Streptomyces Coelicolor A3(2)

Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Pleiotropic morphological and antibiotic deficiencies result from mutations in a gene encoding a tRNA-like product in Streptomyces coelicolor A3(2)

Elizabeth J. Lawlor, Howard A. Baylis, and Keith F. Chater Agricultural and Food Research Council Institute of Plant Science Research, John Innes Institute, Norwich, NR4 7UH, UK

In Streptomyces coelicolor, bldA mutants are defective in antibiotic production and the development of aerial hyphae and spores. Subcloning analysis showed that sequences spanning an NcoI site in cloned bldA ÷ DNA were needed to allow complementation of a bldA mutant. Nucleotide sequencing revealed a tRNA-like sequence 9 bp downstream from the NcoI site. Five independent bldA mutations all fell in a 16-bp region in the tRNA-like sequence, one of them changing the putative anticodon. In RNA dot-blot analysis, hybridization was detected with a probe specific for the tRNA-like transcript but not with a probe for "anti-tRNA-like" transcripts. The transcripts detected were all in the sah-soluble RNA fraction and accumulated relatively late in growth. It is postulated that bldA specifies a tRNA that would recognize the codon UUA (for leucine). This codon is very rare in Streptomyces genes [which generally contain >70 mole% (G + C)], suggesting a possible role for bldA in translational control of development. [Key Words: Differentiation; translational regulation; secondary metabolism; sporulation] Received September 3, 1987; revised version accepted September 17, 1987.

The genus Streptomyces comprises Gram-positive soil was recently cloned on a Streptomyces temperate phage bacteria that grow as a branching vegetative mycelium, vector as a 5.6-kb PstI fragment (Piret and Chater 1985). on which aerial, sporogenous hyphae develop, presump- Here, we present the nucleotide sequence of a part of tively in response to nutritional limitation. Numerous this fragment containing the bldA gene. The location of antibiotics, including many that are valuable to man, are five bldA mutations in this sequence, coupled with produced by this group of bacteria, often at a time coin- analysis of bldA RNA, leads us to suggest that bldA ciding with the formation of aerial hyphae. specifies a tRNA for the rare leucine codon UUA and In different Streptomyces species, studies of morpho- that use of this codon may allow translational control of logical mutants have variously implicated arginine me- development. tabolism (Meade 1985), guanosine nucleotides (Ochi 1986), and extracellular diffusible factors (Khokhlov Results and discussion 1986) in both sporulation and antibiotic production (re- bldA mutations lie in a potential tRNA gene viewed by Chater 1984). In the genetically well-charac- terized S. coelicolor, bldA mutants are one of several Subcloning analysis showed that a BglII-PstI fragment classes of mutants defective in different stages of devel- of approximately 870 bp (fragment A, Fig. 1), derived opment while being apparently unimpaired in vegetative from the 5.6-kb PstI fragment originally cloned by Piret growth (Merrick 1976). On minimal agar medium con- and Chater (1985), gave bldA complementation results taining glucose or cellobiose as a carbon source, bldA identical to those obtained with the larger fragment mutant colonies produce no recognizable aerial hyphae (J.M. Piret and E.J. Lawlor, unpubl.). Following the ob- or spores; instead, the surface hyphae undergo frequent servation that cloning the 5.6-kb PstI fragment at high septation and fragmentation, which may be an aberrant copy number did not disrupt differentiation (J.M. Piret, form of the sporulation process (Chater and Merrick pets. comm.), further subcloning and complementation 1979). In addition, production of four quite different an- tests were carried out using a multicopy plasmid vector. tibiotics (two of them pigmented) made by the wild-type The results suggested that sequences spanning an NcoI strain is abolished. On other carbon sources, such as site (Fig. 1) were required for bldA expression because mannitol or maltose, aerial mycelium development and fragments B and C failed to complement a bldA muta- sporulation appear to occur normally, but antibiotic pro- tion (bldA62). Occasional wild-type recombinant colo- duction is not restored (Merrick 1976). The bldA gene nies were obtained with fragment C, indicating that the

GENES & DEVELOPMENT1:1305-1310 © 1987 by Cold Spring Harbor Laboratory ISSN 0890-9369/87 $1.00 1305 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Lawlor et al.

