Characterization of Species Associated with Pythium Soft Rot of Ginger and Evaluation of Pythium Oligandrum As a Biocontrol

CHARACTERIZATION OF SPECIES ASSOCIATED WITH PYTHIUM SOFT ROT OF GINGER AND EVALUATION OF PYTHIUM OLIGANDRUM AS A BIOCONTROL

Duy Phu Le MSc. Plant Protection, The University of Queensland, Australia BSc. Crop Science, Can Tho University, Vietnam

A thesis submitted for the degree of Doctor of Philosophy at

The University of Queensland in 2016

School of Agriculture and Food Sciences

Abstract

Amongst the 1,400 species within the Zingiberaceae, ginger (Zingiber officinale Roscoe) is believed to be the most commonly used spice for cooking, medicine and confectionery purposes. Following more than a thousand years of domestication and development in the East, ginger is now grown worldwide throughout the tropics and subtropics. Ginger has drawn great attention from scientists over the years for its antibacterial and antifungal chemicals; nonetheless, ginger is a host for many bacteria, fungi, oomycetes and viruses. Among these phytopathogens, Pythium, an oomycete that causes Pythium soft rot (PSR) disease is of the most concern and is widely distributed throughout ginger growing regions. Losses due to PSR in pre- and post-harvested ginger are generally from 5- 30%, but losses up to 100% have been recorded in India and Australia. Pythium myriotylum was believed to be the causal pathogen for the PRS disease outbreaks recorded on the two oldest ginger farms in Australia in 2007. However, P. myriotylum isolated from ginger exhibited differences in pathogenicity on ginger compared with P. myriotylum isolated from other crops in Australia. In addition, from 2007 onwards, PSR was observed on many other farms. A three-year-project (2012 to 2015) was initiated to assess the diversity within P. myriotylum occurring on Australian ginger farms as well as to study the presence of other Pythium spp. occurring on these ginger farms.

The species status of P. myriotylum recovered from ginger with PSR symptoms in Queensland had been previously called into question since numerous PSR isolates exhibited morphological features which had been believed to be unique to P. zingiberis. Although the species status of P. myriotylum and P. zingiberis has been discussed, no comprehensive and comparative assessment has been made to date. International reference isolates of these two species, P. myriotylum CBS254.70 and P. zingiberis NBRC30817 were imported for exclusive re-examination along with samples of P. myriotylum from the collection of the University of Queensland. Since the reference isolate of P. zingiberis NBRC30817 showed minor divergence (less than 1%) in gene sequences (20 gene regions analysed) and very similar morphology, it was proposed to be reunited with the taxon P. myriotylum. The identification of P. myriotylum as a pathogen of PSR disease of ginger in Australia was confirmed.

A collection of Pythium spp. (173 isolates) was isolated from diseased ginger rhizomes and soils collected around diseased ginger. Eleven distinct Pythium spp. were identified based on morphology and molecular sequences. Pathogenicity assays confirmed that P. myriotytlum isolates recovered from PSR ginger were pathogenic on ginger rhizomes and plants at a wide temperature range from 20 - 35 °C. Pythium aphanidermatum was pathogenic on ginger at 30 - 35 °C. Nine

other species assessed were either non-pathogenic or pathogenic on the ginger rhizome only. Subsequent sequence assessments showed that P. myriotylum isolates from different farms were genetically uniform and had a host preference to ginger.

Isolates of P. myriotylum derived from different hosts and origins showed differences in pathogenicity to ginger. Sequence diversity based on single nucleotide polymorphism (SNP) was investigated for these isolates of P. myriotylum. Overall, within 22 nuclear and mitochondrial genes studied, a higher number of true and unique SNPs were discovered in P. myriotylum isolates obtained from PSR ginger in Australia compared with other P. myriotylum isolates. Additionally, the use of the enzyme HinP1I in a PCR-RFLP of the CoxII gene successfully discriminated P. myriotylum isolates from PSR ginger from other P. myriotylum and Pythium spp. Using the same PCR-RFLP of the CoxII gene, P. myriotylum was also detected directly from PSR infected ginger; thus providing a potential diagnostic tool.

The recovery of Pythium oligandrum, a well-known mycoparasitic oomycete, from soils around PSR ginger led to an investigation of antagonism and mycoparasitism of P. oligandrum against an isolate of the PSR pathogen, P. myriotylum Gin1. It was apparent that P. oligandrum did not produce substances toxic to P. myriotylum Gin1, but it did parasitize and compete against P. myriotylum Gin1 in vitro assays. Disease indices recorded in pathogenicity assays in Petri plates containing dual cultures of P. oligandrum and the target pathogen were reduced significantly compared with those recorded with single cultures of P. myriotylum Gin1. However, subsequent pot trials with co-inoculation of these two Pythium species showed no significant difference from control inoculations with P. myriotylum Gin1 only.

The symptoms of soft rot on ginger were not only induced by Pythium, but were also found to be induced by Pythiogeton (Py.) ramosum, a less studied oomycete. This reports Py. ramosum as a pathogen of ginger occurred at high temperatures (30 – 35 °C), and is the first record of its pathogenicity on ginger. It also was confirmed to be pathogenic on excised ginger, carrot and potato roots/tubers and other tested crop species in Petri plate assays. Py. ramosum also exhibited intraspecific variation within the ITS and CoxI genes.

iii

Declaration by author This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School.

I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis.

Publications during candidature Peer reviewed publications: Le, D.P., Smith, M.K., Aitken, E.A.B., 2016. An assessment of Pythium spp. associated with soft rot disease of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol. 45, 377-387 DOI 10.1007/s13313-016-0424-5 Le, D.P., Aitken, E.A.B., Smith, M.K., 2015. Comparison of host range and pathogenicity of isolates of Pythium myriotylum and Pythium zingiberis, Acta Hortic. 1105, 47-54 Le, D.P., Smith, M.K., Aitken, E.A.B., 2015. Pythiogeton ramosum, a new pathogen of soft rot disease of ginger (Zingiber officinale) at high temperatures in Australia. Crop Prot. 77, 9-17. Le, D.P., Smith, M., Hudler, G.W., Aitken, E., 2014. Pythium soft rot of ginger: detection and identification of the causal pathogens, and their control. Crop Prot. 65, 153-167. Le, D.P, Smith, M., Aitken, E., 2014. First report of Pythiogeton ramosum (Pythiales) in Australia. Australas. Plant Dis. Notes 9, 1-3.

Conference abstracts: Le, D.P., Smith, M., Aitken, E., 2015. In vitro interactions between Pythium oligandrum, a potential biocontrol agent, and Pythium myriotylum, a pathogen of soft rot disease of ginger. Proceedings of the TropAg 2015, Brisbane, Australia November 2015. Ishiguro, Y., Le, D.P., Feng, W., Suga, H., Kageyama, K., 2015. Development of LAMP assay for detection of Pythium spinosum. Kansai Division Meeting of Phytopathological Society of Japan, September 2015. Le, D.P., Smith, M., Aitken, E., 2014. Intraspecific variation among isolates of Pythiogeton ramosum isolated from soft rot disease ginger in Queensland, Australia. Proceedings of the eighth Australasian Soilborne Diseases Symposium. Hobart, Tasmania November 2014. Le, D.P., Smith, M., Aitken, E., 2014. Comparison of host range and pathogenicity of isolates of Pythium myriotylum and Pythium zingiberis. Proceedings of the 29th International Horticultural Congress, Brisbane, Australia August 2014. Le, D.P., Smith, M., Aitken, E., 2013. Pathogenicity of Pythium spp. isolated from ginger fields in Australia. Proceedings of the 19th Australasian Plant Pathology Conference. Auckland, New Zealand 2013.

Other outcomes Le, D. P., Smith, M., Aitken, E., Teakle, D., 2015. Common names of diseases of ginger (Zingiber officinale Roscoe). International Society of Plant Pathology. Available for comments and contributions at: http://www.isppweb.org/names_ginger_common.asp Aitken, E., Le, D.P., Smith, M., Abbas, R., 2015. Assessment of Pythium diversity in ginger. RIRDC final report (approved). v

Publications included in this thesis

Le, D.P., Smith, M., Hudler, G.W., Aitken, E., 2014. Pythium soft rot of ginger: detection and identification of the causal pathogens, and their control. Crop Prot. 65, 153-167 – incorporated as Chapter 2. Contributors Statement of contribution

Duy Phu Le (Candidate) Wrote and edited the paper (70%) Mike Smith Wrote and edited the paper (10%) George Hudler Wrote and edited the paper (10%) Elizabeth Aitken Wrote and edited the paper (10%)

Le, D.P., Aitken, E.A.B., Smith, M.K., 2015. Comparison of host range and pathogenicity of isolates of Pythium myriotylum and Pythium zingiberis, Acta Hortic. 1105, 47-54 – incorporated as Chapter 3. Contributors Statement of contribution

Duy Phu Le (Candidate) Designed experiments (80%) Performed experiments (100%) Wrote and edited the paper (70%) Mike Smith Designed experiments (10%) Wrote and edited the paper (15%) Elizabeth Aitken Designed experiments (10%) Wrote and edited the paper (15%)

Le, D.P., Smith, M.K., Aitken, E.A.B., 2016. An assessment of Pythium spp. associated with soft rot disease of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol. 45, 377-387 - incorporated as Chapter 4. Contributors Statement of contribution

Le, D.P, Smith, M., Aitken, E., 2014. First report of Pythiogeton ramosum (Pythiales) in Australia. Australas. Plant Dis. Notes 9, 1-3 – incorporated as Chapter 7. Contributors Statement of contribution

Le, D.P., Smith, M.K., Aitken, E.A.B., 2015. Pythiogeton ramosum, a new pathogen of soft rot disease of ginger (Zingiber officinale) at high temperatures in Australia. Crop Prot. 77, 9-17– incorporated as Chapter 7. Contributors Statement of contribution

Duy Phu Le (Candidate) Designed experiments (80%) Performed experiments (100%) Wrote and edited the papers (70%) Mike Smith Designed experiments (10%) Wrote and edited the papers (15%) Elizabeth Aitken Designed experiments (10%) Wrote and edited the papers (15%)

vii

Contributions by others to the thesis

“No contributions by others.”

Statement of parts of the thesis submitted to qualify for the award of another degree

“None”.

viii

Acknowledgements

First and foremost, I am sincerely thankful to my super friendly, super supportive and super talented supervisors Plant Pathologist, A/Prof. Elizabeth Aitken from School of Agriculture and Food Sciences (SAFS), and ginger Agronomist and Physiologist, Dr. Mike Smith from Maroochy Research Station, Queensland DAF. I have found myself very very lucky to have such a wonderful opportunity to know and work with you two. Without your help and support, sitting here and writing down these words would never have happened.

All the research results contained in this thesis were financially funded and supported by Rural Industries Research and Development Corporation (PRJ-008410) in a conjunction with the Australian Ginger Industry Association. Without this funding source and support, this thesis would still be in the middle of nowhere now. Hence, all the funding and support have been greatly appreciated. I am also very grateful for the PhD sponsorship from Endeavour Awards which gave me a wonderful chance to be back to Australia to experience the life and complete my PhD. Thanks are also sent to SAFS travel awards for financial support to present at conferences in New Zealand in 2013 and Tasmania in 2014, and also to Australasian Plant Pathology Society and Phytopathological Society of Japan for fully supporting my internship to Japan in 2014.

I also want to have special thanks to: Mr. Rob Abbas from Rob Abbas Consulting Pty. Ltd. for his kindness in providing clean ginger materials and sampling diseased ginger; Dr. Sharon Hamill from Queensland DAF for providing primary stocks of tissue culture ginger; Prof. George Hudler from Cornell University, USA; Dr. David Teakle (retired) and Dr. Roger Shivas from Queensland Plant Pathology Herbarium for critically reading some of my manuscripts; Dr. Jin-hsing Huang from Plant Pathology Division, Taiwan Agricultural Research Institute for technical consultation for working with Pythiogeton; Prof. Koji Kageyama from Gifu University, Japan for hosting my internship and providing Pythium DNA; Prof. André Lévesque from Agriculture and Agri-Food Canada for providing Pythium DNA; Ms. Elizabeth Czislowski for help with whole genome sequencing; Dr. Andy Chen for help with RFLP; and Ms. Kerry Vinall from SAFS for help arranging growth cabinets used in pot trials.

Last but not least, I want to thank my mum (Kiem), my sister (Linh) and my girlfriend (Thao) for their unconditional love and support. Also thanks to all other friends, labmates, St Lucia community (my little party community ^.^), you all have painted my PhD life colourfully and beautifully. For certain, I am going to miss you all and I will keep my finger crossed to catch you up (face-to-face, do not count on Facebook ^.^) again some time in this ‘small world’. ix

Keywords

Zingiber officinale, Pythium soft rot (PSR), Pythium myriotylum, Pythium zingiberis, Pythium oligandrum, Pythiogeton ramosum, pathogenicity, host range, interactions

Australian and New Zealand Standard Research Classifications (ANZSRC)

ANZSRC code: 060704, Plant Pathology, 70%

ANZSRC code: 060505 Mycology, 30%

Fields of Research (FoR) Classification

FoR code: 0607 Plant Biology, 70%

FoR code: 0605 Microbiology, 30%

TABLE OF CONTENTS CHAPTER 1 : GENERAL INTRODUCTION ...... 1

1.1. OVERVIEW ...... 1

1.2. OBJECTIVES ...... 2 CHAPTER 2 : LITERATURE REVIEW ...... 3

2.1. INTRODUCTION ...... 3

2.2. IMPACTS OF PYTHIUM SOFT ROT ON GINGER PRODUCTION ...... 5 2.2.1. Economic impacts ...... 5 2.2.2. Ecological impacts ...... 6

2.3. SOFT ROT SYMPTOMS ...... 7

2.4. PYTHIUM SPP.– CAUSAL AGENTS OF THE SOFT ROT DISEASE ...... 8

2.5. PATHOGENICITY ...... 10

2.6. PYTHIUM ISOLATION ...... 14

2.7. PYTHIUM QUANTIFICATION ...... 15

2.8. PYTHIUM IDENTIFICATION AND ITS ADVANCES ...... 17 2.8.1. Morphology ...... 17 2.8.2. Molecular and monoclonal antibody approaches ...... 19

2.9. CONTROL STRATEGIES ...... 22 2.9.1. Chemical ...... 22 2.9.2. Biological agents ...... 23 2.9.3. Cultural practices ...... 24 2.9.4. Host plant resistance ...... 27 2.9.5. Induced resistance ...... 28

2.10. CONCLUDING REMARKS ...... 29 CHAPTER 3 : COMPARISON OF MORPHOLOGY, GENETIC AND PATHOGENICITY OF ISOLATES OF PYTHIUM MYRIOTYLUM AND PYTHIUM ZINGIBERIS ...... 31

3.1. INTRODUCTION ...... 31

3.2. MATERIALS AND METHODS...... 33 3.2.1. Pythium spp. cultures ...... 33 3.2.2. Hyphal growth rate ...... 33 3.2.3. Morphology ...... 33 3.2.4. Sequencing ...... 34 3.2.5. In vitro test of virulence on excised roots/tubers ...... 34 3.2.6. In vitro pre-emerging damping off ...... 35

3.3. RESULTS ...... 35 xi

3.3.1. Radial growth rate ...... 35 3.3.3. Sequence analysis ...... 39 3.3.4. In vitro test of virulence on excised roots/tubers ...... 44 3.3.5. In vitro pre-emerging damping off ...... 44

3.4. DISCUSSION ...... 45 CHAPTER 4 : CHARACTERISATION OF PYTHIUM SPP. ASSOCIATED WITH SOFT ROT DISEASE OF GINGER (ZINGIBER OFFICINALE) IN QUEENSLAND, AUSTRALIA ...... 50

4.1. INTRODUCTION ...... 50

4.2. MATERIALS AND METHODS...... 51 4.2.1. Pythium isolation and cultures ...... 51 4.2.2. Hyphal growth rate ...... 52 4.2.3. Morphology ...... 53 4.2.4. DNA extraction and amplification ...... 53 4.2.5. Sequencing and analysing sequences ...... 54 4.2.6. Pathogenicity tests ...... 54

4.3. RESULTS ...... 56 4.3.1. Isolation and identification ...... 56 4.3.2. Pathogenicity assays ...... 60

4.4. DISCUSSION ...... 64 CHAPTER 5 : COMPARISON OF SNPS AND DEVELOPMENT OF PCR-RFLP FOR DETECTION TOOL FOR PYTHIUM MYRIOTYLUM ISOLATES RECOVERED FROM PYTHIUM SOFT ROT GINGER ...... 68

5.1. INTRODUCTION ...... 68

5.2. MATERIALS AND METHODS...... 70 5.2.1. Pythium and fungal cultures ...... 70 5.2.2. Sequence diversity based on SNP analysis ...... 72 5.2.3. PCR-RFLP for CoxII region ...... 72

5.3. RESULTS ...... 73 5.3.1. Sequence diversity based on SNP typing ...... 73 5.3.2. PCR-RFLP analysis ...... 77

5.4. DISCUSSION ...... 78 CHAPTER 6 : INTERACTIONS BETWEEN MYCOPARASITIC PYTHIUM OLIGANDRUM ISOLATED FROM GINGER FIELDS AND PATHOGENIC PYTHIUM MYRIOTYLUM ...... 81 xii

6.1. INTRODUCTION ...... 81

6.2. MATERIALS AND METHODS ...... 83 6.2.1. Pythium spp. cultures ...... 83 6.2.2. Mycoparasitism of P. oligandrum ...... 84 6.2.3. Growth competition of P. oligandrum ...... 84 6.2.4. Effect of volatile compounds of P. oligandrum on growth of the targets ...... 85 6.2.5. Effect of non-volatiles compounds of P. oligandrum on growth of the targets ...... 85 6.2.6. In vitro pre-emerging damping off suppression ...... 86 6.2.7. Pot trial suppression of P. myriotylum on ginger plants ...... 87

6.3. RESULTS ...... 87 6.3.1. Mycoparasitism and growth competition of P. oligandrum against the targets ...... 87 6.3.2. Effects of volatiles and non-volatiles produced by P. oligandrum on growth of the targets ...... 88 6.3.3. In vitro suppression ...... 90 6.3.4. Pot trial suppression ...... 91

6.4. DISCUSSION ...... 93 CHAPTER 7 : PYTHIOGETON RAMOSUM ASSOCIATED WITH SOFT ROT DISEASE OF GINGER (ZINGIBER OFFICINALE) IN AUSTRALIA ...... 97

7.1. INTRODUCTION ...... 97

7.2. MATERIALS AND METHODS...... 99 7.2.1 Py. ramosum isolation ...... 99 7.2.2 Growth and morphology ...... 101 7.2.4. Sequencing and analysing sequences ...... 102 7.2.6. Pathogenicity tests ...... 102

7.3. RESULTS ...... 103 7.3.1. Growth rate and morphological characteristics ...... 103 7.3.2. DNA sequences ...... 106 7.3.3. Pathogenicity tests ...... 108

7.4. DISCUSSION ...... 112 CHAPTER 8 : GENERAL CONCLUSIONS AND DISCUSSION ...... 115

8.1. SUMMARY OF FINDINGS ...... 115

8.2. DISCUSSION ...... 117

8.3. RECOMMENDATIONS ...... 119

xiii

LIST OF FIGURES Fig 2.1: Ginger crop in Australia with symptoms of PSR. The disease progressed quickly down the row in saturated soils after a prolonged, heavy rainfall event...... 6 Fig 2.2: Early symptoms of PSR in the form of water-soaked and brown coloured area on sheath collar (top left), whole dead infected plant (left plant top right) with stem still standing but easily pulled out of the ground. A healthy rhizome (bottom left) and diseased rhizome (bottom right), the latter with soft, dark brown lesions at the buds (Le, 2010)...... 8 Fig 2.3: Morphology of Pythium spp. associated with PSR of ginger: P. myriotylum (1, finger shaped appressoria and appressoria usually formed in cluster; 2-3, zoospore released from vesicle; 4, smooth, aplerotic oospore; 5 filamentous inflated sporangia), P. splendens (6, globese, smooth, terminal hyphal swelling), P. deliense (7, single antheridium applied to an oogonium and an oogonialphore winding towards the antheridium), P. zingiberis (8, oogonia formed in cluster and typical coiling antheridial stalks around oogonial stalks), P. aphanidermatum (9, single broad antheridium applied to an oogonium), P. ultimum (10, a smooth, terminal oogonium with single antheridium appearing from just right beneath the oogonium), P. spinosum (11, spiky intercalary oogonia)...... 18 Fig 2.4: Ginger fields showing good drainage practice, a method which helps to minimize PSR spread to adjacent paddocks. Drain breaks (arrow) helped stop the spread of P. myriotylum within a ginger field leaving the bed with early PSR infection free of ginger allowing the rest of the paddock to still produce a viable crop. [Photos courtesy of Rob Abbas, Consulting Pty. Ltd.] ...... 27 Fig 3.1: Radial growth rate (mm) on PDA of P. myriotylum CBS254.70, P. zingiberis NBRC 30817 and two putative isolates of P. zingiberis recovered from PSR ginger at 5 °C intervals from 5 to 40 °C. Bars represent standard deviations of four means, P = 0.05 as determined by Tukey’s test...... 36 Fig 3.2: Morphological comparisons of putative P. zingiberis Gin1 isolated from PSR ginger in Australia and reference isolates: P. zingiberis NBRC30817 and P. myriotylum CBS254.70 (Bar = 20 µm)...... 38 Fig 3.3: A maximum likelihood tree showing phylogenetic relationships among Pythium spp. using DNA sequences encoded from the small and large subunits and the ITS region of nuclear genome (length above 4000 bp). The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are displayed). All sequence data were retrieved from Genbank, except for the sequence data of P. myriotylum and P. zingiberis with asterisk which were obtained from whole genome data in this study...... 43 xiv

Fig 4.1: A maximum likelihood tree showed phylogenetic relationships among Pythium species (only representatives presented) recovered from commercial ginger fields in Australia using DNA sequences encoded from ITS gene. The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications)...... 59 Fig 4.2: Aggressiveness of selected Pythium spp. assessed based on mean colonization and recovery of Pythium spp. on 1 cm segments excised from 5.5 cm long ginger sticks at 27 ± 2 °C at 2 DAI (bars represent standard deviations, n = 6). Means were combined from two independent assays due to no significant difference between the two repetitions (P = 0.05)...... 60 Fig 4.3: Disease severity (0-3) which was recorded on ginger plants inoculated with selected Pythium spp. at 21DAI at two temperature ranges 20/25 °C and 30/35 °C with 10 h of photoperiods (bars represent standard errors, n = 6). Data presented the combination of two pot trials due to no significant difference in disease severity recorded on the two ginger cultivars tested (P = 0.05)...... 63 Fig 5.1: HinP1I restriction banding patterns of the partly amplified CoxII gene of P. myriotylum isolates obtained from different hosts and origins: Lane 1, 100 bp ladder marker; lanes 2- 15, DNA templates of P. myriotylum isolates obtained from PSR ginger (except for lane 9, amplification failed); lanes 16-20, DNA templates of P. myriotylum extracted directly from pot trial PSR ginger; lane 21-26, DNA templates of P. myriotylum isolates obtained from Japan; lanes 27-28, DNA templates of P. myriotylum isolates obtained from capsicum wilt; lane 29, P. myriotylum CBS254.70; lane 30, P. myriotylum NBRC30817 ...... 77 Fig 6.1: Effects of volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and in potato broth on growth of P. myriotylum and P. ultimum as assessed by linear growth on a Petri plate. Negative values indicate growth promotion in media putatively infused with non-volatiles from P. oligandrum. Bars represent standard deviation of four replicates. ... 89 Fig 6.2: Effects of non-volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and in potato broth on growth of P. myriotylum and P. ultimum. Negative values indicate growth promotion of non-volatiles. Bars represent standard deviation of four replicates. . 90 Fig 6.3: Disease index (0-1) recorded for millet, rye and wheat seeds/seedlings grown on single and dual cultures of Pythium. Bars represent standard deviation of four replicates...... 91 Fig 6.4: Disease severity recorded on ginger plants inoculated with either P. oligandrum or P. myriotylum or both at 7, 14 and 21DAI 25/30 °C with 10 h of photoperiods (bars represent standard errors, n = 8). Data presented is for the combination of two pot trials as no significant difference in disease severity was recorded on the two trials tested (P = 0.05). Disease severity rates from: 0 = healthy plants; 1 = discoloured sheath collar and yellow xv

lower leaves; 2 = plants alive, but shoots either totally yellow or dead; and 3 = all shoots dead...... 92 Fig 7.1: Typical sickle-shape appressoria and short branch hyphae at right angles with main hyphae (A), a typical terminal long bursiform sporangium observed on a mature culture (B) (bar = 20 µm) ...... 104 Fig 7.2: Sporangia of Py. ramosum on one-week-old cultures: an admixture of globose, eclipsoid and bursiform sporangia observed on cultures of Group I isolates (A); only globose sporangia observed on cultures of Group II isolates (B) (bar = 20 µm) ...... 104 Fig 7.3: Growth rate comparison between four isolates of Py. ramosum on PDA at different temperatures (P<0.01). A bar is representing for a standard deviation of three means. .... 106 Fig 7.4: A maximum likelihood tree showing phylogenetic relationships among Pythiogeton species using DNA sequences encoded from the ITS gene. The numbers at the nodes are the percentage of trees from bootstrap analysis (2000 replications). Access to trees can be found at http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access- code=d72e813919072ae4f8d28bd1665f0b31&format=html ...... 107 Fig 7.5: A maximum likelihood tree showing phylogenetic relationships among Pythiogeton species using DNA sequences encoded from the CoxI gene. The numbers at the nodes are the percentage of trees from bootstrap analysis (2000 replications). Access to trees can be found at http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access- code=d72e813919072ae4f8d28bd1665f0b31&format=html ...... 108 Fig 7.6: Mean colonization of Py. ramosum and P. deliense UQ6021 based on recovery of 1 cm segments from 5.5 cm long ginger pieces onto culture plates at 3 days after inoculation at 25, 30 and 35 °C in dark (bars represent standard errors, n = 4)...... 109 Fig 7.7: Disease severity levels (0-3) recorded on ginger infected with Py. ramosum and P. deliense UQ6021 at 30/35 °C (night/day) (bars represent standard errors, n = 6)...... 109 Fig 7.8: Cauliflower seedlings were attacked by Py. ramosum turning brown and rotten (left) in comparison to white and healthy seedlings in the control (right)...... 110

xvi

LIST OF TABLES Table 2.1: Common Pythium spp. that are well-identified based on either morphology or molecular techniques and highly virulent on ginger ...... 9 Table 2.2: Pythium spp. that need to be re-examined for either their species statuses or pathogenicity on ginger ...... 10 Table 2.3: Some common selective media for Pythium isolation with recent modifications ...... 16 Table 3.1: Morphologicala comparisons of sexual and asexual structures of P. myriotylum CBS254.70, P. zingiberis NBRC 30817 and two putative isolates of P. zingiberis recovered from PSR ginger...... 37 Table 3.2: Pairwise comparisons for level of identity (%) among four isolates of Pythium; sequences of nuclear and mitochondrial genes were extracted from whole genome data.39 Table 3.3: Virulencea at 3 days after inoculation of four Pythium isolates colonising on excised tubers/roots of five crop species ...... 44 Table 3.4: Disease indices (0-1) showing the virulence of four Pythium isolates on different crops ...... 45 Table 4.1: Species of Pythium and Pythiogeton recovered from ginger rhizomes and soil samples collected from commercial ginger fields in Queensland, Australia...... 57 Table 4.2: Morphological characteristicsa and growth rate of 10 species of Pythium recovered ginger rhizomes with PSR or from soil surrounding PSR ginger plants from commercial ginger fields in Queensland, Australia...... 58 Table 4.3: Comparisons of disease indices (0-1) recorded on flower, vegetable and common crops used in rotation with ginger in Australia, which were inoculated with Pythium spp.a ...... 62 Table 5.1: Pythium and fungal isolates used in this study ...... 70 Table 5.2: Genetic diversity compared among the five P. myriotylum and P. zingiberis isolates based on a summary of SNP information including sequence length, number of SNPs/gene, number of SNPs/kb and number of non-synonymous SNPs ...... 74 Table 5.3: Characteristics of non-synonymous SNPs in five P. myriotylum and P. zingiberis isolates; loci without non-synonymous SNPs were excluded in this table...... 75 Table 6.1: Mycoparasitism based on the extent of hyphal coiling (Type 0-4, see text for descriptions) and growth competition (0-7) based on the extent of colonisation in cm measured by the occurrence of oogonial formation of P. oligandrum against P. myriotylum and P. ultimum (n = 4) ...... 88 Table 6.2: Percentage of carrot baits colonised by P. oligandrum, P. myriotylum or both following exposure to soil used in the pot trials as shown in Fig 4 (n = 8, combining data from two replicate pot trials) ...... 92 xvii

Table 7.1: List of Pythiogeton spp. used in this study, isolates with BRIP numbers were used for morphological comparisons, growth rate and pathogenicity...... 99 Table 7.2: Morphological comparison between two groups of Py. ramosum isolated from ginger in this study ...... 105 Table 7.3: Comparisons of disease indices (0-1) for eight vegetable and five common rotation crops in ginger fields inoculated with P. deliense UQ6021 and Py. ramosum ...... 111

xviii

LIST OF ABBRIVIATIONS USED IN THIS THESIS AFLP – Amplified Fragment Length Polymorphism ANOVA – Analysis of variance BABA – DL-β-aminobutyric acid BCA – Biological Control Agents BLAST – Basic Local Alignment Search Tool BTH – 2,1,3 benzothiadiazole CA – Carrot agar CFU – Colony Forming Unit CMA – Corn meal agar CoxI – Cytochrome c oxidase subunit 1 CoxII – Cytochrome c oxidase subunit 2 DNA – Deoxyribonucleic acid dNTP - Nucleoside triphosphate DW – Distilled water ELISA – Enzyme-Linked Immunosorbent Assay ET – Ethylene FAO – Food and Agriculture Organization of the United Nations ITS – Internal Transcribed Spacer JA – Jasmonic Acid LAMP – Loop-Mediated Isothermal Amplification LSD – Least significant difference LSU – Large subunit M – Morphology MPVM – Pythium selective medium, including 5 ppm pimaricin, 100 ppm PCNB, 10 ppm rose bengal and 300 ppm vamcomycin MT – Molecular technique NADH – Dehydrogenase subunit 1 NARM – Pythium selective medium, including 10 ppm nystatin, 250 ppm ampicillin, 10 ppm rifampicin and 1 ppm miconazole P – Pathogenicity

P10VP – Pythium selective medium, including 10 ppm pimaricin, 200 ppm vancomycin and 100 ppm PCNB

P5ARP – Pythium selective medium, including 5 ppm pimaricin, 250 ppm ampicillin, 10 ppm rifampicin and 100 ppm PCNB xix

PARPH – Pythium selective medium, including 5 ppm pimaricin, 250 ppm ampicillin, 10 ppm rifampicin and 100 ppm PCNB, 50 ppm hymexazol PCNB – Pentachloronitrobenzene PCR – Polymerase chain reaction PDA – Potato dextrose agar PSR – Pythium soft rot q-PCR – Quantitative PCR RAPD – Random Amplified Polymorphic DNA rDNA – Ribosomal DNA RFLP – Restriction Fragment Length Polymorphism RGC – Resistant Gene Candidates RIRDC – Rural Industries Research and Development Corporation SA – Salicylic Acid SDS-PAGE – Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis SSR – Simple Sequence Repeats, also known as microsatellites SSU – Small subunit TIR NBS-LRR – Non-toll-interleukin receptor nucleotide binding site leucine rich repeat UPGMA – Unweighted Pair Group Method with Arithmetic mean V8 – V8 juice medium

VP3 – Pythium selective medium, including 75 ppm vancomycin, 100 ppm PCNB, 50 ppm penicillin and 5 ppm pimaricin WA – Water agar

Chapter 1 │General introduction Chapter 1 : GENERAL INTRODUCTION

1.1. Overview Ginger (Zingiber officinale Rosc.) is a perennial monocot herb that belongs to the family Zingiberaceae with 47 genera and 1,400 species (Hogarth, 2000). Within the family, ginger is considered the most common spice. It has been grown in China and India for over a thousand years and today it is cultivated widely throughout tropical and subtropical regions (Kavitha and Thomas, 2008). Currently, India and China are the world’s largest ginger producers, while the United States of America and Japan are the biggest importers (De_Guzman and Siemonsma, 1999). Fijian and Jamaican farmers produce the highest yield and the best quality ginger based on its chemical components, respectively (FAO, 2012; Glover, 2007). The edible part of the plant is the underground stem or rhizome which can be consumed either fresh from local markets or as an imported processed product (Kizhakkayil and Sasikumar, 2011). In addition, people have for centuries used ginger as a medicine for treating headache, nausea, colds, stomach upset and diarrhoea (Shukla and Singh, 2007). Recently, ginger has shown promise in trials to treat cancers, diabetes, and high blood pressure (Anonymous, 2010; Hamilton, 2011; Krell and Stebbing, 2012; Langner et al., 1998; Nicoll and Henein, 2009; Shukla and Singh, 2007; Zachariah, 2008).

Ginger was introduced into Australia as a crop in the early 20th century and has been cultivated on the Sunshine Coast, Queensland since 1916 (Hogarth, 2000). Presently, it is mainly produced under irrigation and on suitable friable soils from Bundaberg to Gatton in Southeast Queensland. The Australian ginger industry is quite small (less than 1% contribution to global share) with an involvement of around 30 full time growers, who produce approximately AUD 15.6 million at farm gate value per year (Camacho and Brescia, 2009). The annual production of the whole Australian ginger industry is estimated at about 8,000 tonnes with almost half of this delivered to the domestic fresh market and the remainder going for the processing industry inside the world’s largest ginger factory, Buderim Ginger Ltd. (Camacho and Brescia, 2009).

Despite the antibacterial and antifungal properties of ginger (Atai et al., 2009; Park et al., 2008; Shaista et al., 2010), it is still a host of at least 24 known plant pathogens (Dake, 1995). Among these pathogens, Pythium spp. which cause Pythium soft rot (PSR) disease are of the most concern around ginger growing areas throughout the world (Dohroo, 2005). The disease can be very destructive leading to crop failure and the pathogens which are very aggressive can induce visual symptoms within a week of artificial inoculation (Stirling et al., 2009). Pythium spp. can attack ginger plants at any growth stage in the field as well as at the postharvest stage, and result in losses

Chapter 1 │General introduction up to 100% and 90%, respectively (Dohroo, 2005; Stirling et al., 2009). Moreover, because Pythium spp. can survive in air dried soil for up to 12 years (Hoppe, 1966), fields infested with Pythium spp. can continue to be at risk for disease outbreaks for many years. According to Dohroo (2005), twelve Pythium species have been shown to cause PSR of ginger around the world. In Australia, P. graminicola Subram and P. myriotylum Drechsl were isolated and reported as early as 1962 (C.M.I., 1966; Teakle, 1962). However, in 2007 a severe PSR outbreak on ginger was observed and P. myriotylum was reported as a causal agent of the disease (Stirling et al., 2009). Several lines of research have been carried out to control the disease including modifying farming practices, and targeted use of chemical and biological agents. These approaches alone or in combination have shown promise, however when conditions are conducive for P. myriotylum development, losses can still be high (Smith et al., 2011; Smith and Abbas, 2011; Stirling et al., 2012). Unfortunately, since the first report of PSR outbreak on ginger in 2009 on the two oldest farms in Sunshine Coast, the disease has also been observed on many other farms and has continued to spread. Additionally, following initial research it was proposed that there may be more than one Pythium species involved in the soft rot disease in Australia. Therefore, a project funded by the Australian ginger industry and the Rural Industries Research and Development Corporation was initiated to assess Pythium diversity in ginger fields in Queensland, Australia.

1.2. Objectives The general objective of this study was to assess the diversity of Pythium spp. causing PSR on ginger and to investigate potential mechanisms of control through diagnostics and biocontrol options. For this purpose the thesis has been divided into five research chapters as follows. (1) Re-assessent of the species status of P. myriotylum recovered from PSR ginger (chapter 3) given it is morphological similar to Pythium zingiberis. For this comprehensive comparison and confirmation, international reference isolates of P. myriotylum and P. zingiberis were imported for the study. (2) Assessment of the diversity of Pythium spp. recovered from PSR ginger and soils around diseased ginger (chapter 4); these data are important for field consultants and farmers to develop appropriate control approaches since different Pythium spp. responsed differently to environmental changes. (3) A method for the rapid detection and accurate identification of pathogenic species of Pythium that did not rely on morphological and sequencing work was developed (chapter 5). (4) Examination of the interaction between pathogenic and non-pathogenic Pythium spp. as a potential tool for PSR disease control (chapter 6). (5) Report of Pythiogeton ramosum an under studied oomycete, as a new pathogen of soft rot disease on ginger in Australia (chapter 7). 2

Chapter 2 │Literature review Chapter 2 : LITERATURE REVIEW1

Abstract The aim of this chapter is to provide a comprehensive overview of Pythium soft rot (PSR) disease as well as the causal pathogens of the PSR recorded around the world. Additionally, discussion about past, present and future approaches for working with, detecting and identifying Pythium spp. have been taken into account in this literature review. A summary of all feasible and practical control methods of the PSR has also been included and finally recommendations for future research directions have been suggested. An ultimate goal of this review was to build up background knowledge to allow the candidate to address the research questions presented in this thesis.

