/km) Igan 1 3 3 3 1 1 - 3 14 1.37 1.32 ± 0.07 2 4 2 1 1 - - 5 13 1.27 Belawai 1 4 2 1 - 2 - 3 12 1.17 1.07 ± 0.14 2 5 2 1 - - - 2 10 0.97 Sarikei 1 4 3 2 2 - - 3 14 1.01 0.94 ± 0.11 2 5 2 1 - - - 4 12 0.86 Nyelong 1 2 1 1 - - - 4 8 0.69 0.74 ± 0.06 2 4 1 2 - - - 2 9 0.78 Kanowit 1 ------0 0 0 2 ------0 0 Poi 1 1 - - 1 - - - 2 0.16 0.16 ± 0.00 2 1 - - - - - 1 2 0.16 Ngemah 1 ------1 1 0.08 0.08 ± 0.00 2 ------1 1 0.08 Katibas 1 ------1 1 0.06 0.06 ± 0.00 2 ------1 1 0.06 Total 33 16 12 5 3 0 31 100

Table 4.7 summarizes data of crocodile density in Rajang RB in 2014 and the density data recorded in the present study.

Table 4.7: Comparison density of crocodile between survey in 2014 and 2017 (present study).

River Crocodiles density (Individuals/km) 2014* 2017 Igan 0.53 1.32 Belawai NA 1.07 Sarikei 1.26 0.94 Nyelong 1.19 0.74 Kanowit NA 0 Poi 0 0.16 Ngemah 0.07 0.08 Katibas 0.04 0.06 *Data from survey done by Robi (2014). NA, data is not available.

108

In general, the rivers in the study area recorded an increase in crocodile density from 2014 to 2017 except for Sarikei and Nyelong Rivers. Comparison between the density of crocodile in 2014 and 2017 cannot be done in Belawai and Kanowit River as both rivers were not included in the 2014 surveys. Igan River recorded the highest increase in crocodile density

(149%) among the rivers in the study area, changing from 0.53 individuals/km in 2014 to

1.32 individuals/km in 2017. While, the lowest increase is in Ngemah River with 14%, changing from 0.07 individuals/km in 2014 to 0.08 individuals/km in 2017 (Table 4.7). The two rivers surveyed in Sarikei district, Sarikei and Nyelong River, recorded a decline in crocodile densities with a reduction for about 25% in Sarikei River, from 1.26 individuals/km in 2014 to 0.94 individuals/km in 2017, and 38% in Nyelong River, from

1.19 individuals/km in 2014 to 0.74 individuals/km in 2017.

The survey in 2014 in Poi River covered up to 10.3 km in distance had recorded zero crocodile in the river. However, the 12.8 km survey in 2017 spotted 2 crocodiles in the river with the density of 0.16 individuals/km. Meanwhile, surveys in 2014 covered 14.6 km distance of Ngemah River and 25 km distance of Katibas River had recorded one crocodile was spotted in both rivers, respectively. Similarly, after three years, the same observation was recorded, one crocodile was spotted in both of the rivers, respectively. The two rivers that were not included in 2014 surveys recorded a density of 1.07 individuals/km in Belawai

River, while, in Kanowit River, recent survey showed negative result (no crocodile spotted).

109

4.3.2 Distribution of crocodile in selected rivers of Rajang River Basin

The distribution of crocodiles spotted during the surveys in eight rivers within the Rajang

RB were shown in maps in Figure 4.2 until Figure 4.8.

Igan

Igan River Location where the gill net was deployed

Figure 4.2: Map showing the survey area in Igan River. Each circle indicates the location of crocodile sighted during the survey and different colours in the circle represent different size class.

Majority of the crocodiles in Igan River were spotted in areas near to the river mouth (Figure

4.2). Two of them were sighted in the area near to a sandy beach at the mouth of the river.

Three crocodiles including a sub-adult were also spotted in the muddy bank adjacent to Igan village, which is also located at the river mouth. In addition, an adult with a size of approximately 2-3 m, was sighted swimming in the middle of the river, about less than a hundred meters from Igan village.

110

Location where the gill net was deployed

Belawai

Figure 4.3: Map showing the survey area in Belawai River. Each circle indicates the location of crocodile sighted during the survey and different colours in the circle represent different size class.

In Belawai, crocodiles were found concentrated in various spots, primarily at the area near to the mouth of smaller tributaries or streams (Figure 4.3). All of the crocodiles were spotted at the river bank or in shallow water at the river’s edge except for the two adult crocodiles who were sighted in the middle of the river. Crocodiles were spotted in close proximity to each other, comprising of at least one mature (sub-adult and adult) and several young crocodiles (hatchlings and yearlings) or just all young crocodiles.

111

Batang Rajang

Sarikei

Nyelong River

Sarikei River Location where the gill net was deployed

Figure 4.4: Map showing the survey area in Sarikei River and Nyelong River. Each circle indicates the location of crocodile sighted during the survey and different colours in the circle represent different size class.

In Sarikei River, a crocodile was first sighted approximately three to four kilometers from the river mouth and no crocodiles were found in the areas near to Sarikei town (Figure 4.4).

More crocodiles were found in less human populated and development areas further upstream. Several sightings of young crocodiles close to each other were also recorded in one or two areas during the survey. Meanwhile in Nyelong River, at least three crocodiles comprising of two sub-adult and a hatchling were spotted in the area near to Nyelong Bridge, about two kilometers from the river mouth (Figure 4.4). The rest of the crocodiles were found in further upstream. Four crocodiles were spotted in area near to oil palm plantations.

112

Kanowit

Kanowit River Location where the gill net was deployed

Figure 4.5: Map showing the survey area in Kanowit River. No crocodile sighting was recorded during the survey.

There was no crocodile sighted in Kanowit River during the survey period (Figure 4.5).

However, this could not mean that the Kanowit River is crocodile-free. After the survey period, a sub-adult crocodile, size about 1.5m to 2.0 m, were spotted in the Batang Rajang, about less than one kilometer distance from mouth of Kanowit River (Figure 4.5). According to local fishermen, they had seen crocodiles in Kanowit River, thus their claims could provide clues about the presence of crocodiles in the river. Local fishermen use the river in regular basis, thus they know the river very well and the possibility for them to encounter with crocodile (if it presents in the river) is high.

113

Batang Rajang

Poi River

Location where the gill net was deployed

Figure 4.6: Map showing the survey area in Poi River. Each circle indicates the location of crocodile sighted during the survey and different colours in the circle represent different size class.

In contrast to the Kanowit River, two crocodiles were recorded during the surveys in Poi

River. The two crocodiles found were a hatchling and a sub-adult, spotted in less than 5 km from the mouth of the tributary (Figure 4.6). The local fishermen also claimed that crocodiles in Poi River are commonly found in the downstream area, not far from the mouth. It was also noted that the hatchling spotted in the survey was in the area near to a school and a longhouse in Poi River (Figure 4.6).

114

Batang Rajang

Ngemah River

Location where the gill net was deployed

Figure 4.7: Map showing the survey area in Ngemah River. Each circle indicates the location of crocodile sighted during the survey and different colours in the circle represent different size class.

One crocodile was recorded in Ngemah River, approximately one kilometer from its river mouth (Figure 4.7). The surveyor was unable to estimate the size or cohort of the crocodile, thus the crocodile falls into ‘eyes only’ category. No other crocodile was detected further deep into the upper section of the river before reaching to the end point of the survey.

115

Batang Rajang

Song

Location where the gill net was deployed Katibas River

Figure 4.8: Map showing the survey area in Katibas River. Each circle indicates the location of crocodile sighted during the survey and different colours in the circle represent different size class.

Similar to Ngemah River, survey in Katibas River also recorded only one sighting of crocodile (Figure 4.8). The crocodile, which was categorized as ‘eyes only’ was spotted near to Katibas Bridge, about two kilometers from the river mouth. There was no sign of a crocodile in further upstream areas.

116

4.3.3 River characteristics and landscapes

Based on the stream habitat assessment, five out of eight studied rivers were categorized as

“Fair” habitat conditions and another three rivers assessed as “Good” habitat condition

(Table 4.8). Details of river characteristics are as in Appendix A2 until A3 (see page 224 -

227).

Table 4.8: Stream habitat assessment and its score for each river in study area of Rajang River Basin.

River River Habitat Assessment A1 B1 C1 D1 E1 Total Score Category Igan 6 5 3 4 3 21 Fair Belawai 6 5 3 4 3 21 Fair Sarikei 6 5 4 5 3 23 Fair Nyelong 5 5 4 5 3 22 Fair Kanowit 6 5 4 5 5 25 Fair Poi 8 6 6 6 7 33 Good Ngemah 7 6 6 5 6 30 Good Katibas 7 6 5 5 6 29 Good *(A1, Bank vegetation; B1, Verge vegetation; C1, In-stream cover, D1, Bank erosion and stability; E1, Riffles, pools and bends)

The three rivers that were categorized as “Good” condition, Poi, Ngemah and Katibas River, were located at the middle and upper regions of the Rajang RB. These rivers scored between

29 to 33 points which indicated that the rivers have less alteration from their natural states.

Out of 8 studied rivers, Poi, Ngemah and Katibas River are not influenced by tidal. The rivers are dominated by a variety of habitats (riffle, pool and runs) with various depth and width. The depths of the rivers are ranging from 5.1 m to 7.8 m (average = 6.14 ± 1.36 m) in Poi River, 5.8 m to 7.6 m (average = 6.50 ± 0.69 m) in Ngemah River and 2.0 m to 10.8

117 m (average = 5.98 ± 3.35 m) in Katibas River. Meanwhile, the widths of the rivers are ranging from 55 m to 20 m (average = 40 ± 12.75 m) in Poi River, 170 m to 30 m (average

= 66 ± 59.10 m) in Ngemah River and 145 m to 90 m (average = 118 ± 20.80 m) in Katibas

River. The rivers have brackish type of water about several kilometers near the river mouth before reaching the fresh water further upstream. The bottom and riverbank substrates in these three rivers are sands, gravels and pebbles especially for the area located upstream.

While at the downstream, it was dominated by sandy and muddy type of riverbank. Riparian vegetation along riverbanks are dominated by trees, grasses and shrubs with the presence of overhanging vegetation in certain areas. The canopy covers for the Poi, Ngemah and Katibas

River are partly shaded especially in upstream area.

Almost all of the rivers that were categorized as “fair” habitat located in lower region of

Rajang RB (Igan, Belawai, Sarikei and Nyelong River) except for Kanowit River (middle region). The scores for habitat condition for these rivers varied in between 20 to 25 points.

Rivers fall into this category show notable alterations from natural state but still offering moderate and stable habitat for surrounding organisms. The highest score in this category was Kanowit River with 25 points. Similar to its neighbouring tributary Poi River, brackish water can be found up to several kilometers from the mouth of Kanowit River before reaching the fresh water further upstream. The river also has diverse habitats including riffle, pools and runs with variation in depths, ranging from 8.1 m to 12.7 m (average = 10.86 ±

2.15 m) and widths, ranging from 265 m to 60 m (average = 118 ± 83.41 m). Riverbank characteristics and riparian vegetation in the Kanowit River are almost similar with Poi

River, except more areas at the riverbank were cleared for residential and industrial purposes as well as for agriculture. The Kanowit River is largely cleared with only certain areas were

118 covered with canopy. There are also very little in-stream vegetation can be found along the river.

Sarikei and Nyelong River scored 23 and 22 points in stream habitat assessment, respectively. Located at the lower region of Rajang River, the water in the rivers is brackish with slight variety of habitats like pools and runs. The depths of the rivers are ranging from

6.7 m to 12.5 m (average = 8.32 ± 2.38 m) in Sarikei River, while the depths of Nyelong

River are ranging from 5.6 m to 10.7 m (average = 8.36 ± 1.82 m). The widths of Sarikei

River are ranging from 210 m to 40 m (average = 94 ± 68.04 m) and in Nyelong River, the widths are ranging from 240 m to 60 m (average = 122 ± 70.59 m). Large areas at the muddy riverbank of Sarikei and Nyelong River are covered by Nypa trees. The rivers are largely cleared, with occasional snags and very little in-stream vegetation. Generally, both rivers have open type of canopy and no overhanging vegetation.

The rivers that have the lowest score in stream habitat assessment are Igan and Belawai

Rivers with 21 points. Both of the rivers are located at the estuary of Rajang RB, hence saltwater and brackish water are abundant in the rivers. Igan and Belawai Rivers have relatively large waterway and offer relatively low number of habitats includes riffles, runs or pools with limited variations in depths and width of the rivers. The depths of the rivers ranging from 13.3 m to 15.8 m (average = 14.28 ± 0.96 m) and 14.3 m to 16.2 m (average =

15.20 ± 0.71 m) for Igan and Belawai River, respectively. The widths of the rivers are ranging from 1,670 m to 915 m (average = 1238 ± 335.20 m) in Igan River, while the depths of Belawai River are ranging from 1,400 m to 560 m (average = 862 ± 356.82 m). Pine trees,

Casuarina equisetifolia, dominated the sandy beach areas at the mouth of both rivers, while

119 further upstream the riverbank was covered by mangroves vegetation and Nypa trees. Both of the rivers also have open type of canopy, low or absent of in-stream vegetation and no overhanging vegetation.

Human activities such as human settlement, riverbank clearance and developments can cause directly and indirectly impact on river habitats as well as the crocodile populations. Details of riverbank development and land use recorded during field sampling in eight studied rivers in Rajang RB as in Appendix A3 (See page 226 - 227). Based on observations, these human activities vary among the rivers in the study area. Several towns can be found at the river mouth of the studied rivers such as Sarikei in Nyelong and Sarikei River, Kanowit in

Kanowit River and Song in Katibas River (Figure 4.4, Figure 4.5 and Figure 4.8). Man-made buildings such as waterfronts, jetties, houses, shops and factories in this area are typically built near to the river. River traffics in this area are constantly high especially during the daylight because people prefer to use water transportation to travel to and from the town.

Remote areas especially in Kanowit (e.g., in Ulu Ngemah, Ulu Poi) and Song (e.g., in Ulu

Katibas) districts are not yet connected by roads, thus for these people boats are the only mean of transportation to travel to another place or town. While in Sarikei, although most of areas were connected by roads, some of the locals prefer to use boat as it is the quickest and cheapest way to travel to the town. Boats can be seen moving in and out from jetty or boat terminal in Kanowit, Song and Sarikei Town. In Igan River, ferries operate from early morning until night, transporting people and vehicles crossing both sides the river.

In Igan and Belawai Rivers, several villages can be found along the rivers and fishing is among the main activities in these villages (Figure 4.2 and Figure 4.3). Fishing activities in

120 these rivers are relatively high and the fishermen typically used various types of fishing vessels, from small single engine boats to big fishing vessels, to catch fish in the river and coastal area. The fishermen use several methods of fishing including cast nets and gill nets, which could be seen set up by the fishermen along the river.

Riverbank clearance for developments or agriculture activities were observed in several rivers in the study area during the surveys. At least one concrete bridge was built across the rivers in the study areas except for Igan and Belawai. In Kanowit, constructions of concrete bridges occurred not far from the towns and at the time of the survey, the works had been on-going for more than two years. The constructions of the bridges were completed at end of 2017. There was also a logging camp sighted in Kanowit River during the survey and it is believed that several more camps can be found further upstream. Logs from these camps are usually transported to factories by towing boats using the river. A large-scale palm oil plantations estate own by a private company were found in Nyelong. Several small-scale agriculture plots planted with paddy, pepper, fruits, vegetables and other cash crops plants could be seen near to residential areas at the bank of Sarikei, Kanowit, Poi, Ngemah and

Katibas Rivers.

Poi and Ngemah River is relatively quieter and less busy compared to other rivers in the study area. There are less developments at the riverbanks and not many villages/longhouses can be found along the rivers (Table Appendix A3, see page 227). In Poi River, two houses were found about less than 5 km from river mouth, while in further upstream, not more than

6 villages/longhouses were found within the survey distance (Figure 4.6). Meanwhile in

Ngemah River, Ngemah village was located near to river mouth and not less than 5

121 villages/longhouses can be found throughout the survey distance in the river (Figure 4.7).

There also one primary school located near to river in Poi and Ngemah River. The local communities in Poi and Ngemah River are less dependent on the river for water sources and transportation as they already have access to clean tap water and electricity and their houses were connected to Kanowit Town and other areas via roads. Fishing activities in Kanowit,

Poi, Ngemah and Katibas Rivers are considered medium to low as the people who live near these rivers are still depending on the river for food resources and incomes.

4.3.4 Selected water quality parameters

The detail measurements for water quality parameters and statistical analysis result are as in

Appendix A4 (see page 228 - 229). The mean values of salinity recorded for selected rivers and tributaries of Rajang RB ranged from 19.80 ± 1.94 ppt to freshwater (no salinity reading detected) (Table 4.9). The water in the two rivers, Ngemah and Katibas is freshwaters, which indicated by the absence of saline water flow through the rivers. Both rivers are located at the upper region of Rajang RB. Igan River recorded the highest salinity with mean reading of 19.17 ppt and shows significant different (p < 0.05) with other rivers except for Belawai

River (p = 0.842).

122

Table 4.9: Selected water quality parameters measured in-situ for rivers and tributaries of Rajang River Basin.

River Salinity, ppt pH Temperature, ºC

Igan L 19.00 ± 2.54 6.42 ± 0.43 26.82 ± 0.34

Belawai L 16.26 ± 5.55 7.53 ± 0.11 29.70 ± 0.12

Sarikei L 6.06 ± 5.67 5.63 ± 0.22 29.72 ± 0.35

Nyelong L 1.99 ± 1.87 5.25 ± 0.16 29.26 ± 0.32

Kanowit M 0.88 ± 0.68 6.81 ± 0.21 27.36 ± 0.11

Poi M 0.47 ± 0.87 7.22 ± 0.15 27.24 ± 0.09

Ngemah U 0.00 ± 0.00 6.98 ± 0.07 25.44 ± 0.09

Katibas U 0.00 ± 0.00 7.02 ± 0.07 25.38 ± 0.11

*L=Lower region; M=Middle region; U=Upper region of Rajang River Basin

Five out of eight rivers showed slightly acidic condition (pH < 7) except for Belawai, Poi and Katibas (Table 4.9). The mean value of pH for all the rivers ranged from 5.25 ± 0.16 to

7.53 ± 0.11, with the highest pH recorded at Belawai River with mean value of 7.53 and significantly higher than pH value of other rivers (p < 0.05) except for Poi River (p = 0.300).

Meanwhile, Nyelong River is significantly more acidic than the other rivers with a mean pH of 5.23 (p < 0.05) except for Sarikei River (p = 0.111).

The mean values of water temperature for selected rivers and tributaries of Rajang RB were ranged from 25.38 ± 0.11 ºC to 29.72 ± 0.35 ºC (Table 4.9). Sarikei River recorded the

123 highest mean of water temperature with 29.72 ºC, significantly higher compared to other rivers (p < 0.05) except for Belawai River (p = 1.000). The mean value of water temperature recorded at Katibas River (25.38 ºC) was significantly lower compared to other rivers (p <

0.05) except for Ngemah River (p = 1.000).

4.3.5 Aquatic food resources for crocodile

Based on Figure 4.9, the highest CPUE was recorded in Belawai River, with mean catch

0.97 ± 0.28 kg/hour and significantly higher (p < 0.05) compared to other rivers except for

Igan River (p = 0.919). In contrast, Sarikei River recorded the lowest mean catch with 0.12

± 0.07 kg/hour, but shows no significantly different (p > 0.05) with other rivers except for

Igan (p = 0.001) and Belawai (p = 0.000). The statistical analysis results as in Appendix A6

(see page 237 - 238).

124

1.0

0.8

0.6

0.4 CPUE (kg/hour) CPUE

0.2

0.0 Belawai Igan Poi katibas Nyelong Ngemah Kanowit Sarikei River

Figure 4.9: Catch per unit effort (CPUE) at eight rivers in Rajang River Basin.

Table 4.9 summarizes the species list of fish and invertebrates caught during the surveys, which were potential food sources of C. porosus in the study areas.

125

Table 4.10: List of fish and invertebrates caught in Rajang River Basin that may be the potential food source of the C. porosus. (symbol +, represent the species was caught in the river).

Family Species Local name River Iga Bel Sar Nye Kan Poi Nge Kat Ariidae Arius microcephalus Ikan belukang + Nemapteryx caelata Ikan duri + + Bagridae Bagroides melapterus Ikan baung pisang + Carcharhinidae Carcharhinus borneensis Ikan yu + Chandidae Ambassis kopsii Ikan tibak belai + + + + + Cyprinidae Puntioplites bulu Ikan mengalan/ kepait + + + Luciosoma setigerum Ikan nyua + + Engraulidae Setipinna breviceps Ikan empirang + + Setipinna melanochir Ikan empirang sirip gelap + Setipinna taty Ikan empirang janggut + Coilia macrognathos Ikan gonjeng + + Mugilidae Chelon subviridis Ikan belanak/kembura + Pangasiidae Pangasius micronemus Ikan buris + + + + + + Plotosidae Plotosus canius Ikan semilang + Polynemidae Eleutheronema tridactylum Ikan senangin + Pristigasteridae Ilisha elongata Ikan popot + + + Ilisha megaloptera Ikan beliak mata + Sciaenidae Johnius spp. Ikan gelama + + + + Scatophagidae Scatophagus argus Ikan ketang + Siluridae Kryptopterus lais Ikan lais/ layah bongkok + Soleidae Archiroides melanorhynchus Ikan daun/ lidah/ sebelah + Stromateidae Pampus argenteus Ikan kilat + Trichiuridae Trichiurus lepturus Ikan timah selayur/layur +

Penaeidae Penaeus spp. Udang + + + + *Iga = kuala Igan, Bel = Belawai, Sar = Sarikei, Nye = Nyelong, Kan = Kanowit, Poi = Poi, Nge = Ngemah, Kat = Katibas River

126

A total of 23 species of fishes and one type of invertebrate representing 18 different families were caught from all the rivers in the study area in Rajang RB (Table 4.10). The highest variety of fish species caught in a river was in Belawai River (13 species), followed by Igan and Nyelong River where both of the rivers recorded six species of fish respectively.

Pangasius micronemus from Family Pangasiidae or locally known as “Ikan buris” have been caught in six rivers (Sarikei, Nyelong, Kanowit, Poi, Ngemah and Katibas River) out of eight rivers in the study area. Commercial fish species had also been caught in the surveys, including from species Setipinna (“Ikan empirang”), Coilia macrognathos (“Ikan gonjeng”),

Ilisha elongata (“Ikan popot”) and Pampus argenteus (“Ikan kilat”). The only invertebrate caught in the survey was from Family Penaeidae or locally known as “udang” and the prawn was caught in Igan, Belawai, Kanowit and Poi River.

4.3.6 Relationship between crocodile density, habitat, water quality parameter and

the abundance of food resources for crocodiles

Pearson’s correlation analysis between crocodile density, water quality parameters and the abundance of food resources for crocodile (CPUE) is shown in Table 4.11. The correlation analysis shows that the crocodile density was significantly and positively correlated with salinity of the river (p < 0.05). The analysis also shows positive correlation between crocodile density with temperature and the abundant of food sources (CPUE) but not significant. Meanwhile, habitat scoring shows significant negative correlations with the crocodile density, while for pH the analysis was insignificantly and negatively correlated with the crocodile density.

127

Table 4.11: Pearson’s correlation between crocodile density, water quality parameters, habitat and the abundance of food resources for crocodile (CPUE).

Salinity pH Temperature CPUE Habitat Crocodile 0.884* -0.350 0.609 0.613 -0.816* Density (P = 0.003) (P = 0.395) (P = 0.109) (P = 0.106) (P = 0.013) *Correlation is significant at the 0.05 level (2-tailed test of significant)

The PCA analysis result of the crocodile density, water quality parameters and CPUE at all river in the study area is best explained by principal component 1 and 2 with 59.22% and

28.71% of the variance respectively, totalling 87.95% (Table 4.12).

Table 4.12: Summary for PCA analysis for the crocodile density, water quality parameters, habitat and CPUE.

Principal Eigenvalue Percentage of Cumulative Percentage component Variance of Variance 1 3.553 59.22% 59.22% 2 1.722 28.71% 87.93%

Based on the PCA ordination bi-plot (Figure 4.10), salinity and CPUE have large positive loading on principal component 1 alongside with the crocodile density, represented on the right of the diagram. This could suggest that the salinity of the water and the abundance of the food sources are among the main factors that influenced the density of crocodile in the rivers. Rivers located at the mouth of Rajang RB, Belawai and Igan River, were mainly loading close on salinity, CPUE and crocodile density (red circle).