PstI /~jcE Pstl 5.6kb I "V ORF tRNAI I I I I I i I I I B~E I Nrol PstI Fragment A I" " I 8?Obp "- tRNA ORF (complements bldA )

B~'E F-rogment B l- 4 %Obp ORF (foiled fo complemenf bldA62} Bgfll Fragment C {failed to comptemenf b~A62, but generoted Bid*recurbr~nts) | 330bp tRNA

NcoI :ace

Fragment O (used in ,ronscription onotysis) ~, ------~"----'--'V | 160 bp tRNA .., ss probe I .. ss probe2 Figure 1. Fragments used for the localization, sequencing, and transcription analysis of bldA. Colonies obtained by transformation of S. coelicolor J395 and S. coelicolor J668 with a plasmid carrying fragment A all showed the Bld + phenotype; those obtained with plasmids carrying either fragment B or C generally retained the bldA mutant phenotype. Fragment D, inserted in M13mpl9, was used to generate two radioactively labeled single-stranded probes (ss probes 1 and 2; see Materials and methods) for transcription analysis (Fig. 4).

bldA62 mutation lay to the right of the NcoI site. Frag- quence. Each mutation was in the potential tRNA gene ments B and C also failed to complement a second bldA (Fig. 3). mutation (bldA39); no wild-type recombinant colonies were seen among the few transformants obtained with The bldA gene specifies a small RNA that accumulates this particularly poorly transformable strain. late in growth The nucleotide sequence of fragment A was determined (Fig. 2). Using the computer program "Frame" Although the double-stranded sequence potentially en- (Bibb et al. 1984), only one (truncated)potential open coding a tRNA was indeed bldA (or a part of it), it re- reading frame (ORF)was identified, beginning at a GTG mained possible that bldA was transcribed from right to triplet 69 bp from the left-hand end of fragment A, and left through this sequence. Using primed synthesis on reading leftward through the BglII site. The finding that single-stranded templates containing each orientation of bldA62 lay to the right of the NcoI site (see above) made the 160-base fragment D (Fig. 1), probe 1, specific for a it unlikely that this ORF was bldA. However, further tRNA-like transcript, and probe 2, specific for an anti- computer analysis of the nucleotide sequence using the tRNA-like transcript, were obtained. In Southern blot program of Staden (1980)revealed a potential tRNA gene analysis of total S. coelicolor DNA, using probe 1, only reading rightward from a position 9 bp to the right of the fragments of the sizes predicted from the restriction map NcoI site (Fig. 3). If this tRNA were the bldA gene of the bldA region were detected (results not shown). product, cleavage at the NcoI site would prevent com- The probes were therefore specific for bldA transcripts plementation of bldA mutants, because it would pre- and were used to analyze RNA that had been isolated at sumably separate the tRNA gene (and any genes down- different growth stages from a bldA + strain and frac- stream of it) from its promoter and from any transcribed tionated by precipitation in 3 M sodium acetate (in leader sequences that might be important for correct which RNA larger than about 6S is preferentially precip- processing of the transcript to give a mature tRNA. This, itated). Hybridization was detected only with probe 1 combined with the apparent absence of other potential and only with the soluble (sRNA)fraction that contains genes from the sequenced DNA, suggested that the po- smaller RNA species such as 5S RNA and tRNA (Fig. 4). tential tRNA gene was indeed bldA. It was strongest in RNA isolated from 36-hr cultures The nucleotide sequences of DNA fragments carrying (just before aerial hyphae appeared). Thus, only the po- five independent bldA mutations [including four pre- tential tRNA gene (and not its complementary strand) is viously shown to be alleles (Piret and Chater 1985)] were detectably transcribed, and its product accumulates as a determined. The 870-bp fragment A (Fig. 1)from each small RNA at a time compatible with its role in differ- mutant differed by only 1 bp from the wild-type se- entiation and antibiotic production.

