Molecular Phylogenetics and Evolution 70 (2014) 231–239
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
Molecular phylogeny reveals independent origins of body scales in Entomobryidae (Hexapoda: Collembola) ⇑ Feng Zhang a,b,c, Zhen Chen b, Rui-Rui Dong b, Louis Deharveng d, Mark I. Stevens e,f, Ya-Hong Huang b, , ⇑ Chao-Dong Zhu a, a Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, PR China b School of Life Sciences, Nanjing University, Nanjing 210093, PR China c Department of Entomology, College of Plant Protection, Nanjing Agricultural University, Nanjing, PR China d UMR 7205 CNRS, Origine, Structure et Evolution de la Biodiversité, Museum National d’Histoire Naturelle, Paris, France e South Australian Museum, GPO Box 234, Adelaide, Australia f School of Earth and Environmental Sciences, University of Adelaide, Australia article info abstract
Article history: Entomobryidae is the largest family in Collembola but relationships within the family have never been Received 3 January 2013 subjected to rigorous phylogenetic analyses. Within the family, body scales are present in many species, Revised 6 September 2013 and are fundamental in the classification at the subfamilial and tribal levels. A molecular phylogeny was Accepted 26 September 2013 reconstructed using the nuclear 18SrRNA and partial 28SrRNA and the mitochondrial 16SrRNA to exam- Available online 4 October 2013 ine the evolution of scales across Entomobryidae subfamilies. These datasets were analyzed separately and combined, with parsimony, likelihood and Bayesian algorithms. Monophyly of Orchesellinae was Keywords: not recovered, and it was split into a scaled clade and an unscaled clade, contradicting to all recent tax- rRNA onomic conceptions. The monophyly of Entomobryinae, Seirinae and Lepidocyrtinae is well supported mtDNA Classification however within Entomobryinae, the polyphyly of Entomobryini and Willowsiini implies that classifica- Convergence tion using the presence/absence of scales is not valid. Analyses of ancestral character state reconstruction Ancestral state reconstruction in Entomobryidae indicate that the presence of body scales have evolved independently at least five times, with a loss of scales occurring independently at least twice. A revision of the family Entomobryidae on molecular and morphological basis is clearly needed. Ó 2013 Elsevier Inc. All rights reserved.
1. Introduction Several studies have made significant contributions to the clas- sification of the family Entomobryidae (Börner, 1906, 1913; Yosii, Springtails (Collembola) are widespread, small arthropods 1961; Szeptycki, 1979; Yoshii and Suhardjono, 1989); Soto- found in all kinds of terrestrial ecosystems, from polar regions to Adames et al., 2008). Five main groups are traditionally recog- tropical areas, from plains to plateau. Entomobryidae, having long nized: Orchesellinae, Entomobryini, Willowsiini, Seirinae, Lep- appendages (antennae, legs and furcula) and elongated fourth idocyrtinae (Szeptycki, 1979), with the latter two (Seirinae and abdominal segment, is the largest family of Collembola with more Lepidocyrtinae) often treated as tribes within Entomobryinae than 1500 species (Bellinger et al., 1996–2013). As soft bodied (Yoshii and Suhardjono, 1989; Soto-Adames et al., 2008). Entomo- arthropods, collembolans are rarely preserved as fossils. The earli- bryini and Willowsiini are united as Entomobryinae in Szeptycki’s est fossil Rhyniella praecursor Hirst and Maulik, 1926 from the Low- system (Szeptycki, 1979). Five additional mono- or oligospecific er Devinian predates other hexapods (Whalley and Jazembowski, suprageneric taxa have been recognized that are not included in 1981; Whalley, 1995); while, several entomobryid fossils (Entomo- the present analysis: Capbryinae, and the tribes Bessoniellini, brya, Lepidocyrtus, Seira) from Miocene amber have also been re- Corynotrichini, Mastigocerini, Nothobryini among Orchesellinae. corded and are similar to extant species (Christiansen, 1971; Compared to other scaled collembolan groups (Tomoceroidea, Par- Mari-Mutt, 1983). onellidae), scales and their morphology in the classification of Entomobryidae are quite important diagnostic characters at the generic and suprageneric levels. Willowsiini, Seirinae, Lepidocyrti- ⇑ Corresponding authors. Fax: +86 10 64807099 (C.-D. Zhu). nae and part of Orchesellinae are scaled, with Willowsiini and E-mail addresses: [email protected] (F. Zhang), [email protected] (L. Dehar- Dicranorchesella lacking scales on the ventral side of dens and other veng), [email protected] (M.I. Stevens), [email protected] (Y.-H. Huang), [email protected] (C.-D. Zhu). scaled genera having dental scales. Shape and surface sculpture of
