DOCSLIB.ORG

Streptomyces Coelicolor A3(2)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Streptomyces Coelicolor A3(2) Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Pleiotropic morphological and antibiotic deficiencies result from mutations in a gene encoding a tRNA-like product in Streptomyces coelicolor A3(2) Elizabeth J. Lawlor, Howard A. Baylis, and Keith F. Chater Agricultural and Food Research Council Institute of Plant Science Research, John Innes Institute, Norwich, NR4 7UH, UK In Streptomyces coelicolor, bldA mutants are defective in antibiotic production and the development of aerial hyphae and spores. Subcloning analysis showed that sequences spanning an NcoI site in cloned bldA ÷ DNA were needed to allow complementation of a bldA mutant. Nucleotide sequencing revealed a tRNA-like sequence 9 bp downstream from the NcoI site. Five independent bldA mutations all fell in a 16-bp region in the tRNA-like sequence, one of them changing the putative anticodon. In RNA dot-blot analysis, hybridization was detected with a probe specific for the tRNA-like transcript but not with a probe for "anti-tRNA-like" transcripts. The transcripts detected were all in the sah-soluble RNA fraction and accumulated relatively late in growth. It is postulated that bldA specifies a tRNA that would recognize the codon UUA (for leucine). This codon is very rare in Streptomyces genes [which generally contain >70 mole% (G + C)], suggesting a possible role for bldA in translational control of development. [Key Words: Differentiation; translational regulation; secondary metabolism; sporulation] Received September 3, 1987; revised version accepted September 17, 1987. The genus Streptomyces comprises Gram-positive soil was recently cloned on a Streptomyces temperate phage bacteria that grow as a branching vegetative mycelium, vector as a 5.6-kb PstI fragment (Piret and Chater 1985). on which aerial, sporogenous hyphae develop, presump- Here, we present the nucleotide sequence of a part of tively in response to nutritional limitation. Numerous this fragment containing the bldA gene. The location of antibiotics, including many that are valuable to man, are five bldA mutations in this sequence, coupled with produced by this group of bacteria, often at a time coin- analysis of bldA RNA, leads us to suggest that bldA ciding with the formation of aerial hyphae. specifies a tRNA for the rare leucine codon UUA and In different Streptomyces species, studies of morpho- that use of this codon may allow translational control of logical mutants have variously implicated arginine me- development. tabolism (Meade 1985), guanosine nucleotides (Ochi 1986), and extracellular diffusible factors (Khokhlov Results and discussion 1986) in both sporulation and antibiotic production (re- bldA mutations lie in a potential tRNA gene viewed by Chater 1984). In the genetically well-charac- terized S. coelicolor, bldA mutants are one of several Subcloning analysis showed that a BglII-PstI fragment classes of mutants defective in different stages of devel- of approximately 870 bp (fragment A, Fig. 1), derived opment while being apparently unimpaired in vegetative from the 5.6-kb PstI fragment originally cloned by Piret growth (Merrick 1976). On minimal agar medium con- and Chater (1985), gave bldA complementation results taining glucose or cellobiose as a carbon source, bldA identical to those obtained with the larger fragment mutant colonies produce no recognizable aerial hyphae (J.M. Piret and E.J. Lawlor, unpubl.). Following the ob- or spores; instead, the surface hyphae undergo frequent servation that cloning the 5.6-kb PstI fragment at high septation and fragmentation, which may be an aberrant copy number did not disrupt differentiation (J.M. Piret, form of the sporulation process (Chater and Merrick pets. comm.), further