1306 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Putative tRNA needed for development

i ~;< GA T C T'T G GA_a_AG C T C CGTGGCGCGCGCGGC CACGAGGGTGGAC CGGTCGGCGATGGGTG ~ ~ AGAACCTTTCGAGGCACCGCGCGCGCCGGmC-CTCCCAC CTGGCCAGCCGCTACC~AC I 60

CGGTGGTCACGGG.a.AGGGCGICTCCTGTCGGTACGGCGTGTGCGGTCGGCACGGTGCGTGC [QCCACC%GTCqCCCTTCCCGCGAGGACAGCCATGCCGCACACGCCAGCCGTGCCACGCACG ",'20

GG~GGCAuGGTG~GTG,~. GGGCACGGTGCGTGCTGGGCACGGTGCGTGCGGTCGGCACGG CCACCGTGCCACACACGACCCGTGCCACGCACGACCCGTGCCACGCACGCCAGCCGTGCC 180

~GCG~GCTCGGGGACGTTGTC:~.TCGmCCCGGTCGf~CGGCGCCCTGTAGTCAGCCGC ~ ACGCACGAGCCCCTGC.

] bTCCGGTTCAGGG~GGCGAC'TTCGGTCGGACGGGCCGGGCCGGTGTCATACCTGCnGa<~ L~%GGCCAAGTCCCCCCGCTG-a-AGCCAOCCTGCCCGGCCCGG-CACAGTATGGACGCCTAC 900

AC-,c,-CGACCCrn~'GGCGGnnCGGGTG~n'-.-GGGG-nGGCGCCCm~nTCGAGACGG<:nc~_~..~ ~. .~=~..~ ,_~ . • _ _

~CCGGCmGGGGCTGC~CC~,

nn%~C~<~CA~~c~CAG~GCGGGC°-TCGCACG~GG6TGTTGGCA~GTGC~I~~ ...... ,c TTA~GGCAGTAAGGCGTATGT~aCGCCCGCCAGCGTGCGTTCCcAC~D~CCGTACACGAC &20

TTO'SCCTGACCCGGT~_ACTGATGCACCCTCAGGCGCCg~T:

G~AGGTTCCACGGGGCGGGCCATTGCCCTG~CCGCGG'CTGGTTGCGACTCAGCGGCCCTG ,~mm-C~%GGmaCCCCGn~CGGT~KCGGGACGGGCGCCGACC.

~<~GCGCTCC~CGCCC~GCGGCCCTGGCGAC'~GG...... ~: - GTATGGGCTTTCGTCCTGCCGGCC_ _ ~=.--~GCGAGGGGCGGGAGCGCCGGGACCGCTGGA~CA~ACC-<~hAGCAGGACGGCCGG~~ ~ ~ .... 780

GGCGGAGGGGGCGGAGTCGCG~CGGCGGCT m~"_~r.CGGCCGGACACGTGATGATCGGACTG ~cC~C~C~GCCTCAGCGCTTGC~GC~G.~GTGCCGGCC~mGCACmACTAGCCTGAC~~. ~~ ~ ~ ~.~ .... 8~0

GCCCTCGTGTGCACCTGTCTGATCGG~CTGICA~ CGGGAGCACACGTGGACAGACTAGCCTGACGTC 873 Figure 2. Nucleotide sequence of fragment A. The boxed nucleotides form an incomplete ORF, and the black bars indicate the sequences of the 20-base oligonucleotide primers used to sequence bldA mutant alleles (Fig. 3). The latter experiments confirmed the sequence across the NcoI site shown here.