128

-0.5 0.0 0.5 2 pH Belawai CPUE 0.5

Salinity Poi Katibas Kuala Igan Habitat Ngemah 0 0.0 Kanowit Crocodile Density

Temperature

-0.5 Principal Component 2 Component Principal

Nyelong -2 Sarikei

-2 0 2 Principal Component 1

Figure 4.10: PCA ordination bi-plot of eight rivers of Rajang River Basin with crocodile density, habitat, water quality parameters (Salinity, pH and Temperature) and food resources for crocodile (CPUE).

129

General Linear Model (GLM) analysis showed similar finding with the results in PCA analysis. Two variables, salinity (F = 21.35, df = 1, P = 0.004) and habitat (F = 11.97, df =

1, P = 0.013) had significant influence on density of crocodile (Table 4.13). However, there is no combination of variables that had significant influence on the density of crocodile. The highest F-value was the combination between temperature and the abundant of food sources

(CPUE) but the value is statistically not significant (F = 7.42, df = 1, P = 0.053).

Table 4.13: Summary for GLM analysis for the water quality parameters, habitat and CPUE in response with crocodile density.

Variables F-value df P-value (or combine) Salinity 21.35 1 0.004* Temperature 3.53 1 0.109 pH 0.84 1 0.395 CPUE 3.61 1 0.106 Habitat 11.97 1 0.013* Salinity * Temperature 1.83 1 0.248

Salinity * pH 1.03 1 0.368

Salinity * CPUE 2.32 1 0.202

Salinity * Habitat 1.62 1 0.272

Temperature * pH 4.68 1 0.096

Temperature * CPUE 7.42 1 0.053

Temperature * Habitat 0.09 1 0.777

pH * CPUE 1.12 1 0.350

pH * Habitat 1.62 1 0.272 CPUE * Habitat 0.25 1 0.646 * Significant at P < 0.05.

130

4.4 Discussion

The crocodile densities in the study areas recorded an increase between 14% to 149% compared to Robi (2014), except for two rivers Sarikei and Nyelong. Sarikei and Nyelong

River recorded a decline in densities with a reduction between 25% to 38%. Meanwhile, with no previous crocodile survey in Belawai and Kanowit River, density comparison could not be done for both rivers. Therefore, the survey result for both rivers can be use as baseline data for future survey. This study did not apply correction for visibility bias (correction factor), therefore the results were only expressed as relative density rather than absolute density which means that the figures only represent the number of crocodiles sighted within the length of river surveyed, rather than the total number of crocodiles in the entire river

(Bayliss, 1987). However, relative density could help in assessing trend in crocodile populations as the data can be compared with previous data in the same stretch of river. The results in this study are coherent with the increasing densities recorded by SFC and FDS in several others rivers in Sarawak such as Samunsam River, Samarahan River, Suai River,

Baram River and Limbang River (Sarawak Forestry Corporation, 2018). The rising densities of crocodile in rivers in Sarawak are an indication of the recovery of the crocodile populations (Fukuda et al., 2011).

The presence of crocodiles in almost all of surveyed rivers in the present study suggests that crocodiles are well distributed throughout the Rajang RB including in the lower, middle and upper region of the river basin. However, the density of crocodile differs according to the regions; densities in rivers in the lower Rajang RB were ranging from 0.74 to 1.32 individuals/km, relatively higher compared to the densities of crocodile in rivers in the

131 middle and upper regions (0.06 to 0.16 individuals/km). Similar results were recorded by

Robi (2014) in his survey in Rajang where density of crocodile in rivers in lower Rajang were around 0.22 to 1.26 individuals/km, while in upper region, the densities were ranging from 0.04 to 0.07 individuals/km. Saltwater crocodiles are typically live in saline waterways near to the coastal areas (Webb et al., 2010), however the sighting of a crocodile in Katibas

River in Song districts, about 180 km away from the estuary of Rajang River in the present survey, confirmed the presence of crocodiles in the tributaries of upper regions of Batang

Rajang. This scientific document confirms the local people’s claims about the presence of crocodiles, therefore the relevant agencies should be cautious and be ready with the possible

HCC in the areas.

Recent survey in Kanowit River showed zero relative density (no crocodile spotted) and with no survey was conducted in the river in 2014, it seems that the crocodile is probably either absent or if present, the numbers are very low. However, this is not necessarily mean that there are no crocodile population in Kanowit river. The result only represents the number of crocodiles sighted within the length of river surveyed in that particular time, not the absolute density or total population in the river. Several factors might influence the result. In addition, based on the interviews with local fishermen, they insisted that although the crocodile is rarely to be seen in Kanowit River lately, they believed that the crocodile is present in the river. There is a possibility that the spotter missed out crocodiles during the survey or the crocodiles regularly move in and out of the Kanowit River to the main river of Batang

Rajang. The crocodiles in the Kanowit River might have developed a high level or wariness, thus they can avoid to be detected by the surveyor (Webb & Messel, 1979). The presence of a sub-adult spotted in the main river of Batang Rajang, about one kilometer distance from

132 the mouth of Kanowit River, further supported the possibility of crocodile movement in and out of Kanowit River.

The distribution of crocodiles varies in each river. In Igan River, majority of the crocodiles were spotted in areas near to the river mouth. According to local community in Igan village, crocodiles were commonly found in Nypa palms areas just next to their village and they believed that crocodiles were using that area as the resting place. The locals also claimed that the crocodiles especially the larger ones are more likely to roam around the river near to the village, sometimes scavenging foods leftover, animal carcasess or rubbish under people’s houses and jetty. During the survey, a large adult was sighted in the middle of the river approximately 50 meters from the village probably waiting for rubbish thrown by the people (Figure 4.2). Similar situation where large adults living near human settlements were also recorded in Bako River, western Sarawak (Hassan et al., 2018). A satellite tracking study by Campbell et al. (2015) reveal that crocodile greater than 2.5 m in length are likely to wander in area near to human settlement due to the curiosity or attracted to something, possibly the smell of food leftovers or animal carcasses.

Several sightings of young crocodiles (yearlings and hatchlings) in close proximity to each other or in clusters were recorded in Igan, Belawai, Sarikei and Nyelong River during the surveys (Figure 4.2, Figure 4.3 and Figure 4.4). When a group of young crocodiles found in one place, it could be a sign that nesting occurs in these particular areas and the cluster of young crocodiles were probably from the same nest (Webb et al., 1977; Fukuda & Saalfeld,

2014). In addition, the presence of at least one adult crocodile in close proximity with the

133 young crocodiles also supports the possibility that there could be a nesting area for crocodiles in that particular area (Webb et al., 1983).

For a large rivers like Igan and Belawai, crocodiles prefer to build their nest at the riverbank of a small tributary or stream compared to the main river to avoid their nest affected by flooded water from the main river and also access to freshwater (Fukuda & Cuff, 2013;

Evans et al., 2016). After hatching, the hatchlings will live in the smaller tributary for few months and when they grow bigger in size they will venture out to the main river. Along the process, the mother stays close to guard the nest, besides assisting in excavating the nest during hatching (Webb et al., 1983; Grigg & Gans, 1993; Evans et al., 2016). Thus, the adult who was spotted near to the hatchlings is most likely to be a female crocodile.

In Sarikei River and Nyelong River, no crocodile was spotted in the proximity of Sarikei town except for a group of sub-adults and hatchling roaming in the area near to a bridge in

Nyelong River. Instead, more crocodiles were found in less human populated and development areas further upstream (Figure 4.4). The town of Sarikei, located at the mouths of Sarikei and Nyelong River, is a high human populated area and the town is the center for economic activities and transportation hub for the surrounding region. In this case, disturbances from human activities along with the changes in riverbank habitat as the result of development could hinder crocodiles from living in the waterway proximity of the town

(Fukuda et al., 2008; Shaney et al., 2017). In Nyelong River, a hatchling and yearling were among the crocodiles spotted close to the oil palm plantations, suggesting that the crocodiles are building nests near or inside the plantations area. This does suggest that riverbank land

134 conversion into oil palm plantations is not necessarily a barrier for crocodile to nesting

(Evans et al., 2016).

It is also noted that the hatchlings spotted in the surveys were present in the area near to a school and a longhouse in Poi River (Figure 4.6). The situation where the crocodiles are present in areas near to schools or residential areas is common in Sarawak because the local people and crocodiles had been sharing the rivers for centuries (Hassan & Abdul-Gani,

2013). Conflicts between human and crocodiles are rarely reported in this area, however local communities in the area especially children need to be reminded about the danger of crocodiles. This can be done through several initiatives by local authorities including putting warning signboards in school and residential areas, conducting public awareness programmes and also frequent sharing sessions between community leaders and local authority so that any information about crocodile can be delivered in a more effective manner.

During the surveys, there were crocodiles that have been detected through eye shine but their body size were unable to be estimated as the crocodiles submerged quickly into the water when the surveyors tried to approach them. The crocodiles might be alerted by the waves or sound created by boat engine or noise from the people on the boat. The sightings were then recorded as “Eyes only” (EO) (Bayliss, 1987). This behaviour is a sign of high wariness and this level of wariness typically associates with larger crocodiles, mainly sub-adult and adult.

A mature crocodile develop the wariness through life experience, as an example learning through frequent encounter with boat, escape from human harassment or hunting (Webb &

135

Messel, 1979). Accordingly, the EO crocodiles seen in the Ngemah and Katibas River were most likely mature crocodiles (sub-adult or adult).

The crocodiles found in Poi, Ngemah and Katibas Rivers shared a common pattern, all of them were spotted in an area less than 5 km from the tributary mouth (Figure 4.6, Figure 4.7 and Figure 4.8). A sub-adult sighted in Poi River along with a small hatchling could suggest that crocodiles in the middle and upper region of Rajang RB used tributaries along the main river as the nesting ground. Similarly, a “eyes only” (assuming it as an adult or subadult crocodile) found in Ngemah and Katibas River, respectively; are probably female crocodiles and they are travelling into these tributaries for nesting. A typical mature crocodile would prefer to live in a large river like Batang Rajang due to a large space area for living and more foods available, but when nesting, a female crocodile prefers to choose an area with less disturbance like in a smaller tributary or stream that have access to freshwater (Fukuda &

Cuff, 2013).

Saline characteristic of the waterway and the access to plentiful of foods area are among the strong factors that influence the abundance of crocodiles. In Sarawak, saline mangroves floodplains and large river systems around estuaries like Belawai and Igan Rivers in this study are the most common habitat for C. porosus where the highest crocodile densities are usually found in these areas (Stuebing et al., 1985; Hassan & Abdul-Gani, 2013; Abdul-

Gani, 2014; Zaini et al., 2014). Rivers in the middle and upper parts of Rajang RB (Kanowit,

Poi, Ngemah and Katibas River) show low value in salinity (Table 4.9). The hypo-saline characteristic in these rivers is expected as they are located more than 100 km from the mouth of Batang Rajang where there are less influence of sea water in the rivers.

136

The low salinity and the absence of tidal influence could be the reason why there are less number of crocodile found in the upper part of Batang Rajang compared to rivers in the lower part of Rajang RB. According to Cramp et al. (2008), the estuarine crocodile, C. porosus, displays broad euryhaline capabilities, where they could be found in waters ranging in salinity from 0 to over 35 ‰. The presence of both freshwater and saltwater are important to crocodiles as it influence their diet, nesting ground and behaviour, hence they regularly move between different habitats, according to the wet and dry seasons changes (Grigg &

Gans, 1993; Fukuda & Cuff, 2013; Hanson et al., 2015; Evans et al., 2017). Tidal currents are important to crocodiles especially for their movement in water as well as giving them advantage when hunting for food (Grigg & Gans, 1993; Campbell et al., 2010).

The pH and water temperature readings for the Ngemah and Katibas Rivers in the present study are similar with what have been recorded in Pelagus River (Ling et al., 2017) and

Balleh Rivers (Ling et al., 2016) in further upstream of Rajang RB. In Pelagus River, the pH value of the streams ranged from 6.1 to 7.1, while in Balleh River the pH value was in between 7.0 to 7.7. The temperature of water in Pelagus River and Balleh River ranged from

25.0 0C to 30.6 0C and 24.7 0C to 28.8 0C, respectively.

The river temperature could be influence by several factors including elevation, rainfalls and seasons (Ling et al., 2016). The water temperature in rivers in the upper part of Rajang RB

(~25 0C) recorded lower reading compared to the rivers in middle (~27 0C) and lower (26 -

29 0C) part of Rajang RB (Table 4.9). During the sampling process, there was no rain were recorded from an hour to a day prior to the sampling period except for samplings in Igan and

Katibas River. River temperature in Igan (26 0C) was recorded lower compare to the rest of

137 rivers in lower region (29 0C) and the result could indicate that the rainfall event occurred a day before sampling period had influence on the river temperature.

An estuarine crocodile can live in a wide range of water temperature, but the optimal temperature for crocodile is ranging from 28 0C to 30 0C (Stuebing et al., 1985; Rodgers et al., 2015). A crocodile is an ectothermic animal, thus the reptile depend on surrounding temperature to regulate its body temperature (Grigg & Gans, 1993). Hence, the capacity of a crocodile to dive and stay longer underwater is depending on the water temperature. The body temperature also restricted mobility, therefore the reptile commonly seek to maintain optimal body temperature through behaviour such as basking, moving in and out from water or finding shade inland (Grigg & Gans, 1993).

The water temperature readings for five out of eight rivers in the study are below the optimal temperature window for crocodile, but whether or not this condition could affect the sighting of crocodile in those rivers is relatively unknown. Four of the rivers (Kanowit, Poi, Ngemah and katibas) that have temperature below the optimal temperature for crocodile are in the middle and upper region of Rajang RB and these rivers also recorded lower density of crocodile compare to those in lower region. It seems to indicate that temperature had influence on the distribution of crocodile in Sarawak, but yet, other factors including salinity, habitat and the availability of food could also influence the crocodile distribution. Although the river temperatures are below optimal, the readings are within the range that can be tolerated by crocodile. According to Rodgers et al. (2015), estuarine crocodiles can tolerate better to a lower temperature compared to a warmer temperature as they have the unique capability of its organs in response to such environment.

138

Out of 23 species of fishes caught in this study, 10 species were similar with what have been recorded by Parenti and Lim (2005) and Bolhen (2017) in the Rajang RB. However, both studies recorded fish species mainly from the upper Rajang area; Parenti and Lim (2005) recoded fish species from Belaga, Baleh, Balui, Kapit and area around Sibu, while Bolhen

(2017) documented fish fauna from Pelagus area. Hence, this could explain why certain species of fish caught in the present study especially the coastal water fish like Setipinna breviceps, Coilia macrognathos, Pampus argenteus and few others, were not in the Parenti and Lim (2005) and Bolhen (2017) fish species checklist. The species of fish caught in the present study varies in each studied river, majorly influence by the river habitat and the type of water in the rivers.

With the presence of crocodile in different habitats in Rajang RB, it could suggest that crocodiles eat various species of fish or invertebrates that are available in the habitat area.

According to Hanson et al. (2015), range of prey (including fish species) for crocodiles could vary among different habitats (e.g., coastal mangroves, freshwaters tributaries or swamps), depends on the diversity of potential prey available in the area. A stomach contents study by Sah and Stuebing (1996) found that C. porosus in Klias River, a river in coastal area of

Sabah, consume majorly on small fish from the Family Hemiramphidae and Engraulidae.

Both of the fish family group are common in estuarine and mangrove habitats, thus explained why the fish species were taken frequently especially by the juvenile crocodiles. The fish checklist data in the present study does not necessarily indicated the diet of crocodile, but it could provide clues on potential food resources for crocodile in the various habitats. Further studies are needed to understand the diet of crocodile in different river habitats including study of fish and invertebrate composition as well as study of crocodile stomach contents.

139

Mangroves waterways in lower Rajang (Belawai and Igan) offer more food sources for crocodiles as compares to rivers in the other part of Rajang RB based on the CPUE results.

Although the CPUE data were collected as one-off survey and the data do not necessarily represent the abundance of food sources for crocodile in the rivers throughout the year, the data could show variation in the level (abundance) of food sources between rivers. The coastal mangroves floodplains are rich in fauna including fish, insects, crustaceans, mammals and reptiles, thus providing a variety of foods for both matured and juveniles crocodiles (Fukuda et al., 2008; Nagelkerken et al., 2008). Crocodiles eat various type of food, ranging from the small aquatic animals including fish, crustaceans and insects to the large terrestrial mammal, primates and reptiles such as pigs, dogs, chickens, goats, monkeys, snake or any animals that come near to the water (Stuebing et al., 1985). The food preference for crocodile usually differ depending on the developmental stage, where young crocodiles prey on smaller animals while the adults hunts for larger animals, sometimes travel further on land to fulfill its appetite (Hanson et al., 2015). However, despite the fact that they prey on large animals, crocodiles are rarely been seen hunting for animals that have size much bigger than their own.

Basically, crocodiles spend most of their time in water and they also move easily in water, thus their main diet are aquatic animals. In addition, crocodiles have limited opportunity to prey upon the terrestrial animals (Hanson et al., 2015). The opportunity only comes when the animals approaching the river for a drink or try to cross the water body or at any chance the primates and any other animals slip into the water. A study by Hanson et al. (2015) suggested that small and young crocodiles feed mainly on herbivorous aquatic animals like small fishes, invertebrates including insects while medium to large adult crocodile eats

140 similarly, but supplement their diets with slightly higher trophic level of preys in riverine habitats such as larger predatory fishes and marine vertebrates. This supports what have been suggested by Stuebing et al. (1985) where hatchling crocodiles particularly in Lupar River,

Sarawak, feed mostly on Paneus prawns and small crabs captured near to the water edge while larger crocodiles prey upon larger fish and vertebrates such as tortoise, monkey and others inland animals.

Pearson’s correlation analysis and general linear model (GLM) analysis shows significant negative correlations between the habitat scoring data and the crocodile density (Table 4.11 and Table 4.13), however, this is not necessarily depicting that crocodiles are more abundant in low habitat condition. The habitat assessment scoring is based on five parameters which are bank vegetation, verge vegetation, in-stream cover, bank erosion and stability and riffles, pools and bends. Hence, for the rivers in lower part of Rajang RB where crocodile densities are higher, the habitat assessment scores were a bit lower compared to other rivers in the middle and upper part of the river basin. Human disturbance and habitat degradation seem to have a weak influence on the abundance of crocodiles among the studied rivers. In several studies (Fukuda et al., 2008; Evans et al., 2016), the variation in land use intensity and the human presence show only a minimum influence in the abundance of crocodiles. However, the pattern of crocodile distribution within the studied rivers showed that crocodiles are avoiding high riverbank development and human populated areas, for example, none or a small number of the crocodile sighting were recorded in town proximity (Sarikei and Song) in Sarikei, Nyelong and Katibas River. Meanwhile in Kanowit, development and industrial activities took place not just in town area only but also further upstream, such as the construction of a concrete bridge and the logging activity. These anthropogenic disturbances

141 could affect the population of crocodile in the river resulting in no crocodile was sighted in

18 km distance of survey. Constant encroachment into crocodile habitat and high impact land use, typically occur in developing area like in Sarikei, Kanowit and Song towns, could affected the crocodile population, as all the activities indirectly contributes to the potential loss of quality habitat including their feeding and nesting area and it also could change the nature of the waterways (Fukuda et al., 2008).

4.5 Conclusion

The present study showed that the estuarine crocodiles are distributed along the lower, middle and upper region of Rajang River Basin and the animals were sighted as far as

Katibas River, approximately 180 km from mouth of the river basin. However, the density and distribution of crocodile differ according to the regions where the crocodile density in lower region was higher compare to the middle and upper regions. Four out of eight studied rivers in Rajang RB namely Igan, Poi, Ngemah and Katibas recorded increase in crocodile density compare to the previous survey suggesting that crocodile population are experiencing recovery. The distribution of crocodiles in the upper region was restricted to the area of several kilometers distance from the mouth of the tributaries, suggesting that the crocodiles might frequently move in and out from the tributaries to the main river. The water quality, river habitats and the abundance of food for crocodiles varied between the eight studied rivers, yet the rivers support crocodile populations. This finding suggests that crocodiles in Sarawak can live in a wide range of habitat, from the large tidal rivers in coastal area to the small non-tidal freshwater tributary in the upper side. Saline characteristic and the abundance of food sources for crocodile are the strong factors that influence the density

142 and distribution of crocodile in Sarawak. The presence of crocodiles in rivers near to the residential, development and agriculture areas indicated that moderate to high human disturbances and riverbank land-use conversion are not a barrier for crocodiles to continue to live in the area.

143

CHAPTER 5

GENETIC RELATIONSHIP AMONG Crocodylus porosus FROM DIFFERENT

RIVER BASINS IN SARAWAK, MALAYSIAN BORNEO

5.1 Introduction

Human–wildlife conflict has become a huge problem in many parts of the world and crocodilians are among the major groups involved in such situation. In Sarawak, conflict between human and crocodile (HCC) as discussed in Chapter 3, showed a mark increased especially in the past 20 years and this had concerned many people. Several actions have been made by relevant agencies to tackle the problem, including culling and translocation of problematic crocodiles from human populated areas to sanctuaries and inhabitant mangrove areas (Tisen & Ahmad, 2010).

In the recent development, wild crocodile harvesting activities in Sarawak has been permitted for those who have the licence, after the status of the animal, particularly the C. porosus species, was transferred from Appendix I to Appendix II in CITES (Sarawak

Forestry Corporation, 2018). Local authority in Sarawak hopes that regulated harvest of C. porosus could control the wild population as their numbers in rivers are on the rise (Abdul-

Gani, 2014). However, hasty actions without proper planning and supported by research data could risk the population of the crocodiles and this could lead to the history of overexploitation to be repeated.

144

Understanding of genetic structure of wild crocodile populations could contribute to better conservation management of the species especially when designing population translocations or introducing sustainable harvest programs (Russello et al., 2007; Maltagliati et al., 2010; Lapbenjakul et al., 2017). Any programmes involving the removal of individuals from a population like translocations and harvesting could bring a risk of disrupting breeding and social systems which may lead to negative impact to the population (Lewis et al., 2013).

Thus, genetic relationship information could help in understating the systems. In addition, study on population genetics could also help in identifying key point to solve the conflicts between human and crocodile in Sarawak by identifying potential demography expansion and migrations of the animals.

Microsatellites or also known as short sequence repeats (SSRs) are repetitive sequences of

DNA, commonly from 2 to 6 bp in length, that are mostly found in non-coding regions of eukaryotic genome. They are known to have high mutation rates that lead to higher allelic variability and high levels of polymorphism, making them suitable for crocodile genetic study (Bashyal et al., 2014). Microsatellite markers has been widely used in various genetic studies of crocodile including populations genetics, paternity study and cross-species hybridization (Lewis et al., 2013; Bashyal et al., 2014; Hekkala et al., 2015; Lapbenjakul et al., 2017).

By using the microsatellite markers, researchers are able to shed lights on population structure and also elucidate phylogeography in crocodilians species. Mauger et al. (2017) studied on the population genetic structure of the American crocodile, C. acutus, in Pacific

Costa Rica, and from their study, they suggested that the C. acutus populations in the country

145 were not panmictic as shown by moderate levels of genetic diversity. The crocodile populations in Costa Rica were also identified experiencing genetic bottleneck, most likely due to declined in number of crocodiles as a result of hunting and illegal poaching (Mauger et al., 2017). Other studies utilising microsatellites have been able to identify genetic differentiation in saltwater crocodile, C. porosus, populations from the Indo-Malay

Archipelago and the Western Pacific Ocean, with support from mtDNA markers (Gratten,

2003). Meanwhile, Russello et al. (2007) had found a separate haplotype for C. porosus population in the Pacific island country of Palau compared to those that had been identified by Gratten (2003) in Indo-Pacific region. A population genetic study of C. porosus from the

Northern Territory of Australia using mtDNA suggested that there is little to no genetic structure within and between populations from the region, thus further studies looking at other sensitive marker like microsatellite in combination with mtDNA to confirm the findings (Luck et al., 2012).

Population genetic studies on crocodiles are still lacking in Malaysia especially in Sarawak.

Preliminary genetic studies by Shoon (2009), Abdullah (2010), Sulaiman (2011), Kasim

(2011) and Abdul-Gani (2014) had suggested a distinctive but close relationship among crocodile populations from the coastal area of western, central and northern parts of Sarawak through combined Cytochrome b and 12S Ribosomal gene, randomly amplified polymorphic DNA (RAPD) and microsatellite data. However, Shoon (2009), Abdullah

(2010), Sulaiman (2011) and Kasim (2011) had used small number of samples, while Abdul-

Gani (2014) only used samples from one locality representing the western, central and northern part of Sarawak. Furthermore, there is a possible expansion of wild crocodile

146 populations in Sarawak with frequent movement occurs alongside the coastal region, based on a high migration rate in the population genetic data (Abdul-Gani, 2014).

