RHAMM PROMOTES NEOPLASTIC CONVERSION AND PROGRESSION THROUGH THE REGULATION OF ERK1,2 ACTIVITY AND AP-1 MEDIATED TRANSCRIPTION
(Spine title: Rhamm Regulates ERK1,2 and AP-1 Mediated Transcription)
(Thesis format: Integrated-Article)
by
Sara Rae Hamilton
Graduate Program in Biochemistry
A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Faculty of Graduate Studies The University of Western Ontario London, Ontario, Canada September, 2007
© Sara R. Hamilton 2007 Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-39274-4 Our file Notre reference ISBN: 978-0-494-39274-4
NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne Privacy Act some supporting sur la protection de la vie privee, forms may have been removed quelques formulaires secondaires from this thesis. ont ete enleves de cette these.
While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. Canada THE UNIVERSITY OF WESTERN ONTARIO FACULTY OF GRADUATE STUDIES
CERTIFICATE OF EXAMINATION
Supervisor Examiners
Dr. Eva A. Turley Dr. David Litchfield
Supervisory Committee Dr. David Rodenhiser
Dr. Eric Ball Dr. Lynne-Marie Postovit
Dr. David Litchfield Dr. Linda Pilarski
The thesis by
Sara Rae Hamilton
entitled:
Rhamm Promotes Neoplastic Conversion and Progression Through the Regulation of ERK1,2 Activity and AP-1 Mediated Transcription
is accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Date Chair of the Thesis Examination Board
ii ABSTRACT
Rhamm (Receptor for Hyaluronic Acid Mediated Motility) is a cell surface hyaluronan receptor and intracellular mitotic spindle protein with limited expression in normal tissues but high expression in aggressive tumours. Cell surface Rhamm regulates signaling by the Ras GTPase in cellular transformation and migration, while intracellular
Rhamm regulates mitotic spindle stability and genomic instability. This thesis investigates the role of cell surface and intracellular Rhamm in tumourigenesis and identifies the signaling pathways necessary for Rhamm transformation.
Analysis of motogenic signaling in aggressive breast cancer cells revealed a novel autocrine mechanism used to sustain their high basal rates of motility. This involved increased production of hyaluronan and increased surface display of CD44 and Rhamm.
Cell surface Rhamm was identified as a coreceptor for CD44 and together they act coordinately to promote ERK (Extracellular Regulated Kinase) 1,2-regulated motogenic signaling.
An oncogenic Rhamm isoform that is highly expressed in many human tumours was previously found to transform immortalized fibroblasts. In this thesis, the involvement of Ras-regulated pathways in Rhamm-mediated transformation was assessed. Rhamm actions upstream and downstream of Ras were collectively required for transformation. Intracellular Rhamm binds directly to ERK1 leading to increased activation and nuclear localization of ERK 1 and increased activation of AP (Activator
Protein)-1-regulated transcription through RSK (Ribosomal S6 kinase) 1,2 phosphorylation and c-fos protein stabilization. Microarray analysis of Rhamm- transformed fibroblasts compared to parental fibroblasts revealed altered expression of
iii genes involved in all stages of tumourigenesis, including genes involved in Rhamm's previously reported functions. However, the majority of genes with altered expression were involved in the regulation of self-sufficiency in growth and insensitivity to growth inhibition, suggesting that Rhamm's role in tumourigenesis is more complex than previously thought.
This thesis provides the first evidence for a physical and functional association between Rhamm and CD44. Extracellular Rhamm may contribute to tumourigenesis by enhancing the latent rumour-promoting activities of CD44. These studies provide the first evidence for a role of intracellular Rhamm in activating Ras-regulated signaling in cellular transformation, and for Rhamm in regulating the expression of multiple genes involved in all stages of tumour progression. Understanding the complex role of Rhamm in tumourigenesis may lead to the development of better therapies for the treatment of cancer.
KEYWORDS: Rhamm, CD44, Hyaluronan, Fibroblasts, Motility, Transformation,
Microarray
iv CO-AUTHORSHIP
The following thesis contains material from a manuscript published previously in the Journal of Biological Chemistry (Chapter 2). Copyright permission is not required by this journal (see: https://www.jbc.org/misc/Copyright_Permission.shtml). This thesis
also contains a manuscript submitted for publication in Molecular and Cellular Biology
(Chapter 3).
Chapter 2 has been previously published as "The hyaluronan receptors CD44 and
Rhamm (CD 168) form complexes with ERK1,2, which sustain high basal motility in
breast cancer cells" by S.R. Hamilton, S.F. Fard , F.F. Paiwand , C. Tolg , M. Veiseh, C.
Wang, J.B. McCarthy, M.J. Bissell, J. Koropatnick and E.A. Turley in The Journal of
Biological Chemistry. S.F. Fard, F.F. Paiwand and C. Tolg are co-second authors and
contributed equally with each other in the research and preparation of this manuscript.
The measurement of hyaluronan production by the breast cancer cell lines (Figure
2.1 A) was done by C. Wang. The migration data using the hyaluronan binding (HABP)
peptide in Figure 2.IB, as well as the characterization of total cellular CD44 expression
(Figure 2.2A), total cellular Rhamm expression (Figure 2.3), and total cellular ERK1,2
expression (Figure 2.9A) were done by F.F. Paiwand. The migration data in Figure 2.1C
(in response to exogenous hyaluronan), in Figure 2.8 (effect of anti-CD44 and/or anti-
Rhamm blocking antibodies), and in Figure 2.12B (effect of blocking MEK and Rhamm
function) were done jointly by me and C. Tolg. The remaining experiments were done by
me. I wrote the manuscript under the supervision of E.A. Turley with the help of S.F.
Fard and C. Tolg.
v Chapter 3 has been submitted for publication to Molecular and Cellular Biology
as "Rhamm/HMMR Transforms Fibroblasts via ERK1 and AP-1 Mediated Transcription" by S.R. Hamilton, S. Zhang, C. Tolg, S. Crump, J.B. McCarthy, and E.A. Turley.
The foci formation and growth data seen in Figures 3.4, 3.5A, and 3.1 IB, C were
done by S. Zhang. The flow data showing cell surface Rhamm expression seen in Figure
3.3A was done by J. Bo. The foci formation and growth in soft agar data seen in Figures
3.2A, B and summarized in Figure 3.1, the kinase assays seen in Figures 3.10 and 3.11 A,
and the in vitro binding data seen in Figure 3.7 and 3.8B were done by both S. Zhang and
me. I performed the majority of the work and wrote the manuscript under the supervision
of E.A Turley.
vi Dedication
Julie and Ted,
"I get by with a little help from my friends." - John Lennon
Thank You.
"The woods are lovely dark and deep, but I have promises to keep, and miles to
go before I sleep, and miles to go before I sleep."
- Robert Frost
vii ACKNOWLEDGEMENTS
I would first like to express my sincerest gratitude to my thesis supervisor and mentor, Dr. Eva Turley for your unwavering encouragement and guidance along the way.
You have taught me to be an independent, critical and creative thinker, as well as a leader and communicator. These are skills that will help me in the years to come. All of this would not have been possible without my friends and lab mates: Dr. Cornelia Tolg, Jenny
Ma, Sarah Crump, Max Qi, Anu Bhalla, and Beatrice Kowalska. Conny, I will always value your insightful comments and our many discussions. Life in the Turley lab would not have been the same without you. I would also like to thank Dr. Shiwen Zhang and
Frouz Paiwand as your work was instrumental to my own. I would like to acknowledge members of my advisory committee, Drs. David Litchfield and Eric Ball, for their valuable feedback, direction and support. To Drs. Joe Mymryk, Tracey Jason, and Karen
Morley, I cannot thank you enough for your critical review of this thesis.
I would like to thank all of my friends and family who have supported me throughout this journey. To my Mom for encouraging me to find my own path and for teaching me that we have no limits. To my sisters, Kelley and Elizabeth and my brothers,
Chris and Jonny, for all of the love, support and encouragement they have given me over the years. Nobody knows me better! For the opportunities that they have provided me, I would also like to thank my Grandparents, Glenna and John.
Julie and Ted. Thank you both for your support and generosity. I would not have made it this far without you both.
viii To my running and triathlon crew - Christina, Sheila, Sherry, Mike, Tim, Rachel, and Peggy -1 most certainly could not have done this without the many stress-relieving hours I spent training with you all!
To the rest of my friends and family - Alison, Tracey, Karen, Steff, Adam, Darci,
Shireen and the rest of the Dining Club and LRCP crew - Thank you for being such wonderful and truly supportive friends. You have made my time in London, inside and outside of the lab, fun and enjoyable.
I would like to acknowledge the Canadian Institutes of Health Research and The
Translational Breast Cancer Research Unit for their continued financial support. In particular, a special thanks to Dr. Ann Chambers, director of the TBCRU.
Finally, I would like to thank all whose support, either direct or indirect, helped me complete my thesis in time.
ix TABLE OF CONTENTS
CERTIFICATE OF EXAMINATION ii
ABSTRACT iii
CO-AUTHORSHIP v
DEDICATION vii
ACKNOWLEDGEMENTS viii
TABLE OF CONTENTS x
LIST OF TABLES xiii
LIST OF FIGURES xiv
LIST OF APPENDICES xvii
LIST OF ABBREVIATIONS xviii
CHAPTER 1 - General Introduction
1.1 The Many Faces of Cancer 1 1.1.1 Cancer at a Glance 1 1.1.2 Cancer : A Definition 1 1.1.3 The "Hallmarks of Cancer" 2 1.2 The Tumour Microenvironment 3 1.3 Hyaluronan 5 1.3.1 Hyaluronan Structure, Synthesis and Physiological Function 5 1.3.2 Hyaluronan and Tumourigenesis 12 1.4 CD44, A Typical Hyaladherin 14 1.4.1 CD44: Structure 14 1.4.2 CD44 as a Hyaluronan Signaling Receptor 20 1.4.3 CD44 and Tumourigenesis 21 1.5 RHAMM (Receptor for Hyaluronic Acid-Mediated Motility), An Atypical Hyaladherin 24 1.5.1 RHAMM: Structure 24 1.5.2 Cell Surface vs. Intracellular Rhamm Functions in Physiology and Tumourigenesis 26 1.6 Ras and MAP Kinase Signaling in Cancer 29 1.6.1 Hyperactive Ras in Cancer 29 1.6.2 The Raf-MEK-ERK Cascade 33
x 1.6.3 Targeting the Raf-MEK-ERK Protein Cascade for the Treatment of Cancer 38 1.7 Hypothesis and Thesis Organization 39 1.8 References 41
CHAPTER 2 - The Hyaluronan Receptors CD44 and RHAMM (CD168) Form Complexes with ERK1,2 Which Sustain High Basal Motility in Breast Cancer Cells 56
2.1 Abstract 56 2.2 Introduction 57 2.3 Materials and Methods 62 2.3.1 Reagents (Antibodies, Growth Factors, Hyaluronan and Peptide Inhibitors) 62 2.3.2 Cell culture 64 2.3.3 Western immunoblotting 64 2.3.4 Analysis of EGF stimulated ERK1,2 activation 66 2.3.5 Measurement of hyaluronan production 66 2.3.6 Flow cytometry 67 2.3.7 Immunoprecipitation assays 68 2.3.8 Pull-down binding assays 68 2.3.9 Time-lapse cinemicrography 69 2.3.10 Immunofluorescence 70 2.3.11 Image analysis 71 2.3.12 Statistical analysis 71 2.4 Results 71 2.4.1 Invasive breast tumour cell lines produce endogenous HA that sustains rapid motility 72 2.4.2 Invasive breast tumour cells display both cell surface CD44 and Rhamm 75 2.4.3 CD44 and cell surface Rhamm are necessary for motility of invasive but not non-invasive breast tumour cell lines 88 2.4.4 CD44 and Rhamm complex with ERK1,2 and these complexes are required for motility in invasive breast cancer cell lines 89 2.5 Discussion 105 2.6 References 109
CHAPTER 3 - RHAMM / HMMR Transforms Fibroblasts via ERK1,2 and AP-1 Mediated Transcription 120
3.1 Abstract 120 3.2 Introduction 121 3.3 Materials and Methods 125 3.3.1 Reagents (Antibodies, Growth Factors, and kits) 125 3.3.2 Plasmids 126
xi 3.3.3 Cell lines, cell culture and transfection 127 3.3.4 Foci formation and growth in soft agar 128 3.3.5 Flow cytometry 129 3.3.6 Immunofluorescence 129 3.3.7 Image acquisition and enhancement 130 3.3.8 Preparation of whole cell lysates and nuclear extracts 131 3.3.9 Western Immunoblotting 131 3.3.10 Immunoprecipitation assays 132 3.3.11 Preparation of recombinant proteins 133 3.3.12 In vitro binding and competition assays 134 3.3.13 In vitro kinase assays 135 3.3.14 Promoter element binding assays 136 3.3.15 Luciferase assays 137 3.3.16 RNA isolation 138 3.3.17 Microarray : RNA quality assessment, probe preparation, Genechip hybridization and data analysis 139 3.3.18 cDNA synthesis and quantitative real-time PCR 141 3.3.19 Statistical analysis 143 3.4 Results 143 3.4.1 Rhammonc transforms 10T1/2 fibroblasts 143 3.4.2 Rhammonc is expressed as a cell surface and intracellular protein 149 3.4.3 Rhammonc associates with MEK1 and ERK1 162 3.4.4 Rhammonc promotes subcellular trafficking and activation of ERK1,2 170 3.4.5 Rhammonc increases RSK1,2 phosphorylation and AP-1 activation 178 3.5 Discussion 203 3.6 References 208
CHAPTER 4 - General Discussion 219
4.1 Thesis Summary and Significance 219 4.2 Synthesis and Discussion 222 4.2.1 Cell Surface Rhamm in Tumourigenesis 223 4.2.2 Rhamm as a Multi-Functional Adapter Protein 226 4.2.3 Rhamm as a Pro-Fibrogenic Factor in Tumourigenesis 228 4.3 A Model for Rhamm in Tumourigenesis 232 4.4 Future Directions 232 4.5 References 236
APPENDICES 243
CURRICULUM VITAE 313
xii LIST OF TABLES
TABLE
Table 3.1 Primer Sequences for Validation of Candidate Genes by Quantitative Real-Time RT-PCR 142
Table 3.2 Validation of Selected Genes by Quantitative Real-Time RT-PCR and Role of ERK1,2 and AP-1 in Regulation and Expression of Candidate Genes 202
Appendix B Microarray Data : Genes Upregulated/Downregulated in Rhammonc-Overexpressing 10T1/2 Fibroblasts 247
Appendix C Microarray Data : Analysis of Cancer-Associated Genes Upregulated / Downregulated in Rhammonc-overexpressing 291 10T1/2 Fibroblasts
Appendix D Microarray Data : "Hallmarks of Cancer" Classification Of Cancer-Associated Genes Upregulated/Downregulated in 296 Rhammonc-overexpressing 10T1/2 Fibroblasts
Appendix E Microarray Data : ERK1,2 Transcriptome vs Rhammonc Transcriptome 310
xiii LIST OF FIGURES
FIGURE
Figure 1.1 Synthesis of hyaluronan by the hyaluronan synthases 7
Figure 1.2 Function of high molecular weight vs. low molecular weight
Hyaluronan 11
Figure 1.3 Hyaladherins 16
Figure 1.4 CD44 and RHAMM 19
Figure 1.5 Ras signaling 32
Figure 1.6 Regulation of ERK MAPK signaling by adapters, scaffolds, and Inhibitors 37 Figure 2.1 MDA-MB-231 invasive breast tumour cells produce greater levels of hyaluronan compared to MCF7 non-invasive breast tumour cells and rely more strongly upon hyaluronan to promote basal motility (A, C. Wang; B, F. Paiwand) 74
Figure 2.2 Cell surface and total cellular CD44 protein levels are increased in MDA-MB-231 breast cancer cells relative to MCF7 cells (A, F. Paiwand) 77
Figure 2.3 Rhamm isoforms (63 and 85kDa) are more highly expressed in MDA-MB-231 and Ras-MCF 10A cells than in MCF7 and parental MCF1OA breast cancer cell lines (F. Paiwand) 79
Figure 2.4 Cell surface and total cellular CD44 protein levels are increased 82
Figure 2.5 Subcellular distribution of CD44 and Rhamm differs in invasive
and non-invasive breast cancer cell lines 85
Figure 2.6 Rhamm isoforms associate with CD44 87
Figure 2.7 MDA-MB-231 and Ras-MCF 1 OA cells have higher basal motility rates than MCF7 and parental MCF 1 OA cells 91 Figure 2.8 High basal motility of MDA-MB-231 and Ras-MCF 1 OA tumour cells is CD44 and Rhamm-dependent 93
Figure 2.9 ERK1,2 is activated in response to EGF in MDA-MB-231 cells (A, F. Paiwand) 96
xiv Figure 2.10 CD44 and Rhamm co-localize and co-immunoprecipitate with
Active (phospho) ERK 1,2 99
Figure 2.11 Rhamm isoforms associate with ERK1,2 101
Figure 2.12 Anti-Rhamm and anti-CD44 antibodies reduce ERK1,2 activity and ERK1,2-dependent motility of MDA-MB-231 cells 104 Figure 3.1 Summary of Rhamm isoform-mediated growth in soft agar and foci formation and conserved C-terminal region of Rhamm 145
Figure 3.2 Rhammonc promotes growth in soft agar and foci formation when overexpressed in 10T1/2 fibroblasts 148
Figure 3.3 Rhammonc is a cell surface and intracellular protein when transiently overexpressed in 10T1/2 and Rhamm"7" cells (A, J. Bo) 151
Figure 3.4 Rhammonc is acting upstream and downstream of Ras during transformation of 10T112 fibroblasts (S. Zhang) 154
Figure 3.5 ERK1,2 is required for Rhammonc-mediated foci formation
(A, S. Zhang) 156
Figure 3.6 Rhammonc co-immunoprecipitates with MEK1 and ERK 1 159
Figure 3.7 Rhammonc binds ERK1 but not ERK2 or MEK1 161 Figure 3.8 Recombinant Rhammonc binds ERK1 directly and sequences within the conserved C-terminal domain are required for this interaction 164
Figure 3.9 Rhammonc directly participates in MEK1 -mediated activation of
ERK1.2 167
Figure 3.10 Rhammonc participates in MEK1 -mediated activation of ERK 1,2 169
Figure 3.11 Rhammonc promotes ERK1,2 activation and foci formation at the level of MEK1/ERK1,2 (B,C, S. Zhang) 172 Figure 3.12 Rhammonc promotes subcellular trafficking and activation of ERK1,2 in Rhamm"7" cells 175
Figure 3.13 Rhammonc promotes nuclear trafficking and activation of ERK1.2 in 10T1/2 cells 177
xv Figure 3.14 Rhammonc overexpression leads to increased levels of phospho- RSK1,2 in 1OT1 /2 fibroblasts 180
Figure 3.15 C-fos protein stability depends on ERK1,2 activity in Rhammonc- overexpressing 10T1/2 fibroblasts 182
Figure 3.16 C-fos DNA binding activity depends on ERK1,2 activity in Rhammonc-overexpressing 10T1/2 fibroblasts 185
Figure 3.17 Basal levels of active c-Jun and kinetics of c-Jun activation are altered in Rhammonc-overexpressing 10T1/2 fibroblasts 188
Figure 3.18 10T1/2 cells overexpressing Rhammonc have higher AP-1 activity than parental 1 OT 112 cells 190
Figure 3.19 Rhammonc-overexpression in 10T1/2 fibroblasts results in significantly altered expression of genes involved in each stage of neoplastic transformation and progression 194
Figure 3.20 Rhammonc vs. ERK1,2 transcriptomes 196
Figure 3.21 Proposed Model for Rhamm in tumourigenesis 199
Appendix A Rhamm isoform expression in 10T1/2 cells transiently and 245 Stably expressing Rhammonc
xvi LIST OF APPENDICES
APPENDIX
Appendix A Rhamm Isoform Expression in 10T1/2 Cells Transiently and 243 Stably Expressing Rhammonc
Appendix B Microarray Data : Genes Upregulated/Downregulated in Rhammonc-Overexpressing 10T1/2 Fibroblasts 246
Appendix C Microarray Data : Analysis of Cancer-Associated Genes Upregulated / Downregulated in Rhammonc-overexpressing 290 10T1/2 Fibroblasts
Appendix D Microarray Data : "Hallmarks of Cancer" Classification Of Cancer-Associated Genes Upregulated/Downregulated in 295 Rhammonc-Overexpressing 10T1/2 Fibroblasts
Appendix E Microarray Data : ERK1,2 Transcriptome vs Rhammonc Transcriptome 309
xvii LIST OF ABBREVIATIONS
2D two-dimensional
3D three-dimensional aa amino acid
Ab antibody
AML acute myeloid leukemia
AP-1 activator protein-1
APC adenomatous polyposis coli
ATP adenosine triphosphate
BAPvDl breast Cancer Associated RING Domain 1
BMEC bone marrow endothelial cells
BRCA1 Breast Cancer Associated Gene 1
BSA bovine serum albumin
B(X)7B basic (X)7 basic
CD44 all forms of CD44
CD44std CD44 standard form (containing no variant exons)
CD44vx a variant of CD44 containing specific variant exons indicated by the x
Cdc37 cell cycle division 37
CDNA complementary DNA
CENP centromere protein
CML chronic myeloid leukemia
Ct threshold cycle
Da Dalton
xviii DAPI 4',6-diamidino-2-phenylindole
DMEM Dulbecco's modified Eagle's Medium
DNA deoxyribonucleic acid
ECL enhanced chemiluminescence
ECM extracellular matrix
EGF epidermal growth factor
EGFR epidermal growth factor receptor
ELISA enzyme-linked immunosorbent assay
ER endoplasmic reticulum
ERK Extracellular Regulated Kinase
FACS fluorescence activated cell sorting
FAK focal adhesion kinase (also known as ppl25FAK)
FBS fetal bovine serum
FCS fetal calf serum
FGF fibroblast growth factor
GAP GTPase activating proteins
GDP guanosine diphosphate
GEF guanine nucleotide exchange factor
GTP guanosine triphosphate
GTPase guanosine triphosphatase
HA hyaluronan
HAS hyaluronan synthase
HMMR Hyaluronan Mediated Motility Receptor (Rhamm) HRas Harvey-Ras
HRP horse radish peroxidase;
Hsp90 heat shock protein 90
IB immunoblot;
Ig immunoglobulin
IP immunoprecipitate;
IQGAP IQ motif-containing GTPase activating protein
JNK c-jun-amino-terminal kinase
KDa kilodalton;
KRasA/B Kirsten-Ras A/B
KSR kinase suppressor of ras
LYVE-1 Lymphatic vessel endothelial hyaluronan receptor 1
MAPK mitogen Activated Protein kinase;
MAPKK mitogen activated protein kinase kinase
MAPKKK mitogen activated protein kinase kinase kinase
MEK1 Mitogen Activated Kinase 1; mg milligram
MKK MAP kinase kinase
MKKK MAP kinase kinase kinase ml milliliter
MMP matrix metalloproteinase;
MP-1 MEK partner-1
MW molecular weight;
xx nm nanometers
NP-40 nonidet P-40
NRas Neural-Ras oHA HA oligosaccharides
PAK p21 Activated Kinase
PBS phosphate buffered saline;
PCR polymerase chain reaction
PDGF platelet derived growth factor
PI3K phosphoinositide 3-kinase
PKA protein kinase A
PKB/Akt protein kinase B
PKC protein kinase C
PP2A protein phosphatase 2A
QPCR quantitative PCR
Racl Ras-related C3 botulinum toxin substrate 1
Rhamm Receptor for Hyaluronic Acid Mediated Motility
RhammFL full-length Rhamm
Rhammonc oncogenic Rhamm
RhoA Ras homolog gene family, member A
RPL32 ribosomal protein L32
RKIP Raf Kinase Inhibitor Protein
RNA ribonucleic acid
ROS reactive oxygen species rpm revolutions per minute
RSK1,2 ribosomal S6 kinase 1,2
RT reverse transcription
SEREX serological identification of antigens by recombinant expression
SOS Son of Sevenless
TBS tris buffered saline
TBST tris buffered saline with 0.1% tween-20
TPX2 targeting Protein for XKLP2
VEGF vascular endothelial growth factor
XRHAMM Xenopus Rhamm homolog mg microgram ml microliter
xxii 1
CHAPTER 1. Introduction
1.1 The Many Faces of Cancer
1.1.1 Cancer at a Glance
Current cancer statistics suggest that 39% of Canadian women and 44% of
Canadian men will develop cancer during their lifetimes (Canadian Cancer Society 2007; www.cancer.ca). This year alone, an estimated 159, 900 Canadians will be diagnosed with cancer and approximately 72,700 deaths will occur, leaving cancer as the leading cause of premature death in our country (Canadian Cancer Society 2007). A better understanding of the molecular mechanisms underlying cancer development, progression and metastasis could eventually lead to a substantial reduction in these numbers.
1.1.2 Cancer: A Definition
What is Cancer? The Canadian Cancer Society defines cancer as a disease that starts in our cells; "a cell's instructions get mixed up and it behaves abnormally. After a while, groups of abnormal cells can form lumps or tumours, or can spread through the bloodstream and lymphatic system to other parts of the body" (Canadian Cancer Society
2007; www.cancer.ca). While this simple definition is certainly valid, it does not take
into account the molecular and clinical complexities of the disease. The current scientific
literature has shown carcinogenesis to be a complex, multistep and multimechanistic process that involves the stepwise accumulation of genetic and epigenetic changes. This accrual of changes confers a growth and survival advantage to cells, thus allowing normal 2 cells to transform into their highly malignant counterparts. However, our understanding of the molecular events that drives these changes remains poorly understood.
1.1.3 The "Hallmarks of Cancer"
Several years ago Hanahan and Weinberg (Hanahan and Weinberg 2000) published a landmark paper in which they proposed that the molecular changes that occur during carcinogenesis could be summarized into six different categories, termed the
"Hallmarks of Cancer". These essential alterations render cells self-sufficient for growth, insensitive to anti-growth signals, and resistant to programs of apoptosis and senescence or terminal differentiation (Hanahan and Weinberg 2000). Such changes in behaviour then endow these emerging neoplastic cells with unlimited capacity for self-renewal, as well as the ability to direct sustained angiogenesis and invade and metastasize into
surrounding tissues (Hanahan and Weinberg 2000).
The vast majority of cancer research to date has focused on the consequences of
genetic mutations within tumour cells (e.g. the activation of oncogenes and/or loss of tumour suppressor genes) to neoplastic initiation and progression (Hanahan and
Weinberg 2000; Bissell and Radisky 2001; Levitt and Hickson 2002; Oliveira et al.
2005). However, it has become increasingly evident that the accumulation of these
"hallmarks of cancer" is not solely dependent on the tumour cells themselves, but is also
a consequence of their microenvironment (Bissell and Radisky 2001). The tumour
microenvironment, which includes the surrounding extracellular matrix (ECM) and
stroma (fibroblasts, immune and fat cells), can help determine the rate at which tumours
develop, grow and spread (Bissell and Radisky 2001). 3
1.2 The Tumour Microenvironment
The extracellular matrix, as part of the microenvironment, is crucial for regulating normal developmental processes and for maintaining tissue homeostasis. It is produced by stromal fibroblasts and tissue epithelial cells and is a complex, three-dimensional (3D) network of large macromolecules that provides positional cues for maintenance of epithelial polarity and tissue architecture, as well as the contextual 3D microenvironment that contributes to the regulation of normal cellular phenotypes (Bissell and Radisky
2001). More recent research has provided greater insight into the role played by the
ECM in tumour progression (Bissell and Radisky 2001). These studies have clearly demonstrated that the tumour microenvironment is not simply a consequence of malignant growth, but that it can play an active role in regulating cell behaviour to drive malignant transformation and progression.
Tumour progression is marked by many alterations to the surrounding microenvironment. These include the degradation and eventual loss of the basement membrane, as well as an increasingly fibrotic ECM, which disrupts the epithelial structure and facilitates the invasion of tumour cells into surrounding tissues (Bissell and
Radisky 2001; Radisky et al. 2007). This fibrotic ECM can also act as a scaffold that tumour cells adhere to, migrate and grow on, as well as a reservoir for many soluble growth factors, cytokines and signaling molecules (Radisky et al. 2007). There is increased activation of resident stromal fibroblasts (myofibroblasts) that deposit fibrotic
ECM components, remodel the existing ECM, and secrete growth, inflammatory, and angiogenic factors that stimulate tumour cell proliferation, attract tumour promoting 4 immune cells, and stimulate the formation of new tumour vasculature (Radisky et al.
2007). The resulting influx of immune cells into the tumour microenvironment can also contribute to tumour progression by secreting tumour promoting growth factors, as well as ECM degrading enzymes that can further degrade the basement membrane to facilitate
invasion and metastasis (Radisky et al. 2007). Each of these changes contributes to tumour initiation and progression. For example, overexpression of stromelysin-1
(MMP3), a stromal factor that degrades the basement membrane, in the mammary glands
of transgenic mice leads to epithelial tumourigenesis in the absence of any other mutating
agent (Sternlicht et al. 1999).
While much attention has been paid to how tumour cells signal to the stroma to
facilitate or induce tumourigenic changes, it is clear that the stroma acts as a reciprocal
signaling partner in tumour progression (Bissell and Radisky 2001). Changes in the
stroma or ECM composition are sensed by receptors (e.g. integrins, cadherins or CD44)
that are displayed on the cell surface of tumour cells, leading to a complex array of
autocrine and paracrine signaling events that can greatly impact tumour cell behaviour.
Furthermore, while abnormal signals from the tumour microenvironment have been
linked to tumour initiation and progression, there is evidence suggesting that these
changes are reversible (Kenny and Bissell 2003). Classic work done by Beatrice Mintz
in the 1970's lends weight to this idea. This group found that when malignant mouse
teratocarcinoma cells were microinjected into normal blastocysts, the tumour cells were
able to differentiate into normal tissues and to generate a normal mouse, suggesting that
reintroduction of normal context could inhibit or revert tumourigenesis in situ (Mintz and
Illmensee 1975; Illmensee and Mintz 1976). Work done recently in Mina Bissell's 5 laboratory has further contributed to this idea. They showed that inhibition of a signaling pathway that is dysregulated in aggressive tumour cells, [e.g. Extracellular Regulated
Kinase (ERK) 1,2], together with an ECM receptor, was sufficient to revert malignant breast tumour cells to polarized, non-proliferating, non-tumourigenic epithelial cells, even though the cells retained multiple downstream activating mutations in growth receptor (Ras) or tumour suppressor (p53) genes (Wang et al. 2002). These and other studies suggest an intriguing possibility that restoration of ECM-regulated pathways that favour differentiation versus transformation / invasion may revert or inhibit tumourigenesis.
While it is clear that changes in the microenvironment contribute to tumourigenesis, the molecular basis of these alterations is not well understood. A
specific ECM component that has been linked to tumourigenesis is hyaluronan.
1.3 Hyaluronan
1.3.1 Hyaluronan Structure, Synthesis and Physiological Functions
Hyaluronan (also known as hyaluronic acid, hyaluronate or HA) is a high
molecular weight glycosaminoglycan that has been implicated in various physiological
and pathological processes. These include maintenance of tissue and/or matrix
homeostasis and structure, as well as cellular proliferation, differentiation, motility,
wound repair and tumourigenesis (Tammi et al. 2002).
Hyaluronan is synthesized as a large, negatively charged, unsulfated, unbranched
polysaccharide that is composed of repeating disaccharide units of JV-acetyl glucosamine Figure 1.1. Synthesis ofhyaluronan by the hyaluronan synthases. Hyaluronan is produced by a family of transmembrane enzymes called the hyaluronan synthases (HAS), which includes HAS1, HAS2, and HAS3. These enzymes synthesize hyaluronan on the inner surface of the plasma membrane by catalyzing the polymerization of N- acetylglucosamine and D-glucoronic acid into long chains of repeating disaccharide units. The growing hyaluronan chain is then extruded out into the extracellular space through a pore formed by the HAS enzymes themselves, where it can be retained by hyaluronan binding proteins such as CD44 or aggrecan. Figure modified from (Toole
2004). 7
COOH CH2OH /
Extracellular Space
Cytosol Hyaluronan Synthase (HAS) 8
and glucoronic acid [(~p(l,4)-GlcUA-P(l,3)-GlcNac~)n] (Figure 1.1) (Fraser et al. 1997).
While other glycosaminoglycans (e.g. heparin sulfate or chondroitin sulfate) are synthesized as proteoglycans in the Golgi apparatus and endoplasmic reticulum, hyaluronan is synthesized on the inner surface of the plasma membrane (Prehm 1984) by a family of three enzymes called the hyaluronan synthases (HAS 1-3) (Itano and Kimata
2002; Toole 2004). Each isoform is located on a different mammalian chromosome yet they have remarkable sequence similarity (Itano and Kimata 2002). They are large, transmembrane proteins with active sites on their cytosolic sides; the UDP-sugar residues bind to the cytosolic face of the HAS enzymes and are added on to a growing hyaluronan chain that is extruded through the plasma membrane into the extracellular space where it is retained either by the HAS enzyme itself or by cell surface hyaluronan-binding receptors (Figure 1.1) (Stern 2003; Toole 2004). Each of the synthases, which are differentially expressed during embryogenesis, response-to-injury processes and neoplastic transformation, is capable of de novo hyaluronan synthesis, though the
synthesis rate and the final molecular weight of the polymers they produce differ (Weigel
et al. 1997; DeAngelis 1999; Itano and Kimata 2002; Spicer et al. 2002). In general,
HAS1 and HAS2 both synthesize chains of 10 -10 kDa and HAS3 produces smaller hyaluronan polymers (no larger than 102 kDa) (Itano and Kimata 2002). Hyaluronan is
degraded by a specific family of enzymes called the hyaluronidases. Six hyaluronidase
genes have been identified in humans, each of which is regulated and distributed
differently (Csoka et al. 2001).
A ubiquitous component of the extracellular matrices of most animal tissues,
hyaluronan is highly concentrated in the skin (dermis and epidermis), synovial fluid, 9 lymph, brain, CNS, and in the vitreous of the eye (Fraser et al. 1997; Tammi et al. 2002).
Under normal physiological conditions, hyaluronan exists as very large polymers that range in size from 106-107 Daltons (2,000-25,000 disaccharides). These high molecular weight chains have remarkable hydrodynamic properties, especially in terms of their viscosity and ability to retain water (Tammi et al. 2002; Toole 2004). As a result, hyaluronan is an important regulator of tissue hydration and homeostasis, as well as a joint lubricator (Tammi et al. 2002; Toole 2004). In addition to existing as a soluble polymer, hyaluronan also forms a unique template to which other proteoglycans, such as versican and aggrecan, and other extracellular molecules can bind to aid in the assembly and stability of the extracellular and pericellular matrices (Knudson 1993; Nishida et al.
1999; Toole 2000; Toole 2004).
The size of the hyaluronan molecule has profound effects on its biological activities (Stern et al. 2006). While the structural functions of high molecular weight hyaluronan in the tissue extracellular matrices of adult organisms are well known, the less well-known functions of hyaluronan fragments are coming to light. Hyaluronan, in particular hyaluronan fragments, also play instructive roles in cellular processes like proliferation, differentiation, and migration (Turley et al. 2002; Toole 2004) during embryonic development, wound repair, inflammation, neo-vascularization and tumourigenesis.
There are several possible mechanisms through which hyaluronan fragments can be generated (Figure 1.2). These include incomplete synthesis by the hyaluronan
synthases as well as depolymerization through both enzymatic and non-enzymatic
mechanisms (Figure 1.2). Enzymes that are able to degrade hyaluronan include the Figure 1.2. Function of high molecular weight versus low molecular weight hyaluronan.
High molecular weight hyaluronan is an important structural component of tissue extracellular matrices. However, low molecular weight hyaluronan fragments (also referred to as hyaluronan oligosaccharides or oHA) are generated through incomplete synthesis or degradation by hyaluronidases or reactive oxygen species (ROS). These hyaluronan fragments bind to cellular receptors like CD44 and/or Rhamm to activate and regulate various signaling cascades to influence cellular behaviours, including motility and invasion. 11
* j / JVC:/-L £<5r
^i A HAVJ Structural I function 1 I Ooniffgenf i , ~~
High molecular weight Hyaluronan
ROS Hyaluronidases HAS 1-3
oHA
Cell surface Signaling function Cytosol
Signaling Low molecular weight complexes Hyaluronan (oHA) 12 family of hyaluronidases mentioned previously, as well as chondriotinases and hexosaminidases (Laurent and Fraser 1992; Stern 2004). Hyaluronan can also be degraded through exposure to reactive oxygen species (ROS) (Deguine et al. 1998;
Yamazaki et al. 2003), which fragments hyaluronan randomly at internal glycosidic linkages.
1.3.2 Hyaluronan and Tumourigenesis
Although a role for hyaluronan in stroma-regulated neoplastic growth has not yet been directly demonstrated, several groups have reported increased hyaluronan accumulation in the stoma of a number of different aggressive tumours (Auvinen et al.
2000; Toole 2004; Gotte and Yip 2006) and on the surface of the tumour cells (Zhang et al. 1995). Further, hyaluronan accumulation is significantly correlated to poor differentiation of the tumours, auxiliary node positivity, and short overall survival of patients (Auvinen et al. 2000; Toole et al. 2002; Toole 2004). While normally produced in the stroma, transformation often results in the synthesis of hyaluronan by the tumour epithelia (Auvinen et al. 2000; Toole et al. 2002). In breast and prostate cancers, enhanced accumulation of hyaluronan in the tumour cells is an indicator of poor prognosis (Auvinen et al. 2000; Lokeshwar et al. 2001). It is also interesting to note that
in breast cancer, the enhanced accumulation of hyaluronan in the stroma or in the transformed epithelia are independent prognostic indicators, and the correlation between hyaluronan accumulation and poor prognosis is increased when the two parameters are
combined (Auvinen et al. 2000). This suggests that each pool of hyaluronan (stromal vs.
epithelial) contributes to tumourigenesis in distinct mechanisms; for stromal hyaluronan, 13 this may involve promotion of angiogenesis (West et al. 1985; West and Kumar 1989;
Sattar et al. 1994; Lees et al. 1995; Montesano et al. 1996).
The precise role(s) played by hyaluronan in neoplastic transformation, growth and progression has been highly researched due to the close clinical association between the levels of hyaluronan and tumourigenesis. Hyaluronan has been associated with the malignant progression of a variety of tumour types, including breast, prostate, colorectal, glial and mesothelial (Toole 2004). Increased hyaluronan expression, through the overexpression of specific HAS isoforms, increased the malignant properties of cells in vitro (using enhanced anchorage-independent growth, adhesion, migration and invasion as measures), as well as enhanced tumour growth and angiogenesis in vivo (Toole 2002).
Specifically, increased HAS2 expression contributed to enhanced cell survival and anchorage-independent growth of both human fibrosarcoma (Kosaki et al. 1999) and mesothelioma cells (Li and Heldin 2001), and it also increased the tumourigenic capacity
of malignant mesothelioma (Li and Heldin 2001) and breast cancer cells (Udabage et al.
2005). In prostate cancer cells, overexpression of HAS3, the isoform commonly upregulated in aggressive human prostate tumours, resulted in increased growth and tumourigenicity of cells in vitro and in vivo (Liu et al. 2001). Furthermore, expression of
HAS1 in mouse mammary carcinoma cells with defective HAS activity restored the
metastatic potential of these cells (Itano et al. 1999). In a converse experiment, antisense
RNA-mediated downregulation of HAS2 and/or HAS3 in osteosarcoma (Nishida et al.
2005), prostate (Simpson et al. 2002), and breast cancer cells (Udabage et al. 2005)
resulted in reduced tumourigenicity in vitro and in vivo. Cell surface hyaluronan, which
results from increased HAS expression, hyaluronan synthesis and hyaluronan retention, 14 has further been shown to mediate the adhesion of circulating prostate and breast cancer cells to bone marrow endothelial cells (BMECs), a function that is mediated, at least in part, by cell surface receptor CD44 (Simpson et al. 2002; Draffin et al. 2004). In support of this, suppression of HAS expression in aggressive prostate cells reduced their ability to adhere to bone marrow endothelial cells (BMEC) (Simpson et al. 2001; Simpson et al.
2002). Collectively, the experimental upregulation of HAS expression and hyaluronan synthesis in these cell systems suggests/indicates a role for hyaluronan in promoting tumour-associated cell behaviour.
While the mechanisms for hyaluronan's role in tumourigenesis are not fully understood, there are characteristics of hyaluronan that are thought to be important in this role. These include its biomechanical properties (e.g. its ability to expand extracellular matrices to facilitate cell migration), its ability to assemble matrices, and its ability to bind to cellular receptors (e.g. CD44 and/or Rhamm) resulting in the activation and/or regulation of a number of different signaling pathways to directly modify cell behaviours,
such as adhesion, migration, invasion, angiogenesis, multi-drug resistance, and anchorage-independent growth (Toole 2004).
1.4 CD44, A Typical Hyaladherin
1.4.1 CD44: Structure
Hyaluronan binding proteins or hyaladherins are divided into extracellular
(including aggrecan and other proteins associated with hyaluronan in the ECM) and
cellular proteins (Figure 1.3), although the distinction between the two is becoming less Figure 1.3. Hyaladherins. Hyaluronan binding proteins, referred to as hyaladherins, are divided into cellular or extracellular proteins. They are further classified according to their sequence homology (e.g. CD44 and LYVE-1), the mechanism for their association with the cell surface (transmembrane vs peripheral or itinerant), and the mechanism by which they bind hyaluronan [link module vs B(X)7B motif]. 16
Proteins iamm (CD1 •cdc37 •p68 (gclqR) •HABP-1 17 clear with increasing characterization of these molecules. For example, the cellular hyaladherin Rhamm can be exported so that it can also be considered extracellular protein (Hardwick et al. 1992). Cellular hyaladherins have further been classified according to their sequence homology (e.g. CD44 and LYVE-1), the mechanism for their association with the cell surface (transmembrane versus peripheral/itinerant), and the mechanism by which they bind hyaluronan (link module versus B(X)7B motif).
CD44 is a class I transmembrane glycoprotein that participates in cell-cell and cell-matrix adhesions. It is encoded by a single, highly conserved gene that consists of
10 "standard" exons and 10 "variable" exons (Naor et al. 1997). The standard form of
CD44 (CD44std), which is the smallest (85kDa) and most widely expressed CD44 isoform, consists of a large extracellular domain, a transmembrane domain, and a short cytoplasmic domain (Figure 1.4A). However, CD44 describes a large, polymorphic family of cell surface receptors that range in size from 85-200kDa (Naor et al. 1997).
Diversity in this protein is achieved, in part, by alternative splicing of the 10 variable exons (CD44v isoforms), resulting in the insertion of various exons into the membrane- proximal region of the extracellular domain (Naor et al. 1997) (Figure 1.4A). In addition to alternative splicing, CD44 protein isoforms are extensively post-translationally modified (including phosphorylation and glycosylation); this is known to affect ligand binding of CD44, thus contributing to the functional diversity of CD44 isoforms (Naor et al. 1997) (Figure 1.4A). In addition to functioning as a membrane-bound cell surface receptor, proteolytic cleavage of CD44 can generate soluble intracellular and extracellular or matrix-bound proteins that have been shown to modulate gene expression and cellular behaviour (Cichy and Pure 2003). Figure 1.4. Rhamm and CD44. A.) CD44 is a class I transmembrane glycoprotein that is encoded by a single gene consisting of 10 "standard" exons and 10 "variable" exons. The standard form of CD44 (CD44std) is the smallest CD44 isoform (85kDa) and consists of a large extracellular domain (which contains the hyaluronan binding link module), a transmembrane domain, and a short cytoplasmic domain. CD44 isoform diversity is achieved, in part, by alternative splicing of the 10 variable exons (CD44v isoforms), resulting in the insertion of various exons into the membrane-proximal region of the extracellular domain. CD44 protein isoforms are also extensively post-translationally modified including phosphorylation (pink circles) and glycosylation (blue circles). B.)
Rhamm is an extensively coiled-coil protein with a basic amino-terminal globular head and a hyaluronan-binding domain [B(X)7BmotifJ in its extreme C-terminus. Rhamm occurs as multiple protein isoforms characterized by multiple molecular weights, some of which are generated by alternative splicing of a single full-length transcript.
Additionally, there are multiple N-terminal truncated isoforms. A. CD44 Variant Exons v1 v2 v4 v4 v5 v6 v7 v7 Extracellular Space v8 v9 v10
Cytosol
B. RHAMM
HA Binding Domain
Globular Protain 20
1.4.2 CD44 as a Hyaluronan Signaling Receptor
CD44 participates in both cell-cell and cell-matrix interactions that, in response to ligand binding, can activate and/or regulate a number of different signaling pathways
(Turley et al. 2002). While originally described as the principal cellular hyaluronan receptor (Aruffo et al. 1990), CD44 has since been shown to bind a number of other extracellular ligands including fibronectin (Jalkanen and Jalkanen 1992) and osteopontin
(Weber et al. 1996). While ligands for the variant isoforms are not yet known, there is evidence suggesting that all isoforms are able to bind to hyaluronan (Galluzzo et al. 1995;
Sleeman et al. 1996). Binding of ECM hyaluronan to CD44 affects cell adhesion and regulates aggregation, proliferation, migration, apoptosis and angiogenesis (Bourguignon et al. 1992; Lesley et al. 1993; Lokeshwar et al. 1996; Bourguignon et al. 1998; Ghatak et al. 2002). Direct interaction has been demonstrated between the cytoplasmic tail of
CD44 and various cytoskeletal proteins such as ankyrin (Bourguignon et al. 1998). This suggests that, similar to integrins, CD44 may provide a direct association between the
ECM and the cytoskeleton (Turley et al. 2002).
At the cell surface, CD44 can function in concert with other cell surface receptors such as pl85HER2 (Bourguignon et al. 1997) and Rhamm (Tolg et al. 2006; Hamilton et al.
2007) to regulate signaling and cellular behaviour. For example, hyaluronan mediated association of CD44 with pl85HER2, results in increased tumour cell growth
(Bourguignon et al. 1997). In addition to activating and/or regulating cell signaling by functioning in concert with other cell surface receptors, binding of ECM hyaluronan to
CD44 has also been shown to regulate a number of intracellular kinases, including the 21 tyrosine kinases c-Src (Bourguignon et al. 2001), Lck and Fyn (Bourguignon et al. 1999), as well as GTPases like RhoA (Bourguignon et al. 1999) and Racl (Oliferenko et al.
2000), MAP kinases such as ERK2 (Bourguignon et al. 2005), and Akt (Ghatak et al.
2002). Regulation of these pathways can lead to a number of downstream effects that ultimately modify cellular behaviours.
CD44 has been implicated in the regulation of cytoskeletal dynamics, in particular. For example, CD44:hyaluronan-mediated c-Src activation resulted in increased phosphorylation of the cytoskeletal protein cortactin by c-Src, effectively attenuating the ability of cortactin to crosslink filamentous actin, leading to increased cell migration (Bourguignon et al. 2001). In addition, CD44-regulated RhoA signaling was required for membrane-cytoskeletal interactions and tumour cell migration during breast cancer progression (Bourguignon et al. 1999), and CD44:hyaluronan activation of Racl signaling led to increased membrane ruffling, motility and cellular transformation
(Oliferenko et al. 2000).
While the involvement of CD44 in activating and regulating cell signaling is much more complex than what has been described above, it is clear that through CD44, hyaluronan is able to modify signaling and cellular behaviour via a myriad of pathways.
1.4.3 CD44 and Tumourigenesis
Although CD44 has been reported to play diverse roles in tumourigenesis, the precise contribution of CD44 to tumour progression remains difficult to define. In the past decade, a number of studies have investigated the relevance of CD44 isoforms (both
CD44std and CD44v) as diagnostic or prognostic parameters for human tumours. While
some have shown that elevated CD44 expression correlates with disease progression for 22 specific cancers, equally convincing studies have disputed a role for CD44 in promoting malignancy (Ponta et al. 2003; Gotte and Yip 2006). In both in situ and invasive breast ductal carcinomas, CD44std expression was upregulated (Auvinen et al. 2005) and the increase in expression was correlated to overall patient survival (Berner et al. 2003; Diaz et al. 2005). CD44std is also highly expressed in tubular carcinoma, a form of breast cancer that rarely metastasizes (Gong et al. 2005). In some cancer types, for example neuroblastomas and prostate carconimas, the absence of CD44std and CD44v expression is correlated with transformation and poor prognosis (Shtivelman and Bishop 1991; De
Marzo et al. 1998). Furthermore, CD44 expression was absent on breast metastatic lesions (Shipitsin et al. 2007) and was lost during prostate cancer progression (Kauffman et al. 2003). Consistent with the idea that CD44std is a negative regulator of cancer metastasis, analysis of breast cancer progression in a CD44-/- animal model (where there is an absence of all CD44 protein isoforms) indicated that loss rather than gain of CD44 expression was associated with increased metastasis (Lopez et al. 2005). Furthermore, overexpression of CD44 in rat prostate cancer cells resulted in a reduction of metastasis to the lung (Gao et al. 1997). In contrast to CD44std, the expression of which appears to be inversely correlated with metastasis and survival, expression of other CD44 variants
(in particular CD44v4-v7) has been suggested to positively correlate with cancer progression (Ponta et al. 2003; Gotte and Yip 2006). For example, in breast cancer, expression of CD44v3 significantly correlated with T-lymphocyte infiltration, and metastasis to draining lymph nodes (Rys et al. 2003). Another isoform, CD44v7-v8, was associated with significant decreases in both disease-free and overall survival (Watanabe et al. 2005). Finally, expression of CD44v6 was upregulated in breast carcinomas, 23 although this was not an independent prognostic factor, and did not correlate with clinical outcome (Morris et al. 2001; Auvinen et al. 2005; Diaz et al. 2005; Ma et al. 2005). This link between increased CD44v expression and cancer progression is not limited to breast cancer; in colorectal carcinomas, expression of CD44 variants also predicted poor prognosis (Wielenga et al. 1993; Wielenga et al. 1999). These studies suggest that CD44 is able to act as both a tumour suppressor (Diaz et al. 2005) and a tumour promoter
(Watanabe et al. 2005). This apparent duality of CD44 function in tumourigenesis may result, in part, from differential expression of CD44 isoforms by tumour cell subsets, including progenitors (Balic et al. 2006; Ponti et al. 2006; Sheridan et al. 2006; Shipitsin et al. 2007). Other studies support this idea, for example, CD44v3 has been shown to promote hyaluronan-mediated breast cancer cell invasion, growth and survival
(Bourguignon et al. 2003) while treatment with anti-CD44v3 antibodies blocks tumour cell migration (Bourguignon 2001; Bourguignon et al. 2003). Furthermore, variable exon
3 can be modified by heparin sulfate such that CD44 isoforms containing heparin sulfate modifications could bind to fibroblast growth factor 2 (FGF2), vascular endothelial growth factor (VEGF), and other heparin-containing growth factors and could therefore regulate/promote proliferation, invasion and angiogenesis (Greenfield et al. 1999;
Delehedde et al. 2001).
Aberrant expression of CD44 in most cancers is not due to mutations at the CD44 locus, rather the changes in CD44 expression are a consequence of other genes that have been implicated in promoting carcinogenesis. One key example is the Ras-MAPK
(Mitogen-activated protein kinase) pathway, which has been strongly linked to neoplastic conversion and progression in many different cancers. The MAPK pathway has been 24 shown to regulate both the increased expression and alternative splicing of CD44
(Hofmann et al. 1993; Wittig et al. 2001).
1.5 Rhamm (Receptor for Hyaluronic Acid-Mediated Motility), An Atypical
Hyaladherin
1.5.1 Rhamm: Structure
Rhamm is largely comprised of predicted coiled-coil motifs with a basic amino- terminal globular head and a hyaluronan-binding domain in its extreme C-terminus
(Hardwick et al. 1992) (Figure 1.4B). Unlike CD44, Rhamm binds to hyaluronan via a domain that is rich in basic amino acids, not homologous to a link module, and is loosely described as a B(X)7B motif (Day and Prestwich 2002). The Rhamm hyaluronan binding domain is composed of two coiled-coil B(X)7B motifs that "wrap" around and secure the hyaluronan chain. Similar to CD44, Rhamm occurs as multiple protein isoforms characterized by multiple molecular weights, some of which are generated by alternative splicing (Assmann et al. 1999; Crainie et al. 1999). Additionally, there are multiple N- terminal truncated isoforms that are predominantly overexpressed in cells after wounding, in Ras-transformed cells, and in human tumours (Hall et al. 1995; Assmann et al. 1998; Wang et al. 1998; Adamia et al. 2005). In fact, an N-terminal truncated Rhamm isoform (Rhammonc) was found to be transforming when overexpressed in immortalized fibroblasts, which resulted in tumour formation and spontaneous metastasis to the lung following injection into immunocompromised mice (Hall et al. 1995). 25
Rhamm was originally identified as a soluble protein released from sub-confluent, migrating fibroblasts that associated with the cell surface and promoted cell motility and invasion through interactions with hyaluronan (Hardwick et al. 1992; Turley et al. 2002).
However, unlike CD44 and other integral hyaluronan receptors, Rhamm is an example of a heterogeneous group of cytoplasmic/nuclear proteins that are exported under specifically regulated conditions, and which have distinct functions inside and outside the cell (Radisky et al. 2003; Nickel 2005). This group includes intracellular proteins (e.g. galectinsl-3, bFGFl,2 and epimorphin/syntaxin-2), which lack a signal peptide that would permit export through the golgi-ER (Radisky et al. 2003; Le et al. 2005; Nickel
2005; Nangia-Makker et al. 2007). This growing class of itinerant proteins are exported via unconventional, poorly characterized mechanisms involving, for example, flipases, membrane channels/transporters and exosomes, in response to cellular stresses (Nickel
2005). They can either be released into the extracellular space or can be retained on the cell surface through interactions with other integral surface proteins (Radisky et al. 2003;
Le et al. 2005; Nickel 2005; Nangia-Makker et al. 2007). Interestingly, unconventional export of some of these cytoplasmic proteins occurs specifically during cellular transformation (Radisky et al. 2003; Le et al. 2005; Nickel 2005; Nangia-Makker et al.
2007). For example, export of Rhamm was associated with cellular transformation in multiple myeloma because it was detected on the cell surface of anti-CD40 stimulated multiple myeloma cells but not on the surface of stimulated primary, non-transformed B cells (Turley et al. 1993; Pilarski et al. 1994; Maxwell et al. 2005).
In addition to its localization at the cell surface (where is has been designated
CD 168), Rhamm also localizes to multiple intracellular compartments including the 26 cytoplasm, the nucleus, mitochondria, cytoskeleton (actin and microtubule), mitotic spindle, centrosome, and cell lamellae (Entwistle et al. 1996; Assmann et al. 1999;
Maxwell et al. 2003; Joukov et al. 2006).
Rhamm is commonly overexpressed in many advanced cancers, but is not normally expressed or expressed at very low levels in most normal tissues (Assmann et al. 1998; Wang et al. 1998; Adamia et al. 2005). However, the details of Rhamm's multiple intracellular versus extracellular functions in relation to cancer progression and aggressiveness have not been fully established. Recent studies in Rhamm-/- mice have shown that motility defects in Rhamm-/- fibroblasts were rescued by expression of cell surface Rhamm but not intracellular forms of Rhamm (Tolg et al. 2006). This observation suggests that at least some of the functions regulated by intracellular versus extracellular Rhamm are distinct.
1.5.2 Cell Surface vs. Intracellular Rhamm Functions in Physiology and
Tumourigenesis
Cell surface Rhamm (CD 168) has been detected on subconfluent adherent cells such as fibroblasts and endothelial cells, on non-adherent cells such as B and T lymphocytes, as well as on many tumour cells where it has been extensively documented as a hyaluronan receptor (Pilarski et al. 1994; Gares and Pilarski 2000; Turley et al. 2002;
Maxwell et al. 2005). It is required for random motility of cells in culture in response to serum, scratch wounding, hyaluronan and Platelet Derived Growth Factor (PDGF)
(Hardwick et al. 1992; Turley et al. 2002; Tolg et al. 2006). Cell surface Rhamm was also required for progression through G2/M of the cell cycle (Mohapatra et al. 1996) and 27 for tubule formation during angiogenesis (Savani et al. 2001). Furthermore, the hyaluronan binding ability of Rhamm was required for both PDGF and hyaluronan- mediated activation and/or regulation of signaling cascades including those involving c-
Src, Focal Adhesion Kinase (FAK), Protein Kinase C (PKC), and ERK1,2 (Turley et al.
2002). Cell surface Rhamm also maintained surface display of CD44 (Tolg et al. 2006).
The extracellular functions of Rhamm contributed to normal wound repair (Tolg et al.
2006), as well as to the progression of diseases such as arthritis and tumourigenesis (Hall et al. 1995; Nedvetzki et al. 2004). Furthermore, the carboxyl-terminal hyaluronan binding sequences of Rhamm were required for both Rhammonc- and H-Ras-mediated neoplastic transformation involving signaling with cellular adhesion sites known as focal contacts (Hall et al. 1995; Turley et al. 2002). In fact, the hyaluronan-binding functions of cell surface Rhamm compensated for loss of CD44 and enhanced the motility and invasion of CD44-/- splenocytes in a model of chronic inflammation in vivo, presumably in partnership with other cell surface receptors (Nedvetzki et al. 2004; Naor et al. 2007).
These and other studies establish a link between transformation, tumour progression and the extracellular (hyaluronan binding and signaling compensation) functions of cell surface Rhamm.
Intracellular forms of Rhamm were found to localize to interphase microtubules, mitotic spindles and centrosomes (Assmann et al. 1999; Maxwell et al. 2003; Maxwell et al. 2005). While the first report linking Rhamm to cell cycle progression demonstrated a role for surface Rhamm forms, subsequent reports have also shown that Rhamm expression was cell cycle-regulated (peaking at G2/M), and that intracellular Rhamm functioned as a mitotic spindle protein that was phosphorylated during mitosis (Cho et al. 28
2001; Whitfield et al. 2002; Nousiainen et al. 2006). Intracellular Rhamm has also been reported to participate in mitotic spindle assembly, centrosome integrity and passage through G2/M (Maxwell et al. 2003; Groen et al. 2004). The Xenopus Rhamm ortholog
(XRHAMM) functions in Ran-dependent (chromatin-driven) mitotic spindle assembly through interactions with TPX2 (Targeting Protein for XKLP2; a mitotic spindle organizing protein): Depletion of XRHAMM from Xenopus extracts impaired both anastral spindle assembly and TPX2 localization, which was reversed by active Ran
(Groen et al. 2004). The association between Rhamm and TPX2 has also been observed in human cells (Maxwell et al. 2005). The ability of Rhamm to interact with TPX2, as well as to target to microtubule (-) ends and the mitotic spindle was mediated by a conserved leucine zipper found in Rhamm's C-terminus (Groen et al. 2004; Maxwell et al. 2005). In addition to TPX2 and y-tubulin, intracellular Rhamm forms also associated with the BRCA1/BARD1 heterodimer; BRCA1 (Breast Cancer Associated Gene 1) and
BARD1 (Breast Cancer Associated RING Domain 1) are structurally related proteins that function to ensure the fidelity of mitosis and mitotic exit (Joukov et al. 2006; Pujana et al.
2007). Specifically, BRCA1/BARD1 regulated anastral spindle assembly by attenuating the excessive mitotic activity of XRHAMM. Alterations in intracellular levels of Rhamm with depletion of BRCA1 resulted in abnormalities in mitotic spindle formation (Joukov et al. 2006). Findings from this study imply that loss of BRCA1/BARD1 activity, which may occur in inherited forms of breast and ovarian cancers, combined with subsequent increases in Rhamm expression, commonly observed in advanced cancers, may fuel tumour progression by promoting genomic instability (Joukov et al. 2006). Indeed,
Rhamm hyperexpression correlated with poor prognosis, elevated centrosome volumes 29 and cytogenetic alterations in some cancers (e.g. multiple myeloma) (Maxwell et al.
2005).
Collectively, these studies suggest that Rhamm is an important human oncoprotein that can promote neoplastic initiation and progression by multiple mechanisms at multiple cellular locations. The factors that provide evidence that Rhamm is an oncogene include: intracellular regulation of mitotic spindle assembly (promoting genomic instability) (Maxwell et al. 2003; Groen et al. 2004; Joukov et al. 2006; Pujana et al. 2007) and extracellular activation of Ras-regulated signaling (promoting transformation and motogenic/invasive functions) (Hall et al. 1995). Furthermore, this functional link between Rhamm and BRCA1, a factor in hereditary forms of breast cancer (Joukov et al. 2006; Pujana et al. 2007), and the identification of Rhamm polymorphisms that predicts breast cancer susceptibility (Pujana et al. 2007), as well as evidence that hyperexpression of Rhamm predicts poor clinical outcome and increased risk of sporadic breast cancer metastasis (Turley et al. 2002), suggest that Rhamm may be influential in both inherited and non-inherited forms of breast cancer.
1.6 Ras and MAP Kinase Signaling in Cancer
1.6.1 Hyperactive Ras in Cancer
Ras proteins are small (21kDa; also referred to as p21) GTPases that cycle between inactive guanosine diphosphate (GDP)-bound (Ras-GDP) and active guanosine triphosphate (GTP)-bound (Ras-GTP) conformations (Donovan et al. 2002; Schubbert et al. 2007). They act as signal switch molecules that regulate cell fates by coupling cell 30 surface receptor activation to downstream effector pathways to control diverse cellular responses including proliferation, differentiation, motility and survival (Bourne et al.
1990; Schubbert et al. 2007). Four structurally and functionally homologous Ras isoforms have been described and include H (Harvey)-Ras, N (neural)-Ras and K
(Kirsten)-RasA and K-RasB (Downward 2003; Sebolt-Leopold and Herrera 2004;
Schubbert et al. 2007). These isoforms are expressed in a tissue specific manner and show subtle structural differences though they are biologically very similar (Schubbert et al. 2007). Activating somatic mutations in the Ras genes and mutations that aberrantly activate Ras regulators and effectors are common events in tumour development and progression (Schubbert et al. 2007).
Ras, whose transformation-promoting activity was first described in 1982, was the first human oncogene to be described and activating mutations in Ras have since been identified in approximately 30% of all human cancers (Schubbert et al. 2007).
Oncogenic Ras usually contains somatic missense mutations in codons 12,13 or 61 of the
Ras gene (Schubbert et al. 2007). These mutations effectively impair the intrinsic
GTPase activity of Ras and inhibit the effects of RasGAPs (GTPase activating proteins), leading to an accumulation of active Ras-GTP complexes (Dhillon et al. 2007).
Mutations in specific Ras genes occur in different malignancies: K-Ras mutations are common in pancreatic, colorectal, lung, cervical and endometrial cancers, as well as in myeloid malignancies, while N-Ras mutations occur frequently in melanoma and myeloid malignancies and H-Ras mutations in bladder carcinomas (Dhillon et al. 2007).
Ras proteins regulate cellular responses to many extracellular stimuli including soluble growth factors and the ECM (Figure 1.5). Activation of cell surface receptors Figure 1.5. Ras Signaling. Ras proteins (p21), which are activated by receptor tyrosine kinases upon binding of various soluble growth factors, are small GTPases that cycle between inactive GDP-bound (Ras-GDP) and active GTP-bound (Ras-GTP) conformations. Activation of cell surface receptors creates intracellular docking sites for adapter molecules and signal-relay proteins (e.g. Grb2, Gab, She, and Shp2) that recruit and activate guanine nucleotide exchanges factors (GEFs; e.g. SOS), which stimulate the dissociation of guanine nucleotides from Ras thereby allowing passive binding of GTP, which is abundant in the cytosol. Ras-GTP is now able to efficiently interact with a variety of downstream effectors, including Raf-1 and PI 3-kinase. Ras-GTP signaling is terminated when the bound GTP is hydrolyzed to GDP. GTPase activating proteins
(GAPs; e.g. pl20 and NF1) negatively regulate Ras by enhancing the intrinsic GTP hydrolysis activity of Ras. Once activated, Ras effector pathways can regulate and control diverse cellular responses including proliferation, differentiation, motility and survival. Figure modified from (Schubbert et al. 2007). 32
Other effectors T Ras Effector Pathways
RALGDS TIAM1 PI3-K PLC RGL, RGL2 1 1 i 1 1 Rac PDK1 Ral PKC 1 1 I + Akt ^|IJ| PLD 1 1 1 Cytoskeletal Survival Proliferation Vesicle Calcium organization Motility/lnvasion trafficking signalling 33 creates intracellular docking sites for adapter molecules and signal-relay proteins that recruit and activate guanine nucleotide exchanges factors (GEFs), which includes members of the SOS (Son of Sevenless) family (Schubbert et al. 2007) (Figure 1.5).
GEFs stimulate the dissociation of guanine nucleotides from Ras thereby allowing passive binding of GTP, which is abundant in the cytosol. Ras-GTP is now able to efficiently interact with a variety of downstream effectors, including Raf-1 and PI 3- kinase (Repasky et al. 2004; Mitin et al. 2005; Schubbert et al. 2007) (Figure 1.5). Ras-
GTP signaling is terminated when the bound GTP is hydrolyzed to GDP. GTPase activating proteins [including pl20GAP and NF1 (neurofibromin)] negatively regulate
Ras by enhancing the intrinsic GTP hydrolysis activity of Ras (Repasky et al. 2004;
Schubbert et al. 2007).
Active Ras regulates a complex signaling network to modulate different cellular programs by binding to and activating a variety of downstream effector proteins, the best characterized of which is the Raf-MEK-ERK cascade (Repasky et al. 2004; Schubbert et al. 2007) (Figure 1.5).
1.6.2 The Raf-MEK-ERK Cascade
Mitogen Activated Protein kinases (MAPK) are members of a conserved and dynamic kinase network that link extracellular signals to intracellular machinery to regulate diverse cellular programs including proliferation, survival and differentiation
(Cuevas et al. 2007; Dhillon et al. 2007). MAPK signaling cascades are comprised of a three-tier kinase module in which the MAPK are activated upon phosphorylation by a mitogen activated protein kinase kinase (MAPKK or MKK), which, in turn, are activated 34 when phosphorylated by a MAPKKK (MKKK) (Cuevas et al. 2007). To date, at least 20
MAPKKK have been identified in vertebrates that can selectively activate different combinations of the seven different known MAPKK's, resulting in the specific activation of MAPK family members (Cuevas et al. 2007). There are six mammalian MAPK families including ERK1,2, ERK3,4, ERK5, ERK7,8, JNK1,2,3, and the p38 isoforms
(«//?/XERK6)/<5) (Cuevas et al. 2007). In general, the ERK1,2 pathway is activated by growth factor-stimulated cell surface receptors, whereas others are activated in response to stress in addition to growth factors (Cuevas et al. 2007; Schubbert et al. 2007). While aberrant regulation of any of the MAPK pathways can contribute to various pathological conditions, deregulation of the ERK1,2-MAPK pathway has been specifically linked to tumourigenesis (Cuevas et al. 2007; Dhillon et al. 2007; Schubbert et al. 2007).