How tRNA-like would the proposed bldA gene product there are examples of tRNAs where both G residues are be? absent (Roberts 1972). The anticodon would recognize the codon UUA, and so the bldA-gene product can be These results provide strong evidence that bldA speci- designated tRNA~r"A. It showed highest homology (65%) fies a tRNA-like product. How tRNA-like would it be? to a Bacillus subtilis tRNA~A (Wawrousek et al. 1984) The stems and loops of its proposed secondary structure and greater homology to leucyl tRNAs with nonho- are consistent with those of tRNAs, and it has a typical mologous anticodons [for example, Escherichia coli "cloverleaf" form (Gauss et al. 1979). Ignoring modified tRNA~% {57%) (Sprinzl et al. 1985)] than to nonleucyl bases (which cannot be deduced from the DNA se- tRNAs [for example, B. subtilis tRNASEc (39%) quence), the potential tRNA contains all the invariant (Wawrousek et al. 1984)]. and semiinvariant residues present in almost all tRNAs What effects might the sequenced bldA mutations (excluding initiator tRNAs)involved in protein syn- have on tRNA structure and function? The bldA39 mu- thesis (Rich and RajBhandary 1976), except the highly tation changes the anticodon to UGA, which would rec- conserved GG pair at nucleotides 18 and 19 in the D ognize the UCA (serine)codon. The bldA16, bldA62, loop. The absence of one G of this pair is striking, but and bldA1 mutations result in mismatched base pairs in

GENES & DEVELOPMENT 1307 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Lawlor et al.

Ncol tRNA start slightly during sporulation, and these changes are ' 1 5"OCGGAG CC CA TGGC C TGCCC GGA TGGTGGA thought to be due to post-translational modification 3" CG CCTCGGGT ACCGGA CGGG CC TA CCA CCT {Void 1985; Henner and Steinberg 1979), but it is not (A16} T c(AdZ) A(AI) G(A39) T(A34) known whether they influence the course of sporula- It t I t ATGCAGA CAC GGCGAGCTTA AA CCT CGC TG tion. The high G + C content of Streptomyces DNA TA CGTCT GTG C CGCT CfiAAT TTGGAGCGA C might allow (or even result from} the use of A + T-rich codons as regulatory signals. In a compilation of 17 sequenced Streptomyces genes provided by M.J. Bibb (pers. C C CC TT CGAG GG CGTGC CG G T TCAAG T CC G GGGGAAGCT C CCG CA CGGC C AAGTTCAGGC comm.), there was only one example of a TTA codon, in the hyg gene of S. hygroscopicus (Zalacain et al. 1986). In tRNA stop 1 addition, recent sequence analysis has shown that the GCT C CGGGCA CCA C TA CTG T CA CGCTGCGT 3" carB gene of S. thermotolerans (Epp et al. 1987)contains CGAGGC C C (3 (3fiT GA TGA CA 5" GTGCGA CGCA two TTA codons and that the sph gene of S. glaucescens (V6gtli and Hfitter 1987)contains one TTA codon. Secondary structure deduced Overall, this represents a frequency of usage for this from DNA sequence codon of less than 1%, CTG and CTC being preferentially used to encode leucine. Thus, it is possible that limited availability of the bldA tRNA~A in S. coelicolor 3 A restricts the translation of mRNA species containing C C UUA codons and that efficient translation of at least one A such mRNA is necessary for normal development. This 0--C C -- G Acceptor stem hypothesis requires that there should be no other tRNA C--G capable of translating UUA codons efficiently. Although C--G G~C Southern blotting (results not shown)indicated that S. G--C T~IC coelicolor DNA contains no other sequences at least A~U U~ arm 0 CIPm CGGCC A 70% homologous to bldA, this does not exclude the pos- AA G IIIII A U GGU5 GCCGG C sibility of a less homologous tRNA with the same anti- G II I U UU codon. Although constrained by the lack of information C ACAC G AO / \ G C concerning modified residues, consideration of the U C 6--CU / G "wobble hypothesis" as originally formulated (Crick C--G G / G Variable arm A--G-- C £ / G 1966) indicates that only tRNAs with the anticodon Anticodon A ~ U £ / A UAA are able to read UUA codons. However, wobble has G--C C G arm C C---U C C also been reported at the first position of the codon, with U A UU pairing occurring between G and U residues (Lin et al. UAA 1 1986 and references therein). This potentially allows G leucyl tRNAs with the anticodon UAG to translate Figure 3. Deduced secondary structure of the potential tRNA UUA codons. and the positions of five bldA point mutations. The base Alternatively, the bldA tRNA could be involved in a change for each bldA mutation is shown, together (in the upper process other than ribosome-mediated protein synthesis. part of the diagram)with the allele number in parentheses. In other organisms, tRNAs have been implicated in nonribosomal amino-terminal addition of amino acids to proteins (Softer and Horinishi 1969), donation of the either the D stem or the anticodon stem, reducing the lysyl group of lysyl-tRNA in the formation of O-L-lysyl stability of the secondary structure. The bldA34 muta- phosphatidylglycerol in Staphylococcus aureus (Lennarz tion lies at N38 in the anticodon loop where the (often highly modified)residues play a part in anticodon- codon recognition (Bouadloun et al. 1986; Ericson and Bj6rk 1986). This mutation may therefore prevent an important modification.