The previous genetic studies were focused on population from the coastal area (Shoon, 2009;

Kasim, 2011; Sulaiman, 2011; Abdul-Gani, 2014), but not much information known about those in the upper region of the river within a large river basin. In the river basins like Rajang,

Lupar and Baram, crocodiles can be found up to hundred kilometers upstream of its main river or tributaries as shown in the findings in Chapter 3 and Chapter 4. Hence, in this chapter, genetic relationships among C. porosus from 13 locations across Sarawak including from the middle or upper regions of river basins were investigated using three set of microsatellite markers (Cj101, Cj105 and Cj131). Information on the genetic diversity, population expansion and migrations (gene flow) between the populations were also discussed in this chapter, so that the data could be used for conservation management of the species and also to formulate ways to minimize HCC in Sarawak.

5.2 Materials and Methods

5.2.1 Sample collection

A total of 22 wild C. porosus from 13 locations in eight river basins in Sarawak were captured in the present study (Figure 5.1). The crocodiles were caught manually by hand, using scoop net or cast net (for animal less than 1.5 m) as described by Abdul-Gani (2014).

For large adult crocodiles (more than 1.5 m), samplings were accompanied by a group of experienced personels in handling problematic crocodiles in Sarawak called Swift Wildlife

Action Team (SWAT), a unit in Sarawak Forestry Corporation (SFC). Cage traps were used

147 for catching larger adult crocodiles. When a crocodile caught alive, the animal was restrained properly before taking sample in order to prevent any incident to occur during the sampling process. Samples MR002, MR003 and MR010 were collected from Miri crocodile farm

(MCF), while samples BN001 and BN002 were obtained from Tumbina Park, Bintulu

(TPB). Samples BN001 and BN002 are originated from Kemena River Basin (RB); they were captured and relocated by the authority into the facility due to potential threat to local people living along the river.

Samples were collected either in the form of tissue or blood. For tissue sample, a small piece or the whole scute was cut from the crocodile’s tail using scalpel. The tail’s scute is most commonly sampled for crocodile DNA. Besides scutes, tissue samples can also be collected from other parts of the crocodile’s body such as from their tail, legs and body. For blood, samples were collected using syringe with proper handling as techniques describe by Elsey et al. (2008).

Samples that had been collected in the field were preserved using methods as follow:

i. Tissue samples

Tissue samples were put in sealed plastic bags (kept in cold condition and

immediately stored in -800C freezer when arrived at the laboratory) or in

preservation tube contain 70% ethanol solutions.

148

ii. Blood samples

For blood samples, two methods of preservation recommended by Munson

(2000) were used. The first method was by dripping drops of blood on a thick

Whatman-type filter paper or touch the filter paper directly to the freshly opened

body cavity. Then the blood spots were dried in room temperature and stored in

sealed plastic bags. The second method was by mixing the blood with a buffer

solution contained 5% EDTA in the preservation tube.

All samples were then brought back to a laboratory in the Faculty of Resource Science and

Technology, UNIMAS and kept in -800C freezer until further molecular works. Information on the sample’s area/tributaries location, species name, type of samples and date of sampling were recorded and vouchered accordingly (Appendix B, see page 239 - 240). Each of the samples were coded based on the origin of the crocodile or the location where the crocodile was caught with the number of samples.

For example:

KP 001

Origin of the crocodile or the Number of sample from sampling location where the crocodile was area (eg.: 001= sample number 1) caught (eg.: KP= Kapit River)

149

All the codes for place of sampling shown in the Table 5.1.

Table 5.1: Voucher codes for samples according to sampling area.

Area Code Sampling Area River Basin Number of Samples (RB) (n) 1. BG Bintangor Rajang 2 2. BK Bako Sarawak River 2 3. BN Bintulu Kemena 2 4. DB Debak Saribas 2 5. KP Kapit Rajang 1 6. MR Miri Miri 3 7. PU Pusa Saribas 1 8. RO Roban Krian 1 9. SB Sibu Rajang 2 10. SJ Simunjan Sadong 1 11. SM Samarahan Samarahan 2 12. ST Santubong Sarawak River 2 13. TA Telaga Air Sarawak River 1 TOTAL 22

150

Miri

Bintulu

Roban Bintangor

Debak Sibu

Pusa Bako

Santubong Kapit Telaga Air

Samarahan

Simunjan

Figure 5.1: Map of Sarawak showing locations of C. porosus samples collected in the present study.

151

5.2.2 Total genomic DNA extraction and Polymerase Chain reaction (PCR)

amplification

Total genomic DNA was extracted from tissues and blood sample using 2% cetyltrimethylammonium bromide (CTAB) protocols as described by Doyle and Doyle

(1987) with some modifications as suggested by Abdul-Gani (2014). For blood samples, the bloods were subjected to few additional preparation steps suggested by Sambrook et al.

(1989) before proceed to CTAB protocols. The additional steps were including resuspended the fresh or frozen blood, after thawing, in the phosphate-buffer saline followed by 15 minutes centrifuge at 15,000 rpm at 4 0C. The excess supernatant was discarded and nuclei pellets were resuspended in 2% CTAB buffer before continued with the 2% CTAB DNA extraction protocol. DNA extraction products then were assessed on 1% Agarose gel (AGE) to determine the presence of total genomic DNA.

Polymerase Chain Reaction (PCR) was conducted using MyCyclerTM Thermal Cycler and microsatellites analysis were follow Isberg et al. (2004) protocols. Three microsatellite markers were used in this study namely Cj101, Cj105 and Cj131 as shown in the Table 5.2.

152

Table 5.2: Microsatellite primers used in this study (Isberg et al., 2004).

Microsatellite Microsatellite Primer sequences (5’-3’) primer Cj101 ACAGGAGGAATGTCGCATAATTG (forward)

GTTTATACCGTGCCATCCAAGTTAG (reverse)

Cj105 CAACAGAAAGTGCCACCTCAAG (forward)

GTTTGATTATGAGACACCGCCACC (reverse)

Cj131 GTTTGTCTTCTTCCTCCTGTCCCTC (forward)

AAATGCTGACTCCTACGGATGG (reverse)

For every microsatellite locus, the amplification reaction total volume was 25 μl which comprised 5 unit/ μL of Taq DNA polymerase (1.5 μL), 10X Taq Buffer with KCl (5 μL),

10 mM dNTP mix (2 μL), 10 μM of forward and reverse primer (2 μL each), 25 mM MgCl2

(2.5 μL), 1 μL DNA template and approximately 9 μL sterile distilled water. Standard PCR thermal conditions was used with preliminary denaturation at 94°C for 3 min; then 30 cycles of strand denaturation at 94°C for 15 sec, annealing at 58°C for 30 sec, and extension at

72°C for 50 sec; followed by a final 4 minutes extension step at 720C and finally soaked at

4°C. A negative control was included in each batch of PCR amplification, consisting of all of the amplification reaction components except for DNA template. Once the amplification completed, the amplification products were detected by electrophoresis on 1% Agarose gel.

153

5.2.3 DNA Sequencing and alignment

The nucleotide sequences of the PCR product were determined by the DNA sequencing

service of a private sequencing company Apical Scientific Sdn. Bhd., Seri Kembangan,

Selangor, Malaysia (formerly known as First Base Laboratories Sdn Bhd). The raw DNA

sequences were subjected to nucleotide Basic Local Alignment Search Tool or BLASTn

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) as suggested by Altschul et al. (1990) for

verification of the species. The raw sequence then was edited followed by alignment using

ClustalX version 2.1 (Larkin et al., 2007). The nucleotide base composition was also

calculated to estimate nucleotide richness using MEGA 7.0 (Kumar et al., 2016). The DNA

sequences of microsatellite genes using primer Cj101, Cj105 and Cj131 were tested for

analysis of compatibility of the combined data set using the Incongruence Length Difference

Test (ILD) or also known as Partition Homogeneity Test (PHT) implemented in PAUP 4.0a

162 software (Swofford, 2002).

5.2.4 Phylogenetic tree and NETWORK reconstruction analyses

Four methods of phylogenetic analysis were used in the present study namely (i) Neighbour-

Joining (NJ), (ii) Maximum-Parsimony (MP), (iii) Maximum-Likelihood (ML) implemented

in the PAUP 4.0a 162 software (Swofford, 2002) and (iv) Bayesian Inference (BI) analyses

using MR. BAYES 3.2.6 software (Huelsenbeck & Ronquist, 2001). Model test, calculated

using PAUP 4.0a 162 software (Swofford, 2002), had chosen TVM as the best substitution

model, based on the Akaike Information Criterion (AIC) and the substitution model was

used in the ML and Bayesian analyses. In Bayesian analysis, two simultaneous metropolis-

154 coupled Monte-Carlo Markov Chains were ran for 380 000 generations before the probability of splits frequencies (p) less than 0.01. Tree(s) were generated in the end of the analysis along with posterior probabilities in each node. A sequence, Tomistoma schlegelii clone 1008-63 microsatellite sequence (Accession no: KJ004636.1) was retrieved from The

National Center for Biotechnology Information (NCBI) GenBank database and used as outgroup in the phylogenetic analyses.

Median-joining (MJ) network was generated by NETWORK 4.6.1.1 (Bandelt et al., 1999) for C. porosus based on the microsatellite haplotype data generated using DNA Sequence

Polymorphism (DNASP) version 6.11.01 software (Rozas et al., 2017) to estimate the dispersion of the species.

5.2.5 Population genetics analyses

Measures of population genetic parameters such as nucleotide diversity (π) and nucleotide divergence (Da) were estimated from microsatellite data sequences using DNASP 6.11.01

(Rozas et al., 2017). To test relationship between the corrected genetic distances and geographical distances, Matric Correlation Analysis (Mantel test) was performed with 1000 permutations in Arlequin version 3.5 (Excoffier & Lischer, 2010). Measures of Nucleotide

Subdivision (Nst), Population Subdivision (Fst) and Gene Flow (Number of Migrants, Nm) among populations of C. porosus were generated using DNASP 6.11.01 (Rozas et al., 2017).

Nst value was estimated using lynch and Crease (1990), whereas estimation for Fst and Nm value was using Hudson et al. (1992). In order to investigate demographic history and geographical population’s differentiation, analysis of Molecular Variance (AMOVA) was

155 performed. Neutrality tests by Tajima, D (Tajima, 1989) and Fu’s Fs (Fu, 1997) were carried out to test for deviation of sequence variation from evolutionary neutrality as well as a mismatch distribution analysis (Rogers & Harpending, 1992) to infer population expansion event occur in the populations of C. porosus alongside Batang Rajang. All AMOVA, neutrality test and mismatch distribution analyses were performed in Arlequin 3.5 (Excoffier

& Lischer, 2010), whereas statistical significant were tested using 1000 permutations.

5.3 Results

5.3.1 Sequences characterization and Basic Local Alignment Search Tool (BLAST)

analysis

Samples from 22 crocodiles were successfully sequenced using three microsatellite markers

(Cj101, Cj105 and Cj131), totalling 66 sequences. Amplifications using marker Cj105 showed multiple bands when viewed under 1% Agarose gel while the other two markers,

Cj101, and Cj131, show single band (Appendix C). Among the three markers, amplification using Cj101 marker yield the longest sequence length with 312 bp, followed by Cj105 (262 bp) and Cj131 (176 bp) (Table 5.3).

156

Table 5.3: Sequence characterization for the microsatellite markers.

Microsatellite Sequence Variable Variable sites Repeat markers length sites Singleton Parsimonious Motif (base sites informative pair, bp) sites Cj101 312 34 16 18 CA12 (10.9%) (47.1%) (52.9%)

Cj105 262 29 13 16 CA16 (11.1%) (44.8 %) (55.2 %)

Cj131 176 18 9 9 CA16 (10.2%) (50.0 %) (50.0 %)

Percentage of variable sites for the three markers were in the range of 11.1% to 10.2% with the highest was Cj105 gene and the lowest was Cj131 gene (Table 5.3). Of the 34 variable sites in Cj101 gene, 16 sites were singleton, leaving 18 or 52.9% potentially parsimoniously informative sites. For Cj105 gene, 13 out 29 variables sites were singleton sites, while another 16 sites (55.2%) were parsimoniously informative characters. Meanwhile, in Cj131 genes the number of sites were equal with 9 (50.0%) out 18 variable sites were singleton and parsimoniously informative sites, respectively.

All of the genes obtained using the three microsatellite markers shared similar repetition base, CA, but have different in number of repetition motif. Cj101 sequences have 12 times repetition of base CA, while Cj105 and Cj131 sequences have 16 times repetition of base

CA (Table 5.3).

157

The average nucleotide base composition at the 1st, 2nd and 3rd codon position for all three genes used in this study are shown in table 5.4. Based on the nucleotide base composition, proportion of A+T base was higher when compared to G+C base. As examples, the proportion of nucleotide base A+T : G+C at the 1st codon position for Cj101 genes was

55.5% : 44.4%, while proportion at 2nd position was 61.5% : 38.0% and at 3rd position, the proportion was 57.2% : 42.5%.

Table 5.4: Average nucleotide base composition at the 1st, 2nd and 3rd codon position for the three microsatellite markers in this study. All frequencies are in percentage (%).

Codon 1st 2nd 3rd positions Nucleotide T(U) A C G T(U) A C G T(U) A C G base Cj101 21.0 34.5 37.0 7.4 19.0 42.5 31.5 6.5 22.0 35.2 31.0 11.5 Cj105 27.0 26.2 29.6 17.6 29.0 22.6 35.3 13.5 27.0 31.6 27.4 14.0 Cj131 25.0 32.8 29.2 13.3 34.0 22.4 28.4 14.7 36.0 22.0 28.2 14.2

Species verification through BLASTn for all sequences hit at least one or several matches in NCBI GenBank for each microsatellite genes (Table 5.5).

158

Table 5.5: Basic Local Alignment Search Tool (BLAST) result.

Markers Description Accession Query E- Identities no. match site value (%)

Cj101 Crocodylus porosus EU593280.1 Site 97 - 275 3e-17 70% clone CpDi07 microsatellite sequence Cj105 Crocodylus porosus JQ876520.1 Site 133- 184 2e-06 83% isolate 7707cro ultra conserved element locus chr2_24748 genomic sequence Crocodylus porosus JQ877513.1 Site 117-136 8.0 95% isolate 8700cro ultra conserved element locus chr3_299 genomic sequence Cj131 Crocodylus porosus EU593305.1 Site 13-37 1.2 92% clone CpDi54 microsatellite sequence Crocodylus porosus EU593442.1 Site 1-32 4.1 81% clone CpP2201 microsatellite sequence

For all microsatellite Cj101 genes, BLAST result showed one similar hits with a nucleotide sequence, Crocodylus porosus clone CpDi07 microsatellite sequence (Accession no:

EU593280.1) with the bases identical up to 70% (Table 5.5). The E-value was recorded very low with the value of 3e-17.

Meanwhile for Cj105 genes, BLAST result showed two matches with C. porosus sequences

(Table 5.5). The match sequences were Crocodylus porosus isolate 7707cro ultra conserved element locus chr2_24748 genomic sequence (JQ876520.1) and Crocodylus porosus isolate

8700cro ultra conserved element locus chr3_299 genomic sequence (JQ877513.1) with 83% and 95% of bases identities and E- value of 2e-06 and 8.0, respectively.

159

Two matches in NCBI GenBank with microsatellite Cj131 genes in this study were recorded and both are microsatellite sequences (Table 5.5). Crocodylus porosus clone CpDi54 microsatellite sequence (EU593305.1) is 92% identical with Cj131 genes and has a E-value of 1.2. Another match, Crocodylus porosus clone CpP2201 microsatellite sequence

(EU593442.1), has lower identities percentage (81%) and higher E-value (4.1).

5.3.2 Combine genes and haplotype build

The three genes were combined in this following order, the Cj101 gene, base site from 1 to

312; the Cj105 gene, from base site 313 to 574 and end by the Cj131 gene, from base site

575 to 750. Prior to combining the genes, they were subjected to the Partition Homogeneity

Test (PHT) and the result showed high p-value (p = 1.00) or not significant, meaning that all three microsatellites genes, Cj101, Cj105 and Cj131 have similar evolutionary rates (Farris et al., 1994; Dolphin et al., 2000). Thus, the three genes can be combined for phylogenetic reconstruction.

Using the combine genes, 21 haplotypes were identified from the 22 individuals of C. porosus sequenced in this study (Table 5.6). Each individual of C. porosus have unique haplotype except for samples from Sibu. Two samples from Sibu, SB001 and SB002, share the same haplotype (Hap_1).

160

Table 5.6: Haplotype identity for 22 microsatellite sequences of C. porosus.

Haplotype Haplotype Voucher Locality River Basin Frequency samples (RB) Hap_1 2 SB001 Sibu Rajang SB002 Hap_2 1 KP001 Kapit Hap_3 1 BG001 Bintangor Hap_4 1 BG002 Hap_6 1 SM002 Samarahan Samarahan Hap_7 1 SM001 Hap_8 1 SJ001 Simunjan Sadong Hap_9 1 DB002 Debak Saribas Hap_10 1 DB001 Hap_11 1 PU001 Pusa Hap_12 1 RO001 Roban Krian Hap_5 1 TA001 Telaga Air Sarawak River Hap_13 1 BK001 Bako Hap_14 1 BK005 Hap_15 1 ST001 Santubong Hap_16 1 ST002 Hap_17 1 MR002 Miri Miri Hap_18 1 MR010 Hap_19 1 MR003 Hap_20 1 BN002 Bintulu Kemena Hap_21 1 BN001

161

5.3.3 Phylogenetic analysis

All the four phylogenetic trees shared almost similar in topologies with slightly different in clade positions as shown in Neighbour-joining (Figure 5.2), Maximum Parsimony (Figure

5.3), Maximum likelihood (Figure 5.4) and Bayesian (Figure 5.5). All trees revealed the monophyl of C. porosus with the outgroup species, T. schlegelii with 100% (NJ), 100%

(MP), 100% (ML) bootstrap supports and 1.00 (Bayesian posterior probabilities, BPP).

Bootstrap values ≥ 70% were considered significant, meaning the topologies of the nodes were regarded as sufficiently resolved, while those of 50% to 70% showed tendencies

(Huelsenbeck & Ronquist, 2001). Meanwhile for posterior probabilities in Bayesian, values

≥ 0.98 or 98% were considered as significant.

All trees exhibited the existence of geographical clade. Samples from Telaga Air (TA001),

Santubong (ST001 and ST002) and Bako (BK001 and BK005) were in the same clade namely Clade A with bootstrap value of 81% (NJ), 91% (MP), 90% (ML) and 0.98 (BPP).

These three localities are located in Sarawak RB, in the western side of Sarawak.

SM001 and SM002 from Samarahan RB and SJ001 from Sadong RB shared the same clade

(Clade B) in all trees with bootstrap value (81%, NJ; 91%, MP; 90%, ML and 0.98, BPP), while samples from Saribas RB (PU001, DB001 and DB002) and Krian RB (RO001) were grouped in the same sister clade (Clade C) with strong supports (54%, NJ; 70%, MP; 71%,

ML and 0.90, BPP), showing a close relationship among the crocodiles in those neighbouring river basins.

162

Clade D consists of BG001, BG002, SB001, SB002 and KP001 were originating from

Rajang RB particularly in middle and upper regions and the monophyletic relationship between the samples were supported by strong bootstrap values (77%, NJ; 91%, MP; 82%,

ML and 0.98, BPP). Samples from Bintulu (BN001 and BN002) and Miri (MR002, MR003 and MR010) were grouped in a clade (Clade E) with bootstrap values of 77% (NJ), 90%

(MP), 96% (ML) and 0.93 (BPP).

163

MR002 77 MR010 MR003 E 77 BN002 a BN001 BK001 BK005 81 ST001 A ST002 a 90 TA001 100 76 SM001 SJ001 B SM002 a DB002 54 DB001 PU001 C a RO001

54 SB001

57 SB002 KP001 77 D BG001 a BG002 T.schlegelii

0.01 substitutions/site

Figure 5.2: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak inferred using Neighbour-joining (NJ) analysis. Support value next to the node are bootstrap values.

164

MR002 83 MR010

90 MR003 E BN002 a BN001 77 SB001 SB002 KP001 D 91 BG001 a BG002 BK001 BK005 91 ST001 A ST002 a 87 TA001 79 SM002 SM001 B 100 SJ001 a DB002 70 DB001 C PU001 a RO001 T.schlegelii

5 changes

Figure 5.3: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak inferred using Maximum Parsimony (MP) analysis. Support value next to the node are bootstrap values.

165

MR002 93 MR010 MR003 96 E BN002 a BN001 70 SB001 SB002 KP001 D 82 BG001 a BG002 BK001 BK005 90 ST001 A 71 ST002 a 94 TA001 94 SM002 SM001 B 100 SJ001 a DB002 71 DB001 C PU001 RO001 T.schlegelii

0.01 substitutions/site

Figure 5.4: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak inferred using Maximum likelihood (ML) analysis. Support value next to the node are bootstrap values.

166

0.98

0.98 A

1.00

0.95

0.90 C 1.00

0.99

D 0.98

0.81

0.93 E

0.9 5

Figure 5.5: Bayesian inference of the 50% majority rule consensus tree of Combine microsattelite genes of C. porosus. Bayesian posterior probabilities are accordingly indicated besides the branch nodes.

167

5.3.4 NETWORK Analysis

The median-joining network for haplotypes of C. porosus showed distinct clusters based on geographical areas, which indicates a high level of haplotype diversity (Figure 5.6). Five groups of haplotypes clustered together or haplogroup were identified in the Network figure, each representing different river basins and this was consistent with the topologies of the phylogenetic trees (Figure 5.2 – 5.5). All C. porosus haplotypes from Sarawak RB (Hap_5,

Hap_13, Hap_14, Hap_15 and Hap_16) clustered in a group that was distinct from haplotypes from Samarahan/Sadong RB (Hap_6, Hap_7 and Hap_8) by at least 5 mutational steps. Meanwhile, Samarahan/Sadong haplotype cluster was separated with haplotypes from

Saribas/Krian RB (Hap_9, Hap_10, Hap_11 and Hap_12) in central region of Sarawak by at least 5 mutational steps (Figure 5.6).

Saribas/Krian cluster of haplotypes were connected to a median vector (node A) by 2 mutation steps before the line connected to a cluster consist of haplotypes from C. porosus sampled in middle part of Rajang RB with 3 mutational steps, totalling 5 mutational steps differentiate between the two clusters (Figure 5.6). The node A could possibly infer the missing haplotype representing population of C. porosus from lower region of Rajang RB, which was unable unsampled in this study. A single haplotype from Kapit (Hap_2) was isolated from the haplotypes of middle Rajang by 10 mutational steps, indicating high genetic divergence between population in the middle and upper parts of Rajang RB (Figure

5.6).

168

Haplotypes from Bintulu (Hap_20 and Hap_21) and Miri (Hap_17, Hap_18 and Hap_19) in northern of Sarawak formed a cluster each, differentiated by 3 mutational steps (Figure 5.6).

Furthermore, distance between haplotype clusters represented the populations of C. porosus in the northern of Sarawak (Bintulu and Miri clusters) and clusters in central region of

Sarawak (Saribas/Krian and Rajang clusters) were at least 11 mutational steps.

169

Miri Bintulu

Middle Node A Rajang

Upper Rajang

Sarawak River (Kuching) Saribas/Krian

Samarahan/Sadong

Figure 5.6: The median-joining Network generated by NETWORK software version 5.0.0.3 illustrating the relationship of the saltwater crocodile, C. porosus from different localities in Sarawak. Each circle represents a haplotype and the diameter of the circle is scale to the haplotype frequency. Different colours in the circle represent different localities. Bold number next the lines connecting the haplotypes indicate number of mutation step(s).

170

5.3.5 Population Genetic Analyses

Nucleotide diversity (π) among five populations of C. porosus in Sarawak were low with values ranging from 1.0% to 2.7%, while net nucleotide divergence (Da) varies in between

0.7% to 3.3%, suggesting small genetic differentiation among the populations (Table 5.7).

Table 5.7: Measures of Nucleotide Diversity (π) and Net Nucleotide Divergence (Da) among populations of C. porosus analysed by locations.

