Supplemental Table 1: Pancreatic lesion multiplicity in Ela-KRASG12D mice at 14 months of age depends on genetic background.
Mouse Strain # Mice Lesion Multiplicity ± SD
FVB-Tg(Ela-KRASG12D) 18 0.3 ± 0.6
G12D SWFVB-Tg(Ela-KRAS )F1 16 0.6 ± 1
G12D a C3FVB-Tg(Ela-KRAS )F1 14 4 ± 4
G12D a BALBFVB-Tg(Ela-KRAS )F1 16 8 ± 4
G12D a D2FVB-Tg(Ela-KRAS )F1 14 8 ± 4
G12D a B6FVB-Tg(Ela-KRAS )F1 18 11 ± 5
aSignificantly different from the FVB-Tg(Ela-KRASG12D) value by Wilcoxon rank sum test (P <
10-4) Supplemental Table 2 1 Supplemental Table 2: Positions of markers analyzed in linkage studies. a b c c c Marker Chrom Pos (cM) Pos (bp) B6xFVB BALBxFVB D2xFVB D1Mit70 1 17.8 32,733,289 B D1Mit5 1 32.8 63,862,105 IB D1Mit46 1 43.1 75,569,122 IB IB D1Mit83 1 52 88,043,561 IB D1Mit80 1 52 88,274,528 IB D1Mit91 1 64 128,355,210 IB D1Mit30 1 70 135,259,675 IB D1Mit102 1 73 149,096,650 IB D1Mit110 1 88.1 169,688,648 IB D1Mit15 1 87.9 170,288,805 IB IB D1Mit115 1 99.7 179,610,205 IB IB D1Mit406 1 101.2 190,093,211 IB D1Mit292 1 107.3 193,227,344 IB D2Mit6 2 12.5 20,814,594 IB I D2Mit80 2 10 20,928,232 B IB D2Mit7 2 28 38,095,233 IB IB D2Mit9 2 37 65,277,459 IB D2Mit37 2 45 74,531,830 IB D2Mit66 2 47.8 84,657,700 IB D2Mit62 2 65 117,938,185 IB D2Mit17 2 69 122,639,898 IB D2Mit30 2 69 123,526,660 IB D2Mit57 2 82 148,128,121 IB IB D2Mit285 2 86 152,683,037 IB D2Mit51 2 95.5 162,976,178 IB D2Mit148 2 105 178,535,250 IB IB D3Mit62 3 4.6 17,467,423 IB D3Mit55 3 13.8 28,475,226 IB IB D3Mit22 3 33.7 69,522,098 B D3Mit51 3 35.2 73,304,714 IB D3Mit49 3 41 89,036,582 I IB D3Mit39 3 52.5 108,572,112 IB D3Mit256 3 66.2 136,014,535 IB D3Mit17 3 71.8 143,310,189 IB IB D3Mit32 3 80.2 149,411,386 IB IB D3Mit19 3 87.6 157,646,003 IB D4Mit18 4 5.2 13,937,604 IB D4Mit1 4 6.3 17,819,763 IB D4Mit2 4 6.5 25,610,387 IB I D4Mit6 4 20.8 49,991,211 I D4Mit17 4 31.4 63,026,328 IB IB IB D4Mit348 4 40 82,826,651 IB D4Mit133 4 42.5 89,188,138 I D4Mit31 4 51.3 106,785,035 IB D4Mit52 4 54.9 114,473,276 IB D4Mit57 4 56 117,791,835 IB D4Mit54 4 66 137,446,452 IB IB D4Mit33 4 79 149,966,385 IB D4Mit356 4 81 151,804,078 IB Supplemental Table 2 2 a b c c c Marker Chrom Pos (cM) Pos (bp) B6xFVB BALBxFVB D2xFVB D4Mit256 4 82.7 154,364,548 IB IB D5Mit61 5 8 21,368,263 B D5Mit11 5 26 48,258,171 IB IB D5Mit54 5 28 50,817,671 I IB D5Mit7 5 45 93,726,231 IB D5Mit10 5 54 104,668,024 IB IB D5Mit158 5 62 115,413,178 IB D5Mit95 5 68 125,309,605 IB D5Mit30 5 72 130,061,274 IB D5Mit99 5 80 141,433,366 IB D5Mit43 5 83 145,401,297 IB IB D5Mit143 5 86 151,804,668 IB D6Mit116 6 5.5 25,100,229 IB D6Mit274 6 20.5 48,676,564 IB D6Mit17 6 30.3 71,069,212 IB D6Mit3 6 33.5 78,579,497 IB D6Mit29 6 36.5 86,756,799 IB D6Mit36 6 46 104,453,354 IB D6Mit10 6 48.7 113,297,319 IB I D6Mit44 6 51.5 115,883,287 I B D6Mit14 6 71.2 145,604,376 IB D6Mit15 6 74 146,377,508 IB IB D7Mit57 7 4 20,283,120 IB D7Mit224 7 15 33,329,325 IB D7Mit25 7 16 37,653,504 IB D7Mit31 7 44 94,642,439 I IB IB D7Mit32 7 46.4 97,308,622 IB IB D7Mit101 7 60 132,776,553 IB IB IB D7Mit223 7 72.4 151,795,777 IB IB IB D8Mit16 8 8 23,762,706 I IB D8Mit3 8 10 25,723,657 IB D8Mit24 8 18 35,705,830 B D8Mit45 8 40 89,829,274 IB IB D8Mit88 8 58 117,360,795 IB D8Mit35 8 59 118,625,692 IB D8Mit14 8 67 127,170,502 IB D8Mit42 8 71 129,076,217 IB D8Mit56 8 73 131,542,319 B D9Mit42 9 8 29,128,608 IB IB IB D9Mit4 9 29 51,931,283 IB IB D9Mit21 9 31 57,532,016 IB D9Mit11 9 48 86,133,452 B D9Mit10 9 49 89,871,843 I IB D9Mit51 9 61 106,314,608 IB D9Mit15 9 61 109,670,306 IB D8Mit46 9 61 114,588,014 IB IB D9Mit201 9 65 117,345,284 IB D9Mit19 9 71 120,271,887 IB D10Mit28 10 4 9,133,173 IB D10Mit51 10 9 18,388,995 IB Supplemental Table 2 3 a b c c c Marker Chrom Pos (cM) Pos (bp) B6xFVB BALBxFVB D2xFVB D10Mit16 10 16 21,435,099 IB D10Mit3 10 21 28,871,992 IB D10Mit40 10 29 48,420,845 IB D10Mit15 10 35 66,475,191 IB D10Mit42 10 44 82,117,849 IB D10Mit230 10 49 89,654,985 IB D10Mit10 10 51 91,754,266 IB D10Mit70 10 59 103,535,851 IB D10Mit233 10 62 113,818,252 IB D10Mit74 10 65 117,990,821 IB D10Mit35 10 69 121,642,455 IB D11Mit19 11 13 25,322,121 IB IB IB D11Mit23 11 28.1 54,049,428 IB I D11Mit4 11 37 68,422,759 B IB D11Mit38 11 49 87,614,342 IB D11Mit289 11 55 94,741,466 IB D11Mit98 11 58 96,724,981 IB D11Mit99 11 59.5 99,510,152 IB D11Mit103 11 76 117,028,633 IB D11Mit48 11 77 117,993,078 IB IB D12Mit12 12 6 25,358,023 IB IB D12Mit2 12 19 42,747,379 IB D12Mit54 12 24 54,960,589 IB D12Mit3 12 32 77,081,506 IB D12Mit5 12 37 82,010,921 IB IB D12Mit28 12 52 106,580,305 IB D12Mit133 12 56 111,536,237 IB D12Mit8 12 58 114,657,953 IB D12Nds2 12 59 115,134,928 IB D13Mit18 13 18 36,258,023 IB IB D13Mit10 13 31 49,821,373 IB D13Mit13 13 35 56,582,797 IB D13Mit9 13 45 81,241,701 IB D13Mit69 13 44 83,982,180 IB D13Mit75 13 59 107,259,982 IB D13Mit78 13 75 119,618,032 IB IB D14Mit1 14 3 12,201,958 IB D14Mit50 14 4 21,831,604 IB D14Mit2 14 5 22,716,706 IB D14Mit54 14 12.5 36,137,026 IB D14Mit18 14 16.5 48,436,964 IB D14Mit39 14 30 69,166,099 IB D14Mit68 14 39 72,914,117 IB D14Mit69 14 43 77,023,931 IB D14Mit42 14 52 108,073,441 I IB D14Mit36 14 63 124,975,953 IB B D15Mit13 15 6.7 3,410,212 IB D15Mit8 15 19.7 33,392,975 IB D15Mit5 15 22.2 43,279,930 IB IB D15Mit31 15 48.5 80,644,949 IB Supplemental Table 2 4 a b c c c Marker Chrom Pos (cM) Pos (bp) B6xFVB BALBxFVB D2xFVB D15Mit70 15 47.7 81,032,515 IB IB D15Mit262 15 51.1 87,111,041 IB D15Mit39 15 56.6 96,095,961 IB D15Mit16 15 61.7 102,818,436 IB IB D15Mit35 15 61.7 103,347,764 IB D16Mit32 16 1.7 3,962,915 IB I D16Mit34 16 9.61 15,913,145 IB D16Mit101 16 17 23,737,062 IB D16Mit30 16 36.5 53,962,663 IB IB IB D16Mit139 16 43.1 65,669,762 IB D16Mit19 16 54 78,812,001 IB D16Mit153 16 56.8 87,583,609 I IB D17Mit134 17 16.9 30,882,736 I D17Mit16 17 17.4 33,737,692 IB IB D17Mit21 17 18.64 34,380,179 IB D17Mit67 17 25 49,391,029 IB D17Mit6 17 31 52,743,901 IB D17Mit7 17 32.3 53,677,823 IB D17Mit93 17 44.5 74,149,996 IB D17Mit39 17 45.3 74,681,434 IB D17Mit41 17 53 84,734,943 IB D18Mit21 18 6 15,691,773 IB D18Mit14 18 18 38,829,325 IB D18Mit35 18 24 45,135,967 IB D18Mit36 18 24 46,694,501 IB D18Mit91 18 29 55,539,802 IB D18Mit48 18 50 77,046,867 IB D18Mit7 18 50 77,086,365 IB D18Mit4 18 57 84,295,656 IB D19Mit16 19 15 20,420,342 IB IB D19Mit23 19 15 20,510,387 IB D19Mit13 19 33 32,713,513 IB D19Mit11 19 41 42,469,099 IB D19Mit38 19 47 47,260,633 IB D19Mit37 19 51 51,501,173 IB D19Mit33 19 53 56,270,122 IB D19Mit6 19 55 61,132,164 IB aPosition from Mouse Genome Informatics (http://www.informatics.jax.org). bPosition from NCBI m37 build (http://www.ensembl.org). cIB, marker analyzed for both intercross and backcross; I, intercross only; B, backcross only. Supplemental Table 3: Primers used for quantitative RT-PCR Gene Product (bp) Forwarda Reversea Actb 53 CCCTGAGGCTCTTTTCCAG GGATGCCACAGGATTCCATA Gapdh 91 GCAGTGGCAAAGTGGAGATTGTTG CCGTGAGTGGAGTCATACTGGAAC Kras 63 ACTTGTGGTGGTTGGAGC TTCTGAATTAGCTGTATCG KRAS-Tg 154 GGACGAATATGATCCAACAATAGAG ACAAAGAAAGCCCTCCCCAGTC Aurka 73 GCACACACGTACCAGGAGAC CCTCTGTCACAAAGTCAGGGA Sdhc 114 ATGTTTGTGAAGTCCCTGTGT GTCCCATAGCAAGTGTCGGA Ywhaz 120 AACAGCTTTCGATGAAGCCAT TGGGTATCCGATGTCCACAAT Actg1 76 ACCAACAGCAGACTTCCAGGAT AGACTGGCAAGAAGGAGTGGTAA aAll primer sequences are written 5' to 3'. Supplemental Table 4 1
Supplemental Table 4: Haplotypes for genes within the Prs regions. Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Chromosome 2 ENSMUSG00000082997 RP23-177D21.3 114532512 114535553 3 FVB B6 B6 B6 ENSMUSG00000074931 AL845260.15 116341847 116374725 2 FVB B6 B6 B6 ENSMUSG00000081787 RP23-232J15.1 116341847 116374725 2 FVB B6 B6 B6 ENSMUSG00000081105 RP23-158L6.1 120372559 120377713 2 FVB B6 B6 B6 Sodium/potassium/calcium exchanger 5 Precursor (Na(+)/K(+)/Ca(2+)- exchange protein 5)(Solute carrier family 24 member 5) ENSMUSG00000035183 Slc24a5 124883512 124915069 17 FVB B6 B6 B6 [Source:UniProtKB/Swiss-Prot;Acc:Q8C261] ENSMUSG00000065851 U6 124928513 124938572 2 FVB B6 B6 B6 U6 spliceosomal RNA [Source:RFAM;Acc:RF00026] GA-binding protein subunit beta-1 (GABP subunit beta-1)(GABPB- 1)(GABP subunit beta-2)(GABPB-2) [Source:UniProtKB/Swiss- ENSMUSG00000027361 Gabpb1 126453175 126516746 56 FVB B6 B6 D2 Prot;Acc:Q00420] Protein CIAO1 (WD repeat-containing protein 39) ENSMUSG00000003662 Ciao1 127068133 127074206 23 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q99KN2] Astacin-like metalloendopeptidase Precursor (EC 3.4.-.-)(Oocyte ENSMUSG00000050468 Astl 127155691 127183389 56 FVB B6 B6 D2 astacin)(Ovastacin) [Source:UniProtKB/Swiss-Prot;Acc:Q6HA09] Alpha-2B adrenergic receptor (Alpha-2B adrenoreceptor)(Alpha-2B ENSMUSG00000058620 Adra2b 127188685 127193268 12 FVB B6 B6 D2 adrenoceptor) [Source:UniProtKB/Swiss-Prot;Acc:P30545] Zinc finger protein 2 (Zinc finger protein 661)(Zfp-661) ENSMUSG00000034800 Zfp661 127400368 127413083 68 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8BIQ3] Coiled-coil-helix-coiled-coil-helix domain-containing protein 5 ENSMUSG00000037938 Chchd5 128955153 128959236 17 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9CQP3] ENSMUSG00000082274 RP24-388N11.4 128968375 129001504 2 FVB B6 B6 D2 ENSMUSG00000037514 Pank2 131083651 131122865 34 FVB B6 B6 D2 pantothenate kinase 2 [Source:RefSeq peptide;Acc:NP_705721]