The MAPK-ERK cascade is a well-studied Ras effector pathway that, depending on the cell type or stimulus used, has been implicated in the regulation of proliferation, differentiation, and survival, as well as migration and invasion (Cuevas et al. 2007;
Dhillon et al. 2007; Schubbert et al. 2007) (Figure 1.5). Upon activation by extracellular factors, Ras recruits the Raf serine/threonine kinases (B-Raf, A-Raf, and Raf-1;
MAPKKK) to the inner cell membrane from the cytosol where it is activated (Cuevas et
al. 2007; Dhillon et al. 2007; Schubbert et al. 2007). Activated Raf then binds to and
activates the dual specificity kinase MEK (MAPKK), which goes on to activate the
MAPK ERK. Activated ERK1,2 proteins can translocate to the nucleus, where they phosphorylate and regulate various transcription factors including the Ets (e.g. Elkl) and
AP-1 (e.g. c-fos) transcription factor families, ultimately leading to changes in gene
transcription (Yoon and Seger 2006; Cuevas et al. 2007). While the majority of ERK 35 substrates are nuclear proteins, they also include a growing number of cytosolic proteins, as well as those found in other organelles (Yoon and Seger 2006). In fact, it was recently estimated that activated ERK MAPKs are able to phosphorylate and regulate a growing array of substrates that include at least 160 different proteins (Yoon and Seger 2006), including transcription factors (nuclear substrates) and cytoskeletal proteins (cytosolic substrates).
While the Raf-MEK-ERK cascade is frequently drawn as a simple, linear and unidirectional cascade of protein kinases that connect the extracellular environment to the nucleus, it is clear that this pathway is much more complex. A more accurate depiction would be one in which this cascade is the core element of a complex signaling network that involves many additional proteins that can contribute to the regulation and propagation of external, as well as internal signals. One example outlining this complexity is the activation and/or regulation of Raf (Galabova-Kovacs et al. 2006).
While Ras is clearly the major activator of Raf function, additional signaling events [e.g. phosphorylation by PAK (p21 Activated Kinase) and Src and/or dephosphorylation by protein phosphatase 2A (PP2A)] are also required for complete activation of Ras kinase activities (Dhillon et al. 2007). Raf function is further regulated via interactions with other proteins such as the 14-3-3 adapter protein or the cdc37 (cell cycle division 37) and/or hsp90 (heat shock protein 90) chaperones (Hunter and Poon 1997; Tzivion et al.
1998; Leicht et al. 2007) (Figure 1.6). An additional layer of regulation of this cascade involves scaffolding or adapter proteins that help to regulate the activity, specificity, and the spatial and temporal regulation of MEK-ERK (Figure 1.6). These include the kinase suppressor of Ras (KSR), MEK partner-1 (MP-1), P-arrestins, and IQ motif-containing Figure 1.6. Regulation of ERK MAPK Signaling by Adapters, Scaffolds and Inhibitors.
The Ras-ERK1,2 MAP kinase cascade is part of a complex signaling network that is regulated, in part, by an array of functionally diverse proteins that act as scaffolding and/or adapter proteins {e.g. KSR, Sef, IQGAP, and Sef), as well as pathway inhibiting proteins {e.g. RKIP). In particular, Raf-1 is regulated by an array of positive and negative signal inputs. Scaffolding/adapter proteins bind to distinct subsets of pathway components to create unique ERK-MAPK signaling complexes at specific subcellular compartments where they will have preferential access to the appropriate ERK substrate for the signal input. In this way, cells are able to regulate specific signals inputs to generate specific signal outputs in distinct spatio-temporal patters. This figure is modified from (Roberts and Der 2007). 37
Cvtoskeletal Membrane Cvtosolic Nucleus •Paxillin •Syk •RSK •AP-1 (fos) •Neurofilaments •CD120a •Elk1 •microtubules •Calnexin •Myc •STAT3
Sub-cellular Scaffolds
Late Golgi Actin Endosomes
IQGAP1 MP1 38
GTPase activating protein a (IQGAP1) (Kolch 2005) (Figure 1.6). Several inhibitors of this pathway have also been identified including Raf Kinase Inhibitor Protein (RKIP), which can disrupt either the Raf-MEK complex or the formation of the Raf-KSR-MEK complex (Kolch 2005) (Figure 1.6).
1.6.3 Targeting the Raf-MEK-ERK Protein Kinase Cascade for the
Treatment of Cancer
Aberrant regulation of the Ras-Raf-MEK-ERK1,2-MAPK pathway has been strongly linked to both cellular transformation and tumour progression, making it an attractive target for drug discovery for treatment of cancer. The involvement of other
MAPKs (other ERKs, p38 and JNK) in tumourigenesis is less clearly established
(Roberts and Der 2007). Most mutations that lead to constitutively high levels of active
ERK1,2 occur early on in the pathway, including activating mutations and/or overexpression of receptor tyrosine kinases, sustained autocrine or paracrine production of activating extracellular ligands, as well as mutational activation of Ras or Raf
(Galabova-Kovacs et al. 2006; Dhillon et al. 2007; Schubbert et al. 2007). However, deregulation of downstream effectors in the pathway may also be oncogenic. For example, overexpression of constitutively activated forms of MEK1,2 or ERK1,2 in cells can produce a transformed phenotype (Dhillon et al. 2007; Roberts and Der 2007). There is substantial experimental evidence demonstrating the necessity of MEK1,2 and ERK1,2 in Ras and iJq/^mediated transformation, and for other oncogenic functions of cells
(Dhillon et al. 2007; Roberts and Der 2007). Furthermore, amplification and deregulation of nuclear transcription factor targets of ERK1,2, including myc and activator protein-1 (AP-1), have also been reported. 39
Each kinase in the Ras-Raf-MEK-ERK1,2 pathway offers a unique opportunity for development of specific inhibitors. To date, several Ras, Raf and MEK targeted kinase inhibitors have been developed for the treatment of a variety of pathologies, including cancers, which have met with some success in animal models and early clinical trials. These include for example, the Raf-1 inhibitor, BAY43-9006, which exhibits broad-spectrum anti-tumour effects in xenograft models of colon, pancreas, breast, and non-small cell lung carcinomas with mutations in B-Raf or K-Ras (Kohno and
Pouyssegur 2006). The anti-tumour efficacy was associated with significant reductions in proliferation and angiogenesis (Kohno and Pouyssegur 2006). This Raf inhibitor is now undergoing clinical evaluation and Phase I trials have shown it to be well tolerated by patients at doses that effectively inhibit ERK1,2 activation. It is now in Phase II/III clinical trials for the treatment of a variety of cancers including melanoma, colorectal, renal-cell, and hepatocellular carcinomas (Kohno and Pouyssegur 2006). However, the diverse and differential regulatory mechanisms at each level of the Ras-Raf-MEK-ERKl,
2 cascade suggest alternate approaches for antagonizing this signaling pathway (Roberts and Der 2007). It is therefore important to understand precisely how the Ras-Raf-MEK-
ERKl, 2 pathway is regulated under normal physiological conditions, and how it is deregulated during different stages of tumourigenesis.
1.7 Hypothesis and Thesis Organization
The work presented in this thesis was performed to gain a better understanding of the role of intracellular and cell surface Rhamm protein forms in regulating and/or promoting neoplastic initiation and progression. Specifically, it examines the regulation 40 of MAP kinase signaling by hyaluronan, Rhamm and CD44. I hypothesize that oncogenic Rhamm isoforms promote fibroblast transformation and neoplastic progression through the modulation and/or activation of MAP kinase (Ras-
MEK1,2-ERK1,2) signaling.
The objectives of this project were the following:
(1.) Determine the mechanism(s) through which cell surface and/or intracellular Rhamm regulate ERK1,2 signaling.
(2.) Determine whether oncogenic Rhamm (Rhammonc) isoforms act through the MAP kinase pathway (specifically, Ras-MEK1,2-ERK1,2) to promote fibroblast transformation.
(3.) Determine the downstream functions of ERK1,2 in Rhammonc overexpressing cells, which are relevant to cellular transformation and/or neoplastic progression. These experimental objectives are described in more detail in Chapters 2 and 3.
Chapter 2 focuses on the role of cell surface Rhamm as a co-receptor for CD44.
Together, cell surface Rhamm and CD44 promote ERKl,2-regulated migration of aggressive breast cancer cell lines. This work illustrates how Rhamm hyperexpression, that is only seen in the aggressive breast cancer cell lines, promotes constitutive ERK1,2 activation, which subsequently leads to increased motogenic signaling.
Stromal functions during tumour progression are of particular interest to me, and since Rhamm transforms in fibroblasts, I went on to identify the transformation pathways regulated by Rhamm overexpression in fibroblasts. This work is outlined in Chapter 3. I 41 found that intracellular Rhamm proteins act at the level of MEK1,2-ERK1,2 and Rhamm acts upstream of Ras (intracellular and/or cell surface Rhamm). Both were collectively required for Rhamm-mediated transformation. Specifically, Rhamm protein expression promotes activation and nuclear localization of ERK1,2. This results in ERK1,2 dependent activation of AP-1 and consequent alterations in gene expression, as assessed by microarray analyses. Genes that regulate all stages of neoplastic initiation and progression (classified in this thesis according to Hanahan and Weinberg's six Hallmarks of Cancer, as well as regulation of genomic stability) were altered in Rhammonc overexpressing cells.
Collectively, these chapters demonstrate that cell surface Rhamm cooperates with
CD44 to promote ERKl,2-mediated migration of aggressive breast cancer cells and that intracellular Rhamm can contribute to Ras-regulated transformation pathways, which has not previously been shown. These studies better our understanding of the complex role of Rhamm in tumourigenesis and may lead to the development of better therapies for the treatment and management of cancer.
1.8 References
Adamia, S., Maxwell, C. A. and Pilarski, L. M. 2005. Hyaluronan and hyaluronan synthases: potential therapeutic targets in cancer. Curr Drug Targets Cardiovasc Haematol Disord. 5, 3-14.
Aruffo, A., Stamenkovic, I., Melnick, M., Underhill, C. B. and Seed, B. 1990. CD44 is the principal cell surface receptor for hyaluronate. Cell. 61, 1303-13.
Assmann, V., Jenkinson, D., Marshall, J. F. and Hart, I. R. 1999. The intracellular hyaluronan receptor RHAMM/IHABP interacts with microtubules and actin filaments. J Cell Sci. 112 ( Pt 22), 3943-54. 42
Assmann, V., Marshall, J. R, Fieber, C, Hofmann, M. and Hart, I. R. 1998. The human hyaluronan receptor RHAMM is expressed as an intracellular protein in breast cancer cells. J Cell Sci. Ill (Pt 12), 1685-94.
Auvinen, R, Tammi, R., Parkkinen, J., Tammi, M., Agren, U., Johansson, R., Hirvikoski, R, Eskelinen, M. and Kosma, V. M. 2000. Hyaluronan in peritumoral stroma and malignant cells associates with breast cancer spreading and predicts survival. Am J Pathol. 156, 529-36.
Auvinen, R, Tammi, R., Tammi, M., Johansson, R. and Kosma, V. M. 2005. Expression of CD 44 s, CD 44 v 3 and CD 44 v 6 in benign and malignant breast lesions: correlation and colocalization with hyaluronan. Histopathology. 47, 420-8.
Balic, M., Lin, H., Young, L., Hawes, D., Giuliano, A., McNamara, G, Datar, R. H. and Cote, R. J. 2006. Most early disseminated cancer cells detected in bone marrow of breast cancer patients have a putative breast cancer stem cell phenotype. Clin Cancer Res. 12, 5615-21.
Berner, H. S., Suo, Z., Risberg, B., Villman, K., Karlsson, M. G. and Nesland, J. M. 2003. Clinicopathological associations of CD44 mRNA and protein expression in primary breast carcinomas. Histopathology. 42, 546-54.
Bissell, M. J. and Radisky, D. 2001. Putting tumours in context. Nat Rev Cancer. 1, 46- 54.
Bourguignon, L. Y. 2001. CD44-mediated oncogenic signaling and cytoskeleton activation during mammary tumor progression. J Mammary Gland Biol Neoplasia. 6, 287-97.
Bourguignon, L. Y, Gilad, E., Rothman, K. and Peyrollier, K. 2005. Hyaluronan-CD44 interaction with IQGAP1 promotes Cdc42 and ERK signaling, leading to actin binding, Elk-1/estrogen receptor transcriptional activation, and ovarian cancer progression. J Biol Chem. 280,11961-72.
Bourguignon, L. Y, Lokeshwar, V. B., He, J., Chen, X. and Bourguignon, G. J. 1992. A CD44-like endothelial cell transmembrane glycoprotein (GP116) interacts with extracellular matrix and ankyrin. Mol Cell Biol. 12, 4464-71.
Bourguignon, L. Y, Singleton, P. A., Zhu, H. and Diedrich, R 2003. Hyaluronan- mediated CD44 interaction with RhoGEF and Rho kinase promotes Grb2- 43
associated binder-1 phosphorylation and phosphatidylinositol 3-kinase signaling leading to cytokine (macrophage-colony stimulating factor) production and breast tumor progression. J Biol Chem. 278, 29420-34.
Bourguignon, L. Y, Zhu, D. and Zhu, H. 1998. CD44 isoform-cytoskeleton interaction in oncogenic signaling and tumor progression. Front Biosci. 3, d637-49.
Bourguignon, L. Y., Zhu, H., Chu, A., Iida, N., Zhang, L. and Hung, M. C. 1997. Interaction between the adhesion receptor, CD44, and the oncogene product, pl85HER2, promotes human ovarian tumor cell activation. J Biol Chem. 272, 27913-8.
Bourguignon, L. Y, Zhu, H., Shao, L. and Chen, Y W. 2001. CD44 interaction with c-Src kinase promotes cortactin-mediated cytoskeleton function and hyaluronic acid- dependent ovarian tumor cell migration. J Biol Chem. 276, 7327-36.
Bourguignon, L. Y, Zhu, H., Shao, L., Zhu, D. and Chen, Y W. 1999. Rho-kinase (ROK) promotes CD44v(3,8-10)-ankyrin interaction and tumor cell migration in metastatic breast cancer cells. Cell Motil Cytoskeleton. 43, 269-87.
Bourne, H. R., Sanders, D. A. and McCormick, F. 1990. The GTPase superfamily: a conserved switch for diverse cell functions. Nature. 348, 125-32.
Cho, R. J., Huang, M., Campbell, M. J., Dong, H., Steinmetz, L., Sapinoso, L., Hampton, G, Elledge, S. J., Davis, R. W. and Lockhart, D. J. 2001. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, 48-54.
Cichy, J. and Pure, E. 2003. The liberation of CD44. J Cell Biol. 161, 839-43.
Crainie, M., Belch, A. R., Mant, M. J. and Pilarski, L. M. 1999. Overexpression of the receptor for hyaluronan-mediated motility (RHAMM) characterizes the malignant clone in multiple myeloma: identification of three distinct RHAMM variants. Blood. 93, 1684-96.
Csoka, A. B., Frost, G I. and Stern, R. 2001. The six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol. 20, 499-508.
Cuevas, B. D., Abell, A. N. and Johnson, G L. 2007. Role of mitogen-activated protein kinase kinase kinases in signal integration. Oncogene. 26, 3159-71. 44
Day, A. J. and Prestwich, G. D. 2002. Hyaluronan-binding proteins: tying up the giant. J Biol Chem. 277, 4585-8.
De Marzo, A. M., Bradshaw, C, Sauvageot, J., Epstein, J. I. and Miller, G. J. 1998. CD44 and CD44v6 downregulation in clinical prostatic carcinoma: relation to Gleason grade and cytoarchitecture. Prostate. 34, 162-8.
DeAngelis, P. L. 1999. Hyaluronan synthases: fascinating glycosyltransferases from vertebrates, bacterial pathogens, and algal viruses. Cell Mol Life Sci. 56, 670-82.
Deguine, V., Menasche, M., Ferrari, P., Fraisse, L., Pouliquen, Y. and Robert, L. 1998. Free radical depolymerization of hyaluronan by Maillard reaction products: role in liquefaction of aging vitreous. Int J Biol Macromol. 22, 17-22.
Delehedde, M., Lyon, M, Sergeant, N., Rahmoune, H. and Fernig, D. G. 2001. Proteoglycans: pericellular and cell surface multireceptors that integrate external stimuli in the mammary gland. J Mammary Gland Biol Neoplasia. 6, 253-73.
Dhillon, A. S., Hagan, S., Rath, O. and Kolch, W. 2007. MAP kinase signalling pathways in cancer. Oncogene. 26, 3279-90.
Diaz, L. K., Zhou, X., Wright, E. T., Cristofanilli, M., Smith, T., Yang, Y, Sneige, N., Sahin, A. and Gilcrease, M. Z. 2005. CD44 expression is associated with increased survival in node-negative invasive breast carcinoma. Clin Cancer Res. 11, 3309-14.
Donovan, S., Shannon, K. M. and Bollag, G 2002. GTPase activating proteins: critical regulators of intracellular signaling. Biochim Biophys Acta. 1602, 23-45.
Downward, J. 2003. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer. 3, 11-22.
Draffin, J. E., McFarlane, S., Hill, A., Johnston, P. G. and Waugh, D. J. 2004. CD44 potentiates the adherence of metastatic prostate and breast cancer cells to bone marrow endothelial cells. Cancer Res. 64, 5702-11.
Entwistle, J., Hall, C. L. and Turley, E. A. 1996. HA receptors: regulators of signalling to the cytoskeleton. J Cell Biochem. 61, 569-77. 45
Fraser, J. R., Laurent, T. C. and Laurent, U. B. 1997. Hyaluronan: its nature, distribution, functions and turnover. J Intern Med. 242, 27-33.
Galabova-Kovacs, G, Kolbus, A., Matzen, D., Meissl, K., Piazzolla, D., Rubiolo, C, Steinitz, K. and Baccarini, M. 2006. ERK and beyond: insights from B-Raf and Raf-1 conditional knockouts. Cell Cycle. 5, 1514-8.
Galluzzo, E., Albi, N., Fiorucci, S., Merigiola, C, Ruggeri, L., Tosti, A., Grossi, C. E. and Velardi, A. 1995. Involvement of CD44 variant isoforms in hyaluronate adhesion by human activated T cells. Eur J Immunol. 25, 2932-9.
Gao, A. C, Lou, W., Dong, J. T. and Isaacs, J. T. 1997. CD44 is a metastasis suppressor gene for prostatic cancer located on human chromosome 1 lpl3. Cancer Res. 57, 846-9.
Gares, S. L. and Pilarski, L. M. 2000. Balancing thymocyte adhesion and motility: a functional linkage between betal integrins and the motility receptor RHAMM. Dev Immunol. 7,209-25.
Ghatak, S., Misra, S. and Toole, B. R 2002. Hyaluronan oligosaccharides inhibit anchorage-independent growth of tumor cells by suppressing the phosphoinositide 3-kinase/Akt cell survival pathway. J Biol Chem. 277, 38013-20.
Gong, Y., Sun, X., Huo, L., Wiley, E. L. and Rao, M. S. 2005. Expression of cell adhesion molecules, CD44s and E-cadherin, and microvessel density in invasive micropapillary carcinoma of the breast. Histopathology. 46, 24-30.
Gotte, M. and Yip, G W. 2006. Heparanase, hyaluronan, and CD44 in cancers: a breast carcinoma perspective. Cancer Res. 66, 10233-7.
Greenfield, B., Wang, W. C, Marquardt, H., Piepkorn, M., Wolff, E. A., Aruffo, A. and Bennett, K. L. 1999. Characterization of the heparan sulfate and chondroitin sulfate assembly sites in CD44. J Biol Chem. 21 A, 2511-7.
Groen, A. C, Cameron, L. A., Coughlin, M., Miyamoto, D. T., Mitchison, T. J. and Ohi, R. 2004. XRHAMM functions in ran-dependent microtubule nucleation and pole formation during anastral spindle assembly. Curr Biol. 14, 1801-11. 46
Hall, C. L., Yang, B., Yang, X., Zhang, S., Turley, M., Samuel, S., Lange, L. A., Wang, C, Curpen, G. D., Savani, R. C, et al. 1995. Overexpression of the hyaluronan receptor RHAMM is transforming and is also required for H-ras transformation. Cell. 82,19-26.
Hamilton, S. R., Fard, S. R, Paiwand, F. F., Tolg, C, Veiseh, M., Wang, C, McCarthy, J. B., Bissell, M. J., Koropatnick, J. and Turley, E. A. 2007. The hyaluronan receptors CD44 and Rhamm (CD 168) form complexes with ERK1,2 that sustain high basal motility in breast cancer cells. J Biol Chem. 282,16667-80.
Hanahan, D. and Weinberg, R. A. 2000. The hallmarks of cancer. Cell. 100, 57-70.
Hardwick, C, Hoare, K., Owens, R., Hohn, H. R, Hook, M., Moore, D., Cripps, V., Austen, L., Nance, D. M. and Turley, E. A. 1992. Molecular cloning of a novel hyaluronan receptor that mediates tumor cell motility. J Cell Biol. 117, 1343-50.
Hofmann, M., Rudy, W, Gunthert, U., Zimmer, S. G, Zawadzki, V., Zoller, M., Lichtner, R. B., Herrlich, R and Ponta, H. 1993. A link between ras and metastatic behavior of tumor cells: ras induces CD44 promoter activity and leads to low-level expression of metastasis-specific variants of CD44 in CREF cells. Cancer Res. 53, 1516-21.
Hunter, T. and Poon, R. Y. 1997. Cdc37: a protein kinase chaperone? Trends Cell Biol. 7, 157-61.
Illmensee, K. and Mintz, B. 1976. Totipotency and normal differentiation of single teratocarcinoma cells cloned by injection into blastocysts. Proc Natl Acad Sci US A. 73, 549-53.
Itano, N. and Kimata, K. 2002. Mammalian hyaluronan synthases. IUBMB Life. 54, 195- 9.
Itano, N., Sawai, T., Miyaishi, O. and Kimata, K. 1999. Relationship between hyaluronan production and metastatic potential of mouse mammary carcinoma cells. Cancer Res. 59, 2499-504.
Jalkanen, S. and Jalkanen, M. 1992. Lymphocyte CD44 binds the COOH-terminal heparin-binding domain of fibronectin. J Cell Biol. 116, 817-25. 47
Joukov, V., Groen, A. C, Prokhorova, T., Gerson, R., White, E., Rodriguez, A., Walter, J. C. and Livingston, D. M. 2006. The BRCA1/BARD1 heterodimer modulates ran- dependent mitotic spindle assembly. Cell. 127, 539-52.
Kauffman, E. C, Robinson, V. L., Stadler, W. M., Sokoloff, M. H. and Rinker-Schaeffer, C. W. 2003. Metastasis suppression: the evolving role of metastasis suppressor genes for regulating cancer cell growth at the secondary site. J Urol. 169, 1122- 33.
Kenny, R A. and Bissell, M. J. 2003. Tumor reversion: correction of malignant behavior by microenvironmental cues. Int J Cancer. 107, 688-95.
Knudson, C. B. 1993. Hyaluronan receptor-directed assembly of chondrocyte pericellular matrix. J Cell Biol. 120, 825-34.
Kohno, M. and Pouyssegur, J. 2006. Targeting the ERK signaling pathway in cancer therapy. Ann Med. 38, 200-11.
Kolch, W. 2005. Coordinating ERK/MAPK signalling through scaffolds and inhibitors. Nat Rev Mol Cell Biol. 6, 827-37.
Kosaki, R., Watanabe, K. and Yamaguchi, Y. 1999. Overproduction of hyaluronan by expression of the hyaluronan synthase Has2 enhances anchorage-independent growth and tumorigenicity. Cancer Res. 59, 1141-5.
Laurent, T. C. and Fraser, J. R. 1992. Hyaluronan. Faseb J. 6, 2397-404.
Le, Q. T., Shi, G, Cao, H., Nelson, D. W, Wang, Y, Chen, E. Y, Zhao, S., Kong, C, Richardson, D., O'Byrne, K. J., et al. 2005. Galectin-1: a link between tumor hypoxia and tumor immune privilege. J Clin Oncol. 23, 8932-41.
Lees, V. C, Fan, T. P. and West, D. C. 1995. Angiogenesis in a delayed revascularization model is accelerated by angiogenic oligosaccharides of hyaluronan. Lab Invest. 73, 259-66.
Leicht, D. T., Balan, V., Kaplun, A., Singh-Gupta, V., Kaplun, L., Dobson, M. and Tzivion, G. 2007. Raf kinases: function, regulation and role in human cancer. Biochim Biophys Acta. \112>, 1196-212. 48
Lesley, J., Hyman, R. and Kincade, P. W. 1993. CD44 and its interaction with extracellular matrix. Adv Immunol. 54, 271-335.
Levitt, N. C. and Hickson, I. D. 2002. Caretaker tumour suppressor genes that defend genome integrity. Trends Mol Med. 8, 179-86.
Li, Y. and Heldin, P. 2001. Hyaluronan production increases the malignant properties of mesothelioma cells. Br J Cancer. 85, 600-7.
Liu, N., Gao, R, Han, Z., Xu, X., Underhill, C. B. and Zhang, L. 2001. Hyaluronan synthase 3 overexpression promotes the growth of TSU prostate cancer cells. Cancer Res. 61, 5207-14.
Lokeshwar, V. B., Iida, N. and Bourguignon, L. Y. 1996. The cell adhesion molecule, GP116, is a new CD44 variant (exl4/vl0) involved in hyaluronic acid binding and endothelial cell proliferation. J Biol Chem. 271, 23853-64.
Lokeshwar, V. B., Rubinowicz, D., Schroeder, G. L., Forgacs, E., Minna, J. D., Block, N. L., Nadji, M. and Lokeshwar, B. L. 2001. Stromal and epithelial expression of tumor markers hyaluronic acid and HYAL1 hyaluronidase in prostate cancer. J Biol Chem. 276,11922-32.
Lopez, J. I., Camenisch, T. D., Stevens, M. V., Sands, B. J., McDonald, J. and Schroeder, J. A. 2005. CD44 attenuates metastatic invasion during breast cancer progression. Cancer Res. 65, 6755-63.
Ma, W., Deng, Y. and Zhou, L. 2005. The prognostic value of adhesion molecule CD44v6 in women with primary breast carcinoma: a clinicopathologic study. Clin Oncol (R Coll Radiol). 17, 258-63.
Maxwell, C. A., Keats, J. J., Belch, A. R., Pilarski, L. M. and Reiman, T. 2005. Receptor for hyaluronan-mediated motility correlates with centrosome abnormalities in multiple myeloma and maintains mitotic integrity. Cancer Res. 65, 850-60.
Maxwell, C. A., Keats, J. J., Crainie, M., Sun, X., Yen, T., Shibuya, E., Hendzel, M., Chan, G. and Pilarski, L. M. 2003. RHAMM is a centrosomal protein that interacts with dynein and maintains spindle pole stability. Mol Biol Cell. 14, 2262-76. 49
Mintz, B. and Illmensee, K. 1975. Normal genetically mosaic mice produced from malignant teratocarcinoma cells. Proc Natl Acad Sci USA. 72, 3585-9.
Mitin, N., Rossman, K. L. and Der, C. J. 2005. Signaling interplay in Ras superfamily function. Curr Biol. 15, R563-74.
Mohapatra, S., Yang, X., Wright, J. A., Turley, E. A. and Greenberg, A. H. 1996. Soluble hyaluronan receptor RHAMM induces mitotic arrest by suppressing Cdc2 and cyclinBl expression. J Exp Me d. 183, 1663-8.
Montesano, R., Kumar, S., Orci, L. and Pepper, M. S. 1996. Synergistic effect of hyaluronan oligosaccharides and vascular endothelial growth factor on angiogenesis in vitro. Lab Invest. 75, 249-62.
Morris, S. R, O'Hanlon, D. M., McLaughlin, R., McHale, T., Connolly, G E. and Given, H. F. 2001. The prognostic significance of CD44s and CD44v6 expression in stage two breast carcinoma: an immunohistochemical study. Eur J Surg Oncol. 27,527-31.
Nangia-Makker, R, Nakahara, S., Hogan, V. and Raz, A. 2007. Galectin-3 in apoptosis, a novel therapeutic target. J Bioenerg Biomembr. 39, 79-84.
Naor, D., Nedvetzki, S., Walmsley, M., Yayon, A., Turley, E. A., Golan, I., Caspi, D., Sebban, L. E., Zick, Y., Garin, T., et al. 2007. CD44 Involvement in Autoimmune Inflammations: The Lesson to be Learned from CD44-Targeting by Antibody or from Knockout Mice. Ann NY Acad Sci. 1110, 233-47.
Naor, D., Sionov, R. V. and Ish-Shalom, D. 1997. CD44: structure, function, and association with the malignant process. Adv Cancer Res. 71, 241-319.
Nedvetzki, S., Gonen, E., Assayag, N., Reich, R., Williams, R. O., Thurmond, R. L., Huang, J. R, Neudecker, B. A., Wang, R S., Turley, E. A., et al. 2004. RHAMM, a receptor for hyaluronan-mediated motility, compensates for CD44 in inflamed CD44-knockout mice: a different interpretation of redundancy. Proc Natl Acad Sci USA. 101, 18081-6.
Nickel, W. 2005. Unconventional secretory routes: direct protein export across the plasma membrane of mammalian cells. Traffic. 6, 607-14. 50
Nishida, Y, Knudson, C. B., Nietfeld, J. J., Margulis, A. and Knudson, W. 1999. Antisense inhibition of hyaluronan synthase-2 in human articular chondrocytes inhibits proteoglycan retention and matrix assembly. J Biol Chem. 274, 21893-9.
Nishida, Y., Knudson, W., Knudson, C. B. and Ishiguro, N. 2005. Antisense inhibition of hyaluronan synthase-2 in human osteosarcoma cells inhibits hyaluronan retention and tumorigenicity. Exp Cell Res. 307, 194-203.
Nousiainen, M., Sillje, H. H., Sauer, G, Nigg, E. A. and Korner, R. 2006. Phosphoproteome analysis of the human mitotic spindle. Proc Natl Acad Sci US ^.103,5391-6.
Oliferenko, S., Kaverina, I., Small, J. V. and Huber, L. A. 2000. Hyaluronic acid (HA) binding to CD44 activates Racl and induces lamellipodia outgrowth. J Cell Biol. 148,1159-64.
Oliveira, A. M., Ross, J. S. and Fletcher, J. A. 2005. Tumor suppressor genes in breast cancer: the gatekeepers and the caretakers. Am J Clin Pathol. 124 Suppl, SI6-28.
Pilarski, L. M., Masellis-Smith, A., Belch, A. R., Yang, B., Savani, R. C. and Turley, E. A. 1994. RHAMM, a receptor for hyaluronan-mediated motility, on normal human lymphocytes, thymocytes and malignant B cells: a mediator in B cell malignancy? Leuk Lymphoma. 14, 363-74.
Ponta, H., Sherman, L. and Herrlich, P. A. 2003. CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol. 4, 33-45.
Ponti, D., Zaffaroni, N., Capelli, C. and Daidone, M. G. 2006. Breast cancer stem cells: an overview. Eur J Cancer. 42, 1219-24.
Prehm, P. 1984. Hyaluronate is synthesized at plasma membranes. Biochem J. 220, 597- 600.
Pujana, M. A., Han, J. D., Starita, L. M., Stevens, K. N., Tewari, M., Ahn, J. S., Rennert, G, Moreno, V., Kirchhoff, T., Gold, B., et al. 2007. Network modeling links breast cancer susceptibility and centrosome dysfunction. Nat Genet.
Radisky, D. C, Hirai, Y and Bissell, M. J. 2003. Delivering the message: epimorphin and mammary epithelial morphogenesis. Trends Cell Biol. 13, 426-34. 51
Radisky, D. C, Kenny, P. A. and Bissell, M. J. 2007. Fibrosis and cancer: do myofibroblasts come also from epithelial cells via EMT? J Cell Biochem. 101, 830-9.
Repasky, G. A., Chenette, E. J. and Der, C. J. 2004. Renewing the conspiracy theory debate: does Raf function alone to mediate Ras oncogenesis? Trends Cell Biol. 14, 639-47.
Roberts, P. J. and Der, C. J. 2007. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 26, 3291-310.
Rys, J., Kruczak, A., Lackowska, B., Jaszcz-Gruchala, A., Brandys, A., Stelmach, A. and Reinfuss, M. 2003. The role of CD44v3 expression in female breast carcinomas. Pol J Pathol. 54,243-7.
Sattar, A., Rooney, P., Kumar, S., Pye, D., West, D. C, Scott, I. and Ledger, P. 1994. Application of angiogenic oligosaccharides of hyaluronan increases blood vessel numbers in rat skin. J Invest Dermatol. 103, 576-9.
Savani, R. C, Cao, G, Pooler, P. M., Zaman, A., Zhou, Z. and DeLisser, H. M. 2001. Differential involvement of the hyaluronan (HA) receptors CD44 and receptor for HA-mediated motility in endothelial cell function and angiogenesis. J Biol Chem. 276, 36770-8.
Schubbert, S., Shannon, K. and Bollag, G. 2007. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer. 7, 295-308.
Sebolt-Leopold, J. S. and Herrera, R. 2004. Targeting the mitogen-activated protein kinase cascade to treat cancer. Nat Rev Cancer. 4, 937-47.
Sheridan, C, Kishimoto, H., Fuchs, R. K., Mehrotra, S., Bhat-Nakshatri, P., Turner, C. H., Goulet, R., Jr., Badve, S. and Nakshatri, H. 2006. CD44+/CD24- breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res. 8, R59.
Shipitsin, M., Campbell, L. L., Argani, P., Weremowicz, S., Bloushtain-Qimron, N., Yao, J., Nikolskaya, T., Serebryiskaya, T., Beroukhim, R., Hu, M., et al. 2007. Molecular definition of breast tumor heterogeneity. Cancer Cell. 11, 259-73. 52
Shtivelman, E. and Bishop, J. M. 1991. Expression of CD44 is repressed in neuroblastoma cells. Mol Cell Biol. 11, 5446-53.
Simpson, M. A., Reiland, J., Burger, S. R., Furcht, L. T., Spicer, A. R, Oegema, T. R., Jr. and McCarthy, J. B. 2001. Hyaluronan synthase elevation in metastatic prostate carcinoma cells correlates with hyaluronan surface retention, a prerequisite for rapid adhesion to bone marrow endothelial cells. J Biol Chem. 276, 17949-57.
Simpson, M. A., Wilson, C. M., Furcht, L. T., Spicer, A. R, Oegema, T. R., Jr. and McCarthy, J. B. 2002. Manipulation of hyaluronan synthase expression in prostate adenocarcinoma cells alters pericellular matrix retention and adhesion to bone marrow endothelial cells. J Biol Chem. 277, 10050-7.
Simpson, M. A., Wilson, C. M. and McCarthy, J. B. 2002. Inhibition of prostate tumor cell hyaluronan synthesis impairs subcutaneous growth and vascularization in immunocompromised mice. Am J Pathol. 161, 849-57.
Sleeman, J., Rudy, W., Hofmann, M., Moll, J., Herrlich, R and Ponta, H. 1996. Regulated clustering of variant CD44 proteins increases their hyaluronate binding capacity. J Cell Biol. 135, 1139-50.
Spicer, A. R, Tien, J. L., Joo, A. and Bowling Jr, R. A. 2002. Investigation of hyaluronan function in the mouse through targeted mutagenesis. Glycoconj J. 19, 341-5.
Stern, R. 2003. Devising a pathway for hyaluronan catabolism: are we there yet? Glycobiology. 13,105R-115R.
Stern, R. 2004. Hyaluronan catabolism: a new metabolic pathway. Eur J Cell Biol. 83, 317-25.
Stern, R., Asari, A. A. and Sugahara, K. N. 2006. Hyaluronan fragments: an information- rich system. Eur J Cell Biol. 85, 699-715.
Sternlicht, M. D., Lochter, A., Sympson, C. J., Huey, B., Rougier, J. R, Gray, J. W., Pinkel, D., Bissell, M. J. and Werb, Z. 1999. The stromal proteinase MMP3/stromelysin-l promotes mammary carcinogenesis. Cell. 98, 137-46.
Tammi, M. I., Day, A. J. and Turley, E. A. 2002. Hyaluronan and homeostasis: a balancing act. J Biol Chem. 277, 4581-4. 53
Tolg, C, Hamilton, S. R., Nakrieko, K. A., Kooshesh, R, Walton, R, McCarthy, J. B., Bissell, M. J. and Turley, E. A. 2006. Rhamm-/- fibroblasts are defective in CD44- mediated ERK1,2 motogenic signaling, leading to defective skin wound repair. J Cell Biol. 175, 1017-28.
Toole, B. P. 2000. Hyaluronan is not just a goo! J Clin Invest. 106, 335-6.
Toole, B. P. 2002. Hyaluronan promotes the malignant phenotype. Glycobiology. 12, 37R-42R.
Toole, B. P. 2004. Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer. 4, 528-39.
Toole, B. P., Wight, T. N. and Tammi, M. I. 2002. Hyaluronan-cell interactions in cancer and vascular disease. J Biol Chem. 211, 4593-6.
Turley, E. A., Belch, A. J., Poppema, S. and Pilarski, L. M. 1993. Expression and function of a receptor for hyaluronan-mediated motility on normal and malignant B lymphocytes. Blood. 81, 446-53.
Turley, E. A., Noble, P. W and Bourguignon, L. Y. 2002. Signaling properties of hyaluronan receptors. J Biol Chem. 277, 4589-92.
Tzivion, G, Luo, Z. and Avruch, J. 1998. Adimeric 14-3-3 protein is an essential cofactor for Raf kinase activity. Nature. 394, 88-92.
Udabage, L., Brownlee, G. R., Nilsson, S. K. and Brown, T. J. 2005. The over-expression of HAS2, Hyal-2 and CD44 is implicated in the invasiveness of breast cancer. Exp Cell Res. 310, 205-17.
Udabage, L., Brownlee, G R., Waltham, M., Blick, T., Walker, E. C, Heldin, P., Nilsson, S. K., Thompson, E. W. and Brown, T. J. 2005. Antisense-mediated suppression of hyaluronan synthase 2 inhibits the tumorigenesis and progression of breast cancer. Cancer Res. 65, 6139-50.
Wang, C, Thor, A. D., Moore, D. H., 2nd, Zhao, Y., Kerschmann, R., Stern, R., Watson, P. H. and Turley, E. A. 1998. The overexpression of RHAMM, a hyaluronan- binding protein that regulates ras signaling, correlates with overexpression of 54
mitogen-activated protein kinase and is a significant parameter in breast cancer progression. Clin Cancer Res. 4, 567-76.
Wang, R, Hansen, R. K., Radisky, D., Yoneda, T., Barcellos-Hoff, M. H., Petersen, O. W., Turley, E. A. and Bissell, M. J. 2002. Phenotypic reversion or death of cancer cells by altering signaling pathways in three-dimensional contexts. J Natl Cancer Inst. 94, 1494-503.
Watanabe, O., Kinoshita, J., Shimizu, T., Imamura, H., Hirano, A., Okabe, T., Aiba, M. and Ogawa, K. 2005. Expression of a CD44 variant and VEGF-C and the implications for lymphatic metastasis and long-term prognosis of human breast cancer. J Exp Clin Cancer Res. 24, 75-82.
Weber, G. F., Ashkar, S., Glimcher, M. J. and Cantor, H. 1996. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science. 271, 509-12.
Weigel, P. H., Hascall, V. C. and Tammi, M. 1997. Hyaluronan synthases. J Biol Chem. 272, 13997-4000.
West, D. C, Hampson, I. N., Arnold, F. and Kumar, S. 1985. Angiogenesis induced by degradation products of hyaluronic acid. Science. 228, 1324-6.
West, D. C. and Kumar, S. 1989. The effect of hyaluronate and its oligosaccharides on endothelial cell proliferation and monolayer integrity. Exp Cell Res. 183,179-96.
Whitfield, M. L., Sherlock, G, Saldanha, A. J., Murray, J. I., Ball, C. A., Alexander, K. E., Matese, J. C, Perou, C. M, Hurt, M. M, Brown, P. O., et al. 2002. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, 1977-2000.
Wielenga, V. J., Heider, K. H., Offerhaus, G J., Adolf, G R., van den Berg, F. M., Ponta, H., Herrlich, P. and Pals, S. T. 1993. Expression of CD44 variant proteins in human colorectal cancer is related to tumor progression. Cancer Res. 53, 4754-6.
Wielenga, V. J., Smits, R., Korinek, V., Smit, L., Kielman, M., Fodde, R., Clevers, H. and Pals, S. T. 1999. Expression of CD44 in Ape and Tcf mutant mice implies regulation by the WNT pathway. Am J Pathol. 154, 515-23. 55
Wittig, B. M., Goebel, R., Weg-Remers, S., Pistorius, G, Feifel, G., Zeitz, M. and Stallmach, A. 2001. Stage-specific alternative cplicing of CD44 and alpha 6 beta 1 integrin in colorectal tumorigenesis. Exp Mol Pathol. 70, 96-102.
Yamazaki, K., Fukuda, K., Matsukawa, M., Hara, F., Yoshida, K., Akagi, M., Munakata, H. and Hamanishi, C. 2003. Reactive oxygen species depolymerize hyaluronan: involvement of the hydroxyl radical. Pathophysiology. 9, 215-220.
Yoon, S. and Seger, R. 2006. The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors. 24, 21-44.
Zhang, L., Underhill, C. B. and Chen, L. 1995. Hyaluronan on the surface of tumor cells is correlated with metastatic behavior. Cancer Res. 55, 428-33. 56
CHAPTER 2. The Hyaluronan Receptors CD44 AND RHAMM (CD168) Form
Complexes With ERK1,2, Which Sustain High Basal Motility in Breast
Cancer Cells
The content of this chapter has been adapted from the paper entitled "The hyaluronan receptors CD44 and Rhamm (CD 168) form complexes with Erkl,2, which sustain high basal motility in breast cancer cells". This paper was published in The Journal of
Biological Chemistry, vol 282(22): pp. 16667-802007 (2007), by Sara R. Hamilton,
Shireen F. Fard , Frouz F. Paiwand*, Cornelia Tolg*, Mandana Veiseh, Chao Wang, James
B. McCarthy, Mina J. Bissell, James Koropatnick and Eva A. Turley ( authors contributed equally).
2.1 Abstract
CD44 is an integral hyaluronan receptor that can promote or inhibit motogenic signaling in tumour cells. Rhamm is a nonintegral cell surface hyaluronan receptor
(CD168) and intracellular protein that promotes cell motility in culture. Here we describe an autocrine mechanism utilizing cell surface Rhamm-CD44 interactions to sustain rapid basal motility in invasive breast carcinoma cell lines that requires endogenous hyaluronan synthesis and the formation of Rhamm-CD44-ERK1,2 complexes. Motile/invasive MDA-MB-231 and Ras-MCFl 0A cells produce more endogenous hyaluronan, cell surface CD44 and Rhamm, an oncogenic Rhamm isoform, and exhibit more elevated basal activation of ERK1,2 than less invasive MCF7 and
MCF10A breast cancer cells. Furthermore, CD44, Rhamm and ERK1,2 uniquely co- 57 localize in MDA-MB-231 and Ras-MCFIOA cells. Combinations of anti-CD44, anti-
Rhamm antibodies, and a MEK1 inhibitor (PD098059) had less-than-additive blocking effects, suggesting the action of all three proteins on a common motogenic signaling pathway. Collectively, these results show that cell surface Rhamm and CD44 act together in a hyaluronan-dependent autocrine mechanism to coordinate sustained signaling through ERK1,2, leading to high basal motility of invasive breast cancer cells. Therefore, an effect of CD44 on tumour cell motility may depend in part on its ability to partner with additional proteins, such as cell surface Rhamm.
2.2 Introduction
Breast cancer invasion and progression involves a motile cell phenotype, which is under complex regulation by growth factors/cytokines and extracellular matrix (ECM) components within the tumour microenvironment (Entschladen et al. 2004; Eccles 2005).
Motogenic signaling in tumour cells can be stimulated by both paracrine and autocrine factors: the latter decrease the requirement of invasive carcinomas for stromal support and is often associated with tumour progression (Wells 2000; Keen and Davidson 2003;
Navolanic et al. 2003; Muraoka-Cook et al. 2005). Hyaluronan (HA, an anionic polymer of repeating units of glucuronic acid and N-acetylglucosamine) is one stromal ECM component that is associated with breast cancer progression (Tammi et al. 2002; Edward et al. 2005). In culture, HA stimulates breast cancer cell motility (Bourguignon et al.
2002; Tzircotis et al. 2005; Udabage et al. 2005), pointing to a possible important role of this glycosaminoglycan in breast cancer cell invasion in vivo. 58
CD44 is a broadly expressed, type I integral cell surface membrane glycoprotein that participates in cell-cell and cell-matrix adhesions, and in particular binds to HA
(Naor et al. 1997; Naor et al. 2002). It is encoded by a single gene but exists as multiple isoforms that are generated by alternative splicing of 10 variable exons, as well as through post-translational modifications (Naor et al. 1997). The most commonly expressed CD44 isoform (the standard form or CD44std) is an 85kDa protein that contains none of the variable exons. Originally described as the principal cell surface receptor for HA (Aruffo et al. 1990), CD44 has since been shown to bind multiple ligands including fibronectin (Jalkanen and Jalkanen 1992) and osteopontin (Weber et al.
1996), although, in general, the ligands for many of the CD44 variants are not yet known.
However, a role for CD44std as a mediator of HA-promoted motility in breast cancer cell lines is well established on tissue culture plastic {2D cultures) (Tammi et al. 2002; Turley et al. 2002; Toole 2004; Adamia et al. 2005). CD44 isoforms containing variable exons v6 and v9 are also involved in HA-mediated signaling [e.g. in activated T cells (Galluzzo et al. 1995)] and expression of isoforms containing variable exons v4-v7 enhances HA binding of a rat pancreatic adenocarcinoma cell line (Sleeman et al. 1996). These results suggest that in addition to CD44std, at least some variants of CD44 isoforms can bind
HA. CD44 binds to HA via an extracellular domain while the cytoplasmic tail activates intracellular signaling pathways that regulate the association of signaling complexes with the cortical actin cytoskeleton (Bourguignon 2001; Naor et al. 2002; Marhaba and Zoller
2004; Toole 2004).
Evidence suggesting that CD44 has motogenic/invasive functions in 2D cultures motivated numerous histopathological evaluations of CD44 expression in breast cancer. 59
Although several groups report that CD44std expression positively correlates with disease-related survival whereas expression of CD44 variants correlates with poor prognosis (Gotte M and Yip G 2006), other studies contradict these results (Morris et al.
2001; Auvinen et al. 2005; Ma et al. 2005; Rom et al. 2006). Furthermore, analysis of breast cancer progression in a CD44-/- mouse background (where there is an absence of all CD44 isoforms) indicates that loss rather than gain of CD44 expression is associated with increased metastasis (Naor et al. 2002; Auvinen et al. 2005). These observations predict a potential for CD44 to act as both as a tumour progression enhancer and a tumour suppressor [e.g. (Diaz et al. 2005; Watanabe et al. 2005)]. The basis for an association of CD44 with different outcomes in breast cancer patients or in animal models of this disease is not well understood. One possibility is that differential expression/function of CD44 isoforms in tumour cell subsets, including progenitors, may affect clinical outcome (Balic et al. 2006; Ponti et al. 2006; Sheridan et al. 2006).
However, CD44 is also known to associate with, and facilitate, signaling through such tumour cell-associated proteins/receptors as metalloproteinases (MMPs) (Yu et al. 2002;
Thanakit et al. 2005), c-met and EGFR (Florquin and Rouschop 2003; Ponta et al. 2003); therefore, the consequences of CD44 expression to tumour cell behavior and its signaling properties may be modified by proteins it associates with, and vice versa. For example, co-expression of CD44v4 with one of its cell surface binding partners (MMP-9) correlates with node-positivity in breast cancer patients, while the expression of CD44v4 alone does not (Thanakit et al. 2005). Furthermore, hyper-expression of other CD44- binding partners including specific hyaluronan synthases and hyaluronidases (e.g., HAS- 60
2 and hyal-2), together with CD44 (but not CD44 alone) correlate with the degree of invasiveness of human breast cancer cell lines (Udabage et al. 2005).
Cell surface Rhamm (CD 168) is an HA-binding protein/receptor that is not highly expressed in normal tissues but is commonly over-expressed in many advanced cancers
(Turley et al. 2002; Adamia et al. 2005), including breast cancer (Assmann et al. 1998;
Wang et al. 1998). Rhamm was first identified as an HA-dependent motility cell surface receptor that can transform fibroblasts when overexpressed (Hardwick et al. 1992; Hall et al. 1995). Rhamm is also a cytoplasmic and nuclear protein that interacts with interphase microtubules, centrosomes and the mitotic spindle, suggesting that it performs multiple functions in a number of cell compartments (Assmann et al. 1999; Maxwell et al. 2003;
Joukov et al. 2006). Importantly, spindle-associated functions of Rhamm are blocked by the breast/ovarian tumour suppressor gene BRCA1 (Joukov et al. 2006). This functional link between Rhamm and BRCA1, a factor in hereditary forms of breast cancer, as well as evidence that hyper-expression of Rhamm predicts poor clinical outcome and increased risk of sporadic breast cancer metastasis (Wang et al. 1998) suggest it may be influential in both inherited and non-inherited forms of breast cancer. However, the relevance of its multiple intracellular vs. extracellular functions to human breast cancer aggressiveness has not been fully established yet. We recently showed that the motility defects of Rhamm-/- wound fibroblasts could be rescued by soluble recombinant Rhamm protein linked to sepharose beads. Rescue required a concomitant surface display of
CD44 (Tolg et al. 2006) but did not require expression of intracellular Rhamm forms.
These results suggest that at least some of the functions regulated by intracellular vs. extracellular Rhamm are distinct. 61
As a consequence of its ability to bind to HA, cell surface Rhamm activates multiple motogenic signaling pathways that have been implicated in breast cancer progression. These include Ras (Hall et al. 1995), pp60-c-src (Hall et al. 1996) and
ERK1,2 (Wang et al. 1998). Cell surface Rhamm is required for sustained activation and intracellular targeting of ERK1,2 in dermal wound fibroblasts (Tolg et al. 2006) suggesting that the extracellular Rhamm form(s) could potentially function in tumour progression to increase the intensity and duration of signaling pathways associated with tumour invasion/motility. Importantly, cell surface Rhamm can additionally perform motogenic/invasive functions similar to CD44 and can even replace CD44 (Nedvetzki et al. 2004). These observations have raised the possibility that cell surface Rhamm may partner with CD44 to "unleash" its motogenic potential (Nedvetzki et al. 2004; Tolg et al.
2006).
Although cell-autonomous tumour progression events can clearly contribute to the aggressiveness of breast cancer cells, such cells still remain sensitive to some exogenous factors in their microenvironment [for review see (Kenny and Bissell 2003)], including cytokines/growth factors and extracellular matrix components such as HA (Hall et al.
1994; Sohara et al. 2001). Indeed, the accumulation of HA within breast tumours or peritumour stroma is an indicator of poor prognosis in breast cancer patients (Gotte and
Yip 2006). ECM factors such as HA act coordinately with activating mutations in critical signal transduction pathways to modify tumour cell behavior (Wang et al. 2002). ECM- mediated activation of the Ras/Raf/MEK1,2/ERK1,2 cascade (Santen et al. 2002; Reddy et al. 2003; Viala and Pouyssegur 2004) is one motogenic pathway associated with breast tumour progression. Invasive breast cancer cell lines such as MDA-MB-231 have higher basal ERK1,2 activity than less invasive cell lines (including MCF7) and sustained
ERK1,2 activity is required for the increased motility /invasion of the aggressive breast cancer cell lines (Reddy et al. 2003). The molecular mechanisms driving sustained
ERK1,2 activation and the consequent effects on tumour motility/invasion are poorly understood (Pouyssegur et al. 2002; Torii et al. 2004; Torii et al. 2004; Kondoh et al.
2005).
In this study we show that invasive breast cancer cells (MDA-MB-231 and Ras-
MCF10A) sustain elevated levels of ERK.1,2 activation upon growth factor/motogenic stimulation when cell surface CD44 and Rhamm are co-expressed and co-associate with each other. In contrast, less invasive (MCF7) and non-malignant (MCF10A) cell lines express lower levels of either HA receptor at the cell surface despite the fact that Rhamm is expressed as a cytoplasmic protein, and can only transiently activate ERK1,2. We demonstrate also that CD44 and Rhamm co-associate with ERK1,2 as complexes in aggressive breast tumour cell lines. Finally, we show that these CD44/Rhamm/ERK1,2 complexes are required for rapid basal motility of the more invasive cell lines. These results are consistent with a model in which HA, CD44, Rhamm and activated ERK1,2 are physically and functionally linked in a biological complex to establish an autocrine mechanism for promoting motility in breast cancer cells.
2.3 Materials and Methods
2.3.1 Reagents (Antibodies, Growth factors, Hyaluronan and Peptide
Inhibitors) 63
Medical grade HA prepared from bacterial fermentation (provided by Hyal
Pharmaceutical Co., Mississauga, ON) was free of detectable proteins, DNA or
endotoxins. The MW range was 250-300kDa. The following primary antibodies were
obtained commercially or as gifts: ERK1 and non-immune IgG (Santa Cruz); phospho-
ERK1,2 (Cell Signaling); p21Ras (Oncogene Science, Cambridge, MA); CD44 (IM7,
Pharmingen); CD44 (Hermes-3, kind gift of Dr. Sirpa Jalkanen, University of Kuopio,
Finland). Anti-CD44 antibodies used were raised against sequence in CD44std form and therefore detect all CD44 isoforms. Polyclonal Rhamm antibodies used in this study were prepared (Zymed, San Diego, CA) against the following human Rhamm sequences:
Antibody-1 (Ab-1): KSKFSENGNQKN (aal50-162), antibody-2 (Ab-2):
VSIEKEKIDEKS (aa217-229), and antibody-3 (Ab-3): QLRQQDEDFR (aa543-553)
(Zhang et al. 1998; Lynn et al. 2001). Specificity of Rhamm and CD44 antibodies were determined using Rhamm-/- and CD44-/- lysates, respectively, and with Rhamm peptide competition. The following secondary antibodies were purchased: for western blot detection, horseradish peroxidase (HRP)-conjugated anti-mouse (Bio-Rad Laboratories,
Hercules, CA), anti-rabbit (Amersham, Oakville, ON), and anti-rat (Santa Cruz); for immunofluorescence analysis, anti-rabbit Alexa 555 and anti-rat Alexa 433 (Molecular
Probes). The MEK1 inhibitor, PD098059 (2-[2'-amino-3'-methoxyphenyl]- oxanaphthalen-4-one]), was purchased from Calbiochem Biosciences (Mississauga, ON).
An HA binding peptide (YKQKIKHVVKLK), which blocks macrophage migration, was synthesized (Savani et al. 2000). A scrambled peptide, YLKQBCKVKKHIV was used as a control. 64
2.3.2 Cell culture
Human breast carcinoma cell lines MDA-MB-231 and MCF7 were obtained from
American Type Culture Collection (Manassas, VA) and were cultured in Dulbecco's
Modified Eagle's Medium (DMEM) (Gibco BRL, Burlington, Ontario) supplemented
with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Hyclone Laboratories Inc.,
Logan, UT) and lOmM HEPES (Sigma Chemical Co., St. Louis, MO), at pH 7.2. The
immortalized human breast epithelial cell line MCF10A, transfected with the empty
pH106 plasmid containing the neomycin resistance gene and MCF10A cells transfected
with the human mutant H-Ras oncogene (mutated at G12-V12) were a kind gift of Dr.
Channing Der (North Carolina) and were grown as previously described (Soule et al.
1990; Basolo et al. 1991). Briefly, the cells were grown in DMEM/F-12 (1:1)
supplemented with 5% equine serum, 0.1(j.g/mL cholera toxin, lOug/mL insulin (Gibco
BRL), 0.5ug/mL hydrocortisone (Sigma) and 0.02(j.g/mL epidermal growth factor
(Collaborative Research Inc., Palo Alto, CA). All cultures were incubated in a humidified
atmosphere of 5% C02 at 37°C.
2.3.3 Western immunoblotting
Cells plated at 50% subconfluency for 12 hours were washed with ice-cold phosphate buffered saline (PBS) and lysed in ice-cold RIPA buffer (25mM Tris-HCl, pH
7.2,0.1% SDS, 1% Triton-X-100,1% sodium deoxycholate, 0.15M NaCl, ImM EDTA, and 50nM HEPES [pH 7.3]) containing the protease and phosphatase inhibitors leupeptin
(lug/mL), phenylmethylsulfonyl fluoride (PMSF, 2mM), pepstatin A (lg/mL), aprotinin
(0.2TIU/mL) and 3,4-dichloroisocoumarin (200mM), sodium orthovanadate, and ImM NaF (Sigma Chemical Col, St. Louis, MO). Cell lysates were then micro-centrifuged at
13,000 x g for 20 minutes at 4°C (Heraeus Biofuge 13, Baxter Diagnostics, Mississauga,
ON) after standing for 20 minutes on ice. Protein concentrations of the supernatants were determined using the DC protein assay (Bio-Rad). lOug of total protein from each cell lysate was loaded and separated by electrophoresis on a 10% SDS-PAGE gel together with prestained molecular weight standards (Gibco BRL). Following electrophoresis, proteins were transferred to nitrocellulose membranes (Bio-Rad) in a buffer containing
25mM Tris-HCl (pH 8.3), 192mM glycine and 20% methanol using electrophoretic transfer cells (Bio-Rad) at 100V for 1.5 hour at 4°C. Additional protein binding sites on the membrane were blocked with 5% defatted milk in TBST (lOmM Tris base (pH 7.4),
150mM NaCl, and 0.1% Tween-20 (Sigma)). The membranes were incubated with the primary antibodies for Rhamm, CD44, Ras or ERK.1,2 (all diluted at 1:1000 or lug/mL in 1% defatted milk in TBST) for 2 hours at room temperature. The membranes were washed three times at 15 minute intervals with 1% defatted milk in TBST.
Immunodetection was performed using secondary antibodies conjugated to HRP (diluted
1:5000 or lmg/mL) in 1% defatted milk in TBST for 1 hour at room temperature followed by three washes with TBST. Blotting was visualized by the enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Pharmacia
Biotech, Piscataway, NJ) according to the manufacturer's instructions. Quantification of optical densities of the reactive protein bands was performed on a Bio-Rad Video
Densitometer. To account for variations in loading, parallel SDS gels were carried out with each experiment in which equal amounts of the protein lysates were run. These gels were then stained with Coomassie blue dye in order to confirm equal loading. The 66 densitometric results were presented as a mean of three experiments ± standard deviations and are presented as a percentage of the protein of interest normalized to a dominant 60kDa marker band on the Coomassie stained gels.
2.3.4 Analysis of EGF stimulated ERK1,2 activation
5 x 104 MCF7 and MDA-MB-231 cells were plated in complete growth medium
(DMEM, 10% FCS) on 6 cm cell culture plates and allowed to attach for 4 hours. The growth medium was replaced by defined medium (DMEM, 4ug/mL insulin, 8|j,g/mL transferrin). After overnight culture, cells were stimulated with 20ng/mL EGF (Sigma) in defined medium. For antibody blocking experiments, cell surface Rhamm and/or CD44 function was blocked by pre-incubating cells for 30 minutes in the presence of either anti-
CD44 antibody (IM-7, lOug/mL), anti-Rhamm antibody (10|j.g/mL), IgG (10|ig/mL) or a combination of anti-CD44 and anti-Rhamm antibodies prior to EGF stimulation. EGF stimulation, protein isolation and SDS-PAGE were performed as described above. The densitometric results were presented as a mean of triplicate samples ± standard deviations. Levels of phospho-ERKl,2 protein were normalized to total ERK1,2 protein and were presented as fold changes.
2.3.5 Measurement of hyaluronan production
Cells were plated at sub-confluence in DMEM + 10% FCS for 12 hours, followed by serum free medium replacement for another 24-48 hours. Hyaluronan released into the medium was collected and assayed using an ELISA assay (Amersham Pharmacia
Biotech, Piscataway, NJ) as per the manufacturer's instructions. 67
2.3.6 Flow Cytometry
Cells were grown to 50% subconfluence on 15cm culture plates in growth media
and were rinsed with Ca2+-free Hank's Buffered Saline Solution (HBSS)/20mM HEPES,
pH 7.3 hours later. Cells were harvested with non-enzymatic HBSS-based cell
dissociation solution (Sigma) and resuspended in 5mL cold PBS and centrifuged at 1200
rpm for 3 minutes. Cells were washed in another 5mL cold PBS and then blocked in cold
10% FCS/HBSS/HEPES (FACS buffer) for 30 minutes. The viability of released cells
was between 85% and 95%, by Trypan blue exclusion. For detection of cell surface
Rhamm (Savani et al. 1995), an aliquot of 2 x 106 cells was incubated with anti-Rhamm antibody (1:100,1 ug/uL) in a total volume of 200ul of FACS buffer for 30 minutes on
ice, and washed three times in cold FACS buffer. Rabbit IgG (1:100 of 1 |ag/mL) was used as a negative control for each cell line. Fluorescein isothiocyanate (FITC)- conjugated goat anti-rabbit IgG (1:300 dilution, Sigma) in FACS buffer was then added and incubated for 30 minutes in the dark on ice. The cells were washed again and examined with a flow cytometer (Beckman Coulter) using FACS Calibur with Cell Quest acquisition and analysis software (Becton Dickinson, Lincoln Park, NJ). For detection of cell surface CD44 (de los Toyos et al. 1989; Khan et al. 2005), 1 x 106 cells were incubated with lug anti-CD44 antibody (clone IM7, Pharmingen) or lug rat IgG antibody (Santa Cruz) in PBS/2% BSA for 1 hour on ice after which time they were washed with cold PBS/2% BSA. Cells were then incubated with rabbit anti-rat Alexa 488
(diluted 1:100, Molecular Probes) in PBS/2% BSA for 1 hour on ice. Cells were washed in cold PBS/2% BSA. Cells were resuspended in lmL fresh, cold PBS/2% 68 paraformaldehyde (Sigma) and were stored overnight at 4°C. Before flow cytometric analysis, samples were filtered (cell strainer caps, Becton Dickinson Labware). Data was collected using a Beckman Coulter flow cytometer. Viable cells were gated based on forward and side scatter to eliminate dead aggregates and debris, and then the distribution of fluorescence intensity was calculated.
2.3.7 Immunoprecipitation assays
Co-immunoprecipitation analyses were performed using 400ug of protein from each ceil lysate mixed with 5ug of either anti-Rhamm, anti-CD44, anti-ERKl, anti-rabbit
IgG, anti-mouse IgG antibodies or anti-rat IgG antibodies. After 12 hours of incubation at
4°C on a rotator, 25 ul of a 50% suspension of protein A/G-Sepharose beads (Gibco BRL) was added to each tube and the samples were mixed end-over-end for another 4 hours at
4°C. The beads were pelleted by brief centrifugation at 7000 x g and washed three times with cold 0.5% Triton-X-100/PBS. Bound proteins were released from the beads by heating the samples in 25 ul of 2X Laemmli buffer for 5 minutes. Protein samples were subjected to 12% SDS-PAGE and immunoblotted as described above.
2.3.8 Pull-down binding assays
In vitro pulldown binding assays were performed using recombinant Rhamm protein (63kDa and 43kDa isoforms) that was purified as a GST fusion protein as previously described (Mohapatra et al. 1996). Briefly, lmg of cellular lysate was incubated with recombinant Rhamm-GST or recombinant GST protein on glutathione
Sepharose beads (Amersham) overnight at 4°C. Beads were then pelleted by 69
centrifugation and washed five times with lmL of cold lysis buffer. Bound proteins were released from the beads by heating the samples in 25 ul of 2X Laemmli buffer for 5
minutes. Protein samples were subjected to 10% SDS-PAGE and immunoblotted as described above.
2.3.9 Time-lapse cinemicrography
Motility analyses were performed to quantify the effect of function blocking
Rhamm and CD44 antibodies, HA binding peptide, hyaluronan, and the MEK1 inhibitor,
PD098059 on cell motility. PD098059 MEK1 inhibitor was used to test the involvement of the MAP kinase pathway in the motility of these cells. Cells were seeded in T-25 flasks (Costar, Cambridge, MA) at 1 x 105 cells/flask. Cells were incubated with anti-
Rhamm antibody (30|a.g/mL), anti-CD44 antibody (30ug/mL), a mixture of anti-Rhamm
(30ug/mL) and anti-CD44 (30^g/mL) antibodies, HA binding peptide (lug/mL) or its scrambled control (1 ug/mL), and/or 50uM PD098059 for 30 minutes prior to filming.
Alternatively, cells were stimulated with 50(ig/mL of HA immediately prior to filming.
As a control, a mixture of mouse or rat and rabbit IgG (30ug/mL each), DMSO (for
PD098059) or PBS (for HA) were used. Cell locomotion was monitored for a period of 6 hours using a 10X modulation objective (Zeiss, Germany) attached to a Zeiss Axiovert
100 inverted microscope equipped with Hoffman Modulation contrast optical filters
(Greenvale, NY) and a 37°C heated stage. Cell images were captured with a CCD video camera module attached to a Hamamatsu CCD camera controller. Motility was assessed using Northern Exposure 2.9 image analysis software (Empix Imaging, Mississauga,
Ontario). Nuclear displacement of 20-30 cells was measured and data were subjected to 70 statistical analysis (see below). Each experiment was repeated at least three times. The results of motility analyses were expressed as means (um/4 hour) + standard deviations, unless otherwise indicated.
2.3.10 Immunofluorescence
MCF7 and MDA-MB-231 cells were plated sparsely (approximately 5000 cells/well) on coverslips in a 24-well dish. The cells were incubated overnight in DMEM supplemented with 10% FCS. Cells were rinsed briefly with 1%BSA/TBS and were then fixed in fresh 3.7% paraformaldehyde in TBS for 10 minutes at room temperature. Cells were rinsed with 1%BSA/TBS and were then permeabilized with 0.5% Triton X-100 in
1%BSA/TBS for 15 minutes at room temperature. Cells were again rinsed in
1%BSA/TBS and blocked in 5%FCS in 1%BSA/TBS for 1 hour at room temperature.
For the phospho-ERKl,2/CD44 double staining, cells were incubated with anti-phospho p44/p42 MAP kinase (Thr202/Tyr204) and anti-CD44 (IM7) antibodies, each diluted
1/100 in 1%BSA/TBS, for 1 hour at room temperature. For the Rhamm/CD44 double staining, cells were first incubated with an anti-Rhamm (Zhang et al. 1998; Lynn et al.
2001) antibody, diluted 1/100 in 1%BSA/TBS, overnight at 4°C. After the overnight incubation, cells were further incubated with the anti-CD44 antibody (IM7), diluted
1/100 in 1%BSA/TBS, for 1 hour at room temperature. After incubation with primary antibodies, cells were rinsed four times for 10 minutes each in 1%BSA/TBS. Primary antibodies were then visualized by incubating cells with anti-rabbit Alexa 555 and anti- rat Alexa 488, diluted 1/150 in 1%BSA/TBS, for lhour at room temperature. After incubation with secondary antibodies, cells were rinsed four times for 10 minutes each in 71
1%BSA/TBS. Cells were briefly incubated with DAPI (4',6-Diamidino-2-phenylindole) diluted in 1%BSA/TBS and then mounted (IF mounting medium, DAKO) on slides. A
Zeiss LSM510 Meta Multiphoton confocal microscope equipped with LSM 5 imaging software was used to visualize the cells (Dept. Anatomy and Cell Biology, UWO). Green and red images were captured individually and were merged using the LSM 5 Imaging software.