Locality Approx. Nucleotide Diversity Net Nucleotide Divergence Distance (π)a,b (Da) (km) Sarawak River - 69.4 0.01111 0.00795 Samarahan/Sadong Sarawak River - 123.2 0.01763 0.01529 Saribas/Krian Sarawak River - 271.0 0.02169 0.02246 Rajang Sarawak River – 532.3 0.02700 0.03358 Bintulu/Miri Samarahan/Sadong 53.8 0.01044 0.00708 - Saribas/Krian Samarahan/Sadong 201.6 0.01465 0.01454 – Rajang Samarahan/Sadong 462.9 0.01906 0.02517 - Bintulu/Miri Saribas/Krian - 147.8 0.01268 0.00770 Rajang Saribas/Krian - 409.1 0.01917 0.02112 Bintulu/Miri Rajang - 341.7 0.02035 0.02279 Bintulu/Miri aEstimated using the Kimura 2-parameter distance (Kimura, 1980). bsites with gaps were completely excluded.

Nucleotide diversity and net nucleotide divergence values were lower in populations from western (Sg. Sarawak and Samarahan/Sadong) and central (Saribas/Krian and Rajang) of

Sarawak compare to population from northern (Bintulu/Miri). Between those populations

171 and Bintulu/Miri population, Da values were much higher (2.1% - 3.3%). On the other hand,

Da values in between populations from western and central were ranging from 0.7% to 2.2%

(Table 5.7).

This information seems to indicate isolation by distance occurred to the populations of C. porosus in Sarawak. However, mantel test showed a lack of significant relationship (only at p < 0.5) between net nucleotide divergence (Da) and geographic distance among the five populations of C. porosus in Sarawak (r = 0.957, p = 0.007, 1000 permutations). The mantel test result revealed that isolation by distance was not applicable to the populations of C. porosus in Sarawak, meaning that geographical distance is not necessarily influence the migrations of the crocodile across the state.

The mismatch distribution of pairwise nucleotide among the microsatellite sequences data for all the populations or each population, support population expansion hypotheses following the expected distribution under the sudden expansion model and also the spatial expansion model. This was indicated by the small sum of squared deviations (SSD) values ranging from 0.05 – 0.16 for sudden expansion and 0.04 – 0.17 for spatial expansion with lack of significance (sudden, p = 0.10 – 0.63; spatial, p = 0.28 – 0.86). In addition, values of

Harpending’s raggedness index (r) were also recorded low, ranging from 0.14 to 0.44 for both expansion models and the analysis result showed lack of significant, p > 0.05 (Table

5.8), inferred as unimodal mismatch distribution in the C. porosus population. However, scatterplots of mismatch distribution for each population (Figure 5.7a – Figure 5.7e) showed multiple peaks in all populations, generally interpreted as multimodal mismatch distribution.

172

Table 5.8: Summary statistics of Microsatellite Cj16 sequences variation in five populations of C. porosus in Sarawak.

Populations N H D Fs Sudden expansion Spatial expansion SSD r SSD r Sarawak RB 5 5 -0.28 1.06 0.09 0.16 0.07 0.16 (p=0.50) (p=0.15) (p=0.10) (p=0.82) (p=0.36) (p=0.83) Samarahan/ 3 3 0.00 -0.08 0.16 0.44 0.17 0.44 Sadong RB (p=1.00) (p=0.23) (p=0.63) (p=1.00) (p=0.86) (p=1.00) Saribas / 4 4 -0.56 -0.36 0.08 0.22 0.08 0.22 Krian RB (p=0.43) (p=0.24) (p=0.50) (p=0.84) (p=0.76) (p=0.90) Rajang RB 5 4 -0.78 0.78 0.13 0.39 0.13 0.39 (p=0.31) (p=0.57) (p=0.32) (p=0.31) (p=0.28) (p=0.43) Bintulu / 5 5 0.30 -1.51 0.05 0.14 0.04 0.14 Miri RB (p=0.66) (p=0.08) (p=0.53) (p=0.80) (p=0.61) (p=0.81)

N= number of sequences analyzed; H= number of haplotypes; D= Tajima’s statistic (P (Dsimul < Dobs), Tajima 1989); Fs, Fu’s statistic (Fu 1997); SSD= sum of squared deviations of the observed and expected mismatch with p values in parentheses; r, raggedness statistic (Harpending, 1994) with p values in parentheses. ** Significance (p < 0.05) was determined using coalescent simulations in Excoffier (2004). Sites with gaps were completely excluded.

Tajima ’s test of neutrality (D) for all populations of C. porosus resulted negative values ranging from -0.28 to -0.78 except for Samarahan/Sadong (0.00) and Bintulu/Miri (0.30) and lack of significance was observed (p = 0.31 to 1.00), indicating that the populations were deviate from neutral and was evolved under non-random process (Table 5.8). Fu’s F neutrality test gave non-significant negative values for Samarahan/Sadong (-0.08, p = 0.23),

Saribas / Krian (-0.36, p = 0.24) and Bintulu/Miri (-1.51, p = 0.08). Conversely, positive Fs values were observed for Sarawak (1.06) and Rajang RB (0.78) with lack of significance (p

= 0.15 and 0.57, respectively) (Table 5.8).

173

(a) 4 (b) 4 (c) 4

3 3 3

2 2 2

1 1 1

Frequency Frequency Frequency 0 0 0 0 2 4 6 8 10 0 2 4 6 8 10 0 2 4 6 8 10 -1 -1 -1 Pairwise Differences Pairwise Differences Pairwise Differences

(d) 4 (e) 4

3 3

2 2

1 1 Frequency Frequency 0 0 0 2 4 6 8 10 0 2 4 6 8 10 -1 -1 Pairwise Differences Pairwise Differences

Figure 5.7: Mismatch distribution of C. porosus at (a) Sarawak RB, (b) Samarahan/Sadong RB, (c) Saribas/Krian RB, (d) Rajang RB and (e) Bintulu/Miri RB population. The dark line represents the observed and light lines represent the expected distribution for each model.

174

The AMOVA analysis (Table 5.9) revealed that most of molecular variance was founded among the populations (71.85%) than within the populations (28.51%), which both was significantly differentiated (p = 0.00). This information possibly signified an unequal rate of evolution occurs among lineages in the same populations.

Table 5.9: Measures of geographical population differentiation in Crocodylus porosus based on an analysis of Molecular Variance approach using microsatellite sequences data.

Source of Variance Percent (%) Fixation Pa variance component variation index, ϕ Among 6.73 71.85 0.72 0.00* populations Within 2.64 28.15 0.72 0.00* Populations Total 9.37 0.72 0.00±0.00

*Significant (p < 0.05). aProbability of finding a more-extreme variance component of the ϕ index than that observed by chance alone after 1000 permutations.

Significant ϕST values were observed in the pairwise genetic differentiation among all the populations (Table 5.9).

Table 5.10: Genetic differentiation matrix of populations calculated by ϕST. p values are shown in parenthesis (below the diagonal).

Sarawak RB Samarahan Saribas / Rajang RB Bintulu / / Sadong RB Krian RB Miri RB Sarawak RB -

Samarahan / 0.52 - Sadong RB (0.01±0.00)* Saribas / Krian 0.65 0.52 - RB (0.01±0.00)* (0.04±0.01)* Rajang RB 0.73 0.67 0.50 - (0.01±0.00)* (0.01±0.00)* (0.01±0.00)* Bintulu / Miri 0.82 0.82 0.74 0.75 - RB (0.01±0.00)* (0.01±0.00)* (0.01±0.00)* (0.01±0.00)* *Significant (p < 0.05) with 1000 permutations.

175

Low nucleotide Nucleotide (Nst) and population (Fst) subdivision with high number of migrants per generation (Nm) were recorded in all five populations of C. porosus in Sarawak, indicating there is gene flow occurs in the populations. Nst and Fst values were higher between the population of Samarahan/Sadong and Bintulu/Miri (Nst = 0.83, Fst = 0.83) compared to others, even more than Sarawak River – Bintulu/Miri populations although the geographical distance between the areas are greater than Samarahan/Sadong - Bintulu/Miri

(Table 5.11). In addition, number of migrants per generation (Nm) for Samarahan/Sadong -

Bintulu/Miri was also lower compared to those in Sarawak River – Bintulu/Miri, further indication that geographical distance is not necessarily influence the migrations of the crocodile across Sarawak.

Table 5.11: Measures of Nucleotide Subdivision (Nst), Population Subdivision (Fst) and Gene Flow (Number of Migrants, Nm) among populations of C. porosus analysed by locations.

Locality Approx. Nucleotide Estimate of Number of Migrants Distance Subdivision Population per generation a b b (km) (Nst) Subdivision (Fst) (Nm) Sarawak River - 69.4 0.55628 0.55414 0.40 Samarahan/Sadong Sarawak River - 123.2 0.63199 0.62831 0.30 Saribas/Krian Sarawak River - 271.0 0.71319 0.70911 0.21 Rajang Sarawak River – 532.3 0.80534 0.80096 0.12 Bintulu/Miri Samarahan/Sadong 53.8 0.53648 0.53448 0.44 - Saribas/Krian Samarahan/Sadong 201.6 0.69685 0.69432 0.22 – Rajang Samarahan/Sadong 462.9 0.82698 0.82410 0.11 - Bintulu/Miri Saribas/Krian - 147.8 0.48104 0.47856 0.54 Rajang Saribas/Krian - 409.1 0.74098 0.73737 0.18 Bintulu/Miri Rajang - 341.7 0.75127 0.74781 0.17 Bintulu/Miri a Estimated using lynch and Crease (1990). b Estimated using Hudson et al. (1992).

176

5.4 Discussion

Potentially parsimoniously informative sites found in the sequences of the microsatellite genes Cj101, Cj105 and Cj131 are relatively high (50.0% - 55.2%), and this indicates that the genes are reliable to infer genetic variations of C. porosus in Sarawak at the population levels (Zainudin et al., 2010). The repeat base, CA, and number of repetition motif for each markers gained in this study were consistent with what have been obtained by Hekkala et al.

(2015) using the same microsatellite markers. Most frequent repeat base among dinucleotide in animal genomes is CA (Ellegren, 2004), which explain why many microsatellite markers are constructed based on this repeat motif including for C. porosus. Higher proportion of

A+T base compared to G+C base found in the sequences in the present study, similar with those reported by Li et al. (2007) who sequenced a complete genome of C. porosus. In their study, Li et al. (2007) found out that A+T skew is higher than G+C skew in the C. porosus genome, whereas the most abundant base is Adenine (A). In other animals like amphibian and echinoderm, the similar bias was observed in their sequences where the frequencies of

A and T bases is higher than G and C bases (Maltagliati et al., 2010; Zainudin et al., 2010).

Generally, all sequences for each microsatellite genes in the present study matches with at least one or several C. porosus sequences in NCBI GenBank with the high bases identical range from 70% to 95% and relatively small E-value (except for one or two matches), ranging from 3e-17 to 8.0. E-value equal to zero or closer to the value of zero show significant match with the hit sequence (Karlin & Altschul, 1990). Thus, all of the matches with microsatellite genes prove that sequences obtained in this study were from C. porosus.

177

Altogether 21 microsatellite haplotypes were identified from the 22 individuals of C. porosus sequenced in this study (Table 5.6), meaning that each individual of C. porosus have unique haplotype except for samples from Sibu, where both SB001 and SB002 share the same haplotype (Hap_1). This further support the reliability of microsatellite marker in inferring genetic variation of C. porosus in Sarawak as different haplotype were identified from each sample. The uniqueness of each haplotype in the presents study could also indicated high genetic diversity among the C. porosus population of Sarawak. There are also different haplotypes were identified in each sample from Miri (MR002, MR003 and MR010), obtained from a crocodile farm (Miri Crocodile Farm, MCF), indicating the diversity of crocodile populations is high for Miri population. MCF has been operating since 1992 and the early brood stocks for crocodile ranching in the farm, were obtained from rivers in Miri and Baram Rivers. In addition, the farm also has been used by the authority as holding facility for captured crocodile that endanger local people in northern part of Sarawak. Thus, mixture of adult crocodiles in MCF could best explained the high genetic diversity of C. porosus from Miri.

Multimodal mismatch distribution shown in all populations scatterplots (Figure 5.7a –

Figure 5.7e) could depict a situation of general demographic stability in the populations

(Rogers & Harpending, 1992). There is a possibility that the crocodile populations are experiencing demographic stability as the population still in the recovery process, due to recent declining (Cox & Gombek, 1985). However, SSD and R values (Table 5.8) and supported by gene flow (Nm) were consistent with the hypothesis of demographical expansion model (Slatkin & Hudson, 1991; Rogers & Harpending, 1992; Ray et al., 2003;

Excoffier & Lischer, 2010). According to Maltagliati et al. (2010), population sub-

178 structuring and mutation rate heterogeneity may account for multimodal mismatch distribution, therefore rather than interpreted as demographic stability, the multimodal mismatch distributions were the result of the presence of different haplogroups detected.

The negative D value in Tajima neutrality test for Sarawak River, Saribas/Krian and Rajang populations (Table 5.8) could have indicated that the populations had experience a bottleneck effect. About 30 to 40 years ago, the crocodile population in the wild were dramatically decline due to overexploitation (Cox & Gombek, 1985), hence genetic bottleneck could possibly happen in the population. Intensive harvesting of crocodiles and their eggs during the exploitation era were recorded in those rivers especially in the Sarawak and Rajang River (Cox & Gombek, 1985). Meanwhile, negative Fs values in

Samarahan/Sadong, Saribas/Krian and Bintulu/Miri would have inferred population expansion or genetic hitchhiking in the populations (Zainudin et al., 2010), but not significant enough (p > 0.05) to support the claim. Therefore, further investigation need be done in the future to resolve this matter.

The data from the population genetic analysis also reveal that populations from Bintulu/Miri in northern of Sarawak appeared to be slightly isolated with populations from the central

(Saribas/Krian and Rajang) and western part (Sarawak River and Samarahan/Sadong) based on the low level of migrants per generation (Nm = 0.11 – 0.18) as well as Nst and Fst values

> 0.8, consistent with phylogenetic trees and Network topologies. High number of migrants per generation (Nm) indicated frequent migration rate or gene flow among the populations of C. porosus and further supporting the population expansion hypothesis.

179

Population genetic data analysis suggest that there is the population expansion due to the frequent migrations of C. porosus in Sarawak. Complex river systems and massive web-like shape in several major river basins in Sarawak play major role influencing the expansion of

C. porosus across the state. Sarawak has 22 major river basins connected to several hundred tributaries, plus peat swamp and mangroves areas that are associated with the river basins, throughout 12 million hectares area of the state (Tisen & Ahmad, 2010). Crocodiles are found in all of those river basins based on the HCC data (Chapter 3) and other reports (Tisen

& Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Robi, 2014; Zaini et al.,

2014; Sarawak Forestry Corporation, 2018) and the animals were found travel frequently in between the river basins.

In several neighbouring river basins in Sarawak, the distance between the mouth of the rivers are small (closed to each other). As example, in Saribas/Krian and Samarahan/Sadong RB the distance between the mouth of each rivers is approximately less than 60 km, thus it is very possible for the crocodiles to travel across the sea to the next river basin. The ability to swim across sea could also explained closed genetic relationship among crocodile in Bintulu and Miri although both area have distance about 200 km. Sea barriers do not appear to pose a significant obstruction for C. porosus to migrate since the reptiles can migrate across the sea for a distance of more than 800 km (Gratten, 2003). Several movements of crocodiles along the coastal area of Australia for hundreds kilometers had been recorded using telemetry and GPS transmitter (Campbell et al., 2010; Campbell et al., 2013). River basins are also connected to each other at some points, for instance Sarawak RB and Samarahan

RB, both were connected via several tributaries, one of them is a tributary call Loba Batu

Belat River. This could facilitate the migrations of the crocodile between the river basins. In

180 addition, during NEM where rainfalls are relatively higher throughout the season period, water level in the rivers are elevated and many areas like swamps and mangroves are flooded with water (Sa’adi et al., 2017), and this situations are believed had facilitated the crocodile to travel to other areas or moving from one waterway to another that were previously disconnected by dry land . Crocodiles also use the water surface current during this monsoon season to travel longer distance (Campbell et al., 2010). Furthermore, monsoon season in

Sarawak typically coincide with the breeding season of crocodile (Stuebing et al., 1985) and the females can travel up to 50 km river distance from their original habitat to a another place for nesting (Campbell et al., 2013).

Migrations of C. porosus in Sarawak are not only occur across the river basins, but the expansion of the animal populations could also occur further upstream in a large river basin, based on the high Nm values for Rajang populations (Table 5.8). In the present study, Rajang populations were represented by samples that had been collected from middle (Bintangor and Sibu) and upper (Kapit) region of the river basin. Saribas/Krian population are the closest with Rajang RB with low Fst and high Nm (Table 5.8) indicating frequent migration in both populations. Geographical distance between the Saribas/Krian and the mouth of

Rajang is estimated around 50 km, while the distance between the mouth with the middle region of Rajang is approximately 100 km. According to Campbell et al. (2013), ‘nomadic’ crocodiles especially males prefer to foraging into new territory and travel long distances including toward freshwater upstream looking for the best site to stay.

181

5.5 Conclusion

Five distinct clades representing five C. porosus populations based on the different geographical areas in Sarawak obtained in the phylogenetic and Network analysis indicating that DNA microsatellite is a good gene marker to infer relationship among C. porosus in the state. Furthermore, population genetic analyses showed that there is gene flow amongst the five populations suggesting that frequent migrations occur between the populations of C. porosus in Sarawak. Mismatch distribution shows multimodal pattern in the scatterplot which is common for populations at demographic equilibrium. However, based on sudden and spatial expansion SSD and R values, the populations are experiencing expansion. In addition, neutrality tests support the population expansion hypothesis particularly in

Samarahan/Sadong, Saribas/Krian and Bintulu/Miri populations.

182

CHAPTER 6

GENERAL DISCUSSION

The historical data (Chapter 3), ecological data (Chapter 4) and genetic data (Chapter 5) collected in the present study are providing valuable information about the populations of C. porosus in Sarawak. Data on conflicts between human and crocodile for over 118 years period revealed that the crocodiles are dispersed in almost all major river basins in Sarawak, even at the time when Sarawak was ruled by the colonial government prior to the year

1940’s. Indeed, it is believed that the crocodile has been long living in the rivers of Sarawak based on the stories told by explorers who came to Sarawak (Wallace, 1869; Hornaday,

1885; Bartlett, 1895; Beccari, 1904) and the findings of crocodile earthen in several places across Sarawak (Datan et al., 2012). The earthen crocodile replicas or known as ‘Baya tanah’ was built by indigenous people in Sarawak more than hundreds of years ago, portraying the respect of the people towards crocodile, living in the nearby rivers at that period of time

(Datan et al., 2012).

A theory by Gratten (2003) suggested that estuarine crocodile have been migrated across

Indo-pacific region including in Borneo Island since Pleistocene glacial periods about 2 million years ago. During the Pleistocene periods, water level was about 120 m lower compare to present day, hence reduced the distance between land and facilitate crocodile migration between islands (Gratten, 2003). Afterward, the increasing water level since the

Pleistocene periods could allowed crocodile to disperse into wider area within Borneo Island.

Genetic diversity as inferred by microsatellite data in Chapter 5 further supports the long

183 history of crocodile migration particularly in Sarawak as distinctive subpopulations were identified according to the demographic area.

The attacks data suggest that crocodiles had been living in the upstream areas far from the sea, since more than 100 years ago, for example two cases of crocodile attack has been recorded as far as in Belaga and Palagus in 1920’s. Belaga and Pelagus are located more than 200 km from the mouth of Rajang River. Crocodile surveys in the Rajang River Basin

(RB) (Chapter 4) had spotted crocodiles in tributaries at the middle and upper regions of the river basin. The farthest tributary surveyed in the present study at Rajang RB is at Katibas

River in Song, Kapit, approximately more than 180 km distance from estuary, with possible adult crocodiles were detected in the tributary.

The presence of crocodile in different regions (lower, middle and upper) of Rajang RB indicated that C. porosus in Sarawak live in a wide range of habitats; from large salt water river system and small tidal tributaries (near to estuary) in the lower region to hypo-saline or fresh water non-tidal tributaries in the middle and upper regions. The crocodiles were abundance in mangroves and Nypa areas near to the river mouth as well as their presences were detected in riverbank areas dominated by mix plants in freshwater rivers. In the crocodile surveys, there were crocodiles found in about 5 km deep into upriver of non-tidal freshwater tributaries in the upper region of Rajang. Although C. porosus typically occur at very low densities in the upstream reaches of freshwater rivers, their presence has or may have a significant impact on the use of rivers and riparian areas by local people and livestock

(Lading, 2013; Tisen et al., 2013). Similar problem has been faced by other countries including Australia and Indonesia whereas crocodiles were found in the upstream reaches

184

(areas upstream of tidal influence) of freshwater rivers and their numbers has been increasing into worrying figures (Letnic et al., 2011; Shaney et al., 2017).

Human activities and riverbank land use assessment in the surveyed rivers (Chapter 4) varies among rivers, where the data reflected that anthropogenic pressures have impacts on the crocodile distributions. In the surveys, the crocodile was not seen or only small number of individuals were spotted in river areas within town proximity such as in Nyelong River and

Sarikei River near to Sarikei Town. Meanwhile, in Kanowit River near to Kanowit Town, the crocodile was absent throughout the entire 18 km survey distance. Sarikei and Kanowit

Town, which are located at the river mouths, are experiencing rapid developments on its riverbank areas and river usages for activities like fishing and boating are constantly high.

All these activities could impact the distribution of crocodile in the rivers and the distribution pattern in those areas showed that crocodiles are avoiding high human populated areas.

Similarly, Shaney et al. (2017) who studied crocodile population in Indonesia found negative correlation between the abundance of crocodiles with proximity to humans, meaning that less crocodiles are found in areas close to humans, consistent with the result of the present study.

However, this situation is not necessarily depicting that the crocodiles are avoiding all human populated areas. There are studies elsewhere suggested that human disturbances may not affect or have a weak influenced on crocodile distributions in the river (Fukuda et al.,

2008; Evans et al., 2016). In river areas near to villages or longhouses where human disturbances and habitat degradation are considered moderate to low, crocodiles were still found in close proximity with humans like in Igan and Belawai River in the present study.

185

The crocodiles in the area might have tolerated with the level of disturbance and adapted with the river conditions. In certain villages where proper garbage disposal areas are unavailable, foods leftover or rubbish are thrown into the river and this could attract crocodiles to come near the villages (Bernama, 2017; Hassan et al., 2018). Crocodiles have well developed olfaction or sense of smell, hence odours from things like animal carcasses and leftover bones that had been thrown into the river can be detected by the reptiles miles away (Grigg & Gans, 1993). If the act of throwing garbage into the river is not stopped, it feared that the garbage could attract crocodiles to come and stay in the areas near to the people’s house and consequently could lead to potential risk of crocodile attacks.

Frequent migrations and on-going expansion occur within the population of C. porosus in

Sarawak as evidently shown by population genetic analyses in Chapter 5. This could explain why their presence are detected in areas that were not known to have the reptiles before or the crocodile were found reappear again in rivers where previously the animals had been absent for years in the areas. Lately, riverine communities in Sarawak have rise their concern about the matter and they hope the relevant agencies could take proper actions to prevent conflicts with the crocodile (Hassan & Abdul-Gani, 2013). To elaborate further, in the present study, two crocodiles were spotted in Poi River while in previous survey in 2014, no crocodile was found in the river (Robi, 2014). Among the two crocodiles spotted in Poi

River, a hatchling was detected about 5 km upriver indicating the possibility of nesting occurred in further reach of the tributary. Hatchling, with size less than 0.5 meter of body length, are normally age less than six months (Webb et al., 1991) and the young crocodile usually did not travel far from the place where it was hatched. At the young age, crocodile hatchlings have short movement range, usually confine in waterway area near to their nest

186

(Webb et al., 1977; Hanson et al., 2015). Female crocodiles might find secluded area like in

Poi River as suitable nesting ground, thus they frequently travel into the river.

The expansion of crocodile populations including into the new areas is most likely influenced by a number of factors. First of all, crocodile populations in Sarawak are on the road of recovery after severe decline in 1980’s and their densities in several rivers across

Sarawak are increasing (Tisen & Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani,

2014; Sarawak Forestry Corporation, 2018), thus larger areas are needed to support the growing populations. At the same time, with limited spaces and food sources found in a particular river, crocodiles have to compete for the resources not just among themselves, but also with other animals and human too. The dominant crocodiles, typically very large adults, would take control of specific parts in the river that have the most abundant key resources like aquatic foods, riverbank spaces for basking and ambushing terrestrial animal. Other smaller adult crocodiles, on the other hand, would not be able to access the areas guarded by the dominant crocodiles, therefore they had to forage into new areas (Hanson et al., 2015).

Successful conservation programs supported by the law protecting the crocodiles in Sarawak may have resulting low fatality among young crocodiles, hence more crocodiles survive into adulthood (Fukuda et al., 2014). The increasing number of young adult crocodiles could contribute to the expanding population as what have been mentioned before, this group of cohorts are the ones that travel long distances and foraging wider areas.

