Effects on Production Traits of Haplotypes Among Casein Genes in Norwegian Goats and Evidence for a Site of Preferential Recombination
Total Page：16
File Type：pdf, Size：1020Kb
Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.106.058966 Effects on Production Traits of Haplotypes Among Casein Genes in Norwegian Goats and Evidence for a Site of Preferential Recombination Ben Hayes,1,2 Nina Hagesæther,1 Tormod A˚ dnøy, Grunde Pellerud, Paul R. Berg and Sigbjørn Lien Centre for Integrative Genetics and Department of Animal and Aquacultural Sciences, Norwegian University of Life Sciences, N-1432 A˚ s, Norway Manuscript received April 5, 2006 Accepted for publication July 2, 2006 ABSTRACT In goat milk the most abundant proteins are the casein genes, CSN1S1, CSN2, CSN1S2, and CSN3. Mutations have been identified within these genes affecting the level of gene expression, and effects on milk production traits have been reported. The aim of this study was to detect polymorphisms (SNPs) in the casein genes of Norwegian goats, resolve haplotype structures within the loci, and assess the effect of these haplotypes on milk production traits. Four hundred thirty-six Norwegian bucks were genotyped for 39 polymorphic sites across the four loci. The numbers of unique haplotypes present in each locus were 10, 6, 4, and 8 for CSN1S1, CSN2, CSN1S2, and CSN3, respectively. The effects of the CSN1S1 haplotypes on protein percentage and fat kilograms were significant, as were the effects of CSN3 haplotypes on fat percentage and protein percentage. A deletion in exon 12 of CSN1S1, unique to the Norwegian goat popu- lation, explained the effects of CSN1S1 haplotypes on fat kilograms, but not protein percentage. Inves- tigation of linkage disequilibrium between all possible pairs of SNPs revealed higher levels of linkage disequilbrium for SNP pairs within casein loci than for SNP pairs between casein loci, likely reflecting low levels of intragenic recombination. Further, there was evidence for a site of preferential recombination between CSN2 and CSN1S2. The value of the haplotypes for haplotype-assisted selection (HAS) is discussed. OAT milk is a valuable source of protein in many reports of the effects of these alleles on milk yield G countries, including a large number of African are somewhat contradictory; for example, Mahe et al. and Asian countries and European countries such as (1994) reported that genetic variants of CSN1S1 had no Norway, France, and Italy. The most abundant proteins effects on milk yield. A unique deletion in CSN1S1 in goat milk, as in other milks, are the caseins. The four (here termed the 04 allele) has been reported in caseins expressed in goat milk, aS1-, b-, aS2-, and Norwegian goats and is present in the Norwegian pop- k-casein, are coded by the loci CSN1S1, CSN2, CSN1S2, ulation at high frequency [0.86 (A˚ dnøy et al. 2003)]. In and CSN3, respectively, located within a 250-kb seg- most other European breeds the null alleles are at low ment of caprine chromosome 6 (Martin et al. 2002a). frequency. A number of genetic variants of the casein genes At least five variants of CSN2 are described, including that affect milk production traits have been described. a null allele associated with no protein expression CSN1S1 is the most complex and is highly polymorphic (Mahe and Grosclaude 1993; Galliano et al. 2004). (Martin et al. 2002b). As many as 18 different alleles Likewise at least five different alleles have been de- have been identified for this gene (Leroux et al. 2003; scribed for CSN1S2 (Recio et al. 1997; Martin et al. Devold 2004), including alleles with ‘‘strong’’ effects, 1999; Erhardt et al. 2002). Prinzenberg et al. (2005) ‘‘medium’’ effects, and ‘‘weak’’ effects and ‘‘null’’ alleles recently described alleles of CSN3, including two new associated with no synthesis of the protein (Leroux alleles and a new nomenclature for the 16 previously et al. 1990; Neveu et al. 2002). Goats carrying the strong described alleles. The influence of CSN3 on milk pro- variants have been reported to produce milk with a duction traits still remains to be evaluated. significantly higher casein, total protein, and fat content While the mutations described above can dramati- than goats carrying the weak variants (Manfredi et al. cally affect the levels of expression of the genes they are 1993; Remeuf 1993; Barbieri et al. 1995). However, found in, effects on total protein production are in some cases less pronounced. One hypothesis is that 1 when expression of one casein gene is downregulated, These authors contributed equally to this work. eroux 2Corresponding author: 475 Mickelham Rd., Attwood 3049, Melbourne, the others can be upregulated to compensate (L Victoria, Australia. E-mail: [email protected] et al. 2003). Bovenhuis et al. (1992) suggested that the Genetics 174: 455–464 (September 2006) 456 B. Hayes et al. conflicting results of the effects of mutations in casein transcribed into cDNA using primer T720 and a genes for cattle at least might be due to linkage between Superscript II RT kit (Invitrogen, Carlsbad, CA). mutations in different caseins, as well as