ENSMUSG00000048911 Rnf24 131123543 131198194 113 FVB B6 B6 D2 RING finger protein 24 [Source:UniProtKB/Swiss-Prot;Acc:Q8BGI1] ENSMUSG00000084721 RNaseP_nuc 131238559 131240779 3 FVB B6 B6 D2 Nuclear RNase P [Source:RFAM;Acc:RF00009] ENSMUSG00000081652 RP23-307O24.1 131239428 131242203 4 FVB B6 B6 D2 ENSMUSG00000083671 RP23-387C21.8 131278006 131286876 5 FVB B6 B6 D2 Spermine oxidase (EC 1.5.3.n1)(EC 1.5.3.n2)(Polyamine oxidase ENSMUSG00000027333 Smox 131314990 131351982 53 FVB B6 B6 D2 1)(PAO-1)(PAOh1) [Source:UniProtKB/Swiss-Prot;Acc:Q99K82] Prokineticin receptor 2 (PK-R2)(G-protein coupled receptor 73-like 1) ENSMUSG00000050558 Prokr2 132148315 132250354 2 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8K458] Putative uncharacterized proteinMCG60738 ; ENSMUSG00000027345 4921508D12Rik 132250354 132284036 3 FVB B6 B6 D2 [Source:UniProtKB/TrEMBL;Acc:Q9D5X9] Putative uncharacterized protein ENSMUSG00000074787 AL807386.14-1 132284036 132345015 2 FVB B6 B6 D2 [Source:UniProtKB/TrEMBL;Acc:Q3UUT4] Putative glycerophosphodiester phosphodiesterase 5 (EC 3.1.-.- )(Preimplantation protein 4) [Source:UniProtKB/Swiss- ENSMUSG00000027346 Prei4 132354086 132414326 27 FVB B6 B6 D2 Prot;Acc:Q8C0L9] Putative uncharacterized protein ENSMUSG00000074783 AU019990 132423204 132640049 16 FVB B6 B6 D2 [Source:UniProtKB/TrEMBL;Acc:Q3TLE0] ENSMUSG00000079027 AL807386.14-2 132445556 132463859 2 FVB B6 B6 B6 Fermitin family homolog 1 (Unc-112-related protein 1)(Kindlin-1) ENSMUSG00000027356 Fermt1 132640049 132942048 5 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:P59113] ENSMUSG00000084393 RP23-308A23.3 132754075 132942048 2 FVB B6 B6 D2 ENSMUSG00000065050 U1 132754075 132942048 2 FVB B6 B6 D2 U1 spliceosomal RNA [Source:RFAM;Acc:RF00003] ENSMUSG00000082940 RP23-26L11.1 132754075 132942048 2 FVB B6 B6 D2 ENSMUSG00000083689 RP23-26L11.2 132959312 133034463 2 FVB B6 B6 D2 Bone morphogenetic protein 2 Precursor (BMP-2)(BMP-2A) ENSMUSG00000027358 Bmp2 133302393 134180963 2 FVB B6 B6 B6 [Source:UniProtKB/Swiss-Prot;Acc:P21274] ENSMUSG00000064983 U6 133302393 134180963 2 FVB B6 B6 B6 U6 spliceosomal RNA [Source:RFAM;Acc:RF00026] Supplemental Table 4 2
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Hydroxyacid oxidase 1 (HAOX1)(EC 1.1.3.15)(Glycolate oxidase)(GOX) ENSMUSG00000027261 Hao1 134321641 134380247 44 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9WU19] Thioredoxin-related transmembrane protein 4 Precursor (Thioredoxin domain-containing protein 13) [Source:UniProtKB/Swiss- ENSMUSG00000034723 Txndc13 134415416 134471674 3 FVB B6 B6 B6 Prot;Acc:Q8C0L0] ENSMUSG00000081243 RP23-207F4.2 134554218 134563266 2 FVB B6 B6 B6 ENSMUSG00000074774 AL840635.6 134586818 134608122 2 FVB B6 B6 D2 ENSMUSG00000083879 RP23-418D21.1 134586818 134608122 2 FVB B6 B6 D2 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta-1 (EC 3.1.4.11)(Phosphoinositide phospholipase C)(Phospholipase C-beta- 1)(PLC-beta-1)(PLC-I)(PLC-154) [Source:UniProtKB/Swiss- ENSMUSG00000051177 Plcb1 134611558 135307243 538 FVB B6 B6 D2 Prot;Acc:Q9Z1B3] ENSMUSG00000082399 RP23-418D21.2 134629665 134643334 2 FVB B6 B6 B6
ENSMUSG00000039943 Plcb4 135550372 135877970 126 FVB B6 B6 D2 phospholipase C beta 4 [Source:RefSeq peptide;Acc:NP_038857] ENSMUSG00000064444 U6 135810853 135877970 2 FVB B6 B6 D2 U6 spliceosomal RNA [Source:RFAM;Acc:RF00026] LAMP family protein C20orf103 homolog Precursor ENSMUSG00000027270 6330527O06Rik 135877970 135909276 2 FVB B6 B6 B6 [Source:UniProtKB/Swiss-Prot;Acc:Q9D387] Serine/threonine-protein kinase PAK 7 (EC 2.7.11.1)(p21-activated kinase 7)(PAK-7)(p21-activated kinase 5) [Source:UniProtKB/Swiss- ENSMUSG00000039913 Pak7 135877970 136219987 16 FVB B6 B6 D2 Prot;Acc:Q8C015] Protein jagged-1 Precursor (Jagged1)(CD339 antigen) ENSMUSG00000027276 Jag1 136418208 137211243 3 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9QXX0] ENSMUSG00000081009 RP23-163A24.1 138665427 138772898 2 FVB B6 B6 D2 ENSMUSG00000082526 RP24-88L6.1 138665427 138772898 2 FVB B6 B6 D2 Threonine aspartase 1 (Taspase-1)(EC 3.4.25.-) [Contains Threonine aspartase subunit alpha;Threonine aspartase subunit beta] ENSMUSG00000039033 Tasp1 139659161 139900799 228 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8R1G1] MACRO domain-containing protein 2 [Source:UniProtKB/Swiss- ENSMUSG00000068205 Macrod2 140212190 142218933 3855 FVB B6 B6 D2 Prot;Acc:Q3UYG8] kinesin family member 16B [Source:RefSeq ENSMUSG00000038844 Kif16b 142444056 142728991 650 FVB B6 B6 D2 peptide;Acc:NP_001074602] Destrin (Actin-depolymerizing factor)(ADF)(Sid 23) ENSMUSG00000015932 Dstn 143736394 143770171 33 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9R0P5] ribosome binding protein 1 isoform b [Source:RefSeq ENSMUSG00000027422 Rrbp1 143771517 143839069 111 FVB B6 B6 D2 peptide;Acc:NP_598329] ENSMUSG00000027423 Snx5 144075853 144104942 23 FVB B6 B6 D2 Sorting nexin-5 [Source:UniProtKB/Swiss-Prot;Acc:Q9D8U8] Transcription factor Ovo-like 2 (mOvo2)(Zinc finger protein 339)(Zinc finger OVO2)(Zinc finger protein mOVO) [Source:UniProtKB/Swiss- ENSMUSG00000037279 Ovol2 144129205 144158190 36 FVB B6 B6 D2 Prot;Acc:Q8CIV7]
Cysteine-rich protein 2-binding protein (CSRP2-binding protein)(CRP2- ENSMUSG00000027425 Csrp2bp 144179654 144233720 68 FVB B6 B6 D2 binding partner)(CRP2BP) [Source:UniProtKB/Swiss-Prot;Acc:Q8CID0] Putative uncharacterized protein ENSMUSG00000074755 AL808119.6 144274279 144293817 19 FVB B6 B6 D2 [Source:UniProtKB/TrEMBL;Acc:Q3UVL2] ENSMUSG00000083674 RP23-70J9.1 144289372 144292801 11 FVB B6 B6 D2 Ankyrin repeat-containing protein C20orf12 homolog ENSMUSG00000037259 6330439K17Rik 144295132 144353555 160 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8C008] DNA-directed RNA polymerase III subunit RPC6 (RNA polymerase III subunit C6)(DNA-directed RNA polymerase III subunit F) ENSMUSG00000027427 Polr3f 144352774 144367934 20 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q921X6] Supplemental Table 4 3
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Putative hydrolase RBBP9 (EC 3.-.-.-)(Retinoblastoma-binding protein 9)(RBBP-9)(B5T overexpressed gene protein)(Protein BOG) ENSMUSG00000027428 Rbbp9 144367934 144390694 43 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:O88851] Protein transport protein Sec23B (SEC23-related protein B) ENSMUSG00000027429 Sec23b 144376479 144416870 84 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9D662] hypothetical protein LOC228715 [Source:RefSeq ENSMUSG00000074754 Gm561 144417695 144421174 6 FVB B6 B6 D2 peptide;Acc:NP_001028469] D-tyrosyl-tRNA(Tyr) deacylase 1 (EC 3.1.-.-) [Source:UniProtKB/Swiss- ENSMUSG00000027430 Dtd1 144425313 144607076 237 FVB B6 B6 D2 Prot;Acc:Q9DD18] ENSMUSG00000084306 RP23-367O15.1 144578636 144586640 5 FVB B6 B6 D2 ENSMUSG00000082858 RP23-281P6.2 144751253 144762609 2 FVB B6 B6 D2
Sodium/potassium/calcium exchanger 3 Precursor (Na(+)/K(+)/Ca(2+)- ENSMUSG00000063873 Slc24a3 144983861 145471387 1443 FVB B6 B6 D2 exchange protein 3) [Source:UniProtKB/Swiss-Prot;Acc:Q99PD7] NTF2-related export protein 1 [Source:UniProtKB/Swiss- ENSMUSG00000036992 Nxt1 148495841 148509889 2 FVB B6 B6 B6 Prot;Acc:Q9QZV9] ENSMUSG00000079881 AL928638.7 148515436 148521406 2 FVB B6 B6 D2 Napb protein [Source:UniProtKB/TrEMBL;Acc:Q05DE5] Monoacylglycerol lipase ABHD12 (EC 3.1.1.23)(2-arachidonoylglycerol hydrolase)(Abhydrolase domain-containing protein 12) ENSMUSG00000032046 Abhd12 150639619 150909781 3 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q99LR1] DNA replication complex GINS protein PSF1 (GINS complex subunit 1) ENSMUSG00000027454 Gins1 150725268 150909781 2 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9CZ15] ENSMUSG00000082341 RP23-193L22.2 150725268 150909781 2 FVB B6 B6 D2 ENSMUSG00000068115 4930519N13Rik 150725268 150909781 2 FVB B6 B6 D2 Ninein-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6ZQ12] ENSMUSG00000084264 RP23-193L22.4 150725268 150909781 2 FVB B6 B6 D2 ENSMUSG00000082375 RP23-193L22.5 150725268 150909781 2 FVB B6 B6 D2 N-acylneuraminate-9-phosphatase (EC 3.1.3.29)(Neu5Ac-9- Pase)(Haloacid dehalogenase-like hydrolase domain-containing protein ENSMUSG00000053916 Nanp 150725268 150909781 2 FVB B6 B6 D2 4) [Source:UniProtKB/Swiss-Prot;Acc:Q9CPT3] ENSMUSG00000083097 RP23-244H7.4 153648245 153655765 2 FVB B6 B6 B6 Sperm-associated antigen 4-like protein [Source:UniProtKB/Swiss- ENSMUSG00000027480 Spag4l 153670493 153700837 7 FVB B6 B6 D2 Prot;Acc:Q9DA32] Long palate, lung and nasal epithelium carcinoma-associated protein 1 ENSMUSG00000027485 U46068 154010764 154046637 116 FVB B6 B6 D2 Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q61114] long palate lung and nasal epithelium protein 5 [Source:RefSeq ENSMUSG00000038572 BC018465 154049021 154066637 32 FVB B6 B6 D2 peptide;Acc:NP_659139]