2.3.11 Image analysis
Colocalization was identified using the co-localization finder plug in of Image J software (https://rsh.info.nih.gov/iiA). This software allows identification of co- localization based on a correlation diagram of two (red and green) images. Pixels that contain information from both channels are considered co-localization and are converted to white on the image. This is therefore an enhancement tool used to more easily visualize co-localization and should not be considered quantitative.
2.3.12 Statistical analysis
Statistically significant (p<0.05) differences between means were assessed by the unpaired, two-tailed Student's t-test method. Cell motility was based on means of at least
30 cells per experiment and western blot quantification was based on triplicate samples, unless otherwise indicated. Hyaluronan production was reported as a mean of 10 separate cultures. 72
2.4 Results
2.4.1 Invasive breast tumour cell lines produce endogenous HA that sustains rapid motility
Hyaluronan, a motogenic factor that is synthesized in large amounts by aggressive breast cancers and that correlates with clinical progression of breast cancer (Udabage et al. 2005), promotes both ERK1,2 activation and breast tumour cell motility/invasion
(Tammi et al. 2002; Turley et al. 2002; Toole 2004; Udabage et al. 2005). Consistent with these previous reports, HA levels in the medium of cultured cells were significantly greater in the aggressive MDA-MB-231 cells than in less aggressive MCF7 cells (Figure
2.1 A). We therefore quantified the reliance of breast tumour cell lines on endogenous
HA production for maintaining motility in culture using an HA binding peptide that blocks cell-HA interactions (Savani et al. 2000). The HA-binding peptide
(YKQKIKHVVKLK) significantly reduced motility of MDA-MB-231 cells but had no effect on the MCF7 cell line (Figure 2.IB). A scrambled control peptide
(YLKQKKVKKHIV), which does not bind to HA or affect HA-mediated macrophage motility (Savani et al. 2000), did not block motility of either cell line. A motogenic response of breast cancer cell lines to exogenous HA was also quantified. Cell cultures were first serum-starved for 24-48 hours to reduce endogenous levels of HA production
( 24-48 hours. HA released into the medium was collected and assayed using an ELISA assay. Values represent the Mean and S.E.M., n=10 from 1 of 3 similar experiments. B.) A 12-mer hyaluronan binding peptide significantly reduces the motility of the MDA-MB- 231 cells compared to controls, whereas it has no effect on the motility of MCF7 tumor cells. 1 x 105 cells were seeded on T-25 flasks and were incubated with the hyaluronan binding peptide or its scrambled control (l|ag/mL) for 30 minutes, in the presence of serum, prior to filming. Cells were filmed for 6 hours. Values represent the Mean and S.E.M., n=30 cells from 1 of 3 similar experiments. C.) Exogenous hyaluronan (25- 50|j.g/mL) significantly stimulates the motility of serum-starved MDA-MB-231 cells when compared to PBS controls; MCF7 cells do not respond to hyaluronan. 1 x 105 cells were plated on T-25 flasks in growth medium for 12 hours, followed by serum-free medium for another 12 hours. Cells were then incubated with exogenous hyaluronan (25- 50ug/mL) for 30 minutes prior to filming. Cells were filmed for 6 hours. Values represent the Mean and S.E.M., n=30 cells from 1 of 3 similar experiments. 74 8 30 a. fe 25- = 20- E < Jl 1 x MCF7 'MDA-MB-231 + FCS B. IMCF7 I MDA-MB-231 PBS HA Binding Control Peptide Peptide + FCS IMCF7 I MDA-MB-231 Serum-free 75 established an HA-dependent autocrine mechanism in the presence of growth factors and/or serum that is required for rapid rates of motility. By contrast, poorly invasive breast cancer cells (e.g., MCF7) lack this mechanism since they produce low levels of HA and do not respond to exogenous HA provided in their microenvironment. 2.4.2 Invasive breast tumour cells display both cell surface CD44 and Rhamm Since the invasive breast cancer cell lines can utilize HA to promote motility, we determined if HA receptors such as CD44 and Rhamm are expressed on these cells. CD44 and Rhamm protein expression were quantified by western blot, flow cytometry and fluorescent confocal analysis. Western blot and flow cytometry analysis indicated that levels of total CD44std (Figure 2.2A) and cell surface CD44 (Figure 2.2B) were greater in MDA-MB-231 than in MCF7 cells. Confocal analysis confirmed high CD44 expression in MDA-MB-231 cells and lower expression in MCF7 cells (Figure 2.5, panels b and/; see below). We confirmed the increased expression of CD44 in cells with matched backgrounds; Total CD44 protein levels were greater in Ras-MCFIOA cells compared to their parental, non-transformed counterparts (Figure 2.2A). Like CD44, Rhamm has been reported to exist as several protein isoforms (Turley et al. 2002; Zaman et al. 2005): these include N-terminal truncations of full length Rhamm (Hall et al. 1995) that are transforming in fibroblasts. To characterize expression of protein isoforms in breast cancer cell lines, peptide-specific polyclonal antibodies were generated against sequence in the amino- (aa150"162, Ab-1) and carboxyl termini (aa542"553, Ab-3) as well as an internal region (aa " , Ab-2) of the human full-length Rhamm Figure 2.2. Cell surface and total cellular CD44 protein levels are increased in MDA- MB-231 breast cancer cells relative to MCF7 cells. A.) Western blot analysis and densitometric quantification of CD44std protein levels in breast cancer cell lines (aggressive MDA-MB-231 and Ras-MCFIOA and their less aggressive counterparts, MCF7 and parental MCF10A). Values represent the Mean and S.E.M., n=3 experiments. Percent expression was determined by normalizing the densitometric value of CD44std protein to that of a 60kDa dominant marker protein on parallel Coommassie stained gels. B.) Flow cytometry analysis of cell surface CD44 expression in MDA-MB-231 and in MCF7 breast cancer cell lines. Values are from 1 of 3 similar experiments. 2(H 20 o 15 ••H 15 '» w g- 10 10 uu 5 0-+ m , ft CD44std form (85kDa) MCF7 MDA-MB-231 MCF10A Ras-MCF10A MCF7 MDA-MB-231 •t igG o CO !/> k o o ™ o o 10 100 1000 1000 FITC CO I CD44 oo 1 CM CO o o 23 land Ras-MCFIOA cells than in MCF7 and parental MCF10A breast cancer cell lines. A.) Diagram showing the location of the sequences to which the three anti-Rhamm antibodies were raised (Ab-1, Ab-2 and Ab-3). Three protein isoforms are expressed in MDA-MB-231 cells and their sequence is predicted based upon reactivity with these anti- peptide antibodies in western blots. Full-length Rhamm isoform (85kDa) reacts with all three antibodies while shorter Rhamm forms (43 and 63kDa) react only with Ab-2 and Ab-3 (data not shown), suggesting the latter are N-terminal truncations of the full-length protein. Detectable Rhamm isoforms expressed in MCF7 cells are the 85kDa (full-length) and 43kDa isoforms (Ab-2). Constitutive expression of total Rhamm protein, and of each isoform (85, 63 and 43kDa) is greater in Ras-MCFIOA cells than MCF10A cells. B.) Quantification of percent Rhamm protein expression was determined by calculating the densitometric ratios of each of the protein isoforms / total Rhamm protein (obtained by totaling the densitometric values of each Rhamm immunoreactive band recognized by Ab-2). Values represent the Mean and S.E.M., n=3 experiments. 79 Ab-1 Ab-2 £\ ^N ^\ ,^ V <$>' # * ^ .^ ^ # ^ ^ ^ kDa 72 aal 85kDa Isoform aa Y 724 aa 164 63kDa Isoform aa ^ 724 aa 2-m 43kDa Isoform aa ^ Ab-1 Ab-2 & ^ .& J* ^ & ^ <& ^ <& kDa B. 85kDa 20 • 85kDa 63kDa • 63kDa D43kDa • 43kDa g w CD h. 10 X UJ MCF7 MDA-MB-231 MCF10A Ras-MCF10A 80 sequence (Figure 2.3A). An 85kDa protein corresponding to full-length Rhamm was expressed to a greater extent in MDA-MB-231 than in MCF7 cells and, as expected, was detected by all three antibodies (Figure 2.3A, B; data not shown for Ab-3). Shorter Rhamm forms (64 and 43kDa) expressed by the breast cancer cell lines were detected by Ab-2 (Figure 2.3A) and Ab-3 (data not shown) but not Ab-1 indicating they are N- terminal truncations of the full length Rhamm protein. In particular, the 63kDa Rhamm protein was abundant in MDA-MB-231 cells and corresponds to the oncogenic Rhamm isoform that is expressed in aggressive human tumours (Hofmann et al. 1998; Ahrens et al. 2001; Turley et al. 2002). This isoform is transforming in fibroblastsa s well (Hall et al. 1995). Intriguingly, this molecular weight also corresponds to a cell surface form of Rhamm expressed by macrophages (Zaman et al. 2005). Flow cytometry analysis showed that MDA-MB-231 cells expressed more cell surface Rhamm than MCF7 cells (Figure 2.4) although both cell lines expressed intracellular Rhamm, detected by confocal microscopy (Figure 2.5 A, panels a and e). Intracellular Rhamm occurred in the cytoplasm and on cytoskeletal structures in MCF7 cells (most likely the interphase microtubules, Figure 2.5A, panel a). In contrast, Rhamm was primarily detected in cell processes and the perinuclear region of MDA-MB-231 cells (Figure 2.5 A, panel e). Similar quantitative differences in the overall levels and isoform expression profiles of Rhamm were observed in Ras-MCFIOA compared to their parental MCF10A cells (Figure 2.3A, B). Thus, aggressive breast cancer cell lines are characterized by high levels of both cell surface CD44 and Rhamm while less aggressive cell lines express only low levels of these two proteins at the cell surface. Figure 2.4. Cell surface Rhamm expression in breast cancer cell lines. Flow cytometry analysis shows cell surface Rhamm expression is increased in MDA-MB-231 compared to MCF7 breast tumor cells. Cells were gated such that Ml refers to the negative population while M2 refers to the positive population. Values represent 1 of 3 similar experiments. 82 MCF-7 MDA-MB-231 FTTC 83 Confocal analyses were next done to look at the distribution of CD44 and Rhamm in the MDA-MB-231 and MCF7 cells. Figure 2.5 shows Rhamm [panels a (MCF7) and e (MDA-MB-231)] and CD44 staining in both cell lines [panels b (MCF7) and/(MDA- MB-231)], as well as the overlay of Rhamm and CD44 staining [panels c (MCF7) and g (MDA-MB-231)]. IgG was used as control [panels d (MCF7) and h (MDA-MB-231)]. These images showed that CD44 and Rhamm co-distributed in cell processes and in the perinuclear region of MDA-MB-231 cells (Figure 2.5, panel g; panel gi shows higher magnification images of MDA-MB-231 Rhamm and CD44 co-localization) but not in MCF-7 cells (Figure 2.5, panel c). Co-localization of Rhamm and CD44 can readily be seen in high-resolution images of MDA-MB-231 cells (panel gi). This co-association of Rhamm and CD44 was confirmed using immunoprecipitation (Figure 2.6A, B) and "pull down" assays (Figure 2.6C). Anti-Rhamrn antibodies co-immunoprecipitated two major CD44 isoforms in MDA-MB-231 and Ras-MCFIOA cells, including an 85kDa species (CD44std) and an additional 116kDa isoform, which likely represented a splice variant or post-translationally modified form of CD44 (Figure 2.6A). However, the same antibodies did not co-immunoprecipitate detectable CD44 protein in MCF7 and MCF10A cells (Figure 2.6A). In reciprocal IP assays (e.g. detection of Rhamm proteins in CD44 immunoprecipitates), CD44 antibody co-immunoprecipitated the 85kDa full length Rhamm protein in all breast cell lines (Figure 2.6B). The 63kDa N-terminal truncated form was co-immunoprecipitated in all the cancer cells lines (MDA-MB-231, Ras- MCFIOA, and MCF7) but not the non-transformed MCF10A cells. Greater amounts of both the 85kDa and 63kDa Rhamm proteins were co-immunoprecipitated with CD44 in the invasive (MDA-MB-231 and Ras-MCFIOA) vs. non-invasive (MCF7) breast tumour Figure 2.5. Subcellular distribution ofCD44 and Rhamm differs in invasive and non invasive breast cancer cell lines. Confocal analysis shows that MCF7 cells express Rhamm as a cytoplasmic protein (red fluorescence; a, arrow, c) but express little or no CD44 protein (green fluorescence; b,c). In contrast, MDA-MB-231 cells express both CD44 (f,g) and Rhamm (e,g) and these co-localize (yellow) in perinuclear vesicular structures (g, arrow). Panel i shows higher magnification images (2X) of CD44 and Rhamm co-localization in MD A-MB-231 cells. Non-immune IgG serves as a control (d,h). DAPI (blue fluorescence) is used to detect the nuclei. Original magnification is 630X. Representative micrographs are from 1 of 4 similar experiments. 85 MCF7 MDA-MB-231 Figure 2.6. Rhamm isoforms associate with CD44. A.) Anti-Rhamm antibodies immunoprecipitate two CD44 isoforms (approximately 85 and 116kDa) in MDA-MB- 231 and Ras-MCFIOA cells but do not immunoprecipitate detectable CD44 in MCF7 and MCF10A breast cells. n=3 experiments. B.) Anti-CD44 antibodies immunoprecipitate the 85kDa Rhamm isoform in all cell lines whereas the 63kDa isoform was associated only with CD44 in MDA-MB-231, Ras-MCFIOA, and MCF7 cells but not in the non- transformed parental MCF10A cells. Greater levels of these Rhamm isoforms are detected in the invasive MDA-MB-231 and Ras-MCFIOA cells than in the less invasive MCF7 and MCF10A cells. n=3 experiments. C.) Recombinant Rhamm-GST (63kDa isoform) protein pulls down CD44std (85kDa) and a variant or post-translationally modified CD44 isoform (116kDa) from MDA-MB-231 lysates. GST recombinant protein is used as control. n=4 experiments. 87 B. TN 5^ J? ^ *<&*& m # ^ ^ j* C. CD44v(116kDa) CD44std form (85kDa) 88 cell lines (Figure 2.6B). The 43kDa Rhamm protein was not detected in the IP assays. An association of 63kDa Rhamm protein, which resembles the transforming and cell surface isoform, with CD44std and the 116kDa isoform was confirmed in MDA-MB-231 cells by pull-down assays using a 63kDa recombinant Rhamm protein as bait (Figure 2.6C). These results suggest that cell surface display and co-association of both CD44 and Rhamm are linked to HA responsiveness and an aggressive tumourigenic phenotype. In order to be invasive, tumour cells must acquire the ability to migrate (Entschladen et al. 2004; Eccles 2005). CD44 was shown previously to promote motility of breast cancer cell lines and Rhamm was shown to promote motility of fibroblasts and immune cells (Bourguignon et al. 1998; Hall et al. 2001; Khan et al. 2005; Tzircotis et al. 2005; Tolg et al. 2006). Therefore, we compared the relative roles played by these HA receptors in the motility of the fibroblast-like MDA-MB-231 and Ras-MCFIOA tumour cells to the epithelial MCF7 and MCF10A cells, using function blocking antibodies specific to each of these receptors. 2.4.3 CD44 and cell surface Rhamm are necessary for motility of invasive but not non-invasive breast tumour cell lines We confirmed that the MDA-MB-231 and Ras-MCFIOA aggressive breast cancer cell lines are more motile than either MCF7 or MCF10A cells as previously reported (Basolo et al. 1991; Rochefort et al. 1998) (Figure 2.7). To determine the extent to which motility is coordinated through HA receptor interaction, we blocked receptor function with inhibitory antibodies against CD44 and Rhamm, added alone or in combination. The motility of MDA-MB-231 and Ras-MCFIOA cells was significantly inhibited by either 89 anti-CD44 or anti-Rhamm antibodies (Figure 2.8). The addition of both antibodies together had no additive inhibitory effect on motility (Figure 2.8). Antibodies had only minor effects on the motility of the non-invasive MCF7 and MCF10A cell lines (data not shown). These results indicate that both cell surface CD44 and Rhamm contribute to the rapid motility rates of the invasive breast cancer cell lines and that they appear to act coordinately on the same motogenic pathway. However, these receptors are much less important for the motility of poorly invasive breast tumour cell lines. Sustained activation of ERK1,2 motogenic pathways has previously been reported as an important factor in promoting invasive and metastatic behavior of aggressive breast cancer cell lines (Santen et al. 2002; Reddy et al. 2003; Viala and Pouyssegur 2004). We and others have shown that both CD44 and cell surface Rhamm regulate ERK1,2 activity (Zhang et al. 1998; Bourguignon et al. 2005). We then determined their role in coordinating ERK1,2 motogenic signaling. 2.4.4 CD44 and Rhamm complex with ERK1,2, and these complexes are required for motility in invasive breast cancer cell lines Both MDA-MB-231 and Ras-MCFIOA cells expressed more total ERK1,2 protein than MCF7 and MCF10A cells (Figure 2.9A), consistent with previous reports (Basolo et al. 1991; Ochieng et al. 1991). Under standard culture conditions, MDA-MB- 231 and Ras-MCFIOA cells also exhibit significantly higher constitutively active (phospho) ERK1,2 than MCF7 or MCF10A cells, consistent with the expression of mutant active Ras (H-Ras) in the invasive cell lines (Basolo et al. 1991; Ochieng et al. 1991). MDA-MB-231 and MCF7 tumour cells also differed in their ability to activate Figure 2.7. MDA-MB-231 andRas-MCFlOA cells have higher basal motility rates than MCF7 and parental MCF10A cells. Basal motility rates of MDA-MB-231 and Ras- MCF10A are significantly increased over MCF7 and MCF10A cells. 1 x 105 cells were seeded on T-25 flasks in complete growth medium. Cells were filmed for 6 hours, 12 hours after plating. Values are the Mean and S.E.M., n=30 cells from 1 of 3 similar experiments. Rate of motility (p.m/4hr) N3 CJl O V//////Ar O > 73 O y//////////////dr o > ^O Figure 2.8. High basal motility ofMDA-MB-231 and Ras-MCFIOA tumor cells is CD44 and Rhamm-dependent. Anti-Rhamm and anti-CD44 antibodies each significantly reduce motility of MDA-MB-231 and Ras-MCFIOA breast cancer cells but have no effect on MCF7 or MCF10A breast cells (data not shown). Addition of the two blocking antibodies together does not have an additive inhibitory effect on motility of MDA-MB- 231 or Ras-MCFIOA cells. 1 x 105 cells were seeded on T-25 flasks and were incubated with anti-Rhamm antibody (30|ig/mL), anti-CD44 antibody (30ug/mL), or a mixture of anti-Rhamm (30|j.g/mL) and anti-CD44 (30ug/mL) antibodies for 30 minutes, in the presence of serum, prior to filming. Cells were filmed for 6 hours. Values represent the Mean and S.E.M., n=30 cells from 1 of 3 similar experiments. 93 MDA-MB-231 anti- anti-Rhamm Rhamm CD44 + anti-CD44 Ras-MCF10A 5: 35 O 20 anti- anti- anti-Rhamm Rhamm CD44 + anti-CD44 94 ERK1,2 in response to EGF, a growth factor linked to breast cancer progression. MDA- MB-231 cells, which have been reported to express high endogenous levels of EGF (Martinez-Carpio et al. 1999), maintained significantly greater levels of ERK1,2 activity than MCF7 cells (Figure 2.9B, time 0). As expected from the endogenous EGF production, the addition of EGF did not increase ERK1,2 activity further in MDA-MB- 231 cells while it transiently increased levels in MCF7 cells, which always maintained significantly less active ERK1,2 in any case (Figure 2.9B). These differences correlated with distinct patterns of CD44/Rhamm/ERK1,2 co-localization in the two cell types as observed using confocal analyses (Figure 2.10). Figure 2.10 shows CD44 [panels a (MCF7) and e (MDA-MB-231)] and phospho-ERKl,2 staining in both cell lines [panels b (MCF7) and/(MDA-MB-231)], as well as the overlay of Rhamm and phospho- ERK1,2 staining [panels c (MCF7) and g (MDA-MB-231)]. IgG was used as control [panels d (MCF7) and h (MDA-MB-231)]. These images showed, for example, that active ERK1,2 and CD44 co-localized in MDA-MB-231 cells as perinuclear vesicular structures and, to a more limited extent, in the nucleus (Figure 2.10, panel g; panel gi shows higher magnification images of phospho-ERKl,2 and CD44 co-localization in MDA-MB-231 cells). The inserts in panels c and g have been "enhanced" (refer to methods) to show all red/green co-localization as white. These images reveal extensive co-localization of ERK1,2 with CD44 in MDA-MB-231 (panel g) but not in MCF7 (panel c) cells. These results suggest that the majority of CD44/Rhamm/activated ERK1,2 complexes occur as vesicles near the nucleus of MDA-MB-231 cells. In contrast, levels of both active ERK1,2 and CD44 were low and limited co-localization was observed in MCF7 cells. Figure 2.9. ERK1,2 is activated in response to EGF in MDA-MB-231 cells. A.) Constitutive expression of total ERK1.2 protein is significantly increased in MDA-MB- 231 and Ras-MCFIOA cells compared to MCF7 and MCF10A cells. Lysates were isolated from cells grown overnight in complete growth medium. Percent expression was determined by normalizing the densitometric value of expressed total ERK1.2 to that of a 60kDa dominant marker protein on parallel Coomassie stained gels. Values represent the Mean and S.E.M., n=3 experiments. B.) Basal levels of phospho-ERKl,2 are significantly higher in MDA-MB-231 than in MCF7 cells (0 minutes). Levels of phospho-ERKl ,2 remain elevated in MDA-MB-231 cells and are not further increased in response to 20ng/mL EGF, whereas EGF transiently increases phospho-ERKl,2 levels in MCF7 cells, albeit not to the levels observed in MDA-MB-231 cells. Cells were plated at sub-confluence (5 x 104/60mm dish) in growth medium for 4 hours, followed by serum free medium for another 12-24 hours. Cells were then stimulated with EGF (20ng/mL) for the indicated period of time. Densitometric values for phospho- ERKl,2 were normalized to total ERK1,2 and fold changes were calculated by arbitrarily setting the ratio of phospho-ERKl,2 to total ERK1,2 in unstimulated MCF7 cells to 1. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. 35 30 c 25 o "ttliHIw^li tn 20 o. x 15 ^ 10 4* 5 0 ItL ^ LMCFI7 MDA-MB-231 MCF10A Ras-MCF10A -ERK1 -ERK2 B. IMCF7 I MDA-MB-231 •S> 2 1.4 si I 1.2 1 •£• = • 30 Time After EGF Stimulation (20ng/ml) (mins) 97 To confirm the association between ERK1,2 and Rhamm, we co- immunoprecipitated ERK1,2 in all cell lines using anti-Rhamm antibodies. As expected, there were greater amounts of ERK1,2 in immunoprecipitates from MDA-MB-231 and Ras-MCFIOA than in MCF7 and MCF10A cells (Figure 2.11 A). The converse experiment using anti-ERKl,2 antibodies, also co-immunoprecipitated larger amounts of Rhamm proteins in the aggressive cell lines (Figure 2.1 IB). Intriguingly, the 85kDa (full- length) Rhamm protein form was not detected in any of the ERK1,2 immunoprecipitates (Figure 2.1 IB); the 63kDa protein was the predominant Rhamm form present. We confirmed the ability of both the 63kDa and 43kDa Rhamm proteins to associate with ERK1,2 in pull down assays using 63 or 43kDa N-terminally truncated recombinant Rhamm, which correspond to the endogenous Rhamm isoforms, as bait (Figure 2.11C). ERK1,2 was present in both pull-downs confirming that, unlike the full length Rhamm form, the smaller Rhamm protein forms can associate with ERK 1,2. Since the 63kDa Rhamm expression, in particular, is greater in the invasive breast tumour cell lines, it may be responsible for the high ERK 1,2 activity observed in the invasive breast cancer cell lines. Rhamm proteins that are smaller than the full length form have been reported to be predominant at the cell surface (Zaman et al. 2005). We determined the role of cell surface Rhamm, as well as CD44, in activating ERK 1,2 in MDA-MB-231 cells after exposure to either anti-Rhamm, anti-CD44 or both antibodies (Figure 2.12). Exposure to isotype matched non-immune IgG served as a control. ERK1,2 activity was significantly reduced by anti-Rhamm antibodies (Figure 2.12A). Anti-CD44 antibodies also appeared to reduce ERK 1,2 activity although the effect did not reach a significance level of Figure 2.10. CD44 andphospho-ERKl,2 co-localize. Confocal analysis shows that MCF7 cells do not express detectable CD44 (a,c), as shown also in Figure 2.5, and only low levels of phospho-ERKl,2 (b,c) using non-immune IgG as a control (d,h). In contrast, MDA-MB-231 cells express more CD44 (e,g) and phospho-ERKl,2 (f,g) and these co-localize (yellow; white enhancement in inset panels) in perinuclear vesicular structures (g, arrow) and, to a more limited extent, in the nucleus (g). Panel i shows higher magnification images (2X) of CD44 and phospho-ERKl,2 co-localization in MDA-MB-231 cells. DAPI (blue fluorescence) is used to detect the nuclei. Original magnification is 630X. Micrographs are from 1 of 4 similar experiments. 99 MCF7 MDA-MB-231 Figure 2.11. Rhamm isoforms associate with ERK1J. A.) Anti-Rhamm antibodies immunoprecipitate ERK1,2 in all cell lines but a greater amount of ERK1,2 is present in Rhamm immunoprecipitates of MDA-MB-231 and Ras-MCFIO compared to MCF7 or MCF10A cells. n=3 experiments. B.) Anti-ERK.1,2 antibodies co-immunoprecipitate the 63kDa Rhamm isoform. As expected, greater amounts of this Rhamm protein form is present in the ERK1,2 immunoprecipitates of MDA-MB-231 and Ras-MCFIOA than in MCF7 or MCF10 cells. The 85kDa full-length Rhamm form is not detected in ERK1,2 immunoprecipitates. Non-specific reactive bands (see IgG lane) migrating at 43kDa obscured detection of the smallest Rhamm protein form (43kDa) expressed by these cells. n=3 experiments. C.) Recombinant Rhamm-GST protein (63kDa and 43kDa isoforms) pull down ERK1,2 protein from MDA-MB-231 lysates, confirming an interaction of the shorter Rhamm protein forms with these MAP kinases. GST recombinant protein is used as control. n=3 experiments. iS J? & *jf .<**.* ERK1 (44kDa) ERK2 42kDa IP:Rhamm;IB:ERK1,2 JF ^ kDa 120 *-*5*»^"irf'*-" ^ ^ *• 85kDa 64 - m,* ~ 63kDa 39 fl|a| ''• oi^* .!&? X^ s>0" .# # aS>' & ERK1,2 associates with Rhamm/CD44 complexes and that both HA receptors are required for activation of these MAP kinases. Since ERK1,2 activity is essential for motility and invasion of MDA-MB-231 cells, we asked whether these HA receptors mediate motility also via an ERK 1,2-dependent pathway. The addition of PD098059, a MEK1 inhibitor (Figure 2.12B), or anti-Rhamm antibodies (data not shown; refer to Figure 2.5) significantly reduced the basal motility rate of MDA-MB-231 cells. Again, the addition of these two reagents together had no additive inhibitory effect (Figure 2.12B). Furthermore, neither the MEK1 inhibitor nor the anti-Rhamm antibodies, individually or in combination, had a significant inhibitory effect on MCF7 cell motility (Figure 2.12B). Similar results were observed when using anti-CD44 antibodies alone or in combination with the MEK1 inhibitor (data not shown). These combined results suggest that Rhamm, CD44, and ERK 1,2 activity are required for rapid basal motility of the aggressive cell lines and that they act collectively on the same motogenic pathway. Results suggest further that although Rhamm can associate with both ERK 1,2 and CD44, even in the less aggressive breast cancer cell lines, the subcellular localization of these complexes and the consequent effects on the kinetics of ERK 1,2 activity as well as motogenic signaling are limited in the cell lines that express little to no cell surface CD44 or Rhamm. Figure 2.12. Anti-Rhamm and anti-CD44 antibodies reduce ERK1.2 activity and ERKl,2-dependent motility ofMDA-MB-231 cells. A.) Anti-Rhamm or anti-CD44 antibodies reduce levels of phospho-ERKl,2 in MDA-MB-231 but have no effect on MCF7 cells (data not shown). Combining the antibodies does not increase inhibition further. Cells were plated at sub-confluence (5 x 104/60mm dish) in growth medium for 4 hours, followed by serum free medium for another 12-24 hours. Cells were then pre- treated with anti-Rhamm antibody (30ug/mL), anti-CD44 antibody (30|j.g/mL), or a mixture of anti-Rhamm (30ug/mL) and anti-CD44 (30(j.g/mL) antibodies for 30 minutes prior to stimulation. Cells were then stimulated with EGF (20ng/mL) in the presence of antibody for 10 minutes. Values are the Mean and S.E.M., n=3 experiments. Densitometric values for phospho-ERKl,2 were normalized to total ERK.1,2 and fold changes were calculated by arbitrarily setting the ratio of phospho-ERKl,2 to total ERK1,2 in IgG treated cells to 1. B.) Addition of the MEK1 inhibitor, PD098059, significantly reduces MD A-MB-231 cell motility but has no effect on MCF7 cell motility. A mixture of PD098059 and anti-Rhamm antibodies does not increase inhibition of MDA-MB-231 cell motility further. 1 x 105 cells were seeded on T-25 flasks and were incubated with anti-Rhamm antibody (30ng/mL), anti-CD44 antibody (30ug/mL), PD098059 (50uM), or a mixture of anti-Rhamm or anti-CD44 (30ug/mL) antibodies with PD098059 (50uM) for 30 minutes, in the presence of serum, prior to filming. Cells were filmed for 6 hours. Values represent the Mean and S.E.M., n=30 cells from 1 of 3 similar experiments. 104 1.25i anti-Rhamm anti-CD44 anti-Rhamm + anti-CD44 B. MCF7 MDA-MB-231 FCS alone PD098059 anti-Rhamm + PD098059 105 2.5 Discussion We have identified an autocrine motility mechanism by which aggressive breast cancer cell lines maintain rapid basal rates of motility. This mechanism requires HA production, ERK1,2 activity and cell surface display of CD44 and Rhamm (CD 168). It is associated with the formation of signaling complexes composed of cell surface CD44, Rhamm, and active ERK1,2 that are most abundant in the aggressive, highly motile breast cancer cell lines. Although previous reports have demonstrated that either CD44 or cell surface Rhamm are required for HA-mediated motility of tumour cells including MDA-MB-231 cells, this is the first report documenting both a functional and physical interaction between these two HA receptors. It is also the first to demonstrate coupling of this complex to a motogenic signaling pathway through ERK1,2 in aggressive tumour cells. Our results raise the possibility that the association of cell surface Rhamm with CD44, and their subsequent association with ERK1,2, may modify tumour suppression by CD44 to favor its latent tumour promoter functions. This is consistent with the strong association amongst elevated HA accumulation, ERK1,2 activity, Rhamm expression and aggressive forms of breast carcinoma (Wang et al. 1998; Balic et al. 2006). Hyaluronan was originally proposed to be an autocrine motility factor for mesenchymal cells (Turley 1992). Indeed, high endogenous production of HA has since been shown to provide autocrine motility signals in embryonic cells (Camenisch et al. 2000; Bakkers et al. 2004), hematopoietic progenitor cells (Pilarski et al. 1999), and a variety of other human tumour cells (Turley et al. 2002; Toole 2004). The possibility that HA is an autocrine motility factor that is produced by and required for the motility of aggressive breast cancer cells is attractive given the close relationship of HA production and HAS expression (Tammi et al. 2002; Toole 2004; Udabage et al. 2005), and co- localization of HA with CD44 in later stages of breast and other cancers (Auvinen et al. 2005). Our data also fit well with the prognostic value of elevated HA in peri-tumour stroma or tumours themselves as a marker of poor outcome in this disease (Toole et al. 2002). HA has consistently been demonstrated to activate motogenic signaling through Ras (Hall et al. 1995; Camenisch et al. 2000; Bakkers et al. 2004) and to require activation of ERK1,2 and PI3-kinase/AKT for this function (Sohara et al. 2001; Toole 2004; Goueffic et al. 2006). Although the HA receptors, CD44 and cell surface Rhamm, have been shown to mediate HA regulation of a Ras-controlled motogenic pathways, the majority of studies have focused on the exclusive role of CD44. An overwhelming number of these support a major role for CD44 in promoting aggressive breast cancer behavior, including cell motility in culture and in experimental tumour models as demonstrated by use of CD44 antibodies, blocking soluble CD44 recombinant protein, or small HA fragments, and genetic deletion or knockdown of this HA receptor (Weber et al. 2002; Toole 2004; Udabage et al. 2005). Nevertheless, reports have documented also that increased motility or invasion of breast and other tumour cells is associated with either shedding of CD44 [e.g. (Goebeler et al. 1996)], genetic loss or blocking of CD44 functions (Lopez et al. 2005; Goueffic et al. 2006). These experimental discrepancies, which reveal a capacity of CD44 for both promoting and inhibiting motility and invasion, mirror the dual relationship of CD44 expression to clinical outcome of breast cancer patients. In breast cancers, over-expression of the standard or specific variant forms has not consistently been demonstrated to relate to outcome parameters (Agnantis et al. 2004; Diaz et al. 2005; Ma et al. 2005; Watanabe et al. 2005). One conclusion from these studies is that it is CD44 variant forms, which are expressed at different stages of breast tumour progression (Naor et al. 2002; Auvinen et al. 2005), perform distinct functions from CD44std in tumour progression. For example, different CD44 protein forms may act as tumour suppressors during early stages of breast cancer: CD44std expression positively correlates with disease-related survival in node negative invasive breast carcinoma (Gotte and Yip 2006), but as enhancers of metastases during later stages (Abraham et al. 2005). Our results support a role for CD44 in aggressive functions of breast tumour cells when it is partnered with other motogenic proteins such as cell surface Rhamm (Tolg et al. 2006). Rhamm is structurally unrelated to CD44, yet cell surface Rhamm can perform similar functions to CD44 including mediating motogenic signaling by HA (Nedvetzki et al. 2004). Since cell surface Rhamm is not an integral protein, it must partner with other receptors that are able to take over these functions of CD44 in its absence. To our knowledge, the identities of such additional proteins have not yet been reported. In addition to its location at the cell surface, Rhamm also occurs in several intracellular compartments. In contrast to cell surface Rhamm, intracellular forms affect centrosome and mitotic spindle formation/integrity (Maxwell et al. 2003; Joukov et al. 2006) and are not likely involved in motogenic functions. In support of this conclusion, we have shown that cell surface Rhamm is sufficient to rescue ERK1,2 dependent motility in Rhamm-/- fibroblasts that do not express intracellular Rhamm forms (Tolg et al. 2006). Previous studies have suggested that the presence of cell surface Rhamm is required for HA-mediated activation of ERK1,2 in endothelial cells (Lokeshwar and Rubmowicz 1999) and fibroblasts (Zhang et al. 1998), and for the motility and invasion of endothelial cells (Savani et al. 2001) when CD44 is co-expressed. Also, we have shown recently that genetic deletion of Rhamm blunts both ERK1,2 activity and motility of dermal fibroblasts even though they express CD44 protein (Tolg et al. 2006). This study further showed that one function of cell surface Rhamm is to promote cell surface display of CD44: in the absence of cell surface Rhamm, CD44 is retained within intracellular vesicles (Tolg et al. 2006). In contrast, in breast cancer cells (e.g. MCF7), the low levels of cell surface CD44 appear to result from its reduced transcription (data not shown) rather than from defects in a Rhamm-regulated display mechanism. ERK1,2 kinases are ubiquitous and homologous MAP kinases that mediate proliferation, differentiation and motility via growth factor and ECM receptor activation. Over-expression and elevated activation of these kinases are common in human tumours. The importance of increased ERK1,2 activity in breast cancer is demonstrated by the anti-tumour effects of a specific inhibitor of the upstream kinase activators MEK1,2 (PD184352) in breast cancer patients (Allen et al. 2003). Although these MAP kinases are amongst the most common effectors in growth factor and ECM-regulated signaling pathways, a variety of temporal, spatial and quantitative cues confer a specificity of functional outcome resulting from their activation (Pouyssegur et al. 2002; Boldt and Kolch 2004; Kuida and Boucher 2004). For example, sustained activation of ERK.1,2 is required to initiate motility of breast cancer cells (Krueger et al. 2001). The duration of ERK1,2 activity is determined by many factors including concentration of the stimulus, receptor dimerization, presence of co-receptors that modify the rate of receptor internalization and the expression/compartmentalization of intracellular scaffolding/accessory proteins (Boldt and Kolch 2004; Kuida and Boucher 2004). The mechanisms by which CD44 and Rhamm sustain elevated basal ERK1,2 activity remains unclear but confocal analysis suggests that these HA receptors co-localize with phospho- ERK1,2, predominantly in the perinuclear area of cells where these proteins appear as vesicles. Although internalization of some receptor/ERKl,2 complexes terminate ERK1,2 activity, internalization of ERK1,2 with other receptors (i.e. Protease-activated Receptor-2 [PAR-2]) results in sustained ERK1,2 activation (Ge et al. 2004). We propose that internalization and trafficking of CD44/Rhamm/ERK1,2 complexes to the perinuclear area promotes sustained ERK1,2 activity in the cytoplasm. By this type of mechanism, active ERK1,2 would be available to traffic to key cytoplasmic compartments such as focal adhesions or the nucleus, sites where its activity is required for cell motility/invasion (Reddy et al. 2003; Viala and Pouyssegur 2004). Further experimentation is needed to assess this possibility. 2.6 References Abraham, B. K., Fritz, P., McClellan, M., Hauptvogel, P., Athelogou, M. and Brauch, H. 2005. Prevalence of CD44+/CD24-/low cells in breast cancer may not be associated with clinical outcome but may favor distant metastasis. Clin Cancer Res. 11,1154-9. Adamia, S., Maxwell, C. A. and Pilarski, L. M. 2005. Hyaluronan and hyaluronan synthases: potential therapeutic targets in cancer. Curr Drug Targets Cardiovasc Haematol Disord. 5, 3-14. Agnantis, N. J., Goussia, A. C, Batistatou, A. and Stefanou, D. 2004. Tumor markers in cancer patients, an update of their prognostic significance. Part II. In Vivo. 18, 481-8. 110 Ahrens, T., Assmann, V., Fieber, C, Termeer, C, Herrlich, P., Hofmann, M. and Simon, J. C. 2001. CD44 is the principal mediator of hyaluronic-acid-induced melanoma cell proliferation. J Invest Dermatol. 116, 93-101. Allen, L. F., Sebolt-Leopold, J. and Meyer, M. B. 2003. CI-1040 (PD184352), a targeted signal transduction inhibitor of MEK (MAPKK). Semin Oncol. 30,105-16. Aruffo, A., Stamenkovic, I., Melnick, M., Underhill, C. B. and Seed, B. 1990. CD44 is the principal cell surface receptor for hyaluronate. Cell. 61,1303-13. Assmann, V., Jenkinson, D., Marshall, J. F. and Hart, I. R. 1999. The intracellular hyaluronan receptor RHAMM/IHABP interacts with microtubules and actin filaments. J Cell Sci. 112 (Pt 22), 3943-54. Assmann, V., Marshall, J. F., Fieber, C, Hofmann, M. and Hart, I. R. 1998. The human hyaluronan receptor RHAMM is expressed as an intracellular protein in breast cancer cells. J Cell Sci. Ill ( Pt 12), 1685-94. Auvinen, P., Tammi, R., Tammi, M., Johansson, R. and Kosma, V. M. 2005. Expression of CD 44 s, CD 44 v 3 and CD 44 v 6 in benign and malignant breast lesions: correlation and ^localization with hyaluronan. Histopathology. 47, 420-8. Bakkers, J., Kramer, C, Pothof, J., Quaedvlieg, N. E., Spaink, H. P. and Hammerschmidt, M. 2004. Has2 is required upstream of Racl to govern dorsal migration of lateral cells during zebrafish gastrulation. Development. 131, 525-37. Balic, M., Lin, H., Young, L., Hawes, D., Giuliano, A., McNamara, G., Datar, R. H. and Cote, R. J. 2006. Most early disseminated cancer cells detected in bone marrow of breast cancer patients have a putative breast cancer stem cell phenotype. Clin Cancer Res. 12, 5615-21. Basolo, F., Elliott, J., Tait, L., Chen, X. Q., Maloney, T., Russo, I. H., Pauley, R., Momiki, S., Caamano, J., Klein-Szanto, A. J., et al. 1991. Transformation of human breast epithelial cells by c-Ha-ras oncogene. Mol Carcinog. 4, 25-35. Boldt, S. and Kolch, W. 2004. Targeting MAPK signalling: Prometheus' fire or Pandora's box? CurrPharm Des. 10, 1885-905. Ill Bourguignon, L. Y. 2001. CD44-mediated oncogenic signaling and cytoskeleton activation during mammary tumor progression. J Mammary Gland Biol Neoplasia. 6,287-97. Bourguignon, L. Y., Gilad, E., Rothman, K. and Peyrollier, K. 2005. Hyaluronan-CD44 interaction with IQGAP1 promotes Cdc42 and ERK signaling, leading to actin binding, Elk-1/estrogen receptor transcriptional activation, and ovarian cancer progression. J Biol Chem. 280, 11961-72. Bourguignon, L. Y., Gunja-Smith, Z., Iida, N., Zhu, H. B., Young, L. J., Muller, W. J. and Cardiff, R. D. 1998. CD44v(3,8-10) is involved in cytoskeleton-mediated tumor cell migration and matrix metalloproteinase (MMP-9) association in metastatic breast cancer cells. J Cell Physiol. 176,206-15. Bourguignon, L. Y., Singleton, P. A., Zhu, H. and Zhou, B. 2002. Hyaluronan promotes signaling interaction between CD44 and the transforming growth factor beta receptor I in metastatic breast tumor cells. J Biol Chem. 277, 39703-12. Camenisch, T. D., Spicer, A. P.. Brehm-Gibson, T., Biesterfeldt, J., Augustine, M. L., Calabro, A., Jr., Kubalak, S., Kiewer, S. E. and McDonald, J. A. 2000. Disruption of hyaluronan synthase-2 abrogates normal cardiac morphogenesis and hy aluronan-mediated transformation of epithelium to mesenchyme. J Clin Invest. 106, 349-60. de los Toyos, J., Jalkanen, S. and Butcher, E. C. 1989. Flow cytometric analysis of the Hermes homing-associated antigen on human lymphocyte subsets. Blood. 74, 751-60. Diaz, L. K., Zhou, X., Wright, E. T., Cristofanilli, M., Smith, T., Yang, Y., Sneige, N., Sahin, A. and Gilcrease, M. Z. 2005. CD44 expression is associated with increased survival in node-negative invasive breast carcinoma. Clin Cancer Res. 11, 3309-14. Eccles, S. A. 2005. Targeting key steps in metastatic tumour progression. Curr Opin Genet Dev. 15, 77-86. Edward, M., Gillan, C, Micha, D. and Tammi, R. H. 2005. Tumour regulation of fibroblast hyaluronan expression: a mechanism to facilitate tumour growth and invasion. Carcinogenesis. 26, 1215-23. 112 Entschladen, F., Drell, T. L. t., Lang, K., Joseph, J. and Zaenker, K. S. 2004. Tumour-cell migration, invasion, and metastasis: navigation by neurotransmitters. Lancet Oncol. 5,254-8. Florquin, S. and Rouschop, K. M. 2003. Reciprocal functions of hepatocyte growth factor and transforming growth factor-beta 1 in the progression of renal diseases: a role for CD44? Kidney IntSuppl. SI5-20. Galluzzo, E., Albi, N., Fiorucci, S., Merigiola, C, Ruggeri, L., Tosti, A., Grossi, C. E. and Velardi, A. 1995. Involvement of CD44 variant isoforms in hyaluronate adhesion by human activated T cells. Eur J Immunol. 25, 2932-9. Ge, L., Shenoy, S. K., Lefkowitz, R. J. and DeFea, K. 2004. Constitutive protease- activated receptor-2-mediated migration of MDA MB-231 breast cancer cells requires both beta-arrestin-1 and -2. J Biol Chem. 279,, 55419-24. Goebeler,M, Kaufmann, D.5 Brocker, E. B. and Klein, C. E. 1996. Migration of highly aggressive melanoma cells on hyaluronic acid is associated with functional changes, increased turnover and shedding of CD44 receptors. J Cell Sci. 109 ( Pt 7), 1957-64. ,.;...;;,{ Gotte, M. and Yip, G. W. 2006. Heparanase, Hyaluronan, and CD44 in Cancers: A Breast Carcinoma Perspective. Cancer Res. 66,10233-7. Goueffic, Y., Guilluy, C, Guerin, P., Patra, P., Pacaud, P. and Loirand, G. 2006. Hyaluronan induces vascular smooth muscle cell migration through RHAMM- mediated PI3K-dependent Rac activation. Cardiovasc Res. Hall, C. L., Collis, L. A., Bo, A. J., Lange, L., McNicol, A., Gerrard, J. M. and Turley, E. A. 2001. Fibroblasts require protein kinase C activation to respond to hyaluronan with increased locomotion. Matrix Biol. 20,183-92. Hall, C. L., Lange, L. A., Prober, D. A., Zhang, S. and Turley, E. A. 1996. pp60(c-src) is required for cell locomotion regulated by the hyaluronanreceptor RHAMM. Oncogene. 13, 2213-24. Hall, C. L., Wang, C, Lange, L. A. and Turley, E. A. 1994. Hyaluronan and the hyaluronan receptor RHAMM promote focal adhesion turnover and transient tyrosine kinase activity. J Cell Biol. 126, 575-88. 113 Hall, C. L., Yang, B., Yang, X., Zhang, S., Turley, M, Samuel, S., Lange, L. A., Wang, C, Curpen, G. D., Savani, R. C, et al. 1995. Overexpression of the hyaluronan receptor RHAMM is transforming and is also required for H-ras transformation. Cell. 82, 19-26. Hardwick, C, Hoare, K., Owens, R., Hohn, H. P., Hook, M., Moore, D., Cripps, V., Austen, L., Nance, D. M. and Turley, E. A. 1992. Molecular cloning of a novel hyaluronan receptor that mediates tumor cell motility. J Cell Biol. 117,1343-50. Hofmann, M., Fieber, C, Assmann, V., Gottlicher, M., Sleeman, J., Plug, R., Howells, N., von Stein, O., Ponta, H. and Herrlich, P. 1998. Identification of IHABP, a 95 kDa intracellular hyaluronate binding protein. J Cell Sci. Ill ( Pt 12), 1673-84. Jalkanen, S. and Jalkanen, M. 1992. Lymphocyte CD44 binds the COOH-terminal heparin-binding domain of fibronectin. JCellBiol. 116, 817-25. Joukov, V., Groen, A. C, Prokhorova, T., Gerson, R., White, E., Rodriguez, A,, Walter, J. C. and Livingston, D. M. 2006. The BRCA1/BARD1 heterodimer modulates ran-dependent mitotic spindle assembly. Cell. 127, 539-52. Keen, J. C. and Davidson, N. E. 2003. The biology of breast carcinoma. Cancer. 97, 825- 33. Kenny, P. A. and Bissell, M. J. 2003. Tumor reversion: correction of malignant behavior by microenvironmental cues. Int J Cancer. 107, 688-95. Khan, S. A., Cook, A. C, Kappil, M., Gunthert, U., Chambers, A. F., Tuck, A. B. and Denhardt, D. T. 2005. Enhanced cell surface CD44 variant (v6, v9) expression by osteopontin in breast cancer epithelial cells facilitates tumor cell migration: novel post-transcriptional, post-translational regulation. Clin Exp Metastasis. 22, 663- 73. Kondoh, K., Torii, S. and Nishida, E. 2005. Control of MAP kinase signaling to the nucleus. Chromosoma. 114, 86-91. Krueger, J. S., Keshamouni, V. G., Atanaskova, N. and Reddy, K. B. 2001. Temporal and quantitative regulation of mitogen-activated protein kinase (MAPK) modulates cell motility and invasion. Oncogene. 20,4209-18. 114 Kuida, K. and Boucher, D. M. 2004. Functions of MAP kinases: insights from gene- targeting studies. JBiochem (Tokyo). 135,653-6. Lokeshwar, V. and Rubinowicz, D. 1999. Hyaluronic acid and hyaluronidase: molecular markers associated with prostate cancer biology and detection. Prostate Cancer Prostatic Dis. 2, S21. Lopez, J. I., Camenisch, T. D., Stevens, M. V., Sands, B. J., McDonald, J. and Schroeder, J. A. 2005. CD44 attenuates metastatic invasion during breast cancer progression. Cancer Res. 65, 6755-63. Lynn, B. D., Li, X., Cattini, P. A., Turley, E. A. and Nagy, J. I. 2001. Identification of sequence, protein isoforms, and distribution of the hyaluronan-binding protein RHAMM in adult and developing rat brain. J Comp Neurol. 439, 315-30. Ma, W., Deng, Y. and Zhou, L. 2005. The prognostic value of adhesion molecule CD44v6 in women with primary breast carcinoma: a clinicopathologic study. Clin Oncol (R Coll Radiol). 17, 258-63. Marhaba, R. and Zoller, M. 2004. CD44 in cancer progression: adhesion, migration and growth regulation. JMol Histol. 35,211-31. Martinez-Carpio, P. A., Mur, C, Fernandez-Montoli, M. E., Ramon, J. M., Rosel, P. and Navarro, M. A. 1999. Secretion and dual regulation between epidermal growth factor and transforming growth factor-betal in MDA-MB-231 cell line in 42- hour-long cultures. Cancer Lett. 147, 25-9. Maxwell, C. A., Keats, J. J., Crainie, M., Sun, X., Yen, T., Shibuya, E., Hendzel, M., Chan, G. and Pilarski, L. M. 2003. RHAMM is a centrosomal protein that interacts with dynein and maintains spindle pole stability. Mol Biol Cell. 14, 2262-76. Mohapatra, S., Yang, X., Wright, J. A., Turley, E. A. and Greenberg, A. H. 1996. Soluble hyaluronan receptor RHAMM induces mitotic arrest by suppressing Cdc2 and cyclinBl expression. J Exp Med. 183, 1663-8. Morris, S. F., O'Hanlon, D. M., McLaughlin, R., McHale, T., Connolly, G. E. and Given, H. F. 2001. The prognostic significance of CD44s and CD44v6 expression in stage two breast carcinoma: an immunohistochemical study. Eur J Surg Oncol. 27,527-31. 115 Muraoka-Cook, R. S., Dumont, N. and Arteaga, C. L. 2005. Dual role of transforming growth factor beta in mammary tumorigenesis and metastatic progression. Clin Cancer Res. 11, 937s-43s. Naor, D., Nedvetzki, S., Golan, I., Melnik, L. and Faitelson, Y. 2002. CD44 in cancer. Crit Rev Clin Lab Sci. 39, 527-79. Naor, D., Sionov, R. V. and Ish-Shalom, D. 1997. CD44: structure, function, and association with the malignant process. Adv Cancer Res. 71,241-319. Navolanic, P. M., Steelman, L. S. and McCubrey, J. A. 2003. EGFR family signaling and its association with breast cancer development and resistance to chemotherapy (Review), bit J Oncol. 22, 237-52. Nedvetzki, S., Gonen, E., Assayag, N., Reich, R., Williams, R. O., Thurmond, R. L., Huang, J. F., Neudecker, B. A., Wang, F. S., Turley, E. A., et al. 2004. RHAMM, a receptor for hyaluronan-mediated motility, compensates for CD44 in inflamed CD44-knockout mice: a different interpretation of redundancy. Proc Natl Acad Sci USA. 101,18081-6. Ochieng, J., Basolo, F., Albini, A., Melchiori, A., Watanabe, H., Elliott, J., Raz, A., Parodi, S. and Russo, J. 1991. Increased invasive, chemotactic and locomotive abilities of c-Ha-ras-transformed human breast epithelial cells. Invasion Metastasis. 11, 38-47. Pilarski, L. M., Pruski, E., Wizniak, J., Paine, D., Seeberger, K., Mant, M. J., Brown, C. B. and Belch, A. R. 1999. Potential role for hyaluronan and the hyaluronan receptor RHAMM in mobilization and trafficking of hematopoietic progenitor cells. Blood. 93,2918-27. Ponta, H., Sherman, L. and Herrlich, P. A. 2003. CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol. 4, 33-45. Ponti, D., Zaffaroni, N., Capelli, C. and Daidone, M. G. 2006. Breast cancer stem cells: an overview. Eur J Cancer. 42, 1219-24. Pouyssegur, J., Volmat, V. and Lenormand, P. 2002. Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling. Biochem Pharmacol. 64, 755-63. 116 Reddy, K. B., Nabha, S. M. and Atanaskova, N. 2003. Role of MAP kinase in tumor progression and invasion. Cancer Metastasis Rev. 22, 395-403. Rochefort, H., Platet, N., Hayashido, Y., Derocq, D., Lucas, A., Cunat, S. and Garcia, M. 1998. Estrogen receptor mediated inhibition of cancer cell invasion and motility: an overview. J Steroid Biochem Mol Biol. 65,163-8. Rom, J., Aulmann, S., Schneeweiss, A., Sohn, C. and Sinn, H. P. 2006. Comparison of immunohistological parameters in primary breast cancers and corresponding locoregional recurrences. Pathol Res Pract. 202,125-30. Santen, R. J., Song, R. X., McPherson, R., Kumar, R., Adam, L., Jeng, M. H. and Yue, W. 2002. The role of mitogen-activated protein (MAP) kinase in breast cancer. J Steroid Biochem Mol Biol. 80, 239-56. Savani, R. C, Cao, G., Pooler, P. M., Zaman, A., Zhou, Z. and DeLisser, H. M. 2001. Differential involvement of the hyaluronan (HA) receptors CD44 and receptor for HA-mediated motility in endothelial cell function and angiogenesis. J Biol Chem. 276, 36770-8. Savani, R. C, Hou, G., Liu, P., Wang, C, Simons, E., Grimm, P. C, Stern, R., Greenberg, A. H., DeLisser, H. M. and Khalil, N. 2000. A role for hyaluronan in macrophage accumulation and collagen deposition after bleomycin-induced lung injury. Am JRespir Cell Mol Biol. 23,475-84. Savani, R. C, Wang, C, Yang, B., Zhang, S., Kinsella, M. G., Wight, T. N., Stern, R., Nance, D. M. and Turley, E. A. 1995. Migration of bovine aortic smooth muscle cells after wounding injury. The role of hyaluronan and RHAMM. J Clin Invest. 95,1158-68. Sheridan, C, Kishimoto, H., Fuchs, R. K., Mehrotra, S., Bhat-Nakshatri, P., Turner, C. H., Goulet, R., Jr., Badve, S. and Nakshatri, H. 2006. CD44+/CD24- breast cancer cells exhibit enhanced invasive properties, an early step necessary for metastasis. Breast Cancer Res. 8, R59. Sleeman, J. P., Arming, S., Moll, J. F., Hekele, A., Rudy, W., Sherman, L. S., Kreil, G., Ponta, H. and Herrlich, P. 1996. Hyaluronate-independent metastatic behavior of CD44 variant-expressing pancreatic carcinoma cells. Cancer Res. 56,3134-41. 117 Sohara, Y., Ishiguro, N., Machida, K., Kurata, H., Thant, A. A., Senga, T., Matsuda, S., Kimata, K., Iwata, H. and Hamaguchi, M. 2001. Hyaluronan activates cell motility of v-Src-transformed cells via Ras-mitogen-activated protein kinase and phosphoinositide 3-kinase-Akt in a tumor-specific manner. Mol Biol Cell. 12, 1859-68. Soule, H. D., Maloney, T. M., Wolman, S. R., Peterson, W. D., Jr., Brenz, R., McGrath, C. M., Russo, J., Pauley, R. J., Jones, R. F. and Brooks, S. C. 1990. Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res. 50, 6075-86. Tammi, M. I., Day, A. J. and Turley, E. A. 2002. Hyaluronan and homeostasis: a balancing act. J Biol Chem. Ill, 4581-4. Thanakit, V., Sampatanukul, P., Ruangvejvorachai, P. and Keelawat, S. 2005. The association of co-expression of CD44v4/MMP-9 with different nodal status in high-grade breast carcinoma patients. J Med Assoc Thai. 88 Suppl 4, S30-5. Tolg, C, Hamilton, S. R., Nakrieko, K. A., Kooshesh, F., Walton, P., McCarthy, J. B., Bissell, M. J. and Turley, E. A. 2006. Rhamm-/- fibroblasts are defective in CD44-mediated ERK1,2 motogenic signaling, leading to defective skin wound repair. J Cell Biol. 175,1017-28. Toole, B. P. 2004. Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer. 4, 528-39. Toole, B. P., Wight, T. N. and Tammi, M. I. 2002. Hyaluronan-cell interactions in cancer and vascular disease. J Biol Chem. 277,4593-6. Torii, S., Kusakabe, M, Yamamoto, T., Maekawa, M. and Nishida, E. 2004. Sef is a spatial regulator for Ras/MAP kinase signaling. Dev Cell. 7, 33-44. Torii, S., Nakayama, K., Yamamoto, T. and Nishida, E. 2004. Regulatory mechanisms and function of ERK MAP kinases. JBiochem (Tokyo). 136, 557-61. Turley, E. A. 1992. Hyaluronan and cell locomotion. Cancer Metastasis Rev. 11,21-30. Turley, E. A., Noble, P. W. and Bourguignon, L. Y. 2002. Signaling properties of hyaluronan receptors. J Biol Chem. 277, 4589-92. 118 Tzircotis, G., Thome, R. F. and Isacke, C. M. 2005. Chemotaxis towards hyaluronan is dependent on CD44 expression and modulated by cell type variation in CD44- hyaluronan binding. J Cell Sci. 118, 5119-28. Udabage, L., Brownlee, G. R., Nilsson, S. K. and Brown, T. J. 2005. The over-expression of HAS2, Hyal-2 and CD44 is implicated in the invasiveness of breast cancer. Exp Cell Res. 310, 205-17. Udabage, L., Brownlee, G. R., Waltham, M., Blick, T., Walker, E. C, Heldin, P., Nilsson, S. K., Thompson, E. W. and Brown, T. J. 2005. Antisense-mediated suppression of hyaluronan synthase 2 inhibits the tumorigenesis and progression of breast cancer. Cancer Res. 65, 6139-50. Viala, E. and Pouyssegur, J. 2004. Regulation of tumor cell motility by ERK mitogen- activated protein kinases. Ann N Y Acad Sci. 1030, 208-18. Wang, C, Thor, A. D., Moore, D. H., 2nd, Zhao, Y., Kerschmann, R., Stern, R., Watson, P. H. and Turley, E. A. 1998. The overexpression of RHAMM, a hyaluronan- binding protein that regulates ras signaling, correlates with overexpression of mitogen-activated protein kinase and is a significant parameter in breast cancer progression. Clin Cancer Res. 4, 567-76. Wang, F., Hansen, R. K., Radisky, D., Yoneda, T., Barcellos-Hoff, M. H., Petersen, O. W., Turley, E. A. and Bissell, M. J. 2002. Phenotypic reversion or death of cancer cells by altering signaling pathways in three-dimensional contexts. J Natl Cancer Inst. 94,1494-503. Watanabe, O., Kinoshita, J., Shimizu, T., Imamura, H., Hirano, A., Okabe, T., Aiba, M. and Ogawa, K. 2005. Expression of a CD44 variant and VEGF-C and the implications for lymphatic metastasis and long-term prognosis of human breast cancer. J Exp Clin Cancer Res. 24, 75-82. Weber, G. F., Ashkar, S., Glimcher, M. J. and Cantor, H. 1996. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science. 271, 509-12. Weber, G. F., Bronson, R. T., Ilagan, J., Cantor, H., Schmits, R. and Mak, T. W. 2002. Absence of the CD44 gene prevents sarcoma metastasis. Cancer Res. 62, 2281-6. Wells, A. 2000. Tumor invasion: role of growth factor-induced cell motility. Adv Cancer Res. 78, 31-101. 119 Yu, W. H., Woessner, J. F., Jr., McNeish, J. D. and Stamenkovic, I. 2002. CD44 anchors the assembly of matrilysin/MMP-7 with heparin-binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling. Genes Dev. 16, 307-23. Zaman, A., Cui, Z., Foley, J. P., Zhao, H., Grimm, P. C, Delisser, H. M. and Savani, R. C. 2005. Expression and role of the hyaluronan receptor RHAMM in inflammation after bleomycin injury. Am J Respir Cell Mol Biol. 33,447-54. Zhang, S., Chang, M. C, Zylka, D., Turley, S., Harrison, R. and Turley, E. A. 1998. The hyaluronan receptor RHAMM regulates extracellular-regulated kinase. J Biol Chem. 273, 11342-8. 120 CHAPTER 3. RHAMM / HMMR Transforms Fibroblasts via ERK1 and AP-1 Mediated Transcription The content of this chapter has been adapted from the paper entitled "RHAMM/HMMR Transforms Fibroblasts via ERK1 and AP-1 Mediated Transcription" by Sara R. Hamilton, Shiwen Zhang, Cornelia Tolg, Sarah Crump, James B. McCarthy, and Eva A. Turley. This paper was submitted for publication to Molecular and Cellular Biology in November 2007. 3.1 Abstract Rhamm/HMMR is an unconventionally exported hyaluronan and CD44-binding surface (CD 168) oncoprotein, as well as an intracellular mitotic spindle/centrosomal protein. Rhamm is proposed to participate in the neoplastic process by at least two mechanisms: regulation of the H-Ras oncogenic pathway through its extracellular hyaluronan/CD44 binding function (Hall et al. 1995; Hamilton et al. 2007) and de regulation of BRCA1/BARD1-mediated mitotic spindle stability via its mitotic spindle- binding function (Joukov et al. 2006). Here, we have further assessed the role of the Ras transformation pathway in mediating the oncogenic effects of Rhamm. Overexpression of Rhamm promotes transformation through the MEK1-ERK1,2 signaling pathway and it acts both upstream and downstream of H-Ras and MEK1, consistent with the previously reported extracellular and intracellular oncogenic functions. We identify a minimal transforming sequence in Rhamm (murine aa164-aa794 ), which contains the previously identified hyaluronan and mitotic spindle binding domains, as well as a direct binding site 121 for ERK1. Recombinant Rhamm protein directly stimulates ERK1 activity in vitro and overexpression of Rhamm oncogenic sequence (Rhammonc) in culture promotes activation of the ERK1,2 substrates, RSK1,2 and c-fos as detected by phosphorylation and protein stability, respectively, and sensitivity to MEK inhibition. Pathway activation results in increased ERKl,2-dependent c-fos promoter binding and AP-1 activity. Microarray analyses of serum stimulated, Rhamm overexpressing fibroblasts reveal changes in the expression of approximately 1000 genes, 135 of which have been associated with cancer. The majority of these cancer-associated genes were grouped as: self-sufficiency in growth signals, insensitivity to anti-growth signals, tumor invasion and metastasis, sustained angiogenesis and genomic instability. In particular, Rhamm overexpression affected the expression of genes that it has been functionally linked to including CD44, TGFp, VEGF and BRCA1. These results show that the signaling "interactome" of Rhamm is more diverse than previously reported and provide the first evidence for Rhamm-regulated ERK1,2 mediated alterations in gene transcription in its oncogenic effects. 