the different Primers for amplification and resequencing are given statistical models used in the analyses. They proposed a in supplemental material at http://www.genetics.org/ multigene model as an alternative to single-gene mod- supplemental/. Samples were sequenced using Dye ter- els. As mutations with effects on quantitative traits such minator chemistry and an ABI3730 sequencer (Applied as milk production can occur in exons, introns (e.g., Biosystems, Foster City, CA). For the identification of Andersson and Georges 2004), promoters, and other SNPs a pipeline based on the phred, phrap, and regulatory sequences (e.g., Hoogendoorn et al. 2003), it polyphred programs was used as described by Olsen is possible that the functional mutation(s) will not be et al. (2005). Contig assembly and putative SNPs were within the set of mutations (such as single-nucleotide visually inspected using consed (Gordon et al. 1998) polymorphisms, SNPs) genotyped in the data set. How- before assays were constructed and SNPs were geno- ever, the functional mutation(s) will have occurred in an typed using matrix-assisted laser desorption/ioniza- ancestral chromosome segment, copies of which persist tion time-of-flight mass spectroscopy (MALDI-TOF MS) in the current generation of animals. These identical- (Sequenom, San Diego). Assays for the genotyping are by-descent (IBD) chromosome segments can be identi- provided as supplemental information (http://www. fied in the current population by unique haplotypes of genetics.org/supplemental/). For simplicity, polymor- SNP or marker alleles. This suggests investigating the phisms are labeled SNP1–SNP39, in order along the effects of haplotypes of the mutation alleles across the chromosome segment containing the caseins. Three casein loci on protein production as an alternative to polymorphisms in exon 12 of CSN1S1 were genotyped considering the genes in isolation. in the same assay and coded as alleles 1, 3, and 6. Se- In this article, we investigate effects of haplotypes of quences for the three polymorphisms in exon 12 are as polymorphisms in the casein genes on production follows: traits in the Norwegian dairy goat population. We first Allele 1: GAACAGCTTCTCAGACTGAAAAATACAACGT sequenced fragments of all four of the casein loci in GCCCCAGCTG seven Norwegian dairy bucks to detect additional poly- Allele 3: GAACAGCTTCTCAGACTGAAGAAATACAACG morphisms in the casein loci. We also sequenced frag- TGCCCCAGCTG ments of the promoters for these genes. We then Allele 6: GAACAGCTTCTCAGACTGAAAAAATACAACG genotyped the 436 bucks representative of the commer- TGCCCCAGCTG. cial population, for these new SNPs as well as previously reported mutations, and constructed haplotypes within Allele 1 is characterized by a single-point deletion each casein locus. The pattern of linkage disequilibrium coding for very low levels of mRNA (our unpublished between the haplotypes suggested preferential recom- data) and a truncated protein undetectable by IEF of bination between CSN2 and CSN1S2; this was sup- milk samples (Vegarud et al. 1989). So far this deletion ported by analysis of linkage disequilibrium between is reported only in Norwegian goats with a surprisingly individual markers. The haplotypes were found to have high frequency of 0.86 (A˚ dnøy et al. 2003). large effects on the milk production traits. The possi- Haplotype construction: To construct haplotypes bility of using these haplotypes in haplotype-assisted se- from SNP genotypes of 436 bucks, two different pro- lection (HAS) is discussed. grams were used in sequence. SimWalk (Sobel and Lange 1996) uses pedigree information to reconstruct haplotypes, while PHASE (Stephens et al. 2001) uses METHODS linkage disequilibrium and allele frequencies. Suffi- SNP detection and genotyping: Among polymor- cient pedigree for successful haplotype construction phisms (six SNPs and two deletions) selected from with SimWalk was available only for a subset of the the literature six turned out to be nonpolymorphic in data, including 240 bucks belonging to half-sib families the Norwegian goat population (see supplemental in- (common sire) of at least six individuals. The identified formation at http://www.genetics.org/supplemental/). haplotypes of these 240 bucks were then assumed to be Primers for resequencing of casein loci were designed for phase-known genotypes in the PHASE program, along the promoters, selected exons, and introns of CSN1S1, with the phase-unknown genotypes of the rest of the 196 CSN2, and CSN3, including exon 16 of CSN1S2 and Norwegian bucks. Haplotypes were predicted within exon 7 of CSN2. Seven Norwegian goats, known to each casein locus. Haplotypes with a frequency of ,1% be variable in CSN1S1 from isoelectric focusing (IEF) were omitted from the data set. of milk samples (Vegarud et al. 1989), were targeted Level of linkage disequilibrium: Once the haplotypes for the resequencing. In addition, coding parts of were constructed, we estimated the level of linkage dis- CSN1S1 were resequenced in 15 goats using primers equilibrium between all pairs of loci using the r2-statistic CSNS1mRNA-F and CSNS1mRNA-R.