How could the bldA-gene product influence differentiation? Although a variety of nontranslational roles of tRNA- like molecules have been reported (see the end of this 24. 36 /+8 hours section), we first discuss the most obvious hypothesis Figure 4. Hybridization between 3 ~g of the salt-soluble RNA for bldA actionmthat its product might play a crucial fractions and probe 1 {Fig. 1}, indicating that a blclA tRNA-like role in differentiation simply by influencing translation, transcript accumulates relatively late in growth. No signals for example, by changes in its abundance or degree of were detected between probe 1 and the salt-insoluble RNA modification. fractions or between probe 2 {Fig. 1) and either the salt-soluble In B. subtilis the tRNA profile changes at least or salt-insoluble RNA fractions.

1308 GENES& DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Putative tRNA needed for development et al. 1971), and peptidoglycan synthesis in staphylo- D (Fig. 1)were respectively filled in or digested with the cocci (Steward et al. 1971). Moreover, there are require- Klenow fragment of DNA polymerase I {Maniatis et al. 1982) ments for an arginine tRNA for DNA replication and ligated with SmaI-cleaved M 13mp 19 and introduced into E. (Mullin et al. 1984; Garcia et al. 1986)and a serine tRNA coli JM101 by transformation. Derivatives of M13mpl9 containing each orientation of fragment D were detected by se- for cell division (Tamura et al. 1984) in E. coli. It is not quence analysis (Bankier and Barrell 1983)and were used to clear whether these latter effects are exerted through the prepare a2P-labeled single-stranded DNA probes by primed syn- translation machinery or via some other activity of thesis (Biggin et al. 1984). Labeled DNA was separated from un- these particular tRNA species. incorporated nucleotides by passage through a Sephadex G-100 Elucidation of both the precise mode of action of column {Hopwood et al. 1985) and denatured at 90°C for 10 min tRNA~r~A and the mechanism of temporal control of prior to use. Probe 1 was prepared from template containing bldA expression will provide a basis for a number of in- fragment D oriented such that the SacII end of the fragment teresting future experiments. These matters will also be was next to the primer site for in vitro DNA synthesis, and of some relevance to the commercial production of anti- probe 2 from template containing fragment D in the opposite biotics by Streptomyces fermentations. orientation.