subcloning and complementation 1979). In addition, production of four quite different an- tests were carried out using a multicopy plasmid vector. tibiotics (two of them pigmented) made by the wild-type The results suggested that sequences spanning an NcoI strain is abolished. On other carbon sources, such as site (Fig. 1) were required for bldA expression because mannitol or maltose, aerial mycelium development and fragments B and C failed to complement a bldA muta- sporulation appear to occur normally, but antibiotic pro- tion (bldA62). Occasional wild-type recombinant colo- duction is not restored (Merrick 1976). The bldA gene nies were obtained with fragment C, indicating that the GENES & DEVELOPMENT1:1305-1310 © 1987 by Cold Spring Harbor Laboratory ISSN 0890-9369/87 $1.00 1305 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Lawlor et al. PstI /~jcE Pstl 5.6kb I "V ORF tRNAI I I I I I i I I I B~E I Nrol PstI Fragment A I" " I 8?Obp "- tRNA ORF (complements bldA ) B~'E F-rogment B l- 4 %Obp ORF (foiled fo complemenf bldA62} Bgfll Fragment C {failed to comptemenf b~A62, but generoted Bid*recurbr~nts) | 330bp tRNA NcoI :ace Fragment O (used in ,ronscription onotysis) ~, ---------~"----'--'V | 160 bp tRNA .., ss probe I .. ss probe2 Figure 1. Fragments used for the localization, sequencing, and transcription analysis of bldA. Colonies obtained by transformation of S. coelicolor J395 and S. coelicolor J668 with a plasmid carrying fragment A all showed the Bld + phenotype; those obtained with plasmids carrying either fragment B or C generally retained the bldA mutant phenotype. Fragment D, inserted in M13mpl9, was used to generate two radioactively labeled single-stranded probes (ss probes 1 and 2; see Materials and methods) for transcription analysis (Fig. 4). bldA62 mutation lay to the right of the NcoI site. Frag- quence. Each mutation was in the potential tRNA gene ments B and C also failed to complement a second bldA (Fig. 3). mutation (bldA39); no wild-type recombinant colonies were seen among the few transformants obtained with The bldA gene specifies a small RNA that accumulates this particularly poorly transformable strain. late in growth The nucleotide sequence of fragment A was deter- mined (Fig. 2). Using the computer program "Frame" Although the double-stranded sequence potentially en- (Bibb et al. 1984), only one (truncated)potential open coding a tRNA was indeed bldA (or a part of it), it re- reading frame (ORF)was identified, beginning at a GTG mained possible that bldA was transcribed from right to triplet 69 bp from the left-hand end of fragment A, and left through this sequence. Using primed synthesis on reading leftward through the BglII site. The finding that single-stranded templates containing each orientation of bldA62 lay to the right of the NcoI site (see above) made the 160-base fragment D (Fig. 1), probe 1, specific for a it unlikely that this ORF was bldA. However, further tRNA-like transcript, and probe 2, specific for an anti- computer analysis of the nucleotide sequence using the tRNA-like transcript, were obtained. In Southern blot program of Staden (1980)revealed a potential tRNA gene analysis of total S. coelicolor DNA, using probe 1, only reading rightward from a position 9 bp to the right of the fragments of the sizes predicted from the restriction map NcoI site (Fig. 3). If this tRNA were the bldA gene of the bldA region were detected (results not shown). product, cleavage at the NcoI site would prevent com- The probes were therefore specific for bldA transcripts plementation of bldA mutants, because it would pre- and were used to analyze RNA that had been isolated at sumably separate the tRNA gene (and any genes down- different growth stages from a bldA + strain and frac- stream of it) from its promoter and from any transcribed tionated