1055-7903/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ympev.2013.09.024 232 F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239 scales are also various and have traditionally been used as an Entomobryomorpha, two Tomoceridae and two Isotomidae species important taxonomic character (Fig. 1). Scales are intuitively con- as outgroups. Thirty seven ingroup species were selected from sidered to have evolved from ordinary chaetae, but the shift from Entomobryidae, including 6, 4, 5, 6, 16 taxa respectively from chaeta to scale has never been examined in a phylogenetic context. Orchesellinae, Seirinae, Lepidocyrtinae, Willowsiini and Entomo- Molecular approaches have been applied to Collembola phyloge- bryini. Table 1 provides the information of taxa name, traditional nies for more than 15 years. Previous phylogenetic studies mainly taxonomical position prior to this study, collection locality and dealt with relationships of collembolan higher orders (Lee et al., Genbank accession numbers. All specimens were collected by aspi- 1995b; Frati et al., 1997; D’Haese, 2002; Park, 2002; Xiong et al., rator or Tullgren-Berlese funnels, stored in 99% ethanol at 20 °C, 2008; Porco and Deharveng, 2009), Entomobryomorpha (Park, and identified using Nikon SMZ1000 and Nikon E600 microscopes. 2009), Neelipleona (Schneider et al., 2011), Hypogastruridae (Lee Photos of scales were taken using a Hitachi scanning electron et al., 1995a; Greenslade et al., 2011), Neanuridae (Frati and microscope (SEM). Dell’Ampio, 2000; Dell’Ampio et al., 2002). However, none has examined the relationship between subfamilies and tribes within Entomobryidae. 2.2. DNA extraction and amplification To improve our current understanding of the relationships within the family, the present study reconstructs the phylogeny DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, of the main clades based on nuclear and mitochondrial genes. To Hilden, Germany) following the manufacturer’s standard protocols. explore the origin of body scales during evolution, we employed Primers, fragment length and references are shown in Table 2. ancestral character state reconstruction and mapped scale pres- Amplification of the four fragments (16SrRNA, 18SrRNA, 28SrRNA ence onto our molecular phylogeny. Implications of our results D1–3 and D7–10) were carried out using TC-5000 Thermal Cycler for the classification of Entomobryidae and for the taxonomic value (TECHNE) and performed in 50 ll volumes containing 2.5 units of of scales are discussed. Easy Taq polymerase, 5 lM of each dNTP, 3 mM MgCl2 (TransGen Biotech, Beijing, China), 2 ll of template DNA, 2 ll of each primer
2. Material and methods (10 mM) and 28.5 ll ddH2O. The PCR programs of 18SrRNA fol- lowed Giribet et al. (1996), 28SrRNA D1–3 followed D’Haese 2.1. Taxon sampling (2002) and Greenslade et al. (2011), 16SrRNA and 28SrRNA D7– 10 after Xiong et al. (2008). All PCR products were checked on a Taxa were chosen for this study with the aim of representing 1% agarose gel. Products were purified and sequenced by Majorbio the phylogenetic diversity of the whole family, following the clas- (Shanghai, China) on an ABI 3730XL DNA Analyser (Applied sification of Szeptycki (1979). We included members of Biosystems).
Fig. 1. Body scales in Entomobryidae. (A) Heteromurus major; (B) Dicranocentrus wangi; (C) Lepidocyrtus fimetarius; (D) Willowsia japonica; (E) Sinhomidia bicolor; (F) Janetschekbrya himalica. Scale bar, 10 lm. F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239 233
Table 1 Sequenced terminals, collection locality, and Genbank accession numbers. Species with both terga and dens scaled are marked with two asterisks ( ). Scaled species but without dental scales are marked with an asterisk ( ). Sinella longisensilla and Sinella triseta not formal published but the related manuscripts have been submitted or in press.
