DOCSLIB.ORG

Isolation, Characterisation and Cross-Species Amplification of Nuclear Microsatellites in the African Tree Genus Greenwayodendron (Annonaceae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Isolation, Characterisation and Cross-Species Amplification of Nuclear Microsatellites in the African Tree Genus Greenwayodendron (Annonaceae) Journal of Tropical Forest Science 28(2): 121–131 (2016) Piñeiro R et al. ISOLATION, CHARACTERISATION AND CROSS-SPECIES AMPLIFICATION OF NUCLEAR MICROSATELLITES IN THE AFRICAN TREE GENUS GREENWAYODENDRON (ANNONACEAE) R Piñeiro1, 2, C Micheneau1, G Dauby1 & OJ Hardy1 1Evolutionary Biology and Ecology Unit CP 160/12, Faculté des Sciences, Université Libre de Bruxelles, Av FD Roosevelt 50, B-1050 Brussels, Belgium 2Jodrell Laboratory, Royal Botanic Gardens, Kew, TW9 3DS, Richmond, Surrey, UK; [email protected] Received July 2014 PIÑEIRO R, MICHENEAU C, DAUBY G & HARDY OJ. 2016. Isolation, characterisation and cross- species amplification of nuclear microsatellites in the African tree genus Greenwayodendron (Annonaceae). Greenwayodendron is a genus of rainforest trees endemic to tropical Africa. Eight nuclear microsatellite loci, amplifiable in two multiplexed reactions, were developed in G. suaveolens and cross-amplified in the second species of the genus, G. oliveri, as well as in all subspecies and varieties recognised by current taxonomic treatments. Characterisation of the microsatellite markers in one population of G. suaveolens from Cameroon revealed polymorphism levels suitable for characterisation of the spatial genetic variation (7 to 16 alleles per locus and expected heterozygosity ranging from 0.57 to 0.89). The eight microsatellite loci optimised could help estimate genetic diversity levels in populations of G. suaveolens, G. oliveri and new local endemic species of Greenwayodendron in rainforests from western and central Africa. Keywords: Microsatellite-enriched library, next-generation sequencing, tropical trees, universal fluorescent- labelled primer INTRODUCTION Greenwayodendron (Annonaceae) is a monophyletic Tomé Island, in the Gulf of Guinea, hereafter tree genus from tropical Africa (Mols et al. 2004). referred to as G. cf. "São Tomé"). The second is Current taxonomic treatments recognise two distributed along the south-west coast of Gabon species, namely, G. oliveri in western Africa, and (hereafter referred to as G. cf. "littoral"). In this G. suaveolens with two disjoint subspecies in central study we intended to isolate and characterise and eastern Africa: G. suaveolens ssp. suaveolens the first set of nuclear microsatellite markers and G. suaveolens ssp. usambaricum respectively for G. suaveolens ssp. suaveolens var. suaveolens, (Aubréville 1959, Le Thomas 1969, Verdcourt and examine cross-amplification in all taxa 1971). In rainforests of central Africa, two taxa, within Greenwayodendron. currently considered as varieties of G. suaveolens ssp. suaveolens, are recognised, i.e. a widespread MATERIALS AND METHODS taxon, var. suaveolens, and a narrowly-distributed variety restricted to Gabon, var. gabonica. These A microsatellite library was generated by pooling two varieties may grow in sympatry, have exclusive 1 μg of genomic DNA from a single individual plastid haplotypes (Dauby et al. 2010) and display of G. suaveolens ssp. suaveolens var. suaveolens, clear morphological differences in terms of leaf and two individuals of two unrelated species and floral dimensions and pubescence of leaves with a sequencer at the Genoscreen genomic (Le Thomas 1969), suggesting that they may platform in Lille, France, following the methods deserve the status of species. In addition, based by Malausa et al. (2011) and Micheneau et al. on their divergent morphology, two putative (2011). From a total of 23,901 reads, 7789 primers new local species may exist, although they have for 846 loci containing nSSR for the three pooled not been formally described yet (G Dauby, species were designed. After discarding short personal observation). The first occurs in ãS o reads and reads containing short microsatellites, © Forest Research