by precipitation in 3 M sodium acetate (in leader sequences that might be important for correct which RNA larger than about 6S is preferentially precip- processing of the transcript to give a mature tRNA. This, itated). Hybridization was detected only with probe 1 combined with the apparent absence of other potential and only with the soluble (sRNA)fraction that contains genes from the sequenced DNA, suggested that the po- smaller RNA species such as 5S RNA and tRNA (Fig. 4). tential tRNA gene was indeed bldA. It was strongest in RNA isolated from 36-hr cultures The nucleotide sequences of DNA fragments carrying (just before aerial hyphae appeared). Thus, only the po- five independent bldA mutations [including four pre- tential tRNA gene (and not its complementary strand) is viously shown to be alleles (Piret and Chater 1985)] were detectably transcribed, and its product accumulates as a determined. The 870-bp fragment A (Fig. 1)from each small RNA at a time compatible with its role in differ- mutant differed by only 1 bp from the wild-type se- entiation and antibiotic production. 1306 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Putative tRNA needed for development i ~;< GA T C T'T G GA_a_AG C T C CGTGGCGCGCGCGGC CACGAGGGTGGAC CGGTCGGCGATGGGTG ~ ~ AGAACCTTTCGAGGCACCGCGCGCGCCGGmC-CTCCCAC CTGGCCAGCCGCTACC~AC I 60 CGGTGGTCACGGG.a.AGGGCGICTCCTGTCGGTACGGCGTGTGCGGTCGGCACGGTGCGTGC [QCCACC%GTCqCCCTTCCCGCGAGGACAGCCATGCCGCACACGCCAGCCGTGCCACGCACG ",'20 GG~GGCAuGGTG~GTG,~. GGGCACGGTGCGTGCTGGGCACGGTGCGTGCGGTCGGCACGG CCACCGTGCCACACACGACCCGTGCCACGCACGACCCGTGCCACGCACGCCAGCCGTGCC 180 ~GCG~GCTCGGGGACGTTGTC:~.TCGmCCCGGTCGf~CGGCGCCCTGTAGTCAGCCGC ~ ACGCACGAGCCCCTGC.<ACAGTTAGCAGGGCCAGCTTGCCGC'GGACATCAGTCGGCGAC 240 ] bTCCGGTTCAGGG~GGCGAC'TTCGGTCGGACGGGCCGGGCCGGTGTCATACCTGCnGa<~ L~%GGCCAAGTCCCCCCGCTG-a-AGCCAOCCTGCCCGGCCCGG-CACAGTATGGACGCCTAC
Load more

Recommended publications
  • Annual Conference Abstracts
    ANNUAL CONFERENCE 14-17 April 2014 Arena and Convention Centre, Liverpool ABSTRACTS SGM ANNUAL CONFERENCE APRIL 2014 ABSTRACTS (LI00Mo1210) – SGM Prize Medal Lecture (LI00Tu1210) – Marjory Stephenson Climate Change, Oceans, and Infectious Disease Prize Lecture Dr. Rita R. Colwell Understanding the basis of antibiotic resistance University of Maryland, College Park, MD, USA as a platform for early drug discovery During the mid-1980s, satellite sensors were developed to monitor Laura JV Piddock land and oceans for purposes of understanding climate, weather, School of Immunity & Infection and Institute of Microbiology and and vegetation distribution and seasonal variations. Subsequently Infection, University of Birmingham, UK inter-relationships of the environment and infectious diseases Antibiotic resistant bacteria are one of the greatest threats to human were investigated, both qualitatively and quantitatively, with health. Resistance can be mediated by numerous mechanisms documentation of the seasonality of diseases, notably malaria including mutations conferring changes to the genes encoding the and cholera by epidemiologists. The new research revealed a very target proteins as well as RND efflux pumps, which confer innate close interaction of the environment and many other infectious multi-drug resistance (MDR) to bacteria. The production of efflux diseases. With satellite sensors, these relationships were pumps can be increased, usually due to mutations in regulatory quantified and comparatively analyzed. More recent studies of genes, and this confers resistance to antibiotics that are often used epidemic diseases have provided models, both retrospective and to treat infections by Gram negative bacteria. RND MDR efflux prospective, for understanding and predicting disease epidemics, systems not only confer antibiotic resistance, but altered expression notably vector borne diseases.