Human could be one of the contributing factors in the migration of crocodile. Sarawak is a fast developing state in Malaysia, thus developments are rapid across the state. The developments are influenced by the increasing number of human populations in Sarawak.

187

The population of Sarawak is estimated to be around 1.72 million in 1991 with population density of 14 persons/km2 then increased to 2.07 million in 2000, and the population rose to

2.47 million in 2010 with density of 20 persons/km2 (Department of Statistics Malaysia,

2017). With the average annual population growth rates in Sarawak are around 0.8% to 1.4% from 2014 to 2017, it is expected that the population of people in Sarawak will reach 3 million by the year 2020. The surge of population in Sarawak can be seen in major cities and towns throughout Sarawak as developments on those areas would attract more people to come and stay in the urban areas.

Developing towns in Sarawak like Sarikei, Kanowit and Kapit are situated in area close to rivers, thus land use for developments are expanding towards the riverbank. To support the growing human population area, more residentials areas are built as well as business and industrial buildings, leading to more riverbanks being cleared to give ways for the development. In addition, demands for food sources are also increase, hence more agriculture lands are opened near to the rivers and fishing activities are booming along the waterway. As the center of economic activities for the surrounding area, the towns will become hub for transportations and as the town situated next to a river, water transportation is still a popular choice among the locals to travel and transport the goods.

These human activities and riverbank developments would affect the habitat and nesting ground of the crocodiles and also change the ecology of the river, resulting less space area habitable for crocodile and food sources are also becoming limited (Fukuda et al., 2008;

Shaney et al., 2017). Loud noise from activities in the city and high boat traffic in the river could also affect the behavior of the crocodile in the river as the crocodile might have

188 experience bad situation like collision with boat or sound from the city or boat engine disturbs their feeding or basking activity (Grant & Lewis, 2010). Booming fishing activities are not just depleting the food abundance for the crocodile, it could also have influence on crocodile behavior in the river as the animal could have been injured or trap into net or hooks that were setup by the fishermen. The changing in ecology of the river and all the anthropogenic disturbance faced by the crocodiles are making harder for them to live in the area, forcing them to migrate into new areas.

6.1 Management Implication

Managing crocodiles in Sarawak is a big challenge for the local authority. Sarawak has a very vast area of waterways (about 124,449.51 km2), comprising 22 major rivers that stretch from centre of Borneo into the sea, with plenty of tributaries, mangroves areas and peat swamps which are associated to the major rivers and also a number of nature-form waterholes such as Logan Bunut (Tisen & Ahmad, 2010). Therefore, monitoring crocodiles in every corner of the waterways would be hard as it will cost a lot of money and manpower as well as time consuming.

Since the time when the law was introduced to protect the crocodile in 1990’s, crocodile management in Sarawak focused on conservation of the animal and efforts to recover the wild population of the crocodiles. After almost three decades, the crocodile populations in

Sarawak are recovering and several rivers show increasing trend in density of the reptiles

(Tisen & Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Sarawak Forestry

189

Corporation, 2018). However, recovering population of wild crocodile in Sarawak has led to rising conflicts between human and crocodile (HCC). Now, crocodile management needs to find solutions that can help in mitigating HCC in the state and at the same time continue with the efforts for conservation of crocodile and its habitat. With the current situation in

Sarawak where crocodile populations are expanding and also increasing in conflicts between human and crocodile, formulating plans and making decision for crocodile management that create a ‘win-win’ situation for both human and crocodile will not be an easy task. Hasty decision made without proper studies and insufficient information known about the crocodile are fear to have adverse effect on the crocodile population. Hence, information collected in the present study could be useful in many ways to help the authority to manage the crocodiles in Sarawak.

The data about crocodile’s population and habitat in Rajang RB collected in the present study could provide clues about crocodile’s population in the rest of the river basins in Sarawak.

Rajang River is the longest river in Sarawak and from the present study, a variety of river habitat that supports crocodile population from lower into upper region of the river were documented. Similar habitats can be found in other river basins, therefore the data can be used as reference to predict the dispersion and abundance of crocodile in other river basins.

The data also suggest the possibility of crocodile expansion that could reach the fresh water sections hundreds of kilometers away from the estuary. The crocodile management agencies can make early preparation if there are reports of crocodile sighting in freshwater section in upriver and to warn not just the community in that area but also communities who live further upstream about the potential risk of attack. Constant reminder and reliable information from

190 the crocodile management agencies could also help communities to take further precaution when using the river.

The removal of problematic or potentially threat crocodile from human populated area is among the quickest options to mitigate HCC. This can be done through translocating the animal into other places or through culling. In Sarawak, crocodiles culling and translocation has been started even since the animal population started to make a comeback in 1990’s. At that time, the removal activities, mostly culling, were carried out only when there were crocodile attacks occurred and it involved the area or river where the attack occurred only

(Ritchie & Jong, 2002). However, in 2012, public sentiment on crocodile has reached boiling point as series of attacks across Sarawak claimed human life and the number of attacks reported increasing from previous year thus as the response, state-wide culling and translocating of crocodiles were conducted across the state (Tisen et al., 2013).

From 2013 to 2017, there are at least 101 operations to remove problematic crocodiles from human populated area were conducted by Swift Wildlife Action Team (SWAT) of SFC throughout Sarawak (Sarawak Forestry Corporation, Unpublished data). In the operations, about 46 crocodiles were killed (some were found dead in the traps) while another 47 crocodiles were captured alive and transferred into nearest holding facilities (eg: Matang

Wildlife Centre, Benaya Crocodile Farm) or wildlife sanctuaries / national parks (eg:

Similajau National Park). Most of the operations were conducted as a response to the crocodile attacks incidents or reports by local peoples that concerned about their safety.

During the operations, the SWAT team only targeted crocodile that possess danger to the human (size above 2.1m) and the team was using traps to captured or if needed, they will

191 kill the crocodile by shooting (Sarawak Forestry Corporation, 2018). The carcass of crocodile that had been killed during the operation were buried in strategic locations.

Culling and translocating of crocodiles from rivers might not fully effective in handling problematic crocodiles in Sarawak and it could only act as temporary measures, mostly to ease public anger and political demands. The removal programs can be very expensive and time-consumptive, while in the long run it would not solve the problem as crocodiles are elusive animals (Fukuda et al., 2014). In addition, homing instinct and the ability of crocodile to travel long distance might become problems to the management as removal of the crocodile from a river could end up fill by other crocodile or the translocated crocodile could find way to return back to the particular river (Campbell et al., 2010; Campbell et al., 2013).

The removal activities could also give rise to some other issues including issues related to ethical value and conservation.

However, despite all the reasoning, the culling and translocating of crocodile could help in the management of the animal and the same time mitigate HCC especially with the current state of recovery population in Sarawak. More systematic and efficient plans on conducting culling and translocation activities can be formulated with the support of scientific data from researches. For instance, data on crocodile attack collected in the present study could be used to narrow down areas that have high records of attacks or areas that have potential risk of

HCC problems, includes area with a high population of residents; recreational areas or resorts that organise water activities like bathing, boating and jet-skiing; schools, clinics and places of worship. Crocodile monitoring need to focus on those areas and if crocodile pose threats to human, the animals need to be removed.

192

In the present study, an adult crocodile with size more than 2 m has been detected in area close to a village in Igan and Belawai River, while a sub-adult, size 1.5 m to 2 m were spotted approximately less 1 km distance from a school in Poi River. The presence of adult crocodiles potentially possess a risk of attack to the community that live in that area especially young children as the adult crocodiles are aggressive and they are perpetrator for most of attacks (Caldicott et al., 2005; Fukuda et al., 2014; Fukuda et al., 2015). Therefore, the adult crocodile should be removed from those areas before any attacks occur. ‘Crocodile

Removal Zones (CRZ)’ had been introduced by the crocodile management in Sarawak at major population centres like Kuching City, Miri City, Sibu, Bintulu, Sri Aman, Limbang,

Niah and popular recreation areas such as Pasir Panjang, Damai Beach, Siar Beach, Wind

Cave. The presence of crocodiles in these areas will not be tolerated and will be culled or captured and removed (Sarawak Forestry Corporation, 2018).

Among concerns when carrying out the removal programs are the translocated animal could not adapt to the new environment due to distinctive habitat, social awkwardness and inbreeding depression (Fukuda et al., 2014). This can be minimized through information provided through researches as the data from studies can be used to decide the areas that best suit for the translocated crocodile. The data could also be used as reference when deciding areas that can be act as sanctuary for the crocodile, so that any nuisance crocodile can be transferred into there. A total of 10 totally protected areas (TPAs) exists in Sarawak, where crocodiles are found in the area, therefore these areas could be good sanctuaries for the crocodiles. Crocodile habitats are well preserved in those areas, thus can help with the conservation of the animal. Pulau Seduku, an island in Batang Lupar is being proposed as a totally protected areas dedicated to the conservation of crocodiles (Tisen et al., 2013). State-

193 wide culling and translocating of crocodiles that had been carried out in Sarawak since 2012

(Tisen et al., 2013) seems to have a minimal effect on genetic structure of C. porosus populations in the state as there is no indications of population fragmentation occurred within the C. porosus populations of Sarawak based on genetic data (Chapter 5).

In 2016, C. porosus in Malaysia was successfully transferred from Appendix I to Appendix

II, with wild harvest restricted to the state of Sarawak and a zero quota for wild specimens for the other states of Malaysia (Sabah and Peninsular Malaysia) (Sarawak Forestry

Corporation, 2018). The purpose of transferring C. porosus to CITES Appendix II is to enable the sustainable utilization of the wild population in Sarawak. The authority in

Sarawak has seen potential in utilizing crocodiles to generate incomes for local communities and also for the state government in general, and at the same could help in reducing HCC problems. With the current status of C. porosus in CITES Appendix II, local communities could be able to involved in the harvesting of wild C. pososus and its eggs, crocodile’s farming and ranching and also international and domestic trade. As C. porosus is a protected species under state’s law, every individual or company who are interested in harvesting wild crocodiles and their eggs need to acquire licence from the authority (Sarawak Forestry

Corporation, 2018).

Allowing harvesting of wild crocodiles in Sarawak would have pros and contras and it potentially have positive and negative impacts towards the population in the state.

Conservationists feared that allowing harvesting would lead to the history of overexploitation of crocodiles in Sarawak will repeat and it will cause extinction of the wild crocodiles. The crocodile management in Sarawak need to take lessons from the past where

194 the crocodile population in the wild once in the brink of extinction due to uncontrolled hunting and over harvesting (Cox & Gombek, 1985) to formulate a master plan for sustainable harvesting. On the genetic level, harvesting will reduce genetic variation in crocodile population as when a number of crocodiles were taken out from the population, the rest will have small circle of mating companion. Low genetic variation at low population size may lead to inbreeding depression that could cause reduction in survival and reproductive output and thus increase the probability of extinction (Bradshaw et al., 2006).

On the bright side, harvesting would help in reducing the number of crocodiles especially in rivers that have high density of crocodiles. Large crocodiles that pose risk to local people are typically targeted by hunters as it can be sold at a good price, thus this could ease the burden of works for crocodile management team. Harvesting of large adult crocodiles could also benefit smaller crocodiles particularly young adults as this will give them higher chance of survival in area that previously dominated by the large crocodile (Bradshaw et al., 2006).

The most important advantage of harvesting of crocodile is that it could potentially reduce

HCC in Sarawak as the number of large crocodiles in the river will be decreased (Webb,

2008).

In the surveys by Sarawak Forestry Corporation (2018), it the estimated that the population of C. porosus in Sarawak are around 13,507 (non-hatchling). Corrections for visibility bias or correction factor adapted from Baylis (1987) was used in calculating the population estimation from the relative density. According to Bayliss (1987), correction factor varies between different size of crocodile due to the behaviour and wariness. The correction of

195 visibility biases might also be increase in different habitats or river width (Fukuda et al.,

2011). Therefore, there is possibility that the population estimation is underestimated.

A quota of no more than 500 non-hatchlings and less than 2,500 eggs per year has been proposed by the Sarawak state for the first three years of the harvesting program (Sarawak

Forestry Corporation, 2018). The annual harvest quota only takes less than 5% from 13,507 individuals of non-hatchling that has been estimated to exist in the rivers in Sarawak and it is considered to have a high probability of being sustainable. After three years, surveys will be conducted to assess the impact of the harvesting programmes and harvest rates will then be adjusted up or down, based on the results. Relatively small off take of crocodiles from the population could have minimum negative impact on the genetic diversity of the population especially if the harvest programmes is likely to spread among several major rivers in Sarawak (Bradshaw et al., 2006). Genetic data in the present study (Chapter 5) also show relatively high genetic variation within population, hence chance for high reduction of genetic diversity in crocodile population in Sarawak as the result of the propose quota of harvesting is probably small.

The people in Sarawak has been long living in fear of crocodiles as many had become the victims of crocodile attacks. Because of this, crocodile has been viewed negatively by the local people, thinking that crocodiles are as animals that can only bring troubles, thus need to be killed (Hassan & Abdul-Gani, 2013). Managing crocodile for conservations would be not an easy task if the efforts are not supported by the people. Throughout the history people have never conserved anything that they did not value positively (Webb, 2008), therefore it is essential to change the negative perspective of people towards crocodile through

196 awareness programmes. Local people need to know about the benefits of conservation of crocodile and its habitat by explaining to them the important roles of crocodiles in environment, socio-economy and cultures.

Potential contribution of crocodiles towards local economy through harvesting and ecotourism activities, like what have been done in Australia (Ryan, 1998; Corey et al., 2018), can be introduced to the people of Sarawak as this kind of benefits would attract more people to involve in conservation efforts. The information on historical exploitation of crocodile collected in the present study (Chapter 3) could be used in explaining to the people about the risk of extinction, once almost occur to the crocodile population in Sarawak, if the crocodile is not been managed in a sustainable manner and no effort is done to conserve the reptile and its habitat. People may not have particularly liked crocodiles, but when they learn about the positive values of crocodile, neither did they like the idea of the reptile going extinct and being lost from the river forever (Webb, 2008).

Reducing HCC in Sarawak would also help in changing negative perspective of local people towards crocodile. Every time case of crocodile attack on human or livestock reported in the news, it will rise fear among the community and at the same time people will be mad at the crocodile and will continue to consider it as a pest. The data collected in the present study will become in handy, help in the assessing risk of crocodile attacks so that actions can be taken to prevent more attacks occurred in Sarawak (Pooley, 2015). For instance, crocodile attacks data especially for the last 20 years (Chapter 3) could be used as a reference to identify ‘hotspot’ rivers or locations. The Lupar river, Saribas, Samarahan, Sarawak River and Sadong are among the top five river basins that have high number of crocodile attacks

197 from 2000 until 2017, therefore, awareness programmes need to be focused to the riverine communities in these river basins. The awareness programmes are including educational talks, information sharing and exhibitions, not just related to crocodile but also about the importance of keeping the river clean for benefit of wildlife as well as human being. In addition, placing warning signboard in strategic areas along the river is among the effective way to remind locals and outsiders about the potential risk of crocodile attack.

Relevant agencies who are conducting awareness programmes could use the data and findings in the present study to share with the locals about when crocodile attacks were mostly happened and could be used to remind them to take extra precaution when using river at the particular time. As an example, majority of the attacks occurred from evening to midnight (Chapter 3, Figure 3.8), therefore, those who are commonly use river for bathing or other activities at this time need to be extra careful. Furthermore, crocodile attacks were also high in the months of March and April, during the Northeast monsoon and at the time of high tide. The awareness programmes need to be focused on specific group of people especially those who are utilizing river as a source of income and food such as fishermen, crab collectors and others as they are vulnerable to crocodile attacks. Meanwhile, several attacks involving workers in the plantation areas need serious attention by relevant agencies.

The awareness programmes should engage the plantation workers too and the authority concern can advise plantations owners to provide proper bathing and toilet facilities for their workers so that they will minimize using river for daily chores.

From the attacks data (Chapter 3), it is realized that high percentage of crocodile attacks occurred when victims are in the water or at the riverbank, doing activities like bathing,

198 washing clothes or tools and fishing. These activities pose the highest risks of attack in

Sarawak, hence people need to be reminded about the risk when doing the mentioned activities in the rivers so that they will more alert with their surrounding. In hotspot areas, community can be advised to minimize activities in the rivers or build fences (or enclosures) in the water around places where they normally carry out the activities or landing stages to prevent crocodile to come near to them when using the water body.

In Sri Lanka, the crocodile exclusion enclosures or locally known as ‘kimbula kotuwa’ are made of thick palm or hard wood poles driven into the river bed, with each end of the enclosure meeting the river bank (Stevenson et al., 2014). These traditional enclosures typically built by local villagers to prevent crocodiles from entering the river area where the people are using water for daily chores like bathing and washing tools. With the support from the Sri Lanka government and public sectors, more solid and safer enclosures are constructed using metal and wire to replace the traditional enclosures. The enclosures had successfully lowered the risk of crocodile attack in Sri Lanka as there was no attacks reported in area that have the facilities (Stevenson et al., 2014). The similar enclosures could also be used in Sarawak especially in areas with high density of crocodiles and areas where peoples are still using river for water sources. Local authority and public sectors also can contribute by funding the construction of the enclosures, while the villagers can work together in maintaining the enclosures if there is any damage and ensuring the enclosure free from river debris.

Concerning behaviour of the large crocodiles wandering in the area near to the local people houses, scavenging food leftover and rubbish that had been thrown into the river as in Igan

199

River in the present study, has to be taken seriously by the community and the local authority.

This situation possesses risk of crocodile attacks toward the people who live in the area, thus actions need to be taken to prevent any loss of life. Awareness programmes should emphasize on the importance of proper waste disposal, while the local authority could provide garbage collecting services for the community. The crocodile distribution data in the present study could also be used to explain to the local community about the potential risk of crocodile attacks if they do not stop throwing garbage into the rivers.

All cases of crocodile attacks involving children below 10 years old were resulting death to the victims (Chapter 3, Figure 3.11). This showed how much vulnerable this age group when they were attacked by the crocodile. Children usually unaware about the danger they will face when they come near to the water body and also when they were attacked by the crocodile, they are powerless to escape from even with a small crocodile (Fukuda et al.,

2015). Therefore, awareness programmes can be used to remind communities about the importance of monitoring their children carefully and keep them away from waterways, especially from river that are known to have crocodiles in it. Starting from 2012, awareness campaigns called “3M Buaya” aiming to educate children on crocodiles had been carried out by SFC. 3M stands for “Mengenali, Memahami and Memulihara” which means to Know,

Understand and Conserve while Buaya is the Malay word for crocodile (Tisen et al., 2013).

“3M Buaya” programs now had been expanded state-wide with the involvement of more target groups and other relevance agencies such as Resident and District Offices, Police, Fire and Rescue Department and Civil Defence. Although attacks still happen to children, it shows some improvement in the number of attacks and severity of the attacks.

200

CHAPTER 7

CONCLUSION AND RECOMMENDATIONS

In general, this study implies that the human-crocodile conflicts in Sarawak are influenced by a number of factors, among them are the distribution of crocodiles in wide range of habitats and the increasing crocodile populations. Analysing crocodile attacks data from

1900 until 2017 had provided essential information that can help in understanding the patterns of HCC as well as distribution of crocodiles throughout the river basins in Sarawak.

From the data, it was noted that the trend of crocodile attacks on human in the Sarawak was associated with the exploitation trend and recovery of the crocodiles in the state.

Furthermore, HCC had occurred in 22 river basins in Sarawak, thus this mean that the animal has been populated all river basins throughout the state. The present study showed that the

C. porosus was distributed along the lower, middle and upper region of Rajang River Basin suggesting that crocodiles in Sarawak can live in a wide range of habitat, from the large tidal rivers in coastal area to the small non-tidal freshwater tributaries in the upper side of river basin. Variation in the water quality, river habitats, riverbank developments and the abundance of food influenced the density of crocodiles in the eight studied rivers in Rajang

River Basin. DNA microsatellite successfully infer the relationship among C. porosus in

Sarawak as five distintive clades based on the geographical areas (river basins), which can be seen in the phylogenetic trees and Network. Furthermore, there is gene flow among the five populations indicating frequent migrations occurs between the populations of C. porosus in Sarawak. Populations of C. porosus in Sarawak are generally experiencing expansion as support by the mismatch distribution and evolutionary neutrality test data, suggesting that populations of crocodile in Sarawak are panmictic population.

201

More research data are required to provide information for the authority to solve problems related to crocodile in Sarawak and also in assisting the management of crocodile in the state. Areas that can be further improved or study are;

1. Monitoring surveys need to be carried out regularly to determine the current

population status and distribution of crocodiles in Sarawak, e.g., survey in every year

for high HCC areas or major tributaries that recorded high crocodile density in

previous surveys or once in every two to three years for large rivers.

2. There is also a need to have a comprehensive study on the size of crocodile

populations in Sarawak as well as their seasonal behaviour and movement together

with the environmental event (drought, floods) and anthropogenic intervention

(pollution, river development, land use), in which affect the distribution of crocodiles

in the state. Human components can also be included in the study such as human

population expansion and human activities in/near waterways.

3. More DNA samples need to be collected from C. porosus populations in different

localities (or from different river order) in Sarawak including from freshwater

sections in upper reach of the rivers to further understand the genetic structure and

expansion of C. porosus in the state.

The limitations of the data set in the present study must be considered before using the information. Human-crocodile conflicts (HCC) data used in the present study were based on the reports of attacks collected from the available sources. Thus, there is a possibility that some cases had not been reported to the authority. There were also limited available sources related to crocodile attacks incidents within the period from 1946 to 1999. Cases of crocodile

202 attack during that period of time could be higher than what had been collected in the present study but without proper records on the matter, it would difficult to access the information.

Data on crocodile densities and distributions in eight rivers of Rajang RB had shed some lights on the population of crocodiles in the river basin and also provides baseline information on various aspect of the reptile which is lacking in Sarawak. However, data collected in the present study only based on one-period survey in Southwest Monsoon season

(SWM), from the month of March to September 2017. Additional surveys including in different season (Northeast Monsoon, NEM) and years would provide more substantial field data on the crocodile population for better understanding of the species ecology and behavior.

In the genetic study, although DNA microsatellite had successfully inferred the relationship among C. porosus from 13 areas in Sarawak, it might not depict the whole genetic structure of the species in the state. Samples from other areas or river basins could not be collected during the study due to time constraints. DNA samples collected from different areas or river basin will provide more information especially on the movement and expansion of crocodiles in Sarawak.

203

REFERENCES

Abdul-Gani, M. I. Z. (2014). Population Density, Human-Crocodile Conflict and Genetic Variation

among Saltwater Crocodile, Crocodylus porosus in Sarawak. (Unpublished Master's thesis).

Universiti Malaysia Sarawak, Sarawak, Malaysia.

Abdullah, N. S. S. (2010). Molecular Phylogeny of Saltwater Crocodiles (Crocodylus porosus) from

Sarawak based on Combined Cyt b and 12S rRNA Gene Analysis. (Unpublished Master's

thesis). Universiti Malaysia Sarawak, Sarawak, Malaysia.

Ali, H., Adenan, R., & Wan Abu Bakar, W. I. (2014). Saltwater Crocodile (Crocodylus porosus)

Survey in Miri and Bintulu Region. Paper presented at the Borneo Crocodile Forum, Sibu,

Sarawak, Malaysia.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic Local Alignment

Search Tool. Journal of Molecular Biology, 215(3), 403-410.

Amarasinghe, A. T., Madawala, M. B., Karunarathna, D. S., Manolis, S. C., de Silva, A., &

Sommerlad, R. (2015). Human-Crocodile Conflict and Conservation Implications of

Saltwater Crocodiles Crocodylus porosus (Reptilia: Crocodylia: Crocodylidae) in Sri Lanka.

Journal of Threatened Taxa, 7(5), 7111-7130.

Ardiantiono, A., Sheherazade, Karta Atmadja, R., & Wardhani, A. (2015). Analisis Serangan Buaya

Muara (Crocodylus porosus) di Indonesia melalui eksplorasi Database CrocBITE

Berbasiskan Citizen Science (An Analysis of Saltwater Crocodile (Crocodylus porosus)

Attack in Indonesia using Citizen Science CrocBITE Database Exploration). Inovasi Online,

24(3), 8-16.

Axelsson, M., & Franklin, C. E. (2011). Elucidating the Responses and Role of the Cardiovascular

System in Crocodilians during Diving: Fifty Years on from the Work of C.G. Wilber.

Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology,

160(1), 1-8.

204

Azreen, A. (2015). Assessment of Saltwater Crocodiles along Bako River during Three Monsoon

Seasons. (Unpublished Final Year Project Report). Universiti Malaysia Sarawak, Sarawak,

Malaysia.