Retinoblastoma-like protein 1 (PRB1)(107 kDa retinoblastoma- ENSMUSG00000027641 Rbl1 156971026 157031108 68 FVB B6 B6 D2 associated protein)(p107) [Source:UniProtKB/Swiss-Prot;Acc:Q64701] Uncharacterized protein KIAA1755 homolog [Source:UniProtKB/Swiss- ENSMUSG00000037813 D630003M21Rik 158007764 158083111 69 FVB B6 B6 D2 Prot;Acc:Q8BWG4] Protein phosphatase 1 regulatory inhibitor subunit 16B (TGF-beta- inhibited membrane-associated protein)(CAAX box protein TIMAP) ENSMUSG00000037754 Ppp1r16b 158490862 158591323 93 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8VHQ3] Alpha-tocopherol transfer protein-like [Source:UniProtKB/Swiss- ENSMUSG00000017679 Ttpal 163405107 163462663 2 FVB B6 B6 B6 Prot;Acc:Q9D3D0] ENSMUSG00000040132 Svs2 164054225 164070013 2 FVB B6 B6 D2 semenogelin I [Source:RefSeq peptide;Acc:NP_059086] Seminal vesicle secretory protein 6 Precursor (Seminal vesicle secretory protein VI)(SVS VI)(Seminal vesicle protein 6)(SVSP99) ENSMUSG00000017000 Svs6 164142295 164144472 13 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q64356] ENSMUSG00000078944 AL590429.9 164147305 164158246 2 FVB B6 B6 D2 WAP four-disulfide core domain 13 [Source:RefSeq ENSMUSG00000067704 Wfdc13 164509119 164513985 2 FVB B6 B6 FVB peptide;Acc:NP_001012722] Supplemental Table 4 4
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Kunitz-type protease inhibitor 4 Precursor (Epididymal trypsin inhibitor ENSMUSG00000017310 Spint4 164517775 164528444 2 FVB B6 B6 FVB Spint4) [Source:UniProtKB/Swiss-Prot;Acc:Q9D263] ENSMUSG00000074593 RP23-370H21.10 164528444 164544198 5 FVB B6 B6 FVB KUNITZ5 [Source:RefSeq peptide;Acc:NP_001035144] WAP four-disulfide core domain 3 [Source:RefSeq ENSMUSG00000076434 Wfdc3 164554337 164604260 7 FVB B6 B6 FVB peptide;Acc:NP_082237] Putative uncharacterized proteinMCG17500, isoform CRA_c ; ENSMUSG00000039951 AL591127.12 164566067 164604260 2 FVB B6 B6 FVB [Source:UniProtKB/TrEMBL;Acc:Q9DAB2]
Deoxynucleotidyltransferase terminal-interacting protein 1 (Terminal deoxynucleotidyltransferase-interacting factor 1)(TdT-interacting factor ENSMUSG00000017299 Dnttip1 164566067 164604260 2 FVB B6 B6 FVB 1)(TdIF1) [Source:UniProtKB/Swiss-Prot;Acc:Q99LB0] Ubiquitin-conjugating enzyme E2 C (EC 6.3.2.19)(Ubiquitin-protein ligase C)(Ubiquitin carrier protein C)(UbcH10) ENSMUSG00000001403 Ube2c 164566067 164604260 2 FVB B6 B6 FVB [Source:UniProtKB/Swiss-Prot;Acc:Q9D1C1] Troponin C, skeletal muscle (STNC) [Source:UniProtKB/Swiss- ENSMUSG00000017300 Tnnc2 164566067 164623643 4 FVB B6 B6 FVB Prot;Acc:P20801] sorting nexin family member 21 [Source:RefSeq ENSMUSG00000050373 Snx21 164604924 164623643 2 FVB B6 B6 FVB peptide;Acc:NP_598685] ENSMUSG00000081758 RP23-138C10.2 165489830 165506096 2 FVB B6 B6 FVB Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1 protein (PtdIns(3,4,5)-dependent Rac exchanger 1)(P-Rex1) ENSMUSG00000039621 Prex1 166390920 166555643 245 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q69ZK0] Prostacyclin synthase (EC 5.3.99.4)(Prostaglandin I2 synthase) ENSMUSG00000017969 Ptgis 166991685 167091442 6 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:O35074] ENSMUSG00000083661 RP23-105M23.3 167091442 167173366 2 FVB B6 B6 D2 Beta-1,4-galactosyltransferase 5 (Beta-1,4-GalTase 5)(Beta4Gal- T5)(b4Gal-T5)(EC 2.4.1.-)(UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 5)(UDP-Gal:beta-GlcNAc beta-1,4- galactosyltransferase 5)(Beta-1,4-GalT II) [Source:UniProtKB/Swiss- ENSMUSG00000017929 B4galt5 167091442 167199217 3 FVB B6 B6 D2 Prot;Acc:Q9JMK0] Sodium/hydrogen exchanger 8 (Na(+)/H(+) exchanger 8)(NHE- 8)(Solute carrier family 9 member 8) [Source:UniProtKB/Swiss- ENSMUSG00000039463 Slc9a8 167230694 167306004 28 FVB B6 B6 D2 Prot;Acc:Q8R4D1] spermatogenesis associated 2 [Source:RefSeq ENSMUSG00000047030 Spata2 167306898 167332533 3 FVB B6 B6 FVB peptide;Acc:NP_739562] RING finger protein 114 (Zinc finger protein 313) ENSMUSG00000006418 Rnf114 167307694 167341682 6 FVB B6 B6 FVB [Source:UniProtKB/Swiss-Prot;Acc:Q9ET26] ENSMUSG00000082687 RP23-118A2.4 167356512 167360975 2 FVB B6 B6 FVB Zinc finger protein SNAI1 (Protein snail homolog 1)(Protein sna) ENSMUSG00000042821 Snai1 167361599 167368790 2 FVB B6 B6 FVB [Source:UniProtKB/Swiss-Prot;Acc:Q02085] ENSMUSG00000081511 RP23-118A2.6 167397492 167672961 2 FVB B6 B6 D2 Ubiquitin-conjugating enzyme E2 variant 1 (UEV-1)(CROC-1) ENSMUSG00000078923 Ube2v1 167397492 167672961 2 FVB B6 B6 D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9CZY3] ENSMUSG00000077999 AL589870.30 167397492 167672961 2 FVB B6 B6 D2 Transmembrane protein 189 [Source:UniProtKB/Swiss- ENSMUSG00000019755 Tmem189 167397492 167672961 2 FVB B6 B6 D2 Prot;Acc:Q99LQ7]
CCAAT/enhancer-binding protein beta (C/EBP beta)(Interleukin-6- dependent-binding protein)(IL-6DBP)(Liver-enriched transcriptional ENSMUSG00000056501 Cebpb 167397492 167672961 2 FVB B6 B6 D2 activator)(LAP)(AGP/EBP) [Source:UniProtKB/Swiss-Prot;Acc:P28033] Putative uncharacterized proteinRIKEN cDNA A530013C23, isoform ENSMUSG00000006462 A530013C23Rik 167397492 167672961 2 FVB B6 B6 D2 CRA_b ; [Source:UniProtKB/TrEMBL;Acc:Q8BS38] ENSMUSG00000080415 AL772258.9-2 168884935 168887198 2 FVB B6 B6 FVB Supplemental Table 4 5
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description
1,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial Precursor (Vitamin D(3) 24-hydroxylase)(24-OHase)(EC 1.14.13.n4)(Cytochrome ENSMUSG00000038567 Cyp24a1 170296640 170326944 2 FVB B6 B6 D2 P450 24A1)(P450-CC24) [Source:UniProtKB/Swiss-Prot;Acc:Q64441]
ENSMUSG00000052033 Pfdn4 170296640 170345248 15 FVB B6 B6 D2 prefoldin 4 isoform 2 [Source:RefSeq peptide;Acc:NP_001013387] ENSMUSG00000080955 RP23-255A6.1 170763011 170786507 2 FVB B6 B6 B6 Cerebellin-4 Precursor (Cerebellin-like glycoprotein 1) ENSMUSG00000067578 Cbln4 171861100 171881920 6 FVB B6 B6 B6 [Source:UniProtKB/Swiss-Prot;Acc:Q8BME9] Transmembrane protein C20orf108 homolog [Source:UniProtKB/Swiss- ENSMUSG00000027495 2010011I20Rik 172171121 172182665 7 FVB B6 B6 B6 Prot;Acc:Q9D8B6] Serine/threonine-protein kinase 6 (EC 2.7.11.1)(Aurora kinase A)(Aurora-A)(Aurora family kinase 1)(Aurora/IPL1-related kinase 1)(Ipl1- and aurora-related kinase 1)(Serine/threonine-protein kinase Ayk1) ENSMUSG00000027496 Aurka 172176909 172196103 34 FVB B6 B6 B6 [Source:UniProtKB/Swiss-Prot;Acc:P97477] Cleavage stimulation factor 50 kDa subunit (CSTF 50 kDa subunit)(CF- 1 50 kDa subunit)(CstF-50) [Source:UniProtKB/Swiss- ENSMUSG00000027498 Cstf1 172196141 172208037 23 FVB B6 B6 B6 Prot;Acc:Q99LC2] Cas scaffolding protein family member 4 [Source:UniProtKB/Swiss- ENSMUSG00000074570 Cass4 172218095 172263713 26 FVB B6 B6 B6 Prot;Acc:Q08EC4] UPF0549 protein C20orf43 homolog [Source:UniProtKB/Swiss- ENSMUSG00000027502 2410001C21Rik 172265935 172294628 59 FVB B6 B6 B6 Prot;Acc:Q99K95] Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N- acetylglucosaminyltransferase 7 (EC 2.4.1.-) [Source:UniProtKB/Swiss- ENSMUSG00000074569 Gcnt7 172274047 172284940 17 FVB B6 B6 B6 Prot;Acc:Q3V3K7] hypothetical protein LOC76426 [Source:RefSeq ENSMUSG00000027505 1700029J11Rik 172297196 172299909 5 FVB B6 B6 B6 peptide;Acc:NP_083884] ENSMUSG00000070497 AL833787.8 172332629 172336446 2 FVB B6 B6 B6 ENSMUSG00000081344 RP23-228E2.8 172332629 172336446 2 FVB B6 B6 B6 Transcription factor AP-2 gamma (AP2-gamma)(Activating enhancer- binding protein 2 gamma)(AP-2.2) [Source:UniProtKB/Swiss- ENSMUSG00000028640 Tcfap2c 172363532 172385297 3 FVB B6 B6 B6 Prot;Acc:Q61312] Transcriptional repressor CTCFL (CTCF-like protein)(CTCF paralog)(CCCTC-binding factor)(Brother of the regulator of imprinted ENSMUSG00000070495 Ctcfl 172918925 172945606 5 FVB B6 B6 B6 sites) [Source:UniProtKB/Swiss-Prot;Acc:A2APF3]