2.1. Introduction Ginger (Zingiber officinale Rosc.) is a perennial monocotyledonous herb belonging to the Zingiberaceae, a family comprised of 47 genera and 1,400 species (Hogarth, 2000). Other important spices in the family include turmeric (Curcuma longa), cardamom (Elettaria sp.), mioga (Zingiber mioga), and galangal (Alpinia galanga). The entire family, including ginger, is presumed to be native to either Asia in general (Singletary, 2010) or specifically to India; however its exact origin is still unclear (Zachariah, 2008). Today ginger is cultivated worldwide throughout the subtropics and tropics where it plays an important role in agricultural economic systems in these regions (Kavitha and Thomas, 2008b). The usable part of the plant is the underground stem or rhizome which can be consumed either fresh for culinary purposes or as a processed product where it may be salted, dried, and/or powdered, used as a paste, or extracted as ginger oil or oleoresin (Kizhakkayil and Sasikumar, 2011). Ginger is planted and traded mainly in the form of fresh rhizomes in India, China, Indonesia and in other countries where it is grown. When imported into the United States, the European Union and Japan it is usually marketed in a processed form (De-Guzman and Siemonsma, 1999).

Flavour and pungency can vary considerably but it is not just cultivar, that contributes to this as environmental factors such as soil type, season, climate, cultivation practice, location, maturity and

1 This chapter was published as: Le, D.P, Smith, M., Hudler, G.W., Aitken, E., 2014. Pythium soft rot of ginger: detection and identification of the causal pathogens, and their control. Crop Prot. 65, 153-167. http://dx.doi.org/10.1016/j.croppro.2014.07.021. The manuscript was modified to keep the format consistent through out the thesis.

Chapter 2 │Literature review postharvest processes have also been shown to contribute to differences in these properties (Singletary, 2010; Vasala, 2010; Zachariah, 2008). In general the genetic diversity within Zingiber officinale is actually considered to be limited. Sasikumar et al. (2000) found this to be the case when they evaluated 14 ginger accessions in India, looking for differences in relative quantities of polyphenol oxidase, super oxidase dismutase and peroxidase. Similarly, Wahyuni et al. (2003) found a relatively close genetic relationship of 28 apparently diverse accessions of big, small and red ginger cultivars in Indonesia based on AFLP (amplified fragment length polymorphism) analysis of their respective DNA. Many other types of molecular markers have been used to assess levels of polymorphism in ginger, and in general the results show only low to moderate variation with just a few exceptions (Kizhakkayil and Sasikumar 2011).

The ginger rhizome contains carbohydrates, proteins, fats, fibre, water, and essential oils. In addition to its nutritional and flavour aspects, it has long been considered to have potential for multiple health benefits as illustrated by its use as a traditional medicine against headache, nausea, colds, and arthritis for as long as a thousand years by traditional people in Asia. More recent assessments by health scientists have shown that ginger may have a role in reducing certain cancers, diabetes, and high blood pressure and also have anti-inflammatory properties (Anonymous, 2010; Hamilton, 2011; Krell and Stebbing, 2012; Langner et al., 1998; Nicoll and Henein, 2009; Shukla and Singh, 2007; Vasala, 2010; Wright, 2011; Zachariah, 2008). However, there are still a few, albeit uncommon, minor adverse effects resulting from the consumption of ginger; these include slight gastrointestinal distress, heartburn, and oral irritation.

Properties of note associated with ginger are its antimicrobial aspects. It has been shown to act as an antibacterial agent (Park et al., 2008; Shaista et al., 2010) where it has been shown to inhibit growth of Escherichia coli, Proteus spp., Staphylococci, and Salmonella in vitro assays (Bhatia and Sharma, 2012; Janes et al., 1999; Stoilova et al., 2007; Voravuthikunchai et al., 2006). It has also been shown to have antifungal properties, inhibiting growth of Aspergillus spp., Saccharomyces spp., Mycoderma spp., and Candida spp. (Atai et al., 2009). Despite its antimicrobial properties, ginger is still a host of at least 24 known plant pathogens (Dake, 1995) including viruses (Nambiar and Sarma, 1974; Nishino et al., 1984; Suryanarayana and Pant, 2008), bacteria (Kumar and Sarma, 2004; Nishijima et al., 2004; Stirling, 2002), oomycete (Sharma and Jain, 1977; Stirling et al., 2009; Wang et al., 2003) and fungi (Gao et al., 2006; Overy and Frisvad, 2005; Rai, 1993; Sharma and Jain, 1977; Stirling, 2004).

Chapter 2 │Literature review The aims of this review chapter are to provide an overview of one particular problematic disease of cultivated ginger that occurs wherever ginger is grown. The disease is commonly known as “soft rot” and although the name suggests involvement of just one pathogen, it is actually caused by several species in the genus Pythium (Stramenopila: Oomycete). Historical and contemporary information on the biology and management of the respective pathogens will be discussed.

2.2. Impacts of Pythium soft rot on ginger production 2.2.1. Economic impacts Pythium soft rot of ginger is also known as soft rot or rhizome rot of ginger. Hereafter, the name Pythium soft rot (PSR) will be used to refer to the disease in question in order to avoid confusion with other common ginger diseases caused by Fusarium spp. and Ralstonia spp. where a rot is involved.

PSR was recorded in scientific literature for the first time when it was found in India more than a hundred years ago (Butler, 1907). Presently, PSR occurs in ginger growing countries throughout the world (Dohroo, 2005). The pathogens responsible for PSR can infect host plants at any stages of growth and even during postharvest storage when growth from latent infections can cause severe losses. Most Pythium spp. recorded on ginger flourish in the field when the soil temperature is high (26-300C) and soil moisture is near or at saturation (Lin et al., 1971; Sarma, 1994; Stirling et al., 2009). Such conditions occurred in the ginger growing region of Queensland, Australia during the summer of 2007-08 and resulted in 5-30% losses of immature ginger in some infested fields (Stirling et al., 2009). This was the first formal report of PSR in Australia, and the relatively high losses caused alarm among growers. However, consistently higher field losses have been reported in other countries; for example losses of 5-30% in Japan (Ichitani and Goto, 1982), 18-54% in Korea (Kim et al., 1996), 25% in Nepal (Nepali et al., 2000), 70% in Taiwan Lin et al (1971), 90% in India (Rajan and Agnihotri, 1989) and 100% in some fields in Fiji (Fullerton and Harris, 1998; Stirling et al., 2009). Stirling et al. (2009) also reported more than 50% loss of plants used for seed ginger production in Australia. In most cases these heavy losses have occurred in years when weather conditions were favourable for pathogen growth (Fig. 2.1). The impact of Pythium spp. can also be high in storage; losses ranging from 24-50% have been reported with rates occasionally exceeding 90% in India (Dohroo, 2005; Nepali et al., 2000).

Chapter 2 │Literature review 2.2.2. Ecological impacts Pythium spp. are able to persist in soil for long periods and the assumptions have been that this is mostly by means of encysted zoospores, oospores and sporangia (Hendrix and Campell, 1973; Madsen et al., 1995). Evidence for this has been shown by Stanghellini (1971) who found that sporangia of P. ultimum can remain viable in air dried soil for a year without reduction in germination. Hoppe (1966) also reported that some Pythium spp. survived in air dried soil for up to 12 years and Garren (1971) reported that P. myriotylum remained infectious for approximately a year when it was held in soil enclosed in a plastic bag at room temperature. Persistence is also influenced by survival on host tissue. For example, P. zingiberis oospores lost capability to germinate within 70 days after burying in soil in the absence of susceptible hosts (Samejima and Ichitani, 1988). Pythium spp. in general have quite a wide host range, so they can survive long periods of time in the field on alternative hosts including weeds. Consequently, susceptible crops may still be affected if replanted into an infested field years after fallows or rotations. Certainly, Lin et al. (1971) in Taiwan observed that ginger yields were still not acceptable in the year following a serious disease outbreak caused by P. myriotylum. In Australia, yields were still impacted up to 7 years after a serious outbreak of PSR. In Japan, Ichitani and Goto (1982) found that P. zingiberis was still detectable from previously infested soils 4-5 years after rotations with non-host crops and consequently PSR developed when ginger was re-introduced to these fields.

Fig 2.1: Ginger crop in Australia with symptoms of PSR. The disease progressed quickly down the row in saturated soils after a prolonged, heavy rainfall event.

Chapter 2 │Literature review 2.3. Soft rot symptoms Early detection of PSR is essential in order for action to be taken in time to reduce crop losses. For farmers, the disease is mainly identified by above ground symptoms such as wilting and yellowing. Symptoms of PSR first appear on above ground parts at the rhizome-stem intersection or “collar” in the form of watery, brown lesions. These lesions then enlarge and coalesce, causing the stem to rot and collapse (Dohroo, 2005). On the leaves, the initial symptoms caused by the basal infection appear as yellowing of the tips of older leaves first then gradual extension of the yellow down along the margin to so that the rest of the leaf blade and, eventually, the sheath become chlorotic. As older leaves wilt and become necrotic, the younger leaves start to develop a similar symptom progression until the entire plant dies (ISPS, 2005) (Fig. 2.2). Once that happens, diseased stems can be easily dislodged because there is so little structural integrity left connecting it to the rhizomes (Dohroo, 2005). However, if the infection is not severe the ginger plants may survive, but they will be less vigorous and stunted (Liu, 1977a). Rhizomes from diseased plants appear brown, water soaked, soft and rotten, and decay gradually (Dohroo, 2005; Haware and Joshi, 1974).

If a diagnosis of the disease is just simply based on the above ground symptoms, it could be mistaken for symptoms of either Fusarium yellows caused by Fusarium oxysporum f. sp. zingiberi or bacterial wilt caused by Ralstonia solanacearum. However, closer inspection of symptoms should enable differentiation of the three diseases. For Fusarium yellows, symptoms are an initial yellowing at leaf margins on lower leaves with yellowing eventually extending to entire leaves and then wilting and drying of plants generally in patches within a field (Dohroo, 2005; Pegg and Stirling, 1994). For Ralstonia wilt, infected plants show curling of the leaves, initially outwards, followed by yellowing and wilting (Pegg and Stirling, 1994). Traditionally, diagnoses would be based on disease symptoms followed up with cultural techniques where diagnosis would be based on fungal/bacterial morphology. However, the deployment of molecular techniques can lead to more rapid identification but also has the capacity to allow soil testing for presence of the pathogen.

Chapter 2 │Literature review

Fig 2.2: Early symptoms of PSR in the form of water-soaked and brown coloured area on sheath collar (top left), whole dead infected plant (left plant top right) with stem still standing but easily pulled out of the ground. A healthy rhizome (bottom left) and diseased rhizome (bottom right), the latter with soft, dark brown lesions at the buds (Le, 2010).

2.4. Pythium spp.– causal agents of the soft rot disease Pythium spp. are fungal-like microorganisms belonging to the family of Pythiaceae in the order Peronosporales of the phylum Oomycete, a member of the kingdom Stramenopila (Webster and Weber, 2007). Stramenopila differ from true fungi in many ways, foremost of which are: (1) production of biflagellate zoospores; (2) a thallus comprised of aseptate hyphae with cell walls predominantly comprised of β-glucans and cellulose; and (3) a diploid vegetative state (Agrios, 2005; Ho, 2009; Schroeder et al., 2013). Pythium spp. can reproduce sexually via fusion of two morphologically distinct gametangia to yield oospores or asexually via zoospores which are produced within spherical sporangia. Sexual reproduction in some species is homothallic (gametangia originating from the same hypha) whereas in others it is heterothallic with gametangia originating from each of two compatible mating types. Nourishment comes from necrotrophic or saprophytic action and many species within the genus are parasitic on plants or animals (Plaats- Niterink, 1981). Historically, workers have described just over 120 species of Pythium based on sexual and asexual structures (Dick, 1990) but with increased use of DNA sequencing to delineate species, there are now more than 300 Pythium spp. recorded on MycoBank (www.mycobank.org). However, a number of synonymous and doubtful species listed in the MycoBank database should be carefully reviewed when describing and recording new and available species.

Chapter 2 │Literature review According to Ho (2009), Pythium species are distributed worldwide, ranging from tropical to temperate sites and even in the Arctic and Antarctic regions. Many species of the genus are common and important pathogens of fruit, vegetable and ornamental crops where they may cause seed rot, seedling damping off and root rot or any combination thereof (Agrios, 2005). On ginger, there are many Pythium spp. associated with soft rot disease (Sharma and Jain, 1977; Dohroo, 2005). Some of these have been well-documented for their identities and pathogenicity on ginger (Table 2.1), whereas some reports do need further investigations as pathogenicity tests were not necessarily carried out or identifications not confirmed or taxonomical descriptions have been reassessed following molecular analysis (Table 2.2).

Table 2.1: Common Pythium spp. that are well-identified based on either morphology or molecular techniques and highly virulent on ginger Species Countries Species References recorded identified bya Pythium Bangladesh M, MT, P Chowdhury et al. (2009) aphanidermatum (Edson) Fitz China M, MT, P Li et al. (2014) India M, MT, P Butler (1907), Philip (2005), Shahare and Asthana (1962) Japan M, P Ichitani and Shinsu (1980)

P. deliense Meurs India M, MT, P Haware and Joshi (1974), Jooju (2005) P. graminicola Subram Australia M, P Teakle (1962) China M, MT, P Yuan et al. (2013) Fiji M, MT Lomavatu et al. (2009) Hawaii M, P Trujillo (1964) India M, P Anonymous (1963), Park (1935) P. myriotylum Australia M, MT, P C.M.I. (1966), Stirling et al. (2009) Drechsler Fiji M, MT, P Stirling et al. (2009) India M, MT, P Kumar et al. (2008), Philip (2005) Korea M, P Kim et al. (1997a) Taiwan M, P Lin et al. (1971), Tsai (1991) P. spinosum Sawada Australia M, P Teakle (1960) Japan M, P Ichitani and Shinsu (1981)

Chapter 2 │Literature review P. splendens Braun India M, MT, P Shanmugam et al. (2010) Malaysia M, P Liu (1977b) P. ultimum Trow India M, MT, P Dohroo (1987, 2001) Japan M, P Ichitani and Shinsu (1980) P. vexans de Bary Fiji M, MT Lomavatu et al. (2009) India M, MT, P Philip (2005), Ramakrishnan (1949) P. zingiberis Japan M, P Takahashi (1954b) Takahashi Korea M, P Yang et al. (1988) a M: Morphology, MT: Molecular technique, P: Pathogenicity confirmed by Koch’s postulates

Table 2.2: Pythium spp. that need to be re-examined for either their species statuses or pathogenicity on ginger Species Countries recorded References

P. butleri Subram India Thomas (1938) P. complectens Braun India Park (1937) P. gracile (de Bary) Schrenk Bangladesh McRae (1911) Fiji Graham (1971) India Butler (1907) P. monospermum Pringsh India Butler and Bisby (1960) P. pleroticum T. Ito India Dohroo and Sharma (1985) P. volutum Vanterpool & Japan Plaats-Niterink (1981) Truscott Pythium spp. China Yuan et al. (2011) Nepal GRP (2009) Uganda Sonko et al. (2005)

2.5. Pathogenicity PSR on ginger was first observed in India with the description of the causal agent being P. gracile. Since 1907, numerous other Pythium species have been described as being associated with PSR although some species may, in fact, be synonyms of others. The following discussion will focus on Pythium spp. involved in PSR on ginger only and their pathogenicity. It is interesting to note that PSR has been recorded in all ginger growing countries, especially in India where most of different Pythium spp. have been recorded as causal agents of PSR. 10

Chapter 2 │Literature review P. gracile was originally recorded by Schenk (1859) on algae and was described based only on filamentous and non-swollen sporangia. Butler (1907) was first to report P. gracile causing PSR on ginger in India. With incomplete descriptions, P. gracile was later renamed P. monospermum Pringsh, a species which forms only filamentous sporangia according to the keys of Plaats-Niterink (1981) but later it was excluded by Dick (1990). This species had also been recorded as the causal agent of a disease called phycomycosis in horses in Australia and Japan (Hutchins and Johnston, 1972; Ichitani and Amemiya, 1980) and dogs in Australia (English and Frost, 1984). In 1987, the species that had originally been described as P.gracile was formally described as P. insidiosum by De Cock et al. (1987). However, in a review by Dohroo (2005) P. gracile was still considered as a synonym for P. aphanidermatum. This classification clearly has some contradictions and should be revisited, ideally with a thorough examination of the original type specimens of P. gracile and P. monospermum. The latter species was originally recovered from dead insects in water in Germany; then later recorded around the world (Plaats-Niterink, 1981) including as an endozoic parasite on nonstylet-bearing nematodes (Tzean and Estey, 1981). In addition to its record on ginger, P. monospermum has been reported on rice seedlings (Ito and Tokunaga, 1933) and sugarcane (Rands and Dopp, 1938).

A second species associated with PSR that is also in need of re-examination is P. butleri. P. butleri was originally considered as a separate taxon although based on its morphology it is quite similar to P. aphanidermatum (Drechsler, 1934). On ginger, P. aphanidermatum was recorded in China, India and Japan, but when assessed for pathogenicity on ginger in Japan in a pot trial, PSR symptoms were not observed (Ichitani and Shinsu, 1980). According to Drechsler (1934), P. butleri had a faster growth rate on media and produced larger oogonia than P. aphanidermatum. However, Krywienczyk and Dorworth (1980), following a serological assay, consolidated the two species under the name of P. aphanidermatum. Further morphological comparisons of a number of isolates identified as P. butleri and P. aphanidermatum carried out by Plaats-Niterink (1981) failed to identify characters that would reliably distinguish the two species. The consolidation of these two species was further confirmed by PCR-RFLP (restriction fragment length polymorphism) analysis of the ITS (internal transcribed spacer) regions (Wang and White, 1997). The technique consisted of PCR (polymerase chain reaction) amplification of the complete ITS gene including the 5.8S region of rDNA followed by digestion of the PCR product with four restriction enzymes: CfoI, HinfI, MboI, and TaqI (Wang and White, 1997). This will be discussed in more detail in another section of this review.

Chapter 2 │Literature review P. complectens, which has been recorded on ginger in India (Park, 1937) was first described and recorded as the causal agent of geranium stem rot by Braun (1924). Based on morphology, P. complectens was then considered to be P. vexans (Drechsler, 1946; Plaats-Niterink, 1981). Under the name of P. vexans, the species was recorded on many different host plants (Lévesque and De Cock, 2004; Plaats-Niterink, 1981). With recent advances in sequencing technology of specific loci, P. vexans and other species in clade K as categorised by Lévesque and de Cock (2004) were placed under two new genera, either Phytopythium (Bala et al., 2010) or Ovatisporangium (Uzuhashi et al., 2010). However, the latter was rejected by Schroeder et al. (2013) as the name Phytopythium was officially introduced first. The genus Phytopythium based on morphologic and phylogenetic analyses is placed between Pythium and Phytophthora (Bala et al., 2010; De Cock et al., 2010).

Pythium pleroticum was first isolated and described by Ito (1944) from water in Japan. Jacobs (1982) later isolated P. pleroticum from decaying leaves of Nymphoides peltata submerged under water and confirmed the species descriptions of Ito (1944). On ginger, P. pleroticum was reported causing PSR by Dohroo and Sharma (1985) and it has also been recorded as pathogenic on corn seedlings (Olaya et al., 2006). Plaats-Ninterink (1981) grouped P. pleroticum with other Pythium spp. producing globose hyphal swelling and plerotic oospores; however, the status of P. pleroticum remains uncertain and should perhaps be renamed.

The only heterothallic Pythium on the list of species associated with PSR is P. splendens. This species is known to produce abundant globe-shaped hyphal swellings in culture (Plaats-Niterink, 1981). Its pathogenicity on numerous plants has also been reported (Al-Sa'di et al., 2008a; Fu et al., 2005; Ploetz, 2004; Tojo et al., 2004). Unlike species which grow well at high temperatures (such as P. myriotylum, P. aphanidermatum, P. diliense, and P. graminicola) P. splendens causes root rot on host plants generally at 15-200C, far below the optimal growing temperature of 300C of these other species (Ploetz, 2004).

P. graminicola was first isolated and described from wheat roots in India and this Pythium species is believed to be pathogenic only on graminaceous plants by Chen and Hoy (1993), Martin (2008) and Plaats-Niterink (1981). However, others have described it as a causal agent of PSR on ginger in Fiji and India (Lomavatu et al., 2009; Philip, 2005; Ramakrishnan, 1949).

P. zingiberis which was first reported to cause PSR in Japan, has so far only been reported in one other country causing PSR on ginger, that being Korea. Although the pathogen supposedly has a

Chapter 2 │Literature review narrow host range limited to ginger and its close relatives (Samejima and Ichitani, 1988), it was also found to cause damping off on cabbage seedlings in Japan (Kubota and Abiko, 2000) and, interestingly, it was also recorded on leeches (Hirudinea) in Poland (Czeczuga et al., 2003). The record of P. zingiberis on leeches was based solely on morphological comparisons to the species as it appears in Dick’s (1990) key and so perhaps should be accepted with caution. Hopefully additional discoveries of this unique host/pathogen interaction will allow for more complete analysis via contemporary phylogenetics.

P. myriotylum, which was first isolated from tomato, is very similar to P. zingiberis in terms of morphology and some gene sequences (Lévesque and De Cock, 2004; Matsumoto et al., 1999). It is however known to have a worldwide distribution and attacks numerous hosts (Plaats-Niterink, 1981). Stirling et al. (2004; 2009) observed that disease severity caused by P. myritotylum on ginger was more strongly influenced by temperature rather than soil moisture. The pathogen was also very aggressive on ginger showing symptoms on aboveground parts of plants within a week of inoculation (Wang et al., 2003; Stirling et al., 2009). Additionally, another species called P. volutum was also considered to be synonymous with P. zingiberis by Plaats-Niterink (1981), but it is in fact quite distinct based on the cardinal temperature and oospore size according to Dick (1990) and Takahashi (1954a).

P. aphanidermatum and P. diliense are both common pathogens on many crops in warm regions. Morphologically they are similar in their production of inflated sporangia, in their antheridial mode and size of the oogonium (Dick, 1990; Plaats-Niterink, 1981), and they differ only by 3% within their ITS sequences (Lévesque and De Cock, 2004). Nonetheless, with slight differences in optimal growing temperature and a morphology characterized by a consistent bending of the oogonialphore towards the antheridium by P. diliense, the two species remain as two separate taxa (Dick, 1990; Herrero and Klemsdal, 1998; Plaats-Niterink, 1981). Both P. aphanidermatum and P. diliense can be distinguished by either RAPD (random amplified polymorphic DNA) analysis (Herrero and Klemsdal, 1998) or with multiplex PCR with specific primer sets (Arif et al., 2011).

P. spinosum has been recovered from rotten ginger rhizomes collected in Australia and Japan (Table 2.1), but when pathogenicity was tested on living ginger plants, no symptoms developed (Le et al., 2010). However, when P. spinosum was inoculated onto excised sections of ginger rhizome it fully colonised the tissue within 3 days when incubated at 27 °C. Only P. myriotylum colonised excised ginger rhizome more rapidly under these conditions (Le et al., 2010). Hence, it is assumed

Chapter 2 │Literature review that P. spinosum is either opportunistic or a postharvest pathogen of ginger. Similarly, P. ultimum was also isolated from ginger rhizomes in India and Japan, but efforts to fulfil Koch’s postulates of the Japanese isolate showed that P. ultimum was non-pathogenic on ginger (Ichitani and Shinsu, 1980). This is despite the fact that the host range of P. ultimum includes many plants in many genera and the pathogen is known to be quite aggressive on seedlings of some other hosts such as cabbage (Kubota et al., 2006a, b), maize (Da Silva and Munkvold, 2010), chingensai (Tanina et al., 2004), common bean (Lucas and Griffiths, 2004), okra (Priekule, 2007), geranium (Chagnon and Belanger, 1991) and lucerne (Denman et al., 1995). Dohroo (2001) confirmed that P. ultimum was a causal agent of PSR on ginger under postharvest storage conditions.

Regardless of the reports of many different Pythium spp. being the pathogens associated with PSR, interactions between species with regard to infection, disease development, and/or severity have been poorly documented in contemporary literature. This is despite it being known that PSR of ginger is more serious when it occurs in association with either Fusarium spp. or Meloidogyne spp. or Ralstonia sp. (Dohroo, 2001; Gupta et al., 2010; Mathur et al., 2002; Rajan et al., 2002). Further work is needed to confirm whether PSR on ginger is a disease complex, as is the case with other crops such as snap bean (Kobriger and Hagedorn, 1984), sugarcane (Lee and Hoy, 1992) and carrot (Suffert and Guibert, 2007), where disease is associated with many Pythium spp. It is proposed that PSR of ginger is caused by a complex of Pythium spp., so more research on this will be of interest. It is also important to establish that identification of the causal agent is accurate. The use of molecular identification along with accurate detailed morphological assessment verified by type specimen is essential.

2.6. Pythium isolation Pythium spp. can be recovered directly from infested tissue by plating onto media such as water agar, potato dextrose agar, corn meal agar or selective media with antibiotic amendments. Pythium spp. can also be recovered by soil dilution plating (see next section) or baiting methods (Martin, 1992). Baiting with cucumber seeds and excised potato tubers has been shown to be successful in recovering P. aphanidermatum from soil (Stanghellini and Kronland, 1985; Watanabe, 1984). A test of ten different plants as candidate baiting materials by Sánchez et al. (2000) showed that orange tree leaves and hemp seed cotyledons were the most successful for retrieving P. aphanidermatum and P. irregulare, the latter of which only produces filamentous, non-inflated sporangia. Likewise, Watanabe et al. (2008) concluded that seeds of hemp, perilla, and radish and leaves of bentgrass and rose were highly effective in attracting zoospores of P. helicoides, P.

Chapter 2 │Literature review myriotylum and P. aphanidermatum and consequently these were employed to “catch” those species from hydroponic solutions. Other successful methods have included the use of rhododendron leaf discs and Douglas-fir needle segments in obtaining Pythium spp. from forest soils (Weiland, 2011) and soybean leaf discs from soybean fields (Jiang et al., 2012). Thanks to the effectiveness of various methods, baiting is believed to be a useful tool for monitoring Pythium populations and forecasting disease occurrence under field conditions (Sánchez et al., 2000; Stanghellini and Kronland, 1985; Watanabe et al., 2008).

2.7. Pythium quantification Although a soil dilution plating method is considered to be a time-consuming and labour-intensive technique, it is still considered useful by some in quantifying Pythium spp. populations in soil in order to forecast a risk of disease outbreaks (Kernaghan et al., 2008; Stanghellini and Kronland, 1985). There are at least 15 different selective media developed for the isolation and quantification Pythium spp. directly from soil by dilution plating techniques (Mircetich and Kraft, 1973). From these 15 media, MPVM medium was evaluated and selected by Mircetich and Kraft (1973) as the most effective one. The MPVM medium was then modified by Ali-Shtayeh et al. (1986) to what was then described as VP3 medium making it less expensive by reducing the amount of vancomycin used (Table 2.3). Likewise, P5ARP was adapted from P10VP to make the medium still less expensive in preparation. The P5ARP medium has proved to be as effective as P10VP in Pythium spp. recovery from soil and mycelial growth (Jeffers and Martin, 1986). Recently, Morita and Tojo

(2007) modified P5ARP medium in order to create a medium referred to as NARM which does not require PCNB to recover and enumerate Pythium spp. According to Morita and Tojo (2007), the

NARM medium was as effective as P5ARP in inhibiting non-pythiaceous microorganisms; however, it yielded much better mycelial growth of tested Pythium spp. Another method which involves baiting with cucumber seeds and fresh potato tuber discs has been developed by Stanghellini and Kronland, (1985) and Watanabe (1984) to estimate the number of P. aphanidermatum propagules in soil.

Chapter 2 │Literature review Table 2.3: Some common selective media for Pythium isolation with recent modifications Original media Modified media

MPVM: 5 ppm pimaricin, 100 ppm PCNB, 10 VP3: 75 ppm vancomycin, 100 ppm PCNB, 50 ppm rose bengal and 300 ppm vamcomycin ppm penicillin and 5 ppm pimaricin (Ali- (Mircetich and Kraft, 1973) Shtayeh et al., 1986)

P10VP: 10 ppm pimaricin, 200 ppm vancomycin P5ARP: 5 ppm pimaricin, 250 ppm ampicillin, and 100 ppm PCNB (Tsao and Ocana, 1969) 10 ppm rifampicin and 100 ppm PCNB (Jeffers and Martin, 1986)

P5ARP: 5 ppm pimaricin, 250 ppm ampicillin, 10 NARM: 10 ppm nystatin, 250 ppm ampicillin, ppm rifampicin and 100 ppm PCNB (Jeffers and 10 ppm rifampicin and 1 ppm miconazole Martin, 1986) (Morita and Tojo, 2007)

PCNB: Pentachloronitrobenzene

Pythium inoculum potential in the soil may be critical for forecasting disease occurrence. Ikeda and Ichitani (1985) estimated that P. zingiberis at a density of between 10-1,000 oospores/g oven dried soil could induce disease on Chenopodium quinoa, a highly susceptible host to P. zingiberis, in controlled experiments. However, in the field they considered that the actual density of P. zingiberis required to cause PSR of ginger may be lower. In fact, Ichitani and Goto (1982) observed that although there was no P. zingiberis detected in soil after 6 years of rotation of non-host crops, PSR was still observed once ginger was replanted in that soil. It could not be determined whether P. zingiberis was reintroduced from seed ginger at planting or dilution plating was not sensitive enough to detect extremely low populations of P. zingiberis in the field. Alternatively, it could be theorized that even a very low initial inoculum density of Pythium spp. could result in disease, provided that favourable conditions for Pythium spp. development have been met. It is also well- known that the effectiveness of plating techniques is also dependent on the particular pathogenic Pythium sp. For example, the plating technique was sensitive enough to detect low populations of P. aphanidermatum at 2-4 cfu/1,000 L of hydroponic solution (Fukata et al., 2013). However, for other species such as P. myriotylum, a dilution plating method was more difficult, so that estimation of the population of P. myriotylum using this method before the growing season was not possible (Lumsden et al., 1975; Wang and Chang, 2003).

Though there have been numerous drawbacks to using selective media in recovery and quantification of Pythium spp., this method is still universally employed. In recent years, selective media have usually been used in conjunction with other approaches such as real time or quantitative 16

Chapter 2 │Literature review PCR for faster identification and quantification of Pythium spp. from soil, water and plant samples (Kernaghan et al., 2008; Schroeder et al., 2006; Schroeder and Paulitz, 2006). By monitoring either directly amplified PCR products bound with a fluorescent dye or complementary probe, or indirectly generated fluorescence applying the exonuclease activity of Taq polymerase, proportions of the PCR products or fluorescence could be determined directly (Okubara et al., 2005). Schroeder et al. (2006) successfully designed specific primers to amplify ITS regions in the DNA of P. ultimum, P. abappressorium, P. attrantheridium, P. hetorothallicum, P. rostratifingens, P sylvaticum and P. irregulare recovered from wheat field soils. Similarly, Kernaghan et al. (2008) also fully amplified ITS regions of P. ultimum and P. irregulare group I and IV in American ginseng field soil samples by using specifically designed primers. Additionally, qPCR was implemented to identify and quantify P. vexans based on the small subunit (SSU) and ITS region of the genome (Bent et al., 2009; Spies et al., 2011b). There are more than 20 different primer sets working specifically on a broad range of Pythium spp. that have been designed (Schroeder et al., 2013). Besides qPCR, Yuen et al. (1998) and Kyuchukova et al. (2006) have successfully employed indirect enzyme-linked immunosorbent assay (ELISA) in order to enumerate the number of propagules of P. ultimum and P. aphanidermatum in a sample. This technique has proven to be sensitive enough to detect P. ultimum at 1:5,000,000 culture dilution rate (Yuen et al., 1998) or at a level of 0.05 g mycelium of P. aphanidermatum per litre of nutrient solution (Kyuchukova et al., 2006). Recently, Fukuta et al. (2013, 2014) successfully developed a highly sensitive, quick and easy detection method, called LAMP (loop-mediated isothermal amplification) to monitor P. aphanidermatum and P. myriotylum from hydroponic solutions (this will be discussed in a next section). Together with conventional plating techniques, advanced molecular and monoclonal antibody technologies allow monitoring populations of Pythium spp. more easily and accurately.

2.8. Pythium identification and its advances 2.8.1. Morphology Pythium identification has conventionally been done by examining morphological characteristics in conjunction with the keys developed by either Plaats-Ninterink (1981) or Dick (1990). For specific countries, researchers can refer to keys of Robertson (1980) for species in New Zealand, Ali- Shtayeh (1986) for species in Israel, Watanabe (2010) for species recorded in Japan or Ho (2011) for species recorded in Taiwan. Although Pythium spp. can be identified to species level by experienced taxonomists based on morphology (Fig 2.3), it is considered not to be an easy task for those lacking experience with this genus (Lévesque and De Cock, 2004). In addition, procedures used for identification are often time-consuming and sometimes not sensitive enough to distinguish

Chapter 2 │Literature review closely related species (Ward et al., 2004). Due to these disadvantages, great efforts have been given to developing complimentary methods based on use of molecular tools.

1 2 3 3

4 5

6 7

8 10 11

Fig 2.3: Morphology of Pythium spp. associated with PSR of ginger: P. myriotylum (1, finger shaped appressoria and appressoria usually formed in cluster; 2-3, zoospore released from vesicle; 4, smooth, aplerotic oospore; 5 filamentous inflated sporangia), P. splendens (6, globese, smooth, terminal hyphal swelling), P. deliense (7, single antheridium applied to an oogonium and an oogonialphore winding towards the antheridium), P. zingiberis (8, oogonia formed in cluster and typical coiling antheridial stalks around oogonial stalks), P. aphanidermatum (9, single broad antheridium applied to an oogonium), P. ultimum (10, a smooth, terminal oogonium with single antheridium appearing from just right beneath the oogonium), P. spinosum (11, spiky intercalary oogonia).

Chapter 2 │Literature review 2.8.2. Molecular and monoclonal antibody approaches White et al. (1990) developed numerous universal primers to amplify non-coding ITS regions including the 5.8S gene of rDNA of all fungal and fungal-like taxa including Oomycete. Following this, many workers have designed different and more specific primers for targeting Pythium spp. (Schroeder et al., 2013). A large number of ITS sequences have already been deposited and made available for public access on the Genbank database. This has allowed the ITS region to become commonly used for quick and accurate identification of Pythium spp. to species levels by doing a BLAST (basic local alignment search tool) search (Lévesque and De Cock, 2004; Matsumoto et al., 1999; McLeod et al., 2009; Schroeder et al., 2013). Furthermore, many specific primer sets based on the ITS region designed for single Pythium species - including P. myriotylum, which can cause soft rot on ginger - have been reported (Schroeder et al., 2013; Wang et al., 2003). Nonetheless, ITS sequences sometimes show low divergence between some closely related species such as P. myriotylum and P. zingiberis (Lévesque and De Cock, 2004; Matsumoto et al., 1999), P. aphanidermatum and P. diliense (Herrero and Klemsdal, 1998) and P. attrantheridium and P. intermedium (Allain-Boulé et al., 2004) or intraspecific variation within species like P. myriotylum (Kageyama et al., 2005; Perneel et al., 2006), P. arrhenomanes (Chen and Hoy, 1993) and P. mercurial sp. nov. (Belbahri et al., 2008). Because sequences of the ITS gene may be difficult for species differentiation among Pythium spp. (Schroeder et al., 2013), sequencing alternative genes has been deployed. These include nuclear encoded β-tubulin, SSU (small subunit) and LSU (large subunit) (Belbahri et al., 2008; Kumar and Shukla, 2006; Lévesque and De Cock, 2004; Liu et al., 2012; Moralejo et al., 2008; Mu et al., 1999; Spies et al., 2011a; Tao et al., 2011), CoxI (cytochrome c oxidase subunit 1) (Kroon et al., 2004; Robideau et al., 2011), CoxII (Garzón et al., 2005b; Kageyama et al., 2005; Kammarnjesadakul et al., 2011; Martin, 2000; Nechwatal et al., 2005; Spies et al., 2011a; Villa et al., 2006) and NADH (dehydrogenase subunit 1) (Kroon et al., 2004; Moralejo et al., 2008).

ELISA has been applied for detection of viral plant diseases since the 1970s. Such assays can be quantitative and are relatively user-friendly (Martin et al., 2000). With the development of specific monoclonal antibodies, ELISA could be carried out to detect Pythium to species level (Bailey et al., 2002; Kageyama et al., 2002). Kageyama et al. (2002) were successful in using monoclonal antibodies (MAbs) in order to differentiate between P. sulcatum and P. myriotylum or P. zingiberis from infected tissues or soil. MAb E5 was developed to recognise P. ultimum in diseased roots of bean, cabbage and sugar beet by double-antibody sandwich ELISA (Yuen et al., 1998). Furthermore, ELISA conducted in combination with PCR amplification of the ITS1 region allowed

Chapter 2 │Literature review workers to differentiate ten species of Pythium and eight Phytophthora spp. The method also enabled staff to rapidly process numerous samples with a high level of confidence in identification (Bailey et al., 2002).