Balaguera-Reina, S. A., Espinosa-Blanco, A. S., Morales-Betancourt, M. A., Seijas, A. E., Lasso, C.

A., Antelo, R., & Densmore, L. D. (2017). Conservation Status and Regional Habitat

Priorities for the Orinoco Crocodile: Past, Present, and Future. PLOS ONE, 12(2), 1-20.

Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median-Joining Networks for Inferring Intraspecific

Phylogenies. Molecular Biology and Evolution, 16(1), 37-48.

Barbour, M. T., Gerritsen, J., Griffith, G. E., Frydenborg, R., McCarron, E., White, J. S., & Bastian,

M. L. (1996). A Framework for Biological Criteria for Florida Streams Using Benthic

Macroinvertebrates. Journal of the North American Benthological Society, 15(2), 185-211.

Baring-Gould, S., & Bampfylde, C. A. (1909). A History of Sarawak under its Two White Rajahs,

1839-1908. London: H. Sotheran & Company.

Bartlett, E. (1895). The Crocodiles and Lizards of Borneo in the Sarawak Museum, with Descriptions

of Supposed New Species and the Variation of Colours in the Several Species during Life.

Journal of the Straits Branch of the Royal Asiatic Society, 28, 73-97.

Bashyal, A., Gross, B., Venegas-Anaya, M., Lowrance, F., & Densmore, L. (2014). Assessment of

Microsatellites in Estimating Inter-and Intraspecific Variation among Neotropical

Crocodylus Species. Genetics and Molecular Research, 13(3), 5492-5502.

Bayliss, P. (1987). Survey Methods and Monitoring within Crocodile Management Programmes. In

G. J. W. Webb, C. Manolis & P. J. Whitehead (Eds.), Wildlife Management: Crocodiles and

Alligators (pp. 157-175). Sydney: Surrey Beatty & Son and The Conservation Commission

of The Northern Territory.

Beccari, O. (1904). Wanderings in The Great Forests of Borneo: Travels and Researches of A

Naturalist in Sarawak. London: Archibald Constabale & Co Ltd.

205

Bernama. (2017, April 3). SWAT Team Handles Rogue Crocs in Sarawak. New Straits Time.

Retrieved from https://www.nst.com.my/news/2017/04/226826/swat-team-handles-rogue-

crocs-sarawak.

Bolhen, H. (2017). Composition of Fish Fauna and Fishieries at Pelagus Area, Batang Rajang,

Sarawak. (Unpublished Master's thesis). Universiti Malaysia Sarawak, Sarawak, Malaysia.

Bradshaw, C. J. A., Fukuda, Y., Letnic, M., & Brook, B. W. (2006). Incorporating Known Sources

of Uncertainty to Determine Precautionary Harvests of Saltwater Crocodiles. Ecological

Applications, 16(4), 1436-1448.

Brazaitis, P. (1969). The Occurrence and Ingestion of Gastroliths in Two Captive Crocodilians.

Herpetoligica, 25, 63-64.

Brazaitis, P., & Watanabe, M. E. (2011). Crocodilian Behaviour: A Window to Dinosaur Behaviour?

Historical Biology, 23(1), 73-90.

Brien, M. L., Gienger, C. M., Browne, C. A., Read, M. A., Joyce, M. J., & Sullivan, S. (2017).

Patterns of Human–Crocodile Conflict in Queensland: A Review of Historical Estuarine

Crocodile (Crocodylus porosus) Management. Wildlife Research, 44(4), 281-290.

Brooke, M. (1913). My Life in Sarawak, by The Ranee of Sarawak. London: Methuen & Co. Ltd.

Caldicott, D. G. E., Croser, D., Manolis, C., Webb, G., & Britton, A. (2005). Crocodile Attack in

Australia: An Analysis of Its Incidence and Review of the Pathology and Management of

Crocodilian Attacks in General. Wilderness & Environmental Medicine, 16(3), 143-159.

Campbell, H. A., Watts, M. E., Sullivan, S., Read, M. A., Choukroun, S., Irwin, S. R., & Franklin,

C. E. (2010). Estuarine Crocodiles Ride Surface Currents to Facilitate Long-distance Travel.

Journal of Animal Ecology, 79(5), 955-964.

Campbell, H. A., Dwyer, R. G., Irwin, T. R., & Franklin, C. E. (2013). Home Range Utilisation and

Long-Range Movement of Estuarine Crocodiles during the Breeding and Nesting Season.

PLOS ONE, 8(5), 1-9.

206

Campbell, H. A., Dwyer, R. G., Wilson, H., Irwin, T. R., & Franklin, C. E. (2015). Predicting the

Probability of Large Carnivore Occurrence: A Strategy to Promote Crocodile and Human

Coexistence. Animal Conservation, 18(4), 387-395.

CITES. (2018). Appendices I, II and III. Retrieved 22 March 2018, from

https://www.cites.org/eng/app/appendices.php.

Cooper-Preston, H., & Jenkins, R. W. G. (1993). Natural History of The Crocodylia. In C. G. Glasby,

J. Ross & P. L. Beesley (Eds.), Fauna of Australia Vol 2A: Amphibia and Reptilia (pp. 1-

15). Canberra: Australian Government Publishing Service.

Corey, B., Webb, G. J. W., Manolis, S. C., Fordham, A., Austin, B. J., Fukuda, Y., . . . Saalfeld, K.

(2018). Commercial Harvests of Saltwater Crocodile Crocodylus porosus Eggs by

Indigenous People in Northern Australia: Lessons for Long-term Viability and Management.

Oryx, 52(4), 697-708.

Cox, J. H., & Gombek, F. (1985). A preliminary survey of the crocodile resources in Sarawak, East

Malaysia. Kuala Lumpur: World Wildlife Fund (WWF) Malaysia.

Cozzi, G., Broekhuis, F., McNutt, J. W., Turnbull, L. A., Macdonald, D. W., & Schmid, B. (2012).

Fear of the Dark or Dinner by Moonlight? Reduced Temporal Partitioning among Africa's

Large Carnivores. Ecology, 93(12), 2590-2599.

Cramp, R. L., Meyer, E. A., Sparks, N., & Franklin, C. E. (2008). Functional and Morphological

Plasticity of Crocodile (Crocodylus porosus) Salt Glands. Journal of Experimental Biology,

211(9), 1482-1489.

Das, C. S., & Jana, R. (2018). Human–Crocodile Conflict in the Indian Sundarban: An Analysis of

Spatio-Temporal Incidences in Relation to People's Livelihood. Oryx, 52(4), 661-668.

Das, I. (2004). Collecting in the “Land below the Wind”, Herpetological Explorations of Borneo.

Bonner Zoologische Beiträge, 52(3/4), 231-243.

Datan, I., Stephen, C., & Nicholas, D. (2012). Earthen Crocodile Effigies (Buaya Tanah) of the Iban

of Sarawak: A Preliminary Study. Sarawak Museum Journal (New Series), LXX(9), 145-160.

207

De Silva, A. (2013). The Crocodiles of Sri Lanka (Including Archeology, History, Folklore,

Traditional Medicine, Human-Crocodile Conflicts and a Bibliography of the Literature on

Crocodiles of Sri Lanka). Gampola: De Silva, Anslem.

Department of Statistics Malaysia. (2017). Statistic Yearbook of Sarawak 2016. Jabatan Perangkaan

Malaysia, Negeri Sarawak. Retrieved from https://newss.statistics.gov.my/newss-

portalx/ep/epDownloadContentSearch.seam?cid=131467.

Dolphin, K., Belshaw, R., Orme, C. D. L., & Quicke, D. L. J. (2000). Noise and Incongruence:

Interpreting Results of the Incongruence Length Difference Test. Molecular Phylogenetics

and Evolution, 17(3), 401-406.

Doyle, J. J., & Doyle, J. L. (1987). A Rapid DNA Isolation Procedure for Small Quantities of Fresh

Leaf Tissue. Phytochemical Bulletin, 19, 11-15.

Dunham, K. M., Ghiurghi, A., Cumbi, R., & Urbano, F. (2010). Human–wildlife Conflict in

Mozambique: A National Perspective, with Emphasis on Wildlife Attacks on Humans. Oryx,

44(2), 185-193.

Ellegren, H. (2004). Microsatellites: Simple Sequences with Complex Evolution. Nature Reviews

Genetics, 5, 435-445.

Elsey, R., Tracy, C. R., Lance, V., & Manolis, C. (2008). Collecting Blood from Crocodilians.

Crocodile Specialist Group Newsletter, 21(1), 21-22.

Emerling, C. A. (2017). Archelosaurian Color Vision, Parietal Eye Loss, and the Crocodylian

Nocturnal Bottleneck. Molecular Biology and Evolution, 34(3), 666-676.

Erickson, G. M., Gignac, P. M., Steppan, S. J., Lappin, A. K., Vliet, K. A., Brueggen, J. D., . . .

Webb, G. J. W. (2012). Insights into the Ecology and Evolutionary Success of Crocodilians

Revealed through Bite-force and Tooth-pressure Experimentation. PLOS ONE, 7(3), 1-12.

Evans, L. J., Jones, T. H., Pang, K., Saimin, S., & Goossens, B. (2016). Spatial Ecology of Estuarine

Crocodile (Crocodylus porosus) Nesting in a Fragmented Landscape. Sensors (Switzerland),

16(9), 1-10.

208

Evans, L. J., Davies, A. B., Goossens, B., & Asner, G. P. (2017). Riparian Vegetation Structure and

the Hunting Behavior of Adult Estuarine Crocodiles. PLOS ONE, 12(10), 1-12.

Excoffier, L. (2004). Patterns of DNA Sequence Diversity and Genetic Structure after a Range

Expansion: Lessons from the Infinite-island Model. Molecular Ecology, 13(4), 853-864.

Excoffier, L., & Lischer, H. E. L. (2010). Arlequin Suite Ver 3.5: A New Series of Programs to

Perform Population Genetics Analyses under Linux and Windows. Molecular Ecology

Resources, 10(3), 564-567.

Farris, J. S., Källersjö, M., Kluge, A. G., & Bult, C. (1994). Testing Significance of Incongruence.

Cladistics, 10(3), 315-319.

Fu, Y.-X. (1997). Statistical Tests of Neutrality of Mutations Against Population Growth,

Hitchhiking and Background Selection. Genetics, 147(2), 915-925.

Fukuda, Y., Whitehead, P., & Boggs, G. (2008). Broad-scale Environmental Influences on the

Abundance of Saltwater Crocodiles (Crocodylus porosus) in Australia. Wildlife Research,

35(2), 167-176.

Fukuda, Y., Webb, G., Manolis, C., Delaney, R., Letnic, M., Lindner, G., & Whitehead, P. (2011).

Recovery of Saltwater Crocodiles Following Unregulated Hunting in Tidal Rivers of the

Northern Territory, Australia. The Journal of Wildlife Management, 75(6), 1253-1266.

Fukuda, Y., & Cuff, N. (2013). Vegetation Communities as Nesting Habitat for the Saltwater

Crocodiles in the Northern Territory of Australia. Herpetological Conservation and Biology,

8(3), 641-651.

Fukuda, Y., Saalfeld, K., Webb, G., Manolis, C., & Risk, R. (2013a). Standardised Method of

Spotlight Surveys for Crocodiles in the Tidal Rivers of the Northern Territory, Australia.

Northern Territory Naturalist, 24(1), 14-32.

Fukuda, Y., Saalfeld, K., Lindner, G., & Nichols, T. (2013b). Estimation of Total Length from Head

Length of Saltwater Crocodiles (Crocodylus porosus) in the Northern Territory, Australia.

Journal of Herpetology, 47(1), 34-40.

209

Fukuda, Y., Manolis, C., & Appel, K. (2014). Management of Human-Crocodile Conflict in the

Northern Territory, Australia: Review of Crocodile Attacks and Removal of Problem

Crocodiles. The Journal of Wildlife Management, 78(7), 1239-1249.

Fukuda, Y., & Saalfeld, K. (2014). Abundance of Saltwater Crocodile Hatchlings is Related to

Rainfall in the Preceding Wet Season in Northern Australia. Herpetologica, 70(4), 439-448.

Fukuda, Y., Manolis, C., Saalfeld, K., & Zuur, A. (2015). Dead or Alive? Factors Affecting the

Survival of Victims during Attacks by Saltwater Crocodiles (Crocodylus porosus) in

Australia. PLOS ONE, 10(5), 1-12.

Gehring, P.-S., Pabijan, M., Randrianirina, J. E., Glaw, F., & Vences, M. (2012). The Influence of

Riverine Barriers on Phylogeographic Patterns of Malagasy Reed Frogs (Heterixalus).

Molecular Phylogenetics and Evolution, 64(3), 618-632.

Grant, P. B., & Lewis, T. R. (2010). High Speed Boat Traffic: A risk to Crocodilian Populations.

Herpetological Conservation and Biology, 5(3), 456-460.

Gratten, J. (2003). The Molecular Systematics, Phylogeography and Population Genetics of Indo-

Pacific Crocodylus. (Unpublished Doctoral dissertation). University of Queensland,

Australia.

Grigg, G. C., & Gans, C. (1993). Morphology and Physiology of the Crocodylia. In C. G. Glasby, J.

Ross & P. L. Beesley (Eds.), Fauna of Australia Vol 2A: Amphibia and Reptilia (pp. 326-

336). Canberra: Australian Government Publishing Service.

Grigg, G. C., & Seebacher, F. (2000). Crocodilian Thermal Relations. In G. C. Grigg, F. Seebacher

& C. E. Franklin (Eds.), Crocodilian Biology and Evolution (pp. 297-309). Sydney: Surrey

Beatty and Sons Pty Ltd.

Gunn, J., Hawkins, D., Barnes, R. F. W., Mofulu, F., Grant, R. A., & Norton, G. W. (2014). The

Influence of Lunar Cycles on Crop-raiding Elephants; Evidence for Risk Avoidance. African

Journal of Ecology, 52(2), 129-137.

210

Hanson, J. O., Salisbury, S. W., Campbell, H. A., Dwyer, R. G., Jardine, T. D., & Franklin, C. E.

(2015). Feeding Across the Food Web: The Interaction between Diet, Movement and Body

Size in Estuarine Crocodiles (Crocodylus porosus). Austral Ecology, 40(3), 275-286.

Hassan, R., & Abdul-Gani, M. I. Z. (2013). Crocodiles in Western of Sarawak, Malaysia. Pp 90-94.

In World Crocodile Conference. Proceedings of the 22nd Working Meeting of the IUCN-SSC

Crocodile Specialist Group. Gland, Switzerland: IUCN.

Hassan, R., Ahmad, R., Md Adzhar, M. A. A., Abdul-Gani, M. I. Z., Ayob, A., & Zainudin, R.

(2016). Notes on the Wild Tomistoma Populations in Western Sarawak, Malaysian Borneo.

International Journal of Ecology, 2016, 1-7.

Hassan, R., Md Adzhar, M. A. A., Abdul-Gani, M. I. Z., & Ahmad, R. (2018). Assessment of Wild

Saltwater Crocodile Population in Bako River, Western Sarawak, Malaysian Borneo for

Potential Ecotourism Industry. Malaysian Applied Biology, 47(1), 131-138.

Hekkala, E. R., Platt, S. G., Thorbjarnarson, J. B., Rainwater, T. R., Tessler, M., Cunningham, S. W.,

. . . Amato, G. (2015). Integrating Molecular, Phenotypic and Environmental Data to

Elucidate Patterns of Crocodile Hybridization in Belize. Royal Society Open Science, 2(9),

1-15.

Hornaday, W. T. (1885). Two Years in the Jungle. The Experiences of A Hunter and Naturalist in

India, Ceylon, the Malay Peninsula and Borneo. New York: Charles Scribner’s Sons.

Hudson, R. R., Slatkin, M. & Maddison, W. P. (1992). Estimation of Levels of Gene Flow from

DNA Sequence Data. Genetics, 132, 583-589.

Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian Inference of Phylogenetic Trees.

Bioinformatics, 17(8), 754-755.

Isberg, S. R., Chen, Y., Barker, S. G., & Moran, C. (2004). Analysis of Microsatellites and Parentage

Testing in Saltwater Crocodiles. Journal of Heredity, 95(5), 445-449.

Isberg, S. R., Thomson, P. C., Nicholas, F. W., Webb, G. J., Manolis, S. C., Barker, S. G., & Moran,

C. (2006). Quantitative Analysis of Production Traits in Saltwater Crocodiles (Crocodylus

211

porosus): IV. Number of Scale Rows. Journal of Animal Breeding and Genetics, 123(1), 48-

55.

Iwata, T., Nakano, S., & Inoue, M. (2003). Impacts of past Riparian Deforestation on Stream

Communities in a Tropical Rain Forest in Borneo. Ecological Applications, 13(2), 461-473.

Jalden, D. (2004). Crocodilians and the Convention on International Trade in Endangered Species of

Wild Fauna and Flora (CITES). Pp 66-68. In Crocodiles. Proceedings of the 17th Working

Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.

Jet, O., Palaniappan, P. M., & Hussein, M. A. S. (2011). Population Ecology and Potential Food

Sources of The Saltwater Crocodiles in Kawang River, Sabah. Borneo Science, 28, 57-65.

Kanwatanakid-Savini, C., Pliosungnoen, M., Pattanavibool, A., Thorbjarnarson, J. B.,

Limlikhitaksorn, C., & Platt, S. G. (2012). A Survey to Determine The Conservation Status

of Siamese Crocodiles in Kaeng Krachan National Park, Thailand. Herpetological

Conservation and Biology, 7(2), 157–168.

Karlin, S., & Altschul, S. F. (1990). Methods for Assessing the Statistical Significance of Molecular

Sequence Features by using General Scoring Schemes. Proceedings of the National

Academy of Sciences, 87(6), 2264-2268.

Kasim, N. Y. (2011). Genetic Diversity of Saltwater Crocodiles (Crocodylus porosus) from Sarawak

Using Microsatellite Approach. (Unpublished Final Year Project Report). Universiti

Malaysia Sarawak, Sarawak, Malaysia.

Kaur, T. (2006). Segama River Survey. Crocodile Specialist Group Newsletter, 25(1), 14-15.

Keats, B. J. B., & Sherman, S. L. (2013). Chapter 13 - Population Genetics. In D. Rimoin, R. Pyeritz

& B. Korf (Eds.), Emery and Rimoin's Principles and Practice of Medical Genetics (pp. 1-

12). Oxford: Academic Press.

Kemmerer, E. W. (1904). A Gold Standard for Straits Settlements. Political Science Quarterly,

33(4), 636-649.

212

Kimura, M. (1980). A Simple Method for Estimating Evolutionary Rate of Base Substitutions

through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution, 16,

111-120.

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis

Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7), 1870-1874.

Lading, E. (2013). Crocodile Attacks in Sarawak. Pp 96. In World Crocodile Conference.

Proceedings of the 22nd Working Meeting of the IUCN-SSC Crocodile Specialist Group.

Gland, Switzerland: IUCN.

Lamichhane, B. R., Persoon, G. A., Leirs, H., Poudel, S., Subedi, N., Pokheral, C. P., . . . de Iongh,

H. H. (2018). Spatio-temporal Patterns of Attacks on Human and Economic Losses from

Wildlife in Chitwan National Park, Nepal. PLOS ONE, 13(4), 1-18.

Langley, R. L. (2010). Adverse Encounters With Alligators in the United States: An Update.

Wilderness & Environmental Medicine, 21(2), 156-163.

Lapbenjakul, S., Thapana, W., Twilprawat, P., Muangmai, N., Kanchanaketu, T., Temsiripong, Y., .

. . Srikulnath, K. (2017). High Genetic Diversity and Demographic History of Captive

Siamese and Saltwater Crocodiles Suggest the First Step toward the Establishment of a

Breeding and Reintroduction Program in Thailand. PLOS ONE, 12(9), 1-21.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., . . .

Higgins, D. G. (2007). Clustal W and Clustal X Version 2.0. Bioinformatics, 23(21), 2947-

2948.

Letnic, M., Carmody, P., & Burke, J. (2011). Problem Crocodiles (Crocodylus porosus) in the

Freshwater, Katherine River, Northern Territory, Australia. Australian Zoologist, 35(3),

858-863.

Lewis, J. L., FitzSimmons, N. N., Jamerlan, M. L., Buchan, J. C., & Grigg, G. C. (2013). Mating

Systems and Multiple Paternity in the Estuarine Crocodile (Crocodylus porosus). Journal of

Herpetology, 47(1), 24-33.

213

Li, Y., Wu, X., Ji, X., Yan, P., & Amato, G. (2007). The Complete Mitochondrial Genome of Salt-

water Crocodile (Crocodylus porosus) and Phylogeny of Crocodilians. Journal of Genetics

and Genomics, 34(2), 119-128.

Ling, T.-Y., Soo, C.-L., Sivalingam, J.-R., Nyanti, L., Sim, S.-F., & Grinang, J. (2016). Assessment

of the Water and Sediment Quality of Tropical Forest Streams in Upper Reaches of the Baleh

River, Sarawak, Malaysia, Subjected to Logging Activities. Journal of Chemistry, 2016, 1-

13.

Ling, T.-Y., Soo, C.-L., Phan, T.-P., Nyanti, L., Sim, S.-F., & Grinang, J. (2017). Assessment of

Water Quality of Batang Rajang at Pelagus Area, Sarawak, Malaysia. Sains Malaysiana,

46(3), 401-411.

Low, H. (1848). Sarawak: its Inhabitants and Productions: being Notes during A Residence in that

Country with HH the Rajah Brooke. London: Richard Bentley.

Luck, N. L., Thomas, K. C., Morin-Adeline, V. E., Barwick, S., Chong, A. Y., Carpenter, E. L., . . .

Gongora, J. (2012). Mitochondrial DNA Analyses of the Saltwater Crocodile (Crocodylus

porosus) from the Northern Territory of Australia. Australian Journal of Zoology, 60(1), 18-

25.

Lynch, M. & Crease, T. J. (1990). The Analysis of Population Survey Data on DNA Sequence

Variation. Molecular Biology and Evolution, 7, 377-394.

Mahyan, N. R., & Selaman, O. S. (2016). Water Supply Resources and Management Practices in

Sarawak and Other Countries. Journal of Civil Engineering, Science and Technology, 7(2),

50-56.

Maltagliati, F., Di Giuseppe, G., Barbieri, M., Castelli, A., & Dini, F. (2010). Phylogeography and

Genetic Structure of the Edible Sea Urchin Paracentrotus lividus (Echinodermata:

Echinoidea) Inferred from the Mitochondrial Cytochrome b Gene. Biological Journal of the

Linnean Society, 100(4), 910-923.

214

Martin, S. (2008). Global Diversity of Crocodiles (Crocodilia, Reptilia) in Freshwater.

Hydrobiologia, 595(1), 587-591.

Mauger, L. A., Velez, E., Cherkiss, M. S., Brien, M. L., Mazzotti, F. J., & Spotila, J. R. (2017).

Conservation Genetics of American Crocodile, Crocodylus acutus, Populations in Pacific

Costa Rica. Nature Conservation, 17, 1-17.

Mazzotti, F. J., Brandt, L. A., Moler, P., & Cherkiss, M. S. (2007). American Crocodile (Crocodylus

Acutus) in Florida: Recommendations for Endangered Species Recovery and Ecosystem

Restoration. Journal of Herpetology, 41(1), 122-132.

Messel, H., & Vorlicek, G. C. (1986). Population Dynamics and Status of Crocodylus porosus in the

Tidal Waterways of Northern Australia. Australia Wildlife Research, 13(1), 71-111.

Miles, L. G., Isberg, S. R., Moran, C., Hagen, C., & Glenn, T. C. (2009a). 253 Novel Polymorphic

Microsatellites for the Saltwater Crocodile (Crocodylus porosus). Conservation Genetics,

10(4), 963-980.

Miles, L. G., Lance, S. L., Isberg, S. R., Moran, C., & Glenn, T. C. (2009b). Cross-species

Amplification of Microsatellites in Crocodilians: Assessment and Applications for the

Future. Conservation Genetics, 10(4), 935-954.

Mohd-Azlan, J., Zulaiha, J., Lading, E., Nuriza, A. A., & Das, I. (2016). Employing Camera Traps

for Studying Habitat Use by Crocodiles in a Mangrove Forest in Sarawak, Borneo.

Herpetological Review, 47(4), 579-583.

Montague, J. (1983). Influence of Water Level, Hunting Pressure and Habitat Type on Crocodile

Abundance in the Fly River Drainage, Papua New Guinea. Biological Conservation, 26(4),

309-339.

Moritz, C. (1999). Conservation Units and Translocations: Strategies for Conserving Evolutionary

Processes. Hereditas, 130(3), 217-228.