3.2 Introduction Tumor initiation and progression requires the accumulation of genetic and epigenetic changes that confer plasticity, growth and survival advantages and enhanced migration/invasion capabilities to cells, allowing normal cells to transform to their highly malignant counterparts (Farber 1984; Weinberg 1989; Hanahan and Weinberg 2000). This process is largely driven by genomic instability, a process that has traditionally been suspected to result from genetic mutations (Murga and Fernandez-Capetillo 2007; van Heemst et al. 2007). However, recent studies point to an additional contribution of the microenvironment to genomic instability (Radisky et al. 2005; Radisky and Bissell 2006). For example, sustained expression of matrix metalloproteinase-3 (MMP3 or stromelysin- 1) in mammary epithelial cells, which promotes tumor formation in vivo, results in the production of ROS, gene damage and genomic instability (Radisky et al. 2005). Furthermore, hypoxia, which is common in tumor microenvironrnents, can also promote genomic instability (Huang et al. 2007). Importantly, a number of seminal studies have demonstrated that the consequences of genomic stability to tumor aggression are dependent upon the microenvironment and tissue architecture, which dominates over genotype in determining cell phenotype (Bissell and Radisky 2001; Radisky et al. 2001; Bissell et al. 2002; Wang et al. 2002). For example, breast cancer cell lines that have highly mutated and unstable genomes can be reverted to a non-tumourigenic, ductal epithelial phenotype by modifying signaling through receptors that sense the microenvironment (Wang et al. 2002). Conversely, injection of tumor cells in wounds undergoing active tissue remodeling promotes tumor growth/spread (Fisher and Fisher 1968; Dolberg et al. 1985; Sieweke and Bissell 1994). Remodeling wounds resemble tumor microenvironrnents as both are characterized by high levels of matrix remodeling metalloproteinases, matricellular proteins like tenascin and proteoglycans/polysaccharides such as hyaluronan (Sieweke and Bissell 1994). Rhamm is an oncoprotein that was originally characterized as a hyaluronan receptor that regulates signaling through the Ras transformation pathway (Hall et al. 1995). Rhamm was one of the first extracellular matrix receptors demonstrated to have oncogenic potential as expression of this protein in 10T1/2 cells transforms them into an 123 aggressively tumourigenic and metastatic phenotype (Hall et al. 1995). Conversely, expression of a dominant acting Rhamm mutant that is not able to bind hyaluronan, blocks transformation through Ras, resulting in phenotypic reversion to a non- tumourigenic state (Hall et al. 1995). Several subsequent studies have implicated hyaluronan and Rhamm as progression factors in various human cancers (Turley et al. 2002; Toole 2004). However, in addition to the cell surface, Rhamm localizes to the apical poles of mitotic spindles, centrosomes, and interphase microtubules, as well as the nucleus and mitochondria (Lynn et al. 2001; Maxwell et al. 2003; Groen et al. 2004; Kuwabara et al. 2004; Joukov et al. 2006). In particular, the interaction of Rhamm with the mitotic spindle/centrosome affects mitotic spindle integrity, raising the possibility that Rhamm affects oncogenesis by promoting genomic instability (Groen et al. 2004; Joukov et al. 2006). This possibility has been strengthened by reports showing an association of Rhamm with the BRCA1/BARD1 pathway that controls mitotic spindle integrity (Joukov et al. 2006; Pujana et al. 2007). We recently showed that Rhamm is normally exported to the cell surface following wounding but is also displayed at the surface of aggressively invasive/metastatic tumour cells (Tolg et al. 2006; Hamilton et al. 2007). We further showed that cell surface Rhamm promotes motility and invasion by binding to CD44 and sustaining activation of ERK1,2 in a CD44-dependent manner (Hamilton et al. 2007). CD44 display is characteristic of aggressive tumor subsets in many types of human tumors (Dirks 2006; Sheridan et al. 2006; Sales et al. 2007; Shipitsin et al. 2007). Collectively, these reports suggest that Rhamm performs two distinct oncogenic functions: one as a cell surface hyaluronan receptor (Hall et al. 1995; Hamilton et al. 124 2007) and the other as a mitotic spindle/centrosome protein (Joukov et al. 2006; Pujana et al. 2007). This type of functional compartmentalization is typical of a disparate group of cytoplasmic proteins that are unconventionally exported in response to specific stimuli (Nickel 2005). "Inside-outside" proteins such as Rhamm, bFGFl,2, galectin 1,3, and syntaxin/epimorphin lack signal peptides for constitutive export through the Golgi/ER and perform distinct intracellular and extracellular functions (Radisky et al. 2003; Muller et al. 2005; Nickel 2005; Nangia-Makker et al. 2007). In the present study, I further assessed the role of Ras transformation pathways in the oncogenic effects of Rhamm. I focused upon the Ras-ERK1,2 pathway because our previous data suggests that Rhamm co-associates with ERK1,2 and because we have recently shown that Rhamm expression is necessary for sustained activation of ERK1,2 in response to growth factor and CD44 engagement (Hall et al. 1995; Zhang et al. 1998; Hamilton et al. 2007). Furthermore, ERK1,2 are microtubule/mitotic spindle-associated kinases that have been linked to hyaluronan-promoted signaling (Turley et al. 2002), mitotic spindle assembly (Eves et al. 2006; Rosner 2007) and BRCA1 effects on cell cycle progression through G2/M (Yan et al. 2005). Consistent with roles for both cell surface and intracellular Rhammonc in neoplastic transformation, I found that Rhammonc acts upstream as well as downstream of Ras and MEK1 to promote transformation of 10T1/2 cells. Surprisingly, I found that intracellular forms of Rhamm bind directly to and enhance ERK1 activity, the MAP kinase specifically required for progression through the G2/M of the cell cycle. We further show that disruption of this interaction reduces translocation of ERK1,2 to the cell nucleus and that Rhamm expression promotes ERKl,2-mediated AP-1 activity, resulting in expression of genes associated not only with 125 metastasis and invasion, but also those associated with growth, survival, transformation and tumor progression; notably BRCA1, CD44, and metalloproteinases. These results provide further evidence for a role of Rhamm on the Ras/ERK1,2 signaling pathway in promoting cell transformation and gene transcription. My work has also shown that one "downstream" transforming function of intracellular Rhammonc is to promote AP-1 regulated expression of genes that affect all stages of neoplastic initiation and progression including, for example, many proto-oncogenes and candidate tumor suppressors, as well as genes that regulate cell survival, apoptosis, senescence, angiogenesis, migration/invasion and genomic stability. I further identify a mechanism by which Rhammonc regulates this AP-1 pathway. Intracellular Rhammonc binds directly to ERK1 and forms a complex with ERK1,2 and MEK1 that sustains ERK1,2 activity, promotes their translocation to the cell nucleus in response to serum stimulation, and stabilizes c- fos protein through ERK.1,2 and/or RSK.1,2 phosphorylation. It has been previously shown that cell surface Rhamm is sufficient to activate ERKl,2-regulated motogenic signaling (Tolg et al. 2006). Results from the present study show that intracellular Rhammonc is also necessary for oncogenic activation of these MAP kinases. 3.3 Materials and Methods 3.3.1 Reagents (Antibodies, Growth factors, and Kits) The following primary antibodies were obtained commercially: ERK1, MEK1, c- fos, c-Jun, phospho-c-Jun (S63/S73), heamaglutinin (HA), actin and non-immune IgG (Santa Cruz Biotechnology, Inc.); phospho-ERKl,2 (Cell Signaling); RSK1 (BD 126 Transduction Laboratories); phospho-RSKl (R&D Systems, Inc.). Polyclonal Rhamm antibodies used in this study were prepared (Zymed, San Diego, C A) against the following human Rhamm sequences: QLRQQDEDFR (aa543-553) (Zhang et al. 1998; Lynn et al. 2001). Specificity of anti-Rhamm antibodies was determined using both Rhamm-/- lysates and Rhamm peptide competition. The following secondary antibodies were purchased: for western blot detection, horseradish peroxidase (HRP)-conjugated anti-mouse (Bio-Rad Laboratories, Hercules, CA), anti-rabbit (Amersham, Oakville, ON), and anti-goat (Santa Cruz); for immunofluorescence analysis, anti-rabbit Alexa 555 and anti-rat Alexa 433 (Molecular Probes). The MEK1 inhibitors, PD098059 (50uM) and U0126 (lOuM) were purchased from BD Biosciences (Mississauga, ON) and were used at concentrations determined to inhibit ERK1,2 activation. Other reagents included human plasma fibronectin (BD Biosciences), immunofluorescence mounting medium with DAPI (4',6-Diamidino-2-phenylindole; Vectashield; Vector Laboratories), G418 (Sigma), isopropyl-P-D-thiogalactopyranoside (IPTG; Sigma), insulin (Invitrogen), transferrin (Invitrogen), bacterial protease inhibitor cocktail (Sigma), thrombin protease (Amersham), glutathione-sepharose (Amersham), reduced glutathione (Sigma), TRIzol (Invitrogen) and Lipofectamine Plus transfection reagents (Invitrogen). RNA purification columns were purchased from QIAgen, luciferase and p-galactosidase activity assay reagents from Promega, in vitro kinase assay kits from Upstate and nuclear extract kits and c-fos promoter binding kits from Active Motif. All Antibodies, reagents and kits were used according to manufacturer's instructions unless otherwise stated. 3.3.2 Plasmids For transfection and expression (transient and stable expression) of Rhamm isoforms [Rhammonc (72kDa), HA-Rhammonc, DN-Rhammonc/HABD", Rhamm (52kDa), N- terminus (NT, aa1"163), or RhammFL (95kDa)] in 10T1/2 and Rhamm-/- fibroblasts, the Rhamm cDNA's were subcloned into the pHApr-1-neo expression vector (for control by the P-Actin promoter) as previously described (Zhang et al. 1998). The mutant active MEK1 construct and dominant negative MEK1, as well as ERK1 and ERK2 cDNA's were kind gifts of Dr. Natalie Ann (Howard Hughes Institute, University of Colorado, Boulder CO). The mutant active Ras (H-Ras) and c-Jun constructs, as well as the dominant negative Ras (DN-RasN17) constructs were kind gifts of Dr. Charming J. Der (University of California, Irvine CA). For expression and purification of recombinant Rhamm protein (Rhammonc, ERK1, ERK2, and MEK1), the cDNA's were subcloned into the pGEX-2T vector as described (Zhang et al. 1998). The APl-luciferase construct was a kind gift of Dr. Ann Chambers (London Regional Cancer Program, London ON) and the P-galactosidase control plasmid was the kind gift of Dr. Joe Mymryk (London Regional Cancer Program, London ON). 3.3.3 Cell lines, cell culture and transfection The mouse embryonic fibroblast 10T1/2 cell line was obtained from American Type Culture Collection (Manassas, V A) and the Rhamm"7" primary mouse embryonic fibroblasts (MEFs) were isolated as described previously (Tolg et al. 2003; Tolg et al. 2006). All cell lines were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Invitrogen) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Hyclone Laboratories) and lOmM HEPES (Sigma), at pH 7.2. All cells were incubated 128 in a humidified atmosphere of 5% CO2 at 37°C. Cells were grown to 70-80% confluency prior to passage, were released from the substratum with 0.25% trypsin-EDTA (Invitrogen), and plated as single cells so they were 30-50% confluent at the time of the experiments. Care was taken to minimize cell-cell contact. 10T1/2 fibroblasts were transfected using Lipofectamine Plus (Invitrogen), as per the manufacturers instructions. Primary and immortalized WT and Rhamnf7" MEFs were transfected using a retroviral system as described previously (Tolg et al. 2003). Stable transfectants were derived from transiently transfected cells treated with 4mg/mL G418 (Sigma) and analysis was done using the total pool of transfectants to minimize non specific effects due to clonal selection. For FCS responsiveness, cells were plated on tissue culture plastic in complete growth medium (DMEM, 10% FCS) and were allowed to attach for 4 hours. The growth medium was then replaced by defined, serum-free medium (DMEM, 4ug/mL insulin, 8(j.g/mL transferrin). After overnight culture, cells were stimulated with 10% FCS for the indicated period(s) of time. 3.3.4 Foci formation and growth in soft agar For foci formation assays, cells were grown to 70% confluence in DMEM supplemented with 10% FCS. Cells were then transiently transfected using Lipofectamine Plus as described above. Post-transfected cells were maintained in DMEM supplemented with 10%) FCS for 10-15 days after which time the cultures were fixed in 4% paraformaldehyde (Sigma) for 10 minutes at room temperature, and stained with methylene blue as described previously (Zhang et al. 1998). The number and size of 129 the formed foci were then analyzed. All experiments were performed in triplicate and were normalized according to transfection efficiency [level of expression of the overexpressed protein(s); e.g. Appendix A]. Results are reported as number of foci relative to the positive control (e.g. H-Ras or Rhammonc transfected cells). For growth in soft agar assays, lxlO5 transiently transfected cells were suspended in 4mL of DMEM supplemented with 10% FCS and 0.3% agarose. This mixture was then overlaid onto a 60mm tissue culture treated dish that contained an underlay of 0.8% agarose in DMEM supplemented with 10% FCS. The dishes were maintained at 37°C with 5% CO2 for 15-20 days. The number of colonies after that time were then counted and photographed. Results were normalized according to transfection efficiency [level of expression of the overexpressed protein(s)]. All experiments were performed in triplicate. 3.3.5 Flow Cytometry Cell surface Rhamm was detected as described in Chapter 2. Briefly, subconfluent cells were released, fixed, washed and stained with anti-heamaglutinin antibodies as described (Savani et al. 1995). Normal mouse IgG was used as a negative control. Stained cells were detected using a flow cytometer (Beckman Coulter) using FACS Calibur with Cell Quest acquisition and analysis software (Becton Dickinson). Viable cells were gated based on forward and side scatter to eliminate dead aggregates and debris, and then the distribution of fluorescence intensity was calculated. 3.3.6 Immunofluorescence 130 Immunofluorescent staining for phospho-ERKl,2 in Rhammonc-rescued Rhamm"" cells (Figure 3.12) was done as previously described in Chapter 2 (Tolg et al. 2006; Hamilton et al. 2007). Briefly, cells were plated sparsely (approximately 5000 cells/well) on fibronectin (25|ig/ml)-coated coverslips in a 24-well dish, allowed to attach for 4 hours, were then serum-starved overnight and stimulated with 10% FCS for the indicated time periods. Rinsed cells were permeabilized with 0.5% Triton X-100 in 1%BSA/TBS and were stained with anti-phospho p44/p42 MAP kinase (Thr202/Tyr204) antibody. Primary antibodies were then visualized by incubating cells with anti-rabbit Alexa 555 and were mounted in DAPI containing mounting medium on slides. A Zeiss LSM510 Meta Multiphoton confocal microscope equipped with LSM 5 imaging software was used to visualize the cells (Dept. Anatomy and Cell Biology, UWO). Staining was done on triplicate samples in each experiment. Staining for stably overexpressed Rhammonc (heamaglutinin-tagged Rhammonc) in 10T1/2 cells (Figure 3.3B) and for transiently overexpressed Rhammonc in Rhamm"7" cells (Figure 3.3C) was done as described above and in Chapter 2. However, the primary anti- Rhamm antibodies were incubated overnight at 4°C. 3.3.7 Image acquisition and enhancement Images of Rhamm staining seen in Figure 3.3C were acquired using a Nikon Eclipse TE300 equipped with a 20x air objective (Nikon), Hoffman modulation optics, a Hamamatsu digital camera, and SimplePCI software (Compix). Images were deconvolved using SimplePCI's nearest-neighbor deconvolution application (Compix). Confocal images seen in Figures 3.3B and 3.12 were acquired using a Zeiss LSM 510 131 Meta confocal microscope (Carl Zeiss Macroimaging, Inc.) equipped with a 63x oil objective (Carl Zeiss Macroimaging, Inc.) and LSM 5 software (Carl Zeiss Macroimaging, Inc.). 3.3.8 Preparation of whole cell lysates and nuclear extracts Whole cell lysates were prepared as described in Chapter 2. Briefly, plated cells were lysed in ice-cold RIPA buffer (25mM Tris-HCl, pH 7.2,0.1% SDS, 1% Triton-X- 100,1% sodium deoxycholate, 0.15M NaCl, ImM EDTA, and 50mM HEPES [pH 7.3]) containing protease and phosphatase inhibitors. Lysates were then micro-centrifuged at 13,000 x g for 20 minutes at 4°C after standing for 20 minutes on ice. Protein concentrations of the supernatants were determined using the DC protein assay (Bio- Rad). Nuclear extracts were prepared as per the manufacturer's instructions (Nuclear Extract kit, Active Motif). 3.3.9 Western immunoblotting SDS-PAGE and Western Blot analyses were done as described in Chapter 2. Briefly, 10-50fxg of total cellular protein was loaded and separated by electrophoresis on a 10% SDS-PAGE gel. Proteins were transferred to nitrocellulose membranes (Bio-Rad Laboratories) and membranes were blocked overnight in 3% defatted milk in TBST [lOmM Tris base (pH 7.4), 150mM NaCl, and 0.1% Tween-20 (Sigma)] at 4°C. The membranes were incubated with the primary antibodies (all diluted at 1:1000 or 1 ng/mL in 1% defatted milk in TBST) for 1 hour at room temperature, with the exception of anti- Rhamm antibodies, which were incubated overnight at 4°C. Immunodetection was 132 performed using secondary antibodies conjugated to HRP (diluted 1:5000 or lmg/mL) in 1% defatted milk in TBST for 1 hour at room temperature. Blotting was visualized by the enhanced chemiluminescence (ECL) Western blotting detection system (Amersham) according to the manufacturer's instructions. Quantification of optical densities of the reactive protein bands was performed on a Bio-Rad Video Densitometer. 3.3.10 Immunoprecipitation assays Cells (parental 10T1/2 or 10Tl/2-Rhammonc) were plated on tissue culture plastic (30-50% confluence) in complete growth medium (DMEM, 10% FCS). After overnight culture, cells were lysed in ice-cold RIPA buffer as described above. Co- immunoprecipitation analyses were performed using 400u^ of protein from each cell lysate mixed with 5ug of anti-Rhamm or normal rabbit IgG antibodies. After 12 hours of incubation at 4°C on a rotator, 25 ul of a 50% suspension of protein G-Sepharose beads (Amersham) was added to each tube and the samples were mixed end-over-end for another 1 hour at 4°C. The beads were pelleted by brief centrifugation at 7000 x g and washed three times with cold 0.5% Triton-X-100/PBS. Bound proteins were released from the beads by heating the samples in 25 ul of 2X Laemmli buffer for 5 minutes. Protein samples were subjected to SDS-PAGE and western blot analysis using ERK1 or MEK1 specific antibodies as described above. Co-immunoprecipitation experiments were done using transiently transfected cells and so data were normalized according to transfection efficiency based on the level of expression of transfected protein(s) (e.g. Appendix A). 133 3.3.11 Preparation of recombinant protein Rhammonc-GST, DN-Rhammonc/HABD-GST, MEK1-GST, ERK1-GST, ERK2- GST, as well as GST recombinant proteins were prepared as previously described (Mohapatra et al. 1996; Zhang et al. 1998). Briefly, overnight bacterial cultures ofE.coli HB101 transformed with individual clone constructs were diluted 1:100 in 2XTY medium containing ampicillin (lOO^g/ml) and incubated for approximately 3-5hrs (OD6oo=0.7-0.9) with shaking at 37°C. Protein production in each of the cultures was then induced with the addition of IPTG (O.lmM). Rhamm-GST cultures were then incubated overnight, with shaking, at 18°C, while MEK1-GST, ERK1,2-GST, and GST alone cultures were incubated for 4 hours, with shaking, at 37°C. Cells were harvested by centrifugation at 5000g for 10 minutes, then resuspended in 15mL PBS containing IX bacterial protease inhibitor cocktail [containing 4-(2-aminoethyl) benzenesulfonyl fluoride (AEBSF), pepstatin A, E-64, bestatin, and sodium EDTA], For Rhamm-GST fusion protein preparation, suspended cells were further diluted using 7mL of PBS with 3% Triton X-100 for a final concentration of 1% Triton X-100. Cells were then disrupted via sonication and lysates were centrifuged at 11,000 rpm for 30 minutes. The supernatant containing soluble recombinant protein was then collected for purification. Fusion protein purification was done using glutathione-sepharose affinity chromatography. Briefly, lmL of the stock slurry (80% slurry in ethanol) was washed and stabilized in approximately 40mL PBS with 1% Triton X-100 (4 x lOmL washes). The fusion protein supernatant(s) were then added to the rinsed glutathione-sepharose beads and were incubated in for 1 hour at room temperature on a nutator. Beads were then spun for 1 minute at 2000 rpm, after which the supernatant was collected. The beads 134 containing the purified protein were then washed 5x with 20mL PBS with 1% Triton X- 100, followed by 3x with 20mL PBS. After the final wash, beads were spun down and resuspended in 800ul of PBS and stored at 4°C. MEK1-GST and ERK1,2-GST fusion protein purification was done as above though in the absence of any Triton X-100. Protein expression and purification was confirmed at this stage using SDS-PAGE and Coomassie blue staining. Proteins were eluted from the column as fusion proteins (elution using free glutathione competition) or cleaved proteins (no GST tag). For glutathione elution, the fusion proteins on the affinity column were eluted using glutathione elution buffer (lOmM reduced glutathione in 50mM Tris-Cl, pH 8.0). The concentration of the fusion protein was evaluated both by Coomassie blue staining with a known protein control (usually bovine serum albumin), as well as using the DC protein assay (Bio-Rad). To remove the GST tag, the fusion proteins were incubated with thrombin protease as per the manufacturer's instructions (1U of thrombin was added per 50[ig of fusion protein and incubated overnight at 22°C on nutator). After overnight cleavage, the slurry was spun down and the supernatant containing the cleaved recombinant protein was collected, aliquoted and stored at -80°C. 3.3.12 In vitro binding and competition assays Purified Rhamm recombinant protein was either immobilized on glutathione- sepharose as a GST fusion protein or was covalently coupled to Sulfolink gel as per the manufacturer's instructions (Sulfolink Coupling Gel, Pierce Biotechnology). Rhamm- coupled beads were incubated with purified ERK1, ERK2 or MEK1 recombinant proteins (lUg) in binding buffer (25mM HEPES, pH 7.2; 50mM NaCl; lOmM MgCl2) for 1 hour at 4°C on a Nutator rotator. The beads were then spun down for 1 minutes at 1000 rpm at 4°C and were washed lOx with lmL cold binding buffer. The beads were then boiled in SDS-PAGE sample buffer to release bound proteins from the beads and the total volume of released proteins was run and separated on a 10% SDS-PAGE gel. Transfer and western blotting methods are described above. Briefly, western blots were done using anti-ERK or anti-MEKl antibodies for detection of any ERK1,2 or MEK1 bound to the recombinant Rhammonc-beads. For competition assays, 1 jig of purified ERK1 recombinant protein was pre- incubated with lOug of peptides or soluble recombinant Rhammonc for 1 hour at 4°C on Nutator rotator. After 1 hour, Rhamm-coupled beads were added to the mix and were incubated for an additional hour at 4°C on the Nutator rotator. The beads were washed and bound protein was quantified as described above. Peptides (Dalton Chemical Laboratories Inc.) used in the competition assay were KQKIKHVVKLKDENSQLKSEVSKLRSQLVKRK (hyaluronan binding domain; HABD), LQVTQRSLEESQGKIAQLEGKL (E3 region) and VSIEKEKIDEK (E4 region). 3.3.13 In vitro kinase assays Cells (parental or transfected 10T1/2 cells) were plated on tissue culture plastic (30-50% confluence) in complete growth medium (DMEM, 10% FCS) or in serum-free medium (DMEM, 4ug/mL insulin, 8|ag/mL transferrin). After overnight culture, cells were lysed and total ERK1,2 protein was immunoprecipitated from cellular lysates as 136 described above. Determination of kinase activity was done using the ERK1 kinase assay kit purchased from Upstate Biotech as per the manufacturer's instructions (MAP kinase/ERK Immunoprecipitation Kinase Assay Kit, Upstate). Briefly, the immunoprecipitated, protein G-sepharose antibody-ERKl complex was incubated with myelin basic protein (MBP; a MAP kinase substrate) in the presence of (32P)-ATP. Each sample was spotted onto P81 filter paper, was washed, dried and 32P incorporation onto the MBP was quantified by scintillation counting. Alternatively, the entire reaction was seperated using SDS-PAGE as decribed above and phosphorylated MBP ( P incorporation) was quantified using autoradiography. In vitro kinase assays using recombinant Rhammonc protein were done according to the Upstate Biotech ERK1 Kinase Assay Kit instructions. Briefly, recombinant, activated MEK1 was incubated with recombinant, inactive ERK1-GST on sepharose beads in the presence of various concentrations of recombinant Rhammonc-GST or GST protein in the presence of unlabelled ATP. To determine the extent of ERK1-GST activation, 32P labeled ATP and myelin basic protein (MBP) were added to the reaction and allowed to incubate further, allowing ERK1 to phosphorylate the MBP with 32P- labeled ATP. The entire reaction was spotted into filter paper and 32P-MBP was quantified using a scintillation counter. 3.3.14 Promoter element binding assays Activation of c-fos or measurement of the DNA-binding capability of c-fos containing AP-1 heterodimers was determined using the Trans Am c-fos Activation Assay (Actif Motif). This assay was done according to the manufacturer's instructions. Briefly, cells (parental and stably transfected Rhamm nc-10Tl/2 cells) were plated at subconfluence (30-50% confluence) on tissue culture plastic in complete growth medium (DMEM, 10% FCS). Cells were allowed to adhere for 4 hours, after which time the growth medium was replaced with serum-free medium (DMEM, 4|ag/mL insulin, 8fj.g/mL transferrin). After overnight culture, cells were stimulated with 10% FCS for the indicated period(s) of time and nuclear extracts were isolated after treatment with 10% FCS as described above. Nuclear extract lysates were then incubated on 96-well plates with an immobilized oligonucleotide that contained a TRE (5'-TGAGTCA-3') element in a modified ELISA assay as per the manufacturer's instructions (TransAm c-fos Activation Assay, Active Motif). Excess lysate was washed away and quantification of c-fos binding to the TRE element was determined by incubation with c-fos specific antibodies followed by incubation with the appropriate HRP-conjugated secondary antibody. 3.3.15 Luciferase assays 10T1/2 parental fibroblasts, as well as stably transfected Rhammonc-10Tl/2 fibroblasts were transiently transfected with both the API-luciferase (3.2u.g) and P- galactosidase (0.8(ag) constructs. Transfections were carried out in triplicate. 24 hours after transfection, cells were starved overnight, were pre-incubated for 30 minutes with either DMSO or the MEK1 inhibitor U0126 (lOuM), after which they were stimulated with 10% FCS for the indicated times in the presence of DMSO or U0126. After stimulation, cells were harvested as per the luciferase kit protocol (Luciferase Assay System, Promega) and total protein concentrations were determined using the Bradford 138 assay (Biorad Laboratories). Cell lysates were assayed for luciferase activity using the protocols from the Promega luciferase assay kit. Cell lysates were assayed for (3-galactosidase activity using 2x (3-galactosidase buffer [200mM Na2HP04,200mM NaH2P04,2mM MgCl2, lOOmM (3-mercaptoethanol, 1.33mg/ml ortho-nitrophenyl-b-D-galactopyranoside (ONPG)]. Each cellular lysate was diluted 1:1 (v:v) in the 2x (3-galactosidase buffer on a 96-well plate and incubated at room temperature until a yellow color appeared. Samples were then read in a plate reader at 420nm. Equivalent transfection efficiencies were confirmed for each sample by standardizing the luciferase activities to (3-galactosidase activity. Data were reported as fold changes in activity in 10Tl/2-Rhammonc cells relative to parental 10T1/2 cells. 3.3.16 RNA isolation 10T1/2 parental fibroblasts, as well as stably transfected Rhammonc-10Tl/2 fibroblasts were plated on tissue culture plastic in complete growth medium (DMEM, 10% FCS) for 4 hours after which time they were starved in serum-free medium (DMEM, 4u,g/mL insulin, 8u,g/mL transferrin). After overnight incubation, cells were stimulated with 10% FCS for 30 mins. Total RNA was isolated from cells using TRIzol Reagent (Invitrogen) as per the manufacturer's instructions. For microarray analysis, RNA samples were further purified using the QIAgen RNAeasy kit (QIAgen) as per the manufacturers instructions. After purification, RNA concentration was determined by absorbance at 260nm by standard spectrophotometric analysis and frozen at -80°C. Three biological replicates were used. 3.3.17 Microarray : RNA quality assessment, probe preparation, genechip hybridization and data analysis All GeneChips were processed at the London Regional Genomics Centre (Robarts Research Institute, London, Ontario, Canada; http://www.lrgc.ca). RNA quality was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies Inc) and the RNA 6000 Nano kit (Caliper Life Sciences). Biotinylated complementary RNA (cRNA) was prepared from 10(a,g of total RNA as per the Affymetrix GeneChip Technical Analysis Manual (Affymetrix). Double- stranded cDNA was synthesized using SuperScriptll (Invitrogen) and oligo(dT)24 primers. Biotin-labeled cRNA was prepared by cDNA in vitro transcription using the BioArray High-Yield RNA Transcript Labeling kit (Enzo Biochem) incorporating biotinylated UTP and CTP. Labeled cRNA (lOug) was hybridized to Mouse Genome 430 2.0 GeneChips for 16 hours at 45 °C as described in the Affymetrix Technical Analysis Manual (Affymetrix). GeneChips were stained with Streptavidin-Phycoerythrin, followed by an antibody solution and a second Streptavidin-Phycoerythrin solution, with all liquid handling performed by a GeneChip Fluidics Station 450. GeneChips were scanned with the Affymetrix GeneChip Scanner 3000 (Affymetrix). Signal intensities for genes were generated using GCOS1.3 (Affymetrix) using default values for the Statistical Expression algorithm parameters and a Target Signal of 150 for all probe sets and a Normalization Value of 1. Gene level data was generated using the RMA preprocessor in GeneSpring GX 7.3.1 (Agilent Technologies Inc). Data were then transformed, (measurements less than 140 0.01 set to 0.01) and normalized per chip to the 50th percentile, and per gene to control samples. To determine the effect of Rhammonc overexpression on gene expression, Rhammonc-10Tl/2 cells were compared to parental 10T1/2 cells 30 mins after stimulation with FCS. Genespring was used to generate fold changes in gene expression between the two cell lines by applying a t-test with Bonferroni multiple testing correction with a significance cutoff of 0.05. Those genes whose expression was greater or equal to 2-fold change in expression were considered for further analysis and study (Appendix B). Functional classification of these array-identified genes was done first using Ingenuity Pathway Analysis software (IPA; http://www.ingenuity.com). Those genes that were identified by IPA as being involved in cancer (referred to as cancer-associated genes) were used to generate the list found in Appendix C. The regulation of these cancer-associated genes by AP-1 was next assessed. First, the proximal regulatory sequences (-2000+500) of these cancer-associated genes was analyzed to identify the presence of putative AP-1 binding site(s) [TRE (5'-TGA(C/G)TCA-3') and CRE (5'- TGACGTCA-3')] (Appendix C). Any previously published associations between each of the cancer-associated genes with ERK1,2 and/or AP-1 (regulation of and/or by ERK1,2 / AP-1) was determined by an extensive review of the literature as provided by PubMed (National Centre for Biotechnology Information; http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed) (Appendix C). To determine the potential role of Rhammonc in neoplastic initiation and/or progression, the cancer-associated genes identified using IPA were functionally classified according to Hanahan and Weinberg's Hallmarks of Cancer (Hanahan and Weinberg 141 2000) by an extensive review of the literature provided by PubMed. Briefly, a functional role for each gene in each Hallmark of Cancer was determined using PubMed. 3.3.18 cDNA synthesis and quantitative real-time PCR Quantitative real-time PCR (QPCR) was used to verify the altered expression of 14 genes (7 upregulated and 7 downregulated genes) originally identified by microarray analysis. 0.5ug of total RNA was used to prepare a 20ul reaction volume of cDNA using random primers in a first-strand cDNA synthesis reaction using Superscript II reverse transcriptase (Invitrogen). Primers for quantitative real-time PCR were designed using Primer 3 software (http://fokker.wi.mit.edu/primer3/input.htm) and were synthesized by Sigma-Genosys (Oakville, ON) (Table 3.1). Detection, quantification, and analysis of mRNA gene expression were done using the Stratagene Mx3000P Real-Time PCR System (Stratagene) with SYBR Green chemistry. Briefly, primers were reconstituted in sterile, RNase-free water with a final concentration of lu-g/ul and were further diluted 1:100 immediately prior to the use in QPCR assay. PCR reactions were set up according to the manufacturer's instructions provided for the iQ SYBR Green Supermix kit (BioRad Laboratories), with a final reaction volume of 20ul. The amplification protocol for all genes consisted of 10 mins at 95°C followed by amplification cycles (25-45) of 95°C for 30 sec, 59°C for 45 sec and 72°C for lmin. Fluorescent measurements were taken at the end of each cycle during the 72°C extension step. Table 3.1 Primer sequences for validation of candidate genes by quantitative real time RT-PCR Gene Primer Position Sequence CAT Forward 5' acatggtctgggacttctgg 3' Reverse 5' caagtttttgatgccctggt 3' CD44 Forward 5' tggatccgaattagctggac 3' Reverse 5' agctttttcttctgcccaca 3' CDH1 Forward 5' caaggacagccttcttttcg 3' Reverse 5' tggacttcagcgtcactttg 3' CSF1 Forward 5' gaccctcgagtcaacagagc 3' Reverse 5' tgtcagtctctgcctggatg 3' HMGA2 Forward 5' accagtgtccgtgaaagacc 3' Reverse 5' taaaagtgcagcgtgaatgc 3' ITGA5 Forward 5' agcgactggaatcctcaaga 3' Reverse 5' tgctgagtcctgtcaccttg 3' MAF Forward 5' agaccacctcaagcaggaga 3' Reverse 5' gcaacaaggagcgaataagc 3' MMP9 Forward 5' tgaatcagctggcttttgtg 3' Reverse 5' gtggatagctcggtggtgtt 3' RUNX1 Forward 5' agcctggcagtgtcagaagt 3' Reverse 5' tggcatctctcatgaagcac 3' TGFb2 Forward 5' ccggaggtgatttccatcta 3' Reverse 5' ggactgtctggagcaaaagc 3' TGFBR2 Forward 5' gcaagttttgcgatgtgaga 3' Reverse 5' ggcatcttccagagtgaagc 3' TPM1 Forward 5' ccaagactccttcgtcaagc 3' Reverse 5' tgagcgttgagacgaaaatg 3' VCL Forward 5' attgacggctctaggggaat 3' Reverse 5' tggtgagtcaactcctgctg 3' VEGFC Forward 5' agccaacagggaatttgatg 3' Reverse 5' cacagcggcatacttcttca 3' 28S RNA Forward 5' tcatcagaccccagaaaagg 3' Reverse 5' gattcggcaggtgagttgtt 3' Cycle threshold (Ct), the cycle at which the fluorescence is determined to be statistically significant above background, was set within the linear range for all reactions. To determine the efficiency of the reaction and the purity of the PCR products, a melting curve was performed at the end of the PCR reaction. This was done by incubating the samples at 95°C for 1 min and ramping down to 55°C at a rate of 0.2 C/sec, followed by a step-wise increase in temperature back up to the original 95°C, in which the temperature was increased at a rate of 0.5°C/sec (for 81 cycles at 30 sec/cycle). Fluorescent measurements were taken at the end of each temperature increment. All samples were run in triplicate, in parallel with no template controls and standard curves for each gene analyzed. Standard curves for each gene were generated by serially diluting the cDNA and all amplifications were carried out within the linear range of this curve. Expression analysis and calculation of relative changes in gene expression were done using Stratagene Mx3000Pro software as well as Microsoft Excel. Relative expression levels were calculated first by normalizing the expression of the gene of interest to total levels of 28S RNA. 3.3.19 Statistical analysis Statistically significant (p<0.05) differences between means were assessed by the unpaired, two-tailed Student's t-test method (SigmaStat). All analyses were based on triplicate samples unless otherwise indicated. 3.4 Results 3.4.1 Rhammonc transforms 10T1/2 fibroblasts It was previously reported that a cDNA encoding amino acids (aa) 164-794 of murine Rhamm was transforming when overexpressed in fibroblasts (Hall et al. 1995). However, expression of an endogenous protein representing this oncogenic form has not been reported. Full length (RhammFL, murine 95kDa,) and truncated (murine 72kDa and Figure 3.1. Summary of Rhamm isoform-mediated growth in soft agar and foci formation. A.) Rhammonc (a 72kDa, N-terminal truncation of RhammFL) promotes growth in soft agar and foci formation when overexpressed in 10T1/2 fibroblasts. Overexpression of RhammFL or RhammAl-216 (52kDa), which is also highly expressed in various human tumours, does not promote growth in soft agar or foci formation. Co- expression of the N-terminal 163 amino acids of RhammFL or mutations in the hyaluronan binding domain (HABD) located in the conserved C-terminal region of Rhamm, inhibits Rhamrnonc-mediated foci formation and growth in soft agar. B.) The conserved C-terminal region of Rhamm containing the previously identified hyaluronan binding region (Yang et al. 1994) and the leucine zipper required for the association of Rhamm with the apex of mitotic spindles (Groen et al. 2004; Joukov et al. 2006). HA and mitotic Foci Soft Aqar s )indle bin d ng regi ans onc 72kDa isoform 794 A1-163 (Rhamm ) ++ +++ l.i i - aa FL 1 794 + aa 95kDa isoform • ^ aa Rhamm ?17 = 52kDa isoform 794 - aa • aa A1-216 aa1 1aa 163 A164-794 (Rhamm-NT) - onc aa163 + aa164 - 72kDa isoform • aa794 Rhamm + Rhamm-NT - onc/HABD aa164 -- 72kDa isoform aa794 DN-RHAMM - - K723AE/ K727AE/ K748AN/ K749AN/ K750AW B. HA Binding Region Homo sapiens QNLKQ Leucine Zipper (mitotic spindle localization) 4^ 146 52kDa) Rhamm protein fonns are expressed in both murine and human cells [(Hall et al. 1995; Zhang et al. 1998; Hamilton et al. 2007) and Appendix A]. Expression of these truncated forms is increased in aggressive cancers (Abetamann et al. 1996; Assmann et al. 1998; Li et al. 2000; Zhou et al. 2002; Kong et al. 2003; Zaman et al. 2005). To determine if these represent an endogenous counterpart of the oncogenic Rhamm cDNA that we originally described, I characterized the antigenic properties of these forms in human breast cancer cell lines by preparing antibodies against sequences along the full- length protein (Hamilton et al. 2007). Antibodies prepared against a sequence in the N- terminal 163 aa (e.g. human Rhamm aalD8"162 and aa217"229) detected only the full length and not truncated Rhamm protein forms (Hamilton et al. 2007). In contrast, antibodies prepared against sequence in the carboxyl terminus (e.g. human Rhamm aa543"553) detect all three isoforms (Hamilton et al. 2007). The murine isoform sequence deduced from these studies for each protein form is shown in Figure 3.1 A. The 72kDa Rhamm protein (Rhammonc) thus corresponds to the previously reported oncogenic Rhamm cDNA . All protein forms contain both the highly conserved hyaluronan region [B(X)yB motifs] (Yang et al. 1994) and mitotic spindle binding regions (Groen et al. 2004; Joukov et al. 2006) that have been implicated in the oncogenic effects of Rhamm (leucine zipper; Figure 3.IB). Since these two domains are common to all Rhamm protein forms (RhammFL, 72kDa and 52kDa), we predicted that all three isoforms would be transforming. We therefore assessed if cDNA's mimicking each form could transform 10T1/2 cells using foci and soft agar assays (summarized in Figure 3.1 A). Surprisingly, only the 72kDa (referred to as Rhammonc) form is transforming (Figure 3.2A, B) in these assays even though all three proteins were expressed in similar levels (Appendix A). The Figure 3.2. Rhammonc promotes growth in soft agar and foci formation when transiently overexpressed in 10T1/2 fibroblasts. A.) Rhammonc promotes growth in soft agar. RhammFL, while able to promote limited growth in soft agar, did so to a lesser extent than Rhammonc. Transiently transfected cells were grown in 0.3% agarose for 15-20 days. Representative micrographs from triplicate samples in 1 of 3 similar experiments are shown. Values for Rhammonc and RhammFL were normalized according to their individual expression levels (e.g. Appendix A). B.) Rhammonc promotes foci formation when transiently overexpressed in 10T1/2 fibroblasts; overexpression of Rhamm does not. H-Ras is used as a positive control. Transiently transfected cells were maintained in growth medium for 10-15 days, after which time they were fixed, stained with methylene blue, and total number of foci were counted. Representative plates are shown. Values for Rhammonc and RhammFL were normalized according to their individual expression levels (e.g. Appendix A). Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. 148 A. 10T1/2 Fibroblasts B. 10T1/2 Fibroblasts •5 50 •540 vector H-Ras 2 30 Z 20 £ 10 vector H-Ras Rhammonc RhammFL Rhammonc RhammFL 149 inability of the 52kDa protein to transform 10T1/2 cells suggests that additional sequence encoded between aa1 "216 is required for full oncogenic potential of Rhamm. However, the inability of RhammFL to transform cells predicted that the N-terminal 163 amino acids blocked the transforming potent ional of the remaining carboxyl terminal (aa164"794) sequence. To assess this possibility, we co-transfected the N-terminal 163 amino acids of the full-length protein together with Rhammonc (aa164"794) (Figures 3.1 A). The N-terminal sequence abolishes the transforming activity of Rhammonc, confirming its inhibitory effect on Rhamm-mediated oncogenicity (Figures 3.1 A). As previously reported, mutation of key basic amino acids required for binding to hyaluronan also abolishes the transforming ability of Rhammonc (Figure 3.1 A, B) (Hall et al. 1995). These results identify the 72kDa Rhamm isoform as an oncogenic Rhamm protein and demonstrate that the oncogenic potential of Rhamm resides in the carboxyl terminal 630 amino acids (aa164"794), a property that can be blocked by the N-terminal 163 amino acids that are present only in the full-length protein. This provides an explanation for the absence of oncogenic activity of RhammFL. Since Rhammonc is uniquely transforming in all of the assays, we investigated the molecular mechanisms by which it transforms cells. 3.4.2 Rhammonc is expressed as a cell surface and intracellular protein Rhamm protein is displayed on the surface of cells (Pilarski et al. 1994; Pilarski et al. 1999; Gares and Pilarski 2000; Turley et al. 2002; Maxwell et al. 2005) but it also present in multiple intracellular compartments (Assmann et al. 1999; Turley et al. 2002; Maxwell et al. 2003; Joukov et al. 2006; Hamilton et al. 2007). However, the subcellular Figure 3.3. Rhammonc is a cell surface and intracellular protein when transiently overexpressed in 10T1/2 and Rhamm-/- cells. A.) Heamaglutinin (HA)-tagged Rhammonc is expressed on the cell surface when transiently overexpressed in 10T1/2 fibroblasts as detected by flow cytometry. Values are from 1 of 3 similar experiments. B.) HA- Rhammonc (green fluorescence) is expressed as an intracellular protein (nuclear and cytoplasmic) when stably overexpressed in 10T1/2 fibroblasts, as detected using immunofluorescence. DAPI (blue fluorescence) is used to detect the nucleus (insert). Original magnification is 63 OX. Representative micrographs are shown from 1 of 2 similar experiments. C.) Rhammonc is expressed as an intracellular protein when expressed in Rhamm-/- fibroblasts as detected using immunofluorescence. Original magnification is 400X. Representative micrographs are shown from 1 of 2 similar experiments. 151 A. 10T1/2-Rhammonc 150T igG Rhamm°nc 1201 I 901 |nn$rt, , ,1,,fp n , B. 10T1/2-Rhammonc c. Rh'- Rh-A - Rhamm1 152 location of Rhammonc has not previously been demonstrated. Identifying the subcellular compartmentalization of this isoform could provide clues as to the mechanisms by which it transforms. Therefore, to establish the specific subcellular distribution of Rhammonc, a haemaglutinin (HA)-tagged Rhammonc was transiently expressed in 10T1/2 cells and was detected using anti-HA antibodies using flow cytometry and immunofluorescence (Figure 3.3A, B). We further confirmed the subcellular distribution in RhammonQ-rescued Rhamm'" cells using immunofluorescence (Figure 3.3C). This HA-tagged Rhamm is detected on the surface of intact cells by flow cytometry indicating that HA-Rhammonc is exported (Figure 3.3A). Confocal analyses reveal intracellular Rhammonc in multiple compartments including the cell nucleus, membrane processes and perinuclear area (Figure 3.3B). Similar results were observed for Rhammonc expressed in Rhammv" fibroblasts (Figure 3.3C). Rhammonc has previously been shown to affect transformation through H-Ras (Hall et al. 1995). H-Ras localizes to the inner cytoplasmic membrane where it interacts with protein complexes, including cell surface receptors, to act as a master switch that controls multiple signaling pathways (Bourne et al. 1990; Schubbert et al. 2007). To begin to assess the relative roles of cell surface versus intracellular Rhamm forms, we reasoned that an oncogenic effect of Rhammonc upstream of Ras would be consistent with a cell surface function while, conversely, an effect downstream of Ras would be consistent with an intracellular oncogenic function of Rhammonc. To assess the effects of Rhamm upstream of H-Ras, we quantified the foci forming ability of Rhammonc when co- transfected with a dominant negative acting H-Ras cDNA (DN-RasN17; Figure 3.4A). Conversely, we co-expressed a dominant negative Rhamm (DN-Rhammonc/HABD") with Figure 3.4. Rhammonc is acting upstream and downstream ofRas during transformation of 10T1/2 fibroblasts. A.) Dominant negative (DN)-Ras blocks Rhammonc-mediated foci formation in 10T1/2 cells. B.) DN-Rhammonc/HABD' blocks //-to-mediated foci formation in 10T1/2 cells. Transiently transfected cells were maintained in growth medium for 10-15 days, after which time they were fixed, stained with methylene blue, and total number of foci were counted. The number of foci in the positive controls {A, Rhammonc and B, H-Ras) were arbitrarily set to 100 and the data normalized to those values. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. 154 .£ #^° fy / B. ._ 120 n 1 •g 100- ^_ I 80- ^^H ^^H E ^^^^H ^^^^H Relativ e N u 3 O i [ 1 — u ^ 1 1 7 4? i / / Figure 3.5. ERK1,2 is required for Rhamm0"''-mediated foci formation. A.) Dominant negative MEK1 (DN-MEK1) blocks Rhammonc-mediated foci formation in 10T1/2 cells. Transiently transfected cells were maintained in growth medium for 10-15 days, after which time they were fixed, stained with methylene blue, and total number of foci were counted. The number of foci in the positive control (Rhammonc) was arbitrarily set to 100 and the data normalized to those values. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. B.) Possible mechanism through which cell surface Rhamm promotes transformation. Cell surface Rhamm binds to CD44 and retains it at the surface. CD44 is then available to complex with Ras and other Ras pathway components such as Raf-1, MEK1,2 and ERK1,2 to promote Ras-regulated transformation pathways. CO > Relative Number of foci Rhammonc + Empty Vector m L Rhammonc + DN-MEK1 (1ug) Rhammonc + I DN-MEK1 (10ug) 157 mutant active H-Ras to block Rhamm-mediated signaling downstream of Ras (Figure 3.4B). DN-RasN17 significantly reduces foci formation in Rhammonc transfected cells (Figure 3.4A) while DN-Rhammonc/HABD" also significantly reduces foci formation in H- Ras transfected cells (Figure 3.4B). These results are consistent with an oncogenic effect of both cell surface and intracellular Rhammonc proteins on a Ras transformation pathway. We and others have shown that Rhamm promotes activation of ERK1,2, MAP kinases (Lokeshwar and Selzer 2000; Aitken and Bagl 2001; Lynn et al. 2001; Tolg et al. 2006; Hamilton et al. 2007) that are commonly hyper-expressed or activated in many cancers (Roberts and Der 2007). We therefore next assessed the effect of a dominant negative MEK1 (DN-MEK1), which blocks ERK1,2 activation, on Rhammonc-mediated transformation (Figure 3.5A). As shown in Figure 3.5A, DN-MEK1 significantly reduces foci formation in Rhammonc-expressing cells. These results demonstrate a requirement for ERK1,2 in Rhammonc-promoted transformation. I have previously shown that cell surface Rhamm binds to CD44 and enhances its retention at the cell surface (Tolg et al. 2006; Hamilton et al. 2007) where CD44 is then available to complex with Ras and other pathway components, including Raf-1, MEK1,2 and ERK1,2. This scenario, which is diagrammed in Figure 3.5B, is consistent with our results showing an upstream effect of Rhammonc in H-Ras-induced transformation, as well as requirement of MEK1 and ERK1,2 activity in Rhammonc-mediated transformation. However, these data are not consistent with our previous report that Rhamm co-immunoprecipitates with ERK1,2 and MEK1, but not Raf as would be expected in the model depicted in Figure 3.5B (Zhang et al. 1998). Therefore, we further characterized the association of Rhammonc with MEK1 and ERK1,2. Figure 3.6. Rhammonc co-immunoprecipitates with MEK1 and ERK1. A.) Transiently overexpressed Rhammonc, but not dominant negative Rhammonc (DN-Rhammonc/HABD'), co-immunoprecipitates with ERK1 in 10T1/2 fibroblasts. Data shown is from 1 of 3 similar experiments. B.) Transiently overexpressed Rhammonc, but not dominant negative Rhammonc (DN-Rhammonc/HABD-), co-immunoprecipitates with MEK1 in 10T1/2 fibroblasts. Data shown is from 1 of 3 similar experiments. Lysates were isolated from cells that were maintained in complete growth medium. IgG only was used as a negative control. O.D. (arbitrary units) H It IP: cx-ERK1 IP: IgG 1 • Empty Vector y II • e-Rha m n R It Rhammonc 3 onc/HABD DN-Rhamm - > I M • H cr ERK 1 ERK 2 m 3 00 O.D. (arbitrary units) 1 ifl IP: oc-MEK1 1 IP: IgG I- Empty Vector ip 1 . •Rham m A b S IB : a-MEK 1 Rhammonc 1 DN-Rhammonc/HABD- • m m 7\ Figure 3.7. Rhammonc binds ERK1 but not ERK2 or MEK1. Recombinant Rhammonc bound covalently to sepharose beads is able to directly bind recombinant ERK1 in in vitro pulldown binding assays. This binding is competed by the addition of increasing amounts of soluble recombinant Rhammonc (Rhonc). Recombinant Rhammonc was not able to bind to recombinant ERK2 or MEK1. Data shown is from 1 of 8 similar experiments. CO > 11 ERK2 Beads only + ERK2 ERK1 CO ERK 2 Rhammonc-beads + Beads only + ERK1 ERK1 70 3 ERK1 (+ 0.5|ig Rhonc) CD MEK1 onc £B ERK1 (+ 2.5ng Rh ) Q. • 1 CO Beads only + MEK1 ERK1 (+10|igRhonc) 9? MEK 1 Rhammonc-beads + MEK1 as 162 3.4.3 Rhammonc associates with MEK1 and ERK1 We first determined if Rhammonc co-associates with ERK1,2 and MEK1. Immunoprecipitation of transiently expressed Rhammonc from 10T1/2 fibroblasts results in co-precipitation of MEK1 and ERK1 (Figure 3.6A, B), but not ERK2 as we have previously described in aggressive breast cancer cell lines (Hamilton et al. 2007). Immunoprecipitation of Rhamm from empty-vector transfected 10T1/2 fibroblasts, which predominantly express RhammFL (Appendix A), did not co-precipitate detectable MEK1 or ERK1 proteins (Figure 3.6A, B). We next determined if these associations resulted from a direct interaction using recombinant protein in in vitro pull-down assays. In these assays, recombinant Rhammonc binds directly to recombinant ERK1 (Figures 3.7A) but not to recombinant ERK2 or MEK1 (Figure 3.7B, C). Furthermore, soluble recombinant Rhammotlc competes the Rhamm0nc/ERK1 interaction (Figure 3.7A). Collectively, these results show that Rhammonc binds directly to ERK1 but indirectly to MEK1, possibly through its association with ERK1. Examination of the full-length Rhamm sequence reveals two putative docking domains for ERK1,2: a DEF docking domain for ERK1,2 (F-Xaa-F-P; RhammFL aa11"15) 748 756 and a D-domain (K/R2.3-Xaa2-6-L/I-Xaa-L/I; Rhamm aa " ) (Figure 3.8A) (Yoon and Seger 2006). Previous work using site-directed mutagenesis suggests that key ERK1,2- binding residues in the D-domain are the basic amino acids and the LXL sequence (Yoon and Seger 2006). Therefore, if the putative D-domain identified in Rhamm is an ERK1 docking site on Rhammonc, mutation of these key residues should reduce the interaction in pull-down assays. We utilized the dominant negative Rhammonc (DN-Rhammonc/HABD") in which the K748R749K750 residues of the putative D-domain have Figure 3.8. Recombinant Rhammonc binds ERK1 directly and sequences within the conserved C-terminal region ofRhamm are required for this interaction. A.) Rhammonc contains a putative "D" domain ERK docking motif that overlaps with the HA binding domain and is partially mutated in the dominant negative (DN)-Rhammone/HABD". RhammFL contains an additional putative "DEF" ERK docking domain in its extreme N- terminus. B.) Recombinant Rhammonc binds directly to recombinant ERK1 in in vitro binding assays, an interaction that can be competed by the addition of excess soluble Rhammonc (Rhonc). Dominant negative Rhammonc (DN-Rhammonc/HABD-) does not bind ERK1 and the addition of excess peptide encoding the Rhamm HA binding (HABD) domain inhibits the interaction of Rhammonc with ERK1. Peptides encoding regions in Rhammonc not required for its transformation potential (peptides E3 and E4) do not affect ERK1 binding to Rhammonc. Soluble recombinant ERK1 protein was incubated with recombinant Rhammonc protein that was covalently bound to sepharose columns, in the presence or absence of indicated peptides. Unbound ERK1 was washed away and bound ERK1 was detected using western blot analysis. Data shown are from 1 of 6 similar experiments. 164 HABD n 794 onc aa164 72kDa isoform II aa A1-163(Rhamm ) 794 FL aa1 95kDa isoform II aa Rhamm / aa11F NDPS aa 15 aa748 KRKQNELRL aa756 (DEFc locking motif ("D" Domain docking motif) DN-Rhamm0"*1*60- (K748AN/ K749AN/ K750AW) B. *" t# rP*& J>y* .T*p* <£?.<& ^ ^° •ERK1 o S 165 been substituted (K748AN/R749AN/K750AW) (Figure 3.8A). This recombinant mutant is less able to bind to ERK1 than the wild-type protein (Figure 3.8B). Furthermore, soluble peptides mimicking the hyaluronan binding domain, which also encodes the putative D-domain, inhibits binding of Rhammoncto ERK1 while peptides mimicking other Rhamm sequences (peptides E3 and E4) do not (Figure 3.8B). To determine if the D-domain is required for the association of Rhammonc with ERK1 and MEK1, immunoprecipitation assays of DN-Rhammonc/HABD" were done. As shown in Figure 3.6, this mutant Rhamm form did not co-immunoprecipitate with ERK1 or MEK1. These results therefore suggest that the interaction of Rhammonc with ERK1 occurs via a characterized D-domain docking site present in the conserved C-terminal region of Rhamm (Figures 3.IB and 3.8A). In order to determine the functional consequences of this interaction, we next asked if recombinant Rhamm affects ERK1 activation in an in vitro assay. In this assay, recombinant active MEK1 is used to activate an inactive, recombinant ERK1 in the presence of recombinant Rhammonc-GST fusion protein or GST recombinant protein. Levels of active ERK1 are then quantified by measuring the phosphorylation of the ERK substrate, myelin basic protein (MBP), which contains multiple ERK1,2 phosphorylation sites. The addition of soluble recombinant Rhammonc stimulates ERK1 activation by MEK1, as is seen by the increased levels of phosphorylated MBP (Figure 3.9). Rhammoncdoes not affect MBP phosphorylation in the absence of MEK1, which indicates that Rhammonc functions as an accessory protein to promote productive MEK1 /ERK 1 /substrate interactions (Figure 3.9). To determine the consequences of these interactions in cells, I compared ERK1 activation following transient transfection of Rhammonc, mutant active MEK1, or co-transfection of MEK1 Figure 3.9. Rhammonc directly participates in MEK1-mediated activation of ERK.1,2. The addition of increasing amounts of recombinant Rhammonc-GST fusion protein significantly increases the activation of inactive recombinant ERK1-GST fusion protein by an activated recombinant MEK1 protein. ERK1 activity was measured by the extent of myelin basic protein (MBP) phosphorylation. GST alone has no effect on ERK1 activation. Data shown is from 1 of 5 similar experiments. • Recombinant Rhammonc-GST • Recombinant GST 70000-1 60000 50000 E 40000 CL o 30000 20000 10000 Amount of protein Ong 10ng 20ng 30ng 40ng 50ng 80ng 100ng 100ng 100ng 100ng onc Rhamm -GST - + - + - + - + - + + GST - - + - + - + - + Activated MEK1 + + + + + + + + + ERK1 + + + + + + + + + MBP + + + + + + + + -0 Figure 3.10. Rhamm0"0 participates in MEK1-mediated activation ofERK.1,2. Transient overexpression of Rhammonc or activated MEK1 in 10T1/2 cells leads to similar increases in ERK.1,2 activation. However, transient expression of Rhammonc together with MEK1 results in significantly higher levels of active ERK1,2 than expression of either Rhammonc or MEK1 alone. Total ERK1,2 protein was immunoprecipitated and kinase activity was determined by incubating the immunoprecipitated ERK1,2 with the substrate myelin basic protein (MBP) in the presence of ( P)-ATP. A phosphoimager was used to quantify the extent of MBP phosphorylation. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. o T3 O.D. (MBP Phosphorylation) (arbitrary units) Empty Vector Rhammonc Activated MEK1 RHammonc + Activated MEK1 0\ 170 with Rhammonc in 10T1/2 cells (Figure 3.10). ERK1 was immunoprecipitated and its ability to phosphorylate MBP was quantified. As shown in Figure 3.10, expression of both Rhammonc and mutant active MEK1 results in increased levels of active ERK1 to a similar extent. However, co-expression of these proteins strongly enhances ERK1 activation (Figure 3.10), thus mirroring the in vitro kinase assay shown in Figure 3.9. Collectively, these results predict that intracellular Rhammonc (e.g. downstream of Ras) promotes oncogenesis through the formation of MEK1/ERK1 complexes. If so, we predicted that DN-Rhammonc/HABD", which is mutated in the basic residues of the D- domain and that does not associate with MEK1 and ERK1, should not activate ERK1 and should block transformation by mutant active MEK1 when expressed in 10T1/2 cells. As shown in Figure 3.11 A, transient expression of DN-Rhammonc/HABD" does not activate ERK1 and co-transfection of this Rhammonc mutant with activated MEK1 significantly reduces MEK1-mediated foci formation (Figure 3.1 IB). We further looked at the effect of mutant Rhamm on transformation by activated c-Jun, a downstream target of this MAP kinase pathway that is transforming itself in fibroblasts (Garcia and Samarut 1990; Vogt 2001; Heasley and Han 2006; Dhillon et al. 2007). Co-expression of DN- Rhammonc/HABD" with activated c-Jun has no effect on c-Jun-mediated foci formation (Figure 3.11C), further supporting an upstream role for Rhamm in MEK1/ERK1 complexes. 3.4.4 Rhammonc promotes subcellular trafficking and activation of ERK1.2, We next hypothesized that since Rhammonc requires ERK1,2 activity for cellular transformation, over-expression of this Rhamm isoform should result in altered Figure 3.11. Rhammonc promotes ERK.1,2 activation and foci formation at the level of MEKl/ERK.1,2. A.) Transient overexpression of Rhammonc in 10T1/2 fibroblasts leads to significantly greater levels of active ERK1,2 when compared to vector control. Expression of dominant negative (DN)-Rhammonc/HABD", which is mutated in the basic residues of the putative ERK1,2 docking D-domain ERK1, does not increase levels of active ERK1,2. Lysates were prepared from transiently transfected cells maintained overnight in normal growth medium (10%FCS). Total ERK1,2 protein was immunoprecipitated and kinase activity was determined by incubating the immunoprecipitated ERK1,2 with the substrate myelin basic protein (MBP) in the presence of (32P)-ATP. A scintillation counter was used to quantify the extent of myelin basic protein phosphorylation. H-Ras was used as a positive control and serum-starved cells as a negative control. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. B.) Dominant negative Rhammonc (DN-Rhammonc/HABD') blocks activated MEK1-mediated foci formation in 10T1/2 cells, but has no effect on activated c-Jun-mediated foci formation (C). Transiently transfected cells were maintained in growth medium for 10-15 days, after which time they were fixed, stained with methylene blue, and total number of foci were counted. The number of foci in the positive controls (5, active MEK1; C, active c-Jun) were arbitrarily set to 100 and the data normalized to those values. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. Relative Number of foci 00 Active MEK1 + Empty Vector MAP Kinase Activity (cpm x 1000) 40 1 Active MEK1 + 30 " -v N3 o Rhammonc/HABD-(1ug) O O O I [ I L0 9 c Empty Vector Active MEK1 + ^ Rhammonc/HABD-(10ug) * H-Ras 1—' ~~ * — Relative Number of foci Rhammonc —I •• Active cJun + onc/HABD — * o-i hamm - (B O Empty Vector i starve d =! -n w c s Active cJun + Rhammonc/HABD-(1ug) Active cJun + Rhammonc/HABD-(10ug) 173 subcellular distribution of these MAP kinases, particularly trafficking to the cell nucleus as approximately 2/3 of all identified ERK1,2 targets are nuclear (Yoon and Seger 2006) and active ERK1,2 in the nucleus is necessary for transformation (Okazaki and Sagata 1995; Robinson et al. 1998). To determine if Rhammonc regulates the subcellular targeting of active ERK1,2, we first used immunofluorescent staining of active (phospho- ) EPJC1,2 in Rhammonc-rescued Rhamm"7" fibroblasts (Figure 3.12). Nuclear levels of active ERK1,2 levels are higher in serum-starved Rhammonc expressing Rhamm"'" fibroblasts when compared to Rhamm"7" controls (0 minutes; Figure 3.12). Furthermore, serum stimulation increases levels of active ERK1,2 in both cell genotypes (Rh"/_ and Rh" '"-Rhamm0"0), but Rhammonc expression results in enhanced and sustained trafficking to both the cell nucleus and the cell membrane when compared to parental Rhamm'7" cells at all time points assessed (Figure 3.12). Similarly, Rhammonc-overexpression results in increased nuclear levels of active ERK1,2 in 10T1/2 cells (Figure 3.13). Here, levels of active ERK1,2 were quantified via western blot analysis of phospho-ERK.1,2 in nuclear extracts. Levels of active ERK1,2 are higher in isolated nuclei of Rhammonc-expressing cells than in control 10T1/2 cells at 60 minutes and 24 hours post-serum stimulation (Figure 3.13). These results show that Rhammonc protein expression promotes trafficking and retention of ERK1,2 in the nucleus, consistent with the evidence for ERK1,2 in Rhammonc- mediated transformation. We next characterized nuclear targets of ERK1,2 that are affected by Rhammonc-overexpression. Figure 3.12. Rhammonc promotes subcellular trafficking and activation of ERK.1,2 in Rhamm'' cells. Confocal analysis of Rhamm"7" (Rh"/_) and Rh_/" cells that express Rhammonc (Rh^-Rhamm0"0) reveals that overall levels of active (phospho) ERK1,2 (red fluorescence), particularly in the nucleus (DAPI, blue fluorescence), are higher in response to serum at all time points assessed in Rharnmonc-rescued Rhamm"/" (Rh"/"- Rhammonc) cells. Cells were plated at subconfluence on coverslips in complete growth medium for 4 hours, followed by serum free medium for another 12 hours. Cells were then stimulated with 10% serum for the indicated period of time. Original magnification is 630X. Representative micrographs from 1 of 2 similar experiments are shown. 175 Rh'-Rhamm0"0 Omin 30min 60min 24hrs Figure 3.13. Rhamm0"0 promotes nuclear trafficking and activation ofERK.1,2 in 10T1/2 cells. 10T1/2 fibroblasts stably expressing Rhammonc (10Tl/2-Rhammonc) have higher levels of phospho-ERK.1,2 in nuclear extracts compared to parental 10T1/2 cells, particularly at 24hrs after stimulation. Cells were plated at subconfluence in complete growth medium for 4 hours, followed by serum free medium for another 12 hours. Cells were then stimulated with 10% serum for the indicated period of time. Nuclear extracts were isolated and levels of active (phospho) ERK1,2 were determined using western blot analysis. Densitometric values for nuclear phospho-ERK.1,2 were normalized to total nuclear p-Actin protein levels. Data shown is from 1 of 3 similar experiments. 177 10T1/2 10T1/2-Rhammonc mins hrs mins hrs 30 60 24 30 60 24 ERK1 Nuclear Phospho-ERK1,2 «•» ERK2 Nuclear fi-Actin p-Actin 10T1/2 10T1/2-Rhamm°nc Omin 30min 60min 24hr 178 3.4.5 Rhammonc increases RSK1.2 phosphorylation and AP-1 activation MEK1/ERK1,2 complexes control a number of oncogenic pathways but one that is commonly hyperactivated in human tumours is the Activator Protein-1 (AP-1) family of transcription factors, particularly the AP-1 family members c-Jun and c-fos (van Dam and Castellazzi 2001; Vogt 2001; Eferl and Wagner 2003; Hess et al. 2004). Since Rhammonc expression is associated with high nuclear levels of activated ERK1,2 (Figures 3.12 and 3.13) (Tolg et al. 2006) and since its expression is associated with high AP-1 activity (Cheung et al. 1999), I next focused on the effect of Rhammonc on these ERK1,2 nuclear targets. ERK1,2 can promote AP-1 activation, in part, through the phosphorylation-mediated stabilization of c-fos protein either directly by ERK1,2 or by RSK1,2, which are also ERK1,2 substrate(s) and effector(s) (Murphy et al. 2002; Murphy et al. 2004). I therefore first assessed the effect of Rhammonc on RSK1,2 activation. Rhammotlc expression strongly increases RSK1,2 phosphorylation compared to parental cells 10T1/2 cells following serum stimulation (Figure 3.14). Total RSK1,2 protein is also increased with Rhammonc expression (Figure 3.14). These results suggest that Rhammonc promotes ERKl,2-mediated phosphorylation and activation of RSK1,2. A direct downstream target of RSK1,2 is c-fos protein and, as mentioned above, RSKl,2-mediated phosphorylation of c-fos increases its stability and activity (Murphy et al. 2002; Murphy et al. 2004). Stable Rhammonc expression results in higher quiescent and, following serum stimulation, sustained levels of c-fos protein than are observed in parental cells (Figure 3.15). However, c-fos protein levels are slightly higher in parental versus Rhammonc expressing cells at 30 and 60 minutes after serum stimulation (Figure 3.15). In addition to direct phosphorylation by ERK.1,2 and/or RSK1,2, stabilization of c- Figure 3.14. Rhammonc overexpression leads to increased levels of phospho-RSKl,2 in 1011/2 fibroblasts. 10T1/2 fibroblasts stably overexpressing Rhammonc have greater total cellular levels of activated RSK1,2 (phospho-RSKl,2 : P-actin) in response to serum when compared to parental 10T1/2 cells at all time points assessed. However, specific activity of RSK1 (phospho-RSKl : total RSK1 protein) is similar in both cell lines. Lysates were isolated from cells that were plated at subconfluence in complete growth medium for 4 hours, followed by serum free medium for another 12 hours. Cells were then stimulated with 10% serum for the indicated period of time. Data shown are from 1 of 4 similar experiments. 180 10T1/2 10T1/2-Rhammonc c to CO c c c c o 'E o co o CM o co o CN CD CD ^—RSK1 Phospho-RSK1,2 • • •• Hiipiltik n^m*tr RSK2 ^^^~ MB ,.,,.,,,,^. .«•••• •••§ flHB flSP Total RSK1 VHF *HW W ^^"^ p-Actin __ —— Figure 3.15. c-fos protein stability depends on ERK1.2 activity in Rhammonc- overexpressing 10T1/2 fibroblasts. Stable Rhammonc overexpression in 10T1/2 fibroblasts leads to increased basal levels of total c-fos protein when compared to parental cells (0 minutes). While there is no significant difference in the overall levels of c-fos protein in both cells lines at 30 and 60 minutes post-stimulation, at 24 hours there is only detectable c-fos protein in the Rhammonc-overexpressing cells (DMSO treated). Treatment of parental 10T1/2 fibroblasts with the MEK1 inhibitor U0126 (lOuM) leads to only a partial loss of c-fos protein, where as MEK1 inhibition in 10Tl/2-Rhammonc cells leads to almost complete loss of c-fos protein. Lysates were isolated from cells that were plated at subconfluence in complete growth medium for 4 hours, followed by serum free medium for another 12 hours. Cells were then stimulated with 10% serum for the indicated period of time. Densitometric values for total c-fos protein were normalized to total cellular (3-Actin. Data shown are from 1 of 3 similar experiments. 182 10T1/2 10T1/2-Rhammonc 0 mins 30 mins 60 mins 24hrs 0 mins 30 mins 60 mins 24hrs ,-, CO ,-N CO ,-, CO ~. CO CO CO CO CO o CM o CM o CM o CN CO •*- CO •«- CO •>- CO •«- CO CO CO CO T— SOSO SOSO :> O ^ O •? O ^ QDQ3 O => Q => Q 3 Q 3 Q 3 Q o_) c-fos .^eaa*** •*""*"*• ^BWP ^^^^^^^^H^|^^^ p-Actin ••• DMSO 3 2.5 DMSO U0126 U0126 I O 1.5 aCO: o 1 £ 0.5 o •55 0 c 60min CD Omin 30min 60min 24hr a Time after FCS Stimulation (mins) Time after FCS Stimulation (mins) 183 fos protein is also regulated in a Mos-dependent manner (through ERK1,2), as well as by ERK5 and p38-mediated phosphorylation (Okazaki and Sagata 1995; Terasawa et al. 2003; Tanos et al. 2005). Therefore, the increased levels of c-fos observed at 30 and 60 minutes in Rhamrnonc-expressing cells may be consistent with a role for the stress- activated MAP kinase, p38 in mediating c-fos stabilization (Tanos et al. 2005). We next assessed whether the high c-fos protein expression in both Rhammonc and parental cells are equally dependent upon ERK.1,2 kinase activity using the MEK1 inhibitor U0126, which reduces ERK.1,2 activation. As shown in Figure 3.15, inhibition of ERK1,2 activity reduces c-fos protein expression in both cell lines at all time points assessed post- serum stimulation. However, ERK.1,2 inhibition reduces c-fos protein levels by approximately 1-fold at 60 minutes post serum stimulation in 10T1/2 parental cells but by 4-fold in Rhammonc expressing cells (Figure 3.15). To confirm that the elevated c-fos protein levels reflect increased c-fos activity, c-fos heterodimers present in nuclear extracts of 10Tl/2-Rhammonc and parental 10T1/2 cells were quantified by measuring binding to a TRE AP-1 promoter element (Figure 3.16). Activity of c-fos measured in this manner reflects the total c-fos protein levels observed in Figure 3.15; activity is sustained longer in response to serum stimulation in Rhammonc expressing 10T1/2 fibroblasts than in parental cells but activity is higher in parental cells than in Rhammonc expressing cells at 30 and 60 minutes post serum stimulation (Figure 3.16). Similar to c- fos protein levels, activity of c-fos is more sensitive to ERK.1,2 inhibition at 60 minutes and 24 hours post serum stimulation in Rhammonc expressing cells than in the parental cell line (Figure 3.16). Figure 3.16. c-fos DNA binding activity depends on ERK1,2 activity in Rhammonc- overexpressing 10T1/2 fibroblasts. 60 minutes post-stimulation there is no significant difference in the DNA binding ability of c-fos containing AP-1 heterodimers in either parental 10T1/2 or 10Tl/2-Rhammonc cells (DMSO treated). At 24 hours there is significantly higher DNA binding activity of c-fos from Rhammonc-overexpressing compared to parental 10T1/2 fibroblasts (DMSO treated). However, treatment of 10Tl/2-Rhammonc cells with the MEK1 inhibitor results in a more significant inhibition of the DNA binding ability of c-fos compared to parental 10T1/2 cells, which showed only partial inhibition with MEK1 inhibition. Cells were plated at subconfluence in complete growth medium for 4 hours, followed by serum free medium for another 12 hours. Cells were then stimulated with 10% serum for the indicated period of time. Nuclear extracts were isolated and incubated with an oligonucleotide encoding the c-fos promoter TRE recognition sequence. Levels of bound c-fos containing AP-1 heterodimers were quantified in a modified ELISA assay using anti-c-fos specific antibodies to detect c-fos bound to the DNA. Mean and S.E.M., n=3 from 1 of 2 similar experiments. C-fos Binding to TRE Element (Arbitrary Units) 3 CD 5 CD -i CO 3' c_ at I—H o" 3 o o CO £81 186 Stabilized c-fos protein can dimerize with phosphorylated c-Jun monomers to form transcriptionally active AP-1 heterodimers (Hess et al. 2004). As ERK1,2 activity has also been linked to phosphorylation of c-Jun and as AP-1 transcriptional activity, particularly of c-fos/c-Jun heterodimers, are required for Ras-regulated transformation of fibroblasts (Wick et al. 1992; Johnson et al. 1996; Janulis et al. 1999), we next assessed the effect of Rhammonc overexpression on c-Jun phosphorylation, as detected by Western analysis (Figure 3.17). The basal levels of activated (phospho-Ser63/Ser73) c-Jun are higher in Rhamrnonc-expressing cells (0 minutes; Figure 3.17) and the kinetics of activation are altered compared to parental cells (Figure 3.17). For example, phosphorylation of c-Jun reaches maximum levels in Rhammonc expressing cells by 30 minutes and this level is sustained at 60 minutes (p-c-Jun/p-Actin; Figure 3.17). In contrast, phospho-c-Jun levels are lower at 30 minutes in parental cells and are highest at 60 minutes (p-c-Jun/p-Actin; Figure 3.17). Interestingly, the MEK1 inhibitor, PD98059, reduces levels of both total c-Jun protein and phosphorylated c-Jun protein in both cell lines, which is consistent with a role for MEK1 in the activation of the primary c-Jun activating MAP kinases, JNK (Figure 3.17) (Hagemann and Blank 2001; Yoon and Seger 2006). The less striking inhibitory effect of blocking ERK1,2 activity on c-Jun phosphorylation than on c-fos protein expression is consistent with previous reports showing that c-Jun activation is regulated by several MAP kinases in addition to ERK1,2 (Yoon and Seger 2006). Collectively, these results suggest that expression of Rhammonc in 10T/2 cells activates both c-fos and c-Jun transcription factors. To confirm that these increases are reflected by increases in AP-1 activation, luciferase reporter assays were performed. AP-1 transcription activity is increased over a 24 hour period in both Figure 3.17. Basal levels of active c-Jun and kinetics ofc-Jun activation are altered in Rhammonc-overexpressing 10T1/2 fibroblasts. Basal levels of active (phospho- Ser63/Ser73) c-Jun are higher in Rhammonc overexpressing 10T1/2 compared to parental 10T1/2 cells (DMSO treated). The kinetics ofc-Jun activation are also slightly altered with Rhammonc-overexpression: phosphorylation of c-Jun reaches maximum levels in Rhammonc expressing cells by 30 minutes and this level is sustained at 60 minutes (DMSO treated; phospho-c-Jun / (3-Actin). In contrast, phospho-c-Jun levels are lower at 30 minutes in parental cells and are highest at 60 minutes (DMSO treated; phospho-c-Jun / (3-Actin). Treatment of both cell lines with the MEK1 inhibitor, PD98059 (50uM), reduces levels of total c-Jun protein and phosphorylated c-Jun protein. Lysates were isolated from cells that were plated in complete growth medium for 4 hours, incubated in serum-free medium for 12 hours and then stimulated with 10% serum for the indicated period of time. Densitometric values for phospho-c-Jun protein levels were normalized to total cellular (3-Actin. Data shown are from 1 of 3 similar experiments. 10T1/2 10T1/2-Rhammonc 0 mins 30 mins 60 mins 0 mins 30 mins 60 mins CD CD en CD CD O) to m m lO in in o o o o o o oo co co co CO co o en O o en O o CD O CO o CO CoD CO o CO oCD CO O CO oCD 2 Q 2 Q 2 Q 2 Q Q 2 Q Q Q. Q Q. Q 0- Q Q. Qs Q. Q Q. Phospho-cJun Total cJun P-Actin DMSO PD98059 10T1/2 10T1/2-Rhammonc 3 c bitr a -C- J a. (a r Q b 0 min 30 min 60 min 0 min 30 min 60 min Time after FCS Stimulation Time after FCS Stimulation Figure 3.18. 10T1/2 cells overexpressing Rhammonc have higher AP-1 activity than parental 10T1/2 cells. Stable overexpression of Rhammonc in 10T1/2 fibroblasts leads to increased AP-1 activity at 4 hours and 24 hours after FCS stimulation as measured by luciferase expression (DMSO treated). The MEK1 inhibitor U0126 (lOuM) inhibits AP- 1 activity in both the parental and Rhammonc overexpressing 10T1/2 fibroblasts. Lysates were isolated from cells that were plated in complete growth medium for 4 hours, incubated in serum-free medium for 12 hours and then stimulated with 10% serum for the indicated period of time. Values represent the Mean and S.E.M., n=3 from 1 of 3 similar experiments. 190 Ohr 4hr 24hr Time After Stimulation (10% FCS) 191 Rhammonc-expressing 10T1/2 and parental 10T1/2 cells (Figure 3.18). However, at both 4 hours and 24 hours, the increases in AP-1 activity in Rhammonc-expressing cells are significantly higher than in the parental cell line (Figure 3.18). Furthermore, although inhibition of MEK1 with U0126 reduces AP-1 activity in both cell lines, inhibition is most pronounced in Rhammonc-expressing cells (Figure 3.18). Collectively, these results indicate that Rhammonc expression promotes dimerization and activation of c-fos and c- Jun. Since upregulated AP-1 transcription activity is strongly linked to neoplastic transformation in fibroblasts (van Dam and Castellazzi 2001; Vogt 2001; Eferl and Wagner 2003; Hess et al. 2004), we next compared the transcriptional profiles of Rhammonc-transfected and parental 10T1/2 fibroblasts using Affymetrix oligonucleotide microarrays. The consequences of ERK1,2 signaling on cellular behaviour depend on its activation kinetics (transient versus sustained activity), as well as its subcellular compartmentalization (Pouyssegur et al. 2002; Boldt and Kolch 2004; Kuida and Boucher 2004). One way that cells can interpret ERK1,2 signaling is through c-fos stabilization, as sustained ERK1,2 signaling is required for c-fos stabilization (Murphy et al. 2002; Murphy et al. 2004). In particular, c-fos is critical for initiating the expression of immediate early genes (IEG) that are then important for responding to the prolonged ERK1,2 signal (Murphy et al. 2002; Murphy et al. 2004). In this way, c-fos acts as a sensor for ERK1,2 activation kinetics. Since Rhamm expression is required for sustained activation of ERK1,2 (Tolg et al. 2006), particularly in the nucleus where it is lost by 30 minutes post-serum stimulation in Rhamm-/- cells, and since Rhammonc overexpression leads to increased levels and activation of c-fos, we assessed the effects of Rhammonc 192 overexpression on the expression of ERK1,2 immediate early genes. Microarray analyses were therefore done on mRNA populations isolated from serum-stimulated (30 minutes) Rhammonc and parental 10T1/2 fibroblasts. Initial analyses revealed that approximately 1000 genes are differentially expressed in 10Tl/2-Rhammonc cells when compared to parental 10T1/2 cells (Appendix B; see Methods for statistical analyses and cut-off values). Using Ingenuity Pathway Assist software (IP A; see Methods for description of algorithm used), 135 of these 1000 differentially expressed genes have been identified as cancer associated genes (Appendix C). These 135 differentially expressed cancer-associated genes were then further functionally classified according to the criteria and examples suggested by Hanahan and Weinberg's "Hallmarks of Cancer" and based on what is currently known about the functions of each of these genes in the literature (Figure 3.19; the fully referenced list can be found in Appendix D) (Hanahan and Weinberg 2000). This functional classification revealed the potential for Rhammonc to regulate or contribute to each of stage of tumourigenesis (Figure 3.19 and Appendix D) including, for example many proto-oncogenes and candidate tumor suppressors, as well as genes that regulate cell survival, apoptosis, senescence, angiogenesis, migration/invasion and genomic stability. Furthermore, of these 135 cancer-associated genes, 19 contain putative CRE or TRE AP-1 binding sequences within their proximal transcriptional regulatory regions (-2000+500) and approximately 75% of these genes have been linked in the literature to regulation of, or regulation by ERK1,2 and/or AP-1 (Appendix C). To further investigate an association between Rhammonc overexpression and ERKl,2-mediated gene transcription, we next compared our Rhammonc transcriptome to a Figure 3.19. Rhammonc overexpression in 10T1/2 fibroblasts results in significantly altered expression of genes involved in each stage of neoplastic transformation and progression. Functional classification of the cancer associated genes with altered expression (upregulation or downregulation) in 10T1/2 fibroblasts stably overexpressing Rhammonc compared to parental 10T1/2 cells reveals a potential role for Rhammonc overexpression in the regulation of each of Hanahan and Weinberg's six "hallmarks of cancer", as well as the enabling characteristic of genomic instability. Appendix D is the complete "hallmarks of cancer" classification of the individual genes, as well as associated references (Hanahan and Weinberg 2002). Number of Genes / Hallmark of Cancer (Altered in 10T1/2-Rhammono Cells as Compared to Control) Self-Sufficiency In Growth Signals Insensitivity to Anti-Growth Signals • I c c Evading Apoptosis 3 3 CT CT CD CD —i O -* —h o— h D c Limitless o •o :> —* Replicative Potential 3 CCOD CD c CO 0) «-t- c CD 0) Q. Sustained »-CD* Q. o Angiogenesis CD C3D CD CD 3 0) CD CO Tissue Invasion and Metastasis Genomic Instability Figure 3.20. Rhammonc versus ERK1,2 transcriptomes. A.) Venn diagram showing the comparison between genes with altered expression in Rhammonc-overexpressing mouse fibroblasts (Rhammonc-10Tl/2 transcriptome) to genes with altered expression in human mammary epithelial cells (MECs) overexpressing a constitutively active MEK1 [MEK1- ERK1,2 transcriptome; (Grill et al. 2004)] showed significant overlap between the two. Approximately 11% of the genes from the Rhammonc-10Tl/2 transcriptome had altered expression in the activated MEK1-expressing MECs while approximately 14% of the genes from the ERK.1,2 transcriptome had altered expression in the Rhammonc-10Tl/2 transcriptome (Appendix E). B.) Hallmarks of cancer (Hanahan and Weinberg 2002) functional classification of cancer-associated genes from that Rhammonc-10Tl/2 transcriptome that had altered expression in the ERK.1,2 transcriptome (Appendix E). 00 > Number of of Genes / Hallmark of Cancer (Rhammonc-Cancer Associated Genes Also Altered in MEK1-Erk1,2 Transcriptome) fi) 3 s Self-Sufficiency (A m In Growth Signals O * najh I •5I-*' 3mU Insensitivity to o 5 Anti-Growth Signals (3D •^ To (D ^2) Evading Apoptosis Limitless Replicative Potential Sustained 7) ra n H 3" Angiogenesis fi) 3 W 3 mc _ Tissue Invasion ri p O o and Metastasis i+ ^i o O 3 H (D Genomic Instability ^ N> Other P ON published ERK1,2 transcriptome in which a mutant active MEK1 was expressed in immortalized but non-transformed human mammary epithelial cells (Grill et al. 2004). Despite these cell background differences (mouse fibroblasts versus human mammary epithelial cells), substantial overlap between the two transcriptomes are observed (Figure 3.20A and Appendix E). Approximately 11% of the genes on the ERK1,2 transcriptome have altered expression in the Rhammonc-expressing cells while approximately 14% of the genes from the Rhammonc transcriptome have altered expression in the ERK1,2 transcriptome (Figure 3.20A and Appendix E) (Grill et al. 2004). To further ensure the specificity of Rhamm on Ras-regulated transformation pathways, I compared the Rhammonc transcriptome to those generated in a study characterizing the oncogenic phenotypes of H-Ras, myc (myelocytomatosis viral oncogene homolog), and E2F 1,2,3 (encoding E2F transcription factors 1, 2 and 3, respectively) when expressed in mouse embryonic fibroblasts (Bild et al. 2006). The Rhammonc transcriptome most strongly resembles the H-Ras transcriptome (approximately 10% overlap) while there was little overlap (0-2%) between the expression profiles of Rhammonc-overexpressing fibroblasts and those expressing myc or E2F proteins (Bild et al. 2006). Therefore, the degree of overlap between the Rhammonc and ERK1,2 transcriptomes is consistent with a role for Rhamm in regulating MEKl-ERKl,2-mediated transcription. To further determine if Rhammonc-overexpression affects a particular subset of ERK1,2 regulated genes that would be important for cellular transformation or genomic stability versus migration or invasion, for example, we next classified all cancer-associated genes that have altered expression in both the Rhammonc and ERK1,2 transcriptomes according to Hanahan and Weinberg's Hallmarks of Cancer (Figure 3.20B and Appendix E) (Hanahan and 198 qnqnqnq sne/onyy ssuso ISBJBI |.-dv eiod jo uoiie|n69y 0/pujds IBUOHdUOSUBJX Aiinqeisui OJOIOUSO \ / (SLUosoa)Ojd o) pe)86je}) siqejsun psziiiqeis • \ / ueuojnieAH 661 200 Weinberg 2000; Grill et al. 2004). Similar to what was described above for the Rhammonc-expressing cells, we found that genes regulated by both MEK1/ERK1,2, as well as Rhammonc, regulate all stages of tumourigenesis. Using quantitative real-time RT-PCR (QPCR) analyses, we next validated the expression of 14 candidate genes (7 upregulated and 7 downregulated) from the microarray analyses. Expression values for each gene were normalized to 28S RNA. QPCR confirms the up and down regulation of genes identified by microarray analysis (Table 3.2). In an effort to specifically determine the consequence of Rhammonc- enhanced ERK1,2 activity on an AP-1 transcriptome, the effect of the MEK1 inhibitor U0126 on the expression of these 14 candidate genes, which were chosen for their known or putative AP-1 regulation (Table 3.2 and Appendix C), was assessed. Five of the 14 genes have altered expression upon MEK1 inhibition (Table 3.2). Interestingly, inhibition of MEK1 significantly affects only genes that are downregulated by Rhammonc overexpression (Table 3.2). The results of this study therefore show that Rhamm acts upstream and downstream of Ras and MEK1 during transformation of 10T1/2 fibroblasts, consistent with roles for both cell surface and intracellular Rhamm forms in neoplastic transformation. It further identifies the formation of a Rhamm/MEKl/ERKl complex that promotes MEK1-mediated activation of ERK1, nuclear trafficking of active ERK1,2, and increased AP-1 activity resulting from increased RSK1,2 activation and c-fos protein stabilization. This study has therefore identified that one "downstream" transforming function of intracellular Rhammonc is to promote AP-1 regulated expression of genes that 201 affect all stages of neoplastic initiation and progression, suggesting that Rhamm's role in tumourigenesis is more complex than previously thought. Table 3.2 Validation of selected genes by quantitative real-time RT-PCR and role of ERK1,2 and AP-1 in regulation and expression of candidate genes Fold Change of Expression in Rhamm°™-10T1/2 cells Associated Hallmark(s) AP-1 Promoter Linked to Linked to MEK1-Erk1,2 Gene Microarray QPCR of Cancer*** Element Erk1,2 AP-1 Transcriptome **** CAT -5.1 * -11.09 2 X X CD44 2.29 2.69 6 X X CSF1 2.84 19.01 1,6 X X X HMGA2 14.52 46.47 1,3 X X X ITGA5 -6.3 * -1.95 1,6 X X MAF 3.92 9.8 1,2 X X MMP9 5.54 ** 6163.56 1,3,6 X X PERP -71.26 *, ** -23366.01 2,3,6 RUNX1 3.9 83.95 2,3,7 X X X TGFb2 -7.96 * -8.6 2,6 X TGFBR2 -2.67 -6.47 2,6,7 TPM1 -3.27 -2 2,6 X VCL -6.3 * -2.17 2,6 X VEGFC 12.16 10.13 6 X X * Expression is significantly altered in Rhammonc-10T1/2 cells with MEK1 inhibition (see Methods for details on MEK1 inhibition) ** MMP9 expression is virtually undetectable in parental 10T1/2 cells; PERP expression is virtually undetectable in Rhammonc-10T1/2 cells *** (1) Self-sufficiency in growth signals; (2) Insensitivity to anti-growth signals; (3) Evading apoptosis; (4) Limitless replicative potential; (5) Sustained angiogenesis; (6) Tissue invasion and metastasis; (7) Genomic Instability (enabling characteristic); (8) Other (Hanahan and Weinberg 2002) Altered expression in the Erk1,2 transcriptome (Grill et al. 2004) 203 3.5 Discussion In this study, we have identified a role for MEK1/ERK1 complexes in the transforming function of Rhammonc. Previous studies have linked Rhamm mRNA and total protein expression to poor outcome, a relationship that is particularly well documented in breast cancer (Assmann et al. 1998; Wang et al. 1998). Prior to this study, two mechanisms for the oncogenic and progressing effects of Rhamm have been proposed: cell surface regulation of H-Ras transforming pathways, in particular, those affecting cell adhesion sites (Hall et al. 1995), and as a promoter of genomic instability resulting from its role as a centrosome/mitotic spindle protein that affects BRCA1/BARD 1-mediated mitotic spindle stability (Joukov et al. 2006; Pujana et al. 2007). Here, we present evidence that is consistent with, but additional to, previous reports implicating Ras transformation pathways in the oncogenic effects of Rhamm. We also identify a specific Rhamm protein that is transforming and that is highly expressed in aggressive tumours and cell lines. We confirm that this Rhamm form is displayed both at the cell surface and inside the cell. Importantly, our data suggest that in addition to the role of cell surface Rhamm in the regulation of Ras signaling, intracellular Rhammonc complexes with MEK1 and ERK1 and this complex results in expression of genes associated with most aspects of cancer progression, including metastasis/invasion and genomic instability. We propose that this multi-point association of Rhammonc with the Ras/MEKl/ERKl pathway accounts not only for the ability of Rhamm to promote metastasis but also for its proposed effects on genomic instability. The seemingly disparate oncogenic functions of cell surface and intracellular Rhamm forms both implicate a highly conserved sequence in the C-terminal region of 204 Rhamm (Hall et al. 1995; Maxwell et al. 2003; Groen et al. 2004; Joukov et al. 2006). We originally described an essential role for basic residues in this region for binding to hyaluronan (Yang et al. 1994), for transformation/metastasis of 10T1/2 cells and for sustaining signaling through the Ras-transformation pathway (Hall et al. 1995; Zhang et al. 1998). Maxwell et al later described a role for this same region in centrosomal targeting of Rhamm (Maxwell et al. 2003) while Groen et al and Joukov et al identified a leucine zipper embedded in this sequence that is required for an association of Rhamm with the apex of mitotic spindles (Groen et al. 2004; Joukov et al. 2006). Joukov et al and Maxwell et al further showed that while Rhamm protein expression is required for mitotic spindle assembly, it can promote spindle instability if overexpressed and if BRCA1 function is impaired (Maxwell et al. 2003; Joukov et al. 2006). Here we provide a third potential oncogenic mechanism of Rhamm in which Rhamm promotes AP-1 regulated expression of genes that affect all stages of tumourigenesis. This includes genes that regulate invasion and migration, as well as genomic stability as may be predicted by Rhamm's previously identified functions. Surprisingly, however, the genes that were the most highly affected by Rhamm expression were those that regulate self-sufficiency in growth, as well as survival or inhibition of anti-growth signals. This is consistent with the previously identified role for cell surface Rhamm in growth factor-regulated responses, including PDGF-mediated activation of ERK1,2 (Zhang et al. 1998). It is further consistent with a role for Rhamm in Ras-regulated signaling and transformation (Hall et al. 1995). The results from this study have demonstrated a dependence of H-Ras, activated MEK1 and Rhammonc on growth factors (serum) for cellular transformation, which is consistent with what has 205 previously been shown for H-Ras (Eisenberg and Henis 2007). However, the upregulation of growth stimulatory factors such as amphiregulin and betacellulin in Rhamm-transformed cells presents the intriguing possibility that Rhamm could function, in part, by decreasing the dependence of Ras on the microenviroment during transformation (Dunbar and Goddard 2000; Mahtouk et al. 2005; Bavik et al. 2006). ERK1 and -2 are two ubiquitous and closely related MAP kinase isoforms that mediate proliferation, differentiation and motility via growth factor and ECM receptor activation (Raman et al. 2007). Elevated activation of these MAP kinases is common in aggressive human tumours, the importance of which is demonstrated by the antitumour effects of the specific inhibitor of their upstream kinase activators MEK1,2 (PD1843 52) in, for example, breast cancer patients (Allen et al. 2003; Roberts and Der 2007). ERK1,2 can be activated by a myriad of extracellular signals and have over 150 different identified substrates (Yoon and Seger 2006). Despite this ubiquitous activation and the vast number of substrates and diverse biological processes regulated by ERK1,2, there are a variety of spatial, temporal, and quantitative cues in place that result in signaling specificity (Kolch 2005). Molecular scaffolds/adapter proteins help achieve this specificity by recruiting signaling pathway components into complexes, much like Rhamm with MEK1 and ERK1. These complexes function by giving pathway members preferential access to one another and to appropriate substrates in specific cellular compartments to ensure the fidelity of a particular signaling response (Kolch 2005). This study has described a physical and functional association of Rhamm with MEK1 and ERK1. It has further shown that through the formation of this complex, Rhamm facilitates MEK1 -mediated activation of ERK1,2 and mediates subcellular 206 trafficking of active ERK1,2, particularly to the nucleus where it can activate AP-1 transcription and where active ERK1,2 is required for cellular transformation (Okazaki and Sagata 1995; Robinson et al. 1998; Yoon and Seger 2006). This functional synergy of Rhamm, MEK1 and ERK1 is similar to what has been described for other known ERK1,2 scaffold/adapter proteins, including IQGAP1, which binds to ERK2 to modulate its activation in response to growth factors as well as its activity (Kolch 2005). In particular, the specificity of Rhamm for ERK1 suggests that Rhamm most closely resembles MEK partner-1 (MP-1), which complexes with MEK1 and ERK1 on endosomes (Kurzbauer et al. 2004; Lunin et al. 2004). However, Rhamm targets ERK1 to the cell periphery, consistent with a role for Rhamm in ERKl,2-promoted migration and invasion (Hamilton et al. 2007), as well as the nucleus to activate AP-1-mediated transcription. Unlike other ERK scaffold/adapter proteins, Rhamm is not constitutively expressed and it is upregulated in response to wounding and during tumourigenesis (Turley et al. 2002; Tolg et al. 2006). ERK 1,2, like Rhamm, localizes to multiple subcellular compartments including the apical pole of mitotic spindles (Cha and Shapiro 2001). These MAP kinases have been linked to hyaluronan-promoted signaling in migration and invasion (Hall et al. 1995; Turley et al. 2002; Kim et al. 2005; Hamilton et al. 2007), as well as to the regulation of mitotic spindle assembly and integrity (Zhang et al. 2005), genomic instability (Cha and Shapiro 2001; Jorquera and Tanguay 2001) and to BRCA1 effects on G2/M progression (Eves et al. 2006). Furthermore, there is increased localization of activated ERK 1,2 to the mitotic spindle poles and on microtubules in cells with an activated Ras (Harrison and Turley 2001). This raises the interesting possibility that the 207 regulation of ERK1,2 at the mitotic spindle apex may represent a mechanism through which Rhamm can contribute to genomic instability. Rhamm and ERK1,2 have both been linked to cell cycle progression through G2/M. Mohapatra et al originally demonstrated a role for cell surface Rhamm (Mohapatra et al. 1996). However, subsequent studies have implicated intracellular Rhamm forms through the regulation of mitotic spindle assembly and integrity at G2/M (Maxwell et al. 2003; Groen et al. 2004). A role for Rhamm at the G2/M cell cycle boundary is consistent with the interaction of Rhamm with ERK1 and not ERK2, as ERK1 has been particularly linked to progression through G2/M (Sette et al. 1999; Liu et al. 2004). In contrast, ERK2 functions at the Gl/S boundary (Liu etal. 2004). The regulation of ERK1 activation and activity by cell surface and intracellular Rhamm forms could therefore represent a novel example of extracellular and intracellular coordinated regulation of mitosis. The expression of shorter Rhamm protein forms has been reported in aggressive tumours and in breast cancer cell lines that express H-Ras (Abetamann et al. 1996; Assmann et al. 1998; Li et al. 2000; Zhou et al. 2002; Kong et al. 2003; Zaman et al. 2005; Hamilton et al. 2007). However, most studies linking Rhamm expression to clinical outcome in cancer have relied on mRNA expression and no systematic study comparing the transformation potential of the various Rhamm isoforms has been done to date. This study has demonstrated that only the 72kDa Rhamm isoform (referred to as Rhammonc) was transforming in 10T1/2 cells. Interestingly, The N-terminal sequence (murine aa1"163) that is present only in the full-length protein, which was not transforming, was able to inhibit the transforming potential of the Rhammonc. This may 208 suggest that Rhamm is activated via removal of its N-terminal sequence, similar to other oncogenic proteins like Raf and Vav (Nagao et al. 1986; Swat and Fujikawa 2005). However, it is not known how the N-terminal sequence in the full-length Rhamm protein mediates it's inhibitory effect. The role of Rhamm in neoplastic initiation and progression has therefore been controversial as it is difficult to reconcile its proposed oncogenic functions as a cell surface receptor that determines, for example, CD44 and hyaluronan activity and function (Hall et al. 1995; Hamilton et al. 2007) from its role as an intracellular mitotic spindle protein that contributes to genomic instability (Joukov et al. 2006; Pujana et al. 2007). Rhamm represents a quintessential cytoplasmic protein, lacking both a signal peptide for export through the Golgi/ER and a membrane spanning sequence. It belongs to a group of disparate cytoplasmic proteins that are secreted by unconventional mechanisms (Radisky et al. 2003). Intriguingly, many of these itinerant proteins are exported during stress responses and transformation (Radisky et al. 2003). Rhamm could therefore represent a novel inside-outside signaling mechanism that functions in normal wound repair but is activated during tumourigenesis. 3.6 References Abetamann, V., Kern, H. F. and Elsasser, H. P. 1996. Differential expression of the hyaluronan receptors CD44 and RHAMM in human pancreatic cancer cells. Clin Cancer Res. 2,1607-18. Aitken, K. and Bagl, D. J. 2001. Stretch-induced bladder smooth muscle cell (SMC) proliferation is mediated by RHAMM-dependent extracellular-regulated kinase (erk) signaling. Urology. 57,109. 209 Allen, L. F., Sebolt-Leopold, J. and Meyer, M. B. 2003. CI-1040 (PD184352), a targeted signal transduction inhibitor of MEK (MAPKK). Semin Oncol. 30, 105-16. Assmann, V., Jenkinson, D., Marshall, J. F. and Hart, I. R. 1999. The intracellular hyaluronan receptor RHAMM/IHABP interacts with microtubules and actin filaments. J Cell Sci. 112 (Pt 22), 3943-54. Assmann, V., Marshall, J. F., Fieber, C, Hofmann, M. and Hart, I. R. 1998. The human hyaluronan receptor RHAMM is expressed as an intracellular protein in breast cancer cells. J Cell Sci. Ill ( Pt 12), 1685-94. Bavik, C, Coleman, I., Dean, J. P., Knudsen, B., Plymate, S. and Nelson, P. S. 2006. The gene expression program of prostate fibroblast senescence modulates neoplastic epithelial cell proliferation through paracrine mechanisms. Cancer Res. 66, 794- 802. Bild, A. H., Yao, G., Chang, J. T., Wang, Q., Potti, A., Chasse, D., Joshi, M. B., Harpole, D., Lancaster, J. M., Berchuck, A., et al. 2006. Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature. 439, 353-7. Bissell, M. J. and Radisky, D. 2001. Putting tumours in context. Nat Rev Cancer. 1, 46- 54. Bissell, M. J., Radisky, D. C, Rizki, A., Weaver, V. M. and Petersen, O. W. 2002. The organizing principle: microenvironmental influences in the normal and malignant breast. Differentiation. 70, 537-46. Boldt, S. and Kolch, W. 2004. Targeting MAPK signalling: Prometheus' fire or Pandora's box? Curr Pharm Des. 10, 1885-905. Bourne, H. R., Sanders, D. A. and McCormick, F. 1990. The GTPase superfamily: a conserved switch for diverse cell functions. Nature. 348,125-32. Cha, H. and Shapiro, P. 2001. Tyrosine-phosphorylated extracellular signal—regulated kinase associates with the Golgi complex during G2/M phase of the cell cycle: evidence for regulation of Golgi structure. J Cell Biol. 153, 1355-67. 210 Cheung, W. F., Cruz, T. F. and Turley, E. A. 1999. Receptor for hyaluronan-mediated motility (RHAMM), a hyaladherin that regulates cell responses to growth factors. Biochem Soc Trans. 27, 135-42. Dhillon, A. S., Hagan, S., Rath, O. and Kolch, W. 2007. MAP kinase signalling pathways in cancer. Oncogene. 26, 3279-90. Dirks, P. B. 2006. Cancer: stem cells and brain tumours. Nature. 444, 687-8. Dolberg, D. S., Hollingsworth, R., Hertle, M. and Bissell, M. J. 1985. Wounding and its role in RSV-mediated tumor formation. Science. 230, 676-8. Dunbar, A. J. and Goddard, C. 2000. Structure-function and biological role of betacellulin. Int J Biochem Cell Biol. 32, 805-15. Eferl, R. and Wagner, E. F. 2003. AP-1: a double-edged sword in tumorigenesis. Nat Rev Cancer. 3, 859-68. Eisenberg, S. and Henis, Y. I. 2008. Interactions of Ras proteins with the plasma membrane and their roles in signaling. Cell Signal. 20, 31-9. Eves, E. M., Shapiro, P., Naik, K., Klein, U. R., Trakul, N. and Rosner, M. R. 2006. Raf kinase inhibitory protein regulates aurora B kinase and the spindle checkpoint. Mol Cell. 23, 561-74. Farber, E. 1984. The multistep nature of cancer development. Cancer Res. 44,4217-23. Fisher, B. and Fisher, E. R. 1968. Role of host and tumor calcium in metastases. Cancer Res. 28, 1753-8. Garcia, M. and Samarut, J. 1990. Cooperation of v-jun and v-erbB oncogenes in embryo fibroblast transformation in vitro and in vivo. J Virol. 64, 4684-90. Gares, S. L. and Pilarski, L. M. 2000. Balancing thymocyte adhesion and motility: a functional linkage between betal integrins and the motility receptor RHAMM. Dev Immunol. 7, 209-25. 211 Grill, C, Gheyas, F., Dayananth, P., Jin, W., Ding, W., Qiu, P., Wang, L., Doll, R. J. and English, J. M. 2004. Analysis of the ERK1,2 transcriptome in mammary epithelial cells. Biochem J. 381, 635-44. Groen, A. C, Cameron, L. A., Coughlin, M., Miyamoto, D. T., Mitchison, T. J. and Ohi, R. 2004. XRHAMM functions in ran-dependent microtubule nucleation and pole formation during anastral spindle assembly. Curr Biol. 14,1801-11. Hagemann, C. and Blank, J. L. 2001. The ups and downs of MEK kinase interactions. Cell Signal. 13, 863-75. Hall, C. L., Yang, B., Yang, X., Zhang, S., Turley, M., Samuel, S., Lange, L. A., Wang, C, Curpen, G. D., Savani, R. C., et al. 1995. Overexpression of the hyaluronan receptor RHAMM is transforming and is also required for H-ras transformation. Cell. 82,19-26. Hamilton, S. R., Fard, S. F., Paiwand, F. F., Tolg, C, Veiseh, M., Wang, C, McCarthy, J. B., Bissell, M. J., Koropatnick, J. and Turley, E. A. 2007. The hyaluronan receptors CD44 and Rhamm (CD 168) form complexes with ERK1,2 that sustain high basal motility in breast cancer cells. J Biol Chem. 282,16667-80. Hanahan, D. and Weinberg, R. A. 2000. The hallmarks of cancer. Cell. 100, 57-70. Harrison, R. E. and Turley, E. A. 2001. Active erk regulates microtubule stability in H- ras-transformed cells. Neoplasia. 3, 385-94. Heasley, L. E. and Han, S. Y. 2006. INK regulation of oncogenesis. Mol Cells. 21, 167- 73. Hess, J., Angel, P. and Schorpp-Kistner, M. 2004. AP-1 subunits: quarrel and harmony among siblings. J Cell Sci. 117, 5965-73. Huang, L. E., Bindra, R. S., Glazer, P. M. and Harris, A. L. 2007. Hypoxia-induced genetic instability—a calculated mechanism underlying tumor progression. J Mol Med. 85,139-48. Janulis, M., Silberman, S., Ambegaokar, A., Gutkind, J. S. and Schultz, R. M. 1999. Role of mitogen-activated protein kinases and c-Jun/AP-1 trans-activating activity in 212 the regulation of protease mRNAs and the malignant phenotype in NIH 3T3 fibroblasts. J Biol Chem. 274, 801-13. Johnson, R., Spiegelman, B., Hanahan, D. and Wisdom, R. 1996. Cellular transformation and malignancy induced by ras require c-jun. Mol Cell Biol. 16,4504-11. Jorquera, R. and Tanguay, R. M. 2001. Fumarylacetoacetate, the metabolite accumulating in hereditary tyrosinemia, activates the ERK pathway and induces mitotic abnormalities and genomic instability. Hum Mol Genet. 10,1741-52. Joukov, V., Groen, A. C, Prokhorova, T., Gerson, R., White, E., Rodriguez, A., Walter, J. C. and Livingston, D. M. 2006. The BRCA1/BARD1 heterodimer modulates ran-dependent mitotic spindle assembly. Cell. 127, 539-52. Kim, M. S., Park, M. J., Kim, S. J., Lee, C. H., Yoo, H., Shin, S. H., Song, E. S. and Lee, S. H. 2005. Emodin suppresses hyaluronic acid-induced MMP-9 secretion and invasion of glioma cells. IntJOncol. 27, 839-46. Kolch, W. 2005. Coordinating ERK/MAPK signalling through scaffolds and inhibitors. Nat Rev Mol Cell Biol. 6, 827-37. Kong, Q. Y., Liu, J., Chen, X. Y., Wang, X. W., Sun, Y. and Li, H. 2003. Differential expression patterns of hyaluronan receptors CD44 and RHAMM in transitional cell carcinomas of urinary bladder. Oncol Rep. 10, 51-5. Kuida, K. and Boucher, D. M. 2004. Functions of MAP kinases: insights from gene- targeting studies. JBiochem (Tokyo). 135, 653-6. Kurzbauer, R., Teis, D., de Araujo, M. E., Maurer-Stroh, S., Eisenhaber, F., Bourenkov, G. P., Bartunik, H. D., Hekman, M., Rapp, U. R., Huber, L. A., et al. 2004. Crystal structure of the pl4/MPl scaffolding complex: how a twin couple attaches mitogen-activated protein kinase signaling to late endosomes. Proc Natl Acad Sci USA. 101, 10984-9. Kuwabara, H., Yoneda, M., Nagai, M., Hayasaki, H. and Mori, H. 2004. A new polyclonal antibody that recognizes a human receptor for hyaluronan mediated motility. Cancer Lett. 210, 73-80. 213 Li, H., Guo, L., Li, J. W., Liu, N., Qi, R. and Liu, J. 2000. Expression of hyaluronan receptors CD44 and RHAMM in stomach cancers: relevance with tumor progression. IntJOncol. 17, 927-32. Liu, X., Yan, S., Zhou, T., Terada, Y. and Erikson, R. L. 2004. The MAP kinase pathway is required for entry into mitosis and cell survival. Oncogene. 23, 763-76. Lokeshwar, V. B. and Selzer, M. G. 2000. Differences in hyaluronic acid-mediated functions and signaling in arterial, microvessel, and vein-derived human endothelial cells. J Biol Chem. 275, 27641-9. Lunin, V. V., Munger, C, Wagner, J., Ye, Z., Cygler, M. and Sacher, M. 2004. The structure of the MAPK scaffold, MP1, bound to its partner, pi 4. A complex with a critical role in endosomal map kinase signaling. J Biol Chem. 279, 23422-30. Lynn, B. D., Li, X., Cattini, P. A., Turley, E. A. and Nagy, J. I. 2001. Identification of sequence, protein isoforms, and distribution of the hyaluronan-binding protein RHAMM in adult and developing rat brain. J Comp Neurol. 439, 315-30. Lynn, B. D., Turley, E. A. and Nagy, J. I. 2001. Subcellular distribution, calmodulin interaction, and mitochondrial association of the hyaluronan-binding protein RHAMM in rat brain. JNeurosci Res. 65, 6-16. Mahtouk, K., Hose, D., Reme, T., De Vos, J., Jourdan, M., Moreaux, J., Fiol, G., Raab, M., Jourdan, E., Grau, V., et al. 2005. Expression of EGF-family receptors and amphiregulin in multiple myeloma. Amphiregulin is a growth factor for myeloma cells. Oncogene. 24, 3512-24. Maxwell, C. A., Keats, J. J., Belch, A. R., Pilarski, L. M. and Reiman, T. 2005. Receptor for hyaluronan-mediated motility correlates with centrosome abnormalities in multiple myeloma and maintains mitotic integrity. Cancer Res. 65, 850-60. Maxwell, C. A., Keats, J. J., Crainie, M., Sun, X., Yen, T., Shibuya, E., Hendzel, M., Chan, G. and Pilarski, L. M. 2003. RHAMM is a centrosomal protein that interacts with dynein and maintains spindle pole stability. Mol Biol Cell. 14, 2262-76. Mohapatra, S., Yang, X., Wright, J. A., Turley, E. A. and Greenberg, A. H. 1996. Soluble hyaluronan receptor RHAMM induces mitotic arrest by suppressing Cdc2 and cyclin Bl expression. J Exp Med. 183, 1663-8. 214 Muller, C, Paupert, J., Monferran, S. and Salles, B. 2005. The double life of the Ku protein: facing the DNA breaks and the extracellular environment. Cell Cycle. 4, 438-41. Murga, M. and Fernandez-Capetillo, O. 2007. Genomic instability: on the birth and death of cancer. Clin Transl Oncol. 9, 216-20. Murphy, L. O., MacKeigan, J. P. and Blenis, J. 2004. A network of immediate early gene products propagates subtle differences in mitogen-activated protein kinase signal amplitude and duration. Mol Cell Biol. 24,144-53. Murphy, L. O., Smith, S., Chen, R. H., Fingar, D. C. and Blenis, J. 2002. Molecular interpretation of ERK signal duration by immediate early gene products. Nat Cell Biol. 4, 556-64. Nagao, M., Ishikawa, F., Tahira, T., Ochiai, M. and Sugimura, T. 1986. Activation of rat and human c-raf(-l) by rearrangement. Princess Takamatsu Symp. 17, 75-84. Nangia-Makker, P., Nakahara, S., Hogan, V. and Raz, A. 2007. Galectin-3 in apoptosis, a novel therapeutic target. JBioenerg Biomembr. 39, 79-84. Nickel, W. 2005. Unconventional secretory routes: direct protein export across the plasma membrane of mammalian cells. Traffic. 6, 607-14. Okazaki, K. and Sagata, N. 1995. The Mos/MAP kinase pathway stabilizes c-Fos by phosphorylation and augments its transforming activity in NIH 3T3 cells. Embo J. 14, 5048-59. Pilarski, L. M., Masellis-Smith, A., Belch, A. R., Yang, B., Savani, R. C. and Turley, E. A. 1994. RHAMM, a receptor for hyaluronan-mediated motility, on normal human lymphocytes, thymocytes and malignant B cells: a mediator in B cell malignancy? Leuk Lymphoma. 14, 363-74. Pilarski, L. M., Pruski, E., Wizniak, J., Paine, D., Seeberger, K., Mant, M. J., Brown, C. B. and Belch, A. R. 1999. Potential role for hyaluronan and the hyaluronan receptor RHAMM in mobilization and trafficking of hematopoietic progenitor cells. Blood.93, 2918-27. 215 Pouyssegur, J., Volmat, V. and Lenormand, P. 2002. Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling. Biochem Pharmacol. 64, 755-63. Pujana, M. A., Han, J. D., Starita, L. M., Stevens, K. N., Tewari, M., Ahn, J. S., Rennert, G., Moreno, V., Kirchhoff, T., Gold, B., et al. 2007. Network modeling links breast cancer susceptibility and centrosome dysfunction. Nat Genet. Radisky, D., Hagios, C. and Bissell, M. J. 2001. Tumors are unique organs defined by abnormal signaling and context. Semin Cancer Biol. 11, 87-95. Radisky, D. C. and Bissell, M. J. 2006. Matrix metalloproteinase-induced genomic instability. Curr Opin Genet Dev. 16, 45-50. Radisky, D. C, Hirai, Y. and Bissell, M. J. 2003. Delivering the message: epimorphin and mammary epithelial morphogenesis. Trends Cell Biol. 13, 426-34. Radisky, D. C., Levy, D. D., Littlepage, L. E., Liu, H., Nelson, C. M., Fata, J. E., Leake, D., Godden, E. L., Albertson, D. G., Nieto, M. A., et al. 2005. Raclb and reactive oxygen species mediate MMP-3-induced EMT and genomic instability. Nature. 436,123-7. Raman, M., Chen, W. and Cobb, M. H. 2007. Differential regulation and properties of MAPKs. Oncogene. 26, 3100-12. Roberts, P. J. and Der, C. J. 2007. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 26, 3291 -310. Robinson, M. J., Stippec, S. A., Goldsmith, E., White, M. A. and Cobb, M. H. 1998. A constitutively active and nuclear form of the MAP kinase ERK2 is sufficient for neurite outgrowth and cell transformation. Curr Biol. 8,1141-50. Rosner, M. R. 2007. MAP kinase meets mitosis: a role for Raf Kinase Inhibitory Protein in spindle checkpoint regulation. Cell Div. 2, 1. Sales, K. M., Winslet, M. C. and Seifalian, A. M. 2007. Stem Cells and Cancer: An Overview. Stem Cell Rev. 216 Savani, R. C, Wang, C, Yang, B., Zhang, S., Kinsella, M. G., Wight, T. N., Stern, R., Nance, D. M. and Turley, E. A. 1995. Migration of bovine aortic smooth muscle cells after wounding injury. The role of hyaluronan and RHAMM. J Clin Invest. 95,1158-68. Schubbert, S., Shannon, K. and Bollag, G. 2007. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer. 7, 295-308. Sette, C, Barchi, M., Bianchini, A., Conti, M., Rossi, P. and Geremia, R. 1999. Activation of the mitogen-activated protein kinase ERK1 during meiotic progression of mouse pachytene spermatocytes. J Biol Chem. 21 A, 33571-9. Shakib, K., Norman, J. T., Fine, L. G., Brown, L. R. and Godovac-Zimmermann, J. 2005. Proteomics profiling of nuclear proteins for kidney fibroblasts suggests hypoxia, meiosis, and cancer may meet in the nucleus. Proteomics. 5, 2819-38. Sheridan, C, Kishimoto, H., Fuchs, R. K., Mehrotra, S., Bhat-Nakshatri, P., Turner, C. H., Goulet, R., Jr., Badve, S. and Nakshatri, H. 2006. CD44+/CD24- breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res. 8, R59. Shipitsin, M., Campbell, L. L., Argani, P., Weremowicz, S., Bloushtain-Qimron, N., Yao, J., Nikolskaya, T., Serebryiskaya, T., Beroukhim, R., Hu, M., et al. 2007. Molecular definition of breast tumor heterogeneity. Cancer Cell. 11,259-73. Sieweke, M. H. and Bissell, M. J. 1994. The tumor-promoting effect of wounding: a possible role for TGF-beta-induced stromal alterations. Crit Rev Oncog. 5, 297- 311. Swat, W. and Fujikawa, K. 2005. The Vav family: at the crossroads of signaling pathways. Immunol Res. 32, 259-65. Tanos, T., Marinissen, M. J., Leskow, F. C, Hochbaum, D., Martinetto, H., Gutkind, J. S. and Coso, O. A. 2005. Phosphorylation of c-Fos by members of the p38 MAPK family. Role in the AP-1 response to UV light. J Biol Chem. 280,18842-52. Terasawa, K., Okazaki, K. and Nishida, E. 2003. Regulation of c-Fos and Fra-1 by the MEK5-ERK5 pathway. Genes Cells. 8, 263-73. 217 Tolg, C, Hamilton, S. R., Nakrieko, K. A., Kooshesh, F., Walton, P., McCarthy, J. B., Bissell, M. J. and Turley, E. A. 2006. Rhamm-/- fibroblasts are defective in CD44-mediated ERK1,2 motogenic signaling, leading to defective skin wound repair. J Cell Biol. 175, 1017-28. Tolg, C, Poon, R., Fodde, R., Turley, E. A. and Alman, B. A. 2003. Genetic deletion of receptor for hyaluronan-mediated motility (Rhamm) attenuates the formation of aggressive fibromatosis (desmoid tumor). Oncogene. 22, 6873-82. Toole, B. P. 2004. Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer. 4, 528-39. Turley, E. A., Noble, P. W. and Bourguignon, L. Y. 2002. Signaling properties of hyaluronan receptors. J Biol Chem. 277, 4589-92. van Dam, H. and Castellazzi, M. 2001. Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis. Oncogene. 20, 2453-64. van Heemst, D., den Reijer, P. M. and Westendorp, R. G. 2007. Ageing or cancer: A review On the role of caretakers and gatekeepers. Eur J Cancer. 43,2144-52. Vogt, P. K. 2001. Jun, the oncoprotein. Oncogene. 20, 2365-77. Wang, C, Thor, A. D., Moore, D. H., 2nd, Zhao, Y., Kerschmann, R., Stern, R., Watson, P. H. and Turley, E. A. 1998. The overexpression of RHAMM, a hyaluronan- binding protein that regulates ras signaling, correlates with overexpression of mitogen-activated protein kinase and is a significant parameter in breast cancer progression. Clin Cancer Res. 4, 567-76. Wang, F., Hansen, R. K., Radisky, D., Yoneda, T., Barcellos-Hoff, M. H., Petersen, O. W., Turley, E. A. and Bissell, M. J. 2002. Phenotypic reversion or death of cancer cells by altering signaling pathways in three-dimensional contexts. J Natl Cancer Inst. 94,1494-503. Weinberg, R. A. 1989. Oncogenes, antioncogenes, and the molecular bases of multistep carcinogenesis. Cancer Res. 49, 3713-21. 218 Wick, M., Lucibello, F. C. and Muller, R. 1992. Inhibition of Fos- and Ras-induced transformation by mutant Fos proteins with structural alterations in functionally different domains. Oncogene. 7, 859-67. Yan, Y., Spieker, R. S., Kim, M., Stoeger, S. M. and Cowan, K. H. 2005. BRCA1- mediated G2/M cell cycle arrest requires ERK1/2 kinase activation. Oncogene. 24, 3285-96. Yang, B., Yang, B. L., Savani, R. C. and Turley, E. A. 1994. Identification of a common hyaluronan binding motif in the hyaluronan binding proteins RHAMM, CD44 and link protein. Embo J. 13, 286-96. Yoon, S. and Seger, R. 2006. The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors. 24, 21-44. Zaman, A., Cui, Z., Foley, J. P., Zhao, H., Grimm, P. C, Delisser, H. M. and Savani, R. C. 2005. Expression and role of the hyaluronan receptor RHAMM in inflammation after bleomycin injury. Am JRespir Cell Mol Biol. 33, 447-54. Zhang, S., Chang, M. C, Zylka, D., Turley, S., Harrison, R. and Turley, E. A. 1998. The hyaluronan receptor RHAMM regulates extracellular-regulated kinase. J Biol Chem. 273,11342-8. Zhang, W. L., Huitorel, P., Glass, R., Fernandez-Serra, M., Arnone, M. I., Chiri, S., Picard, A. and Ciapa, B. 2005. A MAPK pathway is involved in the control of mitosis after fertilization of the sea urchin egg. Dev Biol. 282, 192-206. Zhou, R., Wu, X. and Skalli, O. 2002. The hyaluronan receptor RHAMM/IHABP in astrocytoma cells: expression of a tumor-specific variant and association with microtubules. JNeurooncol. 59, 15-26. CHAPTER 4. Discussion 4.1 Thesis Summary and Significance My thesis was directed towards gaining a better understanding of the mechanisms through which intracellular Rhamm protein forms contribute to neoplastic initiation and progression. My specific goal was to define the signaling pathways necessary for the transforming functions of Rhamm. The first objective of this thesis was to determine the mechanism(s) used by cell surface and/or intracellular Rhamm to regulate ERK1,2. Studies of wound repair in Rhamm-/- mice previously revealed that the kinetics of ERK1,2 activation and motogenic signaling is altered when Rhamm expression is absent (Tolg et al. 2006). Particularly, in the absence of Rhamm, active (phosphorylated) ERK1,2 was not sustained at the cell periphery or in the nucleus (Tolg et al. 2006). Therefore, I assessed whether Rhamm hyper-expression in invasive breast tumour cell lines promotes ERK1,2 activation and ERK-regulated motogenic signaling. My analyses, outlined in Chapter 2, confirmed Rhamm promotion of ERK.1,2 activation. This study revealed a novel autocrine mechanism used by invasive breast cancer cells (MDA-MB-231 and Ras-MCFIOA) to sustain high basal rates of motility. This mechanism involved increased endogenous production of hyaluronan, increased cell surface display of CD44 and Rhamm, and the formation of Rhamm-CD44-ERK1,2 complexes, which uniquely colocalized in the perinuclear region of the MDA-MB-231 cells. Cell surface Rhamm was further identified as a coreceptor for CD44 that functioned, in part, by maintaining CD44 expression at the cell surface. CD44 and Rhamm were shown to act co-ordinately to 220 promote ERK 1,2-regulated motogenic signaling in invasive breast cancer cells. These results also illustrated how Rhamm hyperexpression, seen only in the aggressive breast cancer cells, could promote constitutive ERK 1,2 activation, resulting in increased motogenic signaling. While previous studies have reported that Rhamm and CD44 can both independently regulate hyaluronan-mediated motility of various cell types, this is the first report showing both a physical and functional association of the two receptors (Nagy et al. 1998; Herrera-Gayol and Jothy 1999; Pilarski et al. 1999; Nedvetzki et al. 2004). I was specifically interested in stromal functions during tumor progression and because Rhamm is transforming in fibroblasts in vitro and in vivo but not in epithelial cells in vivo (Hall et al. 1995; Tolg et al. 2003), my next objective was to identify the transformation pathway(s) regulated by Rhamm overexpression in fibroblasts. As studies have previously linked Rhamm to Ras-regulated transformation pathways (Hall et al. 1995; Hall et al. 1996; Zhang et al. 1998), I wanted to determine if oncogenic Rhamm (Rhammonc) isoforms act through the Ras-MEK-ERK1,2 MAP kinase cascade to promote fibroblast transformation, which I addressed in the first portion of Chapter 3. To meet this objective I looked at the effect of either dominant negative Rhammonc (Rhammonc/HABD") on fibroblast transformation by activated members of this MAPK pathway or of dominant negative (kinase dead) members of this pathway on Rhammonc- mediated fibroblast transformation. The results from these experiments provide further evidence for the role of this Ras-regulated pathway in Rhamm-promoted fibroblast transformation. Furthermore, my results show that in addition to Rhamm effects upstream of Ras, intracellular Rhamm forms also activate this pathway downstream of Ras and MEK1. This study further demonstrates that the oncogenic functions of Rhamm 221 are restricted to a carboxyl-terminal sequence (murine aa164-aa794), which contains the previously identified hyaluronan and mitotic spindle binding domains, as well as a direct binding site for ERK1 that is required for constitutive activation of ERK1,2 in Rhamm- transformed cells. The finalobjectiv e of this thesis was to determine the downstream functions of ERK1,2, with respect to cellular transformation and/or neoplastic progression, that can be altered by Rhammonc overexpression. As was described earlier, over 150 different ERK1,2 substrates from multiple subcellular compartments have been identified (Yoon and Seger 2006). However, the phosphorylation and regulation of various transcription factors in the nucleus was one of the earliest and best described functions of ERK1,2 (Yoon and Seger 2006). As studies in Rhamm-/- mice have clearly identified a requirement for Rhamm in maintaining nuclear levels of active ERK1,2 (Tolg et al. 2006), nuclear functions of ERK.1,2 were the first to be examined. I found increased levels of nuclear active ERK1,2 in Rhammonc-transformed fibroblasts, which led to increased activation of RSK1,2, increased c-fos protein stability and increased AP-1- mediated gene expression. Using microarray analysis as a platform to identify global changes in gene expression and to determine the effect of Rhammonc on AP-1 mediated gene transcription, I compared the expression profiles of parental 10T1/2 fibroblastswit h Rhammonc- transformed 10T1/2 fibroblasts. The analyses initially revealed significantly altered expression (up and down regulation) of approximately 1000 genes in the Rhamm- transformed cells. Comparative analyses of this Rhamm transformation transcriptome to a published ERK.1,2 transcriptome demonstrated substantial overlap between the two 222 (Grill et al. 2004). Approximately 11% of the genes on the ERK1,2 transcriptome had altered expression in the Rhammonc overexpressing fibroblasts while approximately 14% of the genes from the Rhammonc transcriptome had altered expression in the ERK1,2 transcriptome. The overlap between my study and the published study was observed despite significant differences in cell background (the Rhamm transcriptome was generated from transformed mouse embryonic fibroblasts versus the ERK1,2 transcriptome from human mammary epithelial cells expressing an activated MEK1) (Grill et al. 2004). My analyses were therefore consistent with a role for Rhamm on ERKl,2-mediated transcription. In addition, I found that approximately 75% of the cancer-associated genes with altered expression in Rhamm-transformed cells had been previously linked to either regulation of, or regulation by ERK1,2 and/or AP-1, consistent with a role for AP-1 in Rhamm-mediated transformation. Finally, analysis of these same cancer-associated genes identified a role for Rhamm in all stages of tumourigenesis including genes involved in tumour invasion, metastasis and genomic stability, consistent with its previously reported functions. Most of the alterations in gene expression are changes in genes linked to self-sufficiency in growth signals and insensitivity to anti- growth inhibition. These results suggest that Rhamm affects oncogenesis in a much more complex manner than previously proposed. 