Institute Malaysia 121 Journal of Tropical Forest Science 28(2): 121–131 (2016) Piñeiro R et al. primers were designed automatically by & Burczyk 2009). Linkage disequilibrium tests Genoscreen genomic platform using Primer3 among pairs of loci were performed using the in the software QDD, version 2 (Meglécz et. software GENEPOP 4.1.4 (Raymond & Rousset al. 2010). Seventy-two primer pairs were tested 1995, Rousset 2008). for robust amplification and polymorphism on seven individuals from different populations RESULTS AND DISCUSSION of G. suaveolens ssp. suaveolens var. suaveolens according to Piñeiro et al. (2012). For 29 loci, All eight microsatellite loci were shown to be where faint amplifications were observed, new polymorphic within G. suaveolens ssp. suaveolens primer pairs were redesigned manually using var. suaveolens (Table 1). The number of alleles Primer3 (Rozen & Skaletsky 1999). Eight loci per locus ranged from 7 to 16, with an average were finally optimised in two multiplex reactions, of 11.2. Observed heterozygosity varied between which consistently amplified either five (GMF2) 0.55 and 0.95 (average 0.71) and expected or three loci (GMG3) (Table 1). PCR reactions heterozygosity between 0.57 and 0.90 (average were carried out in a total volume of 15 μL using 0.72). The microsatellite loci in the multiplex Qiagen multiplex kit. Fluorescent labelling was reaction, namely, PIPE3-67B and, to a lesser performed via amplification with (1) reverse extent, PIPE3-40B, exhibited slightly high null primer, (2) forward primer with a Q1–Q4 allele frequencies (9.8 and 4.2% respectively) universal sequence at the 5' end and (3) Q1 and departure from HWE due to homozygote labelled with 6-FAM, Q2 with NED, Q3 with VIC excess. Linkage disequilibrium was detected and Q4 with PET (Schuelke 2000, Micheneau between pairs of loci PIPE3-21/PIPE3-65, et al. 2011). The PCR protocol was: 7.5 μL PIPE3-21/PIPE3-72B and PIPE3-18/PIPE3-72B. multiplex PCR master mix, 0.1 μL (0.07 μM) Amplification of the two multiplexed of forward primers, and 0.15 μL (0.1 μM) of PCR reactions was tested on all taxa of the reverse primers, 0.15 μL (0.1 μM) of labelled genus Greenwayodendron (Table 2, Appendix), primers Q1, Q2, Q3 and Q4, 1.5 μL DNA (10–100 i.e. the western African species G. oliveri (13 -1 ng mL ), and H2O. Multiplex PCR programs individuals from three locations in Ivory Coast), consisted of 95 °C (15 min), followed by 20 the narrowly-distributed taxon from Gabon cycles of 94 °C (30 s), 57 °C (90 s) for GMF2 or G. suaveolens ssp. suaveolens var. gabonica (63 55 °C (180 s) for GMG3, 72°C (60 s), followed individuals largely distributed across Gabon), by 10 cycles of 94 °C (30 s), 53 °C (45 s), 72 °C the subspecies from east Africa G. suaveolens (45 s), and a final extension at 60 °C (30 min). ssp. usambarium (1 individual), the putative new PCR products were run on DNA sequencer local species from São Tomé island (3 individuals with 12 μL HiDi and 0.3 μL of size standard from one location) and from the south-west LIZ®500. The resulting electropherograms were coast of Gabon (1 individual). All eight loci were automatically scored with Genemapper 3.7 and successfully genotyped in var. gabonica (seven of manually corrected. them polymorphic), and seven loci amplified in Sixty-three individuals from a single G. oliveri (six of them polymorphic) (Table 2). population of G. suaveolens ssp. suaveolens var. Genwayodendron suaveolens ssp. usambaricum suaveolens from south-east Cameroon were was successfully genotyped for six loci and the genotyped (see Appendix). The quality of putative local species from São Tomé, G. cf. "São microsatellite markers isolated was evaluated Tomé", and from coastal Gabon, G. cf. "littoral", by calculating the allele size range, number of worked for seven and five loci respectively. alleles per locus, observed (Ho) and expected The eight microsatellite loci constituted (He) heterozygosities and inbreeding coefficient significant contribution to the genetic resources (Fis). Hardy–Weinberg equilibrium (HWE) available for the family Annonaceae. This is one tests were