Protein electrophoresis analysis has been considered a useful approach for research of fungal taxonomy. Gill (1978) was successful in employing the method to separate Phytophthora (Ph) cinnamomi and Ph. cactorum based on the different protein electrophoretic patterns on a polyacrylamide gel. However, results from Chen et al. (1991) suggested that the reliability of the method was under question. Chen (1991) conducted SDS-polyacrylamide gel electrophoresis of soluble proteins to identify seven homothallic Pythium species (P. aphanidermantum, P. arrhenomanes, P. deliense, P. graminicola, P. irregulare, P. paroecandrum, and P. ultimum). Again the results were not convincing because protein banding patterns of P. aphanidermantum and P. deliense, P. graminicola and P. arrhenomanes had no distinguishable differences.

RAPD is a useful approach in genetic mapping and diagnosis as well as in studies for taxonomy and evolution (Williams et al., 1990) and it has been applied to detect Pythium spp. in some cases (Herrero and Klemsdal, 1998; Sagar et al., 2009). For instance, when three different primers OPA- 03 (5’-AGTCAGCCAC), OPA-15 (TTCCGACCC), and OPB-08 (GTCCACACGG) were used by Herrero and Klemsdal (1998), they were able to differentiate P. aphanidermantum isolated from cucumber from other species such as P. irreglare, P. ultimum, P. diliense and P. paroecandrum. The method was again used by Sagar et al. (2009) to check for variability in P. aphanidermatum recovered from ginger. The assay also showed the possibility of using RAPDs to detect P. aphanidermaum directly from plant material or soil (Sagar et al., 2009). However, the technique has poor reproducibility between labs (Schroeder et al., 2013). Like RAPD, AFLP is a useful technique in mapping and genetic studies (Al-Sa'di et al., 2008b; Lee et al., 2010). Moreover, AFLP was successfully used to identify 25 known Pythium isolates out of 48 blind samples without misidentification by double-digesting genomic DNA with two restriction enzymes: EcoRI and MseI (Garzón et al., 2005a). Compared to RAPD and AFLP, SSR (simple sequence repeats, also known as microsatellites) are more reproducible and co-dominant markers used in SSR are more informative, so this is considered a better approach for studying genetic diversity of Pythium (Lee et al., 2010; Lee and Moorman, 2008; Schroeder et al., 2013). SSR was employed to distinguish Pythium spp. within group F (Vasseur et al., 2005). Furthermore, Lee and Moorman (2008) found five out of 57 SSR markers could be transferable across labs and yielded specific PCR products for 22 different Pythium spp.

Chapter 2 │Literature review

RFLP could also be applied to differentiate Pythium spp. to species level by comparing specific DNA patterns obtained by digesting their DNA with restriction enzymes although this is commonly used to examine polymorphism within species of Pythium (Schroeder et al., 2013; Wang and White, 1997). Hence, Schroeder et al. (2013) emphasised that phylogenetic relationship of closely related species should be taken into account when the application of RFLPs is implemented for accurate species identification. Additionally, compared to sequencing, RFLP for species identification may be less sensitive. RFLP is often conducted in conjunction with PCR amplification of specific loci such as ITS, CoxI, CoxII, SSU, or LSU with the PCR amplicon being digested with restriction enzymes. For instance, PCR products of SSU and ITS regions were digested with Mbo I, Hinf I and Taq I, but resulted in bands that did not show any difference between P. graminicola and P. arrhenomanes and on this molecular evidence, Chen et al. (1992) suggested the consolidation of these two species. However, Chen and Hoy (1993) were successful in applying two enzyme sets: Cfo I, Hinf I, Mbo I, Taq I and Cfo I, Hinf I, Msp I, TaqI to cleave amplified genes of ITS and LSU respectively. The banding patterns strongly indicated the separation of four closely related species of Pythium: P. graminicola, P. arrhenomanes, P. aphanidermatum and P. myriotylum. Likewise, Wang and White (1997) concluded that the PCR-RFLP assays were reliable in Pythium identification by using four enzymes Cfo I, Hinf I, Mbo I and Taq I in order to digest PCR amplicons of the ITS gene of 36 plant pathogenic Pythium spp. Convincing species recognition was also obtained from digestion of either the ITS locus alone (Gómez‐Alpízar et al., 2011; Matsumoto et al., 2000; Watanabe et al., 2007), the CoxI gene alone (Martin, 1990; Martin and Kistler, 1990) or in conjunction with the CoxII gene (Kageyama et al., 2005).

Fukuta et al. (2013, 2014) successfully developed a set of six primers, including two loop primers, to specifically detect P. aphanidermatum and P. myriotylum using LAMP. This novel technique was developed by Notomi et al. (2000). LAMP allows DNA amplification to occur under a single constant temperature condition specifically, efficiently and rapidly (Nagamine et al., 2002; Notomi et al., 2000). Additionally, LAMP does not require an expensive PCR thermal cycler, so it is much cheaper and easier to carry out in comparison to conventional PCR or q-PCR (Fu et al., 2011). Another advantage of LAMP is that it does not require pure DNA templates for amplification. Dai et al. (2012) and Fukuta et al. (2013, 2014) reported that LAMP is ten times more sensitive than PCR, and LAMP can also amplify target DNA directly from crude tissue extracts. Consequently, this method appears very promising for development of a kit for field use (Fukuta et al., 2013, 2014).

Chapter 2 │Literature review

2.9. Control strategies 2.9.1. Chemical Recently a great deal of effort around the world has been directed toward control strategies for PSR of ginger. Control of PSR is difficult because Pythium spp. can persist in the soil for years once introduced (Hoppe, 1966), and it seems that a single approach does not work effectively to suppress the pathogens under field conditions (Mathur et al., 2002; Smith and Abbas, 2011). Smith and Abbas (2011) suggested an integrated program which was mainly based on cultural practices and a strict quarantine procedure to manage the disease. Mathur et al. (2002) found that combined application of soil solarisation and fungicides could effectively minimize PSR occurrence caused by P. myriotylum. Seed ginger (a section of the rhizome used as planting material) treatments with Ridomil® MZ (metalaxyl + mancozeb) at 6.25 g/L in addition to soil drench with Thimet (Phorate) and Ridomil MZ at 10 L/3 m2 plot at 60 days after sowing gave the best control of P. myriotylum on an experimental ginger field in southern Rajasthan, India. The treatments performed even better in solarized plots achieved by using a thick transparent polythene film over the soil surface for 20 days (Mathur et al., 2002). Another experiment conducted on a field naturally infested with P. aphanidermatum in Raigarh, India, showed that seed dipping applications with Ridomil MZ at a rate of 1.25 g/L could increase survival of rhizomes by about 30% in comparison to hot water treatment at 51 °C for 30 minutes (Singh, 2011). Interestingly, seed coating with Fytolan (copper oxychloride) 0.2% + Ridomil 500 ppm + Bavistin (carbendazim) 0.2% + Thimet could keep ginger rhizomes free from PSR in a pot trial (Rajan et al., 2002). Likewise, Smith and Abbas (2011) found that fungicides such as Metalaxyl, Ridomil, Maxim® XL (fludioxonil) and Proplant® (propyl carbamate hydrochloride) applied as a seed treatment gave significantly better control of PSR caused by P. myriotylum than Carbendzim seed treatment (considered as a standard seed dip in Australia) in a pot trial. A synergistic effect on control of PSR was also noted on the treatment of seed with both Metalaxyl and Phospot® (phosphorous acid). Unfortunately, it is now believed that large scale seed dipping to control PSR can lead to cross contamination of seed pieces causing further spread of Pythium spp. to new fields when the treated seeds are used. Therefore, farmers in Australia are now advised to use Pythium-free certified seed ginger that is allowed to air dry until the cut surfaces are fully suberized. Instead of dipping, Lokesh et al. (2012) suggested that seed ginger can be solarized at 47 °C under 200 µm polyethylene sheets for 30 min for Pythium spp. disinfestation. However, this method alone was not effective in reducing PSR occurrence (Lokesh et al., 2012). In addition, a long period (up to 4 weeks) of soil solarisation resulted in a significant decline in Pythium spp. populations and a lower disease incidence in solarized plots (Christensen

Chapter 2 │Literature review and Thinggaard, 1999; Deadman et al., 2006). Until more effective and efficient alternative approaches are developed to manage PSR, chemical applications still remain the most important tool in the control of PSR of ginger, despite the fact that chemical usages are associated with problems such as high cost, environmental pollution and side effects to beneficial microorganisms (Agrios, 2005). In recent years, numerous environmentally friendly control measures against PSR have been investigated.

2.9.2. Biological agents Trichoderma spp. are the most widely used biological control agents (BCAs) in control of PSR of ginger. Rathore et al. (1992) confirmed that non-volatile and volatile compounds produced by T. viride could inhibit the growth of P. myriotylum recovered from infected ginger by 70 and 100%, respectively when assessed in Petri plates. P. myriotylum treated with these compounds formed few oogonia. In addition, T. harzianum and T. saturnisporum also showed strong antagonism against P. splendens in vitro (Shanmugam et al., 2013). Along with Trichoderma spp., several rhizobacteria were also antagonistic and showed significant inhibition of P. myriotytlum growth in dual culture assays (Bhai et al., 2005).

By applying what is known as the “poisoned food technique”, Dohroo et al. (2012) found that growth of P. aphanidermatum on PDA amended with onion and garlic extracts at 5% and 7.5% (v/v), respectively, was completely inhibited. Unusually, using a similar technique, fresh and stored cow urine were assessed and found to strongly inhibit the growth of P. aphanidermatum at a concentration of ≥ 20% (v/v) (Rakesh et al., 2013).

Pot trials with the above BCAs have also given some promising control of PSR of ginger. For example, soil inoculation with T. harzianum colonized wheat grains (9.9 x 108 CFU/g) at the time of planting resulted in suppression of Pythium sp., and disease severity were reduced to just 3% compared to a control treatment without T. harzianum at 81% (Rajan et al., 2002). Ram et al. (2000) coated seed ginger with a Trichoderma spp. slurry2 and found that the percentage of PSR incidence on Trichoderma spp. coated ginger was 2-3 times less than that of the control coated seed ginger without Trichoderma spp. Suppression of PSR was even better, reducing PSR incidence up to four times, when seed ginger was first surface disinfested in 1% HOCl for 5 min, soaked in a suspension of Trichoderma spp. talc-based formulation (6 x 107 CFU/L) and followed up with three

2 Slurry contains 30 g cultures of Trichoderma spp. + 30 g autoclaved fine clay + 50 mL sterile water to make a final concentration of 2.3-3.1 x 104 CFU/g. 23

Chapter 2 │Literature review applications of talc-based formulation (3 x 106 CFU/g) to the soil at 15-day-intervals from time of planting (Shanmugam et al., 2013). According to Gupta et al. (2010), by providing a combination of different modes of action by antagonists, the level and consistency of disease suppression was enhanced. An application of T. harzianum + Glomus mosseae + fluorescent Pseudomonad strain G4 limited infection by P. splendens to 10% compared with 30, 43, and 50% infection in treatments with T. harzianum, G. mosseae, and G4 as single treatments, respectively. Interestingly, seed dipping in a suspension of P. fluorescens or Bacillus sp. (108 CFU/ml) for 1 h combined with inoculation with Glomus sp. at time of planting showed absolute suppression of PSR (Bhai et al., 2005). Moreover, it is well-known that antagonists may also play a role as plant growth promoters. In fact, compared to soil free of biocontrol agents, growth and yield of ginger growing in soil with antagonistic agents were better (Bhai et al., 2005; Gupta et al., 2010; Shanmugam et al., 2013).

Although BCAs have performed impressively in pot trials for the control of PSR, the efficacies of these agents in the field are usually variable and inconsistent. The performance of T. harzianum in controlling PSR incidence in fields with a history of the disease was just around half of that in the pot, and continue to decline by nearly 1.5 times after three seasons of the applications (Singh, 2011). However, Singh (2011) reported that T. harzianum was able to suppress PSR to the same level as Ridomil® MZ. Shanmugam et al. (2013) also reported that though the efficacies of BCAs were lower in fields, better control was achieved when several BCAs were applied together. Additionally, PSR on field-grown ginger may usually be associated with the occurrence of other diseases such as bacterial wilt and Fusarium yellows, so the efficacies of BCAs can be difficult to determine. In fact, control of PSR by T. harzianum was greatly reduced in the presence of F.oxysporum f.sp. zingiberis because the fungus exacerbated PSR of ginger (Rajan et al., 2002). It is evident from these reports that the efficacies of BCAs greatly depends on methods and frequency of application and inoculum concentrations and relied on their ecological competence in native soils, as well as microbiological competition (Papavizas, 1985). Although biological agents for the control of PSR are seen as eco-friendly, many of the commercial products have yet to demonstrate their economic value for controlling PSR of ginger in the field.

2.9.3. Cultural practices Cultural practices including crop rotation, tillage, organic amendment, drainage, and quarantine are commonly employed on ginger fields to control PSR and limit the spread of Pythium spp. to fields that are unaffected. These practices have been designed to: 1) improve soil health by enriching organic matter thereby creating a more diverse and disease suppressive soil biota; and 2) contain

Chapter 2 │Literature review Pythium spp. within the infested area and limit spread to other areas that are free of disease. Most of the Pythium spp. that have been recorded on ginger are also pathogenic on a wide host range, so crop rotation may not be necessarily a useful approach to control Pythium spp. on ginger. However, Harvey and Lawrence (2008) suggested that crop rotations could change the prevalence of Pythium spp. populations within a field, such that each crop would be associated with a particular Pythium species and therefore potential inocula could be reduced in annual rotation fields. Urrea et al. (2013) found that diversity of Pythium spp. greatly depends on rotation of susceptible host crops and the diversity was poor in mono-culture systems. Similarly, Pankhurst et al. (1995) found pathogenic Pythium spp. increased and became dominant in mono-cropping regimes. Rames et al. (2013) also concluded that species richness of fungal and bacterial soil populations were significantly greater in plots with a 4-year program of summer and winter crop rotations compared with plots treated with fumigant or left as bare fallow. A field with continuous growth of pasture grass (Digitaria eriantha subsp. pentzii), where all the green biomass was returned to the field before the ginger was grown also showed a higher diversity of soil biota compared with the fallowed field (Rames et al., 2013). Along with crop rotations, amendment of organic matter, including poultry manure and sawdust (200t/ha) enriched diversity of soil microbial communities in these ginger fields (Rames et al., 2013). These practices also increased soil carbon levels and water infiltration rates which supported growth and yield of ginger and helped suppress PSR on ginger (Smith et al., 2011; Stirling et al., 2012). The role of soil microorganisms in suppressing PSR was confirmed in pot trials where soils from two farms were either fumigated with 1,3 dichloropropene (Telone®) or irradiated at 25 kGy in order to eradicate soil biota. Consequently, PSR in the treated soils was significantly higher than that in control soils without fumigation or irradiation (Stirling et al., 2010). However, Stirling et al. (2012) indicated that once conditions for P. myriotytlum development are ideal, such as high temperature and saturated soils, approaches to retain the presence of antagonist soil microorganisms were not as effective at controlling the pathogen. Stirling et al. (2012) showed that one application of organic manure was not sufficient to allow maintenance of soil C levels after three years cultivation, indicating that total C dropped from 54 g/kg to 39 g/kg which was not significantly different from that found in a bare fallow field. Thus, regular applications of green biomass and organic amendments to the soil are required to maintain the soil C content (Kibblewhite et al., 2008; Smith et al., 2011). Sharma et al. (2010) found a significant negative relationship between organic carbon content and PSR incidence and indicated where soil had an organic carbon content greater than 2.25%, the incidence of PSR was less than 15%.

Chapter 2 │Literature review Tillage practices that reduce soil disturbance should also be taken into account for good ginger farming and control of PSR. Rames et al. (2013) found that minimum tillage led to soils with higher microbial populations compared to conventional tillage practice. However, the soils in minimum till fields also tended to set hard, subsequently, ginger establishment and growth was poor following direct mechanical drilling of the seed (Smith et al., 2011). To overcome this problem, Smith et al. (2011) proposed that beds under minimum tillage with rotation crops should be rotary-hoed before planting seed ginger to create better till for germination and growth of the crop.

Interestingly, integration of neem (Azadirachta indica) seed powder and punarnava (Boerhavia diffusa) leaves, instead of poultry manure, into soil at the time of land preparation also reduced PSR intensity in ginger by up to 89% in comparison to the untreated control (Gupta et al., 2013). Application of neem seed in the form of neem cake at 0.5% mass/mass soil was found to suppress P. aphanidermatum. However, neem cake did not directly inhibit P. aphanidermatum, but increased the number of beneficial microorganisms that suppressed disease (Abbasi et al., 2005). Farmers in some regions in India mulch ginger beds with local green leaves instead of saw-dust or woodchip as is the practice in Australia. The mulching materials included Artemisia vulgaris, Schima wallichii, Eupatorium odoratum, Alnus nepalensis and Datura spp. which have some anti-microbial activities and could be playing a role in disease suppression (Kumar et al., 2012). Kumar et al. (2012) reported that S. wallichii and Datura spp. were the best mulches with regard to suppressing PSR caused by P. aphanidermatum with disease incidence at 12 and 14%, respectively compared to 48% in a control, non-mulched treatment.

Because Pythium spp. produce zoospores which are able to swim and spread in free water, Smith and Abbas (2011) suggested that good water drainage is important in PSR control. Drain breaks that are strategically placed across the field can intercept zoospores in surface water moving along beds and interrows and save the field downslope from further infestation. The drain breaks have proven to minimise losses to PSR (Fig. 2.4). Kim et al. (1998) also showed that PSR incidence was reduced by around 70% in fields with narrow ridge cultivation, in comparison to a control, unridged field. However, this practice was considered impractical since yield of the narrow ridge cultivated ginger was half that of the control, unridged field. In addition to zoospore movement in water, Pythium spp. can also be spread in soil adhering to vehicles, farm machinery, tools and footwear. Hence, it is strictly required that all equipment subjected to Pythium spp. contamination must be disinfested before entering and leaving a field to contain the spread of the pathogens responsible for PSR.

Chapter 2 │Literature review

Fig 2.4: Ginger fields showing good drainage practice, a method which helps to minimize PSR spread to adjacent paddocks. Drain breaks (arrow) helped stop the spread of P. myriotylum within a ginger field leaving the bed with early PSR infection free of ginger allowing the rest of the paddock to still produce a viable crop. [Photos courtesy of Rob Abbas, Consulting Pty. Ltd.]

2.9.4. Host plant resistance Though, to some extent, PSR of ginger can be suppressed by chemical, biological and cultural practices, the pathogens responsible for PSR can still lead to plant death or at the least yield losses. While developing a Pythium resistant variety would be ideal, none of the available edible ginger varieties are resistant to the causal agents (Nair and Thomas, 2013). Senapati and Sugata (2005) screened of 134 ginger varieties available in Koraput, India and found one P. aphanidermatum resistant cultivar and eight others with moderate resistance. However, these data were not supported by other researchers around the country and it was reasoned that the resistant cultivar in this case probably had a regional specific reaction against P. aphanidermatum. Thus, the search for a ginger cultivar resistant to PSR continues.

Sterility and obligatory vegetative propagation of ginger (Nair and Thomas, 2013) continue to hinder breeding efforts and edible ginger (Zingiber officinale) remains a monomorphic crop even in the assumed centre of origin, India (Kizhakkayil and Sasikumar, 2011; Nair and Thomas, 2012). On the other hand, wild Zingiber species exhibit both sexual and asexual reproduction, and therefore offer the potential of introducing variability into the cultivated crop including potential resistance traits (Kavitha and Thomas, 2008c). For example, Nair and Thomas (2007) indentified 42 resistant gene candidates (RGC) belonging to non-toll-interleukin receptor nucleotide binding site leucine rich repeat (TIR NBS-LRR) from ginger and wild Zingiber spp. More specifically in Z. zerumbet, a putative soft rot resistant species, a pool of RGCs have been investigated by implementing mRNA

Chapter 2 │Literature review differential display analysis (Kavitha and Thomas, 2008a). However, as yet none of the characterised R-genes from Z. zerumbet, have been able to improve resistance in edible ginger cultivars by conventional breeding (Nair and Thomas, 2013). Nevertheless, ZzR1 gene involvement in Z. zerumbet defence against PSR is believed to a valuable genomic resource for future Pythium resistant ginger genetic improvement programs. Genetic transformation of ginger therefore offers another area of research worth exploring.

2.9.5. Induced resistance In the absence of genetic resistance to PSR, it may still be possible to offer effective control by upregulating induced resistance mechanisms. Applications of certain chemicals or plant extracts have been shown to activate a systemic resistance in susceptible plants (Agrios, 2005). Various chemicals are implicated in this response including salicylic acid (SA) and Karmakar et al. (2003) demontrated that treating seed ginger of a range ginger cultivars with SA and its analogs DL-β- aminobutyric acid (BABA), and 2,1,3 benzothiadiazole (BTH) resulted in significant reduction in subsequent PSR. This induction was associated with the upregulation of 3-5 induced resistant proteins even 8 weeks after the SA treatments. Similarly, Kavitha and Thomas (2008b) found that the highly susceptible ginger cultivar ‘Varada’ reacted positively to signalling chemicals including SA, jasmonic acid (JA) and ethylene (ET) that resulted in induced resistance against P. aphanidermatum. Interestingly, the non-susceptible Z. zerumbet showed no difference in the response to these signalling molecules when treated (Kavitha and Thomas, 2008b). On the other hand, genes responsible for a hypersensitive response and JA, SA, and ET biosynthesis were themselves markedly upregulated in Z. zerumbet when it was inoculated with P. myriotylum, while down regulation of these genes appeared in Z. officinale (Kiran et al., 2012).

In addition to chemical compounds, non-pathogenic strains of Pythium spp. and also herbal extracts have been used to induce systemic resistance in ginger. Ghosh et al. (2006) observed that ginger plants pre-inoculated with avirulent strains of P. aphanidermatum had reduced disease severity when later challenged with a pathogenic strain; this reduction in PSR was shown to correlate with an increase in expression of five particular defence proteins. Ghosh and Purkayastha (2003) observed a similar increase in resistance to P. aphanidermatum when ginger rhizomes were pre- treated with a dip comprised of six plant extracts. They concluded that 10% leaf extract of Acalypha indica applied as a seed rhizome dip was effective protecting plants against PSR, as was treatment with JA. Furthermore, seed ginger treated with 10% root extract of Boerhaavia diffusa followed by

Chapter 2 │Literature review three foliar sprays of the suspension at weekly intervals were found to lower PSR incidence (Pandey et al., 2010).

2.10. Concluding remarks There is no doubt that ginger plays an important economic role in many countries around the world and its medicinal properties have increasingly drawn great attention. The plant is also host to more than 20 different pathogens and among them Pythium spp. that cause PSR are the most troublesome worldwide. Although fifteen Pythium spp. have been reported as ginger pathogens, some of them may be synonymous with others. Therefore, species status and pathogenicity of some Pythium spp. on ginger need to be re-examined. Although PSR in some countries is commonly associated with bacterial wilt and Fusarium yellows and thus considered a disease complex, it seems that certain species of Pythium by themselves are responsible for PSR of ginger. PSR of ginger can be complex, so further work is necessary to determine interactions among Pythium spp. that cause PSR together with other soilborne pathogens and pests of ginger. The diversity of Pythium spp. has made species identification extremely difficult, especially with regard to morphological identification. Thanks to advanced technologies, identification of Pythium spp. can be more accurate and reliable by sequencing various gene loci such as ITS, LSU, SSU, CoxI, CoxII and β-tubulin. Other approaches, namely RFLP, RAPD, SSR, q-PCR, ELISA and SDS-PAGE have been well proven as diagnostic tools in identifying Pythium spp. With the recent development of LAMP for P. aphanidermatum and P. myriotylum, this technique gives new hope for a quick and accurate means to detect pathogenic species of Pythium in the field for farmers without the need to return the samples to a lab. Unfortunately, current available reference sequences and the above techniques have not been able to separate closely related species affecting ginger such as P. myriotylum and P. zingiberis. With the new era of sequencing technology (next generation sequencing), the whole genome sequence of single species can be easily and accurately obtained. Currently, several Pythium spp. have been fully sequenced and deposited in Genbank. Hopefully, these freely available valuable resources will be useful in finding a better gene region for differentiation of closely related species or pathotypes. Many strategies including chemical, biological, cultural and induced resistance have been proven to be promising in controlling PSR. However, the effectiveness of each of these strategies by itself has not achieved effective levels of control in the field. Therefore, in order to minimize losses caused by PSR in the field, it is necessary to integrate all applicable approaches. Improving soil health by applications of BCAs, organic matter, minimum tillage, and the use of suitable crop rotations should reduce the inoculum densities of pathogenic Pythium spp. as well as lead to their suppression by increasing competition through enrichment in numbers and diversity of

Chapter 2 │Literature review beneficial microorganisms in the soil. At the same time such healthy soils should promote ginger growth allowing the plant to cope better with both biotic and abiotic stress.

It will also be important to use certified clean seed and strategic applications of chemicals or plant extracts to control PSR as part of an integrated program. Where PSR is observed in the field, spot drenches can be helpful and subsequent good quarantine practice should avoid cross infections.

PSR can be controlled; however, the ultimate goal would be the development of PSR resistant ginger cultivars and with recent success in R-gene isolation from a donor species Z. zerumbet, a PSR resistant variety will hopefully be released in the near future.

Chapter 3 │Re-appraisal of P. zingiberis Chapter 3 : COMPARISON OF MORPHOLOGY, GENETIC AND PATHOGENICITY OF ISOLATES OF PYTHIUM MYRIOTYLUM AND PYTHIUM ZINGIBERIS 3

Abstract Pythium myriotylum and P. zingiberis have both been implicated in soft rot of ginger (Zingiber spp.). The status of these two taxa as distinct species follows original descriptions of physiology, morphology and pathogenicity. However, their status has been questioned by phylogenetic analyses. In this study, putative P. zingiberis isolates recovered from edible ginger (Zingiber officinale) rhizomes with Pythium soft rot (PSR) disease sampled from Yandina, Sunshine Coast, Australia, were compared with reference isolates of P. myriotylum from peanut in Israel (CBS254.70) and P. zingiberis from ginger in Japan (NBRC30817). All isolates differed slightly in temperature optima for growth and produced similar sizes of oogonia and oospores. Sequence homology of 20 gene fragments retrieved from nuclear and mitochondrial genomes ranges from over 99 to 100% to each other. In vitro pathogenicity assays were conducted on excised carrot, ginger, potato, radish, and sweet potato tuber/root sections and on seeds and seedlings of cucumber, cauliflower, millet, rye, sweet corn, tomato and wheat with each of the isolate. The reference isolate P. zingiberis NBRC30817, which previously was believed to have a narrow host range, was pathogenic on a number of tested plant species. Analysis of this comprehensive set of data allowed us to assign all tested isolates, including the isolate P. zingiberis NBRC30817, to the taxon P. myriotylum thus confirming that the causal pathogen of PSR disease of ginger in Australia is P. myriotylum.

Keywords: oomycete, morphology, molecular, Pythium soft rot, pathogenicity

3.1. Introduction The genus Pythium belongs to the Phylum Oomycete (Webster and Weber, 2007) and contains over 300 species (www.mycobank.org). Identification and classification of Pythium spp. were traditionally based on distinctive features of their sexual and asexual morphology (Dick, 1990; Plaats-Niterink, 1981). However, it is well known that many Pythium spp. could not be differentiated due to their close similarities in morphology (Moralejo et al. 2008). Moreover, the same Pythium sp. may exhibit morphological differences due to difference in geography and host

3 This chapter was partly published as: Le, D.P., Aitken, E.A.B. and Smith, M.K., 2015. Comparison of host range and pathogenicity of isolates of Pythium myriotylum and Pythium zingiberis, Acta Hortic. 1105, 47-54. DOI 10.1766/ActaHortic.2015.1105.1. The manuscript was modified to keep the format consistent through out the thesis.

Chapter 3 │Re-appraisal of P. zingiberis range (Perneel et al. 2006). Consequently, Plaats-Niterink (1981) consolidated and questioned species status of a number of Pythium spp. in her publication. More recently, with additonal aids of freely available ITS (internal transcribed spacer) and CoxI (cytochrome c oxidase subunit 1) sequences on Genbank, species boundaries of many closely related Pythium spp. have been revealed. However, there are still a number of other species disignations that remain questionable (Lévesque and De Cock, 2004; Robideau et al., 2011).

Species of interest within this study are P. myriotylum and P. zingiberis. P. myriotylum was identified as a causal pathogen responsible for the Pythium soft rot (PSR) disease outbreaks within the ginger industry in Queensland, Australia (Stirling et al., 2009). Nonetheless, the species status of this P. myriotylum has been questioned since isolates of the P. myriotylum associated with the PSR on ginger had a number of characters that were believed to be unique for P. zingiberis.

Although P. myriotylum and P. zingiberis have been accepted as two taxa (Dick, 1990; Ichitani and Shinsu, 1980; Uzuhashi et al., 2010; Takahashi, 1954; Watanabe, 2010), their status as two distinctive species needs a re-appraisal. P. myriotylum was first described in 1943 on tomato in the USA, but has since been reported as having a wide host range worldwide (Plaats-Niterink, 1981). Whereas P. zingiberis, originally reported from Zingiber mioga in Japan in 1954, has been recorded as a pathogen on only a few host species (mioga, ginger and quiona) and restricted to Japan and Korea (Takahashi, 1954; Yang et al., 1988).

Descriptions of P. myrtiotylum and P. zingiberis were originally based solely on morphological differences, but recent DNA sequence analysis of the ITS region of the ribosomal gene complex and the CoxI gene have shown these two species to be indistinguishable (Lévesque and De Cock, 2004; Matsumoto et al., 1999; Robideau et al., 2011). However, to date there has not been a comprehensive comparison of the morphology, physiology, molecular sequence and pathogenicity of these two Pythium spp. In this study, we have re-examined international specimens of P. myriotylum and P. zingiberis for their species status. In addition, we compared putative P. zingiberis recovered from ginger in Australia with the international isolates of P. myriotylum and P. zingiberis.

Chapter 3 │Re-appraisal of P. zingiberis 3.2. Materials and methods 3.2.1. Pythium spp. cultures A reference culture of P. myriotylum CBS254.70 used in the monograph of Plaats-Niterink (1981) (referred to as CBS254.70 here-after) were obtained from CBS-KNAW Fungal Biodiversity Centre, The Netherlands. A reference isolate of P. zingiberis NBRC30817 (NBRC30817) which was morphological confirmed by Ichitani and Shinsu (1980) was imported from the Biological Resource Centre (NBRC), Japan. The isolates were imported into Australia under the permit number IP13012598 issued by Department of Agriculture and Fisheries, Australia. Representative Australian isolates include: putative P. zingiberis Gin1 (UQ5980) isolated from PSR ginger sampled from Templeton farm in 2007 and P. zingiberis Gin2 (UQ6152) isolated from PSR ginger sampled from Eumundi farm in 2013 in Queensland, Australia. All isolates were maintained on PDA (Difco) for fresh working cultures. For long term storage, the cultures were placed on half strength corn meal agar (CMA) prepared from maize meal (polenta), based on the protocol of Dhingra and Sinclair (1995). The culture on the CMA was then submerged in autoclaved distilled water (DW) and stored at room temperature.

3.2.2. Hyphal growth rate The effect of temperature on daily hyphal growth rate of the five isolates was assessed on 9 cm Petri plates at 5 °C intervals from 5 to 40 °C. Plugs (0.5 cm2) of actively growing one-week-old culture were transferred onto PDA plates, using four plates per isolate. Plates were left at room temperature for at least 8 hours for initial growth. The edge of the colony was marked, and then incubated at each designated temperature for 24 hours. After 24 hours, the growing margins of the colonies again were marked. The radius of the colony in mm from the first mark to the second mark was measured at four locations and a mean radius calculated as the daily radial growth of for each isolate.

3.2.3. Morphology To observe morphological characteristics of each isolate, the grass leaf technique was deployed. For this, a soil extract solution was prepared by soaking 20 g of air dried sandy soil in 1 L DW overnight. The solution was filtered through 150 mm Whatman filter paper (No. 1), the filtrate was made up to a volume of 1 L and autoclaved at 121 °C for 20 min (McLeod et al., 2009). Plugs of each culture growing on PDA were submerged in a plate containing autoclaved soil extract to which two pieces (1 cm2) of autoclaved grass leaves (Pennisetum setaceum) were added. The plates were initially incubated at 27 °C for 2 days and then checked daily for the presence/absence of

Chapter 3 │Re-appraisal of P. zingiberis sexual/asexual structures. The resultant mycelial mats also were mounted on microscopic slides, stained with cotton blue, and observed under a BH2 (Olympus) microscope where measurements were recorded of morphological structures at 400x magnification. For each isolate, 20 of each morphological structure were arbitrarily selected and measured.

3.2.4. Sequencing Each isolate was grown in potato broth for approximately one week when mycelial mats were harvested for genomic DNA extraction using the CTAB protocol (Doyle and Doyle, 1990). The DNA was sequenced using Illumina platform for whole genome sequences. Geneious 7.1.4 was used to analyse the sequences. A reference annotated mitochondrial genome of P. ultimum BR114 was used as a template to identify conserved regions which were then retrieved and aligned for sequence homogeny.

3.2.5. In vitro test of virulence on excised roots/tubers The experiment was conducted based on descriptions of Le et al. (2010) with some modifications to test how rapidly each isolates colonised and grew along ginger pieces at 27 °C. Fresh market ginger rhizome, carrot root, radish, sweet potato and potato tubers were peeled and chopped into sticks (5.5 cm long x 1 cm wide x 1 cm high). These sticks were surface sterilized using 25% bleach (1% HOCl) for 1 min, washed twice again with autoclaved DW for 1 min, and blotted dry on autoclaved paper towels. Three sticks, representing three replications, were placed on moist sterile filter paper in 9 cm Petri plates. Small squares, approximately 5 mm2 of 7-day-old cultures from the tested isolates growing on PDA were excised and transferred to one end of each stick. After incubation for 3 days, each stick was cut up, the first 0.5 cm segment in contact with culture plug as removed, the the remaining cut into five smaller pieces (1 x 1 x 1 cm) in sterile and the piece on which the inoculum had been placed was removed. The remaining four pieces were plated on CMA + 3P (50µg/ml Penicillin, 50µg/ml Polymyxin, 25µg/ml Pirmaricin) in order of distance from the inoculated end of the sticks. Plates were incubated at the same temperature in the dark for 24 hours and then observed for growth of the isolate from each piece was recorded. A negative control treatment was conducted with the same procedure but with sterile PDA squares (no culture). The data were recorded as the extent of Pythium spp. colonisation, indicating virulence of tested Pythium spp. on the sticks from 0 (no colonisation corresponding to no virulence) to 5 (all 5 pieces colonised corresponding to most virulent).

Chapter 3 │Re-appraisal of P. zingiberis 3.2.6. In vitro pre-emerging damping off One-week-old cultures of each isolate growing on PDA were transferred onto 1.5% water agar (WA) medium, with three 9 cm Petri plates for each isolate representing three replicates and kept in an incubator set at 27 °C for a week. A negative control was also carried out with the same procedure using non-colonized PDA. Seeds of common rotation crops grown in ginger fields such as rye (Secale cereale), white millet (Panicum miliaceum), wheat (Triticum sp.) as well as vegetable crops including cauliflower (Brassica oleracea botrytis), cucumber (Cucumis sativus), sweet corn (Zea mays) and tomato (Solanum lycopersicum) were placed onto the WA plates (10 seeds/plate). The seeds were washed under running tap water for a 2 min, soaked in distilled water for an hour, surface sterilised with 25% bleach for 2 min, rinsed twice with autoclaved DW and then blotted dry with autoclaved paper towels. The plates were incubated at 27° C for 5 days before rating for disease. The disease index was calculated according to the formulation of Zhang and Yang (2000). 10 DI =∑푖=1 푋푖/40  DI is disease index scaling from 0 (all seedlings healthy after germination) to 1 (all seeds dead before germination). DI indicates degree of virulence of Pythium on tested crops. DI = 0 corresponds to no virulence; DI = 1 corresponds to most virulent.

 Xi is disease rating of the ith seed (from 1 to 10)  Number 40 is equal to the number of seeds multiplied with the highest rating scale (from 0 to 4).  Rating scale used in the experiment was: 0 = seed germinated and seedlings having no visible symptoms; 1 = seed germinated with light browning on roots; 2 = seed germinated with short and enlarging brown lesion on roots; 3 = seedlings died after germination; 4 = seed not germinated.

All data were subjected to analysis of variance (ANOVA) using Minitab 16 program. Separation of means was determined by Tukey’s least significant test (P ≤ 0.05).

3.3. Results 3.3.1. Radial growth rate There was no growth for any isolate at 5 °C and all isolates grew best at temperatures from 25-35 °C. The optimal growth temperature for CBS254.70, NBRC30817, Gin1 and Gin2 were 25, 30, 35 and 35 °C respectively. Daily growth rate at 25 °C of CBS254.70, NBRC30817, Gin1 and Gin2 were 30.96, 25.03, 22.48 and 26.14 mm respectively. All isolates showed little growth at 40 °C (Fig. 3.1), and stopped growth if kept at 40 °C for longer than 48 h. 35

Chapter 3 │Re-appraisal of P. zingiberis

45.00 CBS254.70 NBRC30817 Gin1 Gin2 36.00

27.00

18.00

Growthrate (mm/day) 9.00

0.00 5 10 15 20 25 30 35 40 Temperature °C

Fig 3.1: Radial growth rate (mm) on PDA of P. myriotylum CBS254.70, P. zingiberis NBRC 30817 and two putative isolates of P. zingiberis recovered from PSR ginger at 5 °C intervals from 5 to 40 °C. Bars represent standard deviations of four means, P = 0.05 as determined by Tukey’s test.