Munson, L. (2000). Necropsy Procedures for Wild Animals. In W. B. Karesh, M. F. McEntee, L. J.

Lowenstine, M. E. Roelke-Parker, E. Williams & M. H. Woodford (Eds.), Conservation

215

Research in the African Rainforests: A Technical Handbook (pp. 203-224). New York:

Wildlife Conservation Society.

Nagelkerken, I., Blaber, S. J. M., Bouillon, S., Green, P., Haywood, M., Kirton, L. G., . . . Somerfield,

P. J. (2008). The Habitat Function of Mangroves for Terrestrial and Marine Fauna: A

Review. Aquatic Botany, 89(2), 155-185.

Nagloo, N., Collin, S. P., Hemmi, J. M., & Hart, N. S. (2016). Spatial Resolving Power and Spectral

Sensitivity of the Saltwater Crocodile, Crocodylus porosus, and the Freshwater Crocodile,

Crocodylus johnstoni. The Journal of Experimental Biology, 219(9), 1394-1404.

National Research Council of United State of America. (1983). Crocodiles as a Resource for the

Tropics. The National Academies Press. Retrieved from

https://www.nap.edu/catalog/18531/crocodiles-as-a-resource-for-the-tropics.

Nazli, M. F., Hashim, N. R., & Zakaria, M. (2009). Distribution, Abundance and Habitat

Conservation of Crocodylus porosus in Rembau-Linggi Estuary, Peninsular Malaysia. Pp

130-135. In Postgraduate Qolloquium First Semester 2009/2010. Selangor, Malaysia:

Universiti Putra Malaysia.

O'Shea, M., & Halliday, T. (2002). Reptiles and Amphibians. New York: Dorling Kindersley.

Official Website of Department of Irrigation and Drainage Sarawak. (2017). Sarawak Major River

Basin. Retrieved 18 May 2016, from http://www.did.sarawak.gov.my/page-0-314-315-

Resource-Centre-IRBM-22-Basins.html.

Packer, C., Swanson, A., Ikanda, D., & Kushnir, H. (2011). Fear of Darkness, the Full Moon and the

Nocturnal Ecology of African Lions. PLOS ONE, 6(7), 1-4.

Parenti, L. R., & Lim, K. K. (2005). Fishes of the Rajang Basin, Sarawak, Malaysia. Raffles Bulletin

of Zoology, 13, 175-208.

Platt, S. G., & Thorbjarnarson, J. B. (2000). Population Status and Conservation of Morelet's

Crocodile, Crocodylus moreletii, in Northern Belize. Biological Conservation, 96(1), 21-29.

216

Pooley, S. (2014). An Historical Overview of Human Crocodile Conflict in South Africa and

Swaziland, 1949-2014. Pp 236-245. In Crocodiles. Proceedings of the 23rd Working Meeting

of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland and Cambridge, UK:

IUCN.

Pooley, S. (2015). Using Predator Attack Data to Save Lives, Human and Crocodilian. Oryx, 49(4),

581-583.

Ray, N., Currat, M., & Excoffier, L. (2003). Intra-Deme Molecular Diversity in Spatially Expanding

Populations. Molecular Biology and Evolution, 20(1), 76-86.

Read, M. A., Miller, J. D., Bell, I. P., & Felton, A. (2004). The Distribution and Abundance of the

Estuarine Crocodile, Crocodylus porosus, in Queensland. Wildlife Research, 31, 527-534.

Read, M. A., Grigg, G. C., Irwin, S. R., Shanahan, D., & Franklin, C. E. (2007). Satellite Tracking

Reveals Long Distance Coastal Travel and Homing by Translocated Estuarine Crocodiles,

Crocodylus porosus. PLOS ONE, 2(9), 1-5.

Ritchie, J., & Jong, J. (2002). Man-eating Crocodiles of Borneo. Kota Kinabalu, Sabah: Natural

History Publications (Borneo).

Robi, N. J. (2014). Estuarine Crocodile Distribution in Sibu Region, Sarawak. Paper presented at the

Borneo Crocodile Forum Sibu, Sarawak, Malaysia.

Rodgers, E. M., Schwartz, J. J., & Franklin, C. E. (2015). Diving in a Warming World: The Thermal

Sensitivity and Plasticity of Diving Performance in Juvenile Estuarine Crocodiles

(Crocodylus porosus). Conservation Physiology, 3(1), 1-9.

Rogers, A. R., & Harpending, H. (1992). Population Growth Makes Waves in the Distribution of

Pairwise Genetic Differences. Molecular Biology and Evolution, 9(3), 552-569.

Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J. C., Guirao-Rico, S., Librado, P., Ramos-Onsins,

S. E., & Sánchez-Gracia, A. (2017). DnaSP 6: DNA Sequence Polymorphism Analysis of

Large Data Sets. Molecular Biology and Evolution, 34(12), 3299-3302.

217

Russello, M. A., Brazaitis, P., Gratten, J., Watkins-Colwell, G. J., & Caccone, A. (2007). Molecular

Assessment of the Genetic Integrity, Distinctiveness and Phylogeographic Context of the

Saltwater Crocodile (Crocodylus porosus) on Palau. Conservation Genetics, 8(4), 777-787.

Ryan, C. (1998). Saltwater Crocodiles as Tourist Attractions. Journal of Sustainable Tourism, 6(4),

314-327.

Sa’adi, Z., Shahid, S., Ismail, T., Chung, E.-S., & Wang, X.-J. (2017). Distributional Changes in

Rainfall and River Flow in Sarawak, Malaysia. Asia-Pacific Journal of Atmospheric

Sciences, 53(4), 489-500.

Sah, S. A. M., & Stuebing, R. B. (1996). Diet, Growth and Movements of Juvenile Crocodiles

Crocodylus porosus Schneider in the Klias River, Sabah, Malaysia. Journal of Tropical

Ecology, 12(5), 651-662.

Sambrook, J., Fritsch, E., & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold

Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Sarawak Forestry Corporation. (2018). Management Plan for Estuarine Crocodile (Crocodylus

porosus) in Sarawak 2016-2020. Kuching: Sarawak Forestry Corporation.

Sarawak Gazette. (June 1, 1933). Government Printing Service, Kuching, Sarawak.

Sarawak Gazette. (July 1, 1929). Government Printing Service, Kuching, Sarawak.

Sarawak Gazette. (November 1, 1927). Government Printing Service, Kuching, Sarawak.

Sarawak Gazette. (May 2, 1908). Government Printing Service, Kuching, Sarawak.

Schneider, J. G. (1801). Historiae Amphibiorum naturalis et literariae. Fasciculus secundus

continens Crocodilos, Scincos, Chamaesauras, Boas. Pseudoboas, Elapes, Angues.

Amphisbaenas et Caecilias. Jena: Sumtibus F. Frommanni.

Seymour, R. S., Bennett‐Stamper, C. L., Johnston, S. D., Carrier, D. R., & Grigg, G. C. (2004).

Evidence for Endothermic Ancestors of Crocodiles at the Stem of Archosaur Evolution.

Physiological and Biochemical Zoology, 77(6), 1051-1067.

218

Shafiei-Astani, B., Ong, A. H. K., Valdiani, A., Tan, S. G., Yien, C. Y. S., Ahmady, F., . . . Kuar, T.

(2015). Molecular Genetic Variation and Structure of Southeast Asian Crocodile

(Tomistoma schlegelii): Comparative Potentials of SSRs versus ISSRs. Gene, 571(1), 107-

116.

Shaney, K. J., Hamidy, A., Walsh, M., Arida, E., Arimbi, A., & Smith, E. N. (2017). Impacts of

Anthropogenic Pressures on the Contemporary Biogeography of Threatened Crocodilians in

Indonesia. Oryx, 2017, 1-12.

Shoon, A. (2009). Sequencing of Cytochrome b and 12S mtDNA Genes of Saltwater Crocodiles,

Crocodylus porosus from Sarawak. (Unpublished Final Year Project Report). Universiti

Malaysia Sarawak, Sarawak, Malaysia.

Sideleau, B. M., & Britton, A. (2013). An Analysis of Crocodilian Attacks Worldwide for the Period

of 2008 - July 2013. Pp 110-113. In World Crocodile Conference. Proceedings of the 22nd

Working Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.

Sideleau, B. M., Edyvane, K. S., & Britton, A. R. C. (2016). An Analysis of Recent Saltwater

Crocodile (Crocodylus porosus) Attacks in Timor-Leste and Consequences for Management

and Conservation. Marine and Freshwater Research, 68(5), 801-809.

Slatkin, M., & Hudson, R. R. (1991). Pairwise Comparisons of Mitochondrial DNA Sequences in

Stable and Exponentially Growing Populations. Genetics, 129(2), 555-562.

Stevenson, C., De Silva, A., Vyas, R., Nair, T., Mobaraki, A., & Aleem Chaudhry, A. (2014).

Human-Crocodile Conflict in South Asia and Iran. Pp 209-226. In Crocodiles. Proceedings

of the 23rd Working Meeting of the IUCN-SSC Crocodile Specialist Group. Gland,

Switzerland and Cambridge, UK: IUCN.

Stuebing, R., Ismail, G., & Kusuadi, S. (1985). The Ecology of Crocodile Attacks in Batang Lupar,

Sarawak. Sarawak Museum Journal, 34, 195-215.

Stuebing, R., Ismail, G., & Ching, L. H. (1994). The Distribution and Abundance of the Indo-Pacific

Crocodile Crocodylus porosus Schneider in the Klias River, Sabah, East Malaysia.

Biological Conservation, 69, 1-7.

219

Sulaiman, M. K. (2011). Genetic Diversity of Sarawak Saltwater Crocodile (Crocodylus porosus)

using PCR-RAPD. (Unpublished Final Year Project Report). Universiti Malaysia Sarawak,

Sarawak, Malaysia.

Sulaiman, N. A. S. (2018). Fisherman's Knowledge of the Moon Phenomenon in Fishing Activities.

International Journal of Academic Research in Business and Social Sciences, 8(11), 941-

949.

Swofford, L. D. (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods).

Version 4.0b10. Sunderland, Massachusetts: Sinauer Associates.

Taigor, S. R., & Rao, R. J. (2014). Assessments of Potential Suitable Habitats Stretch of Fresh Water

Crocodile, Gharial Gavialis gangeticus (Gmelin 1789) in the Chambal River, Madhya

Pradesh, India. International Journal of Environmental Sciences, 4(4), 544-550.

Tajima, F. (1989). Statistical Method for Testing the Neutral Mutation Hypothesis by DNA

polymorphism. Genetics, 123(3), 585-595.

Thorbjarnarson, J. (1999). Crocodile Tears and Skins: International Trade, Economic Constraints,

and Limits to the Sustainable Use of Crocodilians. Conservation Biology, 13(3), 465-470.

Tisen, O., & Ahmad, R. (2010). Crocodylus porosus in Sarawak: Status and Management. Paper

presented at the IUCN-SSC crocodile specialist group (CSG) Workshop on Human-

crocodile conflict, Sabah, Malaysia.

Tisen, O., Gombek, F., Ahmad, R., & Ubang, C. K. (2013). Human-Crocodile Issues: Sarawak

Report. Pp 115. In World Crocodile Conference. Proceedings of the 22nd Working Meeting

of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.

UK Office for National Statistics. (2019). How to Calculate Inflation Rate for £1, 1900 to 2017.

Retrieved 16 April, 2019, from https://www.officialdata.org/1900-GBP-in-2017?amount=1.

Wallace, A. R. (1869). The Malay Archipelago: The Land of the Orang-utan and the Bird of Paradise

: A Narrative of Travel, with Studies of Man and Nature. London: Macmillan and Co.

220

Webb, G. J. W., Messel, H., & Magnusson, W. (1977). The Nesting of Crocodylus porosus in

Arnhem Land, Northern Australia. Copeia, 1977(2), 237 - 249.

Webb, G. J. W., & Messel, H. (1979). Wariness in Crocodylus porosus (Reptilia : Crocodilidae).

Wildlife Research, 6(2), 227-234.

Webb, G. J. W., Manolis, S., Buckworth, R., & Sack, G. (1983). An Examination of Crocodylus

porosus Nests in Two Northern Australian Freshwater Swamps, with an Analysis of Embryo

Mortality. Wildlife Research, 10(3), 571-605.

Webb, G. J. W., Hollis, G. J., & Manolis, S. C. (1991). Feeding, Growth and Food Conversion Rates

of Wild Juvenile Saltwater Crocodiles (Crocodylus porosus). Journal of Herpetology, 25(4),

462-473.

Webb, G. J. W. (2008). Wicked Problems with Wicked Crocodiles. Pp 241-249. In Crocodile.

Proceedings of the 19th Working Meeting of the IUCN-SSC Crocodile Specialist Group.

Gland, Switzerland: IUCN.

Webb, G. J. W., Manolis, C., & Brien, M. L. (2010). Saltwater Crocodile, Crocodylus porosus. In C.

Manolis & C. Stevenson (Eds.), Crocodile. Status Survey and Conservation Action Plan.

Third Edition (pp. 99-113). Darwin: Crocodile Specialist Group.

Whitaker, R. (1984). Preliminary survey of crocodiles in Sabah, East Malaysia. Kuala Lumpur:

World Wildlife Fund (WWF) Malaysia.

Woodward, A. R., Franklin Percival, H., Heath Rauschenberger, R., Gross, T. S., Rice, K. G., &

Conrow, R. (2011). Abnormal Alligators and Organochlorine Pesticides in Lake Apopka,

Florida. In J. Elliott, C. Bishop & C. Morrissey (Eds.), Wildlife Ecotoxicology. Emerging

Topics in Ecotoxicology (Principles, Approaches and Perspectives) (Vol. 3, pp. 153-187).

New York, NY: Springer.

Woodward, A. R., Leone, E. H., Dutton, H. J., Hord, L., & Waller, J. E. (2014). Human Alligator

Conflict in Florida, USA. Pp 182-199. In Crocodiles. Proceedings of the 23rd Working

Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland and Cambridge,

UK: IUCN.

221

Zaini, M. K., Ripot, S., Ubang, C. K., Francis, R., & Simon, A. M. (2014). Crocodile Survey at

Kuching, Samarahan and Sri Aman division, Sarawak, Malaysia. Paper presented at the

Borneo Crocodile Forum, Sibu, Sarawak, Malaysia.

Zainudin, R., Nor, S. M., Ahmad, N., Md-Zain, B. M., & Rahman, M. A. (2010). Genetic Structure

of Hylarana erythraea (Amphibia: Anura: Ranidae) from Malaysia. Zoological Studies,

49(5), 688-702.

222

APPENDICES

Appendix A1 (habitat assessment data sheet)

223

Appendix A2

Table appendix A2: Summary of river characteristics observed and recorded during field sampling in eight studied rivers in Rajang River Basin.

River Type of river Distance from Tidal Riverbank characteristic Type of river Water type Sea Influence Riverbank Forest type Canopy cover 1) Igan Large tributary Saltwater Lower region Tidal At estuary, sandy At the mouth of the river, Open canopy in estuary area, and of Rajang riverbank for about riverbank dominated by in most area of located in brackish River Basin. few hundred meters pine trees (Casuarina river mouth lower Rajang and then followed by equisetifolia), then muddy riverbank riverbank dominated by mangroves and Nypa trees

2) Belawai Large tributary Saltwater Lower region Tidal At estuary, sandy At the mouth of the river, Open canopy in estuary area, and of Rajang riverbank for about 1 riverbank dominated by in most area of located in brackish River Basin. kilometer and then pine trees (Casuarina river mouth lower Rajang followed by muddy equisetifolia). After a few delta riverbank kilometers riverbank majorly dominated by mangroves vegetation

3) Sarikei Tributary of Brackish Lower region Tidal Muddy riverbank Nypa trees dominated Open canopy Batang Rajang of Rajang vegetations in the in most area of in lower region River Basin. riverbanks river mouth

4) Nyelong Tributary of Brackish Lower region Tidal Muddy riverbank Nypa trees dominated Open canopy Batang Rajang of Rajang vegetations in the in most area of in lower region River Basin. riverbanks river mouth

224

Table Appendix A2 continue…

5) Kanowit Tributary of Brackish Middle region Tidal Sandy and muddy Mixed Dipterocarp Forest Open canopy Batang Rajang few of Rajang riverbank at (MDF). In some areas of in most area of in the middle kilometres River Basin. downstream. In the the river, riverbank river mouth region from mouth Approx. 125 upstream area, vegetations are dominated of the river, km from riverbank substrates by grass and ferns freshwater mouth of are sandy, gravels and further Rajang pebbles. upstream 6) Poi Tributary of Brackish Middle region Not Sandy and muddy Mixed Dipterocarp Forest Partly shaded Batang Rajang few of Rajang influence riverbank at (MDF). In some areas of especially in the middle kilometres River Basin. by tidal downstream. In the the river, riverbank towards region from mouth Approx. 135 upstream area, vegetations are dominated upstream of the river, km from riverbank substrates by grass and ferns freshwater mouth of are sandy, gravels and further Rajang pebbles. upstream 7) Ngemah Tributary of Brackish Middle region Not Sandy and muddy Mixed Dipterocarp Forest Partly shaded Batang Rajang few of Rajang influence riverbank at (MDF). In some areas of especially in the upper kilometres River Basin. by tidal downstream. In the the river, riverbank towards region from mouth Approx. 155 upstream area, vegetations are dominated upstream of the river, km from riverbank substrates by grass and ferns freshwater mouth of are sandy, gravels and further Rajang pebbles. upstream 8) Katibas Tributary of Brackish Middle region Not Sandy and muddy Mixed Dipterocarp Forest Partly shaded Batang Rajang few of Rajang influence riverbank at (MDF). In some areas of especially in the upper kilometres River Basin. by tidal downstream. In the the river, riverbank towards region from mouth Approx. 180 upstream area, vegetations are dominated upstream of the river, km from riverbank substrates by grass and ferns freshwater mouth of are sandy, gravels and further Rajang pebbles. upstream

225

Appendix A3

Table appendix A3: Riverbank development and land use recorded during field sampling in eight studied rivers in Rajang River Basin.

River Riverbank development and land use Residential /schools near Agriculture and fishing Transportation and Industrial riverbank activity 1) Igan Igan village located at the Fishing activities are relatively high in the One or two ferries operate in daytime, mouth of the river. river. Various types of fishing vessels were transporting peoples and vehicles crossing both found along the river, ranging from small sides of the river. River traffics in the river are boats to big fishing vessels. Fishermen use relatively low, as the villagers rarely use the several methods of fishing including gill river to travel to another place. Most of boating nets and cast nets, which could be seen set activities in the river are involving fishing up by the fishermen along the river. vessels. 2) Belawai Belawai Village located near Fishing activities are relatively high in the River traffics in the river are relatively low, as to the mouth of the river. river. Various types of fishing vessels were the villagers rarely use the river to travel to Another village can be found found along the river, ranging from small another place. Most of boating activities in the approx. 15 km from the river boats to big fishing vessels. Fishermen use river are involving fishing vessels. mouth. several methods of fishing including gill nets and cast nets, which could be seen set up by the fishermen along the river. 3) Sarikei Sarikei Town located near to Several small-scale farms planted with Buildings including shops and offices, the mouth of the river. Several fruits and vegetables could be seen near to manmade waterfront and express boat’s jetty villages can be found further residential areas. Fishing activities are were built near to the mouth of the river. Two upstream. relatively high especially in areas near to bridges can be found in the survey distance, one Sarikei town, of the bridges situated about less than 1 km from the river mouth. River traffics are relatively high especially in areas near to the town. 4) Nyelong Sarikei Town located near to Palm oil estates located approx. more than Buildings including shops and offices, the mouth of the river. Further 10 km in upstream. Fishing activities are manmade waterfront and express boat’s jetty upstream, no other residentials relatively high especially in areas near to were built near to the mouth of the river. A were found near to riverbank Sarikei Town bridge across the river approx. 2 km from the area during the survey period. river mouth. River traffics are relatively high especially in area near to the town.

226

Table Appendix A3 continue…

5) Kanowit Kanowit town is located at the Several agriculture plots planted with Shops, manmade waterfront and express boat’s mouth of the river. Approx. 13 paddy and pepper could be seen near to jetty were built near to the mouth of the river. A to 15 villages/longhouses can residential areas. Fishing activities are logging camp can be found approx. 7 km from be found throughout the river. relatively are relatively high especially in river mouth and use the river to transport logs. Two schools located near to areas near to Kanowit Town. During the time of the survey, construction of a riverbank. concrete bridge is on-going, located approx. 2 km from river mouth. Heavy machineries were used in the construction. River traffics are relatively high especially in areas near to the town. 6) Poi Only 1 or 2 houses can be Several agriculture plots planted with Abandoned logging camp can be found approx. found less than 5 km from paddy and pepper could be seen near to less than 2 km from the river mouth. River river mouth. While further residential areas. Fishing activities are traffics are relatively low. Villages/longhouses upstream, not more than 6 relatively medium to low throughout the were connected to each other and to Kanowit villages/longhouses can be river. Town via roads, thus most of the local people found. One school located travel using land transportations. near to riverbank. 7) Ngemah Ngemah villages located near Several agriculture plots planted with A bridge across the river can be found approx. to river mouth. Not less than 5 paddy and pepper could be seen near to 6 km from river mouth. River traffics are villages/longhouses can be residential areas. Fishing activities are relatively low. Majority of local people use land found throughout the survey relatively medium to low throughout the transportations to travel to other distance in the river. A school river. villages/longhouses or to Kanowit Town as the located near to riverbank. areas are connected via roads. 8) Katibas Song town is located at the Several agriculture plots planted with Buildings including shops and offices, mouth of the river. Approx. 8 paddy and pepper could be seen near to manmade waterfront and express boat’s jetty villages / longhouses and a residential areas. Fishing activities are were built near to the mouth of the river. River school can be found relatively medium to low throughout the traffics are relatively high especially in areas throughout the survey distance river. near to the town. in the river.