4.2 Synthesis and Discussion Previous studies have shown Rhamm to be an important contributor to cancer progression. Rhamm upregulation has been correlated to aggressive neoplastic disease and poor prognosis in many cancers of different origins, including breast, stomach, colon 223 and pancreatic carcinomas and multiple myeloma (Turley et al. 1993; Assmann et al. 1998; Wang et al. 1998; Yamada et al. 1999; Li et al. 2000; Rein et al. 2003). Furthermore, an N-terminally truncated Rhamm isoform (oncogenic Rhamm or Rhammonc) is transforming in immortalized fibroblasts (Hall et al. 1995; Zhang et al. 1998). This Rhamm isoform is highly expressed in many human tumours (Wang et al. 1998; Li et al. 2000), in #-i?as-transformed cells, and in cells after wounding. However, our understanding of the mechanisms underlying Rhamm's role in tumourigenesis have remained largely unknown, illustrating the need for further studies to identify specific functions by which different Rhamm isoforms in different cellular locations contribute to neoplastic initiation and progression. To date, Rhamm has independently been studied as a cell surface hyaluronan receptor that regulates the H-Ras oncogenic pathway(s) (Hall et al. 1995; Zhang et al. 1998) or as an intracellular centrosomal protein involved in BRCAl/BARDl-mediated mitotic spindle stability and genomic instability (Maxwell et al. 2003; Joukov et al. 2006; Pujana et al. 2007). Either of Rhamm's known cell surface or intracellular functions has oncogenic potential and one goal of this thesis was to reconcile these seemingly disparate oncogenic functions. 4.2.1 Cell Surface Rhamm in Tumourigenesis The first evidence of a role for cell surface Rhamm in malignant transformation and progression was in malignant B-lymphocytes, where Rhamm was highly expressed in late stage B cells and plasma cells (Turley et al. 1993). A requirement for cell surface Rhamm in H-Ras and Rhammonc-mediated transformation in fibroblasts has also been demonstrated (Hall et al. 1995). Furthermore, several clinical studies have identified 224 Rhamm as a tumor associated antigen using serological identification of antigens by recombinant expression cloning (SEREX). SEREX allows for the identification of antigenic proteins in cancer through the screening of sera isolated from cancer patients against a tumour-derived cDNA library, thus identifying gene products that have induced antibody production within the patient (Sahin et al. 1995). Rhamm has been identified by SEREX as a tumour-associated antigen in melanoma, colon, renal cell, breast and ovarian carcinomas, as well as in acute and chronic myeloid leukemias (AML and CML) (Greiner et al. 2002; Line et al. 2002; Greiner et al. 2003). Collectively, these studies demonstrate a role for cell surface Rhamm forms in cellular transformation and cancer progression. While the precise roles played by cell surface Rhamm during tumourigenesis are not entirely understood, various studies have given some insight. Rhamm is a well- documented cell surface receptor that mediates random motility of a variety of cell types in response to serum, scratch wounding, hyaluronan and PDGF (Turley 1989; Savani et al. 1995; Zhang et'al. 1995; Nedvetzki et al. 2004; Tolg et al. 2006). Rhamm is also required for PDGF and hyaluronan-mediated activation of signaling cascades including protein phospho-tyrosine kinases such as src (Hall et al. 1996), FAK (Hall et al. 1994; Lokeshwar and Selzer 2000), and other kinases such as PKC (Hall et al. 2001) and ERK (Zhang et al. 1998). Rhamm functions in progression through the G2/M transition of the cell cycle (Mohapatra et al. 1996), as well as in tubule formation during angiogenesis (Savani et al. 2001). Furthermore, the hyaluronan-binding functions of Rhamm can compensate for loss of CD44 during chronic inflammation and can, in fact, enhance splenocyte motility/invasion in the absence of CD44 (Nedvetzki et al. 2004). These and other studies support the link between the extracellular or cell surface functions of Rhamm (hyaluronan binding, signaling, and CD44 compensation) with transformation and tumour progression. The multiple cell surface functions of Rhamm are shared by CD44 and the experiments outlined in Chapter 2 of this thesis link a physical and functional association between these two receptors to migration of invasive breast cancer cell lines. The association of CD44 with the progression and clinical outcome of breast, prostate and other cancers has been controversial. A recent report observed that CD44+ subsets sorted from human breast tumours express gene signatures that are prognostic for poor outcome (Shipitsin et al. 2007). A similar study was done earlier this year, which showed that the gene signature from CD44+/CD24- cells isolated from the pleural effusions of breast cancer patients predicted poor outcome in breast, prostate and other cancers (Liu et al. 2007). While both of these studies are consistent with other reports linking CD44 expression and function to aggressive (e.g. invasive) behaviour of breast cancer cells for example (Toole 2004), they conflict with equally convincing evidence linking CD44 expression to increased survival in human breast cancers (Diaz et al. 2005) and suppression of metastasis in animal models of breast cancer (Lopez et al. 2005). Furthermore, in the same study that assessed the prognostic value of the gene signature from CD44+ breast cancer cell subsets, CD44 expression was absent in the isolated metastatic lesions (Shipitsin et al. 2007). This is consistent with other studies documenting the loss of CD44 expression during prostate cancer progression (Tang et al. 2007). Collectively, these reports suggest that CD44 is able to act as both a tumour suppressor and a tumour promoter, though the basis for the association of CD44 with different clinical outcomes is not well understood. This apparent duality of CD44 function in tumoungenesis may result in part from differential expression of functionally diverse CD44 isoforms by tumour cell subsets (refer to Section 1.3). However, the results from this study may suggest an alternate mechanism in which CD44 co-receptors, like Rhamm, may dictate its function and ability to act as a tumour suppressor or promoter. Previous studies support this hypothesis because CD44 can partner with pro- invasive, secreted and cell surface proteins, including HER2/neu (Bourguignon et al. 1997) and matrix metalloproteinase-9 (MMP9) (Bourguignon et al. 1998). Therefore, this thesis may provide insight into a novel mechanism used by CD44+/CD24- breast tumour cell lines [e.g. MDA-MB-231 (Sheridan et al. 2006)], in which the association between cell surface Rhamm with CD44, and their association with ERK1,2, may modify tumour suppression by CD44 to favour its latent tumour promoter functions. This is consistent with the strong association observed between elevated stromal hyaTuronan accumulation, Rhamm expression, and ERK1,2 activity in aggressive forms of breast carcinoma. Rhamm surface expression may also partially compensate for loss of CD44, such as in advanced prostate cancer, to maintain hyaluronan-driven signaling in the absence of CD44. 4.2.2 Rhamm as a Multi-Functional Adapter Protein As has been mentioned previously, two seemingly disparate oncogenic functions for Rhamm have been proposed: regulation of the H-Ras oncogenic pathway through its extracellular hyaluronan/CD44 binding function (Hall et al. 1995) and de-regulation of BRCA1/BARD 1-mediated mitotic spindle stability via its mitotic spindle-binding function (Joukov et al. 2006). This poses the question: How is it possible for Rhamm to function on the one hand as a cell surface receptor that determines, for example, CD44 activity and function, and, on the other, function as an intracellular mitotic spindle protein? While work presented in this thesis has shown a role for Rhamm upstream of Ras in fibroblast transformation, which is consistent with the previously reported role for cell surface Rhamm in /f-i?as-mediated transformation, I also identified a role for Rhamm downstream of Ras, suggesting that intracellular Rhamm forms are able to activate this pathway. I have proposed in Chapter 3 that the ability of both cell surface and intracellular Rhamm forms to activate and regulate ERK1,2 MAP kinase signaling may link these seemingly disparate oncogenic functions of Rhamm. In addition to localization at the mitotic spindle and centrosome, intracellular Rhamm forms are found in multiple subcellular compartments including the cell lamellae and the nucleus (Turley et al. 2002). Rhamm contains multiple putative kinase recognition sites, as well as known sites for protein-protein interactions, including SH2 and SH3 binding sites. Rhamm also associates with multiple kinases including Src (Hall et al. 1996), PKC (Hall et al. 2001), MEK1 and ERK1 (Zhang et al. 1998; Hamilton et al. 2007). Furthermore, Rhamm is predominantly a coiled-coil protein, a secondary structure that facilitates protein-protein interactions. Collectively, these features of Rhamm suggest that it may be functioning as a signaling adapter protein. Additionally, Rhamm has structural and functional similarities to other adapter proteins, for example, MP-1 (an ERK1 specific adapter) and AKAPs (A-Kinase Anchoring Proteins), which are docking/targeting proteins for PKA (Protein Kinase A) (Dell'Acqua and Scott 1997; Feliciello et al. 2001; Michel and Scott 2002). Rhamm may function as an adapter protein that connects multiple signaling pathways, both at the cell surface and inside the cell, and with structures such as the cytoskeleton or centrosomes. The adapter function is manifested by direct interactions between Rhamm and cell surface receptors such as CD44 and PDGF, as well as with various kinases in different subcellular compartments. The importance of the conserved C-terminal region of Rhamm may also suggest that Rhamm can complex a variety of proteins through mutual binding to hyaluronan. Rhamm's interactions with multiple proteins are predicted to contribute to the cells ability to respond to changes in the microenvironment, particularly those involved in neoplastic conversion. 4.2.3 Rhamm as a Pro-Fibrogenic Factor in Tumourigenesis? Rhamm hyperexpression has been linked to both cancer progression and poor prognosis in many different human cancers. This includes, but is not limited to, cancers originating from mesenchymal cells (e.g. fibromatoses) (Tolg et al. 2003), parenchymal cells (e.g. breast carcinoma) (Assmann et al. 1998; Wang et al. 1998), as well as hematological cells (e.g. multiple myeloma) (Pilarski et al. 1994). However, Rhamm functions have been most extensively studied in mesenchymal cells. Rhamm was originally isolated from the supernatent of migrating fibroblasts (Turley 1989). Rhamm is strongly upregulated in fibroblasts and smooth muscle cells following wounding in vitro (Savani et al. 1995) and during fibroproliferative processes such as hypertrophic scarring of human skin grafts in vivo (Loworn et al. 1998). Early studies on the function of Rhamm have clearly established a role for surface forms of this protein in promoting the migration of fibroblasts in response to hyaluronan (Turley 1989) and have since 229 demonstrated a role for Rhamm in wound repair, fibrogenesis (Tolg et al. 2006), tissue fibrosis (Loworn et al. 1998) and transformation of fibroblasts (Hall et al. 1995). Collectively, these studies outline the importance of Rhamm in promoting or maintaining a mesenchymal phenotype. The link between Rhamm in wound repair and cellular transformation led to a study that directly assessed the role of Rhamm in mesenchymal tumour initiation (Tolg et al. 2003). Rhamm-/- mice were crossed with Apc/Apcl638N mice, which have a targeted mutation in the Ape gene, effectively predisposing these animals to the formation of upper gastrointestinal tumours and aggressive fibromatoses tumours (Tolg et al. 2003). The results of this study showed that Rhamm deficiency significantly reduced both the number and the size of the fibromatoses formed. This study concluded that Rhamm was required for the initiation of these tumours (reduced number), as well as for their invasion (reduced size), consistent with what has previously been shown for Rhamm in tumourigenesis (Tolg et al. 2003). However, in contrast to the effect of Rhamm deletion on the formation of fibromatoses tumours, the absence of Rhamm had no apparent effect on the formation of the preneoplastic gastrointestinal polyps in these mice, suggesting that, at least in Apc/Apcl638N mice, Rhamm did not play a role in transformation of intestinal epithelial cells (Tolg et al. 2003). Despite this observation, numerous clinical studies have observed high Rhamm expression in different carcinomas, including human colorectal (Line et al. 2002) and breast tumours (Assmann et al. 1998; Wang et al. 1998). Rhamm is mutated in subsets of human colorectal tumours and has been linked to a group of genes that contribute to the genomic instability of these tumours (Duval et al. 2001). Furthermore, the functional association between Rhamm and BRCA1 (Joukov et 230 al. 2006; Pujana et al. 2007), as well as the recent identification of Rhamm polymorphisms that predict breast cancer susceptibility (Pujana et al. 2007), suggest that Rhamm is an important contributor to the initiation of some epithelial tumours. While it is possible that Rhamm is important for the initiation of some parenchymal tumours, including breast, it may not be involved in the initiation of gastrointestinal tumours. Rhamm may instead act as a progression factor in some neoplasms of epithelial origin, including gastrointestinal tumours, rather than as an oncogene that participates in parenchymal tumour initiation. The generation of a mesenchymal phenotype, which is often described as epithelial-to-mesenchymal transition, is strongly associated with tumour progression and poor prognosis (Kang and Massague 2004; Radisky et al. 2007). The acquisition of an invasive, mesenchymal phenotype is associated with a loss of epithelial markers such as E-cadherin, (which is important for maintaining normal epithelial cell-cell contacts) and gain of mesenchymal markers such as vimentin (which is a cytoskeletal protein expressed in fibroblasts) (Kang and Massague 2004). Rhamm hyperexpression in transformed epithelia may result from the acquisition of a fibroblast specific gene transcriptome due to epithelial-to-mesenchymal transition (EMT). This is consistent with Rhamm's defined role in regulating mesenchymal cell processes. Alternatively, the observed role for Rhamm in fibrogenesis during wound repair (Tolg et al. 2006) could suggest that Rhamm hyperexpression in epithelial cells is able to drive EMT. An additional possibility is that Rhamm is expressed by surrounding stromal fibroblasts and that stromal derived Rhamm could instead play a paracrine role in carcinoma progression (Tolg et al. 2003). A well- established paradigm maintains that paracrine interactions of carcinomas with their 231 surrounding stroma and ECM can contribute to tumour initiation and progression (Bissell and Radisky 2001; Radisky and Bissell 2004). To date, no study has directly assessed the role of Rhamm in promoting breast cancer initiation. However, a previous study by Wang et al, which examined the correlation between Rhamm and MAPK signaling in human breast tumours, made some interesting observations regarding the prognostic value of Rhamm hyperexpression (Wang et al. 1998). They observed aberrant Rhamm expression in both the epithelia and the stroma of the breast tumours examined (Wang et al. 1998). This group noted that in some tumours, Rhamm was noticeably overexpressed in small subsets of cells within the epithelia (Wang et al. 1998). They further noted that while quantification of overall Rhamm staining in the tumour epithelia or stroma was not a significant prognostic indicator, the existence of small, Rhamm-positive tumour cell subsets predicted poor patient outcome (Wang et al. 1998). While it is still not known precisely how Rhamm- positive tumour cell subsets differ from the rest of the tumour, their association with an invasive and metastatic phenotype may suggest that these are cells that have acquired a mesenchymal phenotype. However, an additional possibility is that these Rhamm positive cells may represent breast cancer progenitors. Several groups have now identified surface CD44 expression as a marker for tumour progenitor cells in, for example, breast (Shipitsin et al. 2007). Furthermore, the gene transcriptomes of CD44+/CD24- breast cancer stem cells, such as MDA-MB-231 cells, are prognostic factors for metastatic disease and poor outcomes in breast cancer (Sheridan et al. 2006). The work presented in this thesis clearly links cell surface Rhamm with CD44 in promoting an invasive and migratory phenotype in CD44+/CD24- breast cancer cells. 232 This may suggest that Rhamm, as a cell surface co-receptor for CD44 that promotes an aggressive phenotype, may be co-coordinately expressed in CD44+/CD24- progenitor cells that predict metastatic disease. This is also consistent with the observation by Wang et al that the presence of Rhamm-positive cell subsets predict poor outcome in breast cancer (Wang et al. 1998). 4.3 A Model for Rhamm in Tumourigenesis This thesis provides evidence that cell surface Rhamm forms are able to promote high basal motility rates characteristic of invasive breast cancer cell lines by partnering with cell surface CD44 and co-operatively activating ERKl,2-motogenic signaling. It further demonstrates that Rhamm acting upstream and downstream of Ras and MEK1 are collectively required for cellular transformation through the activation and regulation of ERK-MAP kinase signaling. This thesis therefore provides a possible mechanism that would reconcile the previously proposed and seemingly disparate oncogenic functions for extracellular and intracellular Rhamm forms: the coordinated regulation of Ras/MEKl/ERKl by cell surface and intracellular Rhamm forms accounts for not only the ability of Rhamm to promote the migration and invasion of cancer cells but also for the proposed effect of Rhamm on genomic instability during transformation. 4.4 Future Directions The link between Rhamm hyperexpression with cancer progression and poor prognosis has been clearly established for a variety of human tumours. However, while recent studies have provided significant insight into the role played by cell surface and 233 intracellular Rhamm isoforms in tumourigenesis, many questions still remain unanswered. For example, while Rhamm has been directly implicated in the transformation of fibroblasts and initiation of mesenchymal tumours (Hall et al. 1995; Tolg et al. 2003), no direct role for Rhamm in epithelial tumour initiation has been described. In fact, while Rhamm has been implicated in the initiation of breast tumours (Joukov et al. 2006; Pujana et al. 2007), the absence of Rhamm in a model of gastrointestinal tumour formation suggests that Rhamm may not be involved in the initiation of epithelial tumours. Instead, Rhamm may act as a progression factor that either promotes or is a result of EMT during tumourigenesis and can contribute to tumour cell migration and invasion. The work presented in this thesis clearly demonstrates a role for Rhamm protein isoforms in fibroblast transformation, as well as in the migration of invasive breast cancer cell lines, consistent with the literature. However, additional work is needed to address the role of Rhamm in epithelial cellular conversion. Future studies should directly assess the implied role for Rhamm in breast tumour initiation as there may be tissue specific functions for Rhamm in cellular conversion. Therefore, while Rhamm has no apparent role in the formation of upper gastrointestinal tumour formation, it may still function in breast tumour initiation. This could be investigated in vitro using Rhammonc-overexpression in immortalized mammary epithelial cells (MECs), much like what has been done for Rhammonc in fibroblast transformation (Hall et al. 1995). The following questions will need to be addressed: does Rhammonc-overexpression in MECs promote growth in soft agar and foci formation? Are Rhammonc-overexpressing MECs able to form tumours in immuno-deficient mice? Another way to assess the role of Rhamm in the initiation of breast tumours would involve an established breast cancer mouse model. Similar to what was done with the Apc/Apcl638N mice, Rhamm-/- mice could be crossed with genetically modified mice that form breast tumours. In this scenario, would the absence of Rhamm affect the formation for breast tumours? The precise contribution of cell surface and intracellular Rhamm forms to tumour initiation and progression also needs to be further elucidated. However, with the exception of antibody blocking experiments, it remains difficult to isolate the specific functions of either. Studies done by our lab assessed the specific requirement for cell surface rescue of Rhamm using recombinant Rhamm protein on beads (Tolg et al. 2006). The recombinant protein bearing beads were added to Rhamm-/- cells in culture and were filmed using time-lapse video microscopy (Tolg et al. 2006). From these experiments, we were able to determine that cell surface Rhamm was sufficient to rescue the motility defect in Rhamm-/- cells (Tolg et al. 2006). However, such methods would not always be possible to assess the role of cell surface Rhamm in transformation, in the absence of any intracellular Rhamm forms, for example. To address this question, a better understanding of the export mechanisms of Rhamm is necessary. By inhibiting Rhamm export, the role of intracellular Rhamm forms could be specifically addressed. Alternatively, it may be possible to rescue Rhamm-/- cells with a Rhamm cDNA that contains a signal peptide for conventional export of Rhamm through the Golgi-ER. Similar experiments have been done for other unconventionally exported proteins to study their extracellular functions such as bFGF (Partridge et al. 2000). Further experimentation will also be required to determine precisely how the conserved C-terminal region of Rhamm functions during cellular transformation and cancer progression. Past reports describing different oncogenic functions of cell surface 235 and intracellular Rhamm forms have independently demonstrated a requirement for this conserved C-terminal region of Rhamm. The conserved C-terminal region contains the hyaluronan-binding domain (Yang et al. 1994) and is required for Rhammonc and Ras- mediated transformation and Ras-regulated signaling associated with focal adhesion turnover (Hall et al. 1995; Hall et al. 1996). This thesis describes a requirement for the C terminal region in mediating the direct interaction of Rhamm with ERK1 and for maintaining constitutive ERK1 activation in Rhammonc-overexpressing cells. Maxwell et al described a role for sequences within this C-terminal region in centrosomal targeting of Rhamm (Maxwell et al. 2003). Recently, Joukov et al. also describe a role for this region in mediating the association of intracellular Rhamm forms with the BRCA1/BARD1 centrosomal complex in mitotic spindle stability and genomic instability (Joukov et al. 2006). Collectively, these studies describe an essential role for the C- terminal region of Rhamm in mediating the direct interaction of cell surface (and possibly intracellular) Rhamm with hyaluronan and intracellular Rhamm with ERK1, to mediate activation of this pathway in transformation. To better understand the role of each of these Rhamm-regulated processes in transformation, and to determine if they are in fact related functions or mutually exclusive, each will need to be examined independently. Therefore, Rhamm mutants that target individual motifs will need to be developed. For example, a Rhamm form that is not able to bind hyaluronan, but is able to bind ERK1 and can localize to the centrosome. Work done by Prestwich et al, further identifying the amino acids required for hyaluronan-binding, may facilitate these mutation studies (Ziebell and Prestwich 2004). It may be possible to disrupt the leucine zipper required for centrosomal targeting, without disrupting ERK1 activation or hyaluronan-binding. In this way, the multiple roles of Rhamm and functions of the C terminal conserved region may be able to be defined. 4.5 References Assmann, V., Marshall, J. F., Fieber, C, Hofmann, M. and Hart, I. R. 1998. The human hyaluronan receptor RHAMM is expressed as an intracellular protein in breast cancer cells. J Cell Sci. Ill ( Pt 12), 1685-94. Bissell, M. J. and Radisky, D. 2001. Putting tumours in context. Nat Rev Cancer. 1,46- 54. Bourguignon, L. Y., Gunja-Smith, Z., Iida, N., Zhu, H. B., Young, L. J., Muller, W. J. and Cardiff, R. D. 1998. CD44v(3,8-10) is involved in cytoskeleton-mediated tumor cell migration and matrix metalloproteinase (MMP-9) association in metastatic breast cancer cells. J Cell Physiol. 176, 206-15. Bourguignon, L. Y., Zhu, H., Chu, A., Iida, N., Zhang, L. and Hung, M. C. 1997. Interaction between the adhesion receptor, CD44, and the oncogene product, pl85HER2, promotes human ovarian tumor cell activation. J Biol Chem. 272, 27913-8. Dell'Acqua, M. L. and Scott, J. D. 1997. Protein kinase A anchoring. J Biol Chem. 272, 12881-4. Diaz, L. K., Zhou, X., Wright, E. T., Cristofanilli, M., Smith, T., Yang, Y., Sneige, N., Sahin, A. and Gilcrease, M. Z. 2005. CD44 expression is associated with increased survival in node-negative invasive breast carcinoma. Clin Cancer Res. 11,3309-14. Dirks, P. B. 2006. Cancer: stem cells and brain tumours. Nature. 444, 687-8. Duval, A., Iacopetta, B., Thorstensen, L., Meling, G. I., Lothe, R. A., Thuille, B., Suraweera, N., Thomas, G. and Hamelin, R. 2001. Gender difference for mismatch repair deficiency in human colorectal cancer. Gastroenterology. 121, 1026-7. 237 Feliciello, A., Gottesman, M. E. and Awedimento, E. V. 2001. The biological functions of A-kinase anchor proteins. JMol Biol. 308,99-114. Greiner, J., Ringhoffer, M, Taniguchi, M., Hauser, T., Schmitt, A., Dohner, H. and Schmitt, M. 2003. Characterization of several leukemia-associated antigens inducing humoral immune responses in acute and chronic myeloid leukemia. IntJ Cancer. 106,224-31. Greiner, J., Ringhoffer, M., Taniguchi, M., Schmitt, A., Kirchner, D., Krahn, G., Heilmann, V., Gschwend, J., Bergmann, L., Dohner, H., et al. 2002. Receptor for hyaluronan acid-mediated motility (RHAMM) is a new immunogenic leukemia- associated antigen in acute and chronic myeloid leukemia. Exp Hematol. 30, 1029-35. Grill, C, Gheyas, F., Dayananth, P., Jin, W., Ding, W., Qiu, P., Wang, L., Doll, R. J. and English, J. M. 2004. Analysis of the ERK1,2 transcriptome in mammary epithelial cells. Biochem J. 381, 635-44. Hall, C. L., Collis, L. A., Bo, A. J., Lange, L., McNicol, A., Gerrard, J. M. and Turley, E. A. 2001. Fibroblasts require protein kinase C activation to respond to hyaluronan with increased locomotion. Matrix Biol. 20,183-92. Hall, C. L., Lange, L. A., Prober, D. A., Zhang, S. and Turley, E. A. 1996. pp60(c-src) is required for cell locomotion regulated by the hyaluronanreceptor RHAMM. Oncogene. 13,2213-24. Hall, C. L., Wang, C, Lange, L. A. and Turley, E. A. 1994. Hyaluronan and the hyaluronan receptor RHAMM promote focal adhesion turnover and transient tyrosine kinase activity. J Cell Biol. 126, 575-88. Hall, C. L., Yang, B., Yang, X., Zhang, S., Turley, M., Samuel, S., Lange, L. A., Wang, C, Curpen, G. D., Savani, R. C, et al. 1995. Overexpression of the hyaluronan receptor RHAMM is transforming and is also required for H-ras transformation. Cell. 82,19-26. Hamilton, S. R., Fard, S. F., Paiwand, F. F., Tolg, C, Veiseh, M., Wang, C, McCarthy, J. B., Bissell, M. J., Koropatnick, J. and Turley, E. A. 2007. The hyaluronan receptors CD44 and Rhamm (CD 168) form complexes with ERK1,2 that sustain high basal motility in breast cancer cells. J Biol Chem. 282,16667-80. 238 Herrera-Gayol, A. and Jothy, S. 1999. Adhesion proteins in the biology of breast cancer: contribution of CD44. Exp Mol Pathol. 66,149-56. Joukov, V., Groen, A. C, Prokhorova, T., Gerson, R., White, E., Rodriguez, A., Walter, J. C. and Livingston, D. M. 2006. The BRCA1/BARD1 heterodimer modulates ran-dependent mitotic spindle assembly. Cell. 127, 539-52. Kang, Y. and Massague, J. 2004. Epithelial-mesenchymal transitions: twist in development and metastasis. Cell. 118,211-9. Li, H., Guo, L., Li, J. W., Liu, N., Qi, R. and Liu, J. 2000. Expression of hyaluronan receptors CD44 and RHAMM in stomach cancers: relevance with tumor progression. IntJ Oncol. 17, 927-32. Line, A., Slucka, Z., Stengrevics, A., Silina, K., Li, G. and Rees, R. C. 2002. Characterisation of tumour-associated antigens in colon cancer. Cancer Immunol Immunother. 51, 574-82. Liu, R., Wang, X., Chen, G. Y., Dalerba, P., Gurney, A., Hoey, T., Sherlock, G., Lewicki, J., Shedden, K. and Clarke, M. F. 2007. The prognostic role of a gene signature from tumorigenic breast-cancer cells. N Engl J Med. 356,217-26. Lokeshwar, V. B. and Selzer, M. G. 2000. Differences in hyaluronic acid-mediated functions and signaling in arterial, microvessel, and vein-derived human endothelial cells. J Biol Chem. 275,27641-9. Lopez, J. I., Camenisch, T. D., Stevens, M. V., Sands, B. J., McDonald, J. and Schroeder, J. A. 2005. CD44 attenuates metastatic invasion during breast cancer progression. Cancer Res. 65, 6755-63. Loworn, H. N., 3rd, Cass, D. L., Sylvester, K. G., Yang, E. Y., Crombleholme, T. M., Adzick, N. S. and Savani, R. C. 1998. Hyaluronan receptor expression increases in fetal excisional skin wounds and correlates with fibroplasia. JPediatr Surg. 33, 1062-9; discussion 1069-70. Maxwell, C. A., Keats, J. J., Crainie, M., Sun, X., Yen, T., Shibuya, E., Hendzel, M., Chan, G. and Pilarski, L. M. 2003. RHAMM is a centrosomal protein that interacts with dynein and maintains spindle pole stability. Mol Biol Cell. 14, 2262-76. Michel, J. J. and Scott, J. D. 2002. AKAP mediated signal transduction. Annu Rev Pharmacol Toxicol. 42, 235-57. Mohapatra, S., Yang, X., Wright, J. A., Turley, E. A. and Greenberg, A. H. 1996. Soluble hyaluronan receptor RHAMM induces mitotic arrest by suppressing Cdc2 and cyclinBl expression. J Exp Med. 183,1663-8. Nagy, J. I., Price, M. L., Staines, W. A., Lynn, B. D. and Granholm, A. C. 1998. The hyaluronan receptor RHAMM in noradrenergic fibers contributes to axon growth capacity of locus coeruleus neurons in an intraocular transplant model. Neuroscience. 86, 241-55. Nedvetzki, S., Gonen, E., Assayag, N., Reich, R., Williams, R. O., Thurmond, R. L., Huang, J. F., Neudecker, B. A., Wang, F. S., Turley, E. A., et al. 2004. RHAMM, a receptor for hyaluronan-mediated motility, compensates for CD44 in inflamed CD44-knockout mice: a different interpretation of redundancy. Proc Natl Acad Sci USA. 101, 18081-6. Partridge, C. R., Hawker, J. R., Jr. and Forough, R. 2000. Overexpression of a secretory form of FGF-1 promotes MMP-1-mediated endothelial cell migration. J Cell Biochem. 78, 487-99. Pilarski, L. M., Masellis-Smith, A., Belch, A. R., Yang, B., Savani, R. C. and Turley, E. A. 1994. RHAMM, a receptor for hyaluronan-mediated motility, on normal human lymphocytes, thymocytes and malignant B cells: a mediator in B cell malignancy? Leuk Lymphoma. 14, 363-7'4. Pilarski, L. M., Pruski, E., Wizniak, J., Paine, D., Seeberger, K., Mant, M. J., Brown, C. B. and Belch, A. R. 1999. Potential role for hyaluronan and the hyaluronan receptor RHAMM in mobilization and trafficking of hematopoietic progenitor cells. Blood. 93,2918-27. Pujana, M. A., Han, J. D., Starita, L. M., Stevens, K. N., Tewari, M., Ann, J. S., Rennert, G., Moreno, V., Kirchhoff, T., Gold, B., et al. 2007. Network modeling links breast cancer susceptibility and centrosome dysfunction. Nat Genet. Radisky, D. C. and Bissell, M. J. 2004. Cancer. Respect thy neighbor! Science. 303, 775- 7. Radisky, D. C, Kenny, P. A. and Bissell, M. J. 2007. Fibrosis and cancer: do myofibroblasts come also from epithelial cells via EMT? J Cell Biochem. 101, 830-9. Rein, D. T., Roehrig, K., Schondorf, T., Lazar, A., Fleisch, M., Niederacher, D., Bender, H. G. and Dall, P. 2003. Expression of the hyaluronan receptor RHAMM in endometrial carcinomas suggests a role in tumour progression and metastasis. J Cancer Res Clin Oncol. 129, 161-4. Sahin, U., Tureci, O., Schmitt, H., Cochlovius, B., Johannes, T., Schmits, R., Stenner, F., Luo, G., Schobert, I. and Pfreundschuh, M. 1995. Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci U 5^.92,11810-3. Savani, R. C, Cao, G., Pooler, P. M., Zaman, A., Zhou, Z. and DeLisser, H. M. 2001. Differential involvement of the hyaluronan (HA) receptors CD44 and receptor for HA-mediated motility in endothelial cell function and angiogenesis. J Biol Chem. 276, 36770-8. Savani, R. C, Wang, C, Yang, B., Zhang, S., Kinsella, M. G., Wight, T. N., Stern, R., Nance, D. M. and Turley, E. A. 1995. Migration of bovine aortic smooth muscle cells after wounding injury. The role of hyaluronan and RHAMM. J Clin Invest. 95,1158-68. Sheridan, C, Kishimoto, H., Fuchs, R. K., Mehrotra, S., Bhat-Nakshatri, P., Turner, C. H., Goulet, R., Jr., Badve, S. and Nakshatri, H. 2006. CD44+/CD24- breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res. 8, R59. Shipitsin, M., Campbell, L. L., Argani, P., Weremowicz, S., Bloushtain-Qimron, N., Yao, J., Nikolskaya, T., Serebryiskaya, T., Beroukhim, R., Hu, M., et al. 2007. Molecular definition of breast tumor heterogeneity. Cancer Cell. 11, 259-73. Tang, D. G., Patrawala, L., Calhoun, T., Bhatia, B., Choy, G., Schneider-Broussard, R. and Jeter, C. 2007. Prostate cancer stem/progenitor cells: identification, characterization, and implications. Mol Carcinog. 46,1-14. Tolg, C, Hamilton, S. R., Nakrieko, K. A., Kooshesh, F., Walton, P., McCarthy, J. B., Bissell, M. J. and Turley, E. A. 2006. Rhamm-/- fibroblasts are defective in CD44-mediated ERK.1,2 motogenic signaling, leading to defective skin wound repair. J Cell Biol. 175, 1017-28. 241 Tolg, C, Poon, R., Fodde, R., Turley, E. A. and Alman, B. A. 2003. Genetic deletion of receptor for hyaluronan-mediated motility (Rhamm) attenuates the formation of aggressive fibromatosis (desmoid tumor). Oncogene. 22, 6873-82. Toole, B. P. 2004. Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer. 4, 528-39. Turley, E. A. 1989. The role of a cell-associated hyaluronan-binding protein in fibroblast behaviour. Ciba Found Symp. 143,121-33; discussion 133-7, 281-5. Turley, E. A., Belch, A. J., Poppema, S. and Pilarski, L. M. 1993. Expression and function of a receptor for hyaluronan-mediated motility on normal and malignant B lymphocytes. Blood. 81,446-53. Turley, E. A., Noble, P. W. and Bourguignon, L. Y. 2002. Signaling properties of hyaluronan receptors. J Biol Chem. 277,4589-92. Wang, C, Thor, A. D., Moore, D. H., 2nd, Zhao, Y., Kerschmann, R., Stern, R., Watson, P. H. and Turley, E. A. 1998. The overexpression of RHAMM, a hyaluronan- binding protein that regulates ras signaling, correlates with overexpression of mitogen-activated protein kinase and is a significant parameter in breast cancer progression. Clin Cancer Res. 4, 567-76. Yamada, Y., Itano, N., Narimatsu, H., Kudo, T., Hirohashi, S., Ochiai, A., Niimi, A., Ueda, M. and Kimata, K. 1999. Receptor for hyaluronan-mediated motility and CD44 expressions in colon cancer assessed by quantitative analysis using real time reverse transcriptase-polymerase chain reaction. Jpn J Cancer Res. 90, 987- 92. Yang, B., Yang, B. L., Savani, R. C. and Turley, E. A. 1994. Identification of a common hyaluronan binding motif in the hyaluronan binding proteins RHAMM, CD44 and link protein. Embo J. 13,286-96. Yoon, S. and Seger, R. 2006. The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors. 24, 21-44. Zhang, L., Underhill, C. B. and Chen, L. 1995. Hyaluronan on the surface of tumor cells is correlated with metastatic behavior. Cancer Res. 55,428-33. Zhang, S., Chang, M. C, Zylka, D., Turley, S., Harrison, R. and Turley, E. A. 1998. The hyaluronan receptor RHAMM regulates extracellular-regulated kinase. J Biol Chem. 273,11342-8. Ziebell, M. R. and Prestwich, G. D. 2004. Interactions of peptide mimics of hyaluronic acid with the receptor for hyaluronan mediated motility (RHAMM). J Comput Aided MolDes. 18, 597-614. 243 Appendix A Rhamm isoform expression in 10T1/2 cells transiently and stably expressing Rhammonc Appendix A. Rhamm isoform expression in transiently and stably transfected 10T1/2 cells. Parental 10T1/2 cells and 10T1/2 transiently expressing RhammFL express low levels of Rhammonc. Conversely, 10T1/2 cells stably expressing Rhammonc (10T1/2- Rhammonc) and those that are transiently expressing Rhammonc express low levels of RhammFL. Lysates were isolated from cells maintained in normal growth medium. 245 stable expression transient expression FL RhammFL- Rhamm Rhammonc Rhammonc~ 246 Appendix B Microarray Data Genes Upregulated/Downregulated in Rhammonc-Rhamm Overexpressing 10T1/2 Fibroblasts Probe ID Genbank Fold Chanqe Gene Svmbol Description 1424470_a_at BC020532 8.759222 Rapgef3 Rap guanine nucleotide exchange factor (GEF) 3 1422782_s_at NMJ26166 9.078193 Tlr3 toll-like receptor 3 1427997_at BG064890 1.9750952 1110007M04Rik RIKEN cDNA 1110007M04 gene 1443027_at BB667435 2.083041 4930523C07Rik RIKEN cDNA 4930523C07 gene 1424629_at U31625 3.049722 Brcal breast cancer 1 1448777_at NM_008564 2.862082 Mcm2 minichromosome maintenance deficient 2 mitotin (S. cerevisiae) 1425733_a_at BC016890 4.4263935 Eps8 epidermal growth factor receptor pathway substrate 8 1447787_x_at AV148957 1.9316123 Gja7 Gap junction membrane channel protein alpha 7 1441320_a_at AV377664 2.8208787 Slc28a2 Solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 1448640_at NM_028122 3.7481182 Slc14a1 solute carrier family 14 (urea transporter), member 1 1425534_at AJ244015 2.3369896 Stau2 Staufen (RNA binding protein) homolog 2 (Drosophila) 1438428_at BB432934 2.1049676 Jph1 Junctophilin 1 1415810_at BB702754 2.2646165 Uhrfl ubiquitin-like, containing PHD and RING finger domains, 1 1450908_at BB406487 1.9151759 Casp8 Caspase 8 1448812_at NM_016677 2.4336202 Hpcall hippocalcin-like 1 1448528_at AV094856 2.04289 PdcdlO programmed cell death 10 1422758_at NM_018763 5.209064 Chst2 carbohydrate sulfotransferase 2 1439036_a_at AV152334 2.1991796 2900036A18 adult Mus musculus cDNA clone 2900036A18, mRNA sequence. 1418126_at NM_013653 10.680747 Ccl5 chemokine (C-C motif) ligand 5 1423025_a_at NM_013928 3.922381 Schipl schwannomin interacting protein 1 1421911_at AF088862 4.9282846 Stat2 signal transducer and activator of transcription 2 1427567_a_at BE380713 1.9182681 Tpm3 tropomyosin 3, gamma 1457359_at BB540672 2.5552325 Inpp4b Inositol polyphosphate-4-phosphatase, type II 1424948_x_at L23495 8.044329 H2-K1 histocompatibility 2, K1, K region 1435529_at BM245961 4.9361596 Ms4a1 Membrane-spanning 4-domains, subfamily A, member 1 1438027_at BB668084 24.046177 D19Ertd737e DNA segment, Chr 19, ERATO Doi 737, expressed 1427441_a_at BF608645 2.5610762 Suclg2 succinate-Coenzyme A ligase, GDP-forming, beta subunit 1421392_a_at NM_007464 3.9132988 Birc3 baculoviral IAP repeat-containing 3 1421731_a_at NM_007999 2.4642515 Fen1 flap structure specific endonuclease 1 1448321 at NM 022316 2.2921977 Smod SPARC related modular calcium binding 1 1416915_at U42190 2.5902116 Msh6 mutS homolog 6 (E. coli) 1451905_a_at M21039 48.025997 Mx1 myxovirus (influenza virus) resistance 1 1435596_at BB820613 1.9684036 Smtn Smoothelin 1455900_x_at BB041811 4.8665705 Tgm2 Transglutaminase 2, C polypeptide 1417019_a_at NM_011799 3.9758086 Cdc6 cell division cycle 6 homolog (S. cerevisiae) 1448632_at NM_013640 10.781263 PsmblO proteasome (prosome, macropain) subunit, beta type 10 1424433_at BC021619 2.0427206 Msrb2 methionine sulfoxide reductase B2 1437012_x_at BB226235 2.6409721 Ttc3 Tetratricopeptide repeat domain 3 1441818_at AI642706 3.1732492 - Transcribed locus 1434191_at AI790538 5.737076 MfscM Major facilitator superfamily domain containing 1 1424354_at BC020080 9.902935 1110007F12Rik RIKEN cDNA 1110007F12 gene 1419603_at NM_008329 5.778715 Ifi204 interferon activated gene 204 1435314_at BG071575 6.4000745 Tph2 tryptophan hydroxylase 2 1426278_at AY090098 4.8508806 Ifi27 interferon, alpha-inducible protein 27 1418293_at NM_008332 8.667396 Ifit2 interferon-induced protein with tetratricopeptide repeats 2 1457069_at BB329527 2.744804 Ascc3l1 Activating signal cointegrator 1 complex subunit 3 1433567_at AW553616 2.004842 Gmps guanine monphosphate synthetase 1452544_x_at J00406 2.6381292 H2-D1 histocompatibility 2, D region locus 1 1425025_at BC022145 5.8318725 Tmem106a transmembrane protein 106A 1452073_at AK011345 2.0385864 6720460F02Rik RIKEN cDNA 6720460F02 gene 1426478_at AA124924 2.351576 Rasal RAS p21 protein activator 1 1450165_at NM_011408 11.522448 Slfn2 schlafen 2 1434329_s_at BG074607 1.980577 Adipor2 adiponectin receptor 2 1435242_at BB295822 2.1289926 Aprin androgen-induced proliferation inhibitor 1417978_at BC027014 3.214769 Eif4e3 eukaryotic translation initiation factor 4E member 3 1452364_at BG066534 2.2891388 Suz12 suppressor of zeste 12 homolog (Drosophila) 1426476_at AA124924 2.063095 Rasal RAS p21 protein activator 1 1433694_at AV270888 5.3673806 Pde3b phosphodiesterase 3B, cGMP-inhibited 1433795_at BM122301 2.1077578 Nrp2 Neuropilin 2 1416979_at NM_025624 2.0583546 Pomp proteasome maturation protein 1416605_at BC024944 2.6480799 Nola2 nucleolar protein family A, member 2 1424681 a at BC010709 2.1772332 Psma5 proteasome (prosome, macropain) subunit, alpha type 5 1424766_at BC004701 1.9636482 Ercc6l excision repair cross-complementing rodent repair deficiency complementation 1416645_a_at NM_007423 16.72313 Afp alpha fetoprotein 1428420_a_at AK005443 6.1621876 120O0O9IO6Rik RIKEN cDNA 1200009106 gene 1418027_at BE986864 2.6539927 Exo1 exonuclease 1 1423620_at AI891882 1.9962722 Cenpq centromere protein Q 1436098_at BB667452 5.1185384 Bche butyrylcholinesterase 1437967_at AV365582 2.2055254 - Transcribed locus, PREDICTED: similar to connectin/titin 1437385_at AV264768 3.8125513 Gpr34 G protein-coupled receptor 34 1424306_at BB829575 7.960224 Elovl4 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1451888_a_at AB025413 4.5348663 Odz4 odd Oz/ten-m homolog 4 (Drosophila) 1453080_at AK018646 4.8211136 9130022K13Rik RIKEN cDNA 9130022K13 gene 1420919_at BB768208 3.2632558 Sgk3 serum/glucocorticoid regulated kinase 3 1418160_at NM_011746 2.866036 Mkrn3 makorin, ring finger protein, 3 1433623_at BE629588 2.2180882 Man2a2 Mannosidase 2, alpha 2 1430427_a_at AK014140 2.909058 Pcdh18 protocadherin 18 1417057_a_at BC011499 3.268736 Ppid peptidylprolyl isomerase D (cyclophilin D) 1416031_s_at NM_008568 2.5546257 Mcm7 minichromosome maintenance deficient 7 (S. cerevisiae) 1436754_at BB360523 2.0219462 AI839735 Expressed sequence AI839735 1428448_a_at AV297256 2.0311177 Gtf3c2 general transcription factor IMC, polypeptide 2, beta 1439758_at BF318690 5.0008245 Cbx3 Chromobox homolog 3 (Drosophila HP1 gamma) 1452676_a_at BB777815 4.09547 Pnptl polyribonucleotide nucleotidyltransferase 1 1417818_at BC014727 2.6594653 Wwtrl WW domain containing transcription regulator 1 1423318_at AK012795 2.3001692 Rad18 RAD18 homolog (S. cerevisiae) 1460550_at BE952757 2.5033238 Cflar CASP8 and FADD-like apoptosis regulator 1418601_at NM_011921 3.52637 Aldh1a7 aldehyde dehydrogenase family 1, subfamily A7 1448650_a_at NM_011132 1.9837612 Pole polymerase (DNA directed), epsilon 1426670_at BM208224 3.794185 Agrin agrin 1416606_s_at BC024944 2.2392645 Nola2 nucleolar protein family A, member 2 1418522_at NM_013604 2.0523384 Mtx1 metaxin 1 1422018_at NM_010437 2.776008 Hivep2 human immunodeficiency virus type I enhancer binding protein 2 1447927_at BG092512 15.444117 Mpa2l macrophage activation 2 like 1440990 at BB012037 4.0275855 . Transcribed locus 1443858_at BI653857 4.1475654 Mania Mannosidase 1, alpha 1451344_at BC025600 2.0149484 Tmem119 transmembrane protein 119 1436524_at AV252102 2.7418334 4833438C02Rik RIKEN cDNA 4833438C02 gene 1434365_a_at BB093351 2.4316065 Spata6 Spermatogenesis associated 6 1434447_at BG060788 2.5727274 Mfge8 Milk fat globule-EGF factor 8 protein 1439068_at AV287655 6.452509 Zfml Zinc finger, matrin-like 1434909_at BF462770 3.8668995 Rragd Ras-related GTP binding D 1450241_a_at NM_010161 3.1696079 Evi2a ecotropic viral integration site 2a 1448925_at NM_007855 2.5666554 Twist2 twist homolog 2 (Drosophila) 1417949_at NM_026374 2.0189333 Ilf2 interleukin enhancer binding factor 2 1428794_at BQ175052 2.6094248 Speed spectrin domain with coiled-coils 1 1449544_a_at NM_013569 3.3729212 Kcnh2 potassium voltage-gated channel, subfamily H (eag-related), member 2 1418754_at NM_009623 3.8281572 Adcy8 adenylate cyclase 8 1431436_a_at AK017114 2.1690762 Katnal2 katanin p60 subunit A-like 2 1419132_at NM_011905 6.808084 Tlr2 toll-like receptor 2 1427167_at BE865094 5.9921584 AI448196 expressed sequence AI448196 1452880_at AK003721 2.0691068 Znhit3 zinc finger, HIT type 3 1448706_at NM_019551 2.0418203 Ttrap Traf and Tnf receptor associated protein 1451784_x_at L36068 2.495144 H2-D1 histocompatibility 2, D region locus 1 1423357_at AK013127 2.2652304 2610209A20Rik RIKEN cDNA 2610209A20 gene 1442873_at BB479296 4.378663 B930049N02Rik RIKEN full-length enriched library, clone:B930049N02, full insert sequence 1456494_a_at BG068242 14.927792 Gne Glucosamine (N-acetyl)-6-sulfatase 1421027_a_at AI595932 14.085947 Mef2c Myocyte enhancer factor 2C 1422890_at BM218630 3.0901213 Pcdh18 protocadherin 18 1417526_at NM_021568 3.2482486 Pcbp3 poly(rC) binding protein 3 1442058_s_at BE687992 3.571584 Psmc3ip Proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein 1420992_at AK009959 4.088194 Ankrdl ankyrin repeat domain 1 (cardiac muscle) 1435054_at BG064903 2.5547953 Eme1 essential meiotic endonuclease 1 homolog 1 (S. pombe) 1455980_a_at BB770972 2.0949287 AtxnIO Ataxin 10 1426721_s_at BB707122 2.1189814 Tiparp TCDD-inducible poly(ADP-ribose) polymerase 1449351_s_at NM_019971 2.4982064 Pdgfc platelet-derived growth factor, C polypeptide 1417938_at BC003738 3.3496711 Rad51ap1 RAD51 associated protein 1 1460371_at BC011103 4.5717607 Hspa12b heat shock protein 12B 1420493_a_at NM_024229 2.0136254 Pcyt2 phosphate cytidylyltransferase 2, ethanolamine 1426604_at BF714880 5.5608463 Rnasel ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent) 1452728_at AK005197 2.6293929 Kirrel3 kin of IRRE like 3 (Drosophila) 1422823_at NM_007945 3.9098408 Eps8 epidermal growth factor receptor pathway substrate 8 1423700_at BC026795 3.1957467 Rfc3 replication factor C (activator 1) 3 1417748_x_at NM_008021 2.1483412 Foxml forkhead box M1 1455235_x_at AV216324 2.239372 Ldhb Lactate dehydrogenase B 1425065_at AB067535 9.234006 Oas2 2'-5' oligoadenylate synthetase 2 1420028_s_at C80350 2.262599 Trim28 Tripartite motif protein 28 1424380_at BC026744 2.397473 Vps37b vacuolar protein sorting 37B (yeast) 1428395_at BB832916 2.649718 Smurfl SMAD specific E3 ubiquitin protein ligase 1 1455393_at BB009037 3.7916908 Hmgal High mobility group AT-hook 1 1448492_a_at BC004694 2.0337315 Psmd12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 1428522_at BB283807 2.4641693 Ttf2 transcription termination factor, RNA polymerase II 1417327_at NM_016900 2.4273415 Cav2 caveolin 2 1416184_s_at NMJ316660 5.0132875 Hmgal high mobility group AT-hook 1 1427651 _x_at X00246 2.6729283 H2-D1 histocompatibility 2, D region locus 1 1437785_at AV364944 3.821488 D330037H05Rik RIKEN cDNA D330037H05 gene 1416489_at NM_025951 2.3987317 Pi4k2b phosphatidylinositol 4-kinase type 2 beta 1424921_at BC008532 21.561232 Brd4 bromodomain containing 4 1421433_at NM_030708 4.3648868 Zfhx4 zinc finger homeodomain 4 1440715_s_at AU021842 2.4170601 Tmodl Tropomodulin 1 1453004_at BM234253 3.770859 3110004L20Rik RIKEN cDNA 3110004L20 gene 1454094_at AK015549 5.257771 4930471 E19Rik RIKEN cDNA 4930471E19 gene 1450082_s_at BG966751 2.6456718 Snca Synuclein, alpha 1419172_at NM_010049 2.750552 Dhfr dihydrofolate reductase 1448737_at AF052492 4.0204763 Tspan7 tetraspanin 7 1416050_a_at NM_016741 2.8593688 Scarbl scavenger receptor class B, member 1 1453416_at BE199211 2.0501313 Gas2l3 growth arrest-specific 2 like 3 1421028_a_at AI595932 3.979892 Mef2c Myocyte enhancer factor 2C 1420859 at AK010212 3.3760288 Pkia protein kinase inhibitor, alpha 1431008_at BG916808 4.59689 0610037M15Rik RIKEN cDNA 0610037M15 gene 1425767_a_at D50416 2.2206383 Six4 sine oculis-related homeobox 4 homolog (Drosophila) 1425902_a_at AF155372 3.6152225 Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 1452242_at AK004655 2.242438 Cep55 centrosomal protein 55 1451474_a_at BC022679 4.977635 Parp8 poly (ADP-ribose) polymerase family, member 8 1425059_at BC022899 2.1563845 Prmt6 protein arginine N-methyltransferase 6 1455320_at BQ176847 2.061788 6820401 HOIRik RIKEN cDNA 6820401H01 gene 1453757_at AI639807 14.121388 Herc5 hect domain and RLD 5 1416030_a_at NM_008568 2.7655003 Mcm7 minichromosome maintenance deficient 7 (S. cerevisiae) 1435208_at AV327407 7.30784 Emilin2 Elastin microfibril interfacer 2 1423519_at BE457744 2.1093168 2210412D01Rik RIKEN cDNA 2210412D01 gene 1431890_a_at AKO19458 4.2211075 Mllt3 myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog (Drosophila) 1420635_a_at NM_016921 3.0420737 Tcirgl T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 1459838_s_at BB230894 7.2146535 Brd2 Bromodomain containing 2 1441375_at AU043080 5.459692 - Leucine-rich repeats and immunoglobulin-like domains 1 1417377_at NM_018770 2.8706284 Igsf4a immunoglobulin superfamily, member 4A 1452598_at AK013116 2.6726034 Ginsl GINS complex subunit 1 (Psf1 homolog) 1449875_s_at NM_010395 4.3495665 H2-T10 histocompatibility 2, T region locus 10 1448961 _at NM_008880 2.9612556 Plscr2 phospholipid scramblase 2 1416298_at NM_013599 5.540871 Mmp9 matrix metallopeptidase 9 1426774_at BM227980 6.642117 Parp12 poly (ADP-ribose) polymerase family, member 12 1437618_x_at BB273882 8.419783 - Transcribed locus 1423389_at BF226166 2.2514808 Smad7 MAD homolog 7 (Drosophila) 1435460_at BB363188 3.8762772 Adrala Adrenergic receptor, alpha 1 a 1423760_at M27130 2.2870412 Cd44 CD44 antigen 1417704_a_at NM_009707 9.338939 Arhgap6 Rho GTPase activating protein 6 1437442_at BG067986 5.7181354 Pcdh7 Protocadherin 7 1429564_at AK002387 3.1293783 Pcgf5 polycomb group ring finger 5 1417939_at BC003738 3.549511 Rad51ap1 RAD51 associated protein 1 1423161 _s_at BQ044290 2.0984988 Spredl sprouty protein with EVH-1 domain 1, related sequence 1426862_at BC004630 2.3954232 Aftph aftiphilin 1451426_at AF316999 17.975393 D11Lgp2e DNA segment, Chr 11, Lothar Hennighausen 2, expressed ^ 1424923_at BC002065 9.358451 Serpina3g serine (or cysteine) peptidase inhibitor, clade A, member 3G 1421134_at NM_009704 5.222079 Areg amphiregulin 1424144_at AF477481 3.1632652 Cdt1 chromatin licensing and DNA replication factor 1 1452661 _at AK011596 2.5240693 Tfrc transferrin receptor 1422781 _at NNM26166 11.485116 Tlr3 toll-like receptor 3 1421161_at NM_007568 3.5682347 Btc betacellulin, epidermal growth factor family member 1457373_at BB495006 8.173413 - Transcribed locus 1424518_at BC020489 7.175535 BC020489 cDNA sequence BC020489 1429947_a_at AK008179 26.415691 Zbp1 Z-DNA binding protein 1 1428834_at AK012530 3.7693422 Dusp4 dual specificity phosphatase 4 1419100_at NM_009252 3.176316 Serpina3n serine (or cysteine) peptidase inhibitor, clade A, member 3N 1450170_x_at NM_010380 4.713831 H2-D1 histocompatibility 2, D region locus 1 1422607_at NM_007960 8.094043 Etv1 ets variant gene 1 1426938_at BB627486 6.1836834 Noval neuro-oncological ventral antigen 1 1456652_at BB293562 2.2677197 Dtl Denticleless homolog (Drosophila) 1428114_at AW556396 6.0027823 Slc14a1 Solute carrier family 14 (urea transporter), member 1 1436186_at BM247465 2.3452873 E2f8 E2F transcription factor 8 1447819_x_at BB546487 2.6454654 E130310F06 Mus musculus cDNA clone E130310F06 3', mRNA sequence. 1441174_a_at BB182358 2.2930472 Ccnf Cyclin F 1427301_at BE634960 8.600154 Cd48 CD48 antigen 1454604_s_at BB072896 8.69486 Tspan12 tetraspanin 12 1438134_at AV341417 6.262006 PcdhlO Protocadherin 10 1418346_at NM_013754 2.648984 Insl6 insulin-like 6 1450678_at NM_008404 2.8178802 Itgb2 integrin beta 2 1433428_x_at AW321975 4.8495426 Tgm2 Transglutaminase 2, C polypeptide 1439114_at BB234229 22.31054 BC013672 CDNA sequence BC013672 1424852_at BB280300 8.164575 Mef2c myocyte enhancer factor 2C 1440299_at BB073366 2.6526306 E330016A19Rik RIKEN cDNA E330016A19 gene 1449070_x_at BB770932 43.38772 Apcddl adenomatosis polyposis coli down-regulated 1 1428377_at AK018115 3.2531104 Btbd11 BTB (POZ) domain containing 11 1435826_at BM250232 2.7149656 Rad18 RAD18 homolog (S. cerevisiae) 1418210_at NM_019410 2.3157756 Pfn2 profilin 2 1419638_at U30244 2.1223893 Efnb2 ephrin B2 1438097_at BG066967 2.3429966 Rab20 RAB20, member RAS oncogene family 1455993_at BG071076 4.021097 Odz4 odd Oz/ten-m homolog 4 (Drosophila) 1428396_at BB832916 2.7480903 Smurfl SMAD specific E3 ubiquitin protein ligase 1 1458438_at AW554226 2.6175468 Rnf141 Ring finger protein 141 1425008_a_at BC008167 6.0978656 lfi203 interferon activated gene 203 1422846_at NM_009034 4.946085 Rbp2 retinol binding protein 2, cellular 1429364_at BB821996 3.203287 4930579G24Rik RIKEN cDNA 4930579G24 gene 1434993_at BM942851 17.753918 C130038G02Rik RIKEN cDNA C130038G02 gene 1438160_x_at AV348121 7.507833 6430631M08 Mus musculus cDNA clone 6430631M08 3', mRNA sequence. 1438061_at AV272196 4.553354 4930523C07Rik RIKEN cDNA 4930523C07 gene 1452092_at AKO19474 7.0774264 4631426J05Rik RIKEN cDNA 4631426J05 gene 1426514_at AKO19474 7.869914 4631426J05Rik RIKEN cDNA 4631426J05 gene 1426580_at BB706079 2.2324219 Plk4 polo-like kinase 4 (Drosophila) 1418441_at NM_007739 3.8601549 Col8a1 procollagen, type VIII, alpha 1 1429184_at BM243571 26.820005 Gvinl GTPase, very large interferon inducible 1 1418440_at NM_007739 10.339757 Col8a1 procollagen, type VIII, alpha 1 1416805_at NMJ33187 2.280487 1110032E23Rik RIKEN cDNA 1110032E23 gene 1416016_at AW048052 7.2708216 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) 1452483_a_at X66083 2.8697078 Cd44 CD44 antigen 1428593_at BG095162 2.4161923 1700029F09Rik RIKEN cDNA 1700029F09 gene 1417822_at NM_033075 4.5178 D17H6S56E-5 DNA segment, Chr 17, human D6S56E 5 1427940_s_at BB046347 2.1884756 Mycbp c-myc binding protein 1435658_at AH 56620 4.3979692 Transcribed locus 1434376_at AW146109 2.1881614 Cd44 CD44 antigen 1433501 _at BG230336 4.44581 Transcribed locus 1435597_at BB431627 3.1191347 C130052G03Rik RIKEN cDNA C130052G03 gene 1435144_at BM243379 4.3415036 Braf Braf transforming gene 1418253_a_at NM_011020 3.3202722 Hspa4l heat shock protein 4 like 1448942_at NM_025331 5.4238505 Gng11 guanine nucleotide binding protein (G protein), gamma 11 1418478_at NM_057173 5.5717883 Lmo1 LIM domain only 1 1420918 at BB768208 2.8576322 Sgk3 serum/glucocorticoid regulated kinase 3 1438855_x_at BB233088 2.5494425 Lilrb3 Leukocyte immunoglobulin-like receptor, subfamily B, member 3 1448291_at NM_013599 13.574602 Mmp9 matrix metallopeptidase 9 1434301 _at BE303700 3.3528717 D330050ID330050l23Ri2 k RIKEN cDNA D330050I23 gene 1451021_a_at BI465857 5.0607486 Klf5 Kruppel-like factor 5 1456214_at BB197591 7.299537 Pcdh7 Protocadherin 7 1419838_s_at AI385771 2.372135 Plk4 Polo-like kinase 4 (Drosophila) 1426568_at BB148652 2.6319923 Slc2a9 Solute carrier family 2 (facilitated glucose transporter), member 9 1426858_at BB253137 17.082603 Inhbb inhibin beta-B 1434737_at AV000765 2.9634635 Obfd oligonucleotide/oligosaccharide-binding fold containing 1 1450378_at AF043943 5.4454803 Tapbp TAP binding protein 1421009_at BB741897 42.723244 Rsad2 radical S-adenosyl methionine domain containing 2 1421207_at AF065917 10.169945 Lif leukemia inhibitory factor 1437155_a_at BG066193 3.7657635 Mapk6 Mitogen-activated protein kinase 6 1419080_at NM_010275 9.26429 Gdnf glial cell line derived neurotrophic factor 1416942_at NM_030711 6.7705374 Artsl type 1 tumor necrosis factor receptor shedding aminopeptidase regulator 1454617_at BG072824 2.2567189 Arrdc3 arrestin domain containing 3 1448441_at NM_016904 2.3494468 Ckslb CDC28 protein kinase 1b 1423555_a_at BB329808 24.822151 Ifi44 interferon-induced protein 44 1452348_s_at AI481797 8.384813 Apoe Apolipoprotein E 1429763_at AW547258 2.4454703 Cnih4 comichon homolog 4 (Drosophila) 1423919_at BC027393 2.6895332 BC023882 cDNA sequence BC023882 1429265_a_at AK011088 3.1700804 Rnf130 ring finger protein 130 1452608_at BB046347 2.881489 Mycbp c-myc binding protein 1443698_at BB645745 10.695955 Fbxo39 F-box protein 39 1434850_at BI083036 2.7077663 Iqgap3 IQ motif containing GTPase activating protein 3 1421551_s_at NM_011940 5.833093 Ifi202b interferon activated gene 202B 1452127_a_at BM236743 4.2291036 Ptpn13 protein tyrosine phosphatase, non-receptor type 13 1425179_at AF237702 2.8613727 Shmtl serine hydroxymethyl transferase 1 (soluble) 1427938_at BB046347 2.6645157 Mycbp c-myc binding protein 1418209_a_at NM_019410 2.5925415 Pfn2 profilin 2 1436562_at BG063981 5.2380133 Ddx58 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 1429139 at AKO13730 2.3676326 Otud7b OTU domain containing 7B 1418587_at U21050 2.6744204 Traf3 Tnf receptor-associated factor 3 1445860_at BB004011 4.414558 Insig2 Insulin induced gene 2 1438037_at AW208668 20.823616 Axl AXL receptor tyrosine kinase 1418535_at NM_016846 6.0996847 Rgh ral guanine nucleotide dissociation stimulator,-like 1 1450505_a_at NM_025459 2.3508215 1810015C04Rik RIKEN cDNA 1810015C04 gene 1417244_a_at NM_016850 18.9415 Irf7 interferon regulatory factor 7 1421812_at AF043943 3.7294986 Tapbp TAP binding protein 1426002_a_at AB018574 2.6274376 Cdc7 cell division cycle 7 (S. cerevisiae) 1422141_s_at NM_033616 58.417946 Csprs component of Sp100-rs 1449099_at NMJD30695 3.7398074 Lrba LPS-responsive beige-like anchor 1452836_at AK021389 2.5163918 Lpin2 lipin 2 1441776_at BB732603 4.522365 Tspanl1 tetraspanin 11 1417511_at NM_025281 2.8651967 Lyar Ly1 antibody reactive clone 1422016_a_at BC025084 2.6301324 Cenph centromere protein H 1450033_a_at AW214029 7.953063 Statl signal transducer and activator of transcription 1 1436200_at BE956940 2.624534 Lonrf3 LON peptidase N-terminal domain and ring finger 3 1421830_at NM_009647 5.482462 Ak3l1 adenylate kinase 3 alpha-like 1 1452917_at AKO11489 2.7993178 Rfc5 replication factor C (activator 1) 5 1420915_at AW214029 4.905029 Statl signal transducer and activator of transcription 1 1437414_at AW987152 2.6448832 Zfp217 zinc finger protein 217 1435005_at BG916502 2.3878045 Cenpe centromere protein E 1448698_at NM_007631 2.3221238 Ccndl cyclin D1 1452200_at BF100837 2.3707194 D11Ertd497e DNA segment, Chr 11, ERATO Doi 497, expressed 1422824_s_at NM_007945 4.2997913 Eps8 epidermal growth factor receptor pathway substrate 8 1434530_at BQ175876 4.185536 Odz4 odd Oz/ten-m homolog 4 (Drosophila) 1430700_a_at AK005158 7.0747323 Pla2g7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 1422811_at NM_011977 4.194047 Slc27a1 solute carrier family 27 (fatty acid transporter), member 1 1435828_at BM240693 2.79071 Mafb Avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog 1457666_s_at AV229143 4.813885 Ank2 Ankyrin 2, brain 1451860_a_at AF220015 21.785543 Trim30 tripartite motif protein 30 1448775_at NM_008328 11.391487 Ifi203 interferon activated gene 203 1417373 a at AW491660 2.3621118 Tuba4 tubulin, alpha 4 1438210_at BB126999 27.73173 Rhd Rh blood group, D antigen 1424143_a_at AF477481 3.0804963 Cdt1 chromatin licensing and DNA replication factor 1 1457164_at BB309395 2.3777575 Trpal Transient receptor potential cation channel, subfamily A, member 1 1417323_at NM_019976 2.8939986 Psrd proline/serine-rich coiled-coil 1 1419812_s_at C77389 2.44504 Clcn5 Chloride channel 5 1450694_at NM_008020 2.3805282 Fkbp2 FK506 binding protein 2 1451780_at AF068182 7.6838403 Blnk B-cell linker 1450403_at AF088862 5.537232 Stat2 signal transducer and activator of transcription 2 1422140_at NMJ333616 11.542819 Csprs component of Sp100-rs 1452458_s_at BC022648 2.5915267 Ppil5 peptidylprolyl isomerase (cyclophilin) like 5 1418264_at NM_021790 2.75628 Cenpk centromere protein K 1422804_at NM_011454 2.8474135 Serpinb6b serine (or cysteine) peptidase inhibitor, clade B, member 6b 1439408_a_at AV100992 2.951431 2410070 E19 Mus musculus cDNA clone 2410070E19, mRNA sequence. 