Group Species name Locality 16S 18S 28S D1–3 28S D7–10 Tomoceridae Tomocerus ocreatus China KC236221 KC236262 KC236303 KC236343 Tomocerus jilinensis China – KC236261 KC236302 KC236342 Isotomidae Folsomia candida China KC236200 KC236239 KC236281 KC236320 Folsomia qudrioculata France KC236199 KC236240 KC236280 KC236320 Orchesellinae Ochesella cincta France KC236208 KC236250 KC236290 KC236331 Orchesellides sinensis China KC236209 KC236251 KC236293 KC236332 Orchesellides sp. China KC236217 KC236226 KC236267 KC236308 Heteromurus major France KC236201 KC236241 KC236282 KC236322 Heteromurus nitidus France KC291493 KC236242 KC236283 KC236323 Dicranocentrus wangi China KC236192 KC236232 KC236273 KC236313 Seirinae Seira delamarei China KC236213 KC236255 KC236292 KC236336 Seira barnardi South Africa KC236212 KC236254 KC236296 KC236335 Seira sp1 China KC236214 KC236257 KC236297 KC236337 Seira sp2 South Africa KC236215 KC236256 KC236298 KC236338 Lepidocyrtinae Pseudosinella alba France KC236211 KC236253 KC236295 KC236334 Pseudosinella tumula China KC236210 KC236252 KC236294 KC236333 Lepidocyrtus sp1 China KC236206 KC236248 KC236289 KC236329 Lepidocyrtus sp2 China KC236207 KC236249 KC236291 KC236330 Ascocyrtus sp. China KC236190 KC236228 KC236269 – Willowsiini Sinhomidia bicolor China KC236220 KC236260 KC236301 KC236341 Willowsia japonica China KC236224 KC236265 KC236307 KC236346 Willowsia guangdongensis China KC236223 KC236264 KC236306 KC236345 Willowsia nigromaculata France KC236222 KC236263 KC236304 KC236344 Willowsia sp1 China KC236205 KC236247 KC236288 KC236328 Willowsia sp2 China KC236225 KC236266 KC236305 KC236347 Willowsia sp3 China KC236198 KC236238 KC236277 KC236318 Entomobryini Entomobrya proxima China KC236197 KC236236 KC236279 KC236317 Entomobrya aino China KC236195 KC236235 KC236279 KC236317 Entomobrya multifasciata France KC236196 KC236237 KC236276 KC236317 Entomobrya sp. China KC236194 KC236234 KC236278 KC236319 Homidia sinensis China KC236203 KC236245 KC236286 KC236326 Homidia socia China KC236204 KC236246 KC236287 KC236327 Homidia sichuanensis China – KC236244 KC236285 KC236325 Sinella curviseta China KC236219 KC236258 KC236300 KC236340 Sinella longisensilla China KC236216 KC236259 KC236299 KC236339 Sinella triseta China – KC236229 KC236270 KC236310 Coecobrya tenebricosa France KC236191 KC236231 KC236272 KC236312 Coecobrya communis China KC236218 KC236227 KC236268 KC236309 Coecobrya brevis China – KC236230 KC236271 KC236311 Drepanura sp. China KC236193 KC236233 KC236274 KC236314 Himalanura sp. China KC236202 KC236243 KC236284 KC236324
Table 2 PCR and sequencing primers and fragment length. Primers LR-J-12887M and LR-N-13398M were modified after Simon et al., 1994 and used to amplify the common fragment. The pair 18S1F and 18S9R were used to amplify the total length of 18SrRNA with other pairs amplifying internal regions as necessary to obtain the full gene fragment.