Chromosome 4 Elongator complex protein 1 (ELP1)(IkappaB kinase complex- associated protein)(IKK complex-associated protein) ENSMUSG00000028431 Ikbkap 56763611 56826019 76 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q7TT37] Tyrosine-protein phosphatase non-receptor type 3 (EC 3.1.3.48) ENSMUSG00000038764 Ptpn3 57188912 57442782 48 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:A2ALK8] ENSMUSG00000038729 Palm2 57442782 57957017 89 FVB B6 BALB D2 Paralemmin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q8BR92] Putative uncharacterized protein ENSMUSG00000073846 AL840629.24-1 57746766 57900952 2 FVB B6 BALB BALB [Source:UniProtKB/TrEMBL;Acc:Q3U5D4] ENSMUSG00000064752 U6 57746766 57900952 2 FVB B6 BALB BALB U6 spliceosomal RNA [Source:RFAM;Acc:RF00026] hypothetical protein LOC242484 [Source:RefSeq ENSMUSG00000052117 D630039A03Rik 57900952 57957017 2 FVB B6 BALB BALB peptide;Acc:NP_848842] Thioredoxin (Trx)(ATL-derived factor)(ADF) [Source:UniProtKB/Swiss- ENSMUSG00000028367 Txn1 57900952 58302787 3 FVB B6 BALB BALB Prot;Acc:P10639] Muscle, skeletal receptor tyrosine protein kinase Precursor (EC 2.7.10.1)(Muscle-specific kinase receptor)(MuSK) ENSMUSG00000057280 Musk 57957017 58390581 35 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q61006] Supplemental Table 4 6
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Proteasome-associated protein ECM29 homolog (Ecm29) ENSMUSG00000050812 AI314180 58810820 58926407 86 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PDI5] Regulator of differentiation 1 (Rod1) [Source:UniProtKB/Swiss- ENSMUSG00000028382 Rod1 59457410 59713470 3 FVB B6 BALB BALB Prot;Acc:Q8BHD7] ENSMUSG00000080831 RP23-286H14.4 59502644 59713470 2 FVB B6 BALB BALB ENSMUSG00000046145 AL824704.27 59502644 59713470 2 FVB B6 BALB BALB Hydroxysteroid dehydrogenase-like protein 2 (EC 1.-.-.-) ENSMUSG00000028383 Hsdl2 59502644 59713470 2 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q2TPA8] Uncharacterized protein KIAA1958 homolog [Source:UniProtKB/Swiss- ENSMUSG00000045071 E130308A19Rik 59502644 59808325 4 FVB B6 BALB D2 Prot;Acc:Q8C4P0] Uncharacterized protein C9orf80 homolog [Source:UniProtKB/Swiss- ENSMUSG00000038544 1110054O05Rik 59744640 59808325 2 FVB B6 BALB FVB Prot;Acc:Q3TXT3] ENSMUSG00000028385 Snx30 59808325 59917817 43 FVB B6 BALB BALB Sorting nexin-30 [Source:UniProtKB/Swiss-Prot;Acc:Q8CE50] FK506-binding protein 15 (FK506-binding protein 133) ENSMUSG00000066151 Fkbp15 61889501 62102990 3 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P9Q6] High affinity copper uptake protein 1 (Copper transporter 1)(CTR1)(Solute carrier family 31 member 1) [Source:UniProtKB/Swiss- ENSMUSG00000066150 Slc31a1 62007126 62102990 2 FVB B6 BALB BALB Prot;Acc:Q8K211] Anaphase-promoting complex subunit CDC26 (Cell division cycle ENSMUSG00000066149 Cdc26 62007126 62102990 2 FVB B6 BALB BALB protein 26 homolog) [Source:UniProtKB/Swiss-Prot;Acc:Q99JP4] U4/U6 small nuclear ribonucleoprotein Prp4 (U4/U6 snRNP 60 kDa protein)(WD splicing factor Prp4) [Source:UniProtKB/Swiss- ENSMUSG00000066148 Prpf4 62007126 62102990 2 FVB B6 BALB BALB Prot;Acc:Q9DAW6]
ENSMUSG00000063851 Rnf183 62007126 62102990 2 FVB B6 BALB BALB RING finger protein 183 [Source:UniProtKB/Swiss-Prot;Acc:Q8QZS5]
WD repeat-containing protein 31 (Spermatid WD repeat-containing ENSMUSG00000028391 Wdr31 62102990 62270012 2 FVB B6 BALB BALB protein)(spWD) [Source:UniProtKB/Swiss-Prot;Acc:Q9JHB4] B box and SPRY domain-containing protein [Source:UniProtKB/Swiss- ENSMUSG00000028392 Bspry 62102990 62270012 2 FVB B6 BALB BALB Prot;Acc:Q80YW5] Haloacid dehalogenase-like hydrolase domain-containing protein 3 ENSMUSG00000038422 Hdhd3 62102990 62270012 2 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9CYW4] Delta-aminolevulinic acid dehydratase (ALADH)(EC 4.2.1.24)(Porphobilinogen synthase) [Source:UniProtKB/Swiss- ENSMUSG00000028393 Alad 62102990 62270012 2 FVB B6 BALB BALB Prot;Acc:P10518] DNA polymerase epsilon subunit 3 (DNA polymerase II subunit 3)(EC 2.7.7.7)(DNA polymerase epsilon subunit p17)(YB-like protein 1)(YBL1)(NF-YB-like protein) [Source:UniProtKB/Swiss- ENSMUSG00000028394 Pole3 62102990 62270012 2 FVB B6 BALB BALB Prot;Acc:Q9JKP7] hypothetical protein LOC214106 [Source:RefSeq ENSMUSG00000058046 4933430I17Rik 62102990 62270012 2 FVB B6 BALB BALB peptide;Acc:NP_808275] Regulator of G-protein signaling 3 (RGS3)(C2PA) ENSMUSG00000059810 Rgs3 62102990 62365432 21 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9DC04]
ENSMUSG00000028358 Zfp618 62623556 62803041 82 FVB B6 BALB D2 Zinc finger protein 618 [Source:UniProtKB/Swiss-Prot;Acc:Q80YY7] Collagen alpha-1(XXVII) chain Precursor [Source:UniProtKB/Swiss- ENSMUSG00000045672 Col27a1 62863665 62997651 125 FVB B6 BALB D2 Prot;Acc:Q5QNQ9] ENSMUSG00000070102 mmu-mir-455 62916122 62920029 2 FVB B6 BALB B6 mmu-mir-455 [Source:miRBase;Acc:MI0004679] Alpha-1-acid glycoprotein 2 Precursor (AGP 2)(Orosomucoid-2)(OMD ENSMUSG00000061540 Orm2 63023464 63027820 6 FVB B6 BALB BALB 2) [Source:UniProtKB/Swiss-Prot;Acc:P07361] ENSMUSG00000039137 Whrn 63075274 63165153 45 FVB B6 BALB D2 Whirlin [Source:UniProtKB/Swiss-Prot;Acc:Q80VW5] Putative uncharacterized protein ENSMUSG00000073821 8030463A06Rik 63632999 63812861 40 FVB B6 BALB D2 [Source:UniProtKB/TrEMBL;Acc:Q8CCG2] Supplemental Table 4 7
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description
Pappalysin-1 Precursor (EC 3.4.24.79)(Pregnancy-associated plasma protein A)(PAPP-A)(Insulin-like growth factor-dependent IGF-binding protein 4 protease)(IGF-dependent IGFBP-4 protease)(IGFBP-4ase) ENSMUSG00000028370 Pappa 64643328 65047572 18 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8R4K8]
ENSMUSG00000028373 Astn2 64961021 66080520 122 FVB B6 BALB D2 Astrotactin-2 Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q80Z10] ENSMUSG00000083087 RP24-371A24.1 67569444 68336043 2 FVB B6 BALB B6 ENSMUSG00000064762 U1 67569444 68336043 2 FVB B6 BALB B6 U1 spliceosomal RNA [Source:RFAM;Acc:RF00003] ENSMUSG00000081231 Tcp1-ps1 67569444 68336043 2 FVB B6 BALB B6 Deleted in bladder cancer protein 1 homolog Precursor (Protein FAM5A)(BMP/retinoic acid-inducible neural-specific protein 1) ENSMUSG00000028351 Dbc1 68336043 68617801 3 FVB B6 BALB B6 [Source:UniProtKB/Swiss-Prot;Acc:Q920P3] ENSMUSG00000082553 RP24-387A5.1 68938181 69126958 2 FVB B6 BALB BALB ENSMUSG00000061015 AL845317.7-1 69265383 69559424 3 FVB B6 BALB D2 ENSMUSG00000080879 RP23-222K9.1 69265383 69559424 3 FVB B6 BALB D2 Receptor-type tyrosine-protein phosphatase delta Precursor (Protein- tyrosine phosphatase delta)(R-PTP-delta)(EC 3.1.3.48) ENSMUSG00000028399 Ptprd 75496940 77865293 1486 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q64487] ENSMUSG00000083496 RP23-57L17.1 78967332 78986533 2 FVB B6 BALB BALB Multiple PDZ domain protein (Multi-PDZ domain protein 1) ENSMUSG00000028402 Mpdz 80924245 81101600 238 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8VBX6] Nuclear factor 1 B-type (Nuclear factor 1/B)(NF1-B)(NFI-B)(NF- I/B)(CCAAT-box-binding transcription factor)(CTF)(TGGCA-binding ENSMUSG00000008575 Nfib 81939513 82352240 235 FVB B6 BALB D2 protein) [Source:UniProtKB/Swiss-Prot;Acc:P97863] Probable palmitoyltransferase ZDHHC21 (EC 2.3.1.-)(Zinc finger DHHC domain-containing protein 21)(DHHC-21)(GABA-A receptor- associated membrane protein 3) [Source:UniProtKB/Swiss- ENSMUSG00000028403 Zdhhc21 82450667 82512437 80 FVB B6 BALB BALB Prot;Acc:Q9D270] Cerberus Precursor (Cerberus-related protein)(Cerberus-like ENSMUSG00000038192 Cer1 82525124 82608286 13 FVB B6 BALB BALB protein)(Cer-l) [Source:UniProtKB/Swiss-Prot;Acc:O55233] Tetratricopeptide repeat protein 39B (TPR repeat protein 39B) ENSMUSG00000038172 Ttc39b 82866172 82972223 128 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8BYY4] ENSMUSG00000064951 U6 82930115 82937084 2 FVB B6 BALB BALB U6 spliceosomal RNA [Source:RFAM;Acc:RF00026] hypothetical protein LOC320226 [Source:RefSeq ENSMUSG00000052407 4930473A06Rik 83164330 83516533 143 FVB B6 BALB BALB peptide;Acc:NP_001074481] Endophilin-A1 (Endophilin-1)(SH3 domain-containing GRB2-like protein 2)(SH3 domain protein 2A)(SH3p4) [Source:UniProtKB/Swiss- ENSMUSG00000028488 Sh3gl2 84849993 85290506 577 FVB B6 BALB D2 Prot;Acc:Q62420] ADAMTS-like protein 1 Precursor (Punctin-1) [Source:UniProtKB/Swiss- ENSMUSG00000066113 Adamtsl1 85690444 86074895 515 FVB B6 BALB D2 Prot;Acc:Q8BLI0] hypothetical protein LOC75811 [Source:RefSeq ENSMUSG00000028492 Fam154a 86083145 86204533 72 FVB B6 BALB D2 peptide;Acc:NP_001074565] Adipophilin (Adipose differentiation-related protein)(ADRP) ENSMUSG00000028494 Adfp 86302404 86317031 9 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:P43883] DENN/MADD domain containing 4C [Source:RefSeq ENSMUSG00000038024 Dennd4c 86381855 86503501 58 FVB B6 BALB D2 peptide;Acc:NP_001074483] ENSMUSG00000082969 RP23-236D1.1 86454667 86468006 3 FVB B6 BALB BALB Alkaline ceramidase 2 (Alkaline CDase 2)(AlkCDase 2)(maCER2)(EC 3.5.1.23)(N-acylsphingosine amidohydrolase 3-like)(Acylsphingosine deacylase 3-like)(Cancer-related gene liver 1 protein)(CRG-L1) ENSMUSG00000038007 Acer2 86511630 86568620 29 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q8VD53] Supplemental Table 4 8