    [Show full text]
  • Industrial Biotechnology: Sustainable Growth and Economic Success
    Edited by Wim Soetaert and Erick J. Vandamme Industrial Biotechnology Related Titles Buchholz, Klaus / Collins, John Hou, C. T., Shaw, J.-F. Concepts in Biotechnology Biocatalysis and Bioenergy History, Science and Business 2008 2010 ISBN: 978-0-470-13404-7 ISBN: 978-3-527-31766-0 Aehle, W. (ed.) Katoh, Shigeo / Yoshida, Fumitake Enzymes in Industry Biochemical Engineering Production and Applications A Textbook for Engineers, Chemists and 2007 Biologists ISBN: 978-3-527-31689-2 2009 ISBN: 978-3-527-32536-8 Sheldon, R. A., Arends, I., Hanefeld, U. Green Chemistry and Catalysis Soetaert, W., Vandamme, E. (eds.) 2007 Biofuels ISBN: 978-3-527-30715-9 2009 ISBN: 978-0-470-02674-8 Fessner, W.-D., Anthonsen, T. (eds.) Modern Biocatalysis Stereoselective and Environmentally Friendly Reactions 2009 ISBN: 978-3-527-32071-4 Edited by Wim Soetaert and Erick J. Vandamme Industrial Biotechnology Sustainable Growth and Economic Success The Editors All books published by Wiley-VCH are carefully produced. Nevertheless, authors, editors, and Prof. Wim Soetaert publisher do not warrant the information contained Ghent University in these books, including this book, to be free of Department of Biochemical and errors. Readers are advised to keep in mind that Microbial Technology statements, data, illustrations, procedural details or Centre of Expertise – Industrial other items may inadvertently be inaccurate. Biotechnology and Biocatalysis Faculty of Bioscience Engineering Library of Congress Card No.: applied for Coupure links 653 9000 Gent British Library
    [Show full text]
  • Supporting Information Copyright Wiley-VCH Verlag Gmbh & Co
    Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2011 Abyssomicin Biosynthesis: Formation of an Unusual Polyketide, Antibiotic- Feeding Studies and Genetic Analysis Elvira M. Gottardi,[a] Joanna M. Krawczyk,[a] Hanna von Suchodoletz,[a] Simone Schadt,[a] Agnes Mhlenweg,[a] Gabriel C. Uguru,[b] Stefan Pelzer,[c] Hans-Peter Fiedler,[d] Mervyn J. Bibb,[e] James E. M. Stach,[b] and Roderich D. Sssmuth*[a] cbic_201100172_sm_miscellaneous_information.pdf Supplementary Information Abyssomicin Biosynthesis: Formation of an Unusual Polyketide Antibiotic - Feeding Studies and Genetic Analysis Elvira M. Gottardi, a Joanna M. Krawczyk a, Hanna von Suchodoletz a, Simone Schadt a, Agnes Mühlenweg a, Gabriel C. Uguru b, Stefan Pelzer c, Hans-Peter Fiedler d, Mervyn J. Bibb e, James E. M. Stach b, Roderich D. Süssmuth a Content: Content: 1 1 Analytical Data from 13 C-labeled substrate feeding experiments 2 1.1 13 C-NMR spectra after feeding acetate 2 1.2 13 C-NMR spectra after feeding propionate 3 1.3 13 C-NMR spectra after feeding glucose 3 2 The abyssomicin biosynthetic gene cluster - Function assignment 5 3 Inactivation studies: Primers and constructs used 7 3.1 Single Crossover Homologous Recombination 7 3.1.1 Primers used for Single Crossover Inactivation 9 3.2 Double Crossover Homologous Recombination by PCR Targeting 3 9 3.2.1 Procedure 10 3.2.2 Primers used for double crossover inactivation 11 3.3 Double Crossover Homologous Recombination using pK18mob2 12 3.3.1 Procedure 12 3.3.2 Primers 13 3.4 Complementation Experiments 13 3.4.1 Procedure 13 3.4.2 Primers 14 4 Phylogenetic analysis of Aby, Chl, Kij, Tca and Tmn 14 5 References 14 a Prof.