Gene Primers Sequence (50–30) Length (bp) References 16S 16SAcoll MGMMTGTTTAWCAAAAACAT 460–496 Schneider et al. (2011) 16SBcoll CGCCGGTTTGAACTCAAATCA Schneider et al. (2011) LR-J-12887M CCGGTCTGAACTCAAATCATGT Simon et al. (1994) LR-N-13398M CGACTGTTTAACAAAAACAT Simon et al. (1994) 18S 18S1F TACCTGGTTGATCCTGCCAGTAG 1669–1673 Giribet et al. (1996) 18S5R GCGAAAGCATTTGCCAAGAA Giribet et al. (1996) 18S3F GTTCGATTCCGGAGAGGGA Giribet et al. (1996) 18Sbi GAGTCTCGTTCGTTATCGGA Whiting et al. (1997) 18S5F GCGAAAGCATTTGCCAAGAA Giribet et al. (1996) 18S9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28S D1–3 28SrD1.2a CCCSSGTAATTTAAGCATATTA 1220–1241 Whiting (2002) 28Sbout CCCACAGCGCCAGTTCTGCTTACC Giribet et al. (2001) 28S D7–10 AS1 CCGCAGCAGGTCTCCAAGGTGAA 819–840 Xiong et al. (2008) OP4 CCGCCCCAGTCA AACTCCC Xiong et al. (2008)
2.3. Alignment and phylogenetic analysis in GenBank (accession numbers listed in Table 1). Sequences were blasted in GenBank and checked for possible errors, and a preli- Sequences were read and assembled in Sequencher 4.5 (Gene minary alignment was generated using the ClustalW in MEGA 5.0 Codes Corporation, Ann Arbor, Michigan, USA), and were deposited (Tamura et al., 2011) with default settings. Preliminary alignments 234 F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239 were then checked and corrected manually. Seventy-eight bp of 3. Results alignment-ambiguous sites of 16SrRNA were excluded from all analyses, and a final 4222bp alignment was generated. In the final 3.1. Phylogenetic inference alignment, 235 characters are variable but parsimony uninforma- tive, and 804 are variable and parsimony informative. We found high congruence among the MP, ML and BI ap- The datasets were analyzed separately as 2 datasets (nuclear proaches in recognizing the main clades (subfamilies). However, and mitochondrial) and also as a combined dataset. For each data- phylogenies based on different markers had notable differences. set, maximum parsimony (MP), maximum likelihood (ML), and All phylogenetic analyses of the concatenated dataset recovered Bayesian inference (BI) were performed. MP-analyses were con- the monophyly of Entomobryinae, Lepidocyrtinae and Seirinae ducted in TNT 1.1 (Goloboff et al., 2008) with unweighted and heu- with high support (parsimony bootstrap (PB) > 75, maximum like- ristic searches, using tree bisection–reconnection (TBR) branch lihood bootstrap (MLB) > 95 and Bayesian posterior probability swapping and 1000 random-addition replicates. Node support (BPP) = 100), while Lepidocyrtinae and Seirinae are sisters with was assessed with non-parametric bootstrap (Felsenstein, 1985) weak support (PB = 16, MLB = 45, BPP = 67) (Fig. 2). Monophyly of procedures (1000 pseudoreplicates, 10 random-addition replicates, Orchesellinae was not recovered and separated into two groups, TBR branch swapping). Best-fitting evolutionary models were as- both having strong support and morphologically corresponding sessed for four partitions using the Akaike information criterion to the scaled and unscaled genera, respectively (Fig. 2). Both (AIC) in jModelTest 0.1.1 (Posada, 2008), with the GTR + I + C mod- Orchesellinae groups locate at the root of the ingroup, but their el selected for three nuclear partitions and TPM2uf + I + C model relationship is not absolutely resolved. In MP- and ML-analysis, for 16SrRNA. The TPM2uf + I + C model cannot be implemented scaled Orchesellinae and the remaining ((Seirinae + Lepidocyrti- in subsequent softwares and then alternative GTR + I + C model nae) + Entomobryinae) are sister groups but with very weak sup- is used. ML trees were reconstructed in raxmlGUI1.3 (Stamatakis, port (PB = 20, MLB = 41). In BI-analysis, two Orchesellinae groups 2006; Silvestro and Michalak, 2012) with the GTRGAMMAI model, appear in a basal polytomy. Among Lepidocyrtinae taxa, Pseudosi- 1000 bootstrap replicates. BI-analyses were conducted in MrBayes nella and Lepidocyrtus s. l. (Ascocyrtus included) are not monophy- 3.2.1 (Ronquist et al., 2012) with four chains (three heated, one letic. Within Entomobryinae, all analyses failed to recover the cold) ran and GTR + I + C model. Model parameters were unlinked monophyly of Entomobryini and Willowsiini. Both Entomobrya and the overall rate was allowed to vary across partitions. The and Willowsia are polyphyletic, and are difficult to recognize the number of generations for the total analysis was set to 20 