3.3.2. Morphology All cultures grew well on PDA and formed cottony colonies within a week at 25 °C. Hyphae were hyaline, aseptae and up to 8 µm wide (Table 3.1). Finger-like appressoria formed abundantly in singles or clusters in water cultures. Sporangia were filamentous inflated and up to 12 µm wide. All isolates were homothallic; sexual structures formed abundantly on agar and water cultures. Smooth- walled oogonia varied in size, ranging from 20 to 39 µm diam; however, the data were not significantly different between isolates (P > 0.05). Gin1 produced the largest oogonia on average (32.25 µm diam), while CBS254.70 produced the smallest ones on average (30.01 µm diam). Based on the classical definition, oospores were mostly aplerotic, but occasionally, plerotic oospores were also observed (Fig. 3.2). The largest oospores observed were the Gin2 culture, but on average CBS254.70 produced larger oospores (26.06 µm diam) than NBRC30817 (22.15 µm diam). On old cultures (> 2-week-old) of NBRC30817, Gin1 and Gin2, most oogonia were empty.

Antheridia were crook-necked and showed apical contact with oogonia. Two to six antheridia wrapped around and attached to each oogonium. In some observations, the number of antheridia/oogonium on Gin1 and Gin2 cultures could not be counted due to the complexity of antheridia wrapping around an oogonium.

Chapter 3 │Re-appraisal of P. zingiberis

Table 3.1: Morphologicala comparisons of sexual and asexual structures of P. myriotylum CBS254.70, P. zingiberis NBRC 30817 and two putative isolates of P. zingiberis recovered from PSR ginger. Sporangiab Oogonia Antheridiac Oosporesd

Diameter No. per

Isolates Hyphal width (µm) Characteristic Width (µm) Characteristic (µm) Characteristic oogonium Characteristic Diameter (µm)

CBS254.70 2-8 (av. 5.4 ± 2.2) F, I 4-12 (av. 7.7 Smooth 24-36 (av. D, M (occ.) 3-6 (av. 4.4 ± A, P (occ.) 20-29 (av.

± 2.7) 30.0 ± 4.0) 1.2) 26.1 ± 3.6)

NBRC30817 2-8 (av. 4.5 ± 2.0) F, I 4-12 (av. 8.1 Smooth 20-38 (av. D, M (occ.) 2-6 (av. 3.9 ± A, P (occ.) 16-28 (av.

± 2.3) 31.2 ± 5.7) 1.3) 22.2 ± 5.0)

Gin1 2-8 (av. 4.8 ± 1.8) F, I 4-12 (av. 8.0 Smooth 24-39 (av. D, M (occ.) 2-8 (av. 4.2 ± A, P (occ.) 21-30 (av.

± 2.6) 32.3 ± 4.0) 1.8) 25.7 ± 3.7)

Gin2 2-8 (av. 5.4 ± 2.1) F, I 4-10 (av. Smooth 20-36 (av. D, M (occ.) 2-8 (av. 4.3 ± A, P (occ.) 18-32 (av.

7.8 ± 2.8) 31.4 ± 6.9) 1.8) 24.5 ± 5.4) a Each of the morphological characters presented here includes max, min and averaged (av.) values of 20 arbitrarily selected. b Sporangia were assessed for their characteristics: filamentous (F), inflated (I), and the width. c Antheridia were assessed for their characteristics: monoclinous (M), diclinous (D) (occ: occasionally), and the diameter. d Oospores were assessed for their characteristics: aplerotic (A), plerotic (P) (occ: occasionally), and the diameter.

Chapter 3 │Re-appraisal of P. zingiberis

Putative P. P. zingiberis P. myriotylum zingiberis Gin1 NBRC30817 CBS254.70 Clusters of appressoria

Filamentous and slightly inflated sporangia

One or more coils of antheridial stalks around oogonial stalks

Aplerotic oospores

Less occasionally plerotic oospores

Fig 3.2: Morphological comparisons of putative P. zingiberis Gin1 isolated from PSR ginger in Australia and reference isolates: P. zingiberis NBRC30817 and P. myriotylum CBS254.70 (Bar = 20 µm).

Chapter 3 │Re-appraisal of P. zingiberis 3.3.3. Sequence analysis Twenty individual conserved loci within nuclear and mitochondrial genes were retrieved from whole genome data for sequence alignments and comparisons. Sequence lengths varied from 389 bp for the mitochondrial gene ATP synthase F0 subunit 8 (ATP8) to 3,778 bp for 28S rDNA (LSU), a nuclear gene (data not presented). Pairwise comparisons of the loci revealed that sequence identity among four isolates ranged from 99.24 to 100%, while sequence divergence based on Kimura 2- parameter correction method ranged from 0 to 0.76% substitutions among the isolates regardless of original identification of each isolates (Table 3.2). Sequences of CBS254.70 and NBRC30817 showed a high level of homology, ranging from 99.4 to 100% identity. All sequences of Gin1 and Gin2, except for the actin locus isolates were 100% identical to each other.

A maximum likelihood tree constructed based on sequences of partly sequenced small and large subunits and completely sequenced ITS genes of the isolates sequenced in this study and Genbank sequence data of 24 Pythium spp. enabled separation P. myriotylum and P. zingiberis, which were grouped together due to a high degree of genetic uniformity, from other lineages (Fig 3.3). A similar well supported group of P. myriotylum and P. zingiberis isolates was also observed on ML tree constructed from all aforementioned genes of these four isolates plus Genbank data combined (Appendix 1).

Table 3.2: Pairwise comparisons for level of identity (%) among four isolates of Pythium; sequences of nuclear and mitochondrial genes were extracted from whole genome data. Genes Isolates CBS254.70 NBRC30817 Gin1 Gin2

SSU+ITS+LSU CBS254.70 99.94 99.92 99.92

NBRC30817 99.94 99.86 99.86

Nucleara Gin1 99.92 99.86 100.00

Gin2 99.92 99.86 100.00

Actin CBS254.70 99.60 99.55 99.55

NBRC30817 99.60 99.72 99.72

Gin1 99.55 99.60 99.77

Gin2 99.55 99.60 99.77

Beta tubulin CBS254.70 99.67 99.67 99.67

Chapter 3 │Re-appraisal of P. zingiberis NBRC30817 99.67 100.00 100.00

Gin1 99.67 100.00 100.00

Gin2 99.67 100.00 100.00

CoxI CBS254.70 99.87 99.40 99.40

NBRC30817 99.87 99.49 99.49

Gin1 99.40 99.49 100.00

Gin2 99.40 99.49 100.00

CoxII CBS254.70 99.74 99.31 99.31

NBRC30817 99.74 99.57 99.57

Gin1 99.31 99.57 100.00 Mitochondrialb Gin2 99.31 99.57 100.00

CoxIII CBS254.70 99.87 99.54 99.54

NBRC30817 99.87 99.54 99.54

Gin1 99.54 99.54 100.00

Gin2 99.54 99.54 100.00

NAD1 CBS254.70 99.91 99.82 99.82

NBRC30817 99.91 99.72 99.72

Gin1 99.81 99.72 100.00

Gin2 99.81 99.72 100.00

NAD4L CBS254.70 99.44 99.43 99.43

NBRC30817 99.44 99.44 99.44

Gin1 99.43 99.44 100.00

Gin2 99.43 99.44 100.00

mt SSU CBS254.70 99.66 99.54 99.54

NBRC30817 99.66 99.43 99.43

Gin1 99.54 99.43 100.00

Gin2 99.54 99.43 100.00

Chapter 3 │Re-appraisal of P. zingiberis mtLSU CBS254.70 99.78 99.67 99.67

NBRC30817 99.78 99.67 99.67

Gin1 99.67 99.67 100.00

Gin2 99.67 99.67 100.00

ATP1 CBS254.70 99.82 99.51 99.51

NBRC30817 99.82 99.45 99.45

Gin1 99.51 99.45 100.00

Gin2 99.51 99.45 100.00

ATP8 CBS254.70 100.00 100.00 100.00

NBRC30817 100.00 100.00 100.00

Gin1 100.00 100.00 100.00

Gin2 100.00 100.00 100.00

NAD5 CBS254.70 99.76 99.58 99.58

NBRC30817 99.76 99.58 99.58

Gin1 99.58 99.58 100.00

Gin2 99.58 99.58 100.00

NAD6 CBS254.70 99.73 99.87 99.87

NBRC30817 99.73 99.87 99.87

Gin1 99.87 99.87 100.00

Gin2 99.87 99.87 100.00

RPS2 CBS254.70 99.55 99.89 99.89

NBRC30817 99.55 99.44 99.44

Gin1 99.89 99.49 100.00

Gin2 99.89 99.49 100.00

RPS16 CBS254.70 99.79 99.79 99.79

NBRC30817 99.79 99.59 99.59

Gin1 99.79 99.59 100.00

Chapter 3 │Re-appraisal of P. zingiberis Gin2 99.79 99.59 100.00

RPS14 CBS254.70 100.00 100.00 100.00

NBRC30817 100.00 100.00 100.00

Gin1 100.00 100.00 100.00

Gin2 100.00 100.00 100.00

RPS4 CBS254.70 99.43 99.24 99.24

NBRC30817 99.43 99.43 99.43

Gin1 99.24 99.43 100.00

Gin2 99.24 99.43 100.00

a Nuclear gene includes: small (SSU) and large subunit (SLU) of rDNA. b Mitochondrial gene includes: cytochrome c subunit (Cox), NADH dehydrogenase subunit (NAD), ATP synthase subunit (ATP), ribosomal protein (RPL or RPS).

Chapter 3 │Re-appraisal of P. zingiberis

Fig 3.3: A maximum likelihood tree showing phylogenetic relationships among Pythium spp. using DNA sequences encoded from the small and large subunits and the ITS region of nuclear genome (length above 4000 bp). The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are displayed). All sequence data were retrieved from Genbank, except for the sequence data of P. myriotylum and P. zingiberis with asterisk which were obtained from whole genome data in this study.

Chapter 3 │Re-appraisal of P. zingiberis 3.3.4. In vitro test of virulence on excised roots/tubers In general, isolates Gin1 and Gin2 were more virulent, colonized more of host tissue in 3 days, than NBRC30817 and CBS254.70 (Table 3.3). Moreover, ginger and carrot tissue were most susceptible to colonization by Gin1 and Gin 2, followed by potato and then sweet potato. Radish was not colonized by Gin 1, Gin 2 or CBS254.70.

Table 3.3: Virulencea at 3 days after inoculation of four Pythium isolates colonising on excised tubers/roots of five crop species Pythium isolates Ginger Carrot Radish Sweet potato Potato CBS254.70 1.0 b 0.7 c 0.0 b 0.0 b 2.7 a NBRC30817 5.0 a 3.3 b 1.7 a 0.0 b 2.0 ab Gin1 5.0 a 5.0 a 0.0 b 3.7 a 3.7 a Gin2 5.0 a 5.0 a 0.0 b 3.0 a 3.7 a Control 0.0 c 0.0 c 0.0 b 0.0 b 0.0 b

Values followed by different letters within a column show a statistically significant difference at the 5% - levels as determined by Tukey’s test. a Virulence of the four Pythium isolates was assessed based on the number of excised tubers/roots of five crops species colonised in 3 DAI. It rated from 0 = no colonisation corresponding to no virulence to 5 = all five excised pieces colonised corresponding to most virulent.

The NBRC30817 isolate was highly virulent on ginger sticks, which were colonized fully by NBRC30817 within 3 DAI. It was also quite aggressive on other plant tissue too, except for sweet potato. Interestingly, NBRC30817 was the only isolate which was able to colonize radish sticks although it was just mildly pathogenic, colonizing 1.67 cm of 5.5 cm long sticks within the 3-day- period. The CBS254.70 isolate was not able to colonise radish and sweet potato sticks and slowly colonised ginger and carrot sticks. Potato was the only susceptible tested material to CBS254.70 colonisation.

3.3.5. In vitro pre-emerging damping off Although the disease indices in the non-inoculated controls were greater than zero, an indication that germination was not 100%, they were significantly different from other treatments (P ≤ 0.05) (Table 3.4). For those germinated, the seedlings grew normally showing no obvious lesions or discolourations recorded in the control. The results in this assay again showed that the Gin1, Gin2 and NBRC30817 isolates were highly virulent (disease index > 0.5) on all tested plant species, 44

Chapter 3 │Re-appraisal of P. zingiberis while the CBS254.70 isolate was highly virulent on only wheat and rye. The Gin1 and Gin2 isolates were the most virulent on the tested plant species (disease index > 0.75) and were significantly different from the least virulent, the CBS254.70 isolate. The NBRC30817 isolate was pathogenic on all seeds and seedlings of tested plant species, except for cucumber.

Table 3.4: Disease indices (0-1) showing the virulence of four Pythium isolates on different crops Pythium isolates Wheat Millet Rye Cucumber Tomato Cauliflower Sweet corn CBS254.70 0.5 b 0.3 b 0.6 b 0.1 c 0.4 b 0.2 b 0.2 ab NBRC30817 0.8 ab 0.7 a 0.7 ab 0.5 b 0.8 a 0.4 ab 0.3 a Gin1 0.9 a 0.9 a 0.9 a 0.9 a 0.8 a 0.7 ab NT Gin2 0.9 a 1.0 a 0.9 a 0.9 a 0.9 a 0.8 a NT Control 0.1 c 0.0 c 0.1 c 0.0 c 0.1 b 0.1 b 0.1 b

Values followed by different letters within a column show a statistically significant difference at the 5% - levels as determined by Tukey’s test.

3.4. Discussion Since 2007 P. myriotylum isolates have been collected from different ginger farms in Queensland, Australia where PSR has been reported, these isolates have exhibited various sizes of oogonia, oospores and temperature responses. This variation resulted in doubts about the species status of P. myriotylum reported by Stirling et al. (2009). Following studies by this author and myself on P. myriotylum isolates recovered from PSR infected rhizomes on ginger farms in Australia was reconsidered to be P. zingiberis according to the descriptions of Takahashi (1954) and the key of Dick (1990). Plaats-Niterink (1981) had considered P. zingiberis as a synonymous species with P. volutum, but in fact according to the descriptions of these two species, they are distinct in oogonial size and temperature response (Dick, 1990; Takahashi, 1954). Additionally, ITS sequences were clearly different between P. zingiberis and P. volutum (Lévesque and De Cock, 2004; Matsumoto et al., 1999). Lévesque and De Cock (2004) and Matsumoto et al. (1999) found that P. myriotylum was more similar to P. zingiberis than P. volutum based on the ITS sequence. Recently, Robideau et al. (2011) have sequenced the CoxI locus and showed that the locus allowed separation of closely related Pythium spp. such as P. catenulatum and P. rhizo-oryzae, as well as P. graminicola, P. perrilum and P. tardicrescens, all of which could not be differentiated by ITS sequence analysis. However, the CoxI locus was not able to be used to distinguish between P. myriotylum and P. zingiberis (Robideau et al. 2011). This is the first study to comprehensively compare of the morphology, physiology, molecular sequences and pathogenicity of the species P. myriotylum and 45

Chapter 3 │Re-appraisal of P. zingiberis P. zingiberis (Uzuhashi et al., 2010; Watanabe, 2010). This study has re-examined the reference isolates of P. myriotylum CBS254.70 and P. zingiberis NBRC30817 and included two putative P. zingiberis isolates recovered from PSR infected rhizomes in Australia.

Comparisons of original descriptions of Drechsler (1930) and Dick (1990) for P. myriotylum and Takahashi (1954) for P. zingiberis reported that P. myriotylum produces smaller oogonia and oospores than those of P. zingiberis. However, Wantanabe (2010) reported oogonia and oospores of P. myrioytlum were larger than those of P. zingiberis. In our study, we observed that P. myriotylum CBS254.70 had slightly smaller oogonia, but produced larger oospores than those of P. zingiberis NBRC30817. For putative P. zingiberis Gin1 and Gin2 collected from the field in this study, smaller oospores and bigger oogonia than those of the reference isolates were observed. P. myriotylum and P. zingiberis were reported to have aplerotic and plerotic oospores, respectively, but Ho (2011) also observed plerotic oospores on P. myriotylum and similarly, Wantanabe (2010) observed aplerotic oospores on P. zingiberis. Interestingly, in most cases the presence of aplerotic oospores, which is based on a classic definition that oospores do not completely fill oogonia, was recorded in our observations, but occasionally the presence of plerotic oospores was also noticed for both reference species and our isolates. Broom-like appressoria, which were believed to be typical for P. myriotylum, were also observed in the reference P. zingiberis NBRC30817 as well as in our putative P. zingiberis isolates although the appressorial cluster sizes were slightly different (data not presented). Likewise, coiling stalks of antheridia around oogonial hyphae, which were reported only on P. zingiberis, were occasionally recorded on both of the reference isolates and our isolates. Other taxonomic characters, including filamentous, lobulated sporangia and number of antheridia/oogonia were very similar in all the isolates.

Both P. myriotylum and P. zingiberis were reported to grow best at temperatures above 30 °C (Drechsler, 1930; Takahashi, 1954; Plaats-Niterink, 1981). P. myriotylum CBS254.70 was reported to grow best at its optimal temperature, 37 °C (Plaats-Niterink, 1981), but in this study, the optimum growth rate occurred at 25 °C, and the growth rate dropped significantly once the temperature was increased. This may have been due to the long term storage of the reference specimen. P. zingiberis NBRC30817 had a reported temperature optimum at near 34 °C (Ichitani and Shinsu, 1980), but in this study it exhibited fastest growth at 30 °C. The putative P. zingiberis isolates obtained from PSR ginger in this study grew particularly well at high temperature and exhibited best growth at 35 °C. Although temperature responses were considered a good additional taxonomic criterion for Pythium identification (Gilbert et al., 1995), it has been argued that this

Chapter 3 │Re-appraisal of P. zingiberis taxonomic feature is not very reliable for species separation in the Pythium genus (Matsumoto et al., 2000; Perneel et al., 2006).

Although there were some variations in morphology and physiology of P. myriotylum and P. zingiberis, the two species shared a continuum of most taxonomic characteristics. Interestingly, morphological and physiological differences were also noticed within a species of P. ultimum (Al- Sheikh and Abdelzaher, 2010; Barr et al., 1996; Tojo et al., 1998) and P. irregulare (Barr et al., 1997; Spies et al., 2011). Historically, taxonomists described and identified new species based solely on physiological and morphological differences, but it is without doubt that there are many limitations with this conventional classification method, including external conditions used for producing morphological characters, requirements of time, expertise knowledge and proper data access and assessments. De Cock et al. (1987) officially renamed P. gracile as P. insidiosum after a thorough re-examination of isolates of P. gracile and P. insidiosum. Similarly, P. jasmonium was re-identified as P. brassicum by Stanghellini et al. (2014) through studies of morphology, genetic and pathogenecity. Use of molecular technologies along with morphological and physiological data have enables a more thorough understanding of Pythium species.

In most cases Pythium spp. can be identified by their morphology and the ITS sequences. Unfortunately, it was difficult for us to differentiate reference isolates of P. myriotylum, P. zingiberis and our isolates of putative P. zingiberis using ITS sequence analysis due to their high degree of genetic similarities (99.88-100% identity). Although the ITS sequence analysis is now used worldwide for Pythium identification, but in many cases, species boundaries have not been revealed by the ITS locus solely (Lévesque and De Cock, 2004; Robideau et al., 2011). Twenty additional loci of nuclear and mitochondrial genes extracted from the whole genomic DNA sequences were above 99 to 100% homology among all isolates, suggesting that among the studied isolates of P. myriotylum and P. zingiberis there were either fine or no polymorphisms that might be present in the analyzed loci. Martin (2000) found that sequence divergence among isolates within a single Pythium species generally varied from 0% to 0.88% substitutions, but in some species, a higher degree of nucleotide substitution occurred. Sequences of multiple DNA loci provide strong evidence to confirm species status of very closely related Pythium spp., for example P. cryptoirregulare from P. irregulare (Garzón et al., 2007), P. recalcitrans from P. sylvaticum (Moralejo et al., 2008), and P. phragmiticola from P. phragmitis (Nechwatal and Lebecka, 2014). In addition to morphology and physiology, the additional molecular evidence from this research justifies our reason to combine P. myriotylum and P. zingiberis into one taxon. The P. myriotylum

Chapter 3 │Re-appraisal of P. zingiberis taxon should be retained since P. myriotylum was first officially described in 1930 by Drechsler (1930), while P. zingiberis was described later in 1954 by Takahashi (1954). Like many other oomycetes such as Phytopythium (Pp.) helicoides, Pp. mercuriale and Ph. citrophthora (Belbahri et al., 2008; Kageyama et al., 2007; Spies et al., 2014), Pythium myriotylum should be considered to be a single phylogenetic species. From the evidence provided here we recommended that P. zingiberis NBRC30817 should be re-assigned to P. myriotylum taxon. Additionally, the putative P. zingiberis isolates recovered from PSR ginger in Australia should be identified as P. myriotylum. It is obvious that Pythium is a taxonomical complex and with recent evidence supporting the occurrence of natural outcrossing in Pythium spp. (Francis and St Clair, 1993; Harvey et al., 2001; Nechwatal and Lekecka, 2014), it might pose a new challenge to taxonomic issues due to genetic exchanges resulting in possible divergent phyto-, patho- and eco-types (Nechwatal and Lekecka, 2014). Therefore, apart from thorough analyses of morphology and molecular phylogenetics, ecology and pathogenicity should also be exclusively assessed for species assignations in Pythium.

In this study, the species identification and consolidation reported are also supported by the in vitro host range assays on both excised materials and seedlings. Although the P. myriotylum isolate CBS254.70 appears to have lost some of its virulence, the wide host range of P. myriotylum has previously been recorded worldwide (Plaats-Niterink, 1981). NBRC30817, Gin1 and Gin2 were pathogenic to almost all tested materials, indicating that these isolates had a wide host range spectrum as has been reported previously for P. myriotylum. In this study, we did not attempt to find relationship between in vitro tests and pot trials due to limitations of working with quarantined isolates. However, Pettitt et al. (2011) found a close correlation between the pathogenicity of Pythium spp. on a detached leaf assay and root rot of chrysanthemum in a pot trial. Similarly, Zhang and Yang (2000) found a significantly positive correlation in the disease index between the Petri plate assays and the pot trials. Thus, the results in this study will provide good indicators for future assays.

In conclusion, P. myriotylum CBS254.70 and P. zingiberis NBRC30817 were consolidated under the name of P. myriotylum resulting based on data from our morphology, molecular sequences and pathogenicity studies. Subsequently, the doubtful status of P. myriotylum isolates recovered from PSR ginger in Australia was also addressed by exclusive comparisons with the international reference isolates. Although there were limited numbers of reference isolates involved in this study, these appeared to be the most reliable cultures alive for species identification. To some extent, minor differences in temperature responses and certain analysed loci of Australian isolates

Chapter 3 │Re-appraisal of P. zingiberis compared to reference ones could account for different levels of aggressiveness and pathogenicity to ginger plants; therefore, further pot trials for Australian isolates under various tested regimes will be warranted. Additionally, based on subtle changes of some loci, either applying current available detection techniques or developing new ones for fast and accurate detection will be worth pursuing to monitor the PSR pathogen. Since the first report in 2009, PSR of ginger has remained a major constraint for Australian ginger production. It is also necessary to have an assessment for Pythium spp. diversity on Australian ginger farms as to determine if other Pythium spp. might be involved in PSR on ginger in Australia.

Chapter 4 │Pythium spp. associated with PSR ginger Chapter 4 : CHARACTERISATION OF PYTHIUM SPP. ASSOCIATED WITH SOFT ROT DISEASE OF GINGER (ZINGIBER OFFICINALE) IN QUEENSLAND, AUSTRALIA4

Abstract In Australia, Pythium soft rot (PSR) outbreaks caused by P. myriotylum were reported in 2009 and since then this disease has remained as a major concern for the ginger industry. From 2012 to 2015, a number of Pythium spp. was isolated from ginger rhizomes and soil from farms affected by PSR disease and assessed for their pathogenicity on ginger. In this study, 11 distinct Pythium spp. were recovered from ginger farms in Yandina, Sunshine Coast, Australia and species identification and confirmation were based on morphology, growth rate and ITS sequences. These Pythium spp. when tested showed different levels of aggressiveness on excised ginger rhizome. P. aphanidemartum, P. deliense, P. myriotylum, P. splendens, P. spinosum and P. ultimum were the most pathogenic when assessed in vitro on an array of plant species. However, P. myriotylum was the only pathogen, which was capable of inducing PSR symptoms on ginger at a temperature range from 20 to 35 °C. Whereas, P. aphanidermatum only attacked and induced PSR on ginger in pot trials at the high temperature range of 30 to 35 °C. This is the first report of P. aphanidermatum inducing PSR of ginger in Australia at high temperatures. Only P. oligandrum and P. perplexum, which had been recovered from soils and not plant tissue, appeared non-pathogenic in all assays.

Key words: Zingiber officinale, oomycete, Pythium soft rot, PSR, ginger rhizome, host range

4.1. Introduction Ginger (Zingiber officinale Rosc.), belonging to the Zingiberaceae, is a cash crop for many growers in various countries including China, India, Indonesia, Fiji and Australia (Kavitha and Thomas, 2008). In Australia, ginger was introduced as a crop in the early 20th Century and has been cultivated on the Sunshine Coast, Queensland since 1916 (Hogarth, 2000). Presently, production extends from Gatton to Bundaberg in southeast Queensland, but the Australian ginger industry is relatively small (less than 1% contribution to global share) with an involvement of around 30 full time growers. Nevertheless, it was worth AUD 15.6 million at the farm gate in 2009 (Camacho and

4 This chapter was published as Le, D.P., Smith, M.K., Aitken, E.A.B., 2016. An assessment of Pythium spp. associated with soft rot disease of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol. DOI 10.1007/s13313-016-0424-5. The manuscript was modified to keep the format consistent through out the thesis.

Chapter 4 │Pythium spp. associated with PSR ginger Brescia, 2009) with an annual production estimated at about 8,000 tonnes. Almost half of this production is delivered to the domestic fresh market with the remainder going for processing inside the world’s largest ginger factory, Buderim Ginger Ltd. (Camacho and Brescia, 2009).

Pythium soft rot (PSR) of ginger was first reported around a century ago in India by Butler (1907) and has since been problematic in most ginger growing regions worldwide (Dohroo, 2005). The disease caused by any one of a number of Pythium spp. (Dohroo, 2005) is of most concern due to the destructiveness and aggressiveness of the pathogens on ginger. Losses generally vary from 5- 30%, but in some cases they can be up to 100% in fields where conditions conducive for disease development, such as water logging and high temperatures, are reached (Stirling et al., 2009). Once ginger fields have been infested with Pythium spp., the persistence of the pathogens leads to PSR in subsequent replanting of ginger in these fields, as reviewed in chapter 2.

In Australia, Pythium spinosum was recorded on ginger as early as 1962 by Teakle (1962), but it was considered a secondary pathogen to Fusarium oxysporum, the causal agent of Fusarium yellows. During 2007, a PSR disease outbreak on ginger in the Sunshine Coast of Australia was attributed to Pythium myriotylum (Stirling et al., 2009) which at the time was considered to be a ubiquitous pathogen with a wide host range and consequently the relevance of the PSR outbreak may have been underestimated. However, PSR has since then continued to be a major constraint for the Australian ginger industry with up to 70% of the surveyed growers in 2015 admitting to have PSR infestation on their farms (T. Pattison pers. comm.). Therefore, it was questioned if there was possibly more than one Pythium species/strains associated with PSR on ginger in Australia.

Following the first report of PSR on two of the oldest ginger farms in in Australia (Stirling et al., 2009), PSR disease was observed on at least 11 other nearby farms. Consequently, questions regarding to dispersal of the pathogen were also raised if the pathogen has been spread from the original infested farms. In this study, PSR ginger rhizome samples and soil samples from around infected ginger plants were collected from 13 infested farms in Queensland, Australia for Pythium isolation, and the phenotypic and genotypic diversity among isolates was compared.

4.2. Materials and methods 4.2.1. Pythium isolation and cultures Diseased ginger rhizomes were sampled from 13 farms in Yandina, Sunshine Coast. Isolations were undertaken by excising sections (5 mm2) of rhizome containing both healthy-looking and PSR

Chapter 4 │Pythium spp. associated with PSR ginger symptom tissue, quickly surface decontaminating (around 10 seconds) with 25% bleach (1% HOCl), then washing twice with sterilized distilled water (DW), and blotted dry with autoclaved paper towel. The sections were then transferred on to Petri plates with corn meal agar with an amendment of 50µg/mL Penicillin, 50µg/mL Polymyxin, and 25µg/mL Pirmaricin (CMA + 3P). The Petri plates were incubated in the dark overnight at 27 °C, then sections taken from the growing edge of the colonies were transferred onto 1.5% water agar (WA), incubated again under the same conditions for another night, after which hyphal tips of each of the isolates were excised out under an inverted compound microscope (Leica) and placed onto full strength potato dextrose agar (PDA, Difco).

In addition, a baiting technique based on Stanghellini and Kronland (1985) was used to recover Pythium spp. from the bulk soil samples collected from around ginger that was showing symptoms of PSR. Briefly, a total 10 grams of putatively infested soil in a 9 cm Petri plate was saturated with DW. Excised pieces (2 cm2) of apparent healthy ginger rhizomes were immersed in 25% bleach for 1 min, rinsed twice with autoclaved DW, and blotted dry with autoclaved paper towels. Ten of these excised ginger pieces were then placed onto the soil sample in each plate. On the top of each ginger piece, a plug (5 mm2) of WA was placed. The plates were incubated at 27 °C for 2-4 days. The WA plugs were then transferred onto 1.5% WA for single hyphal tip isolation.

In addition to representative isolates of each of Pythium spp. recovered in this study, reference specimens of P. myriotylum CBS254.70 and P. zingiberis NBRC30817, as well as P. myriotylum UQ5993 recovered from sudden wilt capsicum in Australia were also included in this study for the pot trial assay only. Work with the reference isolates was undertaken in quarantine approved premises as required by quarantine law for the overseas cultures. For storage, all cultures were placed on half strength corn meal agar (CMA) prepared from maize meal (polenta), based on the protocol of Dhingra and Sinclair (1995). The culture on the CMA was then submerged in autoclaved DW and stored at room temperature for future use.

4.2.2. Hyphal growth rate For each Pythium spp., daily mycelial growth rate at 5 °C intervals under a temperature range from 5 to 45 °C was assessed on 9 cm Petri plates as described by Le (2010). Briefly, 0.5 cm2 plugs of tested cultures (one-week-old) were subcultured onto PDA contained in Petri plates. Two plates were used for isolate, representing two replicates. After subculturing, initial growth of the cultures were standardised by leaving the plates at room temperature for at least 8 h. The initial growing

Chapter 4 │Pythium spp. associated with PSR ginger edges were marked and the marked plates were incubated at each designated temperature for 24 hours. After 24 h of incubation, the second growing edges were marked; radial growth of the colonies was measured at four points in mm using two transecting lines from the first mark to the next. Daily growth rate was calculated as a mean of the four measurements. The growth rates were assessed at each of the designated temperature twice.

4.2.3. Morphology Sexual and asexual structures of Pythium spp. were produced in soil extract cultures amended with two pieces (1 cm2) of grass leaves (Pennisetum setaceum). To make the soil extract, 20 g of air- dried sandy soil was soaked in 1 L DW overnight. The suspension was filtered through 150 mm Whatman filter paper (No. 1), and the filtrate was made up to a volume of 1 L with DW and autoclaved at 121 °C for 20 min (McLeod et al., 2009). Active growing cultures of Pythium spp. on PDA were excised and the plugs (0.5 cm2) were submerged into the soil extract cultures contained in Petri plates. The plates were kept at 27 °C and checked daily for development of taxonomic characteristics. The resultant mycelial mats were mounted on microscopic slides, stained with cotton blue, and observed under a BH2 (Olympus) microscope where measurements were recorded of morphological structures at 400x magnification. For each isolate, 20 arbitrarily selected structures were measured.

4.2.4. DNA extraction and amplification The CTAB protocol of Doyle and Doyle (1990) was employed to extract DNA from mycelia mats growing in potato dextrose broth. The ITS regions including the 5.8S rRNA subunit were amplified in a Mastercycler by using two primers: ITS 1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’) (White et al., 1990). In every 20 µL PCR reaction, there was 1 µL of DNA template (25 ng/µL) and 19 µL of master mix, the latter which included 0.18 µL of Taq DNA polymerase (5 u/µL), 1 µL of primer ITS1 and primer ITS4 each (10 µM), 2.83 µL of

5X Green GoTaq flexi buffer, 0.72 µL of 25 mM MgCl2, 1.05 µL of 10 mM dNTPs and 13.2 µL of dH2O. The reaction cycle was denaturation for 5 min at 94 °C, followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 90 s. The reaction was finally extended for 10 min at 68 °C.

The CoxI gene was amplified by using a primer set of OomCoxILevup (5’- TCAWCWMGATGGCTTTTTTCAAC-3’) and Fm85mod (5’- RRHWACKTGACTDATRATACCAAA-3’) (Robideau et al., 2011). The reaction cycle for CoxI

Chapter 4 │Pythium spp. associated with PSR ginger included a first step at 95 °C for 2 min, followed by 35 cycles of 95 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min The reaction was finally extended for 10 min at 72 °C.

The CoxII gene was amplified by using two primers: FM66 (5’ TAGGATTTCAAGATCCTGC 3’) and FM58 (5’ CCACAAATTTCACTACATTGA 3’) (Martin, 2000). The reaction cycle was denaturation for 5 min at 94 °C, followed by 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 90 s. The reaction was finally extended for 10 min at 68 °C.

To amplify the β-tubulin gene, two primers TUBUF2 (5′ CGGTAACAACTGGGCCAAGG 3′) and TUBUR1 (5′ CCTGGTACTGCTGGTACTCAG 3′) were used (Kroon et al., 2004). The cycling program was based on descriptions of Mu et al. (1999) with some modifications. The reaction cycle was first denatured for 5 min at 94 °C, followed by eight cycles of 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 2 min. The reaction was then continued with another 22 cycles of 94 °C for 1 min, 62 °C for 1 min, 72 °C for 2 min. The program was completed with a 7 min step at 72 °C. All PCR products were run at 110 V in a 1.5% agarose gel for 40 min to confirm the presence of an amplified product.

4.2.5. Sequencing and analysing sequences Both forward and reverse directions were sequenced directly from PCR products by Macrogen (Korea) and the consensus sequences were created after manual alignment and comparison using Clustal 2.0.2. Geneious 7.1.4 was used to align the sequences of the Pythium isolates collected from ginger fields. Comparisons were made among the sequences in this study with those of deposited sequences in Genbank to confirm species identification and determine whether there were any genetic variations. A maximum likelihood (ML) tree of the ITS region was drawn to assess the phylogenetic relationship among the isolates and species. Additional ML trees of the CoxI, CoxII and β-tubulin were also constructed for genotypic studies.

4.2.6. Pathogenicity tests In vitro pathogenicity test on excised ginger sticks The experiment was adapted from methods described in chapter 3 to test for colonization and aggressiveness of Pythium spp. on ginger pieces at 27 ± 2 °C. Briefly, disease free ginger rhizomes were cut into sticks (5.5 cm long x 1 cm wide x 1 cm high), which were surface disinfected in 25% bleach (% HOCl) for 1 min, washed twice again with autoclaved DW for another min, and blotted dry on autoclaved paper towels. Three replicate sticks were prepared for each isolate by plating

Chapter 4 │Pythium spp. associated with PSR ginger together in 9 cm Petri plates containing wet autoclaved filter paper. The sticks were inoculated by placing small squares (0.5 cm2) of active growing Pythium cultures on PDA at one end of each ginger stick. Three days after incubation, each stick was chopped up into five smaller pieces (1 x 1 x 1 cm) under sterile conditions which were then plated (except for the one end containing the culture) onto PDA in a Petri plate in order of distance from the inoculated end of the ginger sticks. These plates were then incubated at the same temperature in the dark for 24 h and observed for recovery of Pythium spp. from each excised piece. The negative control treatment included the same procedure but with uninoculated PDA squares (non-cultured). The data were recorded determining the colonization of Pythium spp. to 1, 2, 3, 4 or 5 cm sections on the ginger sticks, which corresponds to the virulence of Pythium isolates. The assay was independently repeated.

In vitro pre-emerging damping off test The pathogenicity of the Pythium spp. was assessed by screening seedlings of 13 plant species in Petri plates against cultures of each isolate. For each isolate-plant species interaction assessed, a one-week-old culture that had been grown on PDA was sub-cultured onto three replicate 9 cm Petri plates of 1.5% WA, and kept in an incubator set at 27 °C for a week. On each WA plate, ten surface disinfected seeds were placed one of the following 13 plant species: rye (Secalecereale), wheat (Triticum sp.), millet (Panicum miliaceum), barley (Hordeum vulgare), buck wheat (Fagopyrum esculentum), beet-root (Beta vulgaris), spring onion (Allium fistulosum), carrot (Daucus carota), cauliflower (Brassica oleracea botrytis), cucumber (Cucumis sativus), eggplant (Solanum melongena), lettuce (Lactuca sativa), and gypsophila (Gypsophila elegans). The plates were then incubated at 27 °C for 7 days before assessing disease indices. The disease index was calculated using the equation of Zhang and Yang (2000).