Southern blots Materials and methods Southern blots were performed as described in Hopwood et al. Subcloning of bldA (1985). The filters were washed in 3 x SSC/0.1% SDS or 0.2 x SSC/0.1% SDS at 70°C, according to the degree of homology Fragments A, B, and C (Fig. 1) were ligated with the multicopy being sought {70% and 90%, respectively, in the two sets of plasmid vectors pIJ486 and PIJ487 (Ward et al. 1986), cleaved at conditions). appropriate sites in their oppositely oriented polylinker sequences, and introduced into Streptomyces lividans TK24 by transformation (Hopwood et al. 1985). For the easier subcloning Dot blots of fragments B and C, the NcoI site was converted to a BgllI site RNA was isolated from cultures of S. coelicolor J1507 (bldA +) by end filling with the Klenow fragment of DNA polymerase I (Chater and Bruton 1983}, grown for different lengths of time on and attachment of a synthetic BgllI linker (Maniatis et al. 1982). the surface of cellophane sheets laid on R2YE medium (Hop- Plasmids of the correct structure were identified by restriction wood et al. 1985}. The RNA was size-fractionated by two pre- enzyme analysis and introduced into S. coelicolor J395 (bldA62) cipitations in 3 M sodium acetate in which RNA larger than 6S (Piret and Chater 1985) and S. coelicolor J668 (bldA39)(Merrick precipitates (Kirby et al. 1967). The fractionation was checked 1976) by transformation. (Note that bldA mutants were gener- by agarose gel electrophoresis. RNAs (1.5, 3, and 6 ~g)were ally transformed at relatively low frequencies.) "dotted" onto nitrocellulose filters and hybridized with probes 1 and 2, as described in Hopwood et al. (1985). Cloning of bldA mutant alleles

The bldA mutations analyzed were cloned from the following Acknowledgments strains: J668 (bldA39)and J673 (bldA16)(Merrick 1976); and J406 (bldA1), J394 (bldA34), and J395 (bldA62)(D.A. Hopwood We thank Gary Janssen for valuable help with sequencing pro- and K.F. Chater, unpubl.). The mutations were cloned in vivo cedures, Jacqueline Piret for providing bldA-containing phages by recombination between (bC31 KC603, carrying the cloned and unpublished data, Mervyn Bibb for the use of his compila- bldA gene as a 5.6-kb PstI fragment, and the bldA region of the tion of Streptomyces gene sequences, and David Hopwood for respective bldA mutant chromosome as described by Piret and helpful comments on the manuscript. E.J.L. and H.A.B. were Chater (1985). The 870-bp BglII-PstI fragment A (Fig. 1) from the recipients of John Innes Foundation Research Studentships. each mutant was ligated with PstI- and BamHI-cleaved M13mpl9 (Norrander et al. 1983)and introduced into E. coli References JM101 (Messing 1979) by transformation (Bankier and Barrell 1983). Bankier, A.T. and B.G. Barrell. 1983. Shotgun DNA sequencing. In Techniques in the life sciences: Nucleic acid biochem- istry led. R.A. FlavellJ, pp. 1-34. Elsevier Press, Ireland. DNA sequence analysis Bibb, M.I., P.R. Findlay, and M.W. Johnson. 1984. The relation- The DNA sequences of both strands of fragment A carrying the ship between base composition and codon usage in bacterial wild-type bldA allele were determined by the chemical degra- genes and its use for the simple and reliable identification of dation method (Maxam and Gilbert 1980), using fragments protein coding sequences. Gene 30: 157-166. uniquely labeled at the BglII, NcoI (in some cases after its con- Biggin, M., P.J. Farrell, and B.G. Barrell. 1984. Transcription and version to a BglII site), and a vector HindIII site adjacent to the DNA sequence of the BamHI L fragment of B95-8 Epstein- PstI site of the cloned fragment. The DNA sequence of one Barr virus. EMBO J. 3:1083-1090. strand of fragment A was determined for each bldA mutant al- Bouadloun, F., T. Srichaiyo, L.A. Isaksson, and G.R. Bj6rk. lele by the chain-terminating procedure (Bankier and Barrell 1986. Influence of modification next to the anticodon in 1983) using the synthetic oligonucleotide primers shown in tRNA on codon context sensitivity of translational suppres- Figure 2. sion and accuracy. I. Bacteriol. 166: 1022-1027. Chater, K.F. 1984. Morphological and physiological differentiation in Streptomyces. In Microbial development {ed. R. Lo- Preparation of probes sick and L. Shapiro}, pp. 89-115. Cold Spring Harbor Labora- The 5' single-stranded ends generated by NcoI and the 3' tory, Cold Spring Harbor, New York. single-stranded ends generated by SacII of the 160-bp fragment Chater, K.F. and M.J. Merrick. 1979. Streptomyces. In Develop-