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description solute carrier family 24 (sodium/potassium/calcium exchanger), ENSMUSG00000037996 Slc24a2 86611125 86883055 243 FVB B6 BALB D2 member 2 isoform 1 [Source:RefSeq peptide;Acc:NP_766014] Uncharacterized protein KIAA1797 [Source:UniProtKB/Swiss- ENSMUSG00000038368 BC057079 87740342 88057127 241 FVB B6 BALB D2 Prot;Acc:A2AKG8] Protein tyrosine phosphatase-like protein PTPLAD2 (Protein-tyrosine phosphatase-like A domain-containing protein 2) ENSMUSG00000028497 Ptplad2 88041708 88086309 76 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:A2AKM2]
ENSMUSG00000073812 Ifna14 88199946 88237259 3 FVB B6 BALB D2 alpha-interferon precursor [Source:RefSeq peptide;Acc:NP_996753] ENSMUSG00000080964 RP23-67C1.3 88203716 88237259 2 FVB B6 BALB B6 Interferon alpha-9 Precursor [Source:UniProtKB/Swiss- ENSMUSG00000078644 Ifna9 88203716 88238304 3 FVB B6 BALB D2 Prot;Acc:P09235] ENSMUSG00000081784 RP23-139P14.2 88292757 88322640 2 FVB B6 BALB BALB ENSMUSG00000078355 RP23-139P14.3 88292757 88325219 3 FVB B6 BALB D2 interferon alpha 6T [Source:RefSeq peptide;Acc:NP_996750] interferon alpha family, gene B precursor [Source:RefSeq ENSMUSG00000078353 Ifnab 88333297 88340148 4 FVB B6 BALB D2 peptide;Acc:NP_032362] Interferon alpha-11 Precursor (IFN-alpha 11)(Limitin) ENSMUSG00000070906 Ifna11 88465383 88467430 8 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q61716] Interferon alpha-6 Precursor (Interferon alpha-8) ENSMUSG00000078641 Ifna6 88473027 88474291 9 FVB B6 BALB FVB [Source:UniProtKB/Swiss-Prot;Acc:P07350] Interferon alpha-5 Precursor [Source:UniProtKB/Swiss- ENSMUSG00000076440 Ifna5 88481386 88483696 4 FVB B6 BALB D2 Prot;Acc:P07349] ENSMUSG00000080756 RP24-90P24.1 90015788 90028258 4 FVB B6 BALB B6 ENSMUSG00000081876 RP23-438P13.2 90787956 90906604 2 FVB B6 BALB FVB ELAV-like protein 2 (Hu-antigen B)(HuB)(ELAV-like neuronal protein 1)(Nervous system-specific RNA-binding protein Mel-N1) ENSMUSG00000008489 Elavl2 90906604 91069069 67 FVB B6 BALB FVB [Source:UniProtKB/Swiss-Prot;Acc:Q60899] ENSMUSG00000083377 RP23-181N6.1 91030675 91032876 2 FVB B6 BALB FVB ENSMUSG00000049494 AL805956.22-1 91462394 91531128 2 FVB B6 BALB B6 ENSMUSG00000081204 RP23-239F1.2 91462394 91531128 2 FVB B6 BALB B6 ENSMUSG00000068029 AL805956.22-2 91462394 91531128 2 FVB B6 BALB B6 ENSMUSG00000080830 RP23-239F1.3 91462394 91531128 2 FVB B6 BALB B6 ENSMUSG00000083296 RP23-409N18.1 92038051 92040296 2 FVB B6 BALB B6 ENSMUSG00000081987 RP23-390P10.1 92629751 92663047 2 FVB B6 BALB B6 Angiopoietin-1 receptor Precursor (EC 2.7.10.1)(Tyrosine-protein kinase receptor TIE-2)(mTIE2)(Tyrosine-protein kinase receptor TEK)(Tunica interna endothelial cell kinase)(p140 TEK)(HYK)(STK1)(CD202b antigen) [Source:UniProtKB/Swiss- ENSMUSG00000006386 Tek 94405272 94553827 107 FVB B6 BALB D2 Prot;Acc:Q02858] FGGY carbohydrate kinase domain-containing protein (EC 2.7.1.-) ENSMUSG00000028573 Fggy 95223887 95594211 324 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:A2AJL3] cytochrome P450, family 2, subfamilyj, polypeptide 13 [Source:RefSeq ENSMUSG00000028571 Cyp2j13 95688831 95746114 11 FVB B6 BALB D2 peptide;Acc:NP_663523] ENSMUSG00000083880 RP23-80B16.2 95724575 95741196 4 FVB B6 BALB FVB cytochrome P450, family 2, subfamilyj, polypeptide 11 [Source:RefSeq ENSMUSG00000066097 Cyp2j11 95954075 96017689 4 FVB B6 BALB B6 peptide;Acc:NP_001004141] ENSMUSG00000082932 Cyp2j8 96097640 96190488 3 FVB B6 BALB FVB Cytochrome P450 2J6 (EC 1.14.14.1)(CYPIIJ6)(Arachidonic acid ENSMUSG00000052914 Cyp2j6 96138515 96246040 5 FVB B6 BALB D2 epoxygenase) [Source:UniProtKB/Swiss-Prot;Acc:O54750] Supplemental Table 4 9
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description InaD-like protein (Inadl protein)(Pals1-associated tight junction protein)(Protein associated to tight junctions)(Channel-interacting PDZ domain-containing protein) [Source:UniProtKB/Swiss- ENSMUSG00000061859 Inadl 98041333 98388845 100 FVB B6 BALB D2 Prot;Acc:Q63ZW7] KN motif and ankyrin repeat domain-containing protein 4 (Ankyrin repeat domain-containing protein 38) [Source:UniProtKB/Swiss- ENSMUSG00000035407 Kank4 98421144 98487424 92 FVB B6 BALB D2 Prot;Acc:Q6P9J5] Ubiquitin carboxyl-terminal hydrolase 1 (EC 3.1.2.15)(Ubiquitin thioesterase 1)(Ubiquitin-specific-processing protease 1)(Deubiquitinating enzyme 1) [Source:UniProtKB/Swiss- ENSMUSG00000028560 Usp1 98569374 98603111 5 FVB B6 BALB BALB Prot;Acc:Q8BJQ2] Dedicator of cytokinesis protein 7 [Source:UniProtKB/Swiss- ENSMUSG00000028556 Dock7 98603111 98788033 185 FVB B6 BALB D2 Prot;Acc:Q8R1A4] Cysteine protease ATG4C (EC 3.4.22.-)(Autophagy-related protein 4 homolog C)(Autophagin-3)(Autophagy-related cysteine endopeptidase 3)(AUT-like 3 cysteine endopeptidase) [Source:UniProtKB/Swiss- ENSMUSG00000028550 Atg4c 98860713 98926660 167 FVB B6 BALB D2 Prot;Acc:Q811C2] Putative uncharacterized protein ENSMUSG00000070892 AL627166.6 98938064 98941896 17 FVB B6 BALB D2 [Source:UniProtKB/TrEMBL;Acc:Q8C238] ENSMUSG00000084580 5S_rRNA 99290847 99348681 2 FVB B6 BALB FVB 5S ribosomal RNA [Source:RFAM;Acc:RF00001] Forkhead box protein D3 (HNF3/FH transcription factor genesis)(Hepatocyte nuclear factor 3 forkhead homolog 2)(HFH-2) ENSMUSG00000067261 Foxd3 99290847 99348681 2 FVB B6 BALB FVB [Source:UniProtKB/Swiss-Prot;Acc:Q61060] Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-)(Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase)(Asparagine-linked glycosylation protein 6) ENSMUSG00000073792 Alg6 99357678 99439052 5 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q3TAE8] EF-hand calcium binding domain 7 Fragment ENSMUSG00000073791 Efcab7 99482482 99613178 3 FVB B6 BALB D2 [Source:UniProtKB/TrEMBL;Acc:B1B0D1] ENSMUSG00000084478 U4 99573656 99613178 2 FVB B6 BALB B6 U4 spliceosomal RNA [Source:RFAM;Acc:RF00015] Phosphoglucomutase-1 (PGM 1)(EC 5.4.2.2)(Glucose phosphomutase ENSMUSG00000025791 Pgm2 99573656 99700507 6 FVB B6 BALB B6 1) [Source:UniProtKB/Swiss-Prot;Acc:Q9D0F9] Tyrosine-protein kinase transmembrane receptor ROR1 Precursor (EC 2.7.10.1)(Neurotrophic tyrosine kinase, receptor-related 1)(mROR1) ENSMUSG00000035305 Ror1 99700507 100117438 319 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9Z139] ubiquitin-conjugating enzyme E2U (putative) [Source:RefSeq ENSMUSG00000069733 Ube2u 100119239 100226259 51 FVB B6 BALB B6 peptide;Acc:NP_001028945] VWFA and cache domain-containing protein 1 Precursor (Cache domain-containing protein 1) [Source:UniProtKB/Swiss- ENSMUSG00000028532 Cachd1 100427101 100703552 236 FVB B6 BALB B6 Prot;Acc:Q6PDJ1] Ribonucleoprotein PTB-binding 2 (Protein raver-2) ENSMUSG00000035275 Raver2 100721875 100827598 6 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q7TPD6] Tyrosine-protein kinase JAK1 (EC 2.7.10.2)(Janus kinase 1)(JAK-1) ENSMUSG00000028530 Jak1 100810691 101014035 10 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:P52332] ENSMUSG00000083614 RP23-32L21.5 101032735 101065914 2 FVB B6 BALB B6 Adenylate kinase isoenzyme 4, mitochondrial (EC 2.7.4.3)(Adenylate kinase 3-like)(ATP-AMP transphosphorylase) [Source:UniProtKB/Swiss- ENSMUSG00000028527 Ak3l1 101065914 101165034 3 FVB B6 BALB D2 Prot;Acc:Q9WUR9] hypothetical protein LOC545662 [Source:RefSeq ENSMUSG00000035201 B020004J07Rik 101499114 101564193 9 FVB B6 BALB D2 peptide;Acc:NP_001028962] ENSMUSG00000081121 RP23-27H11.2 101511637 101564193 2 FVB B6 BALB FVB ENSMUSG00000081045 RP23-149D11.1 101511637 101564193 2 FVB B6 BALB FVB Supplemental Table 4 10
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Novel protein similar to Prame proteinsPutative uncharacterized protein ENSMUSG00000046133 C130073F10Rik 101511637 101581559 4 FVB B6 BALB FVB ; [Source:UniProtKB/TrEMBL;Acc:Q8C4L8] ENSMUSG00000084208 RP23-149D11.3 101564753 101581559 2 FVB B6 BALB FVB Novel protein similar to Prame proteins ENSMUSG00000037028 RP23-149D11.4 101581588 101585452 2 FVB B6 BALB FVB [Source:UniProtKB/TrEMBL;Acc:B1AUV4] hypothetical protein LOC332923 [Source:RefSeq ENSMUSG00000070890 RP23-149D11.5 101612874 101631492 3 FVB B6 BALB FVB peptide;Acc:NP_001078985] Novel protein similar to Prame proteins ENSMUSG00000078626 RP23-149D11.6 101631492 101660773 2 FVB B6 BALB BALB [Source:UniProtKB/TrEMBL;Acc:B1AUV6] hypothetical protein LOC381536 [Source:RefSeq ENSMUSG00000078625 RP23-149D11.7 101631492 101683443 4 FVB B6 BALB D2 peptide;Acc:NP_001078989] ENSMUSG00000035126 Wdr78 102710602 102804407 37 FVB B6 BALB D2 WD repeat domain 78 [Source:RefSeq peptide;Acc:NP_666366] Uncharacterized protein C1orf141 homolog [Source:UniProtKB/Swiss- ENSMUSG00000028520 4921539E11Rik 102903051 102963676 29 FVB B6 BALB B6 Prot;Acc:Q9D5Q8] ENSMUSG00000078618 AL772338.9 102963264 102984576 41 FVB B6 BALB B6 Metalloendopeptidase OMA1, mitochondrial Precursor (EC 3.4.24.