10 DI =∑푖=1 푋푖/40

- DI is disease index rating from 0 (all seedlings healthy after germination) to 1 (all seeds dead before germination). DI indicates degree of virulence of Pythium on tested crops. DI = 0 corresponds to no virulence; DI = 1 corresponds to most virulent. th - Xi is disease rating of the i seeds (from 1 to 10). - 40 is equal to the number of seeds multiplying with the highest rating scale (from 0 to 4). - The rating scale used was as follows: 0 = seed germinated and healthy seedlings with no obvious symptoms; 1 = seed germinated and seedlings with light brown lesion on roots; 2 =

Chapter 4 │Pythium spp. associated with PSR ginger seed germinated and seedlings with short and enlarging brown lesion on roots; 3 = seedlings died after germination; 4 = seed died with no apparent germination.

Glasshouse pathogenicity test on ginger plants Ginger (cv ‘Queensland’) plants derived from tissue culture were used in pot trials to assess their reaction to a subset of Pythium spp. isolates. Inoculum for pot trials was prepared using sorghum seeds that had been soaked in water for 24 h in the dark and autoclaved twice at 121 °C for 20 min. The sorghum seeds were then plated onto 1 to 2-day-old Pythium cultures grown on PDA in Petri plates and kept at 27 °C for a week or until the seeds were fully covered with mycelia of Pythium. For each isolate of Pythium spp. tested, ginger plants (50 cm high or more) that had been grown in 140 mL pots were inoculated with two sorghum seeds, which were fully colonized with Pythium spp. The pots of inoculated ginger were kept saturated with water from time of inoculation onwards by placing on saucers where the water was maintained. Plants were monitored daily for disease development based on aboveground symptoms applying the following scale: 0 = plants remain green and healthy; 1 = leaf sheath collar discoloured and lower leaves turned yellow; 2 = plants alive, but shoots either totally yellow or dead; and 3 = all shoots dead (Stirling et al., 2009). Attempts were made to re-isolate the Pythium spp. either from diseased rhizomes or from soil, in the latter case by baiting with carrot pieces placed on the soil. The pathogenicity assays were conducted in growth cabinets, which were assigned two temperature ranges 20/25 °C and 30/35 °C (night/day) both with 10 h photoperiod under fluorescent light. The assays were repeated although cv ‘Canton’ was used due to the shortage of cv ‘Queensland’.

All data from pathogenicity assays and the growth rate experiments were subjected to analysis of variance (ANOVA) and the separation of means was determined using Tukey’s least significant difference (LSD) test (P ≤ 0.05). Where stated, data from repeated assays were pooled and analyzed together if there were no significant different between the two repetitions. The ANOVA and comparisons of means were performed with Minitab 16.

4.3. Results 4.3.1. Isolation and identification A total of 173 isolates of Pythium spp. and 15 of Pythiogeton ramosum isolates were obtained either directly from PSR ginger or from baiting of soil from around infected ginger. Eleven species were initially identified based on morphological characteristics by using the keys of Plaat-Niterink (1981) and Dick (1990). Of these 11 Pythium spp., only three of the Pythium spp. as well as the 56

Chapter 4 │Pythium spp. associated with PSR ginger Pythiogeton ramosum were recovered directly from PSR ginger tissue (Table 4.1). Only one species of Pythium was ever recovered from rhizomes with symptoms of PSR. When using ginger as bait from the soil, P. spinosum and P. splendens were recovered most frequently followed by P. aphanidermatum, P. deliense, P. heterothallicum, P. oligandrum, P. perplexum, P. torulosum, and P. ultimum. However, using ginger baits from the soil failed to retrieve either P. graminicola or P. myriotylum.

Table 4.1: Species of Pythium and Pythiogeton recovered from ginger rhizomes and soil samples collected from commercial ginger fields in Queensland, Australia. Number of isolates Number of farms Recovered from Speciesa obtained P. aphanidermatum 2 1 Soil P. deliense 1 1 Soil P. graminicola 3 1 Ginger rhizome P. heterothallicum 2 1 Soil P. myriotylum 79 10 Ginger rhizome P. oligandrum 3 1 Soil P. perplexum 1 1 Soil P. spinosum 51 4 Soil P. spinosum 12 2 Ginger rhizome P. splendens 27 4 Soil P. torulosum 1 1 Soil P. ultimum 1 1 Soil Pythiogeton ramosumb 15 2 Ginger rhizome a Species as determined by morphology and DNA sequence base similarity b Pythiogeton ramosum is be excluded in this chapter from now onwards, but full details will be presented in chapter 7.

All of the species recovered grew well at temperature ranges above 5 °C and below 40 °C, except for P. graminicola which grew poorly below 10 °C. P. aphanidermatum was the exception, which grew normally even at 40 °C and above (Table 4.2).

All isolates were stored and kept in a collection at Plant Pathology lab, School of Agriculture and Food Sciences, The University of Queensland.

Chapter 4 │Pythium spp. associated with PSR ginger

Table 4.2: Morphological characteristicsa and growth rate of 10 species of Pythium recovered ginger rhizomes with PSR or from soil surrounding PSR ginger plants from commercial ginger fields in Queensland, Australia. Colony Hyphal Sexual characteristicsd Temp. response (°C) Pythium species appearance Hyphal Sporangiab swellingc Growth at on PDA width (µm) (µm) (µm) Oogonia (µm) Antheridia Oospores (µm) Max Opt. 25 (mm) P. aphanidermatum Dense- 4-6 (-10) I, 10-16 (- Nil S, 16-27 (av. M, 1(-2)/oog. A, 14-22 (av. 18.7) ≤ 45 35-40 38.67 UQ6082 cottony 20) 22.1 ) P. deliense UQ6021 Slight 4-6 (-8) I, 6-10 (-12) Nil S, 18-22 (av. M, 1(-2)/oog. A, 12-19 (av. 15.7) ≤ 40 35 25.71 radiate 20.5) P. graminicola Dense- 2-4 (-6) I, 6-10 (-12) Nil S, 19-24 (av. M, D (occ.), 1-4 A, P, 14-23 (av. ≤ 40 35 16.71 UQ6049 cottony 21.1) (-6)/oog. 18.7) P. heterothallicum Radiate 2-5 (-7) Nil G, 8-15 (- Nil Nil Nil ≤ 35 25 10.41 UQ6290 24) P. oligandrum Radiate 2-5 (-7) Ir, 8-30 (- Nil O, 14-23 (av. Nil A, 12-20 (av. 14.9) ≤ 40 30 26.13 UQ6085 36) 18.6) P. perplexum UQ6250 Radiate 2-4 (-6) Ir, up to 30 Nil S, 14-26 (av. M, 1/oog. A, P (oc.), 14-22 ≤ 30 20 9.27 21.1) (av. 18.2) P. spinosum UQ6244 Dense- 2-5 (-7) Nil G, up to O, 12-24 (av. M, D (occ.), 1 (- P, A (oc.), 10-21 ≤ 35 25 34.06 cottony 30 18.7) 2)/oog. (av. 16.7) P. splendens UQ6036 Dense- 2-6 (-7) Nil G, 14-30 Nil Nil Nil ≤ 35 30 38.67 cottony (-42) P. torulosum UQ6291 Radiate 2-4 (-6) I, 4-10 (-12) Nil S, 12-20 (av. M, D (occ.), 1- P, 12-18 av. 15.0) ≤ 35 30 12.59 15.8) 2(-3)/oog. P. ultimum UQ6023 Dense- 4-6 (-10) Nil G, 12-20 S, 19-26 (av. M, 1/oog. A, P (oc.), 16-20 ≤ 35 30 30.96 cottony (-25) 22.4) (av. 18.9) a Morphological characters presented here include max, min and averaged (av.) values of 20 arbitrarily selected structures; b Sporangial characteristics: filamentous (F), inflated (I), irregular (Ir) and the width; c Hyphal swelling characteristics: not observed (Nil), globose (G), and the diameter; d Sexual characteristics of oogonia, antheridia and oospore: smooth (S), ornamented (O), diclinous (D), monoclinous (M), aplerotic (A), plerotic (P) (occ: occasionally), and the diameter. 58

Chapter 4 │Pythium spp. associated with PSR ginger

For species confirmation, sequences obtained using the ITS primers (ITS1 and ITS4) were between 761 to 910 bp and once compared with sequences on the Genbank database, all sequences were above 99 to 100% identical with reference species (CBS isolates) on the Genbank, so confirming the status of Pythium spp. in this study. A phylogenetic tree built on the ITS region showed very high bootstrap values (98-100%) between the morphologically identified and the reference species; subsequently, the species identification was verified (Fig. 4.1). Of those UQ isolates considered to be P. myriotylum, sequences of nuclear and mitochondrial loci, including of ITS (57 sequences), CoxI (47 sequences) CoxII (67 sequences) and β-tubulin (19 sequences) were 99.8 to 100% homologous to each other (Appendix 2 - 4).

Chapter 4 │Pythium spp. associated with PSR ginger

4.3.2. Pathogenicity assays In vitro pathogenicity tests on excised ginger Varying levels of virulence were detected among Pythium spp. when inoculated onto ginger sticks. Once colonized, the ginger became soft, discoloured and white mycelia of pathogenic Pythium spp. covered the tissue. Most of the isolates identified as P. myriotylum showed a high level of virulence as assessed by rate of development on the excised ginger rhizome the exception being P. myriotylum UQ5892 isolate (Fig 4.2). Isolates of P. deliense and P. aphanidermatum also showed virulence as high as P. myriotylum followed by P. spinosum, P. splendens, P. ultimum, P. graminicola. P. heterothallicum and P. torulosum were the least aggressive. Those isolates identified as P. perplexum and P. oligandrum were not able to grow on the ginger sticks and colonize the tissue in the conditions tested (27 ± 2 °C) and neither of these species was recovered from the inoculated ginger sticks. None of the control sticks yielded Pythium spp. when samples were plated out onto PDA plates (Fig 4.2).

6.00

Aggressiveness

5.00

5 cm)

- 4.00

3.00

2.00

1.00 Meancolonisation(0 0.00

Fig 4.2: Aggressiveness of selected Pythium spp. assessed based on mean colonization and recovery of Pythium spp. on 1 cm segments excised from 5.5 cm long ginger sticks at 27 ± 2 °C at 2 DAI (bars represent standard deviations, n = 6). Means were combined from two independent assays due to no significant difference between the two repetitions (P = 0.05).

In vitro pre-emerging damping off The seeds of all tested plant species, except for beetroot germinated well in the control treatments (disease index, DI ≤ 0.2) and the subsequent seedlings remained healthy afterwards. The DIs in 60

Chapter 4 │Pythium spp. associated with PSR ginger control treatments were significantly less (P = 0.05) than those recorded for seeds treated with Pythium spp., excluding P. oligandrum in which DIs on tested plant species were not different from those of the control. Similarly, DI recorded on millet infected with P. torulosum was as low as that of the control. P. aphanidermatum, P. myriotylum, P. graminicola, P. spinosum, P. splendens and P. ultimum appeared the most aggressive on the tested plant species, except on barley which was less vulnerable to attack by P. splendens and P. ultimum (DI < 0.5). All pathogenic Pythium spp. infected and killed the seeds before germination and also young seedlings of plant species tested in the assays (DI > 0.5 - 1) (Table 3). All eight tested P. myriotylum isolates were highly aggressive on the 12 tested plant species (DI > 0.5), except for P. myriotylum UQ6152 and UQ6349 which were less aggressive on lettuce (DI = 0.42 - 0.43). P. myriotylum UQ5892 was least aggressive, compared to other P. myriotylum isolates on ginger sticks, it was comparable to other isolates of P. myriotylum in terms of pathogenicity on the crop species assessed (Table 4.3). Where tested, the isolate of P. torulosum was only highly aggressive on wheat (DI > 0.5) as Zhang and Yang (2000) had reported. P. heterothallicum and P. perplexum were the least aggressive to those plant species on which they were tested.

Chapter 4 │Pythium spp. associated with PSR ginger

Table 4.3: Comparisons of disease indices (0-1) recorded on flower, vegetable and common crops used in rotation with ginger in Australia, which

were inoculated with Pythium spp.a

Isolates

Beet root Carrot Cucumber Eggplant Lettuce Spring onion Gypsophllia Barley wheatBuck Millet Rye Wheat P. myriotylum UQ5993 0.95 a 0.99 a 0.83 bc 0.88 a 0.78 a 0.83 a 0.83 a 0.88 a 0.74 ab 0.98 a 0.91 ab 1.00 a P. myriotylum UQ6152 0.88 a 0.58 a 0.78 c 0.84 a 0.43 bc 0.82 a 0.77 ab 0.73 ab 0.67 abc 0.95 a 0.89 ab 0.94 a P. myriotylum UQ6349 0.89 a 0.58 a 0.88 abc 0.81 a 0.42 c 0.80 a 0.78 ab 0.75 ab 0.64 bc 0.88 ab 0.86 abcd 0.87 a P. myriotylum UQ5992 0.97 a 0.64 a 0.91 ab 0.78 a 0.65 abc 0.88 a 0.83 a 0.71 abc 0.74 ab 0.97 a 0.86 abcd 0.87 a P. myriotylum UQ5892 0.89 a 0.87 a 0.77 c 0.83 a 0.61 abc 0.76 a 0.70 b 0.57 bcd 0.53 c 0.98 a 0.72 bcde 0.87 a P. myriotylum UQ6344 0.98 a 0.69 a 0.91 ab 0.88 a 0.68 ab 0.79 a 0.78 ab 0.73 ab 0.72 abc 0.94 a 0.91 ab 0.92 a P. myriotylum UQ6018 0.95 a 0.67 a 0.88 abc 0.79 a 0.84 a 0.85 a 0.79 ab 0.76 ab 0.78 ab 0.98 a 0.87 abc 0.92 a P. myriotylum UQ6016 0.91 a 0.76 a 0.87 bc 0.86 a 0.82 a 0.72 a 0.82 a 0.74 ab 0.70 abc 1.00 a 0.86 abcd 0.93 a P. spinosum UQ6244 0.96 a 0.98 a 0.94 ab 0.80 a 0.81 a 0.80 a 0.83 a 0.58 bcd 0.77 ab 0.88 ab 0.63 cde 0.92 a P. splendens UQ6036 0.94 a 0.91 a 0.94 ab 0.79 a 0.83 a 0.74 a 0.77 ab 0.37 d 0.74 ab 0.93 a 0.62 de 0.84 ab P. ultimum UQ6023 0.95 a 0.91 a 0.99 a 0.84 a 0.83 a 0.79 a 0.79 ab 0.49 d 0.86 a 0.98 a 0.88 ab 0.95 a P. aphanidermatum UQ6082 ------0.92 a 0.87 abc 0.85 a P. graminicola UQ6049 ------0.94 a 1.00 a 0.86 a P. heterothallicum UQ6290 ------0.39 d - 0.32 c - 0.38 d P. oligandrum UQ6085 ------0.00 d 0.10 f 0.00 e P. perplexum UQ6250 ------0.42 d - 0.33 c - 0.47 cd P. torulosum UQ6291 ------0.50 cd - 0.08 d - 0.62 bc Control 0.43 b 0.15 b 0.03 d 0.13 b 0.10 d 0.17 b 0.10 c 0.07 e 0.20 d 0.00 d 0.07 f 0.13 e

Values followed by different letters within a column show a statistically significant different at the 5% - level as determined by Tukey’s test. - : not tested; a P. deliense was excluded from this table as most data will be presented in chapter 7 62

Chapter 4 │Pythium spp. associated with PSR ginger

Pathogenicity on ginger plants Reference isolates of P. myriotylum CBS254.70 and P. zingiberis NBRC30817 were included in this pot trial after an additional quarantine import permit was granted. All P. myriotylum isolates recovered from PSR ginger were pathogenic at both temperature regimes evaluated, regardless of ginger cultivars tested. P. myriotylum UQ5892 was the only exception, which was weakly aggressive at both temperatures and more so at the lower of the two temperature regimes. P. myriotylum CBS254.70 and P. zingiberis NBRC30817 were only pathogenic to ginger plants at 30/35 °C. None of the other Pythium spp. tested caused disease when assessed at the lower temperature. Where disease developed, initially above ground symptoms such as water soaking at collar regions and yellowing of lower leaves were observed as early as 5 and 10 DAI on ginger plants grown at 30/35 °C and 20/25 °C, night/day temperatures. However, by 21 DAI, disease severity eventually was not significantly different between the two temperature ranges, except for P. myriotylum UQ5892. P. myriotylum UQ5993 from capsicum, P. myriotylum CBS254.70, P. zingiberis NBRC30817, and P. aphanidermatum UQ6082 showed different levels of disease severity on ginger plants from the control only when the temperatures were higher than 30 °C (Fig 4.3). All other Pythium spp. were non-pathogenic on ginger plants in the bioassays regardless of temperature. In all assays, Pythium spp. were re-isolated and identified based on morphology from infested potting mix by baiting confirming successful colonization of tested Pythium spp. in soil. Where applicable, the pathogenic Pythium spp. were also recovered from artificially induced PSR ginger in the bioassays.

3.5

3) 20/25 °C 30/35 °C - 3 2.5 2 1.5 1 0.5

0 Disease severitylevels(0

Fig 4.3: Disease severity (0-3) which was recorded on ginger plants inoculated with selected Pythium spp. at 21DAI at two temperature ranges 20/25 °C and 30/35 °C with 10 h of photoperiods (bars represent standard errors, n = 6). Data presented the combination of two pot trials due to no significant difference in disease severity recorded on the two ginger cultivars tested (P = 0.05).

Chapter 4 │Pythium spp. associated with PSR ginger

4.4. Discussion Several oomycetes, namely Pythium spp. and Pythiogeton ramosum were isolated directly from PSR ginger in Queensland, Australia. P. myriotylum was isolated from most of the farms assessed. P. spinosum and P. graminicola were also occasionally recovered from PSR ginger. Unlike studies on other crops, including rooibos, bell pepper, common bean and soybean, of which more than one Pythium sp. was often recovered from diseased plants (Bahramisharif et al., 2013; Chellemi et al., 2000; Li et al., 2014; Zitnick-Anderson and Nelson, 2014), with PSR on ginger in this study only one particular Pythium species was isolated per diseased rhizome. In some cases, mixed infections of Fusarium sp. and Pythium sp. and Pythiogeton sp. were recorded although our findings indicated that PSR in ginger in Australia was probably not caused by such a disease complex. However, more pathogenicity assays, where Pythium spp. are co-inoculated in pot trials will be required to confirm the theory.

In this study, other Pythium spp., including P. aphanideramtum, P. deliense, P. splendens and P. ultimum, which were recorded on ginger grown in China, India, Japan and Malaysia (Liu, 1977b; Ichitani and Shinsu, 1980; Dohroo, 2001; Jooju, 2005; Philip, 2005; Shanmaugam et al., 2010; Li et al., 2014), were only obtained from soil by using ginger baits. It indicated that ginger baits were quite effective in isolating Pythium spp. from soils around ginger, but the species of interest, P. myriotylum was not trapped from the field soils. This is possibly due to either the use of unsuitable baiting conditions or use of substrates which may have favoured the overgrowth of other more saprophytic species, namely P. splendens and P. spinosum. If this was the case, soil plating dilution conducted at a temperature more suited for P. myriotylum (over 30 °C) with a Pythium selective medium will possibly be effective since P. myriotylum populations were assumed to be dominant in the soil habitat. It will be important from a ginger farming system perspective to evaluate P. myriotylum population levels before planting ginger back into infested fields. When potting mix was inoculated with a single Pythium species in an artificially inoculated pathogenicity assays in the pot trials, the same baiting technique successfully allowed recovery of P. myriotylum (data not shown). Therefore in the absence of other competitors, recovery of P. myriotylum was obtained without much effort from the simple baiting technique. The success of recovering Pythium spp. from soil has been shown in the literature to be dependent on the target species and for P. myriotylum in particular, others have also reported difficulty (Lumsden et al. 1975; Wang and Chang 2003).

In most cases, morphology and growth rate allowed us to identify to species status the Pythium spp. isolated in this study. All 11 Pythium spp. were first identified using the keys of Plaats-Niterink 64

Chapter 4 │Pythium spp. associated with PSR ginger

(1981) and Dick (1990), identification of some species, including P. perplexum, P. splendens and P. heterothallicum was difficult due to morphological similarities to others as well as a lack of sexual structures. The identified and putative species were further confirmed by sequences of the ITS region. The ITS sequence analysis is now used worldwide for Pythium identification although species boundaries could not be revealed by the ITS locus solely (Lévesque and De Cock, 2004; Robideau et al., 2011). In this study, a BLAST search from the Genbank database resulted in very high levels of identity, namely over 99 to 100% homology to well-known reference isolates, so multiple gene sequencing was not required. The only exception was that species boundary of P. myriotylum and P. zingiberis was not clearly distinguished using only ITS sequence data. However, this was addressed by analyzing morphology, whole genome data and pathogenicity exclusively (chapter 3).

There have been many different Pythium spp. reported worldwide as major pathogens of PSR of ginger (Dohroo, 2005). In Australia, P. myriotylum was reported in 2009 (Stirling et al., 2009) and in this study, the prevalence and importance of the pathogen were revealed from all infested farms from the Sunshine Coast, Australia. Moreover, P. myriotylum has also caused major losses to ginger crops in many other countries that being China, India, Fiji, Korea and Taiwan (Kim et al., 1997a; Kumar et al., 2008; Stirling et al., 2009; Tsai, 1991; Yuan et al., 2013). P. myriotylum is well- known for its high temperature preferences and it is most pathogenic at about its temperature optimum (37 °C) (Plaats-Niterink, 1981). This was supported by the pot trial results, from which PSR symptoms were only observed on ginger plants inoculated with P. myriotylum CBS254.70, P. zingiberis NBRC30817 and P. myriotylum UQ5993 (capsicum isolate) at 30 - 35 °C. However, isolates of P. myriotylum initially obtained from PSR ginger in Australia appeared more aggressive at a wide temperature range, 20 - 35 °C. Likewise, Perneel et al. (2006) found that P. myriotylum recovered from cocoyam was most pathogenic to cocoyam at 28 °C. Interestingly, cocoyam was also more vulnerable to P. myriotylum isolates, which were initially isolated from diseased cocoyam, than those recovered from other hosts (Perneel et al., 2006). Similarly, we found P. myriotylum from capsicum and P. myriotylum from ginger were strongly pathogenic to capsicum and ginger, respectively regardless of temperatures, but they were much less pathogenic when cross inoculations were undertaken (data not shown). This could be theorised that the P. myriotylum isolated from PSR infected ginger in this study possibly exhibited some level of host preference, so more pot trail screenings for their pathogenicity on other crops is warranted. If the theory is supported by future results, it may have a significant contribution to PSR control programs through crop rotations.

Chapter 4 │Pythium spp. associated with PSR ginger

In addition to the ITS region, sequences of CoxI, CoxII and β-tubulin regions of representatives of P. myriotylum obtained from PSR ginger revealed genetic uniformity of the population. In contrast, Yuan et al. (2013) found polymorphisms within the ITS regions of P. myriotylum recovered from PSR ginger in China. The genetical uniformity within the population of P. myriotylum on ginger farms in Australia, it suggests that P. myriotylum may have been spread from one original source. Stirling et al. (2009) argued that the incidence of PSR on ginger in 2007 was a sporadic event in a very wet year on two of the oldest farms under continuous ginger cultivation, and so specific control methods were not recommended at the time apart from paying better attention to drainage and soil health. However, PSR is now observed on many farms with up to 70% of the ginger farmers in the Sunshine Coast region reporting PSR on their farms (T. Pattison pers. comm.) and is of major concern for the ginger industry. Although quarantine approaches have been deployed in the regions, stricter on-farm biosecurity to prevent further spread is necessary.

In this study, P. aphanidermatum, P. deliense, P. graminicola, P. spinosum, P. splendens and P. ultimum, which were isolated from either soil or diseased ginger or both, have also been found associated with PSR on ginger elsewhere around the world (Dohroo, 2005). Isolates of these species were able to colonize and cause soft rot on ginger sticks at a single incubation temperature (27 ± 2 °C) and were also highly virulent on a wide host range in vitro assays. However, none of these listed species caused PSR on ginger, except for P. aphanideramtum which only caused PSR on ginger at the higher temperature of 30/35 °C. P. aphanidermatum is a high temperature preference species (Plaats-Niterink, 1981). This is the first report of P. aphanidermatum causing PSR on ginger in Australia. Li et al. (2014) found that P. aphanidermatum recovered initially from PSR ginger in China was capable of inducing symptoms of PSR on ginger at 24 - 26 °C. Therefore, it could be of interest to undertake population studies of P. aphanidermatum and ginger around major ginger growing regions since findings might lead to a significant impact for PSR control through selection of tolerant cultivars. The current study could not induce PSR symptoms on ginger plants inoculated with P. deliense, P. graminicola, P. spinosum, P. splendens and P. ultimum, but presence of these pathogenic species should not be underestimated. Except for P. spinosum and P. ultimum which were reported as secondary and postharvest pathogens on ginger, respectively (Dohroo, 2001; Le et al., 2010; Teakle, 1962), presence of other Pythium spp. on Australian ginger farms might pose additional threats to the ginger industry in Australia once favorable environmental conditions for these species to thrive are met.

The recovery of non-pathogenic P. oligandrum from soil surrounding PSR ginger plant might be of interest for further interaction studies with P. myriotylum. P. oligandrum is a mycoparasite of a 66

Chapter 4 │Pythium spp. associated with PSR ginger wide range of oomycete and fungal species (Gerbore et al., 2014). This will be presented in detail in chapter 6.

In conclusion, PSR disease has remained as a main constraint for ginger industry in Australia since the first outbreaks recorded in 2007. Although a number of Pythium spp. have been found to be associated with PSR in certain conditions, the PSR on ginger in Australia was mainly attributed to P. myriotylum. Pathogenicity of P. myriotylum across a wide temperature range might indicate for an occurrence of a new more aggressive strain of P. myriotylum. Therefore, it is worth practicing a stricter quarantine approach to contain the spread, as well as looking for alternative control strategies, including biocontrol.

Chapter 5 │SNP diagnostics Chapter 5 : COMPARISON OF SNPs AND DEVELOPMENT OF PCR-RFLP FOR DETECTION TOOL FOR PYTHIUM MYRIOTYLUM ISOLATES RECOVERED FROM PYTHIUM SOFT ROT GINGER

Abstract The oomycete Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia. Therefore, it is proposed that intraspecific variation within the pathogen might account for aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one P. zingiberis isolate were derived from Illumina sequencer and 22 conserved loci were extracted and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). In most cases, a higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the CoxII gene of 14 P. myriotylum isolates obtained from PSR ginger was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The enzyme specifically cut the PCR amplicons of the CoxII (about 600 bp) of PSR P. myriotylum isolates into two small fragments (about 425 and 175 bp) which were visualised under UV light. Meanwhile, the PCR amplicons of other P. myriotylum isolates and other Pythium spp. as well as true fungi were restricted, resulting in single bands on the gel. The PCR-RFLP was also sensitive enough to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures.

Key words: genome sequencing, genetic variations, restriction enzymes, DNA extracts, cultures

5.1. Introduction

Pythium myriotylum is a destructive soil-borne pathogen that belongs to the order Pythiales, phylum Oomycete (Plaats-Niterink, 1981; Webster and Weber, 2007). This widespread pathogen causes pre- and post-emergence damping off and mature plants of many agricultural and horticultural crops (McCarter and Littrell, 1970; Pacumbaba et al., 1992; Plaats-Niterink, 1981; Porter, 1970; Sigobodhla et al., 2010; Stirling et al., 2004; 2009; Tsror et al., 2004). Depending on the crop and field conditions, yield losses caused by P. myriotylum have been reported to be between as little as

Chapter 5 │SNP diagnostics 4% on soybean grown in Japan (Tomioka et al., 2013) to as much as 90% on cocoyam grown in Cameroon (Pacumbaba et al., 1992) or even up to 100% on ginger grown in Australia (Stirling et al., 2009).

In many cases temperature plays a significant role on the pathogenicity and aggressiveness of P. myriotylum; higher temperatures are associated with greater disease levels (Kim et al., 1997a; Plaats-Niterink, 1981; Stirling et al., 2004; Tomioka et al., 2013). For instance Kim et al. (1997b) found that ginger plants grown at 35 - 40 °C were killed by P. myriotylum three times faster than for plants grown at 15 °C. Similarly, on capsicum disease severity was exacerbated when soil temperature increased from 25 to 40 °C (Stirling et al., 2004). Damping off incidence on soybean associated with P. myriotylum was also higher when the temperature was around 35 °C compared with lower temperatures (Southern, 1976; Tomioka et al., 2013) and stands of rye and tomato sown in a soil mix infested with P. myriotylum were also almost completely lost at 35 °C (Littrell and McCarter, 1970). However, not all isolates of P. myriotylum appear to require high temperatures and this may be influenced by the host and geographical origins of the isolates. P. myriotylum initially recovered from diseased cocoyam was able to quickly kill cocoyam plants at 24 - 28 °C within a week in an inoculated pathogenicity assays (Perneel et al., 2006; Tambong et al., 1999; Tojo et al., 2005). As reported in chapter 4, P. myriotylum isolates obtained from PSR ginger in Australia showed pathogenicity over a wide range temperature from 20 - 35 °C.

In Australia, severe losses in capsicum and ginger crops have been attributed to P. myriotylum (Stirling et al., 2004; 2009). The isolates of P. myriotylum from these hosts showed a differential response in pathogenicity to capsicum and ginger plants (unpublished data). Additionally, the isolates from ginger and capsicum also differed from each other in morphology and physiology (unpublished data). Therefore, it is theorised that these differences are the result of distinct pathogen genotypes. The aim of this chapter was to assess the genetic diversity of isolates of P. myriotylum, to potentially reveal any distinct genotypes associated with pathogenicity on ginger and if found to use such information to devise detection tools to identify those strains of P. myriotylum associated with PSR ginger in Australia. For this purpose, sequences of conserved regions obtained from whole genome sequences of five P. myriotylum isolates originally recovered from different hosts and locations were subjected to single nucleotide polymorphism (SNP) analyses. SNPs are of increasing interest for studies in ecology, evolution, conservation, and population history since SNPs are the most common polymorphism that occurs in genomes and also provide valuable information for marker design (Brookes, 1999; Brumfield et al., 2003; Morin et al., 2004).

Chapter 5 │SNP diagnostics Based on our sequence data, a PCR-RFLP (PCR-restriction fragment length polymorphism) tool was developed and employed for detection and identification of P. myriotylum strains recovered from PSR ginger in Australia. PCR-RFLPs is a reliable molecular tool for species discrimination of Pythium (Chen and Hoy, 1993; Chen, 1992; Paul et al., 1998). Gómez‐Alpízar et al. (2011) successfully utilised a PCR-RFLP of the ITS gene to differentiate P. myriotylum strains recovered from cocoyam and non-cocoyam hosts. PCR-RFLPs were also commonly used for studies of Pythium ecology and diversity in the absence of pure cultures (Chen et al., 1992; Rafin et al., 1995) and as well as for detecting of intra-specific variations among isolates and within single spore isolates of Pythium (Kageyama et al., 2007; Martin, 1990; Martin and Kistler, 1990).

5.2. Materials and methods 5.2.1. Pythium and fungal cultures A total of 43 isolates of 18 Pythium spp., one Pythiogeton ramosum, one Sclerotium sp. and one Fusarium sp. were included in this study (Table 5.1). In most cases DNA was extracted from living cultures growing on potato broth (Difco). These isolates had been previously stored in a collection at Plant Pathology lab, School of Agriculture and Food Sciences, The University of Queensland after having been obtained from the field or from colleagues as listed. The exception was for the six P. myriotylum isolates from Japan where DNA extracts were provided by Prof. Kageyama from Gifu University, Japan.

Table 5.1: Pythium and fungal isolates used in this study Species Isolate Host/habitat Origin Digested with HinP1I P. myriotylum UQ5979 Ginger Australia + P. myriotylum UQ5980* Ginger Australia + P. myriotylum UQ5982 Ginger Australia + P. myriotylum UQ6152* Ginger Australia + P. myriotylum UQ6054 Ginger Australia + P. myriotylum UQ6022 Ginger Australia + P. myriotylum UQ6221 Ginger Australia + P. myriotylum UQ6342 Ginger Australia + P. myriotylum NAM10 Ginger Australia + P. myriotylum UQ6229 Ginger Australia + P. myriotylum UQ6223 Ginger Australia + P. myriotylum UQ6237 Ginger Australia + 70

Chapter 5 │SNP diagnostics P. myriotylum UQ6354 Ginger Australia + P. myriotylum KRS14 Ginger Fiji + P. myriotylum GF64 Kalanchoe Japan - P. myriotylum BeAT1 Kidney bean Japan - P. myriotylum FuOri1 Soybean Japan - P. myriotylum K9-9-7 Sludge Japan - P. myriotylum GunM1 Myoga ginger Japan - P. myriotylum GUKan7sh Kanzo Japan - P. myriotylum BRIP39907 Capsicum Australia - P. myriotylum UQ5993* Capsicum Australia - P. myriotylum CBS254.70* Tomato Israel - P. zingiberis NBRC30817* Ginger Japan - P. aphanidermatum UQ6082 Soil Australia - P. aristosporum UQ6377 Wheat Australia - P. deliense UQ6021 Soil Australia - P. graminicola UQ6049 Ginger Australia - P. heterothallicum UQ6290 Soil Australia - P. irregulare UQ5986 Oat Australia - P. oligandrum UQ6085 Soil Australia - P. perplexum UQ6252 Soil Australia - P. recalcitrans UQ6140 Capsicum Australia - P. spinosum UQ6026 Soil Australia - P. splendens UQ6036 Soil Australia - P. sulcatum UQ6269 Carrot Australia - P. torulosum UQ6291 Soil Australia - P. ultimum UQ6023 Soil Australia - P. vanterpoolii UQ6382 Ginger Australia - P. vexans KRS11 Ginger Fiji - Pythiogeton ramosum UQ6020 Ginger Australia - Sclerotium sp. UQ6043 Ginger Australia - Fusarium sp. UQ6044 Ginger Australia -

* Isolates were whole genome sequenced for genetic diversity studies

Chapter 5 │SNP diagnostics 5.2.2. Sequence diversity based on SNP analysis Whole genome sequence data of four isolates, including CBS254.70, NBCR30817, UQ5980 and UQ6152 presented chapter 3 and an additional sequence of isolate UQ5993 retrieved from Illumina sequencing method were explored for sequence diversity based on SNP genotyping. A reference annotated mitochondrial genome of P. ultimum BR114 was mapped with P. myriotylum genome data to initially identify names of gene sequences. The identified gene sequences from each isolate of P. myriotylum were retrieved and aligned by utilizing the Geneious 7.1.4 software. The alignments were visually inspected for SNPs based on presence of heterozygous bases. The SNPs were then verified by visual inspections of the mapped regions in which 90% of mapped reads carried the SNP. Additionally, publicly available sequences in a nuclear genome were included in this study. The studied sequences were translated and aligned to determine if SNPs were synonymous or non-synonymous. The translated sequences were also aligned by the Geneious 7.1.4 software. Only sequences that appeared highly conserved among the five isolates are presented in this study.

5.2.3. PCR-RFLP for CoxII region Based on results, the CoxII gene sequence was further analysed for use in developing a PCR-RFLP tool to be used for detection and identification of P. myriotylum strains isolated from PSR ginger. Whole genomic DNA was extracted from both mycelia and infected ginger rhizome obtained from pot trials in chapter 4 by using the CTAB protocol of Doyle and Doyle (1990). Approximately 600 bp of the CoxII gene was amplified by using two primers: FM66 (5’ TAGGATTTCAAGATCCTGC 3’) and FM58 (5’ CCACAAATTTCACTACATTGA 3’) (Martin, 2000). The PCR was performed in an Eppendorf Mastercycler® with one cycle of denaturation for 5 min at 94 °C, followed by 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 90 s, and one cycle of final extension for 10 min at 68 °C. The amplified products were electrophoresed under 110 V in 1.5% agarose gel (Sigma) stained with ethidium bromide for 40 min and visualised with UV light to confirm the success of the reactions.

An enzyme, HinP1I (New England Biolabs) was selected due to its unique cutting site, which was predicted using a Web based tool, NEBcutter V2.0. The amplicons of the CoxII gene were digested with the HinP1I in 12 µL reaction mixtures containing 0.2 µL of the enzyme (2 units), 1.2 µL of

10X NEBuffer, 10 µL of PCR products, and 0.6 µL of dH2O. The digestions were performed at 37 °C for 3 h, followed by a deactivation of the enzyme at 65 °C for 20 min. The RFLP products were electrophoresed and visualised as described above.