    [Show full text]
  • The Antibiotic Planosporicin Coordinates Its Own Production in the Actinomycete Planomonospora Alba
    The antibiotic planosporicin coordinates its own production in the actinomycete Planomonospora alba Emma J. Sherwood1 and Mervyn J. Bibb2 Department of Molecular Microbiology, John Innes Centre, Norwich, Norfolk NR4 7UH, United Kingdom Edited by E. Peter Greenberg, University of Washington, Seattle, WA, and approved May 16, 2013 (received for review March 21, 2013) Planosporicin is a ribosomally synthesized, posttranslationally mod- lantibiotics, two actinomycete compounds, NVB302 [an actagardine ified peptide lantibiotic produced by the actinomycete Planomono- derivative (9)] and NAI-107 [also known as microbisporicin (10)] spora alba. It contains one methyl-lanthionine and four lanthionine are currently in clinical development as anti-infectives, whereas bridges and inhibits cell wall biosynthesis in other Gram-positive a third, Moli1901 (also known as lancovutide or duramycin, a bacteria probably by binding to lipid II, the immediate precursor for structural analog of cinnamycin), promises to be a useful adjunct cell wall biosynthesis. Planosporicin production, which is encoded by for the treatment of cystic fibrosis (11, 12). Actinomycete RiPPs a cluster of 15 genes, is confined to stationary phase in liquid culture that have been analyzed genetically include cinnamycin (13), the and to the onset of morphological differentiation when P. alba is spore-associated proteins SapB (14) and SapT (15), michiganin grown on agar. This growth phase-dependent gene expression is (16), actagardine (17), deoxyactagardine (18), microbisporicin controlled transcriptionally by three pathway-specific regulatory pro- (19, 20), cypemycin (21), venezuelin (22), and grisemycin (23). teins: an extracytoplasmic function σ factor (PspX), its cognate anti-σ Planosporicin is another actinomycete-derived lantibiotic pro- factor (PspW), and a transcriptional activator (PspR) with a C-terminal duced by Planomonospora sp.
    [Show full text]
  • Individual Signatures · Sense About Science Individual Signatures the Following People Have Signed the Letter to President-Designate Jean-Claude Juncker
    8/30/2014 Individual signatures · Sense about Science Individual signatures The following people have signed the letter to President-designate Jean-Claude Juncker. Dear Mr Juncker We write to you with some urgency in response to a letter you will have just received from nine NGOs urging you to abolish the position of Chief Scientific Advisor to the President of the European Commission. The letter, which includes Greenpeace as a signatory as well as other prominent NGO voices, alleges that the "post of Chief Scientific Adviser is fundamentally problematic" and asks you to "scrap this position"1. As organisations and individuals who share a commitment to improving the evidence available to policy makers, we cannot stress strongly enough our objection to any attempt to undermine the integrity and independence of scientific advice received at the highest level of the European Commission. The mandate of the Chief Scientific Advisor is to "provide independent expert advice on any aspect of science, technology and innovation as requested by the President"2. We would reassert the fundamental value of this role, which is already minimally resourced for the task of improving the use of evidence in policymaking - a goal that attracts strong support across Europe. We would further defend the record of Professor Anne Glover in having delivered impartial and rigorous advice as she is mandated to do in this role. Some of us will be writing to you individually in more detail on these points and on the background to the recognised need for that role and others have written to you previously.
    [Show full text]
  • Discovery of Novel Antibiotics Via Streptomyces Sporulation by Scott
    Discovery of novel antibiotics via Streptomyces sporulation by Scott McAuley A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Biochemistry University of Toronto c Copyright 2019 by Scott McAuley Abstract Discovery of novel antibiotics via Streptomyces sporulation Scott McAuley Doctor of Philosophy Graduate Department of Biochemistry University of Toronto 2019 Streptomyces are filamentous bacteria known for producing a wide range of bioactive molecules. In addition to being nature's chemists they have a unique multicellular life- cycle that ends with the sporulation of aerial hyphae. I used this unique Streptomyces development cycle, specifically sporulation, as a screening platform to discover novel bi- ologically active molecules and characterized their mechanisms of action. Min-1 inhibits the growth of a range of Gram-positive bacteria, is active against the cell envelope, and induces a short cell phenotype in B. subtilis. Another molecule, EN-7, inhibits bacterial gyrase and is active against extensively resistant Staphylococcus aureus in addition to other Gram-positive pathogens. In addition to investigating these specific molecules, I developed a high-throughput screen to identify molecules that disrupt the Gram-positive bacterial membrane and found that Streptomyces venezuelae sporulation is highly sensi- tive to multiple forms of DNA damage. ii Contents 1 Introduction 1 1.1 The challenges of antibiotic discovery and development . 1 1.2 Identifying novel antimicrobials and their mechanism of action . 3 1.2.1 Identifying bioactive molecules through growth inhibition . 4 1.2.2 Identifying mechanism of action through reporter screens and assays 7 1.2.3 Target-based screening .
    [Show full text]
  • Bo Li CV Website
    Bo Li, Ph.D. PERSONAL Genome Sciences Building 3256 Department of Chemistry The University of North Carolina, Chapel Hill, NC 27599-3290 Phone: 919-843-4436 Email: [email protected] Website: http://www.chem.unc.edu/people/faculty/li/group/index.html EDUCATION Ph.D. Biochemistry, University of Illinois at Urbana-Champaign 2004 – 2009 Advisor: Wilfred A. van der Donk Urbana, IL Thesis title: Mechanistic studies of lantibiotic biosynthetic enzymes and discovery of novel lanthionine-containing peptides B.S. Biological Sciences, Beijing University 2000 – 2004 Advisors: Yuxian Zhu and Hong Cai Beijing, China Thesis title: Novel DNA vaccines against Mycobacterium tuberculosis PROFESSIONAL EXPERIENCE Assistant Professor, The University of North Carolina at Chapel Hill 2013 – present Department of Chemistry, Carolina Center for Genome Sciences Chapel Hill, NC Postdoctoral Fellow, Harvard Medical School 2009 – 2013 Department of Biological Chemistry and Molecular Pharmacology Boston, MA Advisor: Christopher T. Walsh Visiting Scholar, University of California, San Francisco Oct, 2012 Department of Microbiology and Immunology San Francisco, CA Collaborator: Carol A. Gross Visiting Scholar, John Innes Centre, UK Summer, 2011 Department of Molecular Microbiology Norwich, UK Collaborator: Mervyn Bibb HONORS National Institutes of Health Director’s New Innovator Award 2017 National Science Foundation CAREER Award 2017 Packard Fellowship for Science and Engineering 2016 Rita Allen Foundation Scholars 2016 NIH Pathway to Independence Award (K99/R00) 2012 Postdoctoral Travel Award (Harvard Medical School) 2012 David Philips Fellowship 2012 (Biotechnology and Biological Sciences Research Council, UK, declined) Bo Li August 18, 2018 Page 1 of 8 Jane Coffin Childs Postdoctoral Fellowship (Howard Hughes Medical Institute) 2011 Biochemistry Trust of Urbana Ph.D.
    [Show full text]
  • SGM Meeting Abstracts: Edinburgh International Conference Centre, 31
    :WYPUN 4LL[PUN 4HYJO¶ (WYPS ,KPUI\YNO 0U[LYUH[PVUHS *VUMLYLUJL *LU[YL (IZ[YHJ[Z Bacterial secretion systems: commonality and diversity 3 Plenary Session Influence of climate change on disease and microbial environmental processes: microbes and climate change 6 Hot Topic Symposium Type V secretion 8 Contents Cells & Cell Surfaces Group Biological basis of infection control 11 Clinical Microbiology Group How to pass the MRCPath Part 2: tips for the exam 14 Clinical Microbiology / Clinical Virology Groups Joint Session Workshop: Rapid diagnostics – ‘lab on a chip’ 15 Vaccines against viral infections from concept to practice 17 Clinical Virology Group Microbial metabolism of nitrogen-, phosphorus- and sulfur-containing compounds: environmental challenges, possible solutions and future perspectives 20 Environmental Microbiology Group Commercial industrial bioprocess development 24 Fermentation & Bioprocessing Group / IChemE BESG Transmission of viruses through the food chain 26 Food & Beverages Group The horizontal gene pool: the mobilome and virulence 28 Microbial Infection / Physiology, Biochemistry & Molecular Genetics Groups Joint Session Prokaryotic cell biology 31 Physiology, Biochemistry & Molecular Genetics Group Cyanobacteria, architects of our environment: who are they and what do they do? 34 Systematics & Evolution Group supported by the Environmental Microbiology Group Virus modulation of host defences 38 Control of virus gene expression 43 Virus Group Marjory Stephenson Prize Lecture 46 Fleming Prize Lecture 46 Posters 47 Authors 97 Late Abstracts 102 e Abstracts 76 Please note: Abstracts are printed as received from the authors and are not subjected to editing. Plenary Session Bacterial secretion systems: commonality and diversity Mechanism of ATP-driven translocation by the bacterial preprotein The YidC/Oxa1p/Alb3 family of proteins is a new class of proteins Plenary that play a role in the membrane assembly of proteins in bacteria, translocase mitochondria, and chloroplasts.