-) ENSMUSG00000035069 Oma1 102986378 103039049 33 FVB B6 BALB B6 [Source:UniProtKB/Swiss-Prot;Acc:Q9D8H7] ENSMUSG00000078617 AL772393.11-2 103226680 103284180 3 FVB B6 BALB D2 ENSMUSG00000059195 AL772393.11-1 103226680 103245617 2 FVB B6 BALB B6 ENSMUSG00000082916 RP23-398D18.4 103226680 103245617 2 FVB B6 BALB B6 ENSMUSG00000028519 Dab1 103287974 104527648 956 FVB B6 BALB D2 Disabled homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:P97318] ENSMUSG00000082768 RP23-90D4.1 105771221 105771924 3 FVB B6 BALB B6 ENSMUSG00000081189 RP23-90D4.3 105803226 105821647 3 FVB B6 BALB B6 Ubiquitin carboxyl-terminal hydrolase 24 (EC 3.1.2.15) ENSMUSG00000028514 Usp24 105974725 106111467 80 FVB B6 BALB B6 [Source:UniProtKB/Swiss-Prot;Acc:B1AY13] Proprotein convertase subtilisin/kexin type 9 Precursor (EC 3.4.21.- )(Proprotein convertase PC9)(Subtilisin/kexin-like protease PC9)(Neural apoptosis-regulated convertase 1)(NARC-1) ENSMUSG00000044254 Pcsk9 106114134 106139992 21 FVB B6 BALB B6 [Source:UniProtKB/Swiss-Prot;Acc:Q80W65] ENSMUSG00000025418 Bsnd 106155705 106165112 17 FVB B6 BALB B6 Barttin [Source:UniProtKB/Swiss-Prot;Acc:Q8VIM4] 24-dehydrocholesterol reductase Precursor (EC 1.3.1.-)(3-beta- hydroxysterol delta-24-reductase) [Source:UniProtKB/Swiss- ENSMUSG00000034926 Dhcr24 106210144 106271188 4 FVB B6 BALB D2 Prot;Acc:Q8VCH6] Uncharacterized protein C1orf177 homolog [Source:UniProtKB/Swiss- ENSMUSG00000054362 BC055111 106261067 106294946 18 FVB B6 BALB D2 Prot;Acc:A2AVQ5] Tetratricopeptide repeat protein 22 (TPR repeat protein 22) ENSMUSG00000034919 Ttc22 106294946 106312802 74 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8C159] Probable prolyl-tRNA synthetase, mitochondrial Precursor (EC 6.1.1.15)(Proline--tRNA ligase)(ProRS) [Source:UniProtKB/Swiss- ENSMUSG00000043572 Pars2 106316511 106328743 5 FVB B6 BALB BALB Prot;Acc:Q8CFI5] Tetratricopeptide repeat protein 4 (TPR repeat protein 4) ENSMUSG00000025413 Ttc4 106334618 106351714 7 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8R3H9] Uncharacterized protein C1orf175 homolog [Source:UniProtKB/Swiss- ENSMUSG00000047502 Gm1027 106351714 106407399 23 FVB B6 BALB D2 Prot;Acc:A2AVR2] ENSMUSG00000034871 Fam151a 106395798 106421142 33 FVB B6 BALB D2 Protein FAM151A [Source:UniProtKB/Swiss-Prot;Acc:Q8QZW3] Acyl-coenzyme A thioesterase 11 (Acyl-CoA thioesterase 11)(EC 3.1.2. )(Acyl-CoA thioester hydrolase 11)(Brown fat-inducible thioesterase)(BFIT)(Adipose-associated thioesterase) ENSMUSG00000034853 Acot11 106415886 106478199 128 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8VHQ9] Supplemental Table 4 11
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Single-stranded DNA-binding protein 3 (Sequence-specific single- stranded-DNA-binding protein)(Lck-associated signal transducer) ENSMUSG00000061887 Ssbp3 106578089 106733728 137 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9D032] 39S ribosomal protein L37, mitochondrial Precursor (L37mt)(MRP-L37) ENSMUSG00000028622 Mrpl37 106708604 106741150 3 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q921S7] NADH-cytochrome b5 reductase-like (EC 1.6.2.2) ENSMUSG00000028621 Cyb5rl 106733728 106771438 9 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:B1AS42] Uncharacterized protein C1orf83 homolog [Source:UniProtKB/Swiss- ENSMUSG00000028619 2210012G02Rik 106806420 106865830 16 FVB B6 BALB D2 Prot;Acc:Q8R2M0] Transmembrane protein 59 Precursor (Thymic dendritic cell-derived ENSMUSG00000028618 Tmem59 106847481 106876813 4 FVB B6 BALB BALB factor 1) [Source:UniProtKB/Swiss-Prot;Acc:Q9QY73] Type I iodothyronine deiodinase (EC 1.97.1.10)(Type-I 5'- deiodinase)(Type 1 DI)(DIOI)(5DI) [Source:UniProtKB/Swiss- ENSMUSG00000034785 Dio1 106962262 106979859 34 FVB B6 BALB D2 Prot;Acc:Q61153] Protein YIPF1 (YIP1 family member 1) [Source:UniProtKB/Swiss- ENSMUSG00000057375 Yipf1 106986778 107035484 52 FVB B6 BALB D2 Prot;Acc:Q91VU1] Nucleoporin NDC1 (Transmembrane protein 48) ENSMUSG00000028614 Tmem48 107038033 107087087 66 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8VCB1] Zinc finger protein GLIS1 (GLI-similar 1)(Gli homologous protein ENSMUSG00000034762 Glis1 107097861 107308782 348 FVB B6 BALB D2 1)(GliH1) [Source:UniProtKB/Swiss-Prot;Acc:Q8K1M4] Doublesex- and mab-3-related transcription factor B1 (Doublesex- and mab-3-related transcription factor 6) [Source:UniProtKB/Swiss- ENSMUSG00000028610 Dmrtb1 107347962 107363544 6 FVB B6 BALB B6 Prot;Acc:A2A9I7] ENSMUSG00000081916 RP23-399H3.3 107352555 107363544 2 FVB B6 BALB B6 ENSMUSG00000080460 mmu-mir-1194 107364265 107372959 2 FVB B6 BALB FVB mmu-mir-1194 [Source:miRBase;Acc:MI0006299] Low-density lipoprotein receptor-related protein 8 Precursor (Apolipoprotein E receptor 2) [Source:UniProtKB/Swiss- ENSMUSG00000028613 Lrp8 107460588 107551097 72 FVB B6 BALB D2 Prot;Acc:Q924X6] Protein mago nashi homolog [Source:UniProtKB/Swiss- ENSMUSG00000028609 Magoh 107551097 107562693 2 FVB B6 BALB BALB Prot;Acc:P61327] UPF0587 protein C1orf123 homolog [Source:UniProtKB/Swiss- ENSMUSG00000028608 0610037L13Rik 107551097 107578164 3 FVB B6 BALB D2 Prot;Acc:Q8BHG2] Excitatory amino acid transporter 5 (Solute carrier family 1 member 7) ENSMUSG00000008932 Slc1a7 107637607 107689119 10 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8JZR4]
ENSMUSG00000028600 Podn 107672640 107777341 76 FVB B6 BALB D2 Podocan Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q7TQ62] Non-specific lipid-transfer protein (EC 2.3.1.176)(Propanoyl-CoA C- acyltransferase)(NSL-TP)(Sterol carrier protein 2)(SCP-2)(Sterol carrier protein X)(SCP-X)(SCP-chi)(SCPX) [Source:UniProtKB/Swiss- ENSMUSG00000028603 Scp2 107698188 107817474 94 FVB B6 BALB D2 Prot;Acc:P32020]
ENSMUSG00000034645 Zyg11a 107853677 107905395 26 FVB B6 BALB D2 Protein zyg-11 homolog A [Source:UniProtKB/Swiss-Prot;Acc:A2BFL2] Protein zyg-11 homolog B [Source:UniProtKB/Swiss- ENSMUSG00000034636 Zyg11b 107905395 108031410 6 FVB B6 BALB D2 Prot;Acc:Q3UFS0] ENSMUSG00000083957 RP23-46M23.1 107952123 108031410 2 FVB B6 BALB B6 ENSMUSG00000081734 RP23-46M23.2 107952123 108031410 2 FVB B6 BALB B6 Hcp beta-lactamase-like protein C1orf163 homolog ENSMUSG00000048351 2010305A19Rik 107952123 108031410 2 FVB B6 BALB B6 [Source:UniProtKB/Swiss-Prot;Acc:Q921H9] UPF0514 membrane protein FAM159A [Source:UniProtKB/Swiss- ENSMUSG00000059816 Fam159a 108036027 108057895 6 FVB B6 BALB D2 Prot;Acc:A2A9G7] Supplemental Table 4 12
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Glutathione peroxidase 7 Precursor (EC 1.11.1.9) ENSMUSG00000028597 Gpx7 108057895 108093318 2 FVB B6 BALB FVB [Source:UniProtKB/Swiss-Prot;Acc:Q99LJ6] ENSMUSG00000083255 RP23-46M23.6 108108895 108150455 2 FVB B6 BALB BALB zinc finger, CCHC domain containing 11 [Source:RefSeq ENSMUSG00000034610 Zcchc11 108108895 108232169 27 FVB B6 BALB D2 peptide;Acc:NP_780681] ENSMUSG00000070174 U6 108108895 108150455 2 FVB B6 BALB BALB U6 spliceosomal RNA [Source:RFAM;Acc:RF00026] Pre-mRNA-splicing factor 38A [Source:UniProtKB/Swiss- ENSMUSG00000063800 Prpf38a 108237104 108252059 14 FVB B6 BALB BALB Prot;Acc:Q4FK66] Origin recognition complex subunit 1 [Source:UniProtKB/Swiss- ENSMUSG00000028587 Orc1l 108252059 108300537 33 FVB B6 BALB D2 Prot;Acc:Q9Z1N2] Coiled-coil and C2 domain-containing protein 1B ENSMUSG00000028582 Cc2d1b 108287521 108310901 7 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q8BRN9] zinc finger, FYVE domain containing 9 [Source:RefSeq ENSMUSG00000034557 Zfyve9 108306207 108463612 75 FVB B6 BALB D2 peptide;Acc:NP_899123] Transcription factor BTF3 homolog 4 (Basic transcription factor 3-like 4) ENSMUSG00000028568 Btf3l4 108487622 108510842 11 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9CQH7] Ras-related protein Rab-3B [Source:UniProtKB/Swiss- ENSMUSG00000003411 Rab3b 108551173 108616127 76 FVB B6 BALB D2 Prot;Acc:Q9CZT8] Nardilysin Precursor (EC 3.4.24.61)(N-arginine dibasic convertase)(NRD convertase)(NRD-C) [Source:UniProtKB/Swiss- ENSMUSG00000053510 Nrd1 108666462 108740640 55 FVB B6 BALB D2 Prot;Acc:Q8BHG1] ENSMUSG00000076444 mmu-mir-761 108690160 108691171 2 FVB B6 BALB B6 mmu-mir-761 [Source:miRBase;Acc:MI0004306] Oxysterol-binding protein-related protein 9 (OSBP-related protein ENSMUSG00000028559 Osbpl9 108730417 108876670 78 FVB B6 BALB D2 9)(ORP-9) [Source:UniProtKB/Swiss-Prot;Acc:A2A8Z1] ENSMUSG00000028558 Calr4 108902706 108929618 26 FVB B6 BALB FVB calreticulin 4 [Source:RefSeq peptide;Acc:NP_001028398]