Chapter 5 │SNP diagnostics 5.3. Results 5.3.1. Sequence diversity based on SNP typing A total of 22 highly conserved gene fragments among the five studied isolates were identified and retrieved from whole genome data by mapping with annotated genome of P. ultimum BR114. Of the 22, 17 and five were retrieved from mitochondrial and nuclear genomes, respectively. A summary of the sequence length, the number of SNPs, the SNPs/kb and number of non- synonymous SNPs of the 22 gene fragments is presented in Table 5.2. Depending on loci and isolates, the genetic differences among P. myriotylum isolates varied from zero to up to 1% (6.79 SNPs/kb). Overall, a total of 129 SNPs was identified along 22 genes, including coding and non- coding genes in nuclear and mitochondrial genomes. Approximately 99.98% of the SNPs were single base pair (bp) substitutions. There were only two single bp insertions in the small subunit of mitochondrial genome of the isolate CBS254.70. Of these, 57 were synonymous SNPs and 72 were non-synonymous SNPs. Of the non-synonymous SNPs, some altered stop codons resulting in changes in translated protein sequences (Table 5.3). The two isolates UQ5980 and UQ6152 recovered from PSR ginger had the highest number of SNPs (58) and the frequency of one SNP every 437 bp, compared with the isolates UQ5993 recovered from capsicum and CBS254.70 which had the lowest number of SNPs (20 and 21 respectively) and the SNP occurred every 1267 bp. With 30 SNPs and the occurrence of one SNP/845 bp, the isolate NBRC30817 was of intermediate polymorphism among the five isolates studied. Of the studied genes of the nuclear genome, overall the SNP frequency was detected in every 1450 bp and 2175 bp in UQ5980, UQ5993, UQ6152 and CBS254.70, respectively. Meanwhile, a SNP was detected around 4.5 and 2.5 times more frequently (1 SNP per every 320 bp) in the studied genes of the mitochondrial genome in UQ5980 and UQ6152, and CBS254.70 and NBRC30817, respectively. The isolate UQ5993 had a similar SNP frequency in both nuclear and mitochondrial genomes.

Chapter 5 │SNP diagnostics Table 5.2: Genetic diversity compared among the five P. myriotylum and P. zingiberis isolates based on a summary of SNP information including sequence length, number of SNPs/gene, number of SNPs/kb and number of non-synonymous SNPs P. myriotylum UQ5980 P. myriotylum UQ6152 P. myriotylum UQ5993 P. myriotylum CBS254.70 P. zingiberis NBRC30817

Legth Non- Non- Non- Non- Non- Regions (bp) SNPs SNPs/kb synonymous SNPs SNPs/kb synonymous SNPs SNPs/kb synonymous SNPs SNPs/kb synonymous SNPs SNPs/kb synonymous

SSU (18S) 2305 1 0.43 1.0 1 0.43 1.0 1 0.43 1.0 0 0.00 0.0 3 1.30 1.0

LSU (28S) 3778 2 0.53 0.0 2 0.79 0.0 0 00.0 0.0 0 0.00 0.0 0 0.00 0.0

DNA

a ITS 817 1 1.22 0.0 1 1.22 0.0 2 2.45 0.0 0 0.00 0.0 0 0.00 0.0 Actin 879 2 2.28 2.0 2 2.28 2.0 1 1.14 1.0 2 2.28 1.0 2 2.28 1.0

Nuclear β-tubulin 920 0 0.00 0.0 0 0.00 0.0 3 3.26 3.0 3 3.26 3.0 0 0.00 0.0 CoxI 1478 7 4.74 6.0 7 4.74 6.0 1 0.68 1.0 2 1.35 1.0 0 0.00 0.0 CoxII 773 5 6.47 5.0 5 6.47 5.0 0 0.00 0.0 1 1.29 0.0 0 0.00 0.0 CoxIII 914 3 3.28 3.0 3 3.28 3.0 1 1.09 1.0 1 1.09 1.0 0 0.00 0.0 NAD1 980 2 2.04 0.0 2 2.04 0.0 1 1.02 0.0 0 0.00 0.0 1 1.02 0.0 NAD4L 302 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0

mtSSU 1510 5 3.31 3.0 5 3.31 3.0 1 0.66 0.0 2 1.32 2.0 3 1.99 1.0

mtLSU 2654 4 1.51 2.0 4 1.51 2.0 1 0.38 0.0 3 1.13 2.0 2 0.75 1.0 DNA b b ATP1 1534 7 4.56 7.0 7 4.56 7.0 0 0.00 0.0 1 0.65 2.0 2 1.30 1.0 ATP8 389 1 2.57 0.0 1 2.57 0.0 1 2.57 0.0 0 0.00 0.0 0 0.00 0.0 ATP9 227 1 4.41 0.0 1 4.41 0.0 0 0.00 0.0 0 0.00 0.0 1 4.41 0.0

NAD7 1178 8 6.79 8.0 8 6.79 8.0 1 0.85 1.0 2 1.70 2.0 4 3.39 3.0 Mitochondrial NAD5 1994 5 2.51 0.0 5 2.51 0.0 4 2.01 3.0 2 1.00 0.0 2 1.00 0.0 NAD6 740 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0 1 1.35 0.0 1 1.35 1.0 RPL2 806 1 1.24 1.0 1 1.24 1.0 1 1.24 0.0 0 0.00 0.0 4 4.96 1.0 RPL16 404 1 2.48 0.0 1 2.48 0.0 0 0.00 0.0 0 0.00 0.0 1 2.48 1.0 RPS14 299 0 0.00 0.0 0 0.00 0.0 1 3.34 1.0 0 0.00 0.0 0 0.00 0.0 RPS4 461 2 4.34 0.0 2 4.34 0.0 1 2.17 0.0 2 4.34 1.0 1 2.17 1.0 a Nuclear gene includes: small (SSU) and large subunit (SLU) of rDNA; b Mitochondrial gene includes: cytochrome c subunit (Cox), NADH dehydrogenase subunit (NAD), ATP synthase subunit (ATP), ribosomal protein (RPL or RPS). 74

Chapter 5 │SNP diagnostics Table 5.3: Characteristics of non-synonymous SNPs in five P. myriotylum and P. zingiberis isolates; loci without non-synonymous SNPs were excluded in this table. SNP Amino acid Regionsa Context UQ5980 UQ6152 UQ5993 CBS254.70 NBRC30817 position replacement SSU (18S) 136 (A/T)CT Ser-Thr A A T A T Actin 178 (A/G)CT Thr-Ala G G G G A 478 (T/C)GG Arg-Trp C C T T T 655 (C/G)GG Arg-Gly C G G G G 682 (C/T)GG Trp-Arg T T T C T 715 (C/C)GC Cys-Arg C T C T T β-tubulin 14 T(C/T)T Ser-Phe C C T T C 383 T(C/T)T Ser-Phe C C T T C

482 C(T/C)A Leu-Pro T T C C T CoxI 358 (C/T)GG Arg-Trp C C T T T 415 (T/C)CC Ser-Pro T T C C C 739 (T/C)TT Phe-Leu T T C C C 1138 (T/C)GT Arg-Cys C C T T C 1156 (C/T)GG Arg-Trp C C T T T 1372 (C/T)CC Pro-Ser C C T T T 1429 (C/T)GC Arg-Cys C C T T T CoxII 115 (C/T)TT Leu-Phe T T T C T 154 (C/T)AG Gle-stop codon C C T T T 214 (C/T)GC Arg-Cys C C T T T 316 (T/C)CC Ser-Pro T T C C C 664 (C/T)CA Pro-Ser C C T T T 694 (G/A)GT Gly-Ser G G A A A CoxIII 91 (A/G)AA Lys-Glu G G A A G 94 (G/A)TG Val-Met G G A A A 451 (G/A)CC Ala-Thr G G A A A 622 (A/G)GT Ser-Gly A A G G G mtSSU 97 (G/A)TA Val-Ile-Ser G G G G A 372 GA(G/A) Glu-Glu-Arg G G A A A 716 A(G/T)C Ser-Ile-Tyr G G T T T 776 A(A/G)T Asn-Ser-Glu A A G G G 844 TC(A/G) Glu-Phe-Gln A A A A G 1187 A(T/-)T Stop codon-Ile - - - T - 1252 A(A/G)G Lys-Glu-Met A A G G G Stop codon- 1500 (A/G)AA A A G G G Trp-Glu mtLSU 665 T(T/A)A Stop codon- T T A A A

Chapter 5 │SNP diagnostics

Leu 757 (G/A)CT Thr-Ala G G G A G 865 (G/A)AG Lys-Glu G G G G A 1951 (T/C)AT Phe-His T T C C C 2431 (G/C)GT Gly-Arg C C C G C Stop codon- ATP1 92 AT(T/G) G G G G T Leu 104 (T/C)GC Leu-Ser T T C C C 125 C(T/C)A Leu-Pro T T C C C 200 A(C/T)C Thr-Met C C T T T 254 (C/T)GT Ser-Leu C C T T T 485 G(A/G)C Glu-Gly A A G G G 503 A(T/C)A Ile-Thr T T C C C 581 A(C/T)A Thr-Ile C C T T T 779 A(G/A)C Ser-Asn A A A G A

ATP8 47 (C/T)CT Ser-Phe C C T T T NAD7 91 T(A/G)G Trp-Stop codon A A G G G 148 G(A/G)G Glu-Gly A A G G G 244 C(C/T)T Pro-Leu T T T T C 301 A(T/C)A Ile-Thr T T C C C 402 G(G/A)T Gly-Asp A A A A G 544 A(G/A)T Ser-Asn G G A A A 571 A(A/G)G Lys-Arg G G A A G 630 (A/G)TG Met-Val G G G G A 997 A(G/A)(G/T) Arg-Lys-Asn G G A A A 998 A(G/A)(G/T) Arg-Lys-Asn G G G T G 1000 C(C/T)C Leu-Pro C C T T T 1015 (T/C)GG Met-Thr T T C C C 1141 A(C/T)A Pro-Leu C C T T T 1145 TA(C/A) Stop codon-Tyr A A A C A

NAD5 57 TT(G/T) Leu-Phe T T G T T 135 AT(G/A) Met-Ile A A G A A 158 T(T/C)A Leu-Ser C C T C C NAD6 217 (A/G)T(A/T) Ile-Thr G G G G A RPL2 441 A(C/A)G Lys-Asn C C A A A 610 (A/T)TA Ile-Leu T T T T A

RPL16 112 (A/G)AA Lys-Glu G G G G A RPS4 20 C(T/G)A Arg-Leu G G G G T 52 (T/C)CA Pro-Ser C C C T C a Cox: cytochrome c subunit; NAD: NADH dehydrogenase subunit; ATP: ATP synthase subunit; RPL and RPS: ribosomal protein 76

Chapter 5 │SNP diagnostics 5.3.2. PCR-RFLP analysis A number of unique SNPs that resulted in restriction sites were identified using a NEBcutter V2.0. Of those, a single bp substitution of cytosine (C) for thymine (T) was identified at position 175 bp of the 600 bp of the CoxII amplicon in only P. myriotylum isolates recovered from PSR ginger in Australia. This SNP resulted in a HinP1I restriction site. The substitution was unique to P. myriotylum isolates from PSR ginger and this was confirmed with the PCR-RFLP digestion using the HinP1I. The HinP1I cleaved the PCR products of PSR and non-PSR isolates of P. myriotylum into two and one bands visualized under UV light, respectively (Fig 5.1). The results indicated the applicability of the PCR-RFLP of the CoxII gene to discriminate the PSR isolates of P. myriotylum from the non-PSR ones.

Genomic DNA of P. myriotylum obtained directly from the PSR ginger in chapter-4 pot trials was sufficient for the PCR amplification of the CoxII gene and the digested products also showed corresponding bands to those of the pure cultures of PSR isolates of P. myriotylum (Fig 5.1).

Fig 5.1: HinP1I restriction banding patterns of the partly amplified CoxII gene of P. myriotylum isolates obtained from different hosts and origins: Lane 1, 100 bp ladder marker; lanes 2-15, DNA templates of P. myriotylum isolates obtained from PSR ginger (except for lane 9, amplification failed); lanes 16-20, DNA templates of P. myriotylum extracted directly from pot trial PSR ginger; lane 21-26, DNA templates of P. myriotylum isolates obtained from Japan; lanes 27-28, DNA templates of P. myriotylum isolates obtained from capsicum wilt; lane 29, P. myriotylum CBS254.70; lane 30, P. myriotylum NBRC30817

Chapter 5 │SNP diagnostics 5.4. Discussion This study for the first time compared multi-genes (up to 22 individual genes) within the nuclear and mitochondrial genomes among the isolates of P. myriotylum obtained from different hosts and origins. The objective was to assess intraspecific diversity based on the SNP genotyping for discovery of genetic variants.

Within the genus Pythium, P. irregulare, P. helicoides, P. mercurial and P. ultimum have all been shown to be highly intraspecific species (Barr et al., 1996; 1997; Belbahri et al., 2008; Garzón et al., 2005; Kageyama et al., 2007; Matsumoto et al., 2000). Meanwhile, P. myriotylum only exhibits a SNP variation as was shown for the ITS region for isolates recovered from cocoyam compared to other non-cocoyam isolates (Gómez‐Alpízar et al., 2011; Perneel et al., 2006). Similar SNP variants were also observed among P. myriotylum isolates recovered from PSR ginger in China (Yuan et al., 2013). As reported in chapter 3, sequence divergence among the tested P. myriotylum in this study was just about 1%, suggesting that little genetic variation among isolates of P. myriotylum. In fact, the genetic variation varied from no SNP to up to 7.6 SNPs per 1 kb depending on studied loci and origin of isolates. PSR isolates in Australia had higher SNPs than non-PSR isolates and an overseas PSR isolate. Likewise, in studies on Phytophthora (Ph.) infestans, Abbott et al. (2010) found that no SNPs were detected among isolates of Ph. infestans originated from Colombia when examining five microsatellite flanking regions (MFR) of 57 isolates, but a few SNPs across 32 MFRs were apparent when comparing Ph. infestans isolates sampled from Russia, Peru, China, USA and Switzerland. Of the loci within this study, the greatest number of SNPs among the P. myriotylum isolates was observed in NAD7 locus where up to 6.79 SNPs/kb occurred when examining PSR isolates. This intra-varietal variation (SNP/kb) was comparable to those identified among P. ultimum isolates (Eggertson, 2012). Tyler et al. (2006) found a lower SNP frequency of one SNP in every 5 kb and 20 kb in genome sequences of Ph. ramorum and Ph. sojae, respectively. Fleischmann et al. (2002) theorized that genetic variation might play important roles in disease pathogenesis. Therefore, it will be of interest if future studies find any relationship between the genetic mutations in PSR P. myriotylum isolates and its high aggressiveness to ginger, as well as variable responses to environmental and ecological changes.

Among the P. myriotylum isolates studied, the overall number of SNPs/kb was similar for each of the loci within the nuclear genome, but the two isolates of P. myriotylum from PSR ginger had a higher number of SNPs/kb than the two non-PSR P. myriotylum isolates. The mitochondrial genome is believed to have evolved faster than the nuclear genome, resulting from a high mutation rate (Morin et al., 2004), and mitochondrial gene sequences are therefore considered to be a better 78

Chapter 5 │SNP diagnostics choices for markers. The SNPs discovered in this study in the mitochondria might be useful to differentiate the PSR P. myriotylum isolates from non-PSR ones. Currently, partly sequenced CoxI and CoxII in the mitochondrial genome have been widely used along with the ITS region to delimitate closely related Pythium spp. (Martin, 2000; Robideau et al., 2011). However, a similar study by Eggertson (2012) determined that the number of intra-variants of some loci in the nuclear genome of P. ultimum was much higher than those determined in the mitochondrial genome. Song et al. (2008) and Eggertson (2012) also argued that it is inappropriate to use multi-loci of the mitochondrial genome for phylogenetic studies as the genome is non-recombinant and single uni- parentally inherited, which might result in a species estimate bias.

The PCR-RFLP of the CoxII locus with the HinP1I successfully discriminate the PSR P. myriotylum isolates from the non-PSR ones and other Pythium spp. as well as from fungi without the need for further sequencing. A single digestion of the CoxII amplicon with HinP1I was also able to detect PSR P. myriotylum directly from artificially inoculated ginger without requirements of pure cultures, so this simple, reliable and accurate technique could be employed to rapidly identify P. myriotylum that induces PSR in ginger. Likewise, Gómez‐Alpízar (2011) also successfully developed PCR-RFLP of the ITS locus to detect and differentiate P. myriotylum isolates which were pathogenic to cocoyam from non-pathogenic P. myriotylum to cocoyam. Interestingly, regardless of a number of SNPs identified, the PSR P. myriotylum isolates only showed a certain level of host specificity to ginger, while cocoyam P. myriotylum isolates appeared totally host specificity, such isolates were identified by a unique SNP on the ITS2 region (Gómez‐Alpízar et al., 2011). Therefore, the use of such SNPs is open for future research.

PCR-RFLP has been proven to be a powerful molecular tool for detection and identification of Pythium spp. in other studies (Francis et al., 1994; Gómez‐Alpízar et al., 2011; Harvey et al., 2000; Kageyama et al., 2005; Matsumoto et al., 2000; Rafin et al., 1995). However, with rapid progress in developing novel molecular tools, PCR-RFLP is considered to be a time consuming approach compared to isothermal amplification of DNA techniques such as LAMP (loop-mediated isothermal amplification) and SMAP 2 (smart amplification process version 2) (Mitani et al., 2007; Notomi et al., 2000). Both techniques, LAMP and SMAPs have shown to be highly specific detection methods of pathogen targets with the capability of detecting SNPs (Duan et al., 2015; Mitani et al., 2007; Yabing et al., 2015). Thus, applications of novel techniques for fast, effective and accurate detection of PSR P. myriotylum strains will be warranted.

Chapter 5 │SNP diagnostics Briefly, P. myriotylum recovered from PSR ginger in Australia exhibited a certain level of genetic variation compared with other P. myriotylum isolates. A number of SNPs were discovered in this study providing a valuable source for marker development. Moreover, a number of genetic variants within P. myriotylum was identified. It is possible that these variants may be responsible for aggressiveness and pathogenicity, as well as variable responses to environmental and ecological changes. Attempts to correlate the genetic variation within the pathogen with differences in pathogenicity and environmental response are open for further investigations. Use of PCR-RFLP of the CoxII locus was successfully deployed to differentiate the PSR P. myriotylum strains from non- PSR P. myriotylum strains.

Chapter 6 │P. olgiandrum and P. myriotylum interactions Chapter 6 : INTERACTIONS BETWEEN MYCOPARASITIC PYTHIUM OLIGANDRUM ISOLATED FROM GINGER FIELDS AND PATHOGENIC PYTHIUM MYRIOTYLUM

Abstract Pythium oligandrum, an oomycete, a mycoparasite, a competitor, an antibiotic producer and a plant defence inducer is the most commonly studied within a mycoparasitic group of Pythium. It is consequently a potential biological control agent (BCA) for a number of crop species. This study focuses on two endemic strains of P. oligandrum recovered from bulk soils around ginger exhibiting symptoms of Pythium soft rot (PSR). P. oligandrum showed moderate mycoparasitism towards an isolate of P. myriotylum Gin1 (Pm-Gin1) that had been originally isolated from PSR ginger. Whereas the same P. oligandrum isolates showed variable degree of mycoparasitism towards an isolate of P. myriotylum Cap1 (Pm-Cap1) initially isolated from sudden wilt of capsicum and towards an isolate of P. ultimum So1 (Pu-So1) recovered from soil in a ginger field. Corn meal agar cultures pre-colonised by Pm-Gin1 and Pu-So1 did not have an adverse effect on growth and oospore production of P. oligandrum, but growth of P. oligandrum was affected when placed on media already colonised by Pm-Cap1. Metabolic compounds, including volatiles and non-volatiles produced by P. oligandrum appeared non-toxic to tested Pythium spp. P. oligandrum provided significant protection of millet, rye and wheat seeds against Pm-Gin1 and Pu-So1 in vitro dual culture assays; however, disease severity of ginger plants co-inoculated with P. oligandrum and Pm-Gin1 appeared no different in disease response compared with plants with single inoculation of Pm-Gin1. This is the first attempt to understand interactions between P. oligandrum and the PSR pathogen of ginger in Australia.

Key words: antagonist, mycoparasite, competitor, toxins, BCA, disease severity

6.1. Introduction The genus Pythium was first described by Pringsheim in 1858. This genus is now known to be ubiquitous occupying a wide array of environmental niches (Ho, 2009). Pythium can be pathogenic to plants (Hendrix and Campbell, 1973) or animals (De Cock et al., 1987), or can be non-pathogenic (Plaats-Niterink, 1981) existing as a saprophyte, or it can be mycoparasitic (Karaca et al., 2008). Within the mycoparasitic group, P. oligandrum is the most commonly studied species and has been demonstrated to have great potential as a biological control agent (BCA). Consequently, it has been registered as a bio-fungicide in several countries (Benhamou et al., 2012; Brozova, 2002; Gerbore et al., 2014a). P. oligandrum was originally described by Drechsler in 1930 having been isolated 81

Chapter 6 │P. olgiandrum and P. myriotylum interactions from rotting roots of pea (Pisum sativum). Later, several reports indicated that P. oligandrum was a parasite of many fungal species such as Fusarium spp., Rhizoctonia solani, Phoma medicaginis, Sclerotinia spp., Botrytis cinerea and Verticillium spp. (Al-Rawahi and Hancock, 1998; Bradshaw- Smith et al., 1991; El-Katatny et al., 2006; He et al., 1992; Ikeda et al., 2012; Mette Madsen and de Neergaard, 1999; Rey et al., 2005; Ribeiro and Butler, 1995), as well as oomycetes, including Pythium spp., Phytophthora spp. and Aphanomyces cochlioides (Abdelzaher et al., 1997; Benhamou et al., 1999; Horner et al., 2012; McQuilken et al., 1990; Ribeiro and Butler, 1995; Takenaka and Ishikawa, 2013). In addition, P. oligandrum has been reported to have the capability of induce disease resistance and promote plant growth of many crops in both in vitro and in vivo studies (Benhamou et al., 2012; Brozova, 2002; Gerbore et al., 2014a; Takenaka et al., 2008; Yacoub et al., 2016). These three-way interaction between P. oligandrum, pathogens and hosts resulting in disease suppressions were believed to be unique for this BCA (Lévesque, 2011).

Although many studies have reported the beneficial effects of P. oligandrum in protecting crops, the efficacy of applications is still variable (Floch et al., 2009). Depending on the crop, application methods and target pathogens, protection levels achieved by P. oligandrum recording from 12 to up to 100% (Gerbore et al., 2014a). Ribeiro and Butler (1995) found that survival of sugar beet seedlings increased by 52.5% when grown in dual cultures of P. oligandrum and P. ultimum, in comparison to single cultures of pathogenic P. ultimum. In similar studies, Ali-Shtayeh and Saleh (1999) reported that the survival rate of cucumber seedling increased by around 34% in potting mix, where P. oligandrum was co-inoculated with P. ultimum a opposed to P. ultimum alone. Seed- coating methods using P. oligandum have also been done. McQuilken et al. (1990) concluded that commercial pelleting or film-coating seeds of cress and sugar beet with P. oligandrum were as effective as chemical drenches at reducing damping off caused by P. ultimum, R. solani and A. cochlioides. Of the two seed treatments with P. oligandrum, the pelleting treatment was more effective than the film-coating. However, the protection levels either with fungicidal applications or seed coating with P. oligandrum were still insufficient in controlling damping off in soils with high pathogen potential (McQuilken et al., 1990; Takenaka and Ishikawa, 2013). Al-Rawahi and Hancock, (1998) reported fresh biomass of shoots and fruits of bell pepper was significantly higher following co-inoculation soil treatments with Verticullium dahlia and P. oligandrum than those treated with V. dahlia alone despite similar disease incidence. Due to inconsistency in disease control provided by P. oligandrum, it is in general recommended that either multiple applications or co-inoculations of P. oligandrum with other BCAs are more likely to reduce degrees of variability in protection provided by P. oligandrum (Al-Rawahi and Hancock, 1998; Floch et al., 2009; Holmes et al., 1998; Takenaka and Ishikawa, 2013; Gerbore et al., 2014a). 82

Chapter 6 │P. olgiandrum and P. myriotylum interactions

Depending on the target phytopathogenic species of Pythium, the antagonistic effect of P. oligandrum may differ significantly. For example, P. aphanidermatum, P. graminicola and P. vexans were unaffected by P. oligandrum (Jones and Deacon, 1995; Laing and Deacon, 1991), while P. oligandrum was most virulent to P. heterothallicum, P. intermedium, P. irregulare and P. ultimum (Foley and Deacon, 1986). Susceptibility of Pythium spp. to P. oligandrum antagonism can vary greatly among isolates within a species and be influenced by environmental conditions (Al- Rawahi and Hancock, 1998; Floch et al., 2009; Foley and Deacon, 1986; Takenaka and Ishikawa, 2013). In chapters 4, isolates of P. myriotylum varied in aggressiveness; those recovered from PSR ginger were more aggressive and over a wider temperature range on ginger compared with isolates of P. myriotylum recovered from other host crops. Similarly, isolates of P. myriotylum may vary in their level of antagonism by P. oligandrum. The origin of the P. oligandrum may also be critical; those isolated directly from soil collected around PSR ginger may have co-evolved with ginger infecting isolates of P. myriotylum and therefore are more adapted to attack such strains. In this study, interactions between P. myriotylum and P. oligandrum were investigated to determine the potential of P. oligandrum as a BCA against P. myriotylum with the aim of suppressing disease severity of PSR on ginger.

6.2. Materials and Methods 6.2.1. Pythium spp. cultures Isolates of P. oligandrum (Po-So1 = UQ6080 and Po-So2 = UQ6085) were obtained from soils around ginger rhizomes sampled in Yandina, Sunshine Coast by baiting from the soil following the method of Stanghellini and Kronland (1985). The target phytopathogenic species of Pythium used included one isolate of P. myriotylum Cap1 (Pm-Cap1 = UQ5993) recovered from capsicum which had exhibited sudden wilt syndrome, one isolate of P. myriotylum Gin1 (Pm-Gin1 = UQ6512) collected directly from a ginger rhizome with soft rot disease sampled from Yandina, Sunshine Coast, Australia and one isolate of P. ultimum So1 (Pu-So1 = UQ6023) recovered from the soil surrounding a ginger rhizome with soft rot. Working cultures for these isolates were maintained on potato dextrose agar (PDA, Difco). For long term storage, the cultures were placed on half strength 2% corn meal agar (CMA) prepared from maize meal (Polenta) based on the protocol of Dhingra and Sinclair (1995) and then submerged in sterile distilled water and stored at room temperature in the dark.

Chapter 6 │P. olgiandrum and P. myriotylum interactions 6.2.2. Mycoparasitism of P. oligandrum Microscopic observations of mycoparasitic capability of Po-So1 and Po-So2 against the phytopathogenic Pythium isolates were carried out based on the descriptions of Laing and Deacon (1991) with slight modifications. For this purpose, microscope slides were prepared as follows. One side of an autoclaved cover slip was gently and quickly dipped into 0.3% (w/v) agar of molten BCMA which was composed of CMA amended with 15% brown sugar (Bundaberg Rich Brown Sugar). BCMA promotes the growth and formation of the characteristics spiny oogonia of P. oligandrum. The molten media created a thin film covering the cover slip, that was left to set in a laminar flow bench for a few seconds after which the cover slip was transferred, agar-film side up, onto 2% water agar (WA) within a 90 mm dia Petri plate. Each plate was inoculated with a 5 mm2 plug of either Po-So1 or Po-So2 and the target phytopathogenic Pythium isolates growing actively on PDA. The plugs were placed 2.5 cm from the edge of the cover slips and opposite to each other. The plates were sealed with Parafilm and incubated in dark at 25 °C for 3 days. The cover slips were then transferred onto microscopic slides with the agar film sides down and observed under a compound microscope to check for parasitism by Po-So1 and Po-So2 following the ratings of Ribeiro and Butler (1995). These ratings were based on the number of hyphal coils and internal colonization of Po-So1 and Po-So2 on the target phytopathogens and are as follows. - Type 0. Immune: No hyphal coiling observed - Type 1. Resistant: A few incidence of hyphal coiling noted (less than 10 per cover slip) and strictly limited to hyphal contact regions between Po-So1 and Po-So2 and the target isolates. No internal colonization noted. - Type 2. Slightly susceptible: More than 10 hyphal coils observed and coiling found beyond the contact regions. Internal colonization appeared infrequently. - Type 3. Moderately susceptible: Hyphal coiling observed abundantly, but some of the target mycelia are free of Po-So1 and Po-So2 hyphal coils. Internal colonization also observed abundantly. - Type 4. Highly susceptible: Hyphal coiling and internal colonization observed throughout.

6.2.3. Growth competition of P. oligandrum To assess the ability of Po-So1 and Po-So2 to compete with phytopathogenic Pythium spp., a slight modification of pre-colonized plate method described by Berry et al. (1993) was used. The target Pythium isolates were subcultured (5 mm2 plugs) on one side of a CMA Petri plate. Four replicate plates were used per tested target Pythium isolates. The plate was incubated at 25 °C for 5 days by which point the mycelia had nearly reached the other side of the plate. For each plate, a plug of P. oligandrum was then introduced on the opposite side of the plate to the plugs of the tested Pythium 84

Chapter 6 │P. olgiandrum and P. myriotylum interactions spp., and the plate continued to be incubated at the same temperature. The base of each plate was marked with two 5 mm wide strip extending across the plate to include both inoculum plugs. After 3 and 7 days incubation, the medium and culture along the first and second strip, respectively were excised. Each of the excised strips was subdivided into 5mm squares and plated onto a fresh plate of BCMA in order of distance from the original P. oligandrum plug. The BCMA plates were incubated again at 25 °C and examined after 7 days directly under an inverted microscope for the presence of spiny oogonia. Presence of spiny oogonia indicated the extent of growth of P. oligandrum into the mycelia of the target phytopathogenic isolates.

6.2.4. Effect of volatile compounds of P. oligandrum on growth of the targets To assess the influence of volatiles emanating from Po-So1 and Po-So2 on the growth of other Pythium species, the inverted plate technique from El-Katatny et al. (2006) was undertaken with some modifications. Plugs of actively growing P. oligandrum were placed in centre of 90 mm PDA and CMA Petri plates and left at room temperature (22-23 °C) for initial growth for 8 hours. Plugs of target Pythium isolates were subcultured onto separate PDA plates, then within a laminar flow bench the lids were removed and the plates containing the tested Pythium isolates were placed upside down on top of the base of the P. oligandrum plates and sealed with Parafilm. These double- stacked plates were incubated at 25 °C for 24 hours. Radial growth of the target Pythium isolates was measured as linear distance and compared with a control treatment, which was treated in the same fashion but without the presence of Po-So1 and Po-So2 cultures. There were four replicate plates for each of the three phytopathogenic Pythium isolates.

6.2.5. Effect of non-volatiles compounds of P. oligandrum on growth of the targets The influence of non-volatile metabolites produced by Po-So1 and Po-So2 on the subsequent growth of target isolates of Pythium spp. was assessed using the cellophane disc technique adapted from the description of Bradshaw-Smith et al. (1991). P. oligandrum was grown on surface of autoclaved 85 mm dia cellophane discs, which were laid onto PDA plates (one disc/plate) so that the entire surface of the plate was covered. The cellophane discs allowed metabolites produced from P. oligandrum to diffuse through onto PDA surface, but did not allow the mycelia to penetrate through. Two days after incubation at 25 °C, the P. oligandrum colonised cellophane discs were removed and immediately the tested Pythium spp. were placed onto the PDA plates and their daily growth on the PDA amended with the P. oligandrum metabolites was assessed. For the control treatments, plates were treated in the same manner, but with non-colonised cellophane discs. There were four replicate plates for each of the three phytopathogenic isolates.

Chapter 6 │P. olgiandrum and P. myriotylum interactions Metabolites produced by P. oligandrum in liquid culture were also assessed against the growth of the target Pythium spp. The method was modified from Dennis and Webster (1971). P. oligandrum was grown in potato broth at pH = 5.8 for one month at 25 °C in the dark. Potato broth without presence of P. oligandrum was used as control. The filtrate was strained through cheese cloth, and then filtered through Whatman No. 1 paper (0.22 µm pore), warmed in a water bath set at 55 °C and added to 55 °C-molten PDA medium. The filtrate-PDA mixture (50% v/v) was poured into Petri plates. These plates were then inoculated with the phytopathogenic Pythium isolates, and the growth rate was assessed and compared with the control.

Growth inhibition of tested Pythium spp. by metabolites of P. oligandrum was calculated based on the formula below: C−T Growth inhibition (%) = × 100 C C is growth dia. of control plates T is growth dia. of tested plates

6.2.6. In vitro pre-emerging damping off suppression Dual culture assays on Petri plates were done to evaluate the efficacy of Po-So1 and Po-So2 at suppressing pre-emergence damping caused by the selected Pythium isolates. Plugs (0.5 cm2) of P. oligandrum and the tested phytopathogenic isolate cultures were plated opposite each other in Petri plates containing CMA. The plates were incubated at 25 °C in the dark for up to 4 weeks. The preemergence damping off assays were conducted with seeds of three crop species, rye (Secale cereale), white millet (Panicum miliaceum) and wheat (Triticum sp.). Briefly, 10 surface disinfested seeds were placed onto each of the CMA dual culture plate. The plate was incubated at 25° C for 7 days before rating for disease index. There were two replicate plates per tested phytopathogenic isolate, and the assays were conducted twice. Negative control plates contained no culture and positive control plates had a single culture of phytopathogenic isolate. The formula developed by Zhang and Yang (2000) was used to calculate the disease index. 10 DI =∑푖=1 푋푖/40 - DI is disease index scaling from 0 to 1

- Xi is disease rating of the ith seed (from 1 to 10) - Number 40 is equal to the number of seeds multiplying with the highest rating scale (from 0 to 4). - Rating scale used in the experiment was: 0 = seed germinated and seedlings having no visible symptoms; 1 = seed germinated with light browning on roots; 2 = seed germinated

Chapter 6 │P. olgiandrum and P. myriotylum interactions with short and enlarging brown lesion on roots; 3 = seedlings died after germination; 4 = seed not germinated.

6.2.7. Pot trial suppression of P. myriotylum on ginger plants Since Pu-So1 and Pm-Cap1 isolates were non-pathogenic to ginger plants at 25 - 30 °C, they were excluded from the pot trials. Tissue culture derived ginger plants (cv ‘Queensland’) were grown in UC potting mix in 140 mm pots until the plants were about 50 cm high. Inoculum of Pm-Gin1 was prepared using sorghum seeds as a substrate described in chapter 4. Po-So1 and Po-So2 were grown in corn meal broth (CMB). The broth had been freshly prepared from 40 g corn meal (Polenta) in 1 L of distilled water (DW) cooked at 60 °C for 1 h then filtered through a double layer of cheese cloth. The filtrate was made up to 1 L with DW and autoclaved at 121 °C for 20 min priot to inoculation with P. oligandrum. One week after inoculation, the mycelial mats were harvested from the CMB and blended in DW in order to make up a solution of oospores-mycelia homogenate (103 oospores/mL) which was used to drench ginger plants (50 mL/pot) at one week before and again immediately after inoculation with Pm-Gin1 (2 sorghum seeds/pot). Immediately from time of Pm- Gin1 inoculation onwards, the ginger plants were maintained in a water-logged state in a glasshouse in which the temperature remained at 25 - 30 °C. Four replicate pots were used per treatment. Disease severity levels (0 = plants remain green and healthy; 1 = leaf sheath collar discoloured and lower leaves turned yellow; 2 = plants alive, but shoots either totally yellow or dead; and 3 = all shoots dead) based on aboveground symptoms were recorded at 7, 14 and 21 days after inoculation (Stirling et al., 2009). Attempts were made to re-isolate the Pm-Gin1, Po-So1 and Po-So2 either from diseased rhizomes or from UC mix, in the latter case by baiting with carrot pieces (as in chapter 4). The experiment was independently repeated.

All data were subjected to analysis of variance (ANOVA) and the mean separation was determined by Tukey’s least significant difference (LSD) test (P = 0.05) performing with Minitab 16. Where stated, data from repeated assays were pooled and analysed together if there were no significant difference between the two repetitions.

6.3. Results 6.3.1. Mycoparasitism and growth competition of P. oligandrum against the targets No hyphal coiling was observed on the thin film of BCMA on which only P. oligandrum was present. Therefore, the presence of hyphal coils in dual cultures indicated the parasitizing capability of Po-So1 and Po-So2 against the tested phytopathogenic Pythium spp. As shown in Table 1, Pm- Gin1 was consistently moderately susceptible (Type 3) to mycoparasitism by both isolates of Po- 87

Chapter 6 │P. olgiandrum and P. myriotylum interactions So1 and Po-So2. Pm-Cap1 was immune and slightly susceptible (Type 0 and Type 2) to mycoparasitism by Po-So1 and Po-So2, respectively. Similarly, isolates of Po-So1 and Po-So2 showed differing levels of mycoparasitism towards Pu-So1. Pu-So1 was resistant (Type 1) to Po- So1, but slightly susceptible to Po-So2 (Table 6.1).