GENES & DEVELOPMENT 1309 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Lawlor et al.

mental biology of prokaryotes (ed. J.H. Parish), pp. 93-114. aerial mycelial formation in Streptomyces MA406-A-1. J. Blackwell Scientific Publications, Oxford. Gen. Microbiol. 132- 299-305. Chater, K.F. and C.J. Bruton. 1983. Mutational cloning in Strep- Piret, J.M. and K.F. Chater. 1985. Phage-mediated cloning of tomyces and the isolation of antibiotic production genes. bldA, a region involved in Streptomyces coelicolor morpho- Gene 26: 67-78. logical development and its analysis by genetic complemen- Crick, F.H.C. 1966. Codon-anticodon pairing: the wobble hy- tation. J. Bacteriol. 163: 965-972. pothesis. J. Mol. Biol. 19: 548-555. Rich, A. and U.L. RajBhandary. 1976. Transfer RNA molecular Epp, J.K., S.G. Burgett, and B.E. Schoner. 1987. Cloning and nu- structure, sequence, and properties. Annu. Rev. Biochem. cleotide sequence of a carbomycin resistance gene from 45: 805-860. Streptomyces thermotolerans. Gene 53: 73-83. Roberts, R.J. 1972. Structures of two glycyl-tRNAs from Staph- Ericson, J.U. and G.R. Bj6rk. 1986. Pleiotropic effects induced ylococcus epidermidis. Nat. New Biol. 237: 44-45. by modification deficiency next to the anticodon of tRNA Soffer, R.L. and H. Horinishi. 1969. Enzymatic modification of from Salmonella typhimurium LT2. I. Bacteriol. proteins. I. General characteristics of the arginine transfer 166: 1013-1021. reaction in rabbit liver cytoplasm. ]. Mol. Biol. 43:163-175. Garcia, G.M., P.K. Mar, and J.R. Walker. 1986. The Escherichia Sprinzl, M., T. Vorderwtilbecke, and T. Hartmann. 1985. Com- coli dnaY gene encodes an arginine transfer RNA. Abstracts pilation of sequences of tRNA genes. Nucleic Acids Res. of the annual meeting of the American Society for Microbi- 13: r51-r104. ology. Washington, D.C. Abstract H-160. Staden, R. 1980. A computer program to search for tRNA genes. Gauss, D.H., F. Gruter, and M. Sprinzl. 1979. Compilation of Nucleic Acids Res. 8:817-825. tRNA sequences. Nucleic Acids Res. 6: rl-rl9. Steward, T.W., R.I. Roberts, and I.L. Strominger. 1971. Novel Henner, D.J. and W. Steinberg. 1979. Transfer ribonucleic acid species of tRNA. Nature 230: 36-38. synthesis during sporulation and spore outgrowth in Ba- Tamura, F., S. Nishimura, and M. Ohki. 1984. The E. coli dive cillus subtilis studied by two-dimensional polyacrylamide mutation, which differentially inhibits synthesis of certain gel electrophoresis. I. Bacteriol. 140: 555-566. proteins, is in tRNA ser. EMBO ]. 3" 1103-1107. Hopwood, D.A., M.J. Bibb, K.F. Chater, T. Kieser, C.J. Bruton, V6gtli, M. and R. Htitter. 1987. Characterisation of the hydroxy- H.M. Keiser, D.J. Lydiate, C.P. Smith, J.M. Ward, and H. streptomycin phosphotransferase gene (sph)of Streptomyces Schrempf. 1985. Genetic manipulation of Streptomyces: A glaucescens: nucleotide sequence and promoter analysis. laboratory manual. The John Innes Foundation, Norwich, Mol. Gen. Genet. 