Epidermal growth factor receptor substrate 15 (Protein Eps15)(Protein ENSMUSG00000028552 Eps15 108949768 109063032 76 FVB B6 BALB D2 AF-1p) [Source:UniProtKB/Swiss-Prot;Acc:P42567] Tetratricopeptide repeat protein 39A (TPR repeat protein 39A) ENSMUSG00000028555 Ttc39a 109075649 109118365 29 FVB B6 BALB FVB [Source:UniProtKB/Swiss-Prot;Acc:A2ACP1] Uncharacterized protein C1orf185 homolog [Source:UniProtKB/Swiss- ENSMUSG00000060491 4930522H14Rik 109137216 109223798 3 FVB B6 BALB FVB Prot;Acc:Q9CPZ3] ENSMUSG00000077687 SNORA17 109187492 109223798 2 FVB B6 BALB FVB Small nucleolar RNA SNORA17 [Source:RFAM;Acc:RF00560] ENSMUSG00000082771 RP23-320F19.1 109302042 109326039 2 FVB B6 BALB FVB Putative uncharacterized protein ENSMUSG00000059027 9630013D21Rik 109302042 109330682 11 FVB B6 BALB FVB [Source:UniProtKB/TrEMBL;Acc:Q8BFV1]
ENSMUSG00000010517 Faf1 109330790 109638030 72 FVB B6 BALB FVB FAS-associated factor 1 [Source:UniProtKB/Swiss-Prot;Acc:P54731] Doublesex- and mab-3-related transcription factor A2 (Doublesex- and mab-3-related transcription factor 5) [Source:UniProtKB/Swiss- ENSMUSG00000047143 Dmrta2 109645271 109669244 3 FVB B6 BALB FVB Prot;Acc:A2A9A2] ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD)(Hu ENSMUSG00000028546 Elavl4 109876060 110033885 25 FVB B6 BALB D2 antigen D) [Source:UniProtKB/Swiss-Prot;Acc:Q61701] Cytosolic carboxypeptidase 6 (EC 3.4.17.-)(ATP/GTP-binding protein- ENSMUSG00000061298 Agbl4 110070065 111338678 548 FVB B6 BALB D2 like 4) [Source:UniProtKB/Swiss-Prot;Acc:Q09LZ8] ENSMUSG00000081813 RP23-214P11.1 110166872 110211458 2 FVB B6 BALB FVB ENSMUSG00000082348 RP23-214P11.2 110166872 110211458 2 FVB B6 BALB FVB ENSMUSG00000081068 RP23-413M16.1 110959342 110963890 4 FVB B6 BALB FVB BEN domain-containing protein 5 [Source:UniProtKB/Swiss- ENSMUSG00000028545 Bend5 111085997 111134776 53 FVB B6 BALB D2 Prot;Acc:Q8C6D4] Supplemental Table 4 13
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description Spermatogenesis-associated protein 6 Precursor (Kinesin-related ENSMUSG00000034401 Spata6 111392485 111501800 181 FVB B6 BALB FVB protein) [Source:UniProtKB/Swiss-Prot;Acc:Q3U6K5] ENSMUSG00000082686 RP23-342E4.3 111459326 111470124 2 FVB B6 BALB FVB Sodium/glucose cotransporter 4 (Na(+)/glucose cotransporter 4)(mSGLT4)(Solute carrier family 5 member 9) ENSMUSG00000028544 Slc5a9 111538451 111576666 78 FVB B6 BALB FVB [Source:UniProtKB/Swiss-Prot;Acc:Q8VDT1] Selection and upkeep of intraepithelial T-cells protein 8 Precursor (Skint ENSMUSG00000078599 Skint8 111591947 111612739 29 FVB B6 BALB FVB 8) [Source:UniProtKB/Swiss-Prot;Acc:A7XV07] Selection and upkeep of intraepithelial T-cells protein 7 Precursor (Skint ENSMUSG00000049214 Skint7 111645251 111657677 51 FVB B6 BALB FVB 7) [Source:UniProtKB/Swiss-Prot;Acc:A7XV04] ENSMUSG00000084536 7SK 111658517 111675174 2 FVB B6 BALB FVB 7SK RNA [Source:RFAM;Acc:RF00100] selection and upkeep of intraepithelial T cells 1 (Skint1), mRNA ENSMUSG00000083357 RP23-261L23.2 111682932 111694578 25 FVB B6 BALB FVB [Source:RefSeq DNA;Acc:NM_001102662] ENSMUSG00000081066 RP23-170H12.2 112377542 112378915 13 FVB B6 BALB FVB Selection and upkeep of intraepithelial T-cells protein 10 Precursor ENSMUSG00000048766 Skint10 112383004 112447859 130 FVB B6 BALB FVB (Skint-10) [Source:UniProtKB/Swiss-Prot;Acc:A7TZG1] ENSMUSG00000083384 RP23-474L1.1 113040668 113075290 16 FVB B6 BALB FVB ENSMUSG00000082559 RP23-200O20.1 113173438 113375783 3 FVB B6 BALB FVB Selection and upkeep of intraepithelial T-cells protein 5 Precursor (Skint ENSMUSG00000078598 Skint5 113406319 113672122 26 FVB B6 BALB FVB 5) [Source:UniProtKB/Swiss-Prot;Acc:A7XUY5] selection and upkeep of intraepithelial T cells 11 [Source:RefSeq ENSMUSG00000057977 Skint11 113835014 113925623 49 FVB B6 BALB FVB peptide;Acc:NP_808337] UPF0632 protein A Precursor [Source:UniProtKB/Swiss- ENSMUSG00000070867 RP23-309K20.1 114068867 114283371 351 FVB B6 BALB D2 Prot;Acc:B1ATG9]
ENSMUSG00000045268 Zfp691 118840883 118846899 12 FVB B6 BALB D2 Zinc finger protein 691 [Source:UniProtKB/Swiss-Prot;Acc:Q3TDE8] Erythroid membrane-associated protein Precursor ENSMUSG00000028644 Ermap 118848113 118870438 20 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q9JLN5] ENSMUSG00000078585 AL606975.9 118852875 118874773 15 FVB B6 BALB D2 Peptidyl-prolyl cis-trans isomerase H (PPIase H)(Rotamase H)(EC ENSMUSG00000060288 Ppih 118970013 119007003 20 FVB B6 BALB D2 5.2.1.8) [Source:UniProtKB/Swiss-Prot;Acc:Q9D868] Prefoldin subunit 6-like protein [Source:UniProtKB/Swiss- ENSMUSG00000028637 1700041C02Rik 118989675 119088318 98 FVB B6 BALB D2 Prot;Acc:Q8BVF4] zinc finger, MYND domain containing 12 [Source:RefSeq ENSMUSG00000070806 Zmynd12 119093767 119132781 13 FVB B6 BALB D2 peptide;Acc:NP_001014900] Ribosomal protein S6 modification-like protein A ENSMUSG00000048899 Rimkla 119137878 119166126 10 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PFX8] ENSMUSG00000082009 RP23-132L14.3 119174390 119176268 5 FVB B6 BALB FVB
ENSMUSG00000032998 Foxj3 119202531 119301953 60 FVB B6 BALB D2 Forkhead box protein J3 [Source:UniProtKB/Swiss-Prot;Acc:Q8BUR3] Putative uncharacterized protein Fragment ENSMUSG00000078582 AL606916.4 119400457 119545505 125 FVB B6 BALB D2 [Source:UniProtKB/TrEMBL;Acc:Q8CEV3] Transcription factor HIVEP3 (Human immunodeficiency virus type I enhancer-binding protein 3 homolog)(Kappa-B and V(D)J recombination signal sequences-binding protein)(Zinc finger protein ZAS3)(Kappa-binding protein 1)(KBP-1)(KB-binding and regognition component)(Recombinant component)(Schnurri-3) ENSMUSG00000028634 Hivep3 119476429 119811433 352 FVB B6 BALB D2 [Source:UniProtKB/Swiss-Prot;Acc:A2A884]
Endothelin-2 Precursor (ET-2)(Preproendothelin-2)(PPET2)(Vasoactive ENSMUSG00000028635 Edn2 119816694 119840205 6 FVB B6 BALB FVB intestinal contractor)(VIC) [Source:UniProtKB/Swiss-Prot;Acc:P22389] Supplemental Table 4 14
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description
ENSMUSG00000052135 Foxo6 119937270 119969423 2 FVB B6 BALB BALB Forkhead box protein O6 [Source:UniProtKB/Swiss-Prot;Acc:Q70KY4] Polycomb protein SCMH1 (Sex comb on midleg homolog 1) ENSMUSG00000000085 Scmh1 120072880 120210679 93 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q8K214] ENSMUSG00000078579 AL611924.14 120132122 120134461 3 FVB B6 BALB BALB
ENSMUSG00000047518 Slfnl1 120198096 120210679 2 FVB B6 BALB BALB Schlafen-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q8BHW9] CTP synthase 1 (EC 6.3.4.2)(UTP--ammonia ligase 1)(CTP synthetase ENSMUSG00000028633 Ctps 120211317 120245298 22 FVB B6 BALB BALB 1) [Source:UniProtKB/Swiss-Prot;Acc:P70698] Cbp/p300-interacting transactivator 4 (MSG1-related protein 2)(MRG-2) ENSMUSG00000070803 Cited4 120332559 120342858 2 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9WUL8] Potassium voltage-gated channel subfamily KQT member 4 (Voltage- gated potassium channel subunit Kv7.4)(Potassium channel subunit alpha KvLQT4)(KQT-like 4) [Source:UniProtKB/Swiss- ENSMUSG00000028631 Kcnq4 120368444 120431562 62 FVB B6 BALB BALB Prot;Acc:Q9JK97] Nuclear transcription factor Y subunit gamma (Nuclear transcription factor Y subunit C)(NF-YC)(CAAT-box DNA-binding protein subunit C) ENSMUSG00000032897 Nfyc 120418534 120513412 40 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:P70353] ENSMUSG00000065490 mmu-mir-30c-1 120441919 120444318 2 FVB B6 BALB BALB mmu-mir-30c-1 [Source:miRBase;Acc:MI0000547] ENSMUSG00000065409 mmu-mir-30e 120444318 120446944 2 FVB B6 BALB BALB mmu-mir-30e [Source:miRBase;Acc:MI0000259] Regulating synaptic membrane exocytosis protein 3 (Nim3)(Rab-3- interacting molecule 3)(RIM 3)(RIM3 gamma) [Source:UniProtKB/Swiss- ENSMUSG00000032890 Rims3 120525410 120569460 49 FVB B6 BALB BALB Prot;Acc:Q80U57]
ENSMUSG00000064141 Zfp69 120595891 120627118 11 FVB B6 BALB BALB zinc finger protein 69 [Source:RefSeq peptide;Acc:NP_001005788]
Stromal membrane-associated protein 2 (Stromal membrane- ENSMUSG00000032870 Smap2 120627118 120691835 47 FVB B6 BALB BALB associated protein 1-like) [Source:UniProtKB/Swiss-Prot;Acc:Q7TN29] Collagen alpha-2(IX) chain Precursor [Source:UniProtKB/Swiss- ENSMUSG00000028626 Col9a2 120708826 120731449 25 FVB B6 BALB BALB Prot;Acc:Q07643] ENSMUSG00000081423 RP23-227I2.4 120785977 120801169 3 FVB B6 BALB BALB ENSMUSG00000082891 RP23-227I2.5 120787905 120801169 2 FVB B6 BALB BALB ENSMUSG00000064547 7SK 120805607 120826257 2 FVB B6 BALB BALB 7SK RNA [Source:RFAM;Acc:RF00100] rearranged L-myc fusion sequence [Source:RefSeq ENSMUSG00000049878 Rlf 120805607 120906841 7 FVB B6 BALB BALB peptide;Acc:NP_001074482] ENSMUSG00000080706 RP23-144I6.2 120886764 120906841 2 FVB B6 BALB BALB hypothetical protein LOC545677 [Source:RefSeq ENSMUSG00000073764 RP23-144I6.3 120988819 121004670 10 FVB B6 BALB BALB peptide;Acc:NP_001028963] ENSMUSG00000083941 RP23-167B1.1 121046948 121055705 2 FVB B6 BALB BALB ENSMUSG00000083901 RP23-167B1.2 121046948 121055705 2 FVB B6 BALB BALB ENSMUSG00000081465 RP23-167B1.3 121046948 121055705 2 FVB B6 BALB BALB ENSMUSG00000081667 RP23-167B1.4 121065392 121069328 4 FVB B6 BALB BALB hypothetical protein LOC666921 [Source:RefSeq ENSMUSG00000078576 RP23-167B1.5 121085643 121098065 8 FVB B6 BALB BALB peptide;Acc:NP_001138420] hypothetical protein LOC666927 [Source:RefSeq ENSMUSG00000078575 RP23-350D7.1 121285925 121296484 2 FVB B6 BALB BALB peptide;Acc:NP_001092779] ENSMUSG00000083615 RP23-350D7.2 121312422 121324932 2 FVB B6 BALB BALB ENSMUSG00000073763 CU041226.8 121654637 121668867 9 FVB B6 BALB BALB ENSMUSG00000083679 RP23-346N8.2 121715036 121758568 2 FVB B6 BALB BALB ENSMUSG00000083365 RP23-402O17.1 122102783 122194027 2 FVB B6 BALB BALB ENSMUSG00000080871 RP23-132K17.4 122308513 122326261 4 FVB B6 BALB BALB Supplemental Table 4 15