million, further subgeneric groups according to morphological and geo- with the chain sampled every 1000 generations. The burn-in value graphical traits. The monophyly of three genera Coecobrya, Homidia was 25% and other parameters were set as default options. To con- and Sinella is recovered but with weak support for Sinella. Scaled firm convergence, ASDSF (average standard deviation of split fre- Sinhomidia is the sister group with unscaled Homidia (with quencies) and PSRF (potential scale reduction factor) values were PB = 74, MLB = 99 and BPP = 100). visualized in MrBayes, and ESS (evaluating effective sample size) Tree topologies from the concatenated nuclear dataset are very value were checked in Tracer 1.5 (Rambaut and Drummond, similar to the total concatenated analysis. Relationships among 2007). Tracing progress in Tracer and ASDSF values (less than Entomobryinae taxa are poorly resolved due to the lower resolu- 0.01) at the end of the burnin were used to confirm that the anal- tion at species level of nuclear ribosomal fragments. yses had converged. The analyses from the mitochondrial 16SrRNA dataset only recovered the monophyly of the clade of three unscaled Orchesel- linae taxa with weak support (PB = 8, MLB = 48 and BPP = 93); other subfamilies, genera and species including two Isotomidae 2.4. Tree topology comparison outgroup taxa were mixed as a polytomy and does not provide adequate resolution of the family Entomobryidae (Appendix A.2). Several alternative tree topology hypotheses on constraining monophyly were tested under a likelihood theory framework: (A) best tree without any constraints (Scaled Orchesellinae + (Entomo- 3.2. Tree topology tests bryinae + (Serinae + Lepidocyrtinae))); (B) Orchesellinae; (C) Un- scaled Orchesellinae + (Entomobryinae + (Serinae + Lepidocyrti- All three hypotheses (Table 3) on the relationship among scaled nae)); (D) Serinae + Entomobryinae; (E) Willowsiini. Likelihood Orchesellinae, unscaled Orchesellinae and Entomobryinae s. l. approach was conducted in CONSEL V0.1j (Shimodaira and Hase- (Entomobryinae + (Serinae + Lepidocyrtinae)) were not rejected gawa, 2001), which was designed for selection problems, particu- (p > 0.05). Most P-values of hypotheses D and E were much less larly phylogenetic tree selection using per-site log likelihoods. than 0.01, indicating that Serinae is closer to Lepidocyrtinae than Probability values (p-value) of approximately unbiased (AU) tests, Entomobryinae and the monophyly of Willowsiini was not Shimodaira–Hasegawa (SH) and weighted Shimodaira–Hasegawa accepted. (WSH) tests were calculated with the default settings. Per-site log likelihoods prior to CONSEL analyses were generated by raxml- 3.3. Ancestral character state reconstruction GUI. Hypotheses having p-values significant at the alpha-level of 0.05 were rejected. Plesiomorphic character state of scales is showed by ACSR (Figs. 3 and 4). The reconstruction indicates that the scales on the body in Entomobryidae appeared independently at least 5 2.5. Trace character history times, once in Orchesellinae, once in (Lepidocyrtinae + Seirinae), once in Sinhomidia bicolor, once in Willowsia sp1, at least once in Ancestral character state reconstruction (ACSR) was performed the clade of the other Willowsia species that were grouped in a sin- with the Mk1 likelihood model in Mesquite 2.75 (Maddison and gle clade in the ML-analysis but appear as a polytomy in the BI- Maddison, 2009). The history of presence/absence of scales was analysis. ASCR over the ML tree also indicates that the loss of body traced over BI and ML phylogenetic trees. Due to the uncertainty scales (node shift from black to white, Figs. 3 and 4) could occur in in the trees, BI-reconstructions were traced over 15,000 sampled the closest ancestral nodes of ((Serinae + Lepidocyrtinae) + Ento- posterior bayesian trees and summarized on BI consensus tree. mobryinae) and Entomobrya sp. with proportional likelihoods of F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239 235
Fig. 2. Bayesian phylogeny of Entomobryidae based on concatenated dataset (16SrRNA + 18SrRNA + 28SrRNA). Node values represent parsimony bootstrap, likelihood bootstrap and posterior probabilities, respectively, with a – indicating nodes not compatible between the analyses. Species with both terga and dens scaled are marked with two asterisks ( ). Scaled species but without dental scales are marked with an asterisk ( ).