1418758_a_at NM_011182 2.8095832 Pscd3 pleckstrin homology, Sec7 and coiled-coil domains 3 1434129_s_at BG917242 6.3017507 Lhfpl2 lipoma HMGIC fusion partner-like 2 1434210_s_at AV174595 10.289486 Lrigl Leucine-rich repeats and immunoglobulin-like domains 1 1421921_at BC011158 7.7172513 Serpina3m serine (or cysteine) peptidase inhibitor, clade A, member 3M 1425416_s_at BC008994 2.9598165 Psrd proline/serine-rich coiled-coil 1 1427013_at AJ245857 3.2050045 Car9 carbonic anhydrase 9 1454896_at BM235554 3.432251 Rbpsuh recombining binding protein suppressor of hairless (Drosophila) 1449265_at BC008152 2.8324423 Caspl caspase 1 1450034_at AW214029 6.461807 Statl signal transducer and activator of transcription 1 1453939_x_at AK019325 16.20497 2900034J12 RIKEN, clone:2900034J12 (interferon-stimulated protein), full insert sequence. 1436368_at BB140436 2.9208837 Slc16a10 Solute carrier family 16 (monocarboxylic acid transporters), member 10 1425119_at BC012877 2.978403 Oaslb 2'-5' oligoadenylate synthetase 1B 1428660_s_at AK009693 4.7008696 Tor3a torsin family 3, member A 1417506_at NM_020567 3.3739986 Gmnn geminin 1455991_at BG094881 2.7927923 Ccbl2 cysteine conjugate-beta lyase 2 1449107_at NM_027722 2.6180239 Nudt4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1428025_s_at BC028271 5.962171 Pitpnd phosphatidylinositol transfer protein, cytoplasmic 1 1421844_at BE285634 2.7209387 111 rap interleukin 1 receptor accessory protein 1425837_a_at AF199491 5.292544 Ccrn4l CCR4 carbon catabolite repression 4-like (S. cerevisiae) 1419042_at BM239828 51.58245 ligpl interferon inducible GTPase 1 1451821_a_at U83636 6.4709115 Sp100 nuclear antigen Sp100 1417821_at NMJ333075 5.9600286 D17H6S56E DNA segment, Chr 17, human D6S56E 5 1416410_at NM_008776 3.1629303 Pafah1b3 platelet-activating factor acetylhydrolase, isoform 1b, alphal subunit 1452677_at BB777815 4.3276057 Pnptl polyribonucleotide nucleotidyltransferase 1 1415834_at NM_026268 3.766158 Dusp6 dual specificity phosphatase 6 1417961_a_at BM240719 11.254465 Trim30 tripartite motif protein 30 1423174_a_at BE953582 3.4440184 Pard6b par-6 (partitioning defective 6) homolog beta (C. elegans) 1427946_s_at BC028831 4.688427 Dpyd dihydropyrimidine dehydrogenase 1416802_a_at NM_026410 3.1762471 Cdca5 cell division cycle associated 5 1439831_at AW111920 17.590927 DocklO Dedicator of cytokinesis 10 1458427_at BG071758 2.9461582 Bripl BRCA1 interacting protein C-terminal helicase 1 1434139_at BB026163 6.3678036 Epha5 Eph receptor A5 1421038_a_at NM_008433 5.706657 Kcnn4 Potassium intermediate/small conductance Ca-activated channel, subfamily N, member 4 1453622_s_at AK008707 4.5213666 Mllt3 myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog (Drosophila) 1422130_at NM_008730 5.6518574 Nptxl neuronal pentraxin 1 1455214_at BB763517 3.0845306 Mitf microphthalmia-associated transcription factor 1424471_at BC020532 3.41558 Rapgef3 Rap guanine nucleotide exchange factor (GEF) 3 1440739_at AW228853 12.157682 Vegfc Vascular endothelial growth factor C 1447996_at AI848149 2.5836287 AI848149 expressed sequence AI848149 1422011_s_at BC005560 3.1180491 Xlr X-linked lymphocyte-regulated complex 1451635_at AB056443 7.514753 AB056442 cDNA sequence AB056442 1419043_a_at BM239828 45.454895 ligpl interferon inducible GTPase 1 1429863_at AK016522 2.422255 Lonrf3 LON peptidase N-terminal domain and ring finger 3 1439345_at BB113177 19.526554 Gpnmb glycoprotein (transmembrane) nmb 1421228_at AF128193 10.815479 Ccl7 chemokine (C-C motif) ligand 7 1416380_at NM_008619 4.103954 Mov10 Moloney leukemia virus 10 1424775_at BCO18470 18.720293 Oaslg 2'-5' oligoadenylate synthetase 1G 1441105_at BE980314 3.3823721 Limk2 LIM motif-containing protein kinase 2 1451308_at BB829575 5.1414185 ElovW elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1440481_at BB229853 10.228944 - Transcribed locus 1458163 at AV328953 2.6736815 6330445J02 Mus musculus cDNA clone 6330445J02 3', mRNA sequence. 1437187_at BG069355 2.6717787 E2f7 E2F transcription factor 7 1425405_a_at AF291876 7.4867992 Adar adenosine deaminase, RNA-specific 1428484_at AK004768 3.3710592 Osbpl3 oxysterol binding protein-like 3 1417419_at NM_007631 2.5910661 Ccndl cyclin D1 1435595_at AV016374 4.3365264 Triapl TP53 regulated inhibitor of apoptosis 1 1460603_at BB145092 3.6618567 Samd9l sterile alpha motif domain containing 9-like 1448818_at BC018425 2.8398032 Wnt5a wingless-related MMTV integration site 5A 1418026_at BE986864 3.0377784 Exo1 exonuclease 1 1453064_at AK018594 2.670377 Etaal Ewing's tumor-associated antigen 1 1453107_s_at AK008037 2.4945416 Pebpl phosphatidylethanolamine binding protein 1 1452178_at BI525140 7.2595124 Pled plectin 1 1449254_at NM_009263 2.7881079 Spp1 secreted phosphoprotein 1 1426906_at M74124 18.855228 Ifi205 interferon activated gene 205 1418392_a_at NM_018734 61.19104 Gbp3 guanylate nucleotide binding protein 3 1436626_at BB546141 3.3410118 Tspanl1 tetraspanin 11 1441749_at BB796499 3.4708083 Inpp5d Inositol polyphosphate-5-phosphatase D 1448914_a_at BM233698 3.4218664 Csf1 Colony stimulating factor 1 (macrophage) 1439695_a_at BB200034 2.5759506 2700078E11Rik RIKEN CDNA2700078E11 gene 1418240_at NM_010260 38.02919 Gbp2 guanylate nucleotide binding protein 2 1426276_at AY075132 24.260569 Ifihl interferon induced with helicase C domain 1 1456914_at AV231970 3.4251337 Ldlr Very low density lipoprotein receptor 1454788_at BQ176306 7.9676104 Sed Secretory blood group 1 1451241_at BG970109 4.345413 Lamb1-1 laminin B1 subunit 1 1429570_at AK018636 12.291835 Mlkl mixed lineage kinase domain-like 1422788_at NM_021398 2.7422416 Slc43a3 solute carrier family 43, member 3 1448834_at NM_008021 2.7932985 Foxml forkhead box M1 1422864_at NM_009821 3.9032257 Runxl runt related transcription factor 1 1429106_at AK014853 3.8742015 4921509J17Rik RIKEN CDNA4921509J17 gene 1416751_a_at NM_017397 2.9290662 Ddx20 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 1448735_at BB332449 2.6040015 B730048G11 Mus musculus cDNA clone B730048G11 3', mRNA sequence. 1439263_at BB388301 9.790638 Fin15 fibroblast growth factor inducible gene 15 (FIN15) 1418505 at NM_027722 2.6854398 Nudt4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1426481_at BB126112 5.308218 Klhl22 kelch-like 22 (Drosophila) 1417903_at NM_018769 5.560356 Dfna5h deafness, autosomal dominant 5 homolog (human) 1451206_s_at BC007144 14.219387 Pscdbp pleckstrin homology, Sec7 and colled-coil domains, binding protein 1458299_s_at BB820441 21.761742 G830005J05 Mus musculus cDNA clone G830005J05 3', mRNA sequence. 1451564_at BC021340 25.948574 Parp14 poly (ADP-ribose) polymerase family, member 14 1436791_at BB067079 5.2190785 Wnt5a Wingless-related MMTV integration site 5A 1451644_a_at BC010602 13.559393 H2-Q1 histocompatibility 2, Q region locus 1 1437689_x_at AV152288 3.4252663 Clu Clusterin 1422924_at NM_009404 6.914506 Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 1451507_at BB280300 8.60576 Mef2c myocyte enhancer factor 2C 1448562_at NMJD09477 3.7658672 Upp1 uridine phosphorylase 1 1418114_at NM_009035 3.2903135 Rbpsuh recombining binding protein suppressor of hairless (Drosophila) 1436877_at AV231827 4.7315044 Lrch2 leucine-rich repeats and calponin homology (CH) domain containing 2 1416897_at NMJD30253 6.4118915 Parp9 poly (ADP-ribose) polymerase family, member 9 1460416_s_at M55219 24.25682 Hsr HSR; Mouse HSR mRNA, clone pMmHSRc-[1,3,3E,10 and 10E]. 1460220_a_at BM233698 2.8389988 Csf1 Colony stimulating factor 1 (macrophage) 1420679_a_at NM_025446 8.796086 Aig1 androgen-induced 1 1417141_at NM_018738 26.35278 igtp interferon gamma induced GTPase 1422865_at NM_009821 4.2282176 Runxl runt related transcription factor 1 1452340_at BB667188 3.0388014 6820424L24Rik RIKEN cDNA 6820424L24 gene 1436337_at BF453911 2.7112212 4930420K17Rik RIKEN cDNA 4930420K17 gene 1435792_at BB148221 104.54471 4930503L19Rik RIKEN cDNA 4930503L19 gene 1449383_at NM_007421 4.237795 Adssll adenylosuccinate synthetase like 1 1449010_at NM_011020 3.2594564 Hspa4l heat shock protein 4 like 1433902_at BB469300 4.1745534 Kbtbd8 kelch repeat and BTB (POZ) domain containing 8 1424896_at BC026975 7.5380607 Gpr85 G protein-coupled receptor 85 1429310_at BE945486 11.567509 Flrt3 fibronectin leucine rich transmembrane protein 3 1425719_a_at BC002019 11.228781 Nmi N-myc (and STAT) interactor 1434403_at AV229054 3.0562446 Spred2 Sprouty-related, EVH1 domain containing 2 1438676_at BM241485 64.95676 Spp1 Secreted phosphoprotein 1 1434025_at BG069607 6.608586 Klf5 Kruppel-like factor 5 1437422 at AV375653 11.182273 9130201 M22Rik RIKEN, Mus musculus cDNA clone 9130201M22 3', mRNA sequence. 1434130_at BG917242 5.2610207 Lhfpl2 lipoma HMGIC fusion partner-like 2 1417817_a_at BC014727 3.6246521 Wwtrl WW domain containing transcription regulator 1 1434776_at BQ176610 11.394179 Sema5a Semaphorin 5A 1449893_a_at NMJ308377 10.831599 Lrigl leucine-rich repeats and immunoglobulin-like domains 1 1448899_s_at BC003738 3.245651 Rad51ap1 RAD51 associated protein 1 1423280_at BM115022 7.996337 Stmn2 stathmin-like 2 1420512_at NM_020265 7.9725795 Dkk2 dickkopf homolog 2 (Xenopus laevis) 1434456_at BG075955 7.08619 Gm440 gene model 440, (NCBI) 1455500_at AW556558 6.527912 Aldh2 Aldehyde dehydrogenase 2, mitochondrial 1437268_at BB811311 6.8044043 Lancl3 LanC lantibiotic synthetase component C-like 3 (bacterial) 1451415_at BC016562 4.299719 1810011O10Rik RIKEN cDNA 1810011010 gene 1417336_a_at NM_013757 3.5619156 Sytl4 synaptotagmin-like 4 1421534_at NM_008016 9.670112 Fin15 fibroblast growth factor inducible 15 1426074_at BC006770 6.6678023 LOC434536 LOC434536 1442077_at BB197581 10.69544 Tef Thyrotroph embryonic factor 1436472_at BI647893 9.535745 Slfn9 schlafen 9 1419417_at NM_009506 20.67051 Vegfc vascular endothelial growth factor C 1426255_at M20480 16.208902 Nefl neurofilament, light polypeptide 1455238_at BB103233 3.8914533 Mum1h melanoma associated antigen (mutated) 1 -like 1 1435697_a_at BB503614 13.743629 Mmp12 Matrix metallopeptidase 12 1420357_s_at NM_011726 11.685728 Xlr3a X-linked lymphocyte-regulated 3A 1435665_at BM241342 40.509293 Gne Glucosamine (N-acetyl)-6-sulfatase 1441750_x_at BB796499 3.8174386 Inpp5d Inositol polyphosphate-5-phosphatase D 1425603_at BC006049 22.066921 0610011l04Rik RIKEN cDNA 0610011104 gene 1450227_at BM199504 3.0111177 Ankrd6 Ankyrin repeat domain 6 1422851_at X58380 14.519451 Hmga2 high mobility group AT-hook 2 1434380_at BM241271 64.30385 Rpl5 Ribosomal protein L5 1432026_a_at AK015214 19.410282 Herc5 hect domain and RLD 5 1437217_at BM225135 5.42068 Ankrd6 ankyrin repeat domain 6 1430667_at BB077413 32.75111 PcdhIO Protocadherin 10 1452231 _x_at M74124 13.930765 Ifi205 interferon activated gene 205 1452349_x_at AI481797 9.400276 Apoe Apolipoprotein E 1425078_x_at BC007193 20.265936 Apoe Apolipoprotein E 1422617_at NM_009529 3.8354547 Xmr Xlr-related, meiosis regulated 1428694_at AK017164 3.8432753 5033413D16Rik RIKEN cDNA 5033413D16 gene 1435906_x_at BE197524 43.184864 Gbp2 Guanylate nucleotide binding protein 2 1439906_at BB184086 13.910553 Efnb2 Ephrin B2 1444710_at BB818892 5.078215 9230021 C22Rik RIKEN, clone:9230021C22, full insert sequence 1455345_at BI663145 3.4149969 Phf15 PHD finger protein 15 1456060_at AV284857 3.9191751 Maf Avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog 1418191_at NM_011909 46.032894 Usp18 ubiquitin specific peptidase 18 1439766_x_at BB089170 21.450476 - Transcribed locus 1457424_at BB760085 4.6989946 Trp63 Transformation related protein 63 1418726_a_at NM_011619 105.013504 Tnnt2 troponin T2, cardiac 1417292_at NM_008330 28.112432 Ifi47 interferon gamma inducible protein 47 1426454_at AK002516 4.1613026 Arhgdib Rho, GDP dissociation inhibitor (GDI) beta 1435162_at BB823350 4.7195573 Ints8 Integrator complex subunit 8 1418077_at BCO10580 4.8278275 Trim21 tripartite motif protein 21 1449025_at NM_010501 29.027328 Ifit3 interferon-induced protein with tetratricopeptide repeats 3 1424967_x_at L47552 67.47883 Tnnt2 troponin T2, cardiac 1418580_at BC024872 25.117813 Rtp4 receptor transporter protein 4 1456456_x_at BB821390 46.78264 Lmna Lamin A 1449348_at AF199010 10.041088 Mpp6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1417793_at NM_019440 51.636578 Iigp2 interferon inducible GTPase 2 1456929_at BM235852 6.054069 BC042782 CDNA sequence BC042782 1443847_x_at BB342212 6.065004 - Transcribed locus 1426712_at BB129409 10.147459 Slc6a15 solute carrier family 6 (neurotransmitter transporter), member 15 1449280_at BC020038 172.75461 Esm1 endothelial cell-specific molecule 1 1435945_a_at BG865910 4.262598 Rarg Retinoic acid receptor, gamma 1423281_at BM115022 66.212875 Stmn2 stathmin-like 2 1422618_x_at NM_009529 4.322113 Xmr Xlr-related, meiosis regulated 1455627_at AV292255 44.272217 5430421B17 Hypothetical protein 5430421B17 1437556_at BF147593 7.164219 Scn2a1 Sodium channel, voltage-gated, type II, alpha 1 1418589 a at AF100171 4.621825 Mlf1 myeloid leukemia factor 1 1435564_at BB547893 3.6928527 Clic5 Chloride intracellular channel 5 1456858_at BB075339 98.0432 Rhd Rh blood group, D antigen 1438531_at BM119567 4.59905 A930007l19Rik RIKEN cDNA A930007I19 gene 1431591_s_at AK019325 42.39291 2900034J12Rik RIKEN, clone:2900034J12, interferon-stimulated protein (15 kDa), full insert. 1451567_a_at BC008167 8.712537 Ifi203 interferon activated gene 203 1448957_at NM_009035 3.6812127 Rbpsuh recombining binding protein suppressor of hairless (Drosophila) 1420991_at AK009959 4.6972322 Ankrdl ankyrin repeat domain 1 (cardiac muscle) 1449158_at NM_010607 6.8283005 Kcnk2 potassium channel, subfamily K, member 2 1437722_x_at BB559884 4.88177 Parp3 Poly(rC) binding protein 3 1418825_at NM_008326 6.3535724 Irgm immunity-related GTPase family, M 1424683_at BCO19494 4.065533 1810015C04Rik RIKEN cDNA 1810015C04 gene 1449009_at NM_011579 56.03768 Tgtp T-cell specific GTPase 1445271_at BB433710 4.0324154 Cd2ap CD2-associated protein 1416749_at NMJ319564 6.961 Htral HtrA serine peptidase 1 1453196_a_at BQ033138 63.32255 Ripk3 Receptor-interacting serine-threonine kinase 3 1451777_at BC013672 74.47354 BC013672 cDNA sequence BC013672 1456523_at BB767153 6.435394 Tbc1d20 TBC1 domain family, member 20 1424229_at BC006704 4.9218435 Dyrk3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1429205_at AK011386 4.28948 Mllt3 myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog (Drosophila) 1454822_x_at BB271021 66.30355 A830052E09 Mus musculus cDNA clone A830052E09, mRNA sequence. 1441811_x_at AU040201 12.413887 Lpl Lipoprotein lipase 1423909_at BC010831 16.611712 0610011l04Rik RIKEN cDNA 0610011104 gene 1418930_at NM_021274 153.82253 CxcMO chemokine (C-X-C motif) ligand 10 1427346_at X96606 38.749462 Ott ovary testis transcribed 1418383_at BB770932 27.102186 Apcddl adenomatosis polyposis coli down-regulated 1 1436512_at BI964400 7.0903277 Arl4c ADP-ribosylation factor-like 4C 1448303_at NM_053110 53.84116 Gpnmb glycoprotein (transmembrane) nmb 1425222_x_at AB056443 6.3710656 AB056442 cDNA sequence AB056442 1456182_x_at BB795191 89.149055 Lmna Lamin A 1450781_at X58380 18.319496 Hmga2 high mobility group AT-hook 2 1449124_at NM_016846 8.678932 Rgl1 ral guanine nucleotide dissociation stimulator,-like 1 1418004 a at NM 023056 25.230644 1810009M01Rik RIKEN cDNA 1810009M01 gene £» 1438868_at AV280841 52.4446 D14Ertd436e DNA segment, Chr 14, ERATO Doi 436, expressed 1451867_x_at AF177664 6.7332683 Arhgap6 Rho GTPase activating protein 6 1450780_s_at X58380 8.943063 Hmga2 high mobility group AT-hook 2 1434877_at AH 52800 262.43588 - Transcribed locus 1420380_at AF065933 15.849252 Ccl2 chemokine (C-C motif) ligand 2 1433438_x_at BB794642 84.18288 Lmna Lamin A 1450783_at NM_008331 25.592554 lfit1 interferon-induced protein with tetratricopeptide repeats 1 1420549_at NM_010259 43.973145 Gbp1 guanylate nucleotide binding protein 1 1454672_at BE952212 18.98995 Nefl Neurofilament, light polypeptide 1437146_x_at AV025980 -2.163252 Coro7 Coronin 7 1418261_at AW907526 -3.2076976 Syk spleen tyrosine kinase 1454862_at AV253284 -2.8422005 2410042D21Rik RIKEN CDNA2410042D21 gene 1438056_x_at BB794846 -2.2723322 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1421987_at BF786072 -3.225364 Papss2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 1438033_at BB530740 -2.0790222 E030011l18Rik RIKEN, Mus musculus cDNA clone E030011118 3', mRNA sequence. 1452067_at BI106821 -2.388756 Asahl N-acylsphingosine amidohydrolase (acid ceramidase)-like 1454898_s_at AU016407 -2.0273097 Trabd TraB domain containing 1443909_at BM218423 -4.0722284 C0910G10 Mus musculus cDNA clone NIA:C0910G10 IMAGE:30035601 3', mRNA sequence. 1420898_at BB763153 -2.073726 Snap23 synaptosomal-associated protein 23 1448919_at NM_025422 -4.0521817 Cd302 CD302 antigen 1434478_at BE447663 -2.1334867 Heca headcase homolog (Drosophila) 1423176_at BQ266486 -1.9418652 Tnp1 Transition protein 1 1427917_s_at AV295012 -1.907508 Ssbp3 single-stranded DNA binding protein 3 1419434_at NM_130451 -5.534024 Slc2a10 solute carrier family 2 (facilitated glucose transporter), member 10 1416156_at NM_009502 -2.180036 Vcl vinculin 1428145_at AK002555 -2.2960615 Acaa2 acetyl-Coenzyme A acyltransferase 2 1423097_s_at BQ257745 -2.1646159 Capn7 calpain 7 1428568_at BB376573 -2.0802953 C130085M10 Mus musculus cDNA clone C130085M10 3', mRNA sequence. 1448263_a_at NM_023149 -2.4786727 Cndp2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1417980_a_at AV257512 -1.863835 Insig2 insulin induced gene 2 1437629_at AV321315 -1.9827099 Ripk5 Receptor interacting protein kinase 5 1425810 a at BF124540 -3.0021229 Clic4 Chloride intracellular channel 4 (mitochondrial) 1460466_at BB824055 -2.6668293 Hectdl HECT domain containing 1 1433454_at BB621938 -2.378363 Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 1421471_at NM_010934 -3.098697 Npylr neuropeptide Y receptor Y1 1429097_at BB090042 -2.0079985 C030044C12Rik RIKEN cDNA C030044C12 gene 1452432_at BF451808 -2.5054696 Tfpi tissue factor pathway inhibitor 1429001_at AK009757 -2.25055 Pir pirin 1440153_at AI854555 -2.8346946 Morc3 Microrchidia 3 1419367_at NM_026172 -2.3848684 Decii 2,4-dienoyl CoA reductase 1, mitochondrial 1430520_at AW548480 -2.8959816 Cpne8 copine VIII 1433754_at BI649713 -1.9909228 Mbnl2 muscleblind-like 2 1418592_at NM_021422 -2.0260904 Dnaja4 DnaJ (Hsp40) homolog, subfamily A, member 4 1416383_a_at NM_008797 -1.9596219 Pcx pyruvate carboxylase 1431432_at AW986926 -2.6846046 Kpnbl Karyopherin (importin) beta 1 1435207_at BB758432 -1.982229 Dixdd DIX domain containing 1 1416892_s_at BC021353 -2.4856737 3110001 A13Rik RIKEN cDNA 3110001A13 gene 1423770_at BC004840 -2.819464 Tmc6 transmembrane channel-like gene family 6 1415856_at BG064842 -2.6723092 Emb embigin 1459961_a_at BG069527 -2.7517657 Stat3 Signal transducer and activator of transcription 3 1448233_at BE630020 -2.4264467 Prnp prion protein 1425797_a_at U36776 -4.3433747 Syk spleen tyrosine kinase 1426584_a_at BI143942 -2.072389 Sord sorbitol dehydrogenase 1437871_at BG967597 -6.2981277 Pgm5 phosphoglucomutase 5 1415943_at BI788645 -1.8719802 Sdd syndecan 1 1427302_at AV224446 -2.131558 Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 1428168_at AK003513 -3.4907382 Mpzh myelin protein zero-like 1 1436244_a_at AU067681 -3.7461915 Tle2 Transducin-like enhancer of split 2, homolog of Drosophila E(spl) 1427889_at AK011566 -1.8942245 Spna2 spectrin alpha 2 1448509_at BC021353 -2.6570568 3110001A13Rik RIKEN cDNA 3110001A13 gene 1436986_at BB219478 -2.7108488 Dnmt3a DNA methyltransferase 3A 1436364_x_at AW049660 -2.53321 Nfix nuclear factor l/X 1450625_at AV229424 -2.8938084 Col5a2 procollagen, type V, alpha 2 1437830 x at BB703880 -2.0231733 7420457G17 Mus musculus cDNA clone 7420457G17 3', mRNA sequence. 1449198_a_at BB829192 -1.9047946 St3gal5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1450110_at NM_009626 -3.1242187 Adh7 alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide 1442311_at BM199880 -1.9568545 Scd1 Stearoyl-Coenzyme A desaturase 1 1418710_at NM_007652 -1.8844194 Cd59a CD59a antigen 1450896_at BM248774 -1.9912765 Arhgap5 Rho GTPase activating protein 5 1434869_at BG070567 -2.2446084 Tdrd3 tudor domain containing 3 1459971_at AV133559 -4.9092026 Socs7 Suppressor of cytokine signaling 7 1452264_at BI408679 -2.347685 Tend tensin like C1 domain-containing phosphatase 1418586_at NM_009624 -2.1197758 Adcy9 adenylate cyclase 9 1454780_at AV238718 -3.457293 Galntl4 polypeptide N-acetylgalactosaminyltransferase-like 4 1417599_at NM_133983 -1.9831254 Cd276 CD276 antigen 1428983_at AW124134 -3.0940495 Sex scleraxis 1421441_at NM_009640 -2.3624775 Angptl angiopoietin 1 1440920_at BB535404 -3.8118577 Mmp14 Matrix metallopeptidase 14 (membrane-inserted) 1451015_at AI314476 -2.0677836 Tkt transketolase 1419437_at D63383 -6.3057814 Sim2 single-minded homolog 2 (Drosophila) 1426677_at BM233746 -1.9523541 Flna filamin, alpha 1430554_at BB524113 -2.0870352 Lrig3 leucine-rich repeats and immunoglobulin-like domains 3 1419811_at AW125421 -3.3031988 D16Wsu65e DNA segment, Chr 16, Wayne State University 65, expressed 1434628_a_at BF228009 -3.307524 Rhpn2 Rhophilin, Rho GTPase binding protein 2 1428718_at AW490544 -4.5914645 Scrnl secernin 1 1426389_at BG071931 -2.4188228 Camkld calcium/calmodulin-dependent protein kinase ID 1441358_at BB027682 -6.63776 Pcdhb16 Protocadherin beta 16 1419108_at BI134110 -1.9818791 Ophnl oligophrenin 1 1438266_at BB764453 -2.869742 Adamtsl5 ADAMTS-like 5 1424382_at BC025602 -6.625536 Rcn3 reticulocalbin 3, EF-hand calcium binding domain 1436833_x_at BB251824 -2.3496556 Actn4 Actinin alpha 4 1417215_at BB121269 -5.134927 Rab27b RAB27b, member RAS oncogene family 1416414_at NM_133918 -4.347911 Emilinl elastin microfibril interfacer 1 1428958_at AV265674 -3.8388653 Cdc23 CDC23 (cell division cycle 23, yeast, homolog) 1455014_at BM213104 -2.159851 AV009015 expressed sequence AV009015 1423686 a at BC016234 -1.9852061 Prr13 proline rich 13 1450318_a_at NM_008773 -3.3505793 P2ry2 purinergic receptor P2Y, G-protein coupled 2 1431050_at BE291900 -2.3982942 Rps6ka5 ribosomal protein S6 kinase, polypeptide 5 1455288_at BE951265 -2.0107274 1110036O03Rik Rl KEN cDNA 1110036003 gene 1449013_at BC003433 -3.4216015 Eef2k eukaryotic elongation factor-2 kinase 1452970_at AK017929 -1.9581293 Zmym2 zinc finger, MYM-type 2 1435884_at BM248471 -3.5571423 Itsnl intersectin 1 (SH3 domain protein 1A) 1455724_at BM230193 -2.0379686 Plpdl Phospholipase D1 1460626_at AV229846 -2.0269074 Sept Septin 11 1448300_at NM_025569 -2.1677718 Mgst3 microsomal glutathione S-transferase 3 1424529_s_at BC023116 -2.0255651 Cgrefl cell growth regulator with EF hand domain 1 1425814_a_at AF209905 -2.9856458 Calcrl calcitonin receptor-like 1434975_x_at AA673371 -2.0783882 4933439C20Rik RIKEN cDNA 4933439C20 gene 1419435_at NM_009676 -2.5328913 Aox1 aldehyde oxidase 1 1425745_a_at BC004057 -1.8948507 Tacc2 transforming, acidic coiled-coil containing protein 2 1455688_at BB795075 -2.1361637 Elavil ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) 1427126_at M12573 -3.4638073 Hspalb heat shock protein 1B 1436405_at BG068753 -2.9340355 Ccnl2 Cyclin L2 1442051_at BE691662 -4.444293 Hist2h3c1 histone 2, H3c1 1439790_at BE686716 -2.0462756 Sytl4 Synaptotagmin-like 4 1436514_at BB530689 -6.4147553 Gpc4 glypican 4 1450700_at BB012489 -3.1534817 Cdc42ep3 CDC42 effector protein (Rho GTPase binding) 3 1450216_at NM_053141 -5.5733886 Pcdhb16 protocadherin beta 16 1419383_at NM_009115 -2.393086 S100b S100 protein, beta polypeptide, neural 1418888_a_at NM_013759 -2.2542167 Sepxl selenoprotein X 1 1455731 _at BI158381 -1.9078664 Slc29a3 solute carrier family 29 (nucleoside transporters), member 3 1452384_at AV224446 -2.0258775 Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 1416503_at NM_016753 -2.0342844 Lxn latexin 1428394_at AK005293 -3.4383392 Phyhdl phytanoyl-CoA dioxygenase domain containing 1 1434006_at BQ030992 -1.9148484 BC051227 cDNA sequence BC051227 1434557_at BB794880 -2.0589995 Hip1 huntingtin interacting protein 1 1429796_at AK008844 -2.2889106 Kalrn kalirin, RhoGEF kinase 1429893 at AK012666 -2.888909 2810004A10Rik RIKEN cDNA 2810004A10 gene 1453313_at AK017464 -3.432876 Sesn3 sestrin 3 1444763_at BB667296 -3.5140896 Csnk1a1 Casein kinase 1, alpha 1 1421969_a_at U82536 -3.156533 Faah fatty acid amide hydrolase 1440691 _at AV373767 -3.356632 Transcribed locus 1458512_at AW490470 -2.5909114 Mapt Microtubule-associated protein tau 1424556_at BC006727 -5.454265 Pycrl pyrroline-5-carboxylate reductase 1 1419442_at BC005429 -2.9594116 Matn2 matrilin 2 1436124_at BE996519 -2.0235415 Zfp60 Zinc finger protein 60 1426940_at BI412808 -1.9658191 Sidt2 SID1 transmembrane family, member 2 1439087_a_at BB030508 -3.1782277 5830455E04Rik RIKEN cDNA 5830455E04 gene 1417288_at NM_031257 -2.7122407 Plekha2 pleckstrin homology domain-containing, family A, member 2 1454690_at BB147462 -1.9823265 Ikbkg inhibitor of kappaB kinase gamma 1453282_at BE824924 -11.855562 Cxadr coxsackievirus and adenovirus receptor 1450065_at NM_007406 -2.722337 Adcy7 adenylate cyclase 7 1437218_at BM234360 -3.7479284 Fn1 Fibronectin 1 1460210_at NM_013630 -2.879675 Pkd1 polycystic kidney disease 1 homolog 1458236_at BB657751 -3.7357233 D230016B01Rik RIKEN, clone:D230016B01, full insert sequence 1420696_at NM_013657 -2.6974738 Sema3c Semaphorin 3C 1442019_at BB627097 -3.3069205 H2-Eb1 Histocompatibility 2, class II antigen E beta 1454666_at AV230488 -2.125846 9930027L19Rik RIKEN, clone:9930027L19, full insert sequence 1438106_at AV336932 -4.354371 March Membrane-associated ring finger (C3HC4) 7 1418745_at NM_012050 -5.8925443 Omd osteomodulin 1426397_at BG793483 -2.6736221 Tgfbr2 transforming growth factor, beta receptor II 1424290_at BB817847 -3.3766828 BC010311 cDNA sequence BC010311 1425934_a_at AF158746 -3.6831024 B4galt4 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4 1428343_at BB667699 -2.0005865 Rcor3 REST corepressor 3 1438953_at BB359521 -4.413828 Wasp2 WAS protein family, member 2 1416630_at NM_008321 -7.041584 Id3 inhibitor of DNA binding 3 1420562_at NM_020519 -2.0790098 Slurpl secreted Ly6/Plaur domain containing 1 1449154_at NM_007729 -2.8136346 Col11a1 procollagen, type XI, alpha 1 1439514_at BB277834 -2.4042861 Transcribed locus 1428850 x at AK004342 -2.7524455 Cd99 CD99 antigen 1416390_at NM_134083 -2.9933531 Rcbtb2 regulator of chromosome condensation and BTB (POZ) domain containing protein 2 1428622_at AKO14624 -3.458152 Depdc6 DEP domain containing 6 1424653_at BC003872 -2.748669 Tspan15 tetraspanin 15 1452682_at AK019480 -4.591361 4632404H22Rik RIKEN CDNA4632404H22 gene 1416268_at BC005486 -2.1549234 Ets2 E26 avian leukemia oncogene 2, 3' domain 1438954_x_at BB359521 -4.610204 Wasp2 WAS protein family, member 2 1452731_x_at BM195235 -4.3374343 Cnot6l CCR4-NOT transcription complex, subunit 6-like 1440325_at AV332226 -2.0591948 Rp2h Retinitis pigmentosa 2 homolog (human) 1425281_a_at AF201289 -3.1143205 Tsc22d3 TSC22 domain family 3 1438349_at BG069331 -7.741691 BC043476 cDNA sequence BC043476 1416136_at NM_008610 -2.011637 Mmp2 matrix metallopeptidase 2 1417018_at NM_021474 -3.2845976 Efemp2 epidermal growth factor-containing fibulin-like extracellular matrix protein 2 1434956_at AV145226 -1.9954342 AI481227 expressed sequence AI481227 1449033_at AB013898 -3.9900122 TnfrsfHb tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) 1449840_at BI646094 -2.9077551 Sntb2 syntrophin, basic 2 1452668_x_at AK005230 -2.4898622 Rab2b RAB2B, member RAS oncogene family 1449248_at NM_009900 -2.2950475 Clcn2 chloride channel 2 1460456_at AV288141 -2.7574697 2010316F05Rik RIKEN cDNA 2010316F05 gene 1430367_at BE331859 -2.2383468 StambpH Stam binding protein like 1 1423707_at BC004841 -2.3224723 Tmem50b transmembrane protein 50B 1428269_a_at AK010388 -2.0634496 Glt8d1 glycosyltransferase 8 domain containing 1 1460577_at BQ031479 -1.9918044 AI426748 Expressed sequence AI426748 1436122_at BF467246 -2.1118116 Rab23 RAB23, member RAS oncogene family 1434645_at BB493717 -5.2420945 Pkd2 Polycystic kidney disease 2 1460682_s_at BC024320 -4.2253494 Ceacam2 CEA-related cell adhesion molecule 2 1424187_at BG074158 -2.0866666 Ccdc80 coiled-coil domain containing 80 1431146_a_at AK004559 -4.0885777 Cpne8 copine VIII 1435646_at BB821318 -2.0311966 Cybb Cytochrome b-245, beta polypeptide 1426649_at BM114154 -3.049487 Tmeffl transmembrane protein with EGF-like and two follistatin-like domains 1 1422055_at AF026565 -2.3828568 Midi midline 1 1438126_at BB408277 -2.1672568 Psap Prosaposin 1435292 at AF023098 -2.261082 Tbc1d4 TBC1 domain family, member 4 1438673_at AW555750 -2.0633695 - Transcribed locus 1447839_x_at AV378441 -4.3203025 Hsp5 Heat shock 70kD protein 5 (glucose-regulated protein) 1438316_a_at BB375402 -1.9814631 Cybb Cytochrome b-245, beta polypeptide 1421965_s_at NM_008716 -4.8462806 Notch3 Notch gene homolog 3 (Drosophila) 1437568_at BB041237 -2.3548596 Ctsd Cathepsin D 1417732_at NM_013473 -7.6954236 Anxa8 annexin A8 1422626_at AF282844 -2.3449645 Mmp16 matrix metallopeptidase 16 1453771_at BF144687 -2.9657073 Gulpl GULP, engulfment adaptor PTB domain containing 1 1451326_at BC019410 -2.4323182 Abhd14b abhydrolase domain containing 14b 1452679_at AA986082 -4.9481606 Tubb2b tubulin, beta 2b 1454654_at BG069395 -2.4697673 Dirc2 disrupted in renal carcinoma 2 (human) 1418183_a_at AB013464 -2.3299832 Pscdl pleckstrin homology, Sec7 and coiled-coil domains 1 1420715_a_at NM_011146 -5.54975 Pparg peroxisome proliferator activated receptor gamma 1459666_at BB821080 -2.6386998 Sdcbp Syndecan binding protein 1442336_at BE334274 -2.0333834 Pafah1b1 Platelet-activating factor acetylhydrolase, isoform 1b, betal subunit 1442880_at AV319882 -2.6416433 6030413N05 Mus musculus cDNA clone 6030413N05 3', mRNA sequence. 1434414_at BM227994 -4.0926447 Bfsp2 Beaded filament structural protein 2, phakinin 1448491_at NM_016772 -2.6668127 Ech1 enoyl coenzyme A hydratase 1, peroxisomal 1460359_at AK004598 -2.0291114 Armcx3 armadillo repeat containing, X-linked 3 1418502_a_at AW548944 -2.0239573 Oxr1 oxidation resistance 1 1416803_at NM_010222 -2.7907107 Fkbp7 FK506 binding protein 7 1426383_at BF3O3057 -2.2292457 Cry2 cryptochrome 2 (photolyase-like) 1436173_at BB768194 -3.1601229 Did deleted in liver cancer 1 1458376_at BE648536 -3.012798 B930025B16Rik RIKEN cDNA B930025B16 gene 1420514_at NM_138751 -9.170663 Tmem47 transmembrane protein 47 1435793_at BM219801 -2.835586 Btla B and T lymphocyte associated 1455044_at BB080090 -2.0858145 Tm9sf3 Transmembrane 9 superfamily member 3 1455633_at BB040500 -3.8980558 - DNA segment, Chr 14, ERATO Doi 171, expressed 1448594_at NM_018865 -4.578052 Wispl WNT1 inducible signaling pathway protein 1 1419547_at BC026949 -2.0365515 Fahdl fumarylacetoacetate hydrolase domain containing 1 1427195_at W91587 -2.9119956 Taokl TAO kinase 1 1449029 at NM 021462 -2.5480368 Mknk2 MAP kinase-interacting serine/threonine kinase 2 1420422_at NM_053146 -2.9847727 Pcdhb21 protocadherin beta 21 1422474_at BM246564 -4.2616563 Pde4b phosphodiesterase 4B, cAMP specific 1453008_at AK009004 -2.4941669 2300002D11 Rik RIKEN cDNA 2300002D11 gene 1452318_a_at M12573 -2.6561193 Hspal b heat shock protein 1B 1415984_at NM_007382 -2.3474896 Acadm acyl-Coenzyme A dehydrogenase, medium chain 1422438_at NM_010145 -2.3701463 Ephxl epoxide hydrolase 1, microsomal 1435785_at AV245241 -2.3796613 Transcribed locus 1418300_a_at NM_021462 -2.6669018 Mknk2 MAP kinase-interacting serine/threonine kinase 2 1435417_at BG063189 -2.122704 AI464131 expressed sequence AI464131 1428500_at AK008985 -2.2033467 2210419D22Rik RIKEN cDNA 2210419D22 gene 1426917_s_at BM211317 -2.9522789 Scrn3 secemin 3 1436155_at BB398185 -3.1574907 Cyhrl Cysteine and histidine rich 1 1448943_at AK011144 -3.0990748 Nrp1 neuropilin 1 1455826_a_at BB114336 -3.0276682 Crebl CAMP responsive element binding protein 1 1437372_at BB335087 -2.1315458 Tyrpl Tyrosinase-related protein 1 1428327_at BB010301 -2.8117409 Sdcbp Syndecan binding protein 1451302_at BC024574 -2.2855465 1110012L19Rik RIKEN cDNA 1110012L19 gene 1455286_at AV018484 -2.0453749 Btbdl BTB (POZ) domain containing 1 1450297_at NM_031168 -3.2579658 II6 interleukin 6 1431182_at AK004608 -1.9974633 Hspa8 heat shock protein 8 1430404_at BM239430 -4.1507964 Akapl 3 A kinase (PRKA) anchor protein 13 1443882_at BI150812 -2.7348647 Transcribed locus 1436966_at BB337121 -2.254939 B930006J15 Mus musculus cDNA clone B930006J15 3', mRNA sequence. 1436329_at AV346607 -2.4317408 Mitf Microphthalmia-associated transcription factor 1418509_at BC010758 -2.5272756 Cbr2 carbonyl reductase 2 1456717_at BG071163 -2.9461913 Fadd Fas (TNFRSF6)-associated via death domain 1427981_a_at AY033912 -2.0081413 Csad cysteine sulfinic acid decarboxylase 1444105_at AW214292 -13.396319 2645533 Mus musculus cDNA clone IMAGE:2645533 3', mRNA sequence. 1450007_at NM_019769 -2.1819363 1500003O03Rik RIKEN cDNA 1500003003 gene 1457058_at BM125019 -5.329567 L0548H08 Mus musculus cDNA clone L0548H08 3', mRNA sequence. 1438239_at BG073178 -2.5198374 Midi Midline 1 1416522 a at NM 013535 -2.5399745 GrcdO gene rich cluster, C10 gene 1451634_at BC009123 -2.2442226 2810051 F02Rik RIKEN cDNA 2810051F02 gene 1419592_at NM_009472 -7.3428574 Unc5c unc-5 homolog C (C. elegans) 1448145_at AK004087 -2.489162 Wwp2 WW domain containing E3 ubiquitin protein ligase 2 1451131_at AF133669 -2.841321 Arl6ip1 ADP-ribosylation factor-like 6 interacting protein 1 1452014_a_at AF440694 -3.42888 Igfl insulin-like growth factor 1 1437448_s_at BB775640 -2.389414 Ctnnal Catenin (cadherin associated protein), delta 1 1423072_at AW549928 -3.3143036 2610524H06Rik Similar to RIKEN cDNA 2610524H06 gene 1428535_at AK004276 -3.6905918 9430020K01Rik RIKEN cDNA 9430020K01 gene 1424012_at BC004773 -3.5811577 4930506L13Rik RIKEN cDNA 4930506L13 gene 1437245_at BB778966 -2.4599583 Ldha Lactate dehydrogenase A 1418398_a_at AF175771 -9.630646 Tspan32 tetraspanin 32 1420890_at BB129992 -2.9240432 Hccs holocytochrome c synthetase 1429351_at AK018314 -2.30765 Klhl24 kelch-like 24 (Drosophila) 1456647_a_at AI646535 -4.9227123 Eya4 eyes absent 4 homolog (Drosophila) 1418640_at NM_019812 -3.495556 Sirtl sirtuin 1 ((silent mating type information regulation 2, homolog) 1 (S. cerevisiae) 1429764_at BF101721 -2.0363276 F830021D11Rik RIKEN cDNA F830021D11 gene 1416398_at BB474887 -2.6254635 Ccnf Cyclin F 1436363_a_at AW049660 -2.7455287 Nfix nuclear factor l/X 1448383_at NM_008608 -4.8832536 Mmp14 matrix metallopeptidase 14 (membrane-inserted) 1418501_a_at AW548944 -2.184119 Oxr1 oxidation resistance 1 1459807_x_at BB306202 -4.3396115 Eef2 Eukaryotic translation elongation factor 2 1424759_at BC017528 -3.397191 Arrdc4 arrestin domain containing 4 1459909_at BI249259 -2.2036264 5151536 Mus musculus cDNA clone IMAGE:5151536 5', mRNA sequence. 1427198_at BC022960 -5.6915593 BC022960 cDNA sequence BC022960 1439191_at BB540658 -3.3139944 Kritl KRIT1, ankyrin repeat containing 1455642_a_at AI844703 -2.3802545 Selp Selectin, platelet (p-selectin) ligand 1426856_at BM200015 -3.10843 Hsdl2 hydroxysteroid dehydrogenase like 2 1438183_x_at AV253518 -2.2014263 Sord Sorbitol dehydrogenase 1443579_s_at AI957118 -6.3821573 Racgapl Rac GTPase-activating protein 1 1447448_s_at C86813 -2.7698374 J0233D01 Mus musculus cDNA clone J0233D01 3', mRNA sequence. 1416077_at NM_009627 -5.211399 Adm adrenomedullin 1419238 at NM 013850 -2.0808253 Abca7 ATP-binding cassette, sub-family A (ABC 1), member 7 1439789_at BQ177189 -2.909989 Ebf1 Early B-cell factor 1 1428167_a_at AK003513 -3.9380233 Mpzh myelin protein zero-like 1 1452991_at BB211667 -2.0689926 2810013C04Rik RIKEN cDNA 2810013C04 gene 1452050_at BG071931 -4.3365483 Camkld calcium/calmodulin-dependent protein kinase ID 1436994_a_at BB533903 -3.0806031 Zfp451 Zinc finger protein 451 1433901_at AV301998 -2.057734 Gpiapl GPI-anchored membrane protein 1 1448546_at BB703307 -3.605736 Rassf3 Ras association (RalGDS/AF-6) domain family 3 1417162_at BC004752 -2.4040606 Tmbiml transmembrane BAX inhibitor motif containing 1 1421424_a_at NM_008486 -7.4494953 Anpep alanyl (membrane) aminopeptidase 1452667_at AK005230 -3.1962786 Rab2b RAB2B, member RAS oncogene family 1421462_a_at NM_019783 -2.3427656 Leprel leprecan 1 1416157_at NM_009502 -2.7276769 Vcl vinculin 1424392_at BC026584 -3.4789448 Adhfel alcohol dehydrogenase, iron containing, 1 1418084_at AK011144 -2.7229962 IMrpI neuropilin 1 1423771_at BC009660 -2.925933 Prkcdbp protein kinase C, delta binding protein 1428861_at AK019472 -4.0295663 4631422O05Rik RIKEN cDNA 4631422005 gene 1444611_at BE630073 -3.0015082 Transcribed locus 1416203_at NM_007472 -2.8425136 Aqp1 aquaporin 1 1439535_at BB204161 -2.977335 Cd37 CD37 antigen 1439274_at AW455902 -2.1741714 A230083H22Rik RIKEN cDNA A230083H22 gene 1444982_at BB380551 -4.667872 Racgapl Rac GTPase-activating protein 1 1455665_at BB705689 -3.5902457 Lrig2 Leucine-rich repeats and immunoglobulin-like domains 2 1427934_at AA250510 -2.3563838 Lyrm2 LYR motif containing 2 1433983_at AV351864 -2.078595 Sfrs8 Splicing factor, arginine/serine-rich 8 1436780_at BG065325 -2.0758226 Ogt O-linked N-acetylglucosamine (GlcNAc) transferase 1434002_at AW556347 -2.289202 Chesl Checkpoint suppressor 1 1451978_at AF357006 -3.5346115 Loxll lysyl oxidase-like 1 1425273_s_at AF083876 -3.3257024 Emp2 epithelial membrane protein 2 1426556_at BG066777 -5.445691 Suhw4 suppressor of hairy wing homolog 4 (Drosophila) 1423250_a_at BF144658 -5.3694305 4021972 Mus musculus cDNA clone IMAGE:4021972 5', mRNA sequence. 1429063_s_at BG066903 -2.3521328 Kif16b kinesin family member 16B 1454646 at BM245221 -3.404965 Tcp11l2 t-complex 11 (mouse) like 2 1426965_at BC025198 -2.3366954 Rap2a RAS related protein 2a 1434997_at BB510904 -3.0544748 Cnr1 Cannabinoid receptor 1 (brain) 1434891_at AV253087 -2.1113105 Ptgfm prostaglandin F2 receptor negative regulator 1427883_a_at AW550625 -2.2103891 App Amyloid beta (A4) precursor protein 1435280_at BB303582 -5.5943756 Ceacaml CEA-related cell adhesion molecule 1 1418599_at NM_007729 -2.3433976 Col11a1 procollagen, type XI, alpha 1 1433508_at AV025472 -2.131944 Lkf6 Kruppel-like factor 6 1422619_at NM_008903 -2.5155182 Ppap2a phosphatidic acid phosphatase 2a 1457528_at BB454531 -2.9088144 Eif2s3x Eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked 1453275_at AK009098 -3.318898 2310002L13Rik RIKEN cDNA 2310002L13 gene 1447830_s_at BB034265 -4.5930877 Rgs2 Regulator of G-protein signaling 2 1416101_a_at NM_015786 -3.093707 Hist1h1c histone 1, H1c 1460012_at BE987647 -6.3300548 Fut9 Fucosyltransferase 9 1420371_at BI646094 -2.2604854 Sntb2 syntrophin, basic 2 1429360_at AK007959 -2.369282 Klf3 Kruppel-like factor 3 (basic) 1417847_at NM_013881 -2.2594988 Ulk2 Unc-51 like kinase 2 (C. elegans) 1428419_at AK017297 -2.263544 5430411K18Rik RIKEN cDNA 5430411K18 gene 1441937_s_at AV371921 -2.972572 Pinkl PTEN induced putative kinase 1 1449632_s_at AI325255 -2.1006625 FkbpIO FK506 binding protein 10 1426341_at BB357585 -7.7744503 Slc1a3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 1452353_at BB762731 -12.936964 Gpr155 G protein-coupled receptor 155 1448024_at BG080055 -2.7098174 Sp100 Nuclear antigen Sp100 1455409_at BM234794 -3.6938741 Spirel spire homolog 1 (Drosophila) 1436501_at BB747681 -9.958789 Mtusl mitochondrial tumor suppressor 1 1453556_x_at AK002762 -2.7235076 Cd99 CD99 antigen 1444158_at BB376389 -2.1857572 Tsr2 TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) 1428081_at AK007786 -2.704824 Klhl21 kelch-like 21 (Drosophila) 1428823_at AK009957 -2.6232183 Hddc2 HD domain containing 2 1425811_a_at BF124540 -2.9445646 Clic4 Chloride intracellular channel 4 (mitochondrial) 1460555_at BM242294 -6.308812 6330500D04Rik RIKEN cDNA 6330500D04 gene 1420688_a_at NM_011360 -5.7800503 Sgce sarcoglycan, epsilon 1421058 at NM_0O9626 -3.5001922 Adh7 alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide 1434342_at BB316114 -13.539587 S100b S100 protein, beta polypeptide, neural 1439610_at BE980253 -3.3711312 Rab27b RAB27b, member RAS oncogene family 1456424_s_at AI591480 -2.1643398 Bcl2 B-cell leukemia/lymphoma 2 1441481_at AV262974 -3.0625277 Gtf3c4 General transcription factor IMC, polypeptide 4 1419380_at NM_033327 -5.748044 Zfp423 zinc finger protein 423 1459782_x_at BB138279 -2.242589 Son Son cell proliferation protein 1435744_at BG075556 -2.2116199 Adcy8 Adenylate cyclase 8 1454658_at BI408416 -2.1208444 Tbdd20 TBC1 domain family, member 20 1439508_at BI663913 -2.411996 A730055L17Rik RIKEN cDNA A730055L17 gene 1416999_at NM_009213 -2.1386168 Smpd2 sphingomyelin phosphodiesterase 2, neutral 1450658_at BB658835 -15.482629 Adamts5 Aggrecanase-2 1418406_at BB220000 -7.0742254 Pde8a phosphodiesterase 8A 1425587_a_at BI155210 -2.6899064 Ptprj protein tyrosine phosphatase, receptor type, J 1454997_at AV286522 -2.3915668 Hmgal High mobility group box transcription factor 1 1429403_x_at AK003894 -2.4470236 Glt8d2 glycosyltransferase 8 domain containing 2 1437885_at BF682730 -3.9833 D030029J20Rik RIKEN cDNA D030029J20 gene 1439500_at BF466917 -8.198453 Scrnl secernin 1 1452742_at BBO10301 -2.4846587 Sdcbp Syndecan binding protein 1437408_at BB812574 -4.5275626 Vars2l Valyl-tRNA synthetase 2-like 1417952_at NM_010008 -2.6942158 Cyp2j6 cytochrome P450, family 2, subfamily j, polypeptide 6 1449038_at NM_008288 -3.3532066 Hsd11b1 hydroxysteroid 11-beta dehydrogenase 1 1428791_at BB183512 -2.154161 Ube2h ubiquitin-conjugating enzyme E2H 1441688_at AV343428 -2.1456292 Hsp8 Heat shock protein 8 1419577_at NM_133999 -2.335792 A530089l17Rik RIKEN cDNA A530089I17 gene 1457260_at BI080487 -3.527267 7530403E16Rik RIKEN cDNA 7530403E16 gene 1428433_at AK003718 -2.3516123 Hipk2 homeodomain interacting protein kinase 2 1416598_at NM_031184 -2.563767 Glis2 GLIS family zinc finger 2 1450066_at BQ173927 -2.130486 Ubr1 ubiquitin protein ligase E3 component n-recognin 1 1437428_x_at AW551841 -2.1759942 Sfrsl Splicing factor, arginine/serine-rich 2 (SC-35) 1433523_at BB521978 -3.2798538 D930005D10Rik RIKEN cDNA D930005D10 gene 1451798_at M57525 -12.579581 Il1rn interleukin 1 receptor antagonist 1450922 a at BF144658 -7.0122538 4021972 Mus musculus cDNA clone IMAGE:4021972 5', mRNA sequence. 1420641_a_at AF174535 -3.2205417 Sqrdl sulfide quinone reductase-like (yeast) 1438255_at BM196962 -2.3990097 lpo7 Importin 7 1423508_at BB527816 -2.6328657 Myst4 MYST histone acetyltransferase monocytic leukemia 4 1446954_at AW559079 -3.7166371 Pdhal Pyruvate dehydrogenase E1 alpha 1 1448261_at NM_009864 -4.476 Cdh1 cadherin 1 1424280_at BC018329 -2.344562 Mospdl motile sperm domain containing 1 1416250_at NM_007570 -4.328871 Btg2 B-cell translocation gene 2, anti-proliferative 1455164_at AV308092 -2.5593255 Cdgap Cdc42 GTPase-activating protein 1423297_at BM239842 -3.8703961 Add3 Adducin 3 (gamma) 1450716_at D67076 -7.69555 Adamtsl Disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1 1434186_at BB297502 -9.768078 2410005O16Rik RIKEN cDNA 2410005016 gene 1437774_at BB778614 -2.2567322 1700020114Rik RIKEN cDNA 1700020114 gene 1428573_at AK006398 -6.280323 Chn2 chimerin (chimaerin) 2 1423690_s_at BC026486 -2.4504576 Gpsml G-protein signalling modulator 1 (AGS3-like, C. elegans) 1436729_at AV328634 -2.2442853 Spag9 Sperm associated antigen 9 1435990_at BG073461 -7.760137 Adamts2 Disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 1450567_a_at NM_031163 -4.3510523 Col2a1 procollagen, type II, alpha 1 1451136_a_at BC003326 -2.2107217 Eif2b2 eukaryotic translation initiation factor 2B, subunit 2 beta 1441768_at BB122864 -8.814073 Lysmd4 LysM, putative peptidoglycan-binding, domain containing 4 1454709_at BG075363 -3.433535 Tmem64 transmembrane protein 64 1418701 _at NM_007744 -2.2826147 Comt catechol-O-methyltransferase 1423096_at BQ257745 -2.3047488 Capn7 calpain 7 1418345_at NM_023517 -2.5341911 Tnfsf13 tumor necrosis factor (ligand) superfamily, member 13 1455061_a_at BB718075 -2.5248218 Abi1 Abl-interactor 1 1426461_at AI788759 -2.2488246 Stt3a STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1419978_s_at AUO14694 -0.5299711 D10Ertd610e DNA segment, Chr 10, ERATO Doi 610, expressed 1435885_s_at BM248471 -2.2411504 Itsnl intersectin 1 (SH3 domain protein 1A) 1425270_at BE199508 -2.5507238 Kiflb kinesin family member 1B 1444468_at AV328983 -4.587105 Cdc23 CDC23 (cell division cycle 23, yeast, homolog) 1428922_at AK004681 -2.6496747 1200009O22Rik RIKEN cDNA 1200009022 gene 1448868_at NM_020255 -2.923673 Scandl SCAN domain-containing 1 1434511 at BM233125 -2.5496264 Phkb phosphorylase kinase beta 1453119_at BB530087 -3.2019663 Otudl OTU domain containing 1 1418517_at NM_008393 -4.913863 Itx3 Iroquois related homeobox 3 (Drosophila) 1435584_at BB034567 -4.204874 LOC213438 hypothetical protein LOC213438 [Mus musculus] 1424034_at BI660199 -2.7401254 Rora RAR-related orphan receptor alpha 1422450_at NM_007615 -2.4257746 Ctnndl catenin (cadherin associated protein), delta 1 1448254_at BC002064 -3.4714067 Ptn pleiotrophin 1438303_at AV246759 -2.6943338 Tgfb2 Transforming growth factor, beta 2 1429772_at BB085537 -4.9079013 Plxna2 plexin A2 1434151_at AV171622 -3.976971 2010317E24Rik RIKEN cDNA 2010317E24 gene 1430596_s_at BG066866 -4.9765077 170011 ON 18Rik RIKENcDNA 1700110N18 gene 1439066_at BB453314 -2.5311298 Angptl Angiopoietin 1 1426884_at BG795169 -2.5003567 Rmnd5a required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1443749_x_at BB085413 -7.759064 Slda3 Solute carrier family 1 (glial high affinity glutamate transporter), member 3 1428192_at AK003597 -13.54257 Kbtbd7 kelch repeat and BTB (POZ) domain containing 7 1443037_at BB183534 -2.9589195 Cct4 Chaperonin subunit 4 (delta) 1448428_at NM_008675 -3.3652213 Nbl1 neuroblastoma, suppression of tumorigenicity 1 1435866_s_at AV297651 -4.2754917 Hist3h2a histone 3, H2a 1448590_at NM_009933 -6.4789505 Col6a1 procollagen, type VI, alpha 1 1448117_at BB815530 -2.3698702 Kitl kit ligand 1423277_at AI893646 -2.557999 Ptprk protein tyrosine phosphatase, receptor type, K 1433939_at BQ177036 -5.3797812 Tcte3 T-complex-associated testis expressed 3 1440708_at BM121854 -2.9558992 Shroom3 Shroom family member 3 1431469_a_at AK015150 -2.5968528 Cxxc5 CXXC finger 5 1417439_at NM_054042 -2.9446783 Cd248 CD248 antigen, endosialin 1435221_at BM220880 -2.2852392 Zfhxlb Zinc finger homeobox 1b 1417079_s_at NM_025622 -2.7038698 Lgals2 lectin, galactose-binding, soluble 2 1449023_a_at NM_007970 -3.1354997 Ezh1 enhancer of zeste homolog 1 (Drosophila) 1452068_at BI106821 -2.9052038 Asahl N-acylsphingosine amidohydrolase (acid ceramidase)-like 1455257_at AV352983 -3.1344454 AI747699 Expressed sequence AI747699 1434751_at BB493523 -2.2980402 Ids Iduronate 2-sulfatase 1418262_at AW907526 -3.4236808 Syk spleen tyrosine kinase 1453540 at BM218780 -4.428496 2410042D21Rik RIKEN cDNA 2410042D21 gene 1456220_at BB446014 -5.145765 Cct7 Chaperonin subunit 7 (eta) 1424677_at AF336850 -3.7846231 Cyp2j9 cytochrome P450, family 2, subfamily j, polypeptide 9 1418816_at BG073376 -2.7707407 Chmplb chromatin modifying protein 1B 1437284_at BB259670 -3.214821 A730090P11 Mus musculus cDNA clone A730090P11 3', mRNA sequence. 1426260_a_at D87867 -2.8698213 Ugt1a6a UDP glucuronosyltransferase 1 family, polypeptide A6A 1457782_at BB045512 -2.7191362 Tln1 Talin 1 1451177_at BC017161 -3.1064043 Dnajb4 DnaJ (Hsp40) homolog, subfamily B, member 4 1421385_a_at NM_008663 -2.324294 Myo7a myosin Vila 1426947_x_at BI455189 -6.6710024 Col6a2 procollagen, type VI, alpha 2 1417408_at BC024886 -3.7811985 F3 coagulation factor III 1426942_at BM233292 -18.393557 Aim1 absent in melanoma 1 1426288_at AF247637 -7.022676 Lrp4 low density lipoprotein receptor-related protein 4 1437302_at AV083350 -3.315456 Adrb2 Adrenergic receptor, beta 2 1426319_at AF335583 -4.446744 Pdgfd platelet-derived growth factor, D polypeptide 1433626_at BB826296 -4.2948604 Syngrl Synaptogyrin 1 1445918_at BB035414 -12.859221 Tmem2 Transmembrane protein 2 1435553_at AV376136 -2.7581983 Huwel HECT, UBA and WWE domain containing 1 1428523_at BE945410 -2.9993408 Dbnl Drebrin-like 1450882_s_at AK010724 -4.192731 Gpr137b G protein-coupled receptor 137B 1420889_at BB129992 -3.2984807 Hccs holocytochrome c synthetase 1434465_x_at AV333363 -4.7376475 Ldlr Very low density lipoprotein receptor 1424783_a_at BC019434 -2.5155568 Ugt1a9 UDP glucuronosyltransferase 1 family, polypeptide A9 1426008_a_at M62838 -8.501747 Slc7a2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1434768_at AI266910 -2.81483 Sfrsl Splicing factor, arginine/serine-rich 2 (SC-35) 1438035_at BB748934 -2.571121 Taf10 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor 1439566_at BB245373 -33.025616 A730008P19 Mus musculus cDNA clone A730008P19 3', mRNA sequence. 1439256_x_at BB726971 -4.3684063 Gpr137b G protein-coupled receptor 137B 1423298_at BM239842 -4.1045423 Add3 Adducin 3 (gamma) 1423717_at BC019174 -2.2754943 Ak3 adenylate kinase 3 1417148_at NM_008809 -3.1660273 Pdgfrb platelet derived growth factor receptor, beta polypeptide 1440880_at BI648107 -2.6046343 Mppel metallophosphoesterase 1 1426574 a at BI410363 -4.2173786 Add3 adducin 3 (gamma) 1416130_at BE630020 -2.9036474 Prnp prion protein 1450117_at NM_009332 -3.9165204 Tcf3 transcription factor 3 1420508_at BC010976 -2.762221 Sema3f Semaphorin 3 F 1456623_at BM232388 -3.265383 Tpm1 tropomyosin 1, alpha 1434277_a_at BG069663 -5.3549843 BCI2I11 BCL2-like 11 (apoptosis facilitator) 1427153_at AW047304 -3.0842261 Bckdhb branched chain ketoacid dehydrogenase E1, beta polypeptide 1451970_at BC016105 -4.3441887 E330036M9Rik RIKEN cDNA E330036I19 gene 1434513_at BQ030867 -2.366851 - Brother of ataxin-1 1416668_at NM_025736 -2.7812529 4921531 G14Rik RIKEN CDNA4921531G14 gene 1455582_at Bl 156044 -2.6497915 - Transcribed locus 1417963_at NM_011125 -2.5331848 Pltp phospholipid transfer protein 1454699_at BG076140 -3.9003594 Sesnl sestrin 1 1436917_s_at BB491018 -3.0902593 Ubtf Upstream binding transcription factor, RNA polymerase I 1418634_at NM_008714 -5.1315246 Notch 1 Notch gene homolog 1 (Drosophila) 1460241_a_at BB829192 -2.3834095 St3gal5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1418042_a_at BB436535 -2.3281314 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1427742_a_at AF072403 -2.5875514 Klf6 Kruppel-like factor 6 1449117_at NM_010592 -3.0337887 Jundl Jun proto-oncogene related gene d1 1455056_at BM231903 -4.2626705 Lmo7 LIM domain only 7 1420843_at BF235516 -13.726647 Ptprf protein tyrosine phosphatase, receptor type, F 1431856_a_at AK012868 -3.454985 C1qtnf6 C1q and tumor necrosis factor related protein 6 1424544_at BCO12437 -11.56106 Nrbp2 nuclear receptor binding protein 2 1432543_a_at AK002926 -2.5104241 Klf13 Kruppel-like factor 13 1433518_at BM120022 -2.5926998 Lcmt2 leucine carboxyl methyltransferase 2 1434246_at BB022070 -3.0403287 L3mbtl3 l(3)mbt-like 3 (Drosophila) 1427191_at AW558468 -3.6393077 Npr2 natriuretic peptide receptor 2 1438575_a_at BG143413 -3.041286 Fbxo34 F-box only protein 34 1456307_s_at BB746807 -2.5427954 Csflr Colony stimulating factor 1 receptor 1447917_x_at BB303908 -2.3724222 Ntanl N-terminal Asn amidase 1458996_at AI481717 -6.2989283 Itga5 Integrin alpha 5 (fibronectin receptor alpha) 1450095_a_at NM_025421 -3.370314 Acypl acylphosphatase 1, erythrocyte (common) type 1452700 s at AK003597 -13.556852 Kbtbd7 kelch repeat and BTB (POZ) domain containing 7 1443412_s_at BB431535 -2.6495576 Ctsd Cathepsin D 1460011_at AW049789 -2.9401653 Cyp26b1 Cytochrome P450, family 26, subfamily b, polypeptide 1 1456777_at BB072761 -6.070966 Mgam Maltase-glucoamylase 1433639_at AW548096 -4.657091 Psap Prosaposin 1436999_at AI504908 -2.3879123 5033414K04Rik RIKEN cDNA 5033414K04 gene 1420772_a_at NM_010286 -3.244451 Tsc22d3 TSC22 domain family 3 1437003_at BB323930 -3.0495543 - Transcribed locus 1455031_at AV278072 -3.901781 Cnr1 Cannabinoid receptor 1 (brain) 1422457_s_at NM_019929 -6.8422217 Sumo3 SMT3 suppressor of mif two 3 homolog 3 (yeast) 1434335_at BB795504 -2.5689673 AI317237 expressed sequence AI317237 1430514_a_at AK002762 -3.1267736 Cd99 CD99 antigen 1435758_at BI685536 -4.553856 - Transcribed locus 1421923_at BQ179335 -2.4952967 1500004A08Rik RIKEN cDNA 1500004A08 gene 1427256_at BM251152 -2.6624143 Cspg2 chondroitin sulfate proteoglycan 2 1416700_at BC009002 -3.5024326 Rnd3 Rho family GTPase 3 1425538_x_at BC016891 -4.2512712 Ceacaml CEA-related cell adhesion molecule 1 1416221_at BI452727 -3.858495 FstM follistatin-like 1 1434613_at BM230552 -2.6216106 1810013L24Rik RIKEN cDNA 1810013L24 gene 1415973_at AW546141 -3.025929 Hsp5 Heat shock 70kD protein 5 (glucose-regulated protein) 1423627_at AV158882 -2.928875 Nqo1 NAD(P)H dehydrogenase, quinone 1 1448557_at NM_024244 -18.856998 1200015N20Rik RIKEN cDNA 1200015N20 gene 1419662_at BB542051 -5.3397217 Ogn osteoglycin 1434538_x_at AI415184 -2.5657933 Sfrsl Splicing factor, arginine/serine-rich 2 (SC-35) 1451753_at D86949 -4.525392 Plxna2 plexin A2 1428405_at BF580567 -3.576713 F830021D11Rik RIKEN cDNA F830021D11 gene 1424131_at AF064749 -18.97363 Col6a3 procollagen, type VI, alpha 3 1436736_x_at BB369191 -97.76865 D0H4S114 DNA segment, human D4S114 1448325_at NM_008654 -2.8893712 Myd116 myeloid differentiation primary response gene 116 1455007_s_at BI648645 -2.5287833 Trpml Transient receptor potential cation channel, subfamily M, member 1 1448593_at NM_018865 -3.1006312 Wispl WNT1 inducible signaling pathway protein 1 1440275_at AV233043 -10.252351 Mmp2 Matrix metallopeptidase 2 1434202 a at BF682848 -29.933828 T2bp Traf2 binding protein 1429246_a_at AK013026 -2.9281292 Anxa6 annexin A6 1433747_at BQ176475 -2.4789474 Myh9 Myosin, heavy polypeptide 9, non-muscle 1434194_at AV337593 -3.4737844 Map2 Microtubule-associated protein 2 1421088_at BC006622 -8.225735 Gpc4 glypican 4 1433711_s_at BG076140 -3.0662017 Sesnl sestrin 1 1449670_x_at AW546472 -4.7999034 Gpr137b G protein-coupled receptor 137B 1438530_at BB756069 -2.7748134 Tfpi Tissue factor pathway inhibitor 1417283_at NM_011838 -2.4626627 Lynxl Ly6/neurotoxin 1 1460329_at BG066773 -5.7066917 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1447883_x_at BB299566 -2.47199 Wnt10b Wingless related MMTV integration site 10b 1416211_a_at BC002064 -8.813924 Ptn pleiotrophin 1424588_at AF481964 -2.5435255 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 1454674_at AU067669 -7.006645 Mytll Myelin transcription factor 1-like 1426934_at BC013565 -3.407596 NhsM NHS-like 1 1426743_at BC002232 -3.2697487 Dip3b Dip3 beta 1455521_at BB753447 -24.775217 Rpl41 Ribosomal protein L41 1419247_at AF215668 -5.544148 Rgs2 regulator of G-protein signaling 2 1449303_at NM_030261 -4.953515 Sesn3 sestrin 3 1430630_at BB236218 -2.5274718 - Transcribed locus 1448293_at BB125261 -22.1234 Ebf1 Early B-cell factor 1 1416454_s_at NM_007392 -10.191133 Acta2 actin, alpha 2, smooth muscle, aorta 1425663_at M57525 -3.66898 111 rn interleukin 1 receptor antagonist 1441531_at BB143801 -8.936841 Plcb4 Phospholipase C, beta 4 1448136_at BC003264 -4.414439 Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase 2 1452362_at BB834440 -2.893026 Trim 16 tripartite motif protein 16 1456442_at BG065737 -3.944026 Rab3il1 RAB3A interacting protein (rabin3)-like 1 1443491_at BG802688 -2.5768628 Csnk1a1 Casein kinase 1, alpha 1 1455030_at AH 16234 -5.7471557 Ptprj Protein tyrosine phosphatase, receptor type, J 1435203_at BB794673 -3.0086586 Man2a2 mannosidase 2, alpha 2 1455978_a_at BB338441 -2.7183998 Mdm2 Transformed mouse 3T3 cell double minute 2 1434379_at BG868949 -4.268174 Mxd4 Max dimerization protein 4 1431829_a_at AK004876 -3.0130796 Rgl3 ral guanine nucleotide dissociation stimulator-like 3 1421022_x_at NM_025421 -3.1632276 Acypl acylphosphatase 1, erythrocyte (common) type 1440668_at BM235389 -3.733682 Macfl Microtubule-actin crosslinking factor 1 1456439_x_at BB209438 -13.891224 1200004M23Rik RIKEN cDNA 1200004M23 gene 1453593_at BG066866 -4.96189 1700110N18Rik RIKENcDNA 1700110N18 gene 1415972_at AW546141 -2.5900543 Hspa5 Heat shock 70kD protein 5 (glucose-regulated protein) 1454824_s_at BB699957 -7.5070004 Pdgfrl platelet-derived growth factor receptor-like 1416121_at M65143 -82.66288 Lox lysyl oxidase 1437434_a_at BM241735 -3.8918645 Gpr177 G protein-coupled receptor 177 1428411_at AK004510 -2.8951342 1700020114Rik RIKEN cDNA 1700020114 gene 1450876_at AI987976 -5.4628854 Cfh complement component factor h 1448890_at NM_008452 -12.40568 Klf2 Kruppel-like factor 2 (lung) 1420372_at BI646094 -2.5639923 Sntb2 syntrophin, basic 2 1455944_at BB467812 -2.6910944 Nup205 Nucleoporin 205 1457374_at AV377264 -2.6211624 Transcribed locus 1418072_at NM_023422 -5.9252286 Hist1h2bc histone 1, H2bc 1456973_at BM232132 -3.5800326 Foxpl Forkhead box P1 1426833_at BG073769 -3.947208 Eif4g3 eukaryotic translation initiation factor 4 gamma, 3 1418817_at BG073376 -2.9117553 Chmplb chromatin modifying protein 1B 1416727_a_at NM_025797 -3.2282863 Cyb5 cytochrome b-5 1425458_a_at AF022072 -2.5787404 Grb10 growth factor receptor bound protein 10 1443620_at BB212497 -7.8612356 Gpc4 Glypican 4 1417602_at AF035830 -2.6198318 Per2 period homolog 2 (Drosophila) 1438350_at BM234984 -15.5112705 Crkrs Cdc2-related kinase, arginine/serine-rich 1426851_a_at X96585 -7.514758 Nov nephroblastoma overexpressed gene 1429775_a_at AK009736 -4.3347282 Gpr137b G protein-coupled receptor 137B 1439618_at AI448308 -9.186582 PdelOa Phosphodiesterase 10A 1460196_at NM_007620 -4.9414167 Cbr1 carbonyl reductase 1 1454858_x_at AV171622 -3.9555826 2010317E24Rik RIKEN cDNA 2010317E24 gene 1442676_at AV356118 -5.0763645 Maoa monoamine oxidase A 1455299_at BB011882 -6.5834665 1700110N18Rik RIKEN cDNA 1700110N18 gene 1439105_at BE200391 -2.7351828 Cdadd Cytidine and dCMP deaminase domain containing 1 1417900 a at NM 013703 -6.022634 Vldlr very low density lipoprotein receptor 1416701_at BC009002 -3.3329806 Rnd3 Rho family GTPase 3 1425840_a_at AF080090 -6.428616 Sema3f Semaphorin 3 F 1450757_at NM_009866 -31.713396 Cdh11 cadherin 11 1426869_at BB005556 -9.200127 Boc biregional cell adhesion molecule-related/down-regulated by oncogenes binding protein 1449402_at AB046929 -2.6321824 Chst7 carbohydrate (N-acetylglucosamino) sulfotransferase 7 1433453_a_at BB621938 -3.1537282 Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 1450923_at BF144658 -7.9648886 4021972 Mus musculus cDNA clone IMAGE:4021972 5', mRNA sequence. 