208: 195-203. England. Void, B.S. 1985. Structure and organisation of genes for transfer Khokhlov, A.S. 1986. Actinomycete autoregulators. In Biolog- ribonucleic acid in Bacillus subtilis. Microbiol. Rev. ical, biochemical, and biomedical aspects of actinomy- 49:71-80. cetes. Proceedings of 6th Int. Symp. on Actinomycetes Bi- Ward, J.M., G.R. Janssen, T. Kieser, M.J. Bibb, and M.J. Buttner. ology (ed. G. Szab6, S. Bir6, and M. Goodfellow), pp. 1986. Construction and characterisation of a series of multi- 791-798. Akademiai Kiado, Budapest. copy promoter-probe plasmid vectors for Streptomyces Kirby, K.S., E. Fox-Carter, and H. Guest. 1967. Isolation of using the aminoglycoside phosphotransferase gene from deoxyribonucleic acid and ribosomal ribonucleic acid from Tn5 as indicator. Mol. Gen. Genet. 203: 468-478. bacteria. Biochem. J. 104: 258-262. Wawrousek, E.F., N. Narashima, and I.N. Hansen. 1984. Two Lennarz, W.J., J.A. Nesbitt III, and J. Reiss. 1966. The participa- large clusters with thirty-seven transfer RNA genes adjacent tion of sRNA in the enzymatic synthesis of O-L-lysyl phos- to ribosomal RNA gene sets in Bacillus subtilis. J. Biol. phatidylglycerol in Staphylococcus aureus. Proc. Natl. Chem. 259: 3694-3702. Acad. Sci. 55: 934-941. Zalacain, M., A. Gonzales, M.C. Guerro, R.J. Mattaliano, F. Lin, J.P., M. Aker, K.C. Sitney, and R.K. Mortimer. 1986. First Malpartida, and A. limenez. 1986. Nucleotide sequence of position wobble in codon-anticodon pairing: amber suppres- the hygromycin B phosphotransferase gene from Strepto- sion by a yeast glutamine tRNA. Gene 49" 383-388. myces hygroscopicus. Nucleic Acids Res. 14: 1565-1581. Maniatis, R., E.F. Fritsch, and J. Sambrook. 1982. Molecular cloning: A laboratory manual. Cold Spring Harbor Labora- tory, Cold Spring Harbor, New York. Maxam, A.M. and W. Gilbert. 1980. Sequencing end-labeled DNA with base specific chemical cleavages. Methods En- zymol. 65: 499-560. Meade, H. 1985. Cloning of argG from Streptomyces: loss of gene in Arg- mutants of S. cattleya. Bio/Technology 3: 917-918. Merrick, M.J. 1976. A morphological and genetic mapping study of bald colony mutants of Streptomyces coelicolor. J. Gen. Microbiol. 96:299-315. Messing, J. 1979. A multipurpose cloning system based on the single stranded DNA bacteriophage M13. Recombinant DNA Technical Bulletin, NIH Publication 99: 43-48. Mullin, D.A., G.M. Garcia, and J.R. Walker. 1984. An E. coli DNA fragment 118 base pairs in length provides dnaY com- plementing activity. Cell 37: 669-674. Norrander, J., T. Kempe, and J. Messing. 1983. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26:101 - 106. Ochi, K. 1986. A decrease in GTP content is associated with

1310 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Pleiotropic morphological and antibiotic deficiencies result from mutations in a gene encoding a tRNA-like product in Streptomyces coelicolor A3(2).

E J Lawlor, H A Baylis and K F Chater

Genes Dev. 1987, 1: Access the most recent version at doi:10.1101/gad.1.10.1305

References This article cites 31 articles, 8 of which can be accessed free at: http://genesdev.cshlp.org/content/1/10/1305.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.