Table 3 Ratio of abdominal segment IV/III at the midline is less than 1.8 Comparison of tree topology hypotheses using AU, SH and WSH tests in CONSEL. in Orchesellinae, more than 2.0 in the other three subfamilies Monophyly constraints: (A) best tree without any constraints (Scaled Orcheselli- (Soto-Adames et al., 2008). Classification of Orchesellinae tribes nae + (Entomobryinae + (Serinae + Lepidocyrtinae))); (B) Orchesellinae; (C) Unscaled Orchesellinae + (Entomobryinae + (Serinae + Lepidocyrtinae)); (D) Serinae + Entomo- mainly relies on the number of antennal segments, i.e. antennal bryinae; (E) Willowsiini. segments 4 in Corynothricini, 5 in Heteromurini, 6 in Orchesellini. Both Heteromurini and Orchesellini have scaled and unscaled gen- Hypotheses AU SH WSH era within them. Dental scales are absent in Entomobryinae, which A 0.508 0.930 0.517 is separated into Entomobryini and Willowsiini with tergal scales B 0.511 0.875 0.483 C 0.444 0.847 0.450 absent and present respectively. Both Seirinae and Lepidocyrtinae D2e 009 0.017 2e 004 possess tergal and dental scales, with some scales pointed in the E3e 005 0 0 former and apically rounded in the latter. The present molecular phylogeny strongly challenges the traditional systematic view- presence of scales as 0.76 and 0.45, respectively (Fig. 4). BI analysis points of Orchesellinae and Entomobryinae. has no related evidence. Reconstructions on some nodes are dis- tinctly different from those on the ML tree. Several basal nodes 4.1.1. Orchesellinae show absolutely equivocal state. The tribal classification of Orchesellinae as widely accepted to- day was established by Mari-Mutt (1980a, b), with 4 tribes. Soto- Adames et al. (2008) further erected two more tribes (Bessoniellini 4. Discussion and Nothobryini) and excluded Capbrya and Hispanobrya which were moved to a new subfamily Capbryinae. The subdivision of 4.1. Systematics of Entomobryidae Orchesellinae s. l. depends on the number of antennal segments and number of chaetae on the trochanteral organ. Traditionally, groups among Entomobryidae are recognized by The molecular phylogeny presented here does not recover the the ratio of abdominal segments and morphology of body scales. monophyly of Orchesellinae in any unconstrained analysis 236 F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239
Fig. 3. Summary of ancestral character state reconstructions of body scales in Entomobryidae over 15,000 sampled trees on a bayesian consensus tree. Each node indicates character states with different colorations and the proportion of the state over all examined trees. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
although we cannot reject its monophyly in the topology tests. Sur- macrochaetae, moderate number (3) of S-chaetae on Abd. II, III prisingly, four genera sampled in the analyses are split into two and V (personal observation), pigment reduced or distributed groups, corresponding to unscaled (Orchesella, Orchesellides) and throughout body, and dental spines often present. As for the single scaled (Heteromurus, Dicranocentrus) groups and both with high genus Corynothrix of Corynothricini, it is also quite similar to MLB (88/91) and BPP (100/100) but relatively weak BP (47/59) Orchesella and Orchesellides in many aspects (Mari-Mutt, 1980a). support. Moreover, according to the traditional definition, Orche- Six segmented Northobryini is closer to Capbryinae (4 segments) sella and Dicranocentrus belong to Orchesellini for their 6-seg- for falcate mucro, presence of postantennal organ and reduced mented antennae, while Orchesellides and Heteromurus belong to (3–4) chaetae on trochanteral organ. Heteromurini for their 5-segmented antennae. Based on these rela- On the other hand, the additional two segments in Orcheselli- tionships in the molecular phylogeny, a more detailed morpholog- nae (4 normal in first instar larvae), actually arising from the sub- ical assessment of these species reveals that two genera resemble