227

Appendix A4

Table appendix A4: Water quality measurement for each station in eight studied rivers in Rajang River Basin. River Station GPS Coordinates Depth (m) Width (m) Salinity (ppt) pH Temperature (oC) 1) Igan 1 2°49'58.83"N, 111°40'47.36"E 15.80 1500 22.00 6.71 26.50 2 2°49'0.95''N, 111°41'20.95''E 14.50 1670 21.00 6.72 26.50 3 2°48'46.76''N, 111°42'58.67''E 14.10 1155 19.00 6.77 26.80 4 2°48'10.46''N, 111°43'45.77''E 13.30 950 17.00 5.96 27.30 5 2°48'05.39"N, 111°44'43.05"E 13.70 915 16.00 5.94 27.00 Mean 14.28 1238 19.00 6.42 26.82 Standard deviation 0.96 335.20 ± 2.54 ± 0.43 ± 0.34 2) Belawai 1 2°11'39.87"N, 111°15'55.24"E 16.20 730 25.33 7.68 29.60 2 2°11'55.83''N, 111°16'38.94''E 14.30 580 17.33 7.56 29.90 3 2°13'20.51''N, 111°17'11.60''E 15.10 1040 14.33 7.47 29.70 4 2°14'51.72''N, 111°16' 41.49''E 14.90 1400 13.33 7.39 29.60 5 2° 16'5.88"N, 111°17'03.34"E 15.50 560 11.00 7.53 29.70 Mean 15.20 862 16.26 7.53 29.70 Standard deviation 0.71 356.82 ± 5.55 ± 0.11 ± 0.12 3) Sarikei 1 2°8'0.16"N, 111°30'50.51"E 7.90 210 14.00 5.86 30.20 2 2°6'38.36''N, 111°30'56.75''E 12.50 90 8.67 5.76 29.90 3 2°5'47.85''N, 111°30'41.64''E 7.30 80 6.33 5.65 29.70 4 2°4'33.40'' N, 111°30'54.16''E 7.20 50 1.33 5.61 29.30 5 2°2'55.13"N, 111°29'37.70"E 6.70 40 0 5.27 29.50 Mean 8.32 94 6.06 5.63 29.72 Standard deviation ± 2.38 68.04 ± 5.67 ± 0.22 ± 0.35 4) Nyelong 1 2°8'4.97"N, 111°31'30.73"E 8.70 240 5.30 5.51 29.50 2 2°6'38.67''N, 111°32'19.77''E 10.70 130 1.33 5.28 28.70 3 2°5'59.36'' N, 111°33'15.44''E 8.60 95 1.33 5.18 29.30 4 2°5'23.08'' N, 111°34' 17.54''E 8.20 85 1.33 5.15 29.40 5 2° 4'5.69"N, 111°35'11.32"E 5.60 60 0.67 5.13 29.40 Mean 8.36 122 1.99 5.25 29.26 Standard deviation ± 1.82 70.59 ± 1.87 ± 0.16 ± 0.32

228

Table appendix A4 continue…

5) Kanowit 1 2°5'53.16"N, 112°9'28.99"E 12.50 265 2.00 6.87 27.40 2 2°5'13.18''N, 112°9'1.17''E 12.70 100 1.00 6.79 27.50 3 2°3'33.06''N, 112°9'9.46''E 8.10 85 0.37 6.54 27.40 4 2°2'34.18''N, 112°8'21.50''E 10.50 80 0.67 6.72 27.30 5 2°1'7.70"N, 112°4'28.40"E 8.50 60 0.37 7.12 27.20 Mean 10.86 118 0.88 6.81 27.36 Standard deviation ± 2.15 83.41 ± 0.68 ± 0.21 ± 0.11 6) Poi 1 2°3'31.79"N, 112°16'50.19"E 7.10 55 2.00 6.99 27.30 2 2°2'40.49''N, 112°16'9.05''E 7.80 40 0.37 7.16 27.20 3 2°1'44.12''N, 112°15'50.24''E 6.20 50 0 7.25 27.10 4 2°0'29.96''N, 112°15'51.28''E 4.50 30 0 7.30 27.30 5 1°59'20.00"N, 112°15'27.70"E 5.10 25 0 7.38 27.30 Mean 6.14 40 0.47 7.22 27.24 Standard deviation ± 1.36 12.75 ± 0.87 ± 0.15 ± 0.09 7) Ngemah 1 2°1'28.40"N, 112°23'52.57"E 7.60 170 0 6.94 25.50 2 2°0'19.11'' N, 112°23'42.54''E 6.70 55 0 6.88 25.40 3 1°59'30.09'' N, 112°23'51.18''E 6.20 45 0 7.05 25.30 4 1°58'59.61''N, 112°24'17.09''E 6.20 30 0 7.01 25.50 5 1°57'41.48"N, 112°23'53.65"E 5.80 30 0 7.02 25.50 Mean 6.50 66 0 6.98 25.44 Standard deviation ± 0.69 59.10 0 ± 0.07 ± 0.09 8) Katibas 1 2°0'36.13"N, 112°33'14.10"E 10.80 145 0 7.00 25.40 2 1°59'58.43''N, 112°33'15.55''E 3.80 115 0 6.98 25.20 3 1°58'24.32''N, 112°32'55.95''E 7.00 130 0 6.94 25.40 4 1°56'36.10''N, 112°32'52.69''E 6.30 90 0 7.05 25.50 5 1° 54'32.78"N, 112°33'37.92"E 2.00 110 0 7.13 25.40 Mean 5.98 118 0 7.02 25.38 Standard deviation ± 3.35 20.80 0 ± 0.07 ± 0.11

229

Statistical analysis:

One-way ANOVA: Salinity versus River

Method

Null hypothesis All means are equal Alternative hypothesis At least one mean is different Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi, Sarikei

Analysis of Variance

Source DF Adj SS Adj MS F-Value P-Value River 7 2088.8 298.407 32.12 0.000 Error 32 297.3 9.289 Total 39 2386.1

Model Summary

S R-sq R-sq(adj) R-sq(pred) 3.04787 87.54% 84.82% 80.53%

Means

River N Mean StDev 95% CI Belawai 5 16.26 5.55 ( 13.49, 19.04) Kanowit 5 0.882 0.677 ( -1.894, 3.658) Katibas 5 0.000000 0.000000 (-2.776438, 2.776438) Kuala Igan 5 19.00 2.55 ( 16.22, 21.78) Ngemah 5 0.000000 0.000000 (-2.776438, 2.776438) Nyelong 5 1.992 1.871 ( -0.784, 4.768) Poi 5 0.474 0.868 ( -2.302, 3.250) Sarikei 5 6.07 5.68 ( 3.29, 8.84)

Pooled StDev = 3.04787

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

River N Mean Grouping Kuala Igan 5 19.00 A Belawai 5 16.26 A Sarikei 5 6.07 B Nyelong 5 1.992 B Kanowit 5 0.882 B Poi 5 0.474 B Ngemah 5 0.000000 B Katibas 5 0.000000 B

230

Means that do not share a letter are significantly different.

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted Difference of Levels of Means Difference 95% CI T-Value P-Value Kanowit - Belawai -15.38 1.93 (-21.62, -9.14) -7.98 0.000 Katibas - Belawai -16.26 1.93 (-22.51, -10.02) -8.44 0.000 Kuala Igan - Belawai 2.74 1.93 ( -3.51, 8.98) 1.42 0.842 Ngemah - Belawai -16.26 1.93 (-22.51, -10.02) -8.44 0.000 Nyelong - Belawai -14.27 1.93 (-20.51, -8.03) -7.40 0.000 Poi - Belawai -15.79 1.93 (-22.03, -9.55) -8.19 0.000 Sarikei - Belawai -10.20 1.93 (-16.44, -3.96) -5.29 0.000 Katibas - Kanowit -0.88 1.93 ( -7.12, 5.36) -0.46 1.000 Kuala Igan - Kanowit 18.12 1.93 ( 11.88, 24.36) 9.40 0.000 Ngemah - Kanowit -0.88 1.93 ( -7.12, 5.36) -0.46 1.000 Nyelong - Kanowit 1.11 1.93 ( -5.13, 7.35) 0.58 0.999 Poi - Kanowit -0.41 1.93 ( -6.65, 5.83) -0.21 1.000 Sarikei - Kanowit 5.18 1.93 ( -1.06, 11.43) 2.69 0.163 Kuala Igan - Katibas 19.00 1.93 ( 12.76, 25.24) 9.86 0.000 Ngemah - Katibas 0.00 1.93 ( -6.24, 6.24) 0.00 1.000 Nyelong - Katibas 1.99 1.93 ( -4.25, 8.23) 1.03 0.966 Poi - Katibas 0.47 1.93 ( -5.77, 6.72) 0.25 1.000 Sarikei - Katibas 6.07 1.93 ( -0.18, 12.31) 3.15 0.062 Ngemah - Kuala Igan -19.00 1.93 (-25.24, -12.76) -9.86 0.000 Nyelong - Kuala Igan -17.01 1.93 (-23.25, -10.77) -8.82 0.000 Poi - Kuala Igan -18.53 1.93 (-24.77, -12.28) -9.61 0.000 Sarikei - Kuala Igan -12.93 1.93 (-19.18, -6.69) -6.71 0.000 Nyelong - Ngemah 1.99 1.93 ( -4.25, 8.23) 1.03 0.966 Poi - Ngemah 0.47 1.93 ( -5.77, 6.72) 0.25 1.000 Sarikei - Ngemah 6.07 1.93 ( -0.18, 12.31) 3.15 0.062 Poi - Nyelong -1.52 1.93 ( -7.76, 4.72) -0.79 0.993 Sarikei - Nyelong 4.07 1.93 ( -2.17, 10.32) 2.11 0.428 Sarikei - Poi 5.59 1.93 ( -0.65, 11.83) 2.90 0.106

Individual confidence level = 99.72%

231

One-way ANOVA: pH versus River

Method

Null hypothesis All means are equal Alternative hypothesis At least one mean is different Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi, Sarikei

Analysis of Variance

Source DF Adj SS Adj MS F-Value P-Value River 7 21.982 3.14035 72.09 0.000 Error 32 1.394 0.04356 Total 39 23.376

Model Summary

S R-sq R-sq(adj) R-sq(pred) 0.208710 94.04% 92.73% 90.68%

Means

River N Mean StDev 95% CI Belawai 5 7.5260 0.1078 (7.3359, 7.7161) Kanowit 5 6.8080 0.2128 (6.6179, 6.9981) Katibas 5 7.0200 0.0731 (6.8299, 7.2101) Kuala Igan 5 6.420 0.430 ( 6.230, 6.610) Ngemah 5 6.9800 0.0689 (6.7899, 7.1701) Nyelong 5 5.2500 0.1564 (5.0599, 5.4401) Poi 5 7.2160 0.1494 (7.0259, 7.4061) Sarikei 5 5.630 0.224 ( 5.440, 5.820)

Pooled StDev = 0.208710

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

River N Mean Grouping Belawai 5 7.5260 A Poi 5 7.2160 A B Katibas 5 7.0200 B Ngemah 5 6.9800 B Kanowit 5 6.8080 B C Kuala Igan 5 6.420 C Sarikei 5 5.630 D Nyelong 5 5.2500 D

Means that do not share a letter are significantly different.

232

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted Difference of Levels of Means Difference 95% CI T-Value P-Value Kanowit - Belawai -0.718 0.132 (-1.145, -0.291) -5.44 0.000 Katibas - Belawai -0.506 0.132 (-0.933, -0.079) -3.83 0.012 Kuala Igan - Belawai -1.106 0.132 (-1.533, -0.679) -8.38 0.000 Ngemah - Belawai -0.546 0.132 (-0.973, -0.119) -4.14 0.005 Nyelong - Belawai -2.276 0.132 (-2.703, -1.849) -17.24 0.000 Poi - Belawai -0.310 0.132 (-0.737, 0.117) -2.35 0.300 Sarikei - Belawai -1.896 0.132 (-2.323, -1.469) -14.36 0.000 Katibas - Kanowit 0.212 0.132 (-0.215, 0.639) 1.61 0.743 Kuala Igan - Kanowit -0.388 0.132 (-0.815, 0.039) -2.94 0.098 Ngemah - Kanowit 0.172 0.132 (-0.255, 0.599) 1.30 0.891 Nyelong - Kanowit -1.558 0.132 (-1.985, -1.131) -11.80 0.000 Poi - Kanowit 0.408 0.132 (-0.019, 0.835) 3.09 0.070 Sarikei - Kanowit -1.178 0.132 (-1.605, -0.751) -8.92 0.000 Kuala Igan - Katibas -0.600 0.132 (-1.027, -0.173) -4.55 0.002 Ngemah - Katibas -0.040 0.132 (-0.467, 0.387) -0.30 1.000 Nyelong - Katibas -1.770 0.132 (-2.197, -1.343) -13.41 0.000 Poi - Katibas 0.196 0.132 (-0.231, 0.623) 1.48 0.810 Sarikei - Katibas -1.390 0.132 (-1.817, -0.963) -10.53 0.000 Ngemah - Kuala Igan 0.560 0.132 ( 0.133, 0.987) 4.24 0.004 Nyelong - Kuala Igan -1.170 0.132 (-1.597, -0.743) -8.86 0.000 Poi - Kuala Igan 0.796 0.132 ( 0.369, 1.223) 6.03 0.000 Sarikei - Kuala Igan -0.790 0.132 (-1.217, -0.363) -5.98 0.000 Nyelong - Ngemah -1.730 0.132 (-2.157, -1.303) -13.11 0.000 Poi - Ngemah 0.236 0.132 (-0.191, 0.663) 1.79 0.632 Sarikei - Ngemah -1.350 0.132 (-1.777, -0.923) -10.23 0.000 Poi - Nyelong 1.966 0.132 ( 1.539, 2.393) 14.89 0.000 Sarikei - Nyelong 0.380 0.132 (-0.047, 0.807) 2.88 0.111 Sarikei - Poi -1.586 0.132 (-2.013, -1.159) -12.02 0.000

Individual confidence level = 99.72%

233

One-way ANOVA: Temperature versus River

Method

Null hypothesis All means are equal Alternative hypothesis At least one mean is different Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi, Sarikei

Analysis of Variance

Source DF Adj SS Adj MS F-Value P-Value River 7 110.239 15.7484 316.55 0.000 Error 32 1.592 0.0497 Total 39 111.831

Model Summary

S R-sq R-sq(adj) R-sq(pred) 0.223047 98.58% 98.27% 97.78%

Means

River N Mean StDev 95% CI Belawai 5 29.7000 0.1225 (29.4968, 29.9032) Kanowit 5 27.3600 0.1140 (27.1568, 27.5632) Katibas 5 25.3800 0.1095 (25.1768, 25.5832) Kuala Igan 5 26.820 0.342 ( 26.617, 27.023) Ngemah 5 25.4400 0.0894 (25.2368, 25.6432) Nyelong 5 29.260 0.321 ( 29.057, 29.463) Poi 5 27.2400 0.0894 (27.0368, 27.4432) Sarikei 5 29.720 0.349 ( 29.517, 29.923)

Pooled StDev = 0.223047

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

River N Mean Grouping Sarikei 5 29.720 A Belawai 5 29.7000 A B Nyelong 5 29.260 B Kanowit 5 27.3600 C Poi 5 27.2400 C D Kuala Igan 5 26.820 D Ngemah 5 25.4400 E Katibas 5 25.3800 E

Means that do not share a letter are significantly different.

234

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted Difference of Levels of Means Difference 95% CI T-Value P-Value Kanowit - Belawai -2.340 0.141 (-2.797, -1.883) -16.59 0.000 Katibas - Belawai -4.320 0.141 (-4.777, -3.863) -30.62 0.000 Kuala Igan - Belawai -2.880 0.141 (-3.337, -2.423) -20.42 0.000 Ngemah - Belawai -4.260 0.141 (-4.717, -3.803) -30.20 0.000 Nyelong - Belawai -0.440 0.141 (-0.897, 0.017) -3.12 0.066 Poi - Belawai -2.460 0.141 (-2.917, -2.003) -17.44 0.000 Sarikei - Belawai 0.020 0.141 (-0.437, 0.477) 0.14 1.000 Katibas - Kanowit -1.980 0.141 (-2.437, -1.523) -14.04 0.000 Kuala Igan - Kanowit -0.540 0.141 (-0.997, -0.083) -3.83 0.012 Ngemah - Kanowit -1.920 0.141 (-2.377, -1.463) -13.61 0.000 Nyelong - Kanowit 1.900 0.141 ( 1.443, 2.357) 13.47 0.000 Poi - Kanowit -0.120 0.141 (-0.577, 0.337) -0.85 0.988 Sarikei - Kanowit 2.360 0.141 ( 1.903, 2.817) 16.73 0.000 Kuala Igan - Katibas 1.440 0.141 ( 0.983, 1.897) 10.21 0.000 Ngemah - Katibas 0.060 0.141 (-0.397, 0.517) 0.43 1.000 Nyelong - Katibas 3.880 0.141 ( 3.423, 4.337) 27.50 0.000 Poi - Katibas 1.860 0.141 ( 1.403, 2.317) 13.19 0.000 Sarikei - Katibas 4.340 0.141 ( 3.883, 4.797) 30.77 0.000 Ngemah - Kuala Igan -1.380 0.141 (-1.837, -0.923) -9.78 0.000 Nyelong - Kuala Igan 2.440 0.141 ( 1.983, 2.897) 17.30 0.000 Poi - Kuala Igan 0.420 0.141 (-0.037, 0.877) 2.98 0.090 Sarikei - Kuala Igan 2.900 0.141 ( 2.443, 3.357) 20.56 0.000 Nyelong - Ngemah 3.820 0.141 ( 3.363, 4.277) 27.08 0.000 Poi - Ngemah 1.800 0.141 ( 1.343, 2.257) 12.76 0.000 Sarikei - Ngemah 4.280 0.141 ( 3.823, 4.737) 30.34 0.000 Poi - Nyelong -2.020 0.141 (-2.477, -1.563) -14.32 0.000 Sarikei - Nyelong 0.460 0.141 ( 0.003, 0.917) 3.26 0.048 Sarikei - Poi 2.480 0.141 ( 2.023, 2.937) 17.58 0.000

Individual confidence level = 99.72%

235

Appendix A5

Table appendix A5: The coordinates of locations where the gill nets were deployed.

River Coordinates of the gill nets 1 2 3 1) Igan 2°49'44.03" N, 2°48'23.93" N, 2°48'12.98" N, 111°41'22.13" E 111°42'22.83" E 111°44'22.89" E 2) Belawai 2°11'40.80" N, 2°12'46.30 " N, 2°17'14.47" N, 111°15'59.21" E 111°16'56.23" E 111°16'44.79" E 3) Sarikei 2°6'38.44" N, 2°4'59.01" N, 2°3'23.47" N, 111°30'55.07" E 111°30'52.15" E 111°29'38.97" E 4) Nyelong 2°6'48.65" N, 2°5'59.99" N, 2°5'16.42" N, 111°32'16.26" E 111°33'17.14" E 111°34'22.66" E 5) Kanowit 2°4'23.88" N, 2°3'28.40" N, 2°2'52.49" N, 112°9'4.40" E 112°9'8.19" E 112°7'6.60" E 6) Poi 2°3'29.20" N, 2°1'57.19" N, 2°0'28.93" N, 112°16'48.69" E 112°15'32.60" E 112°15'55.85" E 7) Ngemah 2°0'33.51" N, 1°58'40.80" N, - 112°23'45.20" E 112°24'33.62" E 8) Katibas 1°58'23.22" N, 1°56'4.01" N, - 112°32'46.63" E 112°32'23.21" E

236

Appendix A6

Statistical analysis results for the abundant of aquatic food resources for crocodile (CPUE):

One-way ANOVA: CPUE versus RIver

Method

Null hypothesis All means are equal Alternative hypothesis At least one mean is different Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values RIver 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi, Sarikei

Analysis of Variance

Source DF Seq SS Contribution Adj SS Adj MS F-Value P-Value RIver 7 1.9674 85.98% 1.9674 0.28105 12.27 0.000 Error 14 0.3207 14.02% 0.3207 0.02291 Total 21 2.2881 100.00%

Model Summary

S R-sq R-sq(adj) PRESS R-sq(pred) 0.151357 85.98% 78.97% 0.747065 67.35%

Means

RIver N Mean StDev 95% CI Belawai 3 0.970 0.280 ( 0.783, 1.157) Kanowit 3 0.2483 0.0629 ( 0.0609, 0.4358) Katibas 2 0.1685 0.0205 (-0.0610, 0.3980) Kuala Igan 3 0.8217 0.1472 ( 0.6342, 1.0091) Ngemah 2 0.2590 0.1188 ( 0.0295, 0.4885) Nyelong 3 0.308 0.199 ( 0.121, 0.495) Poi 3 0.3750 0.0676 ( 0.1876, 0.5624) Sarikei 3 0.1220 0.0700 (-0.0654, 0.3094)

Pooled StDev = 0.151357

237

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

RIver N Mean Grouping Belawai 3 0.970 A Kuala Igan 3 0.8217 A Poi 3 0.3750 B Nyelong 3 0.308 B Ngemah 2 0.2590 B Kanowit 3 0.2483 B Katibas 2 0.1685 B Sarikei 3 0.1220 B

Means that do not share a letter are significantly different.

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted Difference of Levels of Means Difference 95% CI T-Value P-Value Kanowit - Belawai -0.722 0.124 (-1.158, -0.286) -5.84 0.001 Katibas - Belawai -0.802 0.138 (-1.289, -0.314) -5.80 0.001 Kuala Igan - Belawai -0.148 0.124 (-0.584, 0.288) -1.20 0.919 Ngemah - Belawai -0.711 0.138 (-1.199, -0.223) -5.15 0.003 Nyelong - Belawai -0.662 0.124 (-1.098, -0.226) -5.36 0.002 Poi - Belawai -0.595 0.124 (-1.031, -0.159) -4.81 0.005 Sarikei - Belawai -0.848 0.124 (-1.284, -0.412) -6.86 0.000 Katibas - Kanowit -0.080 0.138 (-0.567, 0.408) -0.58 0.999 Kuala Igan - Kanowit 0.573 0.124 ( 0.137, 1.009) 4.64 0.007 Ngemah - Kanowit 0.011 0.138 (-0.477, 0.498) 0.08 1.000 Nyelong - Kanowit 0.060 0.124 (-0.376, 0.496) 0.48 1.000 Poi - Kanowit 0.127 0.124 (-0.309, 0.563) 1.02 0.962 Sarikei - Kanowit -0.126 0.124 (-0.562, 0.310) -1.02 0.963 Kuala Igan - Katibas 0.653 0.138 ( 0.166, 1.141) 4.73 0.006 Ngemah - Katibas 0.091 0.151 (-0.444, 0.625) 0.60 0.998 Nyelong - Katibas 0.140 0.138 (-0.348, 0.627) 1.01 0.965 Poi - Katibas 0.207 0.138 (-0.281, 0.694) 1.49 0.799 Sarikei - Katibas -0.046 0.138 (-0.534, 0.441) -0.34 1.000 Ngemah - Kuala Igan -0.563 0.138 (-1.050, -0.075) -4.07 0.019 Nyelong - Kuala Igan -0.514 0.124 (-0.950, -0.078) -4.16 0.016 Poi - Kuala Igan -0.447 0.124 (-0.883, -0.011) -3.61 0.043 Sarikei - Kuala Igan -0.700 0.124 (-1.136, -0.264) -5.66 0.001 Nyelong - Ngemah 0.049 0.138 (-0.439, 0.537) 0.35 1.000 Poi - Ngemah 0.116 0.138 (-0.372, 0.604) 0.84 0.987 Sarikei - Ngemah -0.137 0.138 (-0.625, 0.351) -0.99 0.968 Poi - Nyelong 0.067 0.124 (-0.369, 0.503) 0.54 0.999 Sarikei - Nyelong -0.186 0.124 (-0.622, 0.250) -1.51 0.793 Sarikei - Poi -0.253 0.124 (-0.689, 0.183) -2.05 0.488

Individual confidence level = 99.67%

238

Appendix B

Table Appendix B: Information on the vouchered samples collected during samplings.

Collection UNIMAS Species Origin/ River Basin (RB) Description of Collection No. Voucher No. Sampling site Samples Date 1. SB001 C. porosus Sibu Rajang RB Tissue 02/01/2008 2. SM001 C. porosus Samarahan Samarahan RB Blood 27/08/2008 3. SB002 C. porosus Sibu Rajang RB Blood 27/08/2008 4. BN001 C. porosus Bintulu Kemena RB Blood 27/08/2008 (TPB) 5. BN002 C. porosus Bintulu Kemena RB Blood 27/08/2008 (TPB) 6. BG001 C. porosus Bintangor Rajang RB Blood 27/08/2008 7. BK001 C. porosus Sg. Bako Sg. Sarawak RB Blood 29/01/2009 8. MR002 C. porosus Miri Miri RB Blood 18/03/2009 (MCF) 9. MR003 C. porosus Miri Miri RB Blood 18/03/2009 (MCF) 10. MR010 C. porosus Miri Miri RB Blood 18/03/2009 (MCF) 11. BK005 C. porosus Sg. Bako Sg. Sarawak RB Blood 10/03/2010 12. TA001 C. porosus Kuching Wetland NP Sg. Sarawak RB Tissue 02/12/2011 (Telaga air)

239

Table Appendix B continue…

Collection UNIMAS Species Origin/ River Basin Description of Collection No. Voucher No. (Sampling site) Samples Date 13. RO001 C. porosus Sg. Seblak, Roban Krian RB Tissue 03/2013 14. KP001 C. porosus Kapit Rajang RB Tissue 18/10/2013 15. ST001 C. porosus Sg. Santubong Sg. Sarawak RB Tissue & Blood 04/03/2016 16. SM002 C. porosus Sg. Pinang, Samarahan RB Tissue & Blood 9/10/2016 Samarahan 17. ST002 C. porosus Semariang, Sg. Sarawak RB Tissue 8/12/2016 Santubong 18. PU001 C. porosus Sg. Pelasau, Pusa Saribas RB Scute tissue 26/7/2017 19. BG002 C. porosus Sg. Kawi, Bintangor Rajang RB Tissue 30/9/2017 20. SJ001 C. porosus Simunjan Sadong RB Tissue 28/12/2017 21. DB001 C. porosus Sg. Dit, Debak Saribas RB Scute tissue 3/2/2018 22. DB002 C. porosus Sg. Dit, Debak Saribas RB Scute tissue 3/2/2018 *TTB, Tumbina Park, Bintulu; MCF, Miri Crocodile Farm

240

Appendix C

L 1 2 3 4 5 6

300bp

200bp

Figure Appendix C1: An example of 1% agarose gel picture of microsatellites

amplification using Cj131 primer showing single band. Lane L: GeneRuler 100bp Plus DNA ladder (Fermentas); Lane 1: Sample SB001; Lane 2: Sample SB002; Lane 3: Sample KP001; Lane 4: Sample BG001; Lane 5: Sample BG002; Lane 6: Sample RO001.

241

L 1 2 3 4

500bp

400bp

300bp

Figure Appendix C2: An example of 1% agarose gel picture of microsatellites

amplification using Cj105 primer showing multiple bands. Lane L: GeneRuler 100bp Plus DNA ladder (Fermentas); Lane 1: Sample SM001; Lane 2: Sample SM002; Lane 3: Sample SJ001; Lane 4: Sample PU001.

242