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description ENSMUSG00000083109 RP23-132K17.3 122326261 122372429 7 FVB B6 BALB BALB palmitoyl-protein thioesterase-like protein [Source:RefSeq ENSMUSG00000023263 9530002B09Rik 122353591 122383201 3 FVB B6 BALB BALB peptide;Acc:NP_076354] ENSMUSG00000083494 RP23-232N16.1 122454925 122474084 13 FVB B6 BALB BALB Palmitoyl-protein thioesterase 1 Precursor (PPT-1)(EC 3.1.2.22)(Palmitoyl-protein hydrolase 1) [Source:UniProtKB/Swiss- ENSMUSG00000028657 Ppt1 122513169 122536809 37 FVB B6 BALB BALB Prot;Acc:O88531] Adenylyl cyclase-associated protein 1 (CAP 1) ENSMUSG00000028656 Cap1 122535785 122563936 30 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:P40124] Major facilitator superfamily domain-containing protein 2 ENSMUSG00000028655 Mfsd2 122613010 122643917 9 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9DA75] L-myc-1 proto-oncogene protein [Source:UniProtKB/Swiss- ENSMUSG00000028654 Mycl1 122652563 122788522 2 FVB B6 BALB BALB Prot;Acc:P10166]
tRNA isopentenyltransferase, mitochondrial Precursor (IPTase)(EC 2.5.1.8)(Isopentenyl-diphosphate:tRNA isopentenyltransferase)(IPP ENSMUSG00000028653 Trit1 122652563 122788522 2 FVB B6 BALB BALB transferase)(IPPT) [Source:UniProtKB/Swiss-Prot;Acc:Q80UN9] Bone morphogenetic protein 8B Precursor (BMP-8B) ENSMUSG00000002384 Bmp8b 122652563 122806371 3 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:P55105] Succinyl-CoA:3-ketoacid-coenzyme A transferase 2B, mitochondrial Precursor (EC 2.8.3.5)(3-oxoacid-CoA transferase 2B)(Testis-specific succinyl CoA:3-oxoacid CoA-transferase 2)(SCOT-t2) ENSMUSG00000076438 Oxct2b 122788522 122806371 2 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9ESL0] Peptidyl-prolyl cis-trans isomerase E (PPIase E)(Rotamase E)(EC 5.2.1.8)(Cyclophilin E)(Cyclophilin-33) [Source:UniProtKB/Swiss- ENSMUSG00000028651 Ppie 122788522 122841276 4 FVB B6 BALB BALB Prot;Acc:Q9QZH3] Hippocalcin-like protein 4 (Neural visinin-like protein 2)(NVP-2) ENSMUSG00000046093 Hpcal4 122841276 122941277 2 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q8BGZ1]
Cytosolic 5'-nucleotidase 1A (EC 3.1.3.5)(Cytosolic 5'-nucleotidase ENSMUSG00000054958 Nt5c1a 122841276 122941277 2 FVB B6 BALB BALB IA)(cN-IA)(cN1A) [Source:UniProtKB/Swiss-Prot;Acc:A3KFX0] Hairy/enhancer-of-split related with YRPW motif-like protein (Hairy- related transcription factor 3)(mHRT3)(Hairy and enhancer of split- ENSMUSG00000032744 Heyl 122841276 122941277 2 FVB B6 BALB BALB related protein 3) [Source:UniProtKB/Swiss-Prot;Acc:Q9DBX7] ENSMUSG00000083720 RP23-138L21.8 122841276 122941277 2 FVB B6 BALB BALB ENSMUSG00000082634 RP23-138L21.10 122943401 122966163 2 FVB B6 BALB BALB poly(A) binding protein, cytoplasmic 4 isoform 2 [Source:RefSeq ENSMUSG00000011257 Pabpc4 122943401 122979980 6 FVB B6 BALB BALB peptide;Acc:NP_683717] Bone morphogenetic protein 8A Precursor (BMP-8A)(Osteogenic ENSMUSG00000032726 Bmp8a 122980100 123025109 16 FVB B6 BALB BALB protein 2)(OP-2) [Source:UniProtKB/Swiss-Prot;Acc:P34821] Microtubule-actin cross-linking factor 1 (Actin cross-linking family 7) ENSMUSG00000028649 Macf1 123026482 123362284 185 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9QXZ0] ENSMUSG00000023075 Akirin1 123409657 123435726 8 FVB B6 BALB BALB Akirin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q99LF1] ENSMUSG00000043333 Rhbdl2 123465018 123511503 30 FVB B6 BALB BALB rhomboid protease 2 [Source:RefSeq peptide;Acc:NP_898986] Putative uncharacterized protein ENSMUSG00000073761 4933427I04Rik 123535713 123550206 10 FVB B6 BALB BALB [Source:UniProtKB/TrEMBL;Acc:Q3V053] ENSMUSG00000054304 AL606962.22-1 123575031 123602824 2 FVB B6 BALB BALB ENSMUSG00000080993 RP23-29H22.1 123575031 123602824 2 FVB B6 BALB BALB C-Myc-binding protein (Associate of Myc 1)(AMY-1) ENSMUSG00000028647 Mycbp 123575031 123602824 2 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q9EQS3] Supplemental Table 4 16
Ensembl Gene ID Gene Name First SNPa Last SNPa Num. SNP FVB/NJb C57BL/6Jb BALB/cJb DBA/2Jb Description
Ras-related GTP-binding protein C (Rag C)(RagC)(GTPase-interacting ENSMUSG00000028646 Rragc 123575031 123616146 8 FVB B6 BALB BALB protein 2)(TIB929) [Source:UniProtKB/Swiss-Prot;Acc:Q99K70] ENSMUSG00000082515 RP23-29H22.5 123602824 123605310 2 FVB B6 BALB BALB Putative uncharacterized protein ENSMUSG00000051219 3100002H09Rik 124286126 124291606 3 FVB B6 BALB BALB [Source:UniProtKB/TrEMBL;Acc:Q9CXW6] inositol polyphosphate-5-phosphatase B [Source:RefSeq ENSMUSG00000028894 Inpp5b 124414991 124479022 75 FVB B6 BALB BALB peptide;Acc:NP_032411] Metal regulatory transcription factor 1 (Transcription factor MTF- 1)(MRE-binding transcription factor) [Source:UniProtKB/Swiss- ENSMUSG00000028890 Mtf1 124479248 124530543 56 FVB B6 BALB BALB Prot;Acc:Q07243] ENSMUSG00000084526 5S_rRNA 124497878 124498349 2 FVB B6 BALB BALB 5S ribosomal RNA [Source:RFAM;Acc:RF00001] YrdC domain-containing protein, mitochondrial Precursor (Ischemia/reperfusion-inducible protein)(mIRIP) ENSMUSG00000028889 Yrdc 124522732 124534545 6 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q3U5F4] Glycoprotein endo-alpha-1,2-mannosidase-like protein (EC 3.2.1.-) ENSMUSG00000042763 Gm50 124532218 124579116 19 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q6P1J0] Ephrin type-A receptor 10 Precursor (EC 2.7.10.1) ENSMUSG00000028876 Epha10 124555111 124593562 14 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q8BYG9] Borealin (Cell division cycle-associated protein 8)(MESrg) ENSMUSG00000028873 Cdca8 124593562 124614286 12 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q8BHX3] Nucleolar GTP-binding protein 2 [Source:UniProtKB/Swiss- ENSMUSG00000028869 Gnl2 124683603 124745402 15 FVB B6 BALB BALB Prot;Acc:Q99LH1]
Axonemal dynein light intermediate polypeptide 1 (Inner dynein arm ENSMUSG00000042707 Dnali1 124732475 124745402 2 FVB B6 BALB BALB light chain, axonemal) [Source:UniProtKB/Swiss-Prot;Acc:Q8BVN8] Smad nuclear-interacting protein 1 [Source:UniProtKB/Swiss- ENSMUSG00000050213 Snip1 124732475 124753104 4 FVB B6 BALB BALB Prot;Acc:Q8BIZ6] Uncharacterized protein C1orf149 homolog [Source:UniProtKB/Swiss- ENSMUSG00000028863 2310005N01Rik 124753924 124787255 3 FVB B6 BALB BALB Prot;Acc:Q2VPQ9] ENSMUSG00000078049 AL626775.11 124769004 124787255 2 FVB B6 BALB BALB Ribonuclease ZC3H12A (EC 3.1.-.-)(Zinc finger CCCH domain- containing protein 12A)(MCP-induced protein 1) ENSMUSG00000042677 Zc3h12a 124792091 124813061 3 FVB B6 BALB BALB [Source:UniProtKB/Swiss-Prot;Acc:Q5D1E7] aSNP information from the Mouse HapMap Imputed Genotype Resource bHaplotype information: FVB, identical to FVB/NJ; B6, identical to C57BL/6J; BALB, identical to BALB/cJ; D2, identical to DBA/2J Supplemental Figure 1
FVB/NJ C57BL/6J BALB/cJ DBA/2J
110 120 130 140 150 160 170 180 Chr 2 Position (Mb)
FVB/NJ C57BL/6J BALB/cJ DBA/2J
50 60 70 80 90 100 110 120 Chr 4 Position (Mb)
Supplemental Figure 1: Haplotype analysis for Prsq1-3 and Prsq4-5 intervals.
SNP data from the Mouse HapMap Imputed Genotype Resource (http://mouse.cs.ucla.edu/mouseHapMap/) were integrated with information on the set of mouse genes from the Ensembl Biomart resource ( http://www.ensembl.org/biomart). For each gene within the Prsq1-3 (Chr 2) or Prsq4-5 (Chr 4) interval, the haplotype was determined using all of the SNPs within the gene and the two flanking SNPs. Haplotypes were assigned in the strain order listed in each map, with black vertical bars indicating a haplotype matching FVB, red indicating B6, yellow indicating BALB, and green indicating D2. The horizontal lines above the map for each strain indicate the approximate 1 LOD support intervals for the relevant crosses. Supplemental Figure 2
0.3
0.2
0.1 Kras+Ela-KRAS / Actb Kras+Ela-KRAS /
0 FVB C57BL/6 BALB/c
Supplemental Figure 2: Relative KRAS/Kras mRNA values are similar levels in FVB, B6 and BALB strains.
Real-time quantitative PCR was performed using pancreatic RNA isolated from consomic Ela-KRAS transgenic mice. Expression values were calculated as the amount of mRNA relative to beta-actin. Each dot corresponds to one animal.