    [Show full text]
  • Protein Kinases in Streptomyces: Involvement In
    PROTEIN KINASES IN STREPTOMYCES: INVOLVEMENT IN GROWTH, GLYCOPEPTIDE PRODUCTION AND RESISTANCE. By: JOHN M. NEU A Thesis Submitted to the School of Graduate Studies In Partial Fulfilment of the Requirements for the Degree Doctor of Philosophy McMaster University PROTEIN KINASES IN STREPTOMYCES DOCTOR OF PHILOSOPHY (2002) McMaster University (Biochemistry) Hamilton, Ontario TITLE: Protein Kinases in Streptomyces: Involvement in Growth, Glycopeptide Production and Resistance. AUTHOR: John Morley Neu, B.Sc., M.Sc. (McMaster University) SUPERVISOR: Professor G.D. Wright NUMBER OF PAGES: 229; i-xvi. 11 The History of Medicine • 2000 B. C. - Here, eat this root a 1000 A.D. - That root is heathen. Here, scry this prcryer. • 1850 A.D. - That prcryer is superstition. Here, drink this potion. • 1920 A.D. - That potion is snake oil. Here, swallow this pill. a 1945 A.D. - That pill is ineffective. Here, take this penicillin. • 1955 A.D. - Oops .... bugs mutated. Here, take this tetracycline. • 1960-1999- 39 more "oops"... Here, take this more powerfol antibiotic. • 2000 A.D. - The bugs have won! Here, eat this root. -Anonymous 111 Abstract With the recent crisis in hospital-acquired infections, a renewed sense of urgency for studying bacterial species carrying antibiotic resistance determinants has developed. Much of the focus has been centered on the glycopeptide antibiotics including vancomycin, which represent the last main line of defense against many hospital-acquired infections. These clinically pivotal antibiotics are produced by filamentous bacteria in the order Actinomycetes including the genus Streptomyces. The investigations presented in this thesis were undertaken to address fundamental questions of glycopeptide production and resistance in the glycopeptide-producing Streptomyces toyocaensis NRRL 15009 and non-producing Streptomyces coeficolor A3(2).
    [Show full text]
  • Bbsrc Meeting on the History of Streptomyces Science and the Sequencing of the S
    BBSRC MEETING ON THE HISTORY OF STREPTOMYCES SCIENCE AND THE SEQUENCING OF THE S. COELICOLOR GENOME1 EXECUTIVE SUMMARY The Biological and Biotechnological Sciences Research Council (BBSRC) held a one day meeting in London, on 21 January 2010, to review the key historical events that had led to the decision to sequence the Streptomyces coelicolor genome, to examine the impact of the sequence so far, and to invite expert commentary on potential future impacts. This report is organised into four sections, mirroring the four discussion sessions at the meeting: Research and Technology, Networks and training, Funding, and Impacts. S. coelicolor began as an obscure organism, perhaps because it did not seem to possess any industrial promise. In this connection most of Hopwood‟s early competitors had been interested in antibiotic production and the more important industrial models were S. rimosus and S. aureofaciens. From the mid-1970s S. coelicolor began to enjoy a sudden prestige and was transformed into a highly successful model system with researchers distributed across more than 20 countries. When the decision to sequence S. coelicolor was taken in 1997, it took with it the entire budget that the BBSRC Microbial Genomics Working Group had for genome sequencing (£1.5M). This event was a measure of the remarkable transformation of Streptomyces and the four discussions that follow provide valuable insights into how Streptomyces science has progressed and what has been achieved. Research and Technology- Important Outcomes A timeline of milestones in Streptomyces genetics leading up to genome sequencing and genetic manipulation of antibiotic biosynthesis was presented at the meeting.
    [Show full text]
  • Pnas11052ackreviewers 5098..5136
    Acknowledgment of Reviewers, 2013 The PNAS editors would like to thank all the individuals who dedicated their considerable time and expertise to the journal by serving as reviewers in 2013. Their generous contribution is deeply appreciated. A Harald Ade Takaaki Akaike Heather Allen Ariel Amir Scott Aaronson Karen Adelman Katerina Akassoglou Icarus Allen Ido Amit Stuart Aaronson Zach Adelman Arne Akbar John Allen Angelika Amon Adam Abate Pia Adelroth Erol Akcay Karen Allen Hubert Amrein Abul Abbas David Adelson Mark Akeson Lisa Allen Serge Amselem Tarek Abbas Alan Aderem Anna Akhmanova Nicola Allen Derk Amsen Jonathan Abbatt Neil Adger Shizuo Akira Paul Allen Esther Amstad Shahal Abbo Noam Adir Ramesh Akkina Philip Allen I. Jonathan Amster Patrick Abbot Jess Adkins Klaus Aktories Toby Allen Ronald Amundson Albert Abbott Elizabeth Adkins-Regan Muhammad Alam James Allison Katrin Amunts Geoff Abbott Roee Admon Eric Alani Mead Allison Myron Amusia Larry Abbott Walter Adriani Pietro Alano Isabel Allona Gynheung An Nicholas Abbott Ruedi Aebersold Cedric Alaux Robin Allshire Zhiqiang An Rasha Abdel Rahman Ueli Aebi Maher Alayyoubi Abigail Allwood Ranjit Anand Zalfa Abdel-Malek Martin Aeschlimann Richard Alba Julian Allwood Beau Ances Minori Abe Ruslan Afasizhev Salim Al-Babili Eric Alm David Andelman Kathryn Abel Markus Affolter Salvatore Albani Benjamin Alman John Anderies Asa Abeliovich Dritan Agalliu Silas Alben Steven Almo Gregor Anderluh John Aber David Agard Mark Alber Douglas Almond Bogi Andersen Geoff Abers Aneel Aggarwal Reka Albert Genevieve Almouzni George Andersen Rohan Abeyaratne Anurag Agrawal R. Craig Albertson Noga Alon Gregers Andersen Susan Abmayr Arun Agrawal Roy Alcalay Uri Alon Ken Andersen Ehab Abouheif Paul Agris Antonio Alcami Claudio Alonso Olaf Andersen Soman Abraham H.
    [Show full text]
  • Microbial Specialised Metabolites: Origins and Applications", Dubrovnik, Croatia, September 13-21 2014
    Summer School on " Microbial Specialised Metabolites: Origins and Applications", Dubrovnik, Croatia, September 13-21 2014 Timetable Sat 13 Sun 14 Mon 15 Tues 16 Wed 17 Thurs 18 Fri 19 Sat 20 Sun 21 8:00-9:00 Breakfast Breakfast Breakfast Breakfast Breakfast Breakfast Breakfast Breakfast 9:00-10:30 L2 L4 L6 L8 L10 L12 Flavia Marinelli Joern Piel Roberto Kolter Gerry Wright Flavia Marinelli Mervyn Bibb, Greg Challis Trip 10:30-11:00 Break Break Break Break Break Break Departure 11:00-12:30 L3 L5 L7 L9 L11 Wrap-up Gerry Wright Mervyn Bibb, Mervyn Bibb, Duška Vujaklija Joern Piel Arrival Govind Chandra, Maureen Bibb Greg Challis 13:00-14:00 Lunch Lunch Lunch Lunch Lunch Lunch 14:00-15:30 Small-group Computer Computer Computer Computer discussion workshop workshop workshop workshop Free time CW1* CW1* CW2* CW2* 15:30-18:00 Free time & Free time Free time Free time Free time City tour Welcome and 16:00 – 17:30 opening lecture 18:00-20:00 L1 Guest seminar Poster session 1 Guest seminar Poster session 2 Guest seminar Roberto Kolter GS1 GS2 GS3 Mechas Zambrano Paco Barona Alison Foster Reception Gomez Dinner at 20:00--- IUC Party at Dinner Dinner Dinner Dinner Dinner Mimoza and debate Restaurant *Half the group does the computer workshop on one day and the second half on the next; meanwhile the other half has small-group discussions with the teaching staff. Thus each student will participate in two computer workshops and three small-group discussion sessions. Faculty Maureen Bibb, John Innes Centre, Norwich, UK Mervyn Bibb, John Innes Centre,
    [Show full text]