1445256_at BM238599 -12.71412 Vcl Vinculin 1449528_at NM_010216 -3.6467078 Figf c-fos induced growth factor 1417860_a_at NM J 33903 -9.603991 Spon2 spondin 2, extracellular matrix protein 1418595_at NM_020568 -27.85906 S312 plasma membrane associated protein, S3-12 1452424_at AW493905 -6.2231736 Gpr23 G protein-coupled receptor 23 1434423_at BB138485 -2.9214952 Gulpl GULP, engulfment adaptor PTB domain containing 1 1434593_at AV271901 -4.0655127 Eif5a2 eukaryotic translation initiation factor 5A2 1443870_at BB291885 -2.6854405 Col1a2 Procollagen, type I, alpha 2 1436566_at AV364488 -9.4913645 Rab40b Rab40b, member RAS oncogene family 1433512_at BB138212 -11.689986 Afp Alpha fetoprotein 1449244_at BC022107 -2.899613 Cdh2 cadherin 2 1423825_at BC018381 -3.598675 Gpr177 G protein-coupled receptor 177 1453851_a_at AK007410 -3.8493018 Gadd45g growth arrest and DNA-damage-inducible 45 gamma 1429639_at AK009137 -2.9910588 Prei4 preimplantation protein 4 1424186_at BG074158 -3.7849562 Ccdc80 coiled-coil domain containing 80 1435184_at BG066982 -3.221234 Npr3 natriuretic peptide receptor 3 1429089_s_at BG063749 -2.8647094 Gpnmb Glycoprotein (transmembrane) nmb 1416946_a_at NM_130864 -7.7188687 Acaala acetyl-Coenzyme A acyltransferase 1A 1448933_at NM_053142 -18.76417 Pcdhb17 protocadherin beta 17 1452250_a_at BI455189 -13.118469 Col6a2 procollagen, type VI, alpha 2 1433735_a_at BG075363 -3.8602376 Tmem64 transmembrane protein 64 1449036_at AK004847 -17.834457 Rnf128 ring finger protein 128 1424807_at BB053010 -12.672777 Lama4 laminin, alpha 4 1454882_at BB022070 -3.6072893 L3mbti3 l(3)mbt-like 3 (Drosophila) 1434411 at BB114398 -51.43717 9530045015 Mus musculus cDNA clone 9530045015 1423407_a_at BF228318 -3.4549284 Fbln2 Fibulin 2 1428330_at AK012087 -2.9432662 Dopey2 dopey family member 2 1416740_at AW744319 -4.49276 Col5a1 procollagen, type V, alpha 1 1424968_at BC027185 -14.518959 2210023G05Rik RIKEN cDNA 2210023G05 gene 1435246_at AV269651 -2.7646024 Paqr8 progestin and adipoQ receptor family member VIII 1454917_at BB795206 -2.8636644 AU045404 expressed sequence AU045404 1416628_at NM_025791 -6.865335 0610006l08Rik RIKEN cDNA 0610006108 gene 1427565_a_at AF213387 -2.917192 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1435771_at BM730668 -14.63523 Plcb4 phospholipase C, beta 4 1423228_at BG066773 -3.0522516 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1416430_at NMJ309804 -5.0977077 Cat catalase 1451446_at AF378762 -5.0290594 Antxrl anthrax toxin receptor 1 1448259_at BI452727 -3.8210843 FstH follistatin-like 1 1416513_at BC026051 -7.557679 Lamb2 laminin, beta 2 1423824_at BC018381 -4.1237087 Gpr177 G protein-coupled receptor 177 1419663_at BB542051 -4.559964 Ogn osteoglycin 1416505_at NM_010444 -3.2165966 Nr4a1 nuclear receptor subfamily 4, group A, member 1 1420938_at AW536432 -16.790648 Hs6st2 heparan sulfate 6-O-sulfotransferase 2 1434510_at BF780807 -9.603356 Papss2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 1456700_x_at BB100920 -3.162217 9430074M04 Mus musculus cDNA clone 9430074M04 3', mRNA sequence. 1428896_at AK004179 -8.755161 Pdgfrl platelet-derived growth factor receptor-like 1423101_at BB279185 -3.3068833 Paqr4 progestin and adipoQ receptor family member IV 1450881_s_at AK010724 -4.05352 Gpr137b G protein-coupled receptor 137B 1416759_at NM_138315 -11.998218 Micall microtubule associated monoxygenase, calponin and LIM domain containing 1 1417311_at NM_024223 -15.112104 Crip2 cysteine rich protein 2 1418666_at NM_008987 -17.447397 Ptx3 pentraxin related gene 1434378_a_at BG868949 -7.6779 Mxd4 Max dimerization protein 4 1415935_at NM_022315 -11.920266 Smoc2 SPARC related modular calcium binding 2 1422134_at NM_008036 -6.955168 Fosb FBJ osteosarcoma oncogene B 1423164_at AK010724 -3.1042614 Gpr137b G protein-coupled receptor 137B 1419295_at BC016447 -3.9820495 Creb3l1 cAMP responsive element binding protein 3-like 1 1416429_a_at NM_009804 -5.006516 Cat catalase ££ 1416675_s_at NM_019676 -4.185469 Plcdl phospholipase C, delta 1 1427391_a_at AW412729 -6.040881 Col12a1 Procollagen, type XII, alpha 1 1447643_x_at BB040443 -6.9506736 Snai2 Snail homolog 2 (Drosophila) 1416612_at BI251808 -7.88162 Cyp1b1 cytochrome P450, family 1, subfamily b, polypeptide 1 1416978_at NM_010189 -6.134124 Fcgrt Fc receptor, IgG, alpha chain transporter 1437661_at BG069824 -5.352031 AU021092 expressed sequence AU021092 1420841_at BF235516 -4.4701724 Ptprf protein tyrosine phosphatase, receptor type, F 1435043_at BB794831 -6.019513 Plcbl phospholipase C, beta 1 1439795_at AV242919 -14.407665 Gpr64 G protein-coupled receptor 64 1419006_s_at NM_033602 -10.655366 Peli2 pellino 2 1420842_at BF235516 -21.596607 Ptprf protein tyrosine phosphatase, receptor type, F 1439665_at BB417145 -10.775381 Gpr23 G protein-coupled receptor 23 1456878_at BE910952 -20.101255 Ppp1r12b Protein phosphatase 1, regulatory (inhibitor) subunit 12B 1438325_at AI647591 -5.6721153 Evil Ecotropic viral integration site 1 1422603_at BC005569 -18.372765 Rnase4 ribonuclease, RNase A family 4 1434149_at BB364520 -9.581864 2610030H06Rik RIKEN cDNA 2610030H06 gene 1456665_at BB476944 -5.3972716 2010003J03Rik RIKEN cDNA 2010003J03 gene 1438678_at AV154001 -4.118141 1500011K16Rik RIKEN cDNA 1500011K16 gene 1419706_a_at NM_031185 -10.255797 Akap12 A kinase (PRKA) anchor protein (gravin) 12 1424634_at BC011290 -6.911685 TceaH transcription elongation factor A (Sll)-like 1 1425338_at BB224034 -7.536312 Plcb4 phospholipase C, beta 4 1419182_at NM_022814 -4.349205 Svepl sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 1429679_at BB503935 -14.848507 MII3 Myeloid/lymphoid or mixed-lineage leukemia 3 1456658_at BM121216 -17.301346 Acta2 Actin, alpha 2, smooth muscle, aorta 1427884_at AW550625 -7.9130864 App Amyloid beta (A4) precursor protein 1437181_at BM121149 -14.891096 9530014K06 RIKEN, clone:9530014K06,cAMP-regulated guanine nucleotide exchange factor II 1423836_at BB447914 -12.046473 Slc9a1 Solute carrier family 9 (sodium/hydrogen exchanger), member 1 1426261_s_at D87867 -3.6373186 Ugt1a6a UDP glucuronosyltransferase 1 family, polypeptide A6A 1416652_at NM_025711 -155.34065 Aspn asporin 1433582_at AV309085 -3.5727882 1190002N15Rik RIKEN cDNA 1190002N15 gene 1416301_a_at BB125261 -22.344555 Ebf1 Early B-cell factor 1 1427347 s at BC003475 -3.7925937 Tubb2a tubulin, beta 2a ££ 1423669_at U08020 -4.0088854 Col1a1 procollagen, type I, alpha 1 1434150_a_at AV171622 -4.880669 2010317E24Rik RIKEN cDNA 2010317E24 gene 1452398_at AV306884 -15.224818 Plcel phospholipase C, epsilon 1 1438666_at BB534423 -4.515108 Tmem115 Transmembrane protein 115 1435176_a_at BF019883 -3.7652037 Cd86 CD86 antigen 1425560_a_at BC020031 -3.413791 S100a16 S100 calcium binding protein A16 1424029_at BCO17540 -3.2412827 TspyW TSPY-like 4 1435337_at BB150458 -8.985765 Thoc2 THO complex 2 1436555_at AV244175 -35.12945 Cat Catalase 1437921_x_at AW744723 -3.5046747 Nup205 Nucleoporin 205 1418672_at NM_013778 -11.682689 Akr1c13 aldo-keto reductase family 1, member C13 1448507_at BCO19531 -29.664717 Efhdl EF hand domain containing 1 1416723_at AI639846 -12.447519 Lpl Lipoprotein lipase 1452141_a_at BC001991 -8.363782 Seppl selenoprotein P, plasma, 1 1423819_s_at AF133669 -15.309845 Arl6ip1 ADP-ribosylation factor-like 6 interacting protein 1 1429348_at AK004119 -4.195972 Sema3c Semaphorin 3C 1436119_at BM231794 -4.0501013 Aldh1l2 aldehyde dehydrogenase 1 family, member L2 1424393_s_at BC026584 -7.6946144 Adhfel alcohol dehydrogenase, iron containing, 1 1422668_at NM_011452 -4.572368 Serpinb9b serine (or cysteine) peptidase inhibitor, clade B, member 9b 1450112_a_at NM_008087 -6.031083 Gas2 growth arrest specific 2 1418752_at NM_007436 -22.588377 Aldh3a1 aldehyde dehydrogenase family 3, subfamily A1 1429918_at AK018317 -29.931702 Arhgap20 Rho GTPase activating protein 20 1456532_at BB428671 -8.748975 Tgfb2 Transforming growth factor, beta 2 1428804_at AKO17269 -3.8109949 Mfap3l microfibrillar-associated protein 3-like 1448830_at NM_013642 -16.855194 Duspl dual specificity phosphatase 1 1456887_at AW228687 -4.848926 Cmklrl Chemokine-like receptor 1 1451204_at BC016096 -5.5067244 Scara5 scavenger receptor class A, member 5 (putative) 1433891_at Bl 107632 -4.3210897 Lgr4 Leucine-rich repeat-containing G protein-coupled receptor 4 1416947_s_at NM_130864 -5.8560677 Acaala acetyl-Coenzyme A acyltransferase 1A 1426340_at BB357585 -8.022996 Slda3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 1447676_x_at AV074236 -10.534421 Nat11 N-acetyltransferase 11 1418476 at NM 018827 -38.81159 Crlfl cytokine receptor-like factor 1 1454753_at BB540667 -3.90514 RnpepH arginyl aminopeptidase (aminopeptidase B)-like 1 1416318_at AF426024 -28.752737 Serpinbla serine (or cysteine) peptidase inhibitor, clade B, member 1a 1446947_at BG072149 -3.9178565 H3107C10 Mus musculus cDNA clone H3107C10 3', mRNA sequence. 1419248_at AF215668 -28.876938 Rgs2 regulator of G-protein signaling 2 1428392_at AKO18504 -4.6750154 Rassf2 Ras association (RalGDS/AF-6) domain family 2 1454901_at BG069663 -5.3794575 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 1439847_s_at BM249597 -34.06145 Klf12 Kruppel-like factor 12 1425896_a_at AF007248 -8.35275 Fbn1 fibrillin 1 1421041_s_at NM_008182 -12.250113 Gsta2 glutathione S-transferase, alpha 2 (Yc2) 1427912_at AK003232 -4.5477266 Cbr3 carbonyl reductase 3 1453286_at BB085537 -4.320396 Plxna2 plexin A2 1416368_at NM_010357 -8.182581 Gsta4 glutathione S-transferase, alpha 4 1417872_at U41739 -5.669923 Fhh four and a half LIM domains 1 1428667_at AW986246 -3.8703966 Maoa monoamine oxidase A 1416724_x_at AI639846 -6.358455 Lpl Lipoprotein lipase 1416666_at NMJ309255 -119.43703 Serpine2 serine (or cysteine) peptidase inhibitor, clade E, member 2 1425927_a_at AF375476 -7.752982 Atf5 activating transcription factor 5 1433581 _at AV309085 -4.22941 1190002N15Rik RIKEN cDNA 1190002N15 gene 1451527_at AF352788 -7.119672 Pcolce2 procollagen C-endopeptidase enhancer 2 1422155_at BC015270 -5.9167967 Hist2h3c2 histone 2, H3c2 1422561 _at BB658835 -20.309143 Adamts5 A disintegrin-like and metallopeptidase with thrombospondin type 1 motif, 5 1416455_a_at NM_009964 -5.9672055 Cryab crystallin, alpha B 1427479_at AA413531 -4.3189664 Tpm3 Tropomyosin 3, gamma 1442542_at BB363812 -6.036747 2010003 J03Rik RIKEN cDNA 2010003J03 gene 1418071_s_at AF081260 -5.373017 Cdyl chromodomain protein, Y chromosome-like 1417133_at NM_008885 -4.6630273 Pmp22 peripheral myelin protein 1423835_at BB447914 -17.454733 Slc9a1 Solute carrier family 9 (sodium/hydrogen exchanger), member 1 1439255_s_at BB726971 -4.382947 Gpr137b G protein-coupled receptor 137B 1437197_at BB251748 -22.464272 - Transcribed locus 1456504_at BM248637 -19.45855 Bnip3l BCL2/adenovirus E1B interacting protein 3-like 1436543_at BB712878 -10.458931 Brpfl Bromodomain and PHD finger containing, 1 1449110 at BC018275 -4.1014457 Rhob ras homolog gene family, member B 1452540_a_at M25487 -4.35432 Hist1h2bp histone 1, H2bp 1424713_at AY061807 -7.2123895 CalrnW calmodulin-like 4 1422648_at BF533509 -38.701176 Slc7a2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1416239_at NM_007494 -11.779369 Ass1 argininosuccinate synthetase 1 1434479_at AV246911 -4.886221 AI413331 expressed sequence AI413331 1450455_s_at AF177041 -4.8757167 Akr1c12 aldo-keto reductase family 1, member C12 1416613_at BI251808 -10.93814 Cyp1b1 cytochrome P450, family 1, subfamily b, polypeptide 1 1426852_x_at X96585 -7.215531 Nov nephroblastoma overexpressed gene 1418673_at NM_011415 -6.1872077 Snai2 snail homolog 2 (Drosophila) 1422587_at NM_019631 -5.217817 Tmem45a transmembrane protein 45a 1426734_at BB008324 -10.19294 BC022623 CDNA sequence BC022623 1458947_at AV341977 -4.849732 Glb1 Galactosidase, beta 1 1436870_s_at BG068103 -31.142832 AU041783 expressed sequence AU041783 1434369_a_at AV016515 -5.916305 Grb10 Growth factor receptor bound protein 10 1455893_at BG067392 -62.855602 Rspo2 R-spondin 2 homolog (Xenopus laevis) 1416572_at NM_008608 -6.0161905 Mmp14 matrix metallopeptidase 14 (membrane-inserted) 1455037_at BB002869 -7.4199095 Plxna2 plexin A2 1416808_at X14480 -49.080612 Nidi nidogen 1 1417214_at BB121269 -6.5399294 Rab27b RAB27b, member RAS oncogene family 1434148_at BB364520 -14.919412 2610030H06Rik RIKEN cDNA 2610030H06 gene 1452031_at BB357585 -8.198136 Slda3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 1418187_at AF146523 -6.877742 Ramp2 receptor (calcitonin) activity modifying protein 2 1418070_at AF081260 -14.522317 Cdyl chromodomain protein, Y chromosome-like 1431362_a_at AK006809 -23.088583 Smoc2 SPARC related modular calcium binding 2 1455607_at BG072958 -8.376857 Rspo3 R-spondin 3 homolog (Xenopus laevis) 1451332_at BC021376 -73.44238 Zfp521 zinc finger protein 521 1455494_at BI794771 -5.7280583 5658407 Mus musculus cDNA clone IMAGE:5658407 3', mRNA sequence. 1450047_at AW536432 -160.72844 Hs6st2 heparan sulfate 6-O-sulfotransferase 2 1455425_at BG071655 -6.7810826 BB001228 expressed sequence BB001228 1441389_at BB045448 -25.872799 - Transcribed locus 1448421_s_at NM_025711 -142.29128 Aspn asporin 1418979 at NM 134072 -7.208527 Akr1c14 aldo-keto reductase family 1, member C14 1435191_at BM231053 -14.124189 Cdsn Corneodesmosin 1448816_at NM_008968 -11.708516 Ptgis prostaglandin 12 (prostacyclin) synthase 1460208_at NM_007993 -13.300247 Fbn1 fibrillin 1 1454867_at BB234631 -7.2701464 Mn1 meningioma 1 1437409_s_at BB812574 -8.683872 Vars2l Valyl-tRNA synthetase 2-like 1456404_at BB475194 -20.920055 Adamts5 A disintegrin-like and metallopeptidase with thrombospondin type 1 motif, 5 1416321_s_at NM_054077 -20.401625 Prelp proline arginine-rich end leucine-rich repeat 1448228_at M65143 -106.04547 Lox lysyl oxidase 1416271_at NM_022032 -71.256454 Perp PERP, TP53 apoptosis effector 1416302_at BB125261 -12.766286 Ebf1 Early B-cell factor 1 1436761_s_at BB461323 -46.28995 Dcx Doublecortin 1416164_at NM_011812 -63.53051 Fbln5 fibulin 5 1423516_a_at BB781435 -33.726555 Nid2 nidogen 2 1426272_at BG070844 -10.227088 Lmbrl limb region 1 1451348_at BC004774 -13.146012 Depdc6 DEP domain containing 6 1424089 a_at U16321 -11.986632 Tcf4 transcription factor 4 290 Appendix C Microarray Data AP-1 and Erk1,2 Analysis of Cancer-Associated Genes Upregulated/Downregulated in Rhammonc-Overexpressing 10T1/2 Fibroblasts AP1 Promoter Linked Linked Genbank GENE Fold Change Sequence toAP1 to Erk1,2 CRE TRE NM 007423 AFP 16.72313 X AK009959 ANKRD1 4.088194 X BB770932 APCDD1 43.38772 X NM 009704 AREG 5.222079 X NM 007464 BIRC3 3.9132988 BB645745 BIRC4BP 10.695955 AF068182 BLNK 7.6838403 X NM 007568 BTC 3.5682347 BG071758 BRCA1 2.9461582 BG064890 C60RF66 1.9750952 AJ245857 CA9 3.2050045 BC008152 CASP1 2.8324423 NM 013653 CCL5 10.680747 AF128193 CCL7 10.815479 X AF065933 CCL13 15.849252 NM 007631 CCND1 2.3221238 X X M27130 CD44 2.2870412 X X BE634960 CD48 8.600154 NM 011799 CDC6 3.9758086 ABO18574 CDC7 2.6274376 AF477481 CDT1 3.0804963 BG916502 CENPE 2.3878045 X BC025084 CENPH 2.6301324 NM 016904 CKS1B 2.3494468 AV152288 CLU 3.4252663 X X BM233698 CSF1 2.8389988 X X X NM 021274 CXCL10 153.82253 X X NM 010049 DHFR 2.750552 X AK012530 DUSP4 3.7693422 X X NM 026268 DUSP6 3.766158 X X NM 007945 EPS8 4.2997913 X NM_008021 F0XM1 2.7932985 X X NM 010275 GDNF 9.26429 X X BB009037 HMGA1 3.7916908 X X X58380 HMGA2 14.519451 X X NM 008329 IFI16 5.778715 X NM 011940 IFI202B 5.833093 X X NM 018770 IGSF4 2.8706284 X BB253137 INHBB 17.082603 NM 008404 ITGB2 2.8178802 X X NM 013569 KCNH2 3.3729212 X X AF065917 LIF 10.169945 X X AP1 Promoter Linked Linked Genbank GENE Fold Change Sequence toAP1 toErk1,2 CRE TRE NM 057173 LM01 5.5717883 X X AV174595 LRIG1 10.289486 AV284857 MAF 3.9191751 X NM 008564 MCM2 2.862082 NM 008568 MCM7 2.5546257 X AI595932 MEF2C 14.085947 X BB763517 MITF 3.0845306 X X AF100171 MLF1 4.621825 AK011386 MLLT3 4.28948 X NM 013599 MMP9 5.540871 X X U42190 MSH6 2.5902116 AF155372 NFKB2 3.6152225 X NM 030253 PARP9 6.4118915 X AK008037 PEBP1 2.4945416 X X BB706079 PLK4 2.2324219 X BB777815 PNPT1 4.09547 X NM 011132 POLE 1.9837612 BM236743 PTPN13 4.2291036 X X AA124924 RASA1 2.351576 X X BF714880 RNASEL 5.5608463 NM 009821 RUNX1 3.9032257 X X X BF226166 SMAD7 2.2514808 X X NM 009263 SPP1 2.7881079 X X AW214029 STAT1 7.953063 X AF088862 STAT2 5.537232 AK011596 TFRC 2.5240693 AW321975 TGM2 4.8495426 X NM 011905 TLR2 6.808084 X X U21050 TRAF3 2.6744204 X NM 019551 TTRAP 2.0418203 AW228853 VEGFC 12.157682 X BC018425 WNT5A 2.8398032 X X NM 008486 ANPEP -7.4494953 BB369191 C50RF13 -97.76865 X AF209905 CALCRL -2.9856458 NM 009804 CAT -5.0977077 X X NM 009864 CDH1 -4.476 X X NM 009866 CDH11 -31.713396 BI251808 CYP1B1 -7.88162 X X NM 013642 DUSP1 -16.855194 X X X NM 010145 EPHX1 -2.3701463 X BC005486 ETS2 -2.1549234 X X AI647591 EVI1 -5.6721153 X BM234360 FN1 -3.7479284 X X AP1 Promoter Linked Linked Genbank GENE Fold Change Sequence toAP1 toErk1,2 CRB TRE NM 008036 FOSB -6.955168 X X BM232132 FOXP1 -3.5800326 BI452727 FSTL1 -3.8210843 X AV016515 GRB10 -5.916305 X BB794880 HIP1 -2.0589995 M12573 HSPA1B -2.6561193 X X NM 008321 ID2 -7.041584 AF440694 IGF1 -3.42888 X X AI481717 ITGA5 -6.2989283 X X X NM 008452 KLF2 -12.40568 X X AF072403 KLF6 -2.5875514 BB053010 LAMA4 -12.672777 M65143 LOX -82.66288 X X AF357006 LOXL1 -3.5346115 X AV233043 MMP2 -10.252351 X X NM 008608 MMP14 -6.0161905 X AF282844 MMP16 -2.3449645 X BG868949 MXD4 -4.268174 NM 008714 NOTCH 1 -5.1315246 X X NM 008716 NOTCH3 -4.8462806 X X96585 NOV -7.514758 X AK011144 NRP1 -3.0990748 X X AF335583 PDGFD -4.446744 NM 008809 PDGFRB -3.1660273 X X BB699957 PDGFRL -7.5070004 NM 022032 PERP -71.256454 NM 013630 PKD1 -2.879675 X X NM 019676 PLCD1 -4.185469 X AV306884 PLCE1 -15.224818 NM 011146 PPARG -5.54975 X X NM 008968 PTGIS -11.708516 BC002064 PTN -3.4714067 X X AF146523 RAMP2 -6.877742 X BC018275 RHOB -4.1014457 X X BI788645 SDC1 -1.8719802 X X BCO10976 SEMA3F -2.762221 X NM 019812 SIRT1 -3.495556 X BB040443 SNAI2 -6.9506736 BG069527 STAT3 -2.7517657 X X U36776 SYK -4.3433747 X X BC004057 TACC2 -1.8948507 BB756069 TFPI -2.7748134 BF144658 TGFB2 -7.9648886 BG793483 TGFBR2 -2.6736221 X X AP1 Promoter Linked Linked Genbank GENE Fold Change Sequence toAP1 toErk1,2 CR£ TRE BM232388 TPM1 -3.265383 X BC003475 TUBB2A -3.7925937 NM 009502 VCL -2.180036 X X NM 018865 WISP1 -4.578052 X 295 Appendix D Microarray Data "Hallmarks of Cancer" Classification of Cancer-Associated Genes Upregulated/Downregulated in Rhammonc-Overexpressing 10T1/2 Fibroblasts Unregulated Genes Self-Sufficiency in Growth Signals Reference Gene Common Name Function (Pubtned Identification) AREG Amphiregulin stimulates prostate epithelial cell growth in a paracrine manner; can stimulate growth of MM cells PMID16424011; PMID15735670 BTC Betacellulin EGFR ligand/mitogen PMID10940639 CCND1 CyclinDI ectopic expression is transforming PMID17440082; PMID14634283 CLU Clusterin frequently downregulated in tumours; inhibits oncogene-mediated cellular proliferation PMID15126350 ligand for c-f ms oncogene CSF1' Colony Stimulating Factor-1 PMID17332318 EPS8 Epidermal growth factor receptor pathway substrate 8 is transforming when overexpressed PMID11244499 GDNF Glial cell derived neurotrophic factor highly expressed in glioblastomas; reduced expression reduces proliferation PMID11079571 HMGA1 High mobility group AT-hook 1 is transforming when overexpression in immortilized cell lines PMID11602345 HMGA2 High mobility group AT-hook 2 tg mice overexpressing a CT truncated form of HMGA1 have high incidence of benign tumors PMID11602345 KLF5 Kruppel-like factor 5 is transforming when overexpressed and mediates Ras transformation PMID15077182 LIF Leukemia inhibitory factor stimulates proliferation of a variety of cell types PMID12529546 LM01 LIM domain only 1 candidate oncogene (transgenic mice overexpressing LM01 developed immature and PMID15930276 aggressive T-cell leukemia) MAF V-maf musculoaponeurotic fibrosarcoma oncogenic in chicken embryo fibroblasts PMID16247450 oncogene homolog (avian) MITF Microphthaimia-associated transcription factor an amplified oncogene in a fraction of melanomas; has an oncogenic role in clear cell sarcoma PMID16899407 MMP9 Matrix metallopeptidase 9 can be transforming when overexpressed; secretion correlated with oncogenic transformation PMID16353190; PMID11401328 MYCBP C-myc binding protein frequently upregulated in colon carcinomas where it may act as c-myc coactivator PMID15979100 NFKB2 Nuclear factor of kappa light polypeptide gene candidate proto-oncogene (rearranged in certain types of lymphoma and more PMID9021684 enhancer in B-cells 2, p49/p100 commonly in cutaneous lymphoma) PARP9 Poly (ADP-ribose) polymerase family, member 9 identified as a risk-related gene in diffuse large B-cell lymphoma PMID16809771 PDGFC Platelet-derived growth factor, C polypeptide candidate oncogene in mesothelioma; expression upregulated in brain tumors PMID15920167; PMID12097282 RASA1 RAS p21 protein activator 1 oncogenic activity (activating mutations in the SH2 domain confer direct oncogenic potential PMID8738474 SMAD7 MAD homolog 7 (Drosophila) oncogenic in skin cancer; upregulated in many cancers PMID17477360; PMID16289860 STAT1 Signal transducer and activator of transcription 1 respond to IFNs and to PDGF by reducing the expression of c-myc (functions as a growth inhibitor) PMID14502556 STAT2 Signal transducer and activator of transcription 2 functions in type IIFN signaling PMID14502555 TFRC Transferrin receptor c-myc effector that enhances cellular proliferation and tumorigenesis PMID16508012 VEGFC Vascular endothelial growth factor C promotes leukemic cellular proliferation PMID11877295 Insensitivity to Anti-Growth Signals Reference Gene Common Name Function (Pubmed Identification) APCDD1 Adenomatosis polyposis coli down-regulated 1 direct target of APC-TCF4 TF complex; exogenous expression promotes tumor growth PMID12384519 BLNK B-cell linker acts as a tumor suppressor that limits pre-B cell expansion PMID12436112 BRCA1 Breast cancer 1 tumor suppressor PMID17052168; PMID11832208 CCND1 CyclinDI ectopic expression shortens the G1 phase of the cell cycle PMID17359287; PMID14634283 CDC6 Cell division cycle 6 homolog (S. cerevisiae) required for DNA replication; can repress the INK4/ARF tumor suppressor locus PMID16572177 CDC7 Cell division cycle 7 homolog (S. cerevisiae) required for DNA replication PMID15364349 CDT1 Chromatin licensing and DNA replication factor 1 DNA replication factor PMID17042960 CKS1B CDC28 protein kinase 1 b expression is repressed in p53-dependent manner PMID17377499; PMID8939596 DHFR Dihydrofolate reductase required for DNA synthesis PMID17333344 DUSP4 Dual specificity phosphatase 4 candidate tumor suppressor; frequently lost in breast carcinomas PMID15184884; PMID15993269 DUSP6 Dual specificity phosphatase 6 candidate tumor suppressor; frequent LOH in pancreatic cancer PMID12759238 FOXM1 Forkhead box protein M1 required for cell cycle progression PMID17014965 IFI202B Interferon activated gene 202B negative regulator of cell growth PMID12894219 IGSF4 Immunoglobulin superfamily, member 4 candidate tumor suppressor (adhesion protein that contributes to the maintenance PMID16128739 of an epithelial phenotype) INHBB Inhibin beta-B induced growth inhibition through the SMAD pathway PMID16636301 KCNH2 Potassium voltage-gated channel, facilitates TNF-alpha mediated tumor cell proliferation PMID12208728 subfamily H (eag-related), member 2 KLF5 Kruppel-like factor 5 candidate tumor suppressor; frequently deleted in prostate cancer PMID12085961 promotes mitosis by activating cyclin B1/Cdc2 during Ras transformation PMID16102754 LRIG1 Leucine-rich repeats and immunoglobulin-like domains 1 candidate tumor suppressor (antagonize growth factor signaling) PMID17239582 MAF V-maf musculoaponeurotic fibrosarcoma counteracts Ras/Raf/MEK-mediated transformation in embryonic neuroretina cells PMID16247450 oncogene homolog (avian) MCM2 Minichromosome maintenance 2 part of the prereplicative complex that essential for DNA replication; frequently PMID16101384 overexpressed in malignant cells MCM7 Minichromosome maintenance 7 part of the prereplicative complex that essential for DNA replication PMID16101384 MSH6 MutS homolog 6 (E. coli) DNA MMR genes involved in mediating apoptosis in response to DNA damage PMID14632208 NFKB2 Nuclear factor of kappa light polypeptide gene candidate tumor suppressor PMID16793322; PMID12389034 enhancer in B-cells 2, p49/p100 PLK4 Polo-like kinase 4 candidate tumor suppressor; Plk4 haploinsufficiency results in mitotic infidelity and carcinogenesis PMID16025114 PNPT1 Polyribonucleotide nucleotidyltransferase 1 induced during terminal differentiation and senescence (induces growth arrest) PMID16687933 POLE Polymerase (DNA directed), epsilon functions in DNA damage recognition pathways PMID8791484 PTPN13 Protein tyrosine phosphatase, non-receptor type 13 putative tumor suppressor gene in hepatocarcinogenesis PMI016489062 RASA1 RAS p21 protein activator 1 tumor suppressing factor (directly inactivates activated Ras) PMID8738474 RUNX1 Runt-related transcription factor 1 haploinsufficiency or mutated forms (no longer able to activate transcription) are PMID16250015 associated with leukemia STAT1 Signal transducer and activator of transcription 1 candidate tumor suppressor (inhibits growth and acts as a proapoptotic factor) PMID14502555 TRAF3 Tnf receptor-associated factor 3 inhibitor of noncanonical NF-kappaB, which are associated B cell lymphomas when activated PMID17158868; PMID16970925 TTRAP Traf and Tnf receptor associated protein inhibits nuclear factor-kappa B activation PMID10764746 WNT5A Wingless-type MlvlTV integration site 5A has tumor suppressor activity in primary thyroid carcinoma PMID15735754 Evading Apoptosis Reference Gene Common Name Function (Pubmed Identification) AFP Alpha-fetoprotein anti-apoptotic factor PMID17046153; PMID16869888 ANKRD1 Ankyrin repeat domain 1 (cardiac muscle) Pro-apoptotic factor PMID16139514 BIRC3 Baculoviral IAP repeat-containing 3 Inhibitor of apoptosis PMID17154176 BIRC4BP XIAP associated factor-1 Inducer of apoptosis; antagonizes the anticaspase activity of XIAP PMID11175744 BRCA1 Breast cancer 1 can induce caspase-dependent apoptosis in response to DNA damage PMID16721040 C60RF66 inhibits apoptosis in hormone responsive tumor cells PMID14871833 CA9 Carbonic anhydrase 9 resistance to hypoxia and low pH-induced apoptosis in tumor stroma PMID17415526; PMID17213826 CASP1 Caspase 1 Pro-apoptotic factor PMID11114501 CCND1 CyclinDI can enhance or inhibit apoptosis (depends on expression level, cell type and growth conditions) PMID14634283 CD48 C048 antigen CD2-CD48 interaction inhibits apoptosis in B lymphocytes (e.g.) up-regulating bcl-2 expression PMID7925579 inhibits apoptosis by interacting with activated Bax CLU Clusterin PMID16113678 DUSP4 Dual specificity phosphatase 4 an essential target of p53 in signaling apoptosis PMID16778175 DUSP6 Dual specificity phosphatase 6 exogenous expression in pancreatic cancer cells induces apoptosis PMID12759238 GDNF Glial cell derived neurotrophic factor inhibits apoptosis in response to staurosporine- and ischemia and EtOH PMID17497674; PMID17113937 HMGA1 High mobility group AT-hook 1 forced expression in normal cells is toxic (induces apoptosis by deregulating S-phase PMID11602345 and delaying entry into G2M) HMGA2 High mobility group AT-hook 2 forced expression in normal cells is toxic (induces apoptosis by deregulating S-phase PMID11602345 and delaying entry into G2M) IFI16 Interferon activated gene 16 modulates pS3 function to promote apoptosis PMID14990579 IFI202B Interferon activated gene 202B M-Ras mediated increases in p202 protect cells from serum starvation-induced apoptosis PMID12461788 KLF5 Kruppel-like factor 5 regulates apoptosis; interacts with p53 to regulate expression of survivin PMID16595680 LRIG1 Leucine-rich repeats and immunoglobulin-like domains 1 ectopic expression of LRIG1 protects A431 cells from EGF-induced cell growth arrest and apoptosis PMID17239582 MEF2C Myocyte enhancer factor 2C regulates apoptosis (e.g. antiapoptotic during development but proapoptotic in mature neurons PMID11904443 exposed to excitotoxic or stress) MLF1 Myeloid leukemia factor 1 inhibits cell cycle progression through a p53-dependent mechanism PMID15861129 MLLT3 Myeloid/lymphoid or mixed-lineage leukemia; protects leukemic cells from apoptosis PMID11681416 translocated to, 3 MMP9 Matrix metallopeptidase 9 contributes to cell survival (e.g. in lung microenvironment) PMID16397239 NFKB2 Nuclear factor of kappa light polypeptide gene pro-apoptotic protein with anti-oncogenic function PMID12389034; PMID12498710 enhancer in B-cells 2, p49/p100 PEBP1 Phosphatidylethanolamine binding protein 1 abrogating the survival and antiapoptotic properties of Raf-1-MEK1/2-ERK1/2 and PMID15327891 NF-kappaB signaling pathways PLK4 Polo-like kinase 4 transcriptionally repressed by p53; induces apoptosis upon RNAi silencing PMID15967108 PTPN13 Protein tyrosine phosphatase, non-receptor type 13 mediates resistance to Fas-mediated apoptosis in cancer cells PMID16888780 RNASEL Ribonuclease L pro-apoptotic PMID12590567 (2',5'-oligoisoadenylatesynthetase-dependent) RUNX1 Runt-related transcription factor 1 Reduction of transcription factor activity up-regulates Fas, enhancing apoptotic sensitivity of PMID16177090 double positive thymocytes SPP1 Secreted phosphoprotein 1 (Osteopontin) autocrine stimulation by osteopontin contributes to antiapoptotic signaling PMID12183442 TGM2 Transglutaminase 2, C polypeptide shown to be both a pro- and anti-apoptotic factor PMID17581697 TLR2 Toll-like receptor 2 overexpression sensitizes cells to serum deprivation-induced apoptosis PMID16213463 VEGFC Vascular endothelial growth factor C survival factor; protected leukemic cells from the apoptotic effects of chemotherapeutic agents PMID17164762; PMID11877295 Limitless Replicative Potential Reference Gene Common Name Function (Pubmed Identification) AREG Amphiregulin factor produced by senescent cells PMID16424011 CCND1 Cyclin D1 highly expressed in senescent fibroblasts; not clear if it causes cells to senesce PMID14634283 Sustained Angiogenesis Reference Gene Common Name Function (Pubmed Identification) BTC Betacellulin overexpression by HCC cells and EGFR by tumor endothelial cells enhance PMI016949929 vascularity in a paracrine manner KCNH2 Potassium voltage-gated channel, promotes VEGF secretion in GBM cells PMID16175187 subfamily H (eag-related), member 2 KLF5 Kruppel-like factor 5 angiogenic factor PMID15609325 SPP1 Secreted phosphoprotein 1 (Osteopontin) induces angiogenesis of murine neuroblastoma cells in mice PMID11920639 TFRC Transferrin receptor receptor for transferrin, which has been implicated in cartilage neovascularization PMID9087450 TGM2 Transglutaminase 2, C polypeptide involved in crosslinking ECM proteins (stabilizing the basement membrane) PMID17581697 and impairing angiogenesis VEGFC Vascular endothelial growth factor C promotes angiogenesis PMID17164762; PMID11175837 Tissue Invasion and Metastasis Reference Gene Common Name Function (Pubmed Identification) AREG Amphiregulin stimulates mammary morphogenesis PMID16079154 BTC Betacellulin induces MMP expression PMID12612292; PMID15197768 C6ORF66 induces mmp9 production to increase invasion of breast cancer cells PMID17001319 CCL5 Chemokine (C-C motif) ligand 5 induces tumor leukocyte infiltration and regulates tumor-associated macrophages PMID17016763 serum levels correlated with metastatic disease PMID12509950; PMID16353083 CCL7 Chemokine (C-C motif) ligand 7 anti-tumorigenic; impaired ability to attract TAM when cleaved (e.g. by MMP2); functions as PMID15246056 receptor antagonists for intact CC chemokines CCL13 Chemokine (C-C motif) ligand 13 recruits blood monocytes or blood DC precursors that differentiate into typical DCs to PMID15027495 improve antitumour immune responses CCND1 Cyclin D1 increase expression of genes involved in metastasis or malignancy (e.g. FGF1) PMID12543798 CD44 CD44 antigen adhesion molecule involved in increased cell migration and invasion PMID17079438 CSF1 Colony Stimulating Factor-1 recruits macrophages to promote tumor progression to malignancy PMID12465600 CXCL10 Chemokine (C-X-C motif) ligand 10 up-regulates invasion-related properties in colorectal cancer cells PMID17409450 enhances migration through regulation of Rac, FAK and actin cytoskeleton dynamics PMID17537571; PMID17496330 EPS8 Epidermal growth factor receptor pathway substrate 8 O O GDNF Glial cell derived neurotrophic factor promotes chemotaxis and branching morphogenesis in the kidney; stimulates migration PMID17540362; PMID9732293 and chemoattraction of epithelial cells HMGA1 High mobility group AT-hook 1 transgenic human breast epithelial cells that overexpress HMGA1 form PMID11602345 metastatic tumors in nude mice ITGB2 integrin beta 2 tumor cells can interact with CD 18 during hematogenous metastasis PMID7628754 KCNH2 Potassium voltage-gated channel, regulate cell invasion of tumor cells PMID14744775 subfamily H (eag-related), member 2 LIF Leukemia inhibitory factor chemoattractant for many cell types; recently identified metastatic factor in rhabdomyosarcomas PMID17332343; PMID12529546 MMP9 Matrix metallopeptidase 9 degrades basement membrane (collagen IV) to contribute to invasion and metastasis PMID16680569; PMID6243750 PEBP1 Phosphatidylethanolamine binding protein 1 metastasis suppressor gene in prostate cancer PMID15313400 SMAD7 MAD homolog 7 (Drosophila) stable overexpression inhibits invasion of melanoma cells into matrigel PMID16007121; PMID17332363 and suppresses bone metastasis SPP1 Secreted phosphoprotein 1 (Osteopontin) involved in cell adhesion, migration and invasion PMID12606946; PMID10435636 TGM2 Transglutaminase 2, C polypeptide ectopic expression leads to increased cell adhesiveness PMID17581697 TTRAP Traf and Tnf receptor associated protein inhibits the migration of epithelial cancer cells PMID12743594 VEGFC Vascular endothelial growth factor C promotes metastasis (promotes lymphangiogenesis, cell motility and invasion) PMID17164762 Genomic Instability Reference Gene Common Name Function (Pubmed Identification) BRCA1 Breast cancer 1 important for maintaining genomic stability by promoting double-strand break repair PMID16998501 CCND1 CyclinDI aberrant expression is linked to genomic instability PMID12007188 CDT1 Chromatin licensing and DNA replication factor 1 deregulated expression leads to rereplication and chromosomal instability PMID17042960 CENPE Centromere protein E functions at mitotic spindle assembly checkpoint; aberrant expression linked to aneuploidy PMID17268814 CENPH Centromere protein h+C44 centromeric protein; overexpression of CENPH induces genomic instability PMID15930286; PMID16691204 FOXM1 Forkhead box protein M1 deregulation leads to mitotic defects and aneuploidy PMID17014965 MCM2 Minichromosome maintenance 2 required for processive DNA replication (target of S-phase checkpoints); functional loss PMID15108800 causes DNA damage and genome instability MCM7 Minichromosome maintenance 7 required for processive DNA replication (target of S-phase checkpoints); functional loss PMID15108800 causes DNA damage and genome instability PLK4 Polo-like kinase 4 Plk4+/- embryonic fibroblasts have increased centrosomal amplification, PMID16025114 multipolar spindle fomiation and aneuploidy POLE Polymerase (DNA directed), epsilon overexpression leads to an increased mutation rate PMID15811630 RUNX1 Runt-related transcription factor 1 haploinsufficiency predisposes cells to the acquisition of additional mutations that will PMID16250015 cause AML in adulthood; contributes to genomic instability WNT5A Wingless-type MMTV integration site 5A possible activator of telomerase in cancer cells PMID14756623 1>J o Downreaulated Genes Self-Sufficiency in Growth Signals Reference Gene Common Name Function (Pubmed Identification) CDH11 CadherinU oncogenic in bone when expressed as fusion protein with usp6 PMID15026324 CYP1B1 Cytochrome P450, family 1, subfamily b, polypeptide 1 catalyze formation of reactive oxygenated intermediates leading to DNA PMID17128211 damage and cancer initiation EPHX1 Epoxide hydrolase 1, microsomal activation of procarcinogens PMID12915882 ETS2 E26 avian leukemia oncogene 2, 3' domain promotes foci formation of NIH3T3 cells and growth in soft agar of rat-1 cells PMID8445738; PMID2813360 EVI1 Ecotropic viral integration site 1 is transforming PMID15156182 FOSB FBJ osteosarcoma oncogene B is transforming when overexpressed in rat fibroblasts PMID1903195 FOXP1 Forkhead box P1 increased expression correlated with development of large diffuse B-cell PMID17477366 lymphomas and poor prognosis GRB10 Growth factor receptor-bound protein 10 protooncogene (regulates Bcr-Abl-mediated transformation) PMID9747873 HIP1 Huntington interacting protein 1 endocytic protein that is transforming when overexpressed in fibroblasts PMID12781365 HSPA1B Heat shock protein 1B transforming when overexpressed in Rat-1 fibroblasts PMID10380887 ID2 Inhibitor of DNA binding 2 is transforming when overexpressed and leads to growth factor insensitivity PMID11034201 IGF1 Insulin-like growth factor 1 is required for cellular transformation by oncogenes such as SV40 Large T-Antigen PMID14688466 ITGA5 Integrin alpha 5 is transforming when overexpressed in fibroblasts PMID11555674 NOTCH1 Notch gene homolog 1 (Drosophila) Is transforming when overexpressed; overexpression of activated Notchl PMID16507912 induces mammary tumor formation NOTCH3 Notch gene homolog 3 (Drosophila) overexpression of activated Notch3 blocks induces mammary tumors PMID16507912 PDGFD Platelet-derived growth factor, D polypeptide upregulated in brain tumors PMID12097282 PDGFRB Platelet derived growth factor receptor, beta polypeptide is transforming with PDGFB PMID12629513 PLCE1 Phospholipase C, epsilon 1 required for H-ras-induced de novo TPA-induced skin carcinogenesis PMID15604236 PTN Pleiotrophin transforms NIH 3T3 cells and induces tumors in nude mice PMID8421705 SNAI2 Snail homolog 2 acts downstream of c-kit in transformation PMID17550342 STAT3 Signal transducer and activator of transcription 3 required for fibroblast transformation by a number of oncogenes PMID16082218 TUBB2A Tubulin, beta 2a significantly upregulated in malignant prostate cancers PMID9111604 WISP1 WNT1 inducible signaling pathway protein 1 transforming when overexpressed in rat kidney fibroblasts (these cells formed tumors in mice) PMID10716946 Insensitivity to Anti-Growth Signals Reference Gene Common Name Function (Pubmed Identification) CAT Catalase tumor suppressor (important inactivator of many environmental mutagens) PMID13677623 CDH1 Cadherin 1 tumor suppressor (loss of cdhl based cell-cell adhesion associated with increased PMID17502225 proliferation and metastasis) CDH11 Cadherin 11 candidate tumor suppressor in retinoblastoma PMID15383628 DUSP1 Dual specificity phosphatase 1 candidate tumor suppressor; frequently downregulated in cancer PMID15981206 FN1 Fibronectin 1 full-length FN can revert the transformed phenotype; FN fragments can promote transformation PMID12083849 FOSB FBJ osteosarcoma oncogene B stimulates cell cycle entry (go to g 1) PMID9710644 FOXP1 Forkhead box P1 candidate tumor suppressor (LOH at this site associated with many solid tumors) PMID17477366 FSTL1 Follistatin-like 1 a TGF-b responsive gene that inhibits growth when expressed in human cancer cells PMID10814877 ID2 Inhibitor of DNA binding 2 inhibition by pRB required for anti-proliterative effect of RB; overexpression PMID11034201 leads to hyperproliferation of cells KLF2 Kruppel-like factor 2 negative regulator of T-cell proliferation PMID16351639 KLF6 Kruppel-like factor 6 tumor suppressor; frequently lost in cancers PMID12651597; PMID17313992 LOX Lysyl oxidase tumor suppressor; reverts Ras transfoimation of NIH3T3 cells PMID12640111 LOXL1 Lysyl oxidase-like 1 candidate tumor suppressor PMID17456585 MXD4 Max dimerization protein 4 candidate tumor suppressor (can act as c-myc antagonists in transformation) PMID8521822 NOTCH 1 Notch gene homolog 1 (Drosophila) candidate tumor suppressor; intracellular Notch 1 suppresses v-src transformation; PMID17146440; PMID17325209 Notch signaling required for TGFb-mediated growth arrest NOV Nephroblastoma overexpressed amino-truncated isoforms induce transformation of fibroblasts; full-length secreted PMID15769600; PMID16598765 CCN3 inhibits cell growth PDGFRL Platelet-derived growth factor receptor-like candidate tumor suppressor gene PMID7898930 PERP PERP, TP53 apoptosis effector candidate tumor suppressor PMID11396142; PMID11062687 PKD1 Polycystic kidney disease 1 homolog slows the growth of MDCK cells PMID11106764 PLCD1 Phospholipase C, delta 1 expression is frequently decreased in colon carcinomas PMID7893368 PPARG Peroxisome proliferator-activated receptor gamma tumor suppressor (PPARG ligands inhibit the proliferation of various cancer cells in vitro) PMID17264754 PTGIS Prostaglandin 12 (prostacyclin) synthase frequently hypermethylated in human cancers; silencing of PTGIS associated with p53 mutations PMID16007128 RHOB Ras homolog gene family, member B positive and negative regulator of cell growth (context dependent) PMID11905808 SDC1 Syndecan 1 frequently downregulated in advanced tumors; important for maintenance of epithelial morphology PMID8932508; PMID7545031 SYK Spleen tyrosine kinase tumor-suppressing factor; expression frequently lost in human cancers PMID16442709 TACC2 Transforming, acidic coiled-coil containing protein 2 candidate tumor suppressor in breast cancer PMID12620397; PMID10749935 TGFB2 Transforming growth factor, beta 2 acts as tumor suppressor during early tumor formation; inhibits cell cycle PMID16885354; PMID2808542 progression and tumor growth TGFBR2 Transforming growth factor, beta receptor II putative tumor suppressor (controls cell growth and differentiation) PM1D15520171 TPM1 Tropomyosin 1 tumor suppressor (forced expression reverts Ras-mediated transformation of fibroblasts) PMID8346214 VCL Vinculin candidate tumor suppressor (overexpression can result in decreased tumorigenic PMID9819562 and metastatic potential) Limitless Replicative Potential Reference Gene Common Name Function (Pubmed Identification) FN1 Fibronectin 1 negative regulator of anoikis; FN peptides (degradation products) induce anoikis PMID15909113 GRB10 Growth factor receptor-bound protein 10 mediator of Bad-dependent cell survival; acts as an Akt coactivator PMID17535812; PMID11809791 HIP1 Huntington interacting protein 1 can be pro-apoptotic or anti-apopotic PMID11788820; PMID12163454 HSPA1B Heat shock protein 1B effective inhibitor of apoptosis PMID9799222 IGF1 Insulin-like growth factor 1 anti-apoptotic; activates Akt-mediated cell survival PMID14688466 KLF2 Kruppel-like factor 2 sensitizes cells to DNA-damage induced apoptosis through the inhibition of WEE1 transcription PM1D15735666 KLF6 Kruppel-like factor 6 pro-apoptotic factor in NSC lung cancer; anti-apoptotic factor in HCC PMID15172991; PMID17347668 PERP PERP, TP53 apoptosis effector TP53-mediated apoptosis effector PMID14726658 PKD1 Polycystic kidney disease 1 homolog protects MDCK cells from apoptosis PMID11106764 PTN Pleiotrophin anti-apoptotic through its receptor (Alk) PMID12107166 RAMP2 Receptor (calcitonin) activity modifying protein 2 anti-apoptotic through its ligand adrenomedullin PMID11420706 RHOB Ras homolog gene family, member B specialized activator of apoptosis in transformed cells PMID11905808 SDC1 Syndecan 1 inhibits anchorage-independent growth PMID8932508; PMID7545031 SNAI2 Snail homolog 2 anti-apoptotic factor mediating effects of oncogenic E2A-HLF fusion protein in leukemia PMID17550342 STAT3 Signal transducer and activator of transcription 3 required for the survival of tumors that developed in the presence of STAT3 PMID16082218 Gene Common Name Function Reference HSPA1B Heat shock protein 1B suppress p53-mediated cellular senescence PMID17555746 SIRT1 Sirtuin 1 (silent mating type information promotes repiicative senescence in response to chronic cellular stress (e.g. oncogenic stress) PMID16054100 regulation 2, homolog) 1 (S. oerevisiae) Sustained Angiogenesis Reference Gene Common Name Function (Pubmed Identification) FN1 Fibronectin 1 promotes VEGF expression, endothelial proliferation and tube formation PMID16308732 GRB10 Growth factor receptor-bound protein 10 positive regulator of VEGF signaling PMID11494124 ID2 Inhibitor of DNA binding 2 can regulate VEGF expression in myc transformed cells PMID15831462 IGF1 Insulin-like growth factor 1 induces VEGF expression PMID14688466 NOTCH1 Notch gene homolog 1 (Drosophila) required for estrogen-induced angiogenesis PMID15192074 NOV Nephroblastoma overexpressed induces neovascularization when implanted in rat cornea PMID12695522 NRP1 Neuropilin 1 binds two disparate ligands, class 3 semaphorins (anti-angiogenic) and VEGF (Pro-angiogenic) PMID17503412; PMID16445911 PTN Pleiotrophin induces formation of functional neovasculature in vivo PMID15949466 RAMP2 Receptor (calcitonin) activity modifying protein 2 proangiogenic through its ligand adrenomeduilin PMID14712479 SEMA3F Sema domain, immunoglobulin domain (Ig), inhibits tumor angiogenesis and metastasis through the NRP receptor family PMID16445911 short basic domain, secreted, (semaphorin) 3F Tissue Invasion and Metastasis Reference Gene Common Name Function (Pubmed Identification) AN PEP Alanyl (membrane) aminopeptidase increases migration (e.g.) through proteolytic processing of cell surface migration receptors PMID17363734 C50RF13 regulates migration and invasion PMID16229809; PMID11358844 CALCRL Calcitonin receptor-like an autocrine regulator of proliferation in endometrial endothelial cells during angiogenesis PMID11642745; PMID10956553 ETS2 E26 avian leukemia oncogene 2, 3' domain regulates expression of urokinase (promotes migration and invasion) PMID9431810 FN1 Fibronectin 1 produced by tumor stromal cells in response to VEGF stimulation; required for tumor cell adhesion PMID16730054 FSTL1 Follistatin-like 1 inhibits invasion when expressed in cell lines PMID11103936 IGF1 Insulin-like growth factor 1 stimulates EMT (through disassembly of adherens junctions), motility and invasion PMID14688466 ITGA5 Integrin alpha 5 required for metastasis of B16F10 melanoma cells PMID15979576 LAMA4 Laminin, alpha 4 promotes malignancy by inducing proteases production, tumour cell adhesion and migration PMID12845613 LOX Lysyl oxidase a metastasis promoting gene; hypoxia-induced metastases PMID17471532; PMID16969095 MMP2 Matrix metallopeptidase 2 promotes tumor cell invasion and migration PMID17717634 MMP14 Matrix metallopeptidase 14 promotes tumor cell invasion and migration PMID17050376 O MMP16 Matrix metallopeptidase 16 contributes to tumour cell migration PMID12904296 NOV Nephroblastoma overexpressed supports endothelial cell adhesion and induces chemotaxis PMID12695522 NRP1 Neuropilin 1 inhibits tumor cell growth and metastasis through SEMA ligands PMID16445911 PDGFD Platelet-derived growth factor, D polypeptide potent angiogenic GF PMID12629S13 PDGFRB Platelet derived growth factor receptor, beta polypeptide promotes cancer cell motility, invasion and metastasis PMID16741576 PERP PERP, TP53 apoptosis effector down-regulation is correlated with metastatic capacity of melanoma cell lines PMID11062687 PKD1 Polycystic kidney disease 1 homolog promotes cell-cell and cell-matrix interactions in cancer cells, inhibiting migration and invasion PMID17437318 PLCE1 Phospholipase C, epsilon 1 H-Ras effector that suppresses integrin affinity PMID16895916 PPARG Peroxisome proliferator-activated receptor gamma inhibits MMP-1 and FN expression PMID15090544; PMID14693716 PMID17264754 PTN Pleiotrophin can promote glioblastoma migration PMID15908427 RAMP2 Receptor (calcitonin) activity modifying protein 2 enhances tumor cell invasion through its ligand adrenomedullin PMID17290391 RHOB Ras homolog gene family, member B key regulator of actin reorganization, cell motility, cell-cell and cell-extracellular matrix adhesion PMID15501444 SDC1 Syndecan 1 plays an important role in inhibiting tumor cell invasion PMID15563454 SEMA3F Sema domain, immunoglobulin domain (Ig), chemorepulsant for endothelial cells PMID15520858 short basic domain, secreted, (semaphorin) 3F STAT3 Signal transducer and activator of transcription 3 affects expression and function of genes critical for invasion and angiogenesis of tumor cells PMID17332277 SYK Spleen tyrosine kinas reduced expression correlated with increased metastasis PMID16442709 TFPI Tissue factor pathway inhibitor required for metastasis of Tissue Factor (TF)-expressing melanoma cells PMID14500372 TGFB2 Transforming growth factor, beta 2 induces MMP-2 expression and suppresses TIMP-2 to promote invasion of glioma cell lines PMID11716069 TGFBR2 Transforming growth factor, beta receptor II loss promotes invasion of tumors initiated by Ape mutation PMID17047044 TPM1 Tropomyosin 1 functions in actin cable assembly and stabilization PMID2649250 VCL Vinculin overexpression results in larger focal adhesions but reduced cell motility PMID9819562 WISP1 WNT1 inducible signaling pathway protein 1 decreased motility and invasion of lung cancer cells and increased PMID12717393; PMID12529380 invasion of cholangiocarcinoma cells Genomic Instability Reference Gene Common Name Function (Pubtned Identification) CYP1B1 Cytochrome P450, family 1, subfamily b, polypeptide 1 can generate reactive oxygenated intermediates, which can lead to genomic instability PMID17128211 PTGIS Prostaglandin 12 (prostacyclin) synthase silencing of PTGIS associated with aneuploidy in colorectal cancer PMID16007128 SIRT1 Sirtuin 1 (silent mating type information can suppress genomic instability PMID1605410O regulation 2, homolog) 1 (S. cerevisiae) TGFBR2 Transforming growth factor, beta receptor II coding microsatellite repeats (contributes to MSI in colorectal cancers) PMID15735733 Other Reference Gene Common Name Function (Pubmed identification) CYP1B1 Cytochrome P450, family 1, subfamily b, polypeptide 1 can metabolize procarcinogens to protect cells from DNA damage PMID17128211 EPHX1 Epoxide hydrolase 1, microsomal epoxide detoxifying enzyme; can detoxify environmental carcinogens PMID12915882 IGF1 Insulin-like growth factor 1 IGF signaling associated with increased resistance to chemotherapeutics PMID12011069 o CO 309 Appendix E Microarray Data ERK1,2 Transcriptome vs Rhammonc transciptome (includes total overlapping genes, as well as overlapping cancer-associated genes) 310 Total Overlapping Genes Cancer Overlapping Genes MEK1 vs Rhamm MEK1 vs Rhamm Cancer (976 genes on Rhamm transcriptome: 14% overlap) (134 genes on Rhamm Cancer list) (1210 genes on MEK1 transcriptome : 11.4% overlap) 30% of Rhamm Cancer genes on MEK1 list ABCC5 AREG ADCY7 BLNK ADCY9 BRCA1 ADD3 CDC6 ADM CDH11 ANGPT1 CENPE AOX1 CLU AREG CYP1B1 ARL6IP DHFR ASAH1 DUSP4 BCL2L11 DUSP6 BLNK EPHX1 BNIP3L EPS8 BRAF ETS2 BRCA1 FOXM1 BRD4 GRB10 CASP8 HMGA2 CBR1 HSPA1B CBR3 ID2 CCNF INHBB CDC6 ITGA5 CDH11 KLF5 CEACAM1 KLF6 CENPE LM01 CFLAR LOX CKS1B LOXL1 CLCN2 MAF CLU MCM2 COL8A1 MCM7 CREB1 MITF CSF1R MXD4 CTSD NOTCH3 CYB5 PLK4 CYP1B1 RASA1 DHFR SMAD7 DUSP4 TGFB2 DUSP6 TFRC EFNB2 TLR2 ELAVL1 TPM1 EPHX1 VEGFC EPS8 ETS2 ETV1 EX01 F3 FEN1 FLNA F0XM1 GAS2L3 GLB1 GPNMB GRB10 GRCC10 GSTA4 HMGA2 HSD11B1 HSPA1B HSPA8 HUWE1 IFIT2 IFIT3 IL1RAP IL1RN INHBB INPP4B ITGA5 KCNN4 KLF5 KLF6 LAMB2 LM01 LOX LOXL1 LPL MAF MAN2A2 MAOA MCM2 MCM7 MFGE8 MGST3 MITF MMP12 MPP6 MTUS1 MTX1 MXD4 NEFL NOTCH3 NPTX1 NUP205 OGT PDE4B PER2 PINK1 PIR PLK4 PPAP2A PRNP RAB27B RAB40B RAD51AP1 RASA1 RBPSUH RFC3 RFC5 RRAGD SCHIP1 SEPP1 SERPINE2 SLC1A3 SLC6A15 SMAD7 SMTN SNAI2 SNTB2 SPAG9 SPRED2 SRGAP3 ST3GAL5 STAU2 SUZ12 TCEAL1 TENC1 TFRC TGFB2 TIPARP TLR2 TNP1 TPM1 TSC22D3 TSPYL4 UPP1 VEGFC VLDLR WNT10B VWVTR1 ZFHX1B 313 Curriculum Vitae SARA R. HAMILTON Cancer Research Laboratories London Regional Cancer Program A4-931, 790 Commissioners Rd E London, ON N6A 4L6 Canada POST-SECONDARY EDUCATION 2001 - 2007 University of Western Ontario, London, Ontario Doctor of Philosophy, Departments of Biochemistry and Experimental Oncology Estimated date of completion in December 2007. 1996 - 2000 University of Victoria, Victoria, British Columbia Bachelor of Science, Department of Biochemistry/Microbiology Completed Co-operative Education Program. Graduated with 1st Class Honours. 1995 - 1996 Okanagan University College, Salmon Arm, British Columbia First Year Sciences. 1994 - 1995 Kyoto Tachibana, Kyoto, Japan Japanese/General Studies. DISSERTATION Title: "Rhamm Promotes Neoplastic Conversion and Progression Through the Regulation of ERK1,2 Activity and AP-1 Mediated Transcription" Advisor: Dr. Eva A. Turley Professor / Senior Scientist Department of Biochemistry / Cancer Research Laboratories University of Western Ontario / London Regional Cancer Program London, Ontario This thesis assessed possible mechanisms by which cell surface and intracellular forms of the hyaluronan-binding protein, Rhamm, may promote and/or regulate wound repair, transformation of fibroblasts and aggressive behavior of breast cancer cells. Much of this work has been published or is in preparation for publication. OTHER RESEARCH AND TEACHING EXPERIENCE 1/05-4/05 Teaching Assistant. BIOC 380 (3rd year laboratory course). Department of Biochemistry, University of Western Ontario, London, Ontario. 314 1/04 - 4/04 Teaching Assistant. BIOC 3 80 (3rd year laboratory course). Department of Biochemistry, University of Western Ontario, London, Ontario. 1 /03 - 4/03 Teaching Assistant. BIOC 3 80 (3rd year laboratory course). Department of Biochemistry, University of Western Ontario, London, Ontario. 5/00 - 12/00 Summer Research Student / Technician. Supervisor : Dr. Eva A. Turley Division of Cardiovascular Research, Hospital for Sick Children, Toronto, Ontario. 9/99 - 4/00 Laboratory Assistant / Technician. Part time. Supervisor : Dr. Patrick von Aderkas Centre for Forest Biology, University of Victoria, Victoria, British Columbia. 9/98-8/99 Research Assistant. Co-op Position. Supervisors : Dr. Makoto Ohgaki and Dr. Makoto Seki Pharmaceutical Research Division, Mistubishi Chemical Corp., Yokohama Research Centre, Yokohama, Japan. 1/98 - 4/98 Research Assistant / Technician. Co-op Position. Supervisor : Dr. Mohammad Morshed Vector-Borne Diseases Laboratory, British Columbia Centre for Disease Control, Vancouver, British Columbia. 5/97 - 8/97 Research Assistant / Technician. Co-op Position. Supervisor: Leslie Walker Virology Laboratory, British Columbia Centre for Disease Control, Vancouver, British Columbia. AWARDS AND SCHOLARSHIPS 9/05 - 12/07 Breast Cancer Society of Canada Traineeship. Breast Cancer Society of Canada (Sarnia, Ontario). 1/04-12/05 Canadian Institutes of Health Research (CIHR) Doctoral Studentship. CIHR (Ottawa, Ontario). 1/04 - 12/05 Graduate Tuition Scholarship (GTS). University of Western Ontario (London, Ontario). 9/03 - 8/05 Breast Cancer Society of Canada Traineeship. Breast Cancer Society of Canada (Sarnia, Ontario). 5/03-12/03 Ontario Graduate Scholarship in Science and Technology (OGSST). University of Western Ontario (London, Ontario). 5/01 - 4/03 Special University Scholarship (SUS). University of Western Ontario (London, Ontario). 315 7/01 - 7/02 Lawson Health Research Institute Studentship. Lawson Health Research Institute (London, Ontario). 5/00 - 8/00 John D. Schultz Science Student Scholarship. Heart and Stroke Foundation of Ontario (Toronto, Ontario). 9/99 - 4/00 University of Victoria Student Bursary. University of Victoria (Victoria, British Columbia). 1/98 - 4/98 Lumby Lion's Club Academic Scholarship. Lumby Lion's Club (Lumby, British Columbia). 9/97 - 4/98 Edith Hembroff-Schleicher Scholarship for Women in Science. University of Victoria (Victoria, British Columbia). 9/96 - 4/97 Father Michael Byrne Memorial Scholarship. Okanagan University College (Salmon Arm, British Columbia). 9/95 - 4/96 Springbend Community Scholarship. A.L. Fortune High School (Enderby, British Columbia). 8/94 - 8/95 Kyoto Tachibana Entrance Scholarship. Kyoto Tachibana High School (Kyoto, Japan). PUBLICATIONS Peer-Refereed Manuscripts: 1. Hamilton SR, Fard S*, Paiwand FF\ Tolg C*, Wang C, McCarthy JB, Bissell MJ, Koropatnick J and Turley EA (2007) The hyaluronan receptors Rhamm and CD44 form complexes with ERK1,2 that sustain high basal motility in breast cancer cells. J Biol Chem, 282(22): 16667-80. ('authors contributed equally). 2. Tolg C, Hamilton SR, Nakrieko KA, Kooshesh F, Walton P, McCarthy JB, Bissell MJ, and Turley EA (2006) Rhamm-/- fibroblasts are defective in CD44-mediated ERK1,2 motogenic signaling, leading to defective skin wound repair. J Cell Biol, 175(6): 1017-28. 3. Hamilton SR, Tolg C, Richardson J, Brown R, Gonzalez M, Vanzieleghem M, Anderson P, Asculai SS, Winnik F, Savani RC, Koropatnick J, Freeman D, and Turley EA 2006 Pharmacokinetics and pharmacodynamics of hyaluronan infused into human volunteers. (Submitted to Curr Drug Metab. In Revision). Manuscripts in Preparation: 4. Hamilton SR, Tolg C, Zhang S, McCarthy JB, and Turley EA (2007) Intracellular Rhamm is an Erkl binding protein that regulates fibroblast transformation through modulation of AP- 1 mediated transcription. (In preparation). 316 5. Tolg C, Hamilton SR, Paraskevis P, McCarthy JB, Savani RC, Winnik F, Turley EA (2007) Hyaluronan binding peptides isolated from random phage libraries modify fibrogenic repair of excisional skin wounds. (In preparation). Published Contributions to Conference Proceedings / Book Chapters: 6. Tolg C, Hamilton SR, Naor D, McCarthy JB, Turley EA (2004) Analysis of convergent and divergent signaling pathways regulated by Rhamm and CD44: Identification of actin cytoskeleton proteins as Rhamm binding partners. Biochem Soc Trans. (In press). 7. Tolg C, Hamilton SR, and Turley EA (2003) RHAMM is a key hyaluronan receptor involved in response-to-injury and neoplastic processes. In: Chemistry and Biology of Hyaluronan. (Eds Garg HG and Hales CA) Elsevier Ltd., New York, NY, pp 125-151. 8. Hamilton SR, Wang F-S, Turley EA (2002) Hyaluronan and hyaladherins in lung repair. In: Proteoglycans and Lung Disease. (Eds Garg HG, Roughly PJ, Hales CA) Marcel Dekker, Inc. NY. Vol. 168: ppl07-134. Abstracts, Poster Presentations and Public Lectures: 9. Hamilton SR and Turley EA (2007) Rhamm promotes fibroblast transformation through modulation of Erkl activity and AP-1 activation. Invited Speaker for the 4th Annual Department of Oncology Research and Education Day (University of Western Ontario, London, ON Canada). 10. Hamilton SR, Zhang S and Turley EA (2006) Rhamm promotes mesenchymal cellular transformation through the regulation of Erkl activity and AP-1 activation. Poster presented at the 3rd Annual Department of Oncology Research and Education Day (University of Western Ontario, London, ON Canada). 11. Hamilton SR (2006) Rhamm promotes mesenchymal cellular transformation through the activation of Erkl and AP-1 mediated transcription. Department of Experimental Oncology Ivy Lecture (London Regional Cancer Program, London, ON Canada). 12. Hamilton SR, Tolg C, Crump S, Zhang S and Turley EA (2005) Regulation of the extracellular regulated kinase 1, Erkl, by Rhamm in fibroblast transformation. Poster Presented at the Epithelial to Mesenchymal Transition Conference (Vancouver, BC Canada). 13. Hamilton SR, Tolg C, Crump S, Zhang S and Turley EA (2005) Regulation of the extracellular regulated kinase 1, Erkl, by Rhamm in fibroblast transformation. Invited Speaker for the 2nd Annual Department of Oncology Research and Education Day (University of Western Ontario, London, ON Canada). 14. Hamilton SR (2005) Overexpression of trRhamm increases levels of active Erkl and AP-1 subunits. Department of Experimental Oncology Ivy Lecture (London Regional Cancer Program, London, ON Canada). 317 15. Hamilton SR, Zhang S, and Turley EA (2004) Regulation of Fibroblast Transformation by Rhamm. Invited Speaker for the 1st Annual Department of Oncology Research and Education Day (University of Western Ontario, London, ON Canada). 16. Hamilton SR (2004) TrRhamm regulates fibroblast transformation through a direct association with Erkl. Department of Experimental Oncology Ivy Lecture (London Regional Cancer Program, London, ON Canada). 17. Hamilton SR, Zhang S, and Turley EA (2003) Regulation of Cellular-Transformation by the Hyaluronan-Binding Protein, Rhamm. Mol. Biol. Cell, 14 (supplement). Presented at the 43rd Annual American Society for Cell Biology Meeting (San Francisco, CA USA). 18. Ruggi A, Wang F-S, Hamilton SR, Khandani A, Tolg C, and Turley EA (2003) The role of cortactin/Rhamm/Erkl,2 complexes in cell motility. Mol. Biol. Cell, 14 (supplement), 43rd Annual American Society for Cell Biology Meeting (San Francisco, CA USA). 19. Hamilton SR, Zhang S, and Turley EA (2003) Regulation of Cellular-Transformation by the Hyaluronan-Binding Protein, Rhamm. Poster Presentation at the Hyaluronan 2003 Meeting (Cleveland, OH USA). 20. Hamilton SR (2003) Intracellular trRhamm acts at the level MEK1/Erkl,2 to promote fibroblast transformation. Department of Experimental Oncology Ivy Lecture (London Regional Cancer Program, London, ON Canada). 21. Hamilton SR, Zhang S, and Turley EA (2002) Regulation of Cellular Transformation by the Hyaluronan-binding Protein, Rhamm. Poster Presentation at the Gordon Conference for Signal Transduction by Engineered Extracellular Matrices (New London, CT USA). 22. Hamilton SR (2002) Overexpression of an N-terminal truncated Rhamm isoform is transforming in 10T1/2 fibroblasts. Department of Experimental Oncology Ivy Lecture (London Regional Cancer Program, London, ON Canada). 23. Tolg C, Hamilton SR, Turley EA (2000) Fibroblasts from Rhamm Knockout Mice Have Locomotory Defects. Mol. Biol. Cell, 11 (supplement). Presented at the 40th Annual American Society for Cell Biology Meeting (San Francisco, CA).