division of the basal two segments, usually appear in adults each other except for the antennal segments. Orchesellides is simi- (Mari-Mutt, 1979). Number of chaetae on trochanteral organ is lar to Orchesella in habitus, absence of body scales, polymacrochae- only 1 at first instar, gradually added during postembryonic totic tergal chaetotaxy, abundant S-chaetae on Abd. II, III and V development (South, 1961). Such secondary and unstable struc- (P5, Szeptycki, 1979; Jordana and Baquero, 2006), distinct color tures during development used for suprageneric classification patterns, and absence of dental spines. Dicranocentrus resembles are disputable characters in modern taxonomy. Our phylogeny Heteromurus in habitus, presence of body scales, less tergal here indicates that the traditional classification of Orchesellinae F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239 237
Fig. 4. Ancestral character state reconstructions of body scales in Entomobryidae on a ML-tree with proportional likelihoods shown on each node. s. l. should be reconsidered by looking for more stable characters, discussed its phylogeny and suggested on morphological ground such as the presence/absence of body scales. Actually, Absolon that Willowsia might be probably paraphyletic. The present molec- and Kseneman (1942) proposed a classification of Entomobryo- ular phylogeny confirms this hypothesis. Entomobryini, Willowsi- morpha that has been completely overlooked by subsequent ini, Entomobrya, and Willowsia are demonstrated to be authors. They considered ‘‘Heteromurini’’ as a tribe of Lepidocyrti- polyphyletic. Those Entomobrya and Willowsia species are mixed nae (sensu all scaled taxa of Entomobryidae), orchesellins being across all our analyses. For example, one clade (Willowsia grouped in a separate independent subfamily. Our molecular phy- sp1 + (Himalanura sp. + Entomobrya proxima)) with strong support logeny supports this dissociation between heteromurins and (PB = 85, MLB = 99, BPP = 100) groups two Entomobryini and one orchesellins, the difference with the Absolon and Kseneman’s con- Willowsiini, while other species of the same tribes as well as other ception being that Heteromurini are isolated from rather than in- species of Entomobrya and Willowsia are in different clades. Yosii cluded in Lepidocyrtinae. (1971) already regarded Himalanura as a subgenus of Entomobrya, and considered that Willowsia complex might partly derive from 4.1.2. Entomobryini and Willowsiini Himalanura. A new taxonomic classification will have obviously Entomobryinae sensu Szeptycki, 1979 is traditionally divided to be set up at both generic and tribe level among Entomobryinae. into Entomobryini and Willowsiini, the former unscaled and the Given the complexity of the relationships between scaled and un- latter scaled but with dental scales absent. Willowsiini genera scaled species disclosed by our analyses, it will require larger taxon were firstly grouped by Denis (1941, Siraeformes). Later, Yoshii sampling. In any case, the separation of Willowsiini from Entomo- and Suhardjono (1989) proposed the name Willowsiini while bryini on the basis of the presence of scales is challenged by de- doubting the monophyly of Willowsia. Zhang et al. (2011) reviewed tailed morphological analyses (Zhang et al., in press) and is not the Willowsia complex (Willowsia, Janetschekbrya, Americabrya), supported by molecular evidence. 238 F. Zhang et al. / Molecular Phylogenetics and Evolution 70 (2014) 231–239