performed for each locus using of the major families of tropical trees in the SPAGeDi 1.4 (Hardy & Vekemans 2002). Null Neotropics and in the Old World (Couvreur et al. alleles were coded differently from missing data. 2011, Chatrou et al. 2012). Since abundance and The frequency of null alleles was estimated by species richness of Annonaceae correlate well taking into account average inbreeding of the with temperature and precipitation, this family population using the software INEst 1.0 (Chybicki provide a good proxy for tropical rainforests. To © Forest Research Institute Malaysia 122 Piñeiro R et al. Journal of Tropical Forest Science Forest Journal ofTropical Table 1 Characterisation of 8 nuclear microsatellite loci isolated from Greenwayodendron suaveolens ssp. suaveolens var. suaveolens and characterisation of polymorphisms in 63 individuals from a population in south-east Cameroon Locus name GenBank Primer sequence (5'–3') Label Repeat Ta Allele size Allele Ho He Fis Null nr F-primer* motif (°C) range nr Multiplex GMF2 28(2): 121–131(2016) PIPE3-18 KP172239 F:ACAAAATTTCATTACAGAGCCAG Q2-NED (gt)10 57 154–182 7 0.612 0.581 -0.067 0 R:AAAGTGGAATACTGCTCACAAA PIPE3-40B KP172234 F:AAAAACTAAATTTACAAGAATGCAGA Q4-PET (ga)17 57 161–181 8 0.645 0.736 0,124** 0.042 R:ACCGAGCCAAACTGAGTAGC PIPE3-65 KP172235 F:GACAATGCTAAGCGTGTGGA Q1-6-FAM (tct)18 57 238–313 10 0.556 0.568 0.023 0.002 R:AGCTGCACCAGAGAAGGATT 123 PIPE3-67B KP172236 F:GGTTTAGATTGGGCATCTTCA Q3-VIC (tct)13 57 191–251 15 0.694 0.9 0,229** 0.098 R:CCAACATGAATTTTTCGACG PIPE3-72B KP172237 F:GAAGGTCAAACCGAGCAGTC Q2-NED (ctt)11 57 194–227 11 0.746 0.705 -0.059 0 R:AACGCAGCTATTGGTAACGC Multiplex GMG3 PIPE3-03B KP172238 F:GGGATTATTCTTCATGGATTCG Q3-VIC (tc)11 55 191–217 12 0.746 0.697 -0.071 0 R:TGCATCATGATTGAACTTACCA PIPE3-21 KP172240 F:TTGGCCATTTCTACTTTGGG Q1-6-FAM (ct)11 55 152–197 16 0.952 0.893 -0.066 0 R:CCAGTGAACCATTCAACCAG PIPE3-38 KP172233 F:ACATCTTGCCATTCTTTGATTG Q2-NED (ca)12 55 212–239 11 0.714 0.724 0.013 0 R:AGTTATAGGGACAAATGTGATAGTTGG *Q1 = TGTAAAACGACGGCCAGT (Schuelke 2000), Q2 = TAGGAGTGCAGCAAGCAT, Q3 = CACTGCTTAGAGCGATGC, Q4 = CTAGTTATTGCTCAGCGGT (Q2–Q4) (Culley et al.
Load more

Recommended publications
  • (Bedd.) IM Turner (Annonaceae) and a New Variety from India
    Taiwania 62(3): 305‒310, 2017 DOI: 10.6165/tai.2017.62.305 Notes on the Taxonomic status of Polyalthia malabarica (Bedd.) I. M. Turner (Annonaceae) and a new variety from India Mohan ALISTER*, Gopalaprabhu RAJKUMAR, Ahammed NAZARUDEEN and Alagramam Govindasamy PANDURANGAN Division of Plant Systematics and Evolutionary Science, Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram district, Kerala- 695 562, India. * Corresponding author's email: [email protected] (Manuscript received 15 April 2016; accepted 28 May 2017; online published 25 July 2017) ABSTRACT: The taxonomic status of Polyalthia malabarica (Bedd.) I. M. Turner is discussed and a variety from Western Ghats of India is newly proposed with taxonomic description and illustration. KEY WORDS: Annonaceae, India, Kerala, New variety, Polyalthia malabarica var. longipedicellata. INTRODUCTION et al., 2012). Approximately 65 species were removed from the genus Polyalthia but at the same time nine The genus Polyalthia (Annonaceae) was first additions were included by merging the genus described by C. L. Blume (1830) based on type Haplostichathus as mentioned. Presently the genus specimen Polyalthia subcordata, which was collected Polyalthia comprises approximately 85 species and its from Java (Xue et al., 2012). The genus was considered distribution ranged to Austral-Asian region as one of the largest genera in paleotropical regions in (Chaowasku et al., 2012). the family Annonaceae with distribution ranging from The genus is now characterised by reticulate East Africa to Madagascar, Indian subcontinent and venation of leaves, generally with more or less South East Asia to Australia with approximately about subcordate or cordate leaf base, axillary to extra 150 species (Verdcourt, 1969; Xue et al., 2011; axillary or terminal inflorescence, 2‒6 ovules per ovary, Saunders et al., 2011).
    [Show full text]
  • Nonaceae Using Targeted Enrichment of Nuclear Genes Supplementary
    Phylogenomics of the major tropical plant family An- nonaceae using targeted enrichment of nuclear genes Thomas L.P. Couvreur1,*, Andrew J. Helmstetter1, Erik J.M. Koenen2, Kevin Bethune1, Rita D. Brand~ao3, Stefan Little4, Herv´eSauquet4,5, Roy H.J. Erkens3 1 IRD, UMR DIADE, Univ. Montpellier, Montpellier, France 2 Institute of Systematic Botany, University of Zurich, Z¨urich, Switzer- land 3 Maastricht University, Maastricht Science Programme, P.O. Box 616, 6200 MD Maastricht, The Netherlands 4 Ecologie Syst´ematiqueEvolution, Univ. Paris-Sud, CNRS, AgroParis- Tech, Universit´e-Paris Saclay, 91400, Orsay, France 5 National Herbarium of New South Wales (NSW), Royal Botanic Gardens and Domain Trust, Sydney, Australia * [email protected] Supplementary Information (see next page) 1 Supplementary Table 1. Specimen details of taxa sampled for both An- nonaceae and Piptostigmateae analyses Subfamily Tribe Species Collector number Country INDEX TAG total reads Mapped % enrichment 10x coverage mean depth Ambavioideae Cleistopholis staudii Couvreur, T.L.P. 570 Gabon I12 TAG79 1790158 402150 22 0,82 119,7 Ambavioideae Drepananthus ramuliflorus Sauquet, H. 167 Malaysia I10 TAG45 2676926 150278 6 0,66 45,1 Ambavioideae Meiocarpidium olivieranum Couvreur, T.L.P. 920 Gabon I10 TAG13 3950072 343879 9 0,80 104,3 Anaxagoreoideae Anaxagorea crassipetala Maas, P.J.M. 9408 Costa Rica I10 TAG25 2648398 256748 10 0,67 76,9 Annonoideae Annoneae Annona glabra Chatrou, L.W. 467 Peru I10 TAG36 4328486 622387 14 0,83 190,7 Annonoideae Annoneae Anonidium mannii Couvreur, T.L.P. 1053 Cameroon I04 TAG36 1613002 679049 42 0,89 206,9 Annonoideae Annoneae Boutiquea platypetala Couvreur, T.L.P.
    [Show full text]
  • Phylogenomics of the Major Tropical Plant Family Annonaceae Using Targeted Enrichment of Nuclear Genes
    bioRxiv preprint doi: https://doi.org/10.1101/440925; this version posted October 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Phylogenomics of the major tropical plant family Annonaceae using targeted enrichment of nuclear genes Thomas L.P. Couvreur1,*+, Andrew J. Helmstetter1,+, Erik J.M. Koenen2, Kevin Bethune1, Rita D. Brandão3, Stefan Little4, Hervé Sauquet4,5, Roy H.J. Erkens3 1 IRD, UMR DIADE, Univ. Montpellier, Montpellier, France 2 Institute of Systematic Botany, University of Zurich, Zürich, Switzerland 3 Maastricht University, Maastricht Science Programme, P.O. Box 616, 6200 MD Maastricht, The Netherlands 4 Ecologie Systématique Evolution, Univ. Paris-Sud, CNRS, AgroParisTech, Université-Paris Saclay, 91400, Orsay, France 5 National Herbarium of New South Wales (NSW), Royal Botanic Gardens and Domain Trust, Sydney, Australia * [email protected] + authors contributed equally Abstract Targeted enrichment and sequencing of hundreds of nuclear loci for phylogenetic reconstruction is becoming an important tool for plant systematics and evolution. Annonaceae is a major pantropical plant family with 109 genera and ca. 2450 species, occurring across all major and minor tropical forests of the world. Baits were designed by sequencing the transcriptomes of five species from two of the largest Annonaceae subfamilies. Orthologous loci were identified. The resulting baiting kit was used to reconstruct phylogenetic relationships at two different levels using concatenated and gene tree approaches: a family wide Annonaceae analysis sampling 65 genera and a species level analysis of tribe Piptostigmateae sampling 29 species with multiple individuals per species.
    [Show full text]
  • Conservation Status of the Vascular Plants in East African Rain Forests
    Conservation status of the vascular plants in East African rain forests Dissertation Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaft des Fachbereich 3: Mathematik/Naturwissenschaften der Universität Koblenz-Landau vorgelegt am 29. April 2011 von Katja Rembold geb. am 07.02.1980 in Neuss Referent: Prof. Dr. Eberhard Fischer Korreferent: Prof. Dr. Wilhelm Barthlott Conservation status of the vascular plants in East African rain forests Dissertation Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaft des Fachbereich 3: Mathematik/Naturwissenschaften der Universität Koblenz-Landau vorgelegt am 29. April 2011 von Katja Rembold geb. am 07.02.1980 in Neuss Referent: Prof. Dr. Eberhard Fischer Korreferent: Prof. Dr. Wilhelm Barthlott Early morning hours in Kakamega Forest, Kenya. TABLE OF CONTENTS Table of contents V 1 General introduction 1 1.1 Biodiversity and human impact on East African rain forests 2 1.2 African epiphytes and disturbance 3 1.3 Plant conservation 4 Ex-situ conservation 5 1.4 Aims of this study 6 2 Study areas 9 2.1 Kakamega Forest, Kenya 10 Location and abiotic components 10 Importance of Kakamega Forest for Kenyan biodiversity 12 History, population pressure, and management 13 Study sites within Kakamega Forest 16 2.2 Budongo Forest, Uganda 18 Location and abiotic components 18 Importance of Budongo Forest for Ugandan biodiversity 19 History, population pressure, and management 20 Study sites within Budongo Forest 21 3 The vegetation of East African rain forests and impact
    [Show full text]
  • Angiosperms) Julien Massoni1*, Thomas LP Couvreur2,3 and Hervé Sauquet1
    Massoni et al. BMC Evolutionary Biology (2015) 15:49 DOI 10.1186/s12862-015-0320-6 RESEARCH ARTICLE Open Access Five major shifts of diversification through the long evolutionary history of Magnoliidae (angiosperms) Julien Massoni1*, Thomas LP Couvreur2,3 and Hervé Sauquet1 Abstract Background: With 10,000 species, Magnoliidae are the largest clade of flowering plants outside monocots and eudicots. Despite an ancient and rich fossil history, the tempo and mode of diversification of Magnoliidae remain poorly known. Using a molecular data set of 12 markers and 220 species (representing >75% of genera in Magnoliidae) and six robust, internal fossil age constraints, we estimate divergence times and significant shifts of diversification across the clade. In addition, we test the sensitivity of magnoliid divergence times to the choice of relaxed clock model and various maximum age constraints for the angiosperms. Results: Compared with previous work, our study tends to push back in time the age of the crown node of Magnoliidae (178.78-126.82 million years, Myr), and of the four orders, Canellales (143.18-125.90 Myr), Piperales (158.11-88.15 Myr), Laurales (165.62-112.05 Myr), and Magnoliales (164.09-114.75 Myr). Although families vary in crown ages, Magnoliidae appear to have diversified into most extant families by the end of the Cretaceous. The strongly imbalanced distribution of extant diversity within Magnoliidae appears to be best explained by models of diversification with 6 to 13 shifts in net diversification rates. Significant increases are inferred within Piperaceae and Annonaceae, while the low species richness of Calycanthaceae, Degeneriaceae, and Himantandraceae appears to be the result of decreases in both speciation and extinction rates.
    [Show full text]
  • Is Pseudoxandra Spiritus-Sancti (Annonaceae), with Its Male and Bisexual Flowers, an Androdioecious Species?