Both isolates of Po-So1 and Po-So2 were able to grow on media already colonised by the phytopathogenic isolates of Pm-Gin1 and Pu-So1, indicating that metabolites produced by the biocontrol isolates nor the direct presence of the phytopathogenic mycelia did not have adverse effects on growth and oospores production of Po-So1 and Po-So2. This was apparent by the abundance of spiny oospores observed when segments (5 mm2) of culture were removed from the dual cultures and assessed on the BCMA. Moreover, both the Po-So1 and Po-So2 isolates were able to grow across the already colonised media by Pm-Gin1 and Pu-So1. However, for the Pm-Cap1 assay, no oogonia of Po-So1 and Po-So2 were observed indicating that neither of the two isolates P. oligandrum was able to compete fully with this isolate (Table 6.1). Results indicated that both Po- So1 and Po-So2 isolates were strong growth competitors against Pm-Gin1 and Pu-So1, but they were not against Pm-Cap1 in which no spiny oospores were detected.

Table 6.1: Mycoparasitism based on the extent of hyphal coiling (Type 0-4, see text for descriptions) and growth competition (0-7) based on the extent of colonisation in cm measured by the occurrence of oogonial formation of P. oligandrum against P. myriotylum and P. ultimum (n = 4) Mycoparasitic levels Growth competition Po-So1 Po-So2 Po-So1 Po-So2 Pm -Gin1 3 a 3 a 7 a 7 a Pm-Cap1 0 b 2 a 0 b 0 b Pu-So1 1 b 2 a 7 a 7 a None 0 b 0 b 7 a 7 a

Values followed by different letters within a column show a statistically significant difference at the 5% - level as determined by Tukey’s test.

6.3.2. Effects of volatiles and non-volatiles produced by P. oligandrum on growth of the targets Regardless of the media used whether CMA or PDA, the volatiles produced from the Po-So1 and Po-So2 cultures on the inverted Petri plates technique had no negative effects on the growth of the target Pythium isolates (P > 0.05). Growth of Pm-Gin1 was slightly promoted by volatiles collected

Chapter 6 │P. olgiandrum and P. myriotylum interactions from P. oligandrum grown on PDA, but those volatiles collected from P. oligandrum grown on CMA subsequently caused a slight inhibition of growth of Pm-Gin1 (only about 3% inhibition) (Fig 6.1). Both growth of Pm-Cap1 and Pu-So1 slightly decreased when treated with the volatiles.

-20 Growht inhibition (%)

-40 Po-So1 on PDA Po-So2 on PDA

Po-So1 on CMA Po-So2 on CMA -60 Pm-Gin1 Pm-Cap1 Pu-So1

Fig 6.1: Effects of volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and in potato broth on growth of P. myriotylum and P. ultimum as assessed by linear growth on a Petri plate. Negative values indicate growth promotion in media putatively infused with non-volatiles from P. oligandrum. Bars represent standard deviation of four replicates.

The growth of all target Pythium isolates were stimulated when subcultured on PDA Petri plates with non-volatiles produced by Po-So1 and Po-So2 that diffused through cellophane discs, that is the growth was significantly faster than the control no volatiles. Growth of Pm-Gin1 was increased by 40 - 52%, while growth of Pu-So1 and Pm-Cap1 were less promoted, increasing by only around 11% and 25%, respectively (Fig 6.2). Growth of the target Pythium isolates on PDA, which was amended with filtrates collected from liquid cultures of Po-So1 and Po-So2, were however slightly - moderately inhibited (Fig 6.2). Pm-Gin1 grew around 30% slower on filtrate-PDA than that of the control, whereas growth of Pu-So1 and Pm-Cap1 were less impacted.

Chapter 6 │P. olgiandrum and P. myriotylum interactions

-20 Growth inhibition (%) -40 Po-So1 on cellophane Po-So2 on cellophane

Po-So1 in potato broth Po-So2 in potato broth -60 Pm-Gin1 Pm-Cap1 Pu-So1

Fig 6.2: Effects of non-volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and in potato broth on growth of P. myriotylum and P. ultimum. Negative values indicate growth promotion of non-volatiles. Bars represent standard deviation of four replicates.

6.3.3. In vitro suppression All single cultures of the target Pythium isolates were highly aggressive (DI > 0.5) on the seeds of millet, rye and wheat, killing the seeds either before or immediately after germination. Both isolates of Po-So1 and Po-So2 were able to reduce DI significantly (P = 0.05) in dual culture plates with Pm-Gin1. Similarly, interactions between Po-So1/Po-So2 and Pu-So1 in dual cultures also reduced DIs significantly by 55% to 80%, compared with DIs recorded on single cultures of Pu-So1. However, Po-So1 and Po-So2 were not able to suppress Pm-Cap1 in dual cultures and DIs > 0.9 were recorded. DIs recorded on single cultures of Pm-Cap1 and dual cultures of Pm-Cap1 and Po- So1/Po-So2 were not significantly different (Fig 6.3).

Chapter 6 │P. olgiandrum and P. myriotylum interactions

1.2 Millet Rye Wheat

1) -

0.8

0.6

Disease (0 Disease index 0.4

0.2

Fig 6.3: Disease index (0-1) recorded for millet, rye and wheat seeds/seedlings grown on single and dual cultures of Pythium. Bars represent standard deviation of four replicates.

6.3.4. Pot trial suppression Pot trials were undertaken to further investigate the role of P. oligandrum in control of PSR of ginger. Presence of Po-So1 and Po-So2 in co-inoculated pots with Pm-Gin1 did not reduce disease incidence on ginger, compared with pots inoculated with Pm-Gin1 alone. Typical above ground symptoms of PSR disease were observed on the Pm-Gin1 inoculated control and the Po x Pm-Gin1 co-inoculated treatments from 7 DAI. At 21 DAI, nearly all these plants were dead and no difference in disease severity was detected among treatment (Fig 6.4). No obvious PSR symptoms were observed on controls pots and pots inoculated with Po-So1 and Po-So2 alone.

Chapter 6 │P. olgiandrum and P. myriotylum interactions

3.5

7DAI 14DAI 21DAI

3) 2.8

2.1

1.4

0.7 Disease severity (0 Disease severity 0

Fig 6.4: Disease severity recorded on ginger plants inoculated with either P. oligandrum or P. myriotylum or both at 7, 14 and 21DAI 25/30 °C with 10 h of photoperiods (bars represent standard errors, n = 8). Data presented is for the combination of two pot trials as no significant difference in disease severity was recorded on the two trials tested (P = 0.05). Disease severity rates from: 0 = healthy plants; 1 = discoloured sheath collar and yellow lower leaves; 2 = plants alive, but shoots either totally yellow or dead; and 3 = all shoots dead.

Pm-Gin1 was easily recovered from Pm or a combination of both Po and Pm species infested potting mix at the end of the experiment using carrot as bait. Recovery of Po-So1 and Po-So2 from infested pots occurred less frequently (Table 6.2).

Table 6.2: Percentage of carrot baits colonised by P. oligandrum, P. myriotylum or both following exposure to soil used in the pot trials as shown in Fig 4 (n = 8, combining data from two replicate pot trials) Percentage recovery in carrot baits Pot trial treatment P. oligandrum P. myriotylum Po-So1 42.5 ± 7.0 0.0 ± 0.0 Po-So2 38.8 ± 9.0 0.0 ± 0.0 Po-So1 + Pm-Gin1 23.8 ± 2.0 97.5 ± 4.0 Po-So1 + Pm-Gin1 21.3 ± 5.0 98.8 ± 2.0 Po-So1 + Po-So2 + Pm-Gin1 27.5 ± 7.0 98.8 ± 2.0 Pm-Gin1 0.0 ± 0.0 100.0 ± 0.0

Chapter 6 │P. olgiandrum and P. myriotylum interactions 6.4. Discussion This study demonstrated that representative isolates of P. myriotylum from capsicum and ginger responded differently to the mycoparasite P. oligandrum. The isolate Pm-Gin1 was moderately susceptible (Type 3) to mycoparasitism by P. oligandrum, while Pm-Cap1 was immune or slight susceptible, Type 0 and Type 2 reactions, to the two isolates of P. oligandrum that were used. Our results were consistent with other findings where isolates within the same Pythium sp. might exhibit various degrees of susceptibility or antagonism from P. oligandrum (Floch et al., 2009; Foley and Deacon, 1986; Takenaka and Ishikawa, 2013). According to Gerbore et al. (2014b) soil-borne host pathogens were most vulnerable to mycoparasitism by P. oligandum when the latter was originally recovered from the same rhizospheres as of the pathogens. Indeed, Pm-Gin1 was more susceptible to endemic P. oligandrum, which had been isolated from soil sampled from around PSR ginger infected with P. myriotylum, than Pm-Cap1 obtained from a capsicum showing sudden wilt. Interestingly, Pm-Gin1 showed the consistent degree of susceptibility (Type 3) to the two P. oligandrum isolates tested; it was even more susceptible than Pu-So1. P. ultimum is a well-known host of P. oligandrum within the Pythium genus; there have been many successful examples of using P. oligandrum to suppress P. ultimum infection of cress, cucumber, sugar beet and wheat (Abdelzaher et al., 1997; Ali-Shtayeh and Saleh, 1999; Holmes et al., 1998; McQuilken et al., 1990; Ribeiro and Butler, 1995). Therefore, by screening a bigger population of P. oligandrum recovered from ginger soils where P. myriotylum is known to be present may lead to recovery of more antagonistic strains of P. oligandrum.

P. oligandrum was capable of competing with phytopathogic species for space and nutrients, subsequently reducing either disease incidence or disease severity on crops (Cwalina-Ambroziak and Nowak, 2012; Martin and Hancock, 1987; Takenaka and Ishikawa, 2013). In this study, P. oligandrum overgrew CMA plates colonised by Pm-Gin1 and Pu-So1, but the mycoparisite was not able to grow on plates colonised by Pm-Cap1. This implied that the P. oligandrum isolates tested here were strong growth competitors against Pm-Gin1 and Pu-So1 but not Pm-Cap1. However, the capacity of the mycoparasitic Pythium sp. to grow across the pre-colonised culture plate could be a general indicator of its ability to either derive nutrients from the media and/or to tolerate negative effects of metabolic by-products produced from the pathogenic Pythium spp. Moreover, growth medium was also important since CMA was found to be a more suitable medium for P. oligandrum than PDA (Ali-Shtayeh and Saleh, 1999; Foley and Deacon, 1986). Therefore, failing to recover P. oligandrum from CMA pre-colonised by Pm-Cap1 indicated that Pm-Cap1 was resistant to P. oligandrum in addition to mycoparasitism evidence.

Chapter 6 │P. olgiandrum and P. myriotylum interactions Attempts in collecting metabolites with an antibiotic funtion (Bradshaw-Smith et al., 1991; Gerbore et al., 2014a; Whipps, 1987) in forms of volatiles and non-volatiles produced by P. oligandrum were undertaken to assess growth suppressiveness of the mycoparasitic Pythium towards their targets. Results in this study showed that regardless of the media used (whether PDA or CMA), the volatile metabolites produced by P. oligandrum had little effect on the growth of tested Pythium spp. By deploying the same inverted plate technique, Whipps (1987) observed that P. oligandrum grown on PDA and tap water agar (TWA) media produced volatile compounds that inhibited growth of Rhizoctonia solani, Sclerotinia sclerotiorum and Botrytis cinerea. Likewise, results from the same technique conducted by Bradshaw-Smith (1991) indicated that growth inhibition of Phoma medicaginis and Mycosphaerella pinodes was recorded when challenged with volatiles produced from P. oligandrum.

The non-volatiles did have effect on growth of the pathogens. Cellophane discs on which P. oligandrum was grown significantly stimulated growth of the tested Pythium spp presumably because of non-volatiles present in the discs. We found up to 50% growth stimulation of Pm-Gin1 when grown on the non-volatiles diffused through cellophane discs. Although Whipps (1987) also observed growth promotion, increasing by 7-10% when F. oxysporum and S. sclerotiorum were exposed to non-volatiles produced by P. oligandrum collected through cellophane discs supported by TWA, our finding should be noticed. Additionally, Bradshaw-Smith et al. (1991) found that non- volatiles diffused through cellophanes discs were non-toxic to fungi tested, including F. solani, P. medicaginis and M. pinodes. Foley and Deacon (1986) also concluded that there was no evidence that P. oligandrum produced non-volatile toxins against F. culmorum, R. solani or P. ultimum, and that consequently no adverse effect on the growth of these phytopathogens was observed.

This differed, however, when the non-volatiles were collected as filtrates from potato broth cultures of P. oligandrum since a range of growth inhibition of the tested Pythium spp. was observed. Therefore, it should be noted that antibiosis by P. oligandrum varies depending on strains themselves and their targets as well as other antibiotic factors, including media and temperature used (Whipps, 1987). Besides, stresses might impact on antibiotic production of P. oligandrum (Gerbore et al., 2014a). Hence, under certain conditions it would still be warranted to assess antibiosis of P. oligandrum against new target hosts.

In general, virulence based on degrees of mycoparasitism and growth competition of P. oligandrum against tested Pythium spp. was equivalent to disease control on millet, rye and wheat in the in vitro culture assays. Therefore, presumably millet, rye and wheat were protected from Pm-Gin1 and Pu- 94

Chapter 6 │P. olgiandrum and P. myriotylum interactions So1 infection due to the mycoparasitism and growth competition by P. oligandrum than by any toxics properties produced by P. oligandrum. These observations are consistent with those of McQuilken et al. (1990) who suggested that P. oligandrum plays a role as both a mycoparasite and a competitor against pathogens rather than as an antibiotic producer. Many other workers also found evidence to support roles of mycoparasitism and growth competition by P. oligandrum. Al-Rawahi and Hancock (1998) suggested that mycoparasitism of P. oligandrum resulted in a population reduction of Verticillim dahliae, a wilt pathogen of capsicum, and reduced disease severity was decreased. The root surface of sugar beet seedlings was colonized by P. oligandrum within 24 h post inoculation, and protected the crop from subsequent infection by P. ultimum (Martin and Hancock, 1987). Ali-Shtayeh and Saleh (1999) suggested P. oligandrum suppressed P. ultimum on cucumber by competition for nutrients and space. Similarly, Takenaka and Ishikawa (2013) reported sugar beet roots were protected from A. cochlioides infection by early establishment of P. oligandrum on the root surface of the crop, and reduced disease severity as a result of growth competition on the crop. In our study, Pm-Cap1 was immune to P. oligandrum tested, and consequently it was probably not surprising that P. oligandrum did not protect millet, rye and wheat seeds from infection by Pm-Cap1 in dual cultures assays in Petri plates.

In the pot trial however, P. oligandrum did not provide protection for ginger plants against P. myriotylum Gin1. These observations contrasted with the in vitro assay and we suggest that poor colonisation in potting mix by P. oligandrum might have been the cause of this conflictingly observation and perhaps the soil drench application may have been inadequate in allowing sufficient colonisation. Soil drenching with an oospore suspension has shown to be effective in either direct or indirect control of A. cochlioides, V. dahlia, B. cinerea, Phaeomoniella chlamydospora and Ralstonia solanacearum (Al-Rawahi and Hancock, 1998; Floch et al., 2009; Takenaka and Ishikawa, 2013; Takenaka et al., 2008; Yacoub et al., 2016), this could be soil medium dependent. According to Holmes et al. (1998) drenching of mycelial suspension of P. oligandrum directly to potting mix achieved higher control efficacy of damping off induced by P. ultimum, compared with oospore drench since active growth of mycelial fragments colonised the potting mix and rhizosphere quickly prior to the colonization of the pathogen, leading to effective control of the hosts (Holmes et al., 1998; Martin and Hancock, 1987). Regardless of application methods, activity and interaction of P. oligandrum against target species appeared dependent on environmental factors such as temperature, matric potential, pH (Al-Rawahi and Hancock, 1998; Holmes et al., 1998) and native microbial communities (Vallance et al., 2012; 2009). To some extent, soil and root colonisations by P. oligandrum are also influenced by soil management and plant physiology (Gerbore et al., 2014b; Yacoub et al., 2016). Therefore, it would be interesting for 95

Chapter 6 │P. olgiandrum and P. myriotylum interactions future studies on biotic and abiotic factors to expand on the understanding about colonisations and establishment of P. oligandrum on ginger and adjacent rhizophere.

To sum up, this study provided preliminary knowledge regarding the use of P. oligandrum as a biocontrol agent against PSR pathogens of ginger. P. oligandrum parasitised and outcompeted Pm- Gin1 and Pu-So1. There was no evidence that P. oligandrum produces metabolic toxins against Pm- Gin1 and Pu-So1. P. oligandrum reduced disease of millet, rye and wheat in vitro; however, P. oligandrum failed to protect ginger from Pm-Gin1 in pot trials. P. oligandrum has been shown to promote plant growth and activate plant defences; however, this was not evaluated in our work (Benhamou et al., 2012; Gerbore et al., 2014a). These multi-faceted interactions of P. oligandrum make the parasitic potential unpredictable due to factors impacting control efficacy of this potential BCA. Therefore, it is worth assessing interactions between P. oligandrum and new target pathogens and their host crops as well as factors affecting P. oligandrum. A limitation of this work is that only two strains of P. oligandrum were evaluated and it is possible that there are other strains of P. oligandrum that could provide more control of PSR. Hence, selection and screening a larger population of P. oligandrum recovered from soils from around PSR ginger for better strains will be of future interest.

Chapter 7 │Record of Pythiogeton ramosum in Australia

Chapter 7 : PYTHIOGETON RAMOSUM ASSOCIATED WITH SOFT ROT DISEASE OF GINGER (ZINGIBER OFFICINALE) IN AUSTRALIA5

Abstract In addition to Pythium spp., 15 isolates of a Pythium-like organism were recovered from ginger with soft rot symptoms. These Pythium-like isolates were identified as Pythiogeton (Py.) ramosum based on its morphology and the ITS sequences. There is relatively little known about this organism therefore pathogenicity assays and phylogenetic studies were done to examine the role, if any, of this oomycete in PSR of ginger. Our pathogenicity tests in Petri plates conducted on excised ginger, carrot (Daucus carota), sweet potato (Ipomoea batatas), potato (Solanum tubersum) and radish (Raphanus sativus) roots/tubers showed that Py. ramosum was not pathogenic to excised ginger and radish sticks at 27 °C, but it was pathogenic to carrot, sweet potato and potato sticks. However, the excised ginger was colonised by Py. ramosum resulting in soft rot and discolouration at temperature above 30 °C. The pot trials on ginger plants showed that Py. ramosum was also only pathogenic to ginger at high temperature (30-35° C). Ginger plants inoculated with Py. ramosum exhibited initial symptoms of wilting and leave yellowing, which were indistinguishable from those of Pythium soft rot of ginger, at 10 days after inoculation. In addition, morphological and phylogenetic studies indicated that isolates of Py. ramosum were quite variable and our isolates obtained from soft rot ginger were divided into two groups based on these variations. This is also for the first time Py. ramosum is reported as a pathogen on ginger at high temperatures.

Keywords: Pythiaceae, zoospores, narrow hyphae, isolation, cultivation, host range

7.1. Introduction The genus Pythiogeton (Py.) was first described by Minden (1916) with three species descriptions based on non-pure cultures. Pythiogeton, together with Pythium and Phytophthora, belong in the family Pythiaceae although this little studied genus was thought to be a candidate for a new family

5 This chapter was published as:

Le, D.P., Smith, M., Aitken, E., 2014. First report of Pythiogeton ramosum (Pythiales) in Australia. Australas. Plant Dis. Notes 9, 1-3. DOI 10.1007/s13314-014-0130-5

Chapter 7 │Record of Pythiogeton ramosum in Australia named Pythiogetonaceae (Dick, 2001; Voglmayr et al., 1999). With recent sequence analyses of CoxI (cytochrome c oxidase subunit 1) and ITS (internal transcribed spacer) regions of Pythiogeton spp., the genus was revealed to be closely related to Pythium and has consequently remained within the Pythiaceae (De Cock et al., 2010; Huang et al., 2013; Robideau et al., 2011). The genus was distinguished from Pythium by the presence of narrow hyphae, production of zoospores outside asymmetrical sporangia and strictly plerotic oospores with extreme thick oospore walls when present (Huang et al., 2013; Voglmayr et al., 1999). The genus was believed to be recalcitrant for research because of its unculturable and unstorable features (Jee et al., 2000). However, Ann et al. (2006) and Huang et al. (2013) recently reasoned that as long as suitable media and working approaches were implemented, pure cultures can be obtained. In fact, Py. ramosum-like isolates recovered from cypress and English ivy were able to grow normally on oomycete selective medium (PARPH), V8 juice (V8), corn meal agar (CMA), potato dextrose agar (PDA) and carrot agar (CA) media (Silva-Rojas et al., 2004). Huang et al. (2013) also found that the genus is in fact very common, but it is usually not recovered during isolation. Hence, once typical narrow glassy and refractive hyphae are recognized, Pythiogeton could be isolated before Pythium or other species overgrow the cultures.

Approximately 100 years after being described as a new genus, only 15 different species have been ascribed to Pythiogeton including six new species from Taiwan (Huang et al., 2013). Most Pythiogeton spp. have been isolated from decayed materials, so they have been consequently recorded as saprophytes. The exceptions are Py. zeae and Py. zizaniae which are pathogenic to corn and water bamboo, respectively (Ann et al., 2006; Jee et al., 2000). Pythiogeton ramosum (syn. Py. autossytum) (Huang et al., 2013) appears to be the most commonly reported species around the world (Drechsler, 1932; Hamid, 1942; Hsieh and Chang, 1976; Minden, 1916; Nascimento et al., 2012; Sparrow, 1932; Watanabe, 1974; Zebrowska, 1976). Recently, Py. ramosum was isolated from diseased cypress and English ivy (Silva-Rojas et al., 2004), and Py. ramosum-like isolates from California induced symptoms of root and basal stalk rots on wild rice (Doan et al., 2013).

Ginger is the most common spice in the Zingiberaceae and it is cultivated worldwide throughout tropical and subtropical regions (Kavitha and Thomas, 2008). In Australia, ginger has been grown in Sunshine Coast, Queensland since 1916 principally for the fresh and confectionery market (Camacho and Brescia, 2009; Hogarth, 2000). In 2009, Pythium soft rot (PSR) of ginger rhizomes caused by Pythium myriotylum was reported for the first time in Australia. The disease was highly destructive and resulted in up to 100% loss in some fields (Stirling et al., 2009). Quarantine strategies have been implemented to prevent further spread of the pathogen, and a number of 98

Chapter 7 │Record of Pythiogeton ramosum in Australia control methods have also been applied to suppress disease development. Despite these measures, P. myriotylum still remains a serious threat to ginger production in southeast Queensland (Smith et al., 2011; Stirling et al., 2012). Because there are many Pythium spp. associated with PSR of ginger reported around the world (Dohroo, 2005), we have proposed that there is probably more than one Pythium sp. causing PSR of ginger in Australia. To test this theory, in 2012, ginger with PSR symptoms caused by Pythium spp. was sampled from selected farms at Yandina, on the Sunshine Coast, Queensland, Australia. A number of Pythium spp., including Pythium aphanidermatum, Pythium deliense, Pythium graminicola and more were recovered either directly from PSR ginger rhizomes or soils collected around PSR ginger (unpublished data). Most of the recovered Pythium spp. were recorded for their pathogenicity on ginger elsewhere (Dohroo, 2005). Along with these Pythium isolates, isolates of Py. ramosum were also recovered from PSR ginger. In this study, we assessed the diversity of Py. ramosum based on their morphology, sequences of ITS, CoxI and CoxII regions and pathogenicity in both in vitro and in vivo conditions.

7.2. Materials and methods 7.2.1 Py. ramosum isolation Py. ramosum was isolated from PSR ginger collected from two farms at Yandina: farm 1 at 26°32’S, 152°56’E and farm 2 at 26°33’S, 152°56’E. Isolation was as described in chapter 3. Four selected isolates from the collection, including UQ6020, UQ6053, UQ6211 and UQ6214 (Table 7.1) were used in this study for morphological study, growth rate and pathogenicity assays. Working cultures of these isolates were maintained on PDA (Difco). To store the isolates, cultures on PDA were subcultured onto half strength CMA. Cultures of the isolates were incubated in the dark at 25 °C for a week, then plugs (0.5 cm2) were placed in a sterile vial containing 5 mL sterilised distilled water (DW). Vials were sealed with Parafilm and kept in the dark at room temperature for future use.

Table 7.1: List of Pythiogeton spp. used in this study, isolates with BRIP numbers were used for morphological comparisons, growth rate and pathogenicity. Isolates BRIP no.* Genbank accession number References ITS CoxI CoxII Py. ramosum UQ6020 BRIP59948 KF151204 KM819500 KM819510 This study6 Py. ramosum UQ6053 BRIP59949 KF151205 KM819501 KM819511 This study6 Py. ramosum UQ6207 KF151206 KM819502 KM819512 This study7

6 Isolates recovered from diseased ginger sampled from Yandina farm 1 (26°32’S, 152°56’E) 99

Chapter 7 │Record of Pythiogeton ramosum in Australia

Py.ramosum UQ6208 KF151207 KM819503 KM819513 This study7 Py. ramosum UQ6209 KF151208 KM819504 KM819514 This study7 Py. ramosum UQ6210 KF151209 KM819505 KM819515 This study7 Py. ramosum UQ6211 BRIP59950 KF151210 KM819506 KM819516 This study7 Py. ramosum UQ6212 KF151211 KM819507 KM819517 This study7 Py. ramosum UQ6213 KF151212 KM819508 KM819518 This study7 Py. ramosum UQ6214 BRIP59951 KF151213 KM819509 KM819519 This study7 Py. ramosum BCRC-CH30007 JQ610179 - - Huang et al. (2013) Py. ramosum BCRC-CH30008 JQ610180 - - Huang et al. (2013) Py. ramosum BCRC-CH30019 JQ610185 - - Huang et al. (2013) Py. ramosum BCRC-CH30023 JQ610188 - - Huang et al. (2013) Py. ramosum BCRC-CH30027 JQ610190 - - Huang et al. (2013) Py. ramosum BCRC-CH30031 JQ610193 - - Huang et al. (2013) Py. ramosum BCRC-CH30034 JQ610195 - - Huang et al. (2013) Py. abundance BCRC-CH30016 JQ610184 - - Huang et al. (2013) Py. abundance BCRC-CH30026 JQ610189 - - Huang et al. (2013) Py. microzoosporumBCRC-CH30013 JQ610183 - - Huang et al. (2013) Py. oblongilobum BCRC-CH30013 JQ610182 - - Huang et al. (2013) Py. oblongilobum BCRC-CH30022 JQ610187 - - Huang et al. (2013) Py. paucisporum BCRC-CH30035 JQ610196 - - Huang et al. (2013) Py. paucisporum BCRC-CH30039 JQ610198 - - Huang et al. (2013) Py. proliferatum BCRC-CH30037 JQ610197 - - Huang et al. (2013) Py. proliferatum BCRC-CH30040 JQ610199 - - Huang et al. (2013) Py. puliensis BCRC-CH30010 JQ610181 - - Huang et al. (2013) Py. puliensis BCRC-CH30020 JQ610186 - - Huang et al. (2013) Py. puliensis BCRC-CH30033 JQ610194 - - Huang et al. (2013) Py. zeae Lev3132 HQ643405 HQ708452 - Robideau et al. (2011) Py. zizaniae BCRC-CH30003 JQ610176 - - Huang et al. (2013) Py. zizaniae BCRC-CH30002 JQ610177 - - Huang et al. (2013) Py. zizaniae BCRC-CH30006 JQ610178 - - Huang et al. (2013)

7 Isolates recovered from diseased ginger sampled from Yandina farm 2 (26°33’S, 152°56’E) 100

Chapter 7 │Record of Pythiogeton ramosum in Australia

Cultures were also checked for their viability after five months, one- and two-year storage by placing three of the plugs back onto CMA and observing for Pythiogeton recovery.

7.2.2 Growth and morphology The effect of temperature on daily radial growth rate of four isolates: UQ6020, UQ6053, UQ6211, and UQ6214 was assessed on 9 cm Petri plates at 5 °C intervals from 10 to 40 °C (as described in chapter 3). The assay was repeated three times and there was one plate per repetition.

A grass leaf technique was undertaken to observe morphological characteristics of Py. ramosum where plugs of the culture growing on PDA were transferred into Petri plates containing 25 mL of sterile distilled water and two pieces of sterile grass leaves each. The plates were kept at 27 °C for at least one week and then the plates were analysed directly under an inverted microscope for the presence of sporangia and appressoria. The method of Huang et al. (2013) was modified slightly to observe zoospore differentiation and zoospores. Plugs of culture growing on PDA were submerged into plates containing 20 mL corn meal broth (as the preparation of CMA but without agar amendment), the plates were then incubated at 27 °C for 2 days. After 2 days growth, the corn meal broth was pipetted out and the mycelia mats were rinsed three times with sterile DW at 20 min intervals. The mats were then soaked in 0.01 M calcium carbonate solution (Nyochembeng et al., 2002), the plates were kept at 27 °C for another 1-2 days. The plates were examined either directly using an inverted microscope (Leica) or using a compound Olympus BH-2 after staining slides with cotton blue.

7.2.3. DNA extraction and amplification DNA extraction was carried out as in chapter 3. The two universal primers ITS 1 (5’- TCCGTAGGTGAACCTGCGG-3’) and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’) (White et al., 1990) were used to amplify DNA from ITS regions including the 5.8S rRNA region using a thermal cycler machine (Mastercycler). In some cases, ITS5 (5’- GGAAGTAAAAGTCGTAACAAGG-3’) (White et al., 1990) was substituted for the ITS1 in PCR. The reaction was initially denatured for 5 min at 94 °C, followed by 35 cycles which commenced with continuous denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extending for 90 s at 72 °C. The reaction was eventually extended for 10 min at 68 °C. When the primer ITS5 was used, the reaction was firstly denatured for 5 min at 96 °C, followed by 35 cycles beginning with 95 °C for 30 s, another 30 s at 52 °C and 90 s at 72 °C. The final extension was at 72 °C for 10 min (Huang et al., 2013). After finishing the PCR, the desired DNA was then run under 110V in 1.5% agarose gel for 45 min to check for a PCR product. 101

Chapter 7 │Record of Pythiogeton ramosum in Australia

Two other coding regions, including CoxI and CoxII were also amplified. Two primers OomCoxILevup (5’-TCAWCWMGATGGCTTTTTTCAAC-3’) and Fm85mod (5’- RRHWACKTGACTDATRATACCAAA-3’), and other two FM66 (5’ TAGGATTTCAAGATCCTGC 3’) and FM58 (5’ CCACAAATTTCACTACATTGA 3’) were used for CoxI and CoxII amplification, respectively (Martin, 2000; Robideau et al., 2011).

7.2.4. Sequencing and analysing sequences PCR products were sent to Macrogen (Korea) for sequencing services. Both forward and reverse directions were sequenced and the consensus sequences were made up after manual alignment and comparison using Clustal 2.0.2. MEGA 5 was used to align the sequences themselves and with other Pythiogeton spp. from Genbank to analyse whether there were any genetic variations.

7.2.6. Pathogenicity tests In vitro pathogenicity on excised ginger The above isolates of Py. ramosum and a well-known pathogen, Pythium deliense UQ6021 which was selected as a positive control, were used in the pathogenicity tests. The assay was conducted to assess for aggressiveness of the tested isolates on ginger sticks at 25, 30 and 35 °C (as in chapter 3). The assay was also conducted on radish (Raphanus sativus), carrot (Daucus carota), potato (Solanum tubersum) and sweet potato (Ipomoea batatas) tubers at 27 °C. The assay was repeated twice and there were two excised sticks per replicate.

In vitro pre-emerging damping off test Actively growing cultures of tested Py. ramosum isolates including the positive control P. deliense UQ6021 were subcultured onto 1.5% WA to screen for their capability of causing pre-emerging damp off on rye (Secale cereale), white millet (Panicum miliaceum), buck wheat (Fagopyrum esculentum), wheat (Triticum sp.), barley (Hordeum vulgare), carrot, cucumber (Cucumis sativus), eggplant (Solanum melongena), lettuce (Lactuca sativa) and spring onion (Allium cepa). The assay was carried out at 27 °C as described previously in chapter 3. The disease index was calculated based on descriptions of Zhang and Yang (2000). 10 DI =∑푖=1 푋푖/40 - DI is disease index scaling from 0 to 1

- Xi is disease rating of the ith seed (from 1 to 10)

102

Chapter 7 │Record of Pythiogeton ramosum in Australia

- Number 40 is equal to the number of seeds multiplying with the highest rating scale (from 0 to 4). - Rating scale used in the experiment was: 0 = seed germinated and seedlings having no visible symptoms; 1 = seed germinated with light browning on roots; 2 = seed germinated with short and enlarging brown lesion on roots; 3 = seedlings died after germination; 4 = seed not germinated.

Glasshouse pathogenicity test on ginger plants Tissue culture ginger plants (Queensland cultivar) growing on steamed University of California (UC) potting mix in 140 mL pots and approximately 50 cm high (approximately 4 months after deflasking), the pots were inoculated by inserting four hyphae-colonised autoclaved sorghum seeds under the soil to a depth of 25-30 mm. The sorghum seeds were prepared as previous descriptions in chapter 3. The inoculated pots were kept saturated with water from time of inoculation onwards by placing the pots on saucers which were kept full with tap water. The pathogenicity test was run at 25/30 °C and 30/35 °C (night/day) in a temperature controlled cabinet. The cabinet was set for a 10 h photoperiod. The pathogenicity test at 30/35 °C was repeated twice. There were three replicate pots per isolate. Disease severity levels based on aboveground symptoms were recorded at 7, 14 and 21 days after inoculation applying the following scales: 0 = healthy plants; 1 = leaf sheath collar starting discoloration and some leaves starting to turn yellow; 2 = plant alive, but shoots either totally yellow or dead; and 3 = all shoots dead (Stirling et al., 2009). Attempts were made to re- isolate the Py. ramosum and P. deliense UQ6021 either from diseased rhizomes or from UC mix, in the latter case by baiting with carrot pieces (as in chapter 3).

All data from pathogenicity tests and the growth rate experiment were subjected to analysis of variance (ANOVA) and the means were compared using Tukey’s least significant difference (LSD) test (P = 0.05) when treatment effects were detected. The ANOVA and comparisons of means were performed with Minitab 16.

7.3. Results 7.3.1. Growth rate and morphological characteristics Py. ramosum was identified based on its typical morphology: narrow coenocytic hyaline hyphae with numerous short branches at right angles with main hyphae, sickle-shape appressoria, and globose, ellipsoid and long bursiform sporangia (Fig 7.1). However, differences in sporangial morphology were observed in the isolates recovered from each farm. Group I isolates from one farm formed different sporangia in sizes and shapes, while group II isolates from the other farm 103

Chapter 7 │Record of Pythiogeton ramosum in Australia formed only globose sporangia on one-week-old cultures (Fig 7.2). However by the third week the cultures from both groups became more difficult to distinguish from one another due to the admixture of bursiform and globose sporangia, even though sporangial sizes of group II isolates were larger than those of group I isolates (Table 7.2).

Fig 7.1: Typical sickle-shape appressoria and short branch hyphae at right angles with main hyphae (A), a typical terminal long bursiform sporangium observed on a mature culture (B) (bar = 20 µm)

A B

Fig 7.2: Sporangia of Py. ramosum on one-week-old cultures: an admixture of globose, eclipsoid and bursiform sporangia observed on cultures of Group I isolates (A); only globose sporangia observed on cultures of Group II isolates (B) (bar = 20 µm)

Py. ramosum did not grow at 10 or 40 °C; optimum growing temperatures were between 30 and 35 °C. At 10 °C, Py. ramosum stopped growth, but it could regrow if incubated again at 25 °C, whereas there was no regrowth at 40 °C. The mean growth rate at 25 °C was 21.0 and 21.3 mm/24 h on PDA and CMA respectively (Fig 7.3). All isolates grew well on the different media, including PDA, CMA, CMA + 3P, half strength CMA, WA, and potato and corn meal broths. The isolates were still viable in the storage conditions described above after two years although it took up to a week for some isolates to recover on CMA at 27 °C.

104

Chapter 7 │Record of Pythiogeton ramosum in Australia

Table 7.2: Morphological comparison between two groups of Py. ramosum isolated from ginger in this study Morphological features Py. ramosum group I (UQ6020 Py. ramosum group II (UQ6211 and and UQ6053) UQ6214) Hyphae width (µm) 2-5 (-7.5) 2-5 (-7.5) Appressoria (µm) Sickle shape (8-12 (-16) x 22-26 Sickle shape (7.5-12.5 (-15) x 24-26 (- (-32)) 34)) Sporangia (µm) Mostly terminal, globose (17-36 Mostly terminal, globose (20-46 (- (-50)), ellipsoid (29-41 (-50) x 72)), ovoid (35-44 (-63) x 40-58 (- 31-77 (-125)), ovoid (32-43 (- 79)), elongate (32-45(-68) x 70-130 (- 51) x 45-60 (-70)), obovoid- 238)), peanut-shape (42-49 (-55) x elongate (39-50 (-62) x 72-129 130-157 (-192)), utriform (52-60 (-73) (-222)), peanut-shape (37-45 (- x 115-127 (-148), reinform (35-60 x 52) x 92-116 (-160)) 135-145), obpyriform (30-62 (-75) x 100-107) Zoospore size (µm) 12-16 (-18) 12-16 (-18) Growth rate at 25 °C 20.43 and 20.98 21.73 and 21.62 on PDA and CMA (mm)

105

Chapter 7 │Record of Pythiogeton ramosum in Australia

35 UQ6020 UQ6053 30 UQ6211 UQ6214

5 Radicalgrowth rate (mm/24h) 0 10 15 20 25 30 35 40 Temperature (°C)

Fig 7.3: Growth rate comparison between four isolates of Py. ramosum on PDA at different temperatures (P<0.01). A bar is representing for a standard deviation of three means.