The systematic position of Sinhomidia in Entomobryinae is con- of ecological changes associated to the transformation of chaetae firmed here. Zhang et al. (2009) excluded Acanthocyrtus bicolor into scales during evolution. from Seirinae, assigned it to Willowsiini with the newly erected genus Sinhomidia, and considered it to be closest to Homidia except Acknowledgements for the presence of scales. Sinhomidia is sister to Homidia in our molecular analyses with high support (PB = 74, MLB = 99, This project was supported by the National Natural Science PBB = 100). Further sampling from within both genera is needed Foundation of China (No. 31101622, J1210002) granted to Dr. Feng to determine if Sinhomidia could be regarded as ‘‘scaled Homidia’’. Zhang and partially supported by a Grant (No. Y229YX5105) from the Key Laboratory of the Zoological Systematics and Evolution of 4.1.3. Are Lepidocyrtinae and Seirinae sisters? the Chinese Academy of Sciences to Chao-Dong Zhu. Miss Fang Yosii (1961) excluded Seirinae from Entomobryinae based on YU and Tian-Juan SU provided helps to generate data in Beijing. accessory chaetae around bothriotricha. Szeptycki (1979) further Dr. Douglas Chesters assisted with initial phylogenetic analyses. divided Seirinae into Seirinae and Lepidocyrtinae, both demoted to tribes by Yoshii and Suhardjono (1989) based on scale morphol- ogy and chaetotaxy. Despite scales present on the dens, both Appendix A. Supplementary material groups have distinct differences, for example scale shape and sculpture, chaetotaxy and male genital plate. Seirinae also shares Supplementary data associated with this article can be found, in some features with Entomobryinae, chaetotaxy polymacrochaetot- the online version, at http://dx.doi.org/10.1016/j.ympev.2013 .09. ic, dental scales usually narrower as those in some Willowsia spe- 024. cies. The Lepidosira-group recognized by Yoshii and Suhardjono (1989) in Seirinae is fairly similar to Entomobryinae in most char- References acters except scale distribution. The weak but consistent grouping in our molecular phylogenetic analyses of Seirinae and Lepidocyrti- Absolon, K., Kseneman, M., 1942. Troglopeditini. Vergleichende studie über eine nae supports the hypothesis that these subfamilies are sister altertümliche höhlenbewohnende Kollembolengruppe aus den dinarischen Karstgebieten. Bericht über eine naturwissenschaftliche Forschungsreise und groups. biospeologische Erforschung der Insel Brac, Brazza in Dalmatien. Stud. Geb. Allg. Karst. Wiss. Höhl. Nachbargeb. 16, 5–34. Bellinger, P.F., Christiansen, K.A., Janssens, F., 1996–2013. Checklist of the 4.2. Evolution of body scales Collembola of the World.
Mari-Mutt, J.A., 1980b. A classification of the Orchesellinae with a key to the tribes, Szeptycki, A (Ed.), 1979. Morpho-systematic Studies on Collembola. IV. Chaetotaxy genera and subgenera (Collembola: Entomobryidae). Ann. Entomol. Soc. Am. 73, of the Entomobryidae and its Phylogenetical Significance. Polska Akademia 455–459. Nauk, Kraków, pp. 1–219. Mari-Mutt, J.A., 1983. Collembola in amber from the Dominican Republic. Proc. Stamatakis, A., 2006. RAxML-VI-HPC: maximum Likelihood-based phylogenetic Entomol. Soc. Wash. 85, 575–587. analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688– Park, K.H., 2002. Phylogenetic analysis of Collembola based on highly variable 2690. region of 28S rRNA gene sequence. Korean J. Genet. 24, 21–29. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Park, K.H., 2009. Molecular biological study on speciation and phylogeny of the molecular evolutionary genetics analysis using maximum likelihood, order Entomobryomorpha (Collembola: Hexapoda). Entomol. Res. 39, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 334–340. 2731–2739. Porco, D., Deharveng, L., 2009. Phylogeny of Collembola based on cuticular Whalley, P., 1995. Unfair to ancient fossil springtails! Antenna 19, 2–3. compounds: inherent usefulness and limitation of a character type. Whalley, P., Jazembowski, E., 1981. A new assessment of Rhyniella, the earliest Naturwissenschaften 96, 943–954. known insect, from the Devonian of Rhynie, Scotland. Nature 291, 317. Posada, D., 2008. JModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, Whiting, M.F., Carpenter, J.M., Wheeler, Q.D., Wheeler, W.C., 1997. The Strepsiptera 1253–1256. problem: phylogeny of the holometabolous insect orders inferred from 18S and Rambaut, A., Drummond, A.J., 2007. Tracer v1.4.