    Filogenômica, morfologia e taxonomia na tribo Malmeeae (Malmeoideae, Annonaceae): implicações na evolução da androdioicia Phylogenomics, morphology and taxonomy in tribe Malmeeae (Malmeoideae, Annonaceae): implications on the evolution of androdioecy Jenifer de Carvalho Lopes São Paulo 2016 Filogenômica, morfologia e taxonomia na tribo Malmeeae (Malmeoideae, Annonaceae): implicações na evolução da androdioicia Phylogenomics, morphology and taxonomy in tribe Malmeeae (Malmeoideae, Annonaceae): implications on the evolution of androdioecy Jenifer de Carvalho Lopes Tese apresentada ao Instituto de Biociências da Universidade de São Paulo, para a obtenção de Título de Doutor em Ciências, na Área de Botânica. Orientador: Renato de Mello-Silva São Paulo 2016 Lopes, Jenifer de Carvalho Filogenômica, morfologia e taxonomia na tribo Malmeeae (Malmeoideae, Annonaceae): implicações na evolução da androdioicia / 98 Tese (Doutorado) – Instituto de Biociências da Universidade de São Paulo. Departamento de Botânica 1. Androdioicia. 2. Annonaceae. 3. Filogenômica. I. Universidade de São Paulo. Instituto de Biociências. Departamento de Botânica. Comissão Julgadora: ________________________ _______________________ Prof(a). Dr(a). Prof(a). Dr(a). ________________________ _______________________ Prof(a). Dr(a). Prof(a). Dr(a). ______________________ Prof. Dr. Renato de Mello-Silva Orientador Metafísica? Que metafísica têm aquelas árvores? A de serem verdes e copadas e de terem ramos E a de dar fruto na sua hora, o que não nos faz pensar, A nós, que não sabemos dar por elas. Mas que melhor metafísica que a delas, Que é a de não saber para que vivem Nem saber que o não sabem? Alberto Caeiro, heterônimo de Fernando Pessoa Trecho de Guardador de Rebanhos, poema quinto Agradecimentos Gostaria de agradecer à Universidade de São Paulo pela estrutura fornecida para o desenvolvimento da minha pesquisa e formação acadêmica.
    [Show full text]
  • A Preliminary Checklist of the Vascular Plants and a Key to Ficus of Goualougo Triangle, Nouabalé-Ndoki National Park, Republic of Congo
    A Preliminary checklist of the Vascular Plants and a key to Ficus of Goualougo Triangle, Nouabalé-Ndoki National Park, Republic of Congo. Sydney Thony Ndolo Ebika MSc Thesis Biodiversity and Taxonomy of Plants University of Edinburgh Royal Botanic Garden Edinburgh Submitted: August 2010 Cover illustration: Aptandra zenkeri, Olacaceae Specimen: Ndolo Ebika, S.T. 28 By Sydney Thony Ndolo Ebika Acknowledgments Acknowledgments The achievement of this MSc thesis in Biodiversity and Taxonomy of Plants is the result of advice, support, help and frank collaboration between different people and organizations and institutions. Without these people this thesis could not have been achieved. My deep grateful thanks go to both Dr. Moutsamboté, J.-M. ( Rural Development Institute, Marien Ngouabi University, Republic of Congo ) and Dr. Harris, D.J. (Royal Botanic Garden Edinburgh) who gave me a powerful boost in studying plants during the botanic training workshop titled Inventory and Identification they organized at Kabo, Republic of Congo, in August 2006. Especially I would like to thank Dr. Harris, because the collaboration he established with the Goualougo Triangle Ape Project, Nouabalé- Ndoki National Park (NNNP), project I was working for, and his continued support for me has been very important to my training as a botanist. The Goualougo Triangle Ape Project (GTAP) is the area where all of the specimens treated in this thesis were collected. The team of this project was always looking after me night and day from 2006 to 2009. I would like to thank both principal investigators of the Triangle both Dr. Morgan, D. and Dr. Sanz, C. for their support to me.
    [Show full text]
  • Article ISSN 1179-3163 (Online Edition)
    Phytotaxa 69: 33–56 (2012) ISSN 1179-3155 (print edition) www.mapress.com/phytotaxa/ PHYTOTAXA Copyright © 2012 Magnolia Press Article ISSN 1179-3163 (online edition) Characterization of Hubera (Annonaceae), a new genus segregated from Polyalthia and allied to Miliusa TANAWAT CHAOWASKU 1, DAVID M. JOHNSON2, RAYMOND W.J.M. VAN DER HAM1 & LARS W. CHATROU3 1Naturalis Biodiversity Center (section NHN), Leiden University, Einsteinweg 2, 2333 CC Leiden, the Netherlands; email: [email protected] 2Department of Botany-Microbiology, Ohio Wesleyan University, Delaware, Ohio 43015 USA 3Wageningen University, Biosystematics Group, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands Abstract On the basis of molecular phylogenetics, pollen morphology and macromorphology, a new genus of the tribe Miliuseae, Hubera, segregrated from Polyalthia and allied to Miliusa, is established and described. It is characterized by the combination of reticulate tertiary venation of the leaves, axillary inflorescences, a single ovule per ovary and therefore single-seeded monocarps, seeds with a flat to slightly raised raphe, spiniform(-flattened peg) ruminations of the endosperm, and pollen with a finely and densely granular infratectum. Twenty-seven species are accordingly transferred to this new genus. Key words: Malmeoideae, molecular systematics, Old World floristics, Paleotropics, palynology Introduction The large magnoliid angiosperm family Annonaceae is prominent in lowland forests across the tropics (Gentry 1988, Slik et al. 2003). Circumscription of genera within the family was initially founded on characters emphasizing the diversity of floral morphologies represented in the family, which recapitulates many trends found with angiosperm evolution at large (Johnson & Murray 1995, Endress & Doyle 2009, Endress 2011): apocarpy/syncarpy, polypetaly/sympetaly, bisexual/unisexual flowers, reductions in stamen and carpel number, and changes in ovule number.
    [Show full text]
  • INTRODUCTION Hf ATERIALS and METIIODS
    Research Journal of Rotany 3 (1): 1-8, 2008 ISSN 1816-4919 0 2008 Academic Journals Inc. I3iosystematic Studies in Annonnccae 11. Vegctntive ant! Floral ;\lorphologicnI Studies of Some Genera of Annonnccac in Nigeria A.E. Polorunso and 0. Olorode Depaitment of Botany, Obafemi Awolowo University, Ile-Ife, Osun S.zte, Nigcria Abstnct: A vegetative and floral morphological study of the species of Anncnnceae found in Nigeria was conducted in search of intergenerib chvacters that may be of tz..onornic value in the identification and classification of the species. Life plants, fruits, flo\~::rs and seeds were sludied frorn mature plants in the experimental garden. Bob q; rlitative mind quantitative characters were recorded The intergeneric relationships among ar! I between the species of Annonaceae were reported and similarly, adhtional features d: !t may be of taxonomic value in the classification and identification in the fanily are apocx>y, syncarpy, phyllotxxy, monopody, syn~pody,fruit tpand fruit shape have been provi<';.d Kcy words Vegetative, floral, interaeneric, phyllotxxy, apot:arpy, syncarpy, taxonomic INTRODUCTION Annonaceae belongs to thc class Magnolidcac in thc ordcr Magnoliales. :.labbcrley (1987), Brumrnitt (1992) and FoloruGo and Olorode (2006a) reported that the family consists of 2,050 species in 125 genera and they are found mainly in thc tropics. The economic, nutritional and me4cinal importance of the genera of Annonac; ae cannot Ix over- emphasized The fitsand seeds ofxylopia aethiopica are hot to taste and are sol -1 as a spice and as a substitute for can black pepper (Pipernig~i~n).The crushed seeds rublxL:on the forehead cure headache and neuralgia; a decoction of the fruit is used as a lotion for b.)ils and eruptions.
    [Show full text]
  • A New Subfamilial and Tribal Classification of the Pantropical Flowering Plant Family Annonaceae Informed by Molecular Phylogene
    bs_bs_banner Botanical Journal of the Linnean Society, 2012, 169, 5–40. With 1 figure A new subfamilial and tribal classification of the pantropical flowering plant family Annonaceae informed by molecular phylogenetics LARS W. CHATROU1*, MICHAEL D. PIRIE2, ROY H. J. ERKENS3,4, THOMAS L. P. COUVREUR5, KURT M. NEUBIG6, J. RICHARD ABBOTT7, JOHAN B. MOLS8, JAN W. MAAS3, RICHARD M. K. SAUNDERS9 and MARK W. CHASE10 1Wageningen University, Biosystematics Group, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands 2Department of Biochemistry, University of Stellenbosch, Stellenbosch, Private Bag X1, Matieland 7602, South Africa 3Utrecht University, Institute of Environmental Biology, Ecology and Biodiversity Group, Padualaan 8, 3584 CH, Utrecht, the Netherlands 4Maastricht Science Programme, Maastricht University, Kapoenstraat 2, 6211 KL Maastricht, the Netherlands 5Institut de Recherche pour le Développement (IRD), UMR DIA-DE, DYNADIV Research Group, 911, avenue Agropolis, BP 64501, F-34394 Montpellier cedex 5, France 6Florida Museum of Natural History, University of Florida, PO Box 117800, Gainesville, FL 32611-7800, USA 7Missouri Botanical Garden, PO Box 299, St. Louis, MO 63166-0299, USA 8Netherlands Centre for Biodiversity, Naturalis (section NHN), Leiden University, Einsteinweg 2, 2333 CC Leiden, the Netherlands 9School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China 10Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3DS, UK Received 14 October 2011; revised 11 December 2011; accepted for publication 24 January 2012 The pantropical flowering plant family Annonaceae is the most species-rich family of Magnoliales. Despite long-standing interest in the systematics of Annonaceae, no authoritative classification has yet been published in the light of recent molecular phylogenetic analyses.
    [Show full text]
  • Phylogeny and Geographic History of Annonaceae Phylogénie Et Histoire Géographique Des Annonaceae Phylogenie Und Geographische Geschichte Der Annonaceae James A
    Document generated on 09/27/2021 5:58 p.m. Géographie physique et Quaternaire Phylogeny and Geographic History of Annonaceae Phylogénie et histoire géographique des Annonaceae Phylogenie und geographische Geschichte der Annonaceae James A. Doyle and Annick Le Thomas Volume 51, Number 3, 1997 Article abstract Whereas Takhtajan and Smith situated the origin of angiosperms between URI: https://id.erudit.org/iderudit/033135ar Southeast Asia and Australia, Walker and Le Thomas emphasized the DOI: https://doi.org/10.7202/033135ar concentration of primitive pollen types of Annonaceae in South America and Africa, suggesting instead a Northern Gondwanan origin for this family of See table of contents primitive angiosperms. A cladistic analysis of Annonaceae shows a basal split of the family into Anaxagorea, the only genus with an Asian and Neotropical distribution, and a basically African and Neotropical line that includes the rest Publisher(s) of the family. Several advanced lines occur in both Africa and Asia, one of which reaches Australia. This pattern may reflect the following history: (a) Les Presses de l'Université de Montréal disjunction of Laurasian (Anaxagorea) and Northern Gondwanan lines in the Early Cretaceous, when interchanges across the Tethys were still easy and the ISSN major lines of Magnoliidae are documented by paleobotany; (b) radiation of the Northern Gondwanan line during the Late Cretaceous, while oceanic 0705-7199 (print) barriers were widening; (c) dispersal of African lines into Laurasia due to 1492-143X (digital) northward movement of Africa and India in the Early Tertiary, attested by the presence of fossil seeds of Annonaceae in Europe, and interchanges between Explore this journal North and South America at the end of the Tertiary.
    [Show full text]
  • Annonaceae Substitution Rates – a Codon Model Perspective1
    108 ANNONACEAE SUBSTITUTION RATES – A CODON MODEL PERSPECTIVE1 LARS WILLEM CHATROU2, MICHAEL DAVID PIRIE3,4, ROBIN VAN VELZEN5, FREEK THEODOOR BAKKER2 ABSTRACT - The Annonaceae includes cultivated species of economic interest and represents an important source of information for better understanding the evolution of tropical rainforests. In phylogenetic analyses of DNA sequence data that are used to address evolutionary questions, it is imperative to use appropriate statistical models. Annonaceae are cases in point: Two sister clades, the subfamilies Annonoideae and Malmeoideae, contain the majority of Annonaceae species diversity. The Annonoideae generally show a greater degree of sequence divergence compared to the Malmeoideae, resulting in stark differences in branch lengths in phylogenetic trees. Uncertainty in how to interpret and analyse these differences has led to inconsistent results when estimating the ages of clades in Annonaceae using molecular dating techniques. We ask whether these differences may be attributed to inappropriate modelling assumptions in the phylogenetic analyses. Specifically, we test for (clade-specific) differences in rates of non-synonymous and synonymous substitutions. A high ratio of nonsynonymous to synonymous substitutions may lead to similarity of DNA sequences due to convergence instead of common ancestry, and as a result confound phylogenetic analyses. We use a dataset of three chloroplast genes (rbcL, matK, ndhF) for 129 species representative of the family. We find that differences in branch lengths between major clades are not attributable to different rates of non- synonymous and synonymous substitutions. The differences in evolutionary rate between the major clades of Annonaceae pose a challenge for current molecular dating techniques that should be seen as a warning for the interpretation of such results in other organisms.
    [Show full text]