7.3.2. DNA sequences Complete sequences of the ITS region including the 5.8S rDNA showed absolute similarity of all isolates to each other, except UQ6020 and UQ6053, which showed a single base pair substitution from adenine to guanine at position 844 in 861 bp long sequences. When all available sequences (isolates from Australia and Taiwan) were compared together, there were 11 single substitution points along ITS sequence. Australian isolates showed 99-100% similarity to those of Py. ramosum deposited recently in Taiwan (Huang et al., 2013). The sequencing results supported the species identification based on morphological characteristics. Based on maximum likelihood tree of the ITS region, all ten isolates were grouped in one cluster along with other Py. ramosum obtained from Genbank with high bootstrap value support (100%). Phylogenetic analyses indicated that Py. ramosum was from the same ancestor with subtle genetic variations and had a separate position with other Pythiogeton spp. (Fig 7.4). Sequences of CoxI and CoxII were also amplified and deposited in Genbank. However, with limited reference sequences for CoxI and CoxII available in Genbank it was not possible to identify any close alignments. Sequence alignment of the CoxI region of Australian isolates of Py. ramosum showed four single substitution points along 700 bp long sequences on the basis of which Australian isolates were split into two groups (Fig 7.5). On the other hand, sequences of the CoxII region were homologous (data not shown).

106

Chapter 7 │Record of Pythiogeton ramosum in Australia

Fig 7.4: A maximum likelihood tree showing phylogenetic relationships among Pythiogeton species using DNA sequences encoded from the ITS gene. The numbers at the nodes are the percentage of trees from bootstrap analysis (2000 replications). Access to trees can be found at http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access- code=d72e813919072ae4f8d28bd1665f0b31&format=html

107

Chapter 7 │Record of Pythiogeton ramosum in Australia

Fig 7.5: A maximum likelihood tree showing phylogenetic relationships among Pythiogeton species using DNA sequences encoded from the CoxI gene. The numbers at the nodes are the percentage of trees from bootstrap analysis (2000 replications). Access to trees can be found at http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access- code=d72e813919072ae4f8d28bd1665f0b31&format=html

7.3.3. Pathogenicity tests All tested Py. ramosum isolates were non-pathogenic on excised ginger pieces at 25 °C, but at higher temperature Py. ramosum colonised and caused excised ginger sticks to discolour and rot. All isolates of Py. ramosum were most aggressive at 35 °C and the aggressiveness did not vary between tested isolates (Fig 7.6). All isolates were also pathogenic on carrot, sweet potato and potato tubers 27 °C. The tested tubers were decayed, soft and brown in colour and Py. ramosum was reisolated after placing decayed tissue onto CMA + 3P. P. deliense UQ6021 was more aggressive at 25 and 30 °C, but it was less aggressive at 35 °C than the Py. ramosum isolates tested (P = 0.05). On ginger plants, no visual above ground symptoms were observed from Py. ramosum infested pots at 25/30 °C, but symptoms were recorded at 30/35 °C (Fig 7.7). There were no obvious symptoms observed in pots inoculated with P. deliense UQ6021 in all assays. Symptoms induced by Py. ramosum were indistinguishable from PSR symptoms caused by Pythium spp. Yellowing appeared first on lower leaves, then moved upward and resulted in the whole plant becoming yellow, wilting and eventually resulted in the plant’s death. Control plants remained green and healthy during the experiments. Disease severity levels recorded for group I isolates were higher than those for group II, but they were not significantly different at P = 0.05. The results were similar in the second pathogenicity test at 30/35 °C. Py. ramosum was reisolated directly from the 108

Chapter 7 │Record of Pythiogeton ramosum in Australia infected ginger rhizomes. Py. ramosum was also isolated from the infested potting mix by baiting with excised carrot roots after four days of incubation.

P. deliense UQ6021 Py. ramosum UQ6020 Py. ramosum UQ6053

Py. ramosum UQ6211 Py. ramosum UQ6214 (cm) 5

Pythiogeton and

3 Pythium 2

1 Meanspead of 0 25 30 35 Temperature (°C)

Fig 7.6: Mean colonization of Py. ramosum and P. deliense UQ6021 based on recovery of 1 cm segments from 5.5 cm long ginger pieces onto culture plates at 3 days after inoculation at 25, 30 and 35 °C in dark (bars represent standard errors, n = 4).

3.5 P. deliense UQ6021 Py. ramosum UQ6020 Py. ramosum UQ6053 3 Py. ramosum UQ6211 Py. ramosum UQ6214

2.5

1.5

Disease severitylevels 1

0.5

0 7DAI 14DAI 21DAI Fig 7.7: Disease severity levels (0-3) recorded on ginger infected with Py. ramosum and P. deliense UQ6021 at 30/35 °C (night/day) (bars represent standard errors, n = 6).

109

Chapter 7 │Record of Pythiogeton ramosum in Australia

Py. ramosum isolates caused very low levels of disease on seeds and seedlings of all rotation crops tested with no significant difference from the control treatment (Table 7.3). However, Py. ramosum was pathogenic on bean, cauliflower, capsicum and lettuce, but it did not attack seeds and seedlings of carrot and cucumber (Table 7.3; Fig 7.8). The positive control, P. deliense UQ6021 was very aggressive on all tested host species (disease index > 0.5).

Py. ramosum BRIP59948 Control

Fig 7.8: Cauliflower seedlings were attacked by Py. ramosum turning brown and rotten (left) in comparison to white and healthy seedlings in the control (right).

110

Chapter 7 │Record of Pythiogeton ramosum in Australia Table 7.3: Comparisons of disease indices (0-1) for eight vegetable and five common rotation crops in ginger fields inoculated with P. deliense

UQ6021 and Py. ramosum

sicum

tuce

Isolates uckwheat

Bean Carrot Cap Cauliflower Cucumber Eggplant Let Springonion Rye Millet B Wheat Barley P. deliense UQ6021 0.9 a 0.9 a 0.9 a 0.8 a 1.0 a 0.8 a 0.8 a 0.8 a 0.9 a 0.9 a 0.4 a 1.0 a 0.7 a Py. ramosum UQ6020 0.1 bcd 0.3 b 0.5 b 0.5 a 0.1 b 0.7 ab 0.2 bc 0.5 a 0.2 b 0.1 b 0.2 b 0.5 b 0.0 b Py. ramosum UQ6053 0.0 cd 0.2 b 0.5 b 0.5 a 0.1 b 0.3 b 0.1 c 0.5 ab 0.1 b 0.2 b 0.2 b 0.2 b 0.0 b Py. ramosum UQ6211 0.4 b 0.2 b 0.4 bc 0.5 a 0.0 b 0.3 b 0.2 bc 0.5 ab 0.1 b 0.1 b 0.2 b 0.3 b 0.0 b Py. ramosum UQ6214 0.3 bc 0.2 b 0.4 b 0.5 a 0.1 b 0.5 ab 0.4 b 0.5 a 0.2 b 0.2 b 0.3 b 0.2 b 0.0 b Control 0.0 d 0.1 b 0.2 c 0.1 b 0.1 b 0.3 b 0.0 c 0.2 b 0.1 b 0.1 b 0.1 b 0.1 b 0.0 b

Values followed by different letters within a column show a statistically significant difference at the 5% - level as determined by Tukey’s test.

111

Chapter 7 │Record of Pythiogeton ramosum in Australia

7.4. Discussion Pythiogeton ramosum was first isolated from plant debris in 1916 by Minden (1916) and it has since been commonly recovered from materials under anaerobic conditions (Czeczuga et al., 2005; El-Hissy et al., 1994; Huang et al., 2013; Nascimento et al., 2012). It was believed that Py. ramosum was a saprophyte and until recently its pathogenicity on living plants had not been confirmed (Ann et al., 2006). The results from this study allowed us to conclude that Py. ramosum is indeed pathogenic to several hosts, including this first report on ginger, and that its pathogenicity is also dependent on temperature. Pathogenicity of Pythiogeton has also been recorded from two other Pythiogeton spp.: Py. zeae (Jee et al., 2000) and Py. zizaniae (Ann et al., 2006). Pythiogeton zeae caused basal stalk rot of corn but also attacked tomato, melon fruits and carrot roots (Jee et al., 2000), while Py. zizaniae was specific to water bamboo (Zizania latifolia) (Ann et al., 2006). Although Py. ramosum in this study was isolated directly from ginger rhizomes with symptoms of soft rot, it was not pathogenic on fresh ginger rhizome tissues and living ginger plants until the temperature reached 30-35 °C, which corresponded to its optimum growth temperature. In addition, host range test results for five common rotation crops and some vegetable crops indicated that Py. ramosum isolated from ginger was a moderate pathogen on bean, capsicum, cauliflower, lettuce and spring onion seedlings even at 27 °C. Since waterlogged soil was required for infection, it might be suggested that under high temperature and waterlogged conditions, which are stressful to the ginger plant, might increase susceptibility to infection. However, typical symptoms of PSR were not observed on positive control plants inoculated with P. deliense. P. deliense is a high temperature preference species (max growth at 40 °C) with a wide host range including ginger (Haware and Joshi, 1974; Plaats-Niterink, 1981). Also in our assays, P. deliense was pathogenic on ginger rhizomes at different temperatures and on all tested crops. Hence, pathogenicity of Py. ramosum to ginger at high temperature can be confirmed.

The symptoms induced by Py. ramosum infection were indistinguishable from those caused by Pythium spp. such as P. myriotylum and P. aphanidermatum. Additionally, these temperature and soil moisture conditions often occur in ginger fields during Queensland’s summer, so it is proposed that Py. ramosum infected ginger may be misidentified due to its similar symptoms to PSR of ginger. Furthermore, Py. ramosum was re-isolated from the infected rhizomes to fulfil Koch’s postulates. This is the first report of Py. ramosum as an additional pathogen of soft rot disease on ginger. Species in the Pythiogeton genus are mostly saprophytic. The recent occurrence of diseases caused by newly emerging pathogenic Pythiogeton spp. such as Py. zeae in Korea, Py. zizaniae in Taiwan and Py. ramosum-like in USA may be due to environmental changes including global warming. A very typical example is P. helicoides, an emerging pathogen under high temperature 112

Chapter 7 │Record of Pythiogeton ramosum in Australia conditions. P. helicoides was rarely recorded as a pathogen, but since 2002 it has been reported as an aggressive pathogen on many host plants (Kageyama, 2014).

Huang et al. (2013) observed that isolates of Py. ramosum from Taiwan produced different types of sporangia depending on whether Py. ramosum was floated in either sterile or non-sterile field water. It could be reasoned that morphological variation of Py. ramosum isolates from Taiwan was due to response of isolates to nutritional conditions. Similarly, isolates of Py. autossytum, which was considered a conspecific species of Py. ramosum by Huang et al. (2013), formed entirely different types of sporangia when growing in/on distilled water and string bean agar (Drechsler, 1932). However, morphological variation was also observed in our research where Py. ramosum isolates from two groups were manipulated to produce sporangia in the same manner by floating Py. ramosum cultures on plates containing only sterile distilled water and pieces of grass leaves. It is obvious that morphology of Py. ramosum is variable and this could result in misidentification if morphology alone is used for identification. Based on our results, however, morphological variation of Py. ramosum was not the only criterion for differentiating the two groups of our isolates. The division of the two groups of Py. ramosum isolates was also supported by mycelial behaviour, temperature response and molecular sequences. Group I isolates showed sparse aerial mycelia when growing on PDA and CMA. On the other hand, Group II isolates showed no aerial growth on culture media. Group I isolates grew faster than Group II isolates at 20 °C, whereas Group II isolates grew faster at 35 °C (P = 0.05). It is interesting to note that all recently isolated Pythiogeton spp. reported in the literature have a high temperature preference; most of them grow optimally at temperatures above 30 °C, but not over 37 °C (Ann et al., 2006; Huang et al., 2013; Jee et al., 2000) and this was also observed for our Py. ramosum collection. Additionally, a fine intraspecific variation with one base pair substitution was noticed on ITS sequence alignment between these two groups. A genetic variation within Py. ramosum populations collected from different hosts and locations was seen by comparison with other ITS sequences obtained from Genbank (Huang et al., 2013). Moreover, with four single point substitutions along CoxI sequences, it is suggested that Py. ramosum is a relatively complex taxon. With only a few sequences available for identification of Pythiogeton to species level, which are mainly based on the ITS region, identification of Pythiogeton relies currently on its morphology. However, unlike Pythium which is well known for similarity in morphology among species, Pythiogeton seems to vary in its morphology within the species which, as indicated, has its limitations. Except for some recently described species (Ann et al., 2006; Huang et al., 2013; Jee et al., 2000), previous species such as Py. nigrescens, Py. transversum, Py. utriforme were mainly described based on impure and irreproducible cultures, so their identification based on morphology may be in doubt. 113

Chapter 7 │Record of Pythiogeton ramosum in Australia

From the perspective of isolation and maintenance of pure cultures, Pythiogeton has been reported to be recalcitrant for study due to its unculturable characteristics and requirement for a specific growth medium (Ann et al., 2006; Huang et al., 2013; Jee et al., 2000). However, our Py. ramosum isolates grew well on different media, including PDA and WA which were previously reported not suitable for mycelial growth of Pythiogeton (Ann et al., 2006; Jee et al., 2000). Likewise, Py. ramosum-like isolates recovered from cypress and English ivy were also able to be cultured on a number of different media (Silva-Rojas et al., 2004). Huang et al. (2013) reported the genus Pythiogeton is common in soil habitats and could be cultured using modified PDA medium. Unlike isolates of Py. zeae recovered from diseased corn (Zea mays), which lost their viability when subcultured (Jee et al., 2000), our Py. ramosum isolates were still viable after subculturing and under storage conditions for up to two years. It appears that sporangia produced on half strength CMA are the main structures responsible for Py. ramosum survival since Py. ramosum is known as a heterothallic species, which does not produce oospores on single culture. Additionally, we failed to produce oospores from our Py. ramosum on dual cultures. Because there was no loss of germination of our Pythiogeton ramosum isolates after two years of storage, it is proposed that the storage method reported herein could be implemented to preserve Pythiogeton for the long term with minimum subculturing.

It has been well documented that PSR of ginger is more serious when it occurs in association with either Fusarium spp. or Meloidogyne spp. or Ralstonia sp. (Dohroo, 2001; Gupta et al., 2010; Mathur et al., 2000; Rajan et al., 2002). Therefore, it is possible that a similar interaction occurs between Pythium spp. and Py. ramosum. Due to similar symptoms induced by Py. ramosum and Pythium sp. on ginger in pot trials, soft rot caused Py. ramosum may be misdiagnosed in the field. It is therefore necessary to develop a quick tool to detect and monitor Py. ramosum in infected ginger and in soils. For Pythium, many selective media and baiting materials have been undertaken successfully to recover and enumerate Pythium populations from soils. In many cases, isolation of Pythiogeton is often more difficult since Pythiogeton is usually overgrown by Pythium on culture plates (Huang et al., 2013). Compared with other molecular techniques, LAMP (loop-mediated isothermal amplification) is able to detect a target pathogen without a requirement of pure DNA templates. LAMP is an accurate, cheap, fast and robust technique and can be carried out in the field (Fukuta et al., 2013; Notomi et al., 2000). Therefore, monitoring Py. ramosum together with Pythium spp. in ginger fields by application of LAMP would be of interest and practical benefit to farmers.

114

Chapter 8 │General conclusions and discussion

Chapter 8 : GENERAL CONCLUSIONS AND DISCUSSION

In Australia, ginger is a small cash crop producing about AUD 15.6 million at farm gate value per annum (Camacho and Brescia, 2009). However, from a regional perspective it provides significant levels of employment, particularly as first-order processing of the crop contributes another AUD 80 million to the local economy. Since the first record in 2007of PSR on the two oldest ginger farms, Pythium myriotylum still appears as a pathogen of major concern for the ginger industry. This study was initiated to contribute to a better understanding of Pythium species causing PSR on ginger through an assessment of Pythium diversity on ginger farms on the Sunshine Coast, Australia. Within this chapter, a summary of findings, discussion and recommendations for future investigations are reviewed.

8.1. Summary of findings The first research chapter (chapter 3) covers the re-examination of species status of P. myriotylum attributed to the PSR outbreaks of ginger on the Sunshine Coast reported by Stirling et al. (2009). P. zingiberis-like morphological features of P. myriotylum isolates recovered from PSR ginger were compared with those produced by reference isolates of P. myriotylum CBS254.70 and P. zingiberis NBRC30817. All studied isolates shared similar size of oogonia, oospores, and number of antheridia per oogonium. A typical coiling of the antheridial stalk around the oogoinal stalk before coming in contact, as originally described for P. zingiberis, was also observed in P. myriotylum isolates in this study. Both plerotic and aplerotic oospores were recorded in the studied isolates. Conserved gene fragments extracted from whole genome sequence data showed high degree of homology, ranging from 99.4 to 100% identity among the isolates. The phylogenetic tree constructed based on these gene fragments enabled a grouping of P. myriotylum and P. zingiberis into a separate cluster to other lineages. In vitro pathogenicity assays showed that tested isolates were capable of attacking different tested plant materials. Finally, it was recommended that the reference isolate of P. zingiberis NBRC30817 should be reassigned to the taxon P. myriotylum and P. myriotylum was confirmed as the causal pathogen of PSR disease of ginger in Australia.

A Pythium population study was reported in chapter 4. Eleven Pythium spp. isolated from PSR ginger and soils sampled from around PSR ginger and were identified based on morphology and DNA sequences of the ITS region. Only three of the 11 Pythium spp., including P. myriotylum, P. graminicola and P. spinosum were isolated directly from PSR ginger. Additional sequences of the CoxI, CoxII and β-tubulin of the P. myriotylum collection exhibited a high degree of homology

115

Chapter 8 │General conclusions and discussion among the P. myriotylum isolates collected from different ginger farms. In vitro pathogenicity tests on excised ginger rhizome showed that P. aphanidemartum, P. deliense, P. myriotylum, P. splendens, P. spinosum and P. ultimum were the most pathogenic. P. myriotylum recovered initially from PSR ginger was the only pathogen inducing PSR symptoms on ginger in pot trials at a temperature range from 20 - 35 °C. P. aphanidermatum only attacked and induced PSR on ginger within the narrower temperature range of 30 - 35 °C. P. oligandrum and P. perplexum recovered from soils appeared non-pathogenic in all assays.

In chapter 5, the genetic diversity based on SNP genotyping of P. myriotylum isolates obtained from different hosts and origins is presented. Gene fragments (22 loci) were extracted from whole genome sequences of four P. myriotylum and one P. zingiberis isolates derived from Illumina sequencing. True and unique SNPs occurred more frequently in PSR P. myriotylum isolates than those of others. A total of 129 SNPs was identified along the studied genes. Of these, there were 44 synonymous and 85 non-synonymous SNPs. SNP frequency was 7.64 SNPs/kb. Digestion of PCR products of the partially amplified CoxII locus with the HinP1I enzyme allowed the PSR P. myriotylum strains to be distinguished from other P. myriotylum and Pythium spp. and as well as fungi. PCR-RFLP of the CoxII was sensitive enough to detect PSR P. myriotylum strains directly from artificially inoculated ginger rhizomes without a requirement of pure cultures.

In chapter 6, studies on the interaction on the PSR pathogen by a mycoparsite, P. oligandrum recovered from soils collected from around PSR ginger, are described. P. myriotylum Gin1 originally isolated from PSR ginger was moderately susceptible to P. oligandrum based on mycoparasitism assay. P. myriotylum was not however adversely affected by metabolites produced by P. oligandrum. The studies did show that P. oligandrum was capable of reducing the disease index recorded on seedlings of millet, rye and wheat grown on dual cultures of P. oligandrum and P. myritotylum Gin1. However, P. oligandrum was not able to mitigate disease severity of ginger when co-inoculated with P. myriotylum Gin1 in pot trials. Interestingly in all assasys conducted, P. myriotylum Cap1, which was originally isolated from sudden wilt on capsicum, was not negatively impacted by ginger field derived P. oligandrum, indicating existence of possible host specificity by P. oligandrum-isolates.

The study also revealed that PSR ginger in Australia was attributed to not only Pythium spp. but also Pythiogeton (Py.) ramosum, a little studied oomycete genus (chapter 7). A total of 15 isolates was recovered and identified based on morphology and the ITS region. Py. ramosum was not pathogenic on excised ginger rhizome and ginger plants at temperature below 30 °C. Typical 116

Chapter 8 │General conclusions and discussion symptoms of PSR on ginger plants in pot trials were induced by Py. ramosum once the tested temperature was above 30 °C. Based on sequence diversity of the ITS and CoxI genes and also temperature response, Py. ramosum isolates were divided into two groups. This is the first report of Py. ramosum associated with soft rot disease of ginger.

8.2. Discussion The first report of PSR on ginger was more than 100 years ago in India (Butler, 1907), but the disease is relatively new to Australia. Therefore, accurate identification of the pathogen involved in the PSR diseased ginger is crucial to the development and improvement of control strategies. However, species boundaries among Pythium spp. are not always clear cut. Different Pythium spp. might share similar morphology (Garzón et al., 2007; Nechwatal and Lebecka, 2014). On the other hand, the same Pythium sp. might exhibit variation in morphology (Al-Sheikh and Abdelzaher, 2010; Barr et al., 1996; Tojo et al., 1998). Therefore, Pythium identification is not always an easy task for pathologists with little taxonomic experience (Schroeder et al., 2013). The work is even more challenging when recent evidence supports natural outcrossing in Pythium resulting in possible divergent phyto-, patho- and eco-types (Francis and St Clair, 1993; Harvey et al., 2001; Nechwatal and Lekecka, 2014). With the advent of sequencing technologies, many closely related Pythium spp. have been either distinguished or reunited (Lévesque and De Cock, 2004; Robideau et al., 2011). Along with morphological and physiological re-examinations, pathogenicity tests, and sequences obtained from the whole genome, the results in this study confirmed the identification of P. myriotylum as the causal pathogen of PSR of ginger in Australia.

A number of different Pythium spp. has been reported to be associated with PSR of ginger worldwide (Dohroo, 2005). Although in this study 11 Pythium spp. were recovered from soils and PSR ginger sampled from the Sunshine Coast, Australia, P. myriotylum was predominant. This species has caused major losses to ginger crops in many other countries, including China, India, Fiji, Korea and Taiwan (Kim et al., 1997a; Kumar et al., 2008; Stirling et al., 2009; Tsai, 1991; Yuan et al., 2013). However, other Pythium species, for example P. aphanidermatum and even another oomycete genus that being Pythiogeton ramosum are also capable of causing soft rot of ginger at temperatures above 30 °C in soils. These pathogens pose additional threats to the ginger industry. P. myriotylum is well-known to have wide host range (Plaats-Niterink, 1981), but strains of P. myriotylum recovered initially from PSR ginger exhibited a certain degree of host preference (data not presented). Likewise, P. myriotylum isolates originally obtained from cocoyam appeared to have some degree of host specificity to cocoyam (Perneel et al., 2006). Sequence analyses of four loci of strains of PSR P. myriotylum recovered from ginger in Australia unveiled genetic uniformity 117

Chapter 8 │General conclusions and discussion of the population implying that P. myriotylum has probably been dispersed from one original source.

A uniform Australian population of PSR P. myriotylum was revealed. However, when compared with other P. myriotylum isolates from various hosts and geographic origins, intraspecific variation was observed. This first comparison of multiple genes (up to 22 genes) within the nuclear and mitochondrial genomes among the five P. myriotylum isolates from ginger, capsicum and peanut discovered little genetic divergence (from 0% to up to 1% difference among the studied genes). Unlike highly intraspecific species such as P. irregulare, P. helicoides, P. mercurial and P. ultimum, sequence divergence among isolates might be seen up 3.59% (Barr et al., 1996; 1997; Belbahri et al., 2008; Garzón et al., 2005; Kageyama et al., 2007; Matsumoto et al., 2000). Interestingly, sequences of PSR P. myriotylum isolates from Australia were 100% identical in most genes studied. Therefore, SNPs discovered in PSR P. myriotylum isolates are unique and identical, which have provided useful markers for detection and identification. A powerful molecular tool, PCR-RFLP of the CoxII gene was successfully deployed to detect and diffrentiate PSR P. myriotylum strains from others without the need of isolation of pure cultures. Similarly, Gómez‐ Alpízar (2011) also successfully developed PCR-RFLP of the ITS locus to detect and differentiate P. myriotylum isolates which were pathogenic to cocoyam from non-pathogenic P. myriotylum to cocoyam.

In this study, the recovery of P. oligandrum, a well-known wide host range antagonist was examined to determine if an antagonistic interaction exists with the PSR P. myriotylum which could lead to potential disease control. Although P. oligandrum did not produce toxic metabolites against the pathogen hosts, P. myriotylum Gin1, P. myriotylum Cap1 and P. ultimum So1, its mycoparasitism and competitiveness appeared to be responsible for reductions of the disease index recorded on millet, rye and wheat grown on dual cultures of P. oligandrum and P. myriotylum Gin1/P. ultimum So1. Both mycoparasitism and growth competition were principle mechanisms for suppressing diseases caused by a number of pathogens, namely Verticillum daliae, P. ultimum and Aphanomyces cochlioides (Al-Rawahi and Hancock, 1998; Martin and Hancock, 1987; Ali-Shtayeh and Saleh, 1999; Takenaka and Ishikawa, 2013). However, P. oligandrum failed to protect ginger plants from P. myriotylum Gin1 infection in pot trials. One possible reason for this failure may be poor colonisation of P. oligandrum in the potting mix. To some extent, soil and root colonisation by P. oligandrum are influenced by soil management and plant physiology (Gerbore et al., 2014b; Yacoub et al., 2016).

118

Chapter 8 │General conclusions and discussion

8.3. Recommendations P. myriotylum was confirmed as the predominant causal agent causing PSR of ginger in Australia, but the pathogen has exhibited some degree of host preference to ginger. More pot trials evaluating different crop species for susceptibility to P. myriotylum are warranted, as these data may have significant contributions to PSR control program through crop rotations. Additionally, the P. myritoylum population recovered originally from PSR ginger appeared genetically uniform suggesting the pathogen has been disseminated throughout the industry from one source. Therefore, stricter on-farm biosecurity to prevent further spread is required. Although detection and identification of PSR P. myriotylum strains were accurately achieved by PCR-RFLP, it is still time consuming. Hence, novel and fast turn-around SNP detection approaches, including LAMP and SMAP 2 need to be developed to quickly track and monitor pathogenic P. myriotylum in the field. In addition, fast and sensitive detection approaches to monitor other recently reported PSR pathogens that being P. aphanidermatum and Py. ramosum are also warranted. Discovery of numerous genetic variants of PSR P. myriotylum strains when compared with other P. myriotylum strains were theorised to be responsible for aggressiveness and pathogenicity as well as their variable response to environmental and ecological changes. Therefore, attempts to correlate the genetic variation and these changes are open for further investigations. Because there was a limited number of P. oligandrum isolates included in interaction assays, further research with P. oligandrum populations in soils around PSR ginger to discover strains with improved antagonistic properties is needed. These could be used in integration with other control approaches for more sustainable management of PSR of ginger.

119

References

Abbasi, P.A., Riga, E., Conn, K.L., Lazarovits, G., 2005. Effect of neem cake soil amendment on reduction of damping-off severity and population densities of plant-parasitic nematodes and soilborne plant pathogens. Can. J. Plant Pathol. 27, 38-45. Abbott, C.L., Gilmore, S.R., Lewis, C.T., Chapados, J.T., Peters, R.D., Platt, H.W., Coffey, M.D., Lévesque, C.A., 2010. Development of a SNP genetic marker system based on variation in microsatellite flanking regions of Phytophthora infestans. Can. J. Plant Pathol 32, 440-457. Abdelzaher, H.A., Elnaghy, M., Fadl-Allah, E., 1997. Isolation of Pythium oligandrum from Egyptian soil and its mycoparasitic effect on Pythium ultimum var. ultimum the damping-off organism of wheat. Mycopathologia 139, 97-106. Agrios, G.N., 2005. Plant pathology. Elsevier Academic Press, Burlington, Mass. Ali-Shtayeh, M., Saleh, A.F., 1999. Isolation of Pythium acanthicum, P. oligandrum, and P. periplocum from soil and evaluation of their mycoparasitic activity and biocontrol efficacy against selected phytopathogenic Pythium species. Mycopathologia 145, 143-153. Ali-Shtayeh, M.S, 1986. The genus Pythium in the West Bank and Gaza Strip. Research and Documentation Centre An-Najah National University, Nablus. Ali-Shtayeh, M.S., Len, L.-H.C., Dick, M.W., 1986. An improved method and medium for quantitative estimates of populations of Pythium species from soil. T. Brit. Mycol. Soc. 86, 39-47. Allain-Boulé, N., Tweddell, R., Mazzola, M., Bélanger, R., Lévesque, C.A., 2004. Pythium attrantheridium sp. nov.: taxonomy and comparison with related species. Mycol. Res. 108, 795-805. Al-Rawahi, A.K., Hancock, J.G., 1998. Parasitism and biological control of Verticillium dahliae by Pythium oligandrum. Plant Dis. 82, 1100-1106. Al-Sa'di, A.M., Deadman, M.L., Al-Said, F.A., Khan, I., Al-Azri, M., Drenth, A., Aitken, E.A.B., 2008a. First report of Pythium splendens associated with severe wilt of muskmelon (Cucuinis melo) in Oman. Plant Dis. 92, 313-313. Al-Sa'di, A.M., Drenth, A., Deadman, M.L., DeCock, A.W.A.M., Al‐Said, F.A., Aitken, E.A.B., 2008b. Genetic diversity, aggressiveness and metalaxyl sensitivity of Pythium spinosum infecting cucumber in Oman. J. Phytopathol. 156, 29-35. Al-Sheikh, H., Abdelzaher, H.M.A., 2010. Differentiation between two isolates of Pythium ultimum var. ultimum isolated from diseased plants in two different continents. J. Biol. Sci. 10, 306- 315.

120

References

Ann, P.J., Huang, J.H., Wang, I.T., Ko, W.H., 2006. Pythiogeton zizaniae, a new species causing ba sal stalk rot of water bamboo in Taiwan. Mycologia 98, 116-120. Anonymous, 1963. Plant protection research. Diseases Report. Hawaiian Sug. Plrs’ Ass. Exp. Stn 1963, 27-33. Anonymous, 2010. Ginger, Vibrant Life, Hagerstown, United States, Hagerstown, pp. 17. Arif, M., Garzon, C., Corona, F.O., 2011. Detection and discrimination of Pythium aphanidermatum and P. deliense by single probe based real time PCR and multiplex end point PCR. Phytopathology 101, S9. Atai, Z., Atapour, M., Mohseni, M., 2009. Inhibitory effect of ginger extract on Candida albicans. Am. J. Appl. Sci. 6, 1067-1069. Bahramisharif, A., Lamprecht, S.C., Spies, C.F.J., Botha, W.J., Calitz, F.J., McLeod, A., 2013. Pythium spp. associated with rooibos seedlings, and their pathogenicity toward rooibos, lupin, and oat. Plant Dis. 98, 223-232. Bailey, A.M., Mitchell, D.J., Manjunath, K.L., Nolasco, G., Niblett, C.L., 2002. Identification to the species level of the plant pathogens Phytophthora and Pythium by using unique sequences of the ITS1 region of ribosomal DNA as capture probes for PCR-ELISA. FEMS Microbiol. Lett. 207, 153-158. Bala, K., Robideau, G.P., Lévesque, C.A., Cock, A.W.A.M.d., Abad, Z.G., Lodhi, A.M., Shahsad, S., Ghaffar, A., Coffey, M.D., 2010. Phytopythium Abad et al. gen. nov. and Phytopythium sindhum Lodhi et al. sp. nov. Persoonia. 24, 136-137. Barr, D.J.S., Warwick, S.I., Desaulniers, N.L., 1996. Isozyme variation, morphology, and growth response to temperature in Pythium ultimum. Can. J. Bot. 74, 753-761. Barr, D.J.S., Warwick, S.I., Desaulniers, N.L., 1997. Isozyme variation, morphology, and growth response to temperature in Pythium irregulare. Can. J. Bot. 75, 2073-2081. Belbahri, L., McLeod, A., Paul, B., Calmin, G., Moralejo, E., Spies, C.F.J., Botha, W.J., Clemente, A., Descals, E., Sánchez-Hernández, E., Lefort, F., 2008. Intraspecific and within-isolate sequence variation in the ITS rRNA gene region of Pythium mercuriale sp. nov. (Pythiaceae). FEMS Microbiol. Lett. 248, 17-27. Benhamou, N., le Floch, G., Vallance, J., Gerbore, J., Grizard, D., Rey, P., 2012. Pythium oligandrum: an example of opportunistic success. Microbiology 158, 2679-2694. Benhamou, N., Rey, P., Picard, K., Tirilly, Y., 1999. Ultrastructural and cytochemical aspects of the interaction between the mycoparasite Pythium oligandrum and soilborne plant pathogens. Phytopathology 89, 506-517.

121

References

Bent, E., Loffredo, A., Yang, J.-I., McKenry, M.V., Becker, J.O., Borneman, J., 2009. Investigations into peach seedling stunting caused by a replant soil. FEMS Microbiol. Ecol. 68, 192-200. Berry, L.A., Jones, E.E., Deacon, J.W., 1993. Interaction of the mycoparasite Pythium oligandrum with other Pythium species. Biocontrol Sci. Techn. 3, 247-260. Bhai, R.S., Kishore, V.K., Kumar, A., Anandaraj, M., Eapen, S.J., 2005. Screening of rhizobacterial isolates against soft rot disease of ginger (Zingiber officinale Rosc.). JOSAC 14(2), 130-136. Bhatia, M., Sharma, A., 2012. Antibacterial activities of Trigonella foenum-graecum and Zingiber officinale. Int. J. Pharm. Sci. Res. 3, 3228-3228. Bradshaw-Smith, R.P., Whalley, W.M., Craig, G.D., 1991. Interactions between Pythium oligandrum and the fungal footrot pathogens of peas. Mycol. Res. 95, 861-865. Braun, H., 1924. Geranium stem rot caused by Pythium complectens n. sp. Host resistance reactions, significance of Pythium-type of sporangial germination. J. Agr. Res. 29, 399-419. Brookes, A.J., 1999. The essence of SNPs. Gene 234, 177-186. Brozova, J., 2002. Exploitation of the mycoparasitic fungus Pythium oligandrum in plant protection. Plant Prot. Sci. 38, 29-35. Brumfield, R.T., Beerli, P., Nickerson, D.A., Edwards, S.V., 2003. The utility of single nucleotide polymorphisms in inferences of population history. Trends Ecol. Evol. 18, 249-256. Butler, E.J., 1907. An account of the genus Pythium and some Chytridiaceae. Memoirs of the Department of Agriculture, India (Botanical Series) 1, p70. Butler, E.J., Bisby, G.R., 1960. The fungi of India. The Indian Council of Agricutural Research, New Delhi. C.M.I., 1966. Pythium myriotylum. Commonwealth Agricultural Bureaux, Great Britain. Camacho, H.E., Brescia, A., 2009. The Australian ginger industry: overview of market trends and oppotunities. Department of Employment, Economic Development and Innovation, The State of Queensland, p. 54. Chagnon, M.C., Belanger, R.R., 1991. Tolerance in greenhouse geraniums to Pythium ultimum. Plant Dis. 75, 820-823. Chellemi, D.O., Mitchell, D.J., Kannwischer-Mitchell, M.E., Rayside, P.A., Rosskopf, E.N., 2000. Pythium spp. associated with bell pepper production in Florida. Plant Dis. 84, 1271-1274. Chen, W., Hoy, J., Schneider, R., 1992. Species-specific polymorphisms in transcribed ribosomal DNA of five species. Exp. Mycol. 16, 22-34. Chen, W., Hoy, J.W., 1993. Molecular and morphological comparison of Pythium arrhenomanes and Pythium graminicola. Mycol. Res. 97, 1371-1378.

122

References

Chen, W., Hoy, J.W., Schneider, R.W., 1991. Comparisons of soluble proteins and isozymes for seven Pythium species and applications of the biochemical data to Pythium systematics. Mycol. Res. 95, 548-555. Chen, W.D., 1992. Restriction-fragment-length-polymorphisms in enzymatically amplified ribosomal dnas of 3 heterothallic Pythium species. Phytopathology 82, 1467-1472. Chowdhury, E.K., Hasan, M.M., Mustarin, K., Hasan, M.S., Fancy, R., 2009. Efficacy of different fungicides in controlling rhizome rot of ginger. J. Agrofor. Environ. 3(1), 179-181. Christensen, L.K., Thinggaard, K., 1999. Solarization of greenhouse soil for prevention of Pythium root rot in organically grown cucumber. J. Plant Pathol. 81(2), 137-144. Cwalina-Ambroziak, B., Nowak, M., 2012. The effects of biological and chemical controls on fungal communities colonising tomato (Lycopersicon esculentum Mill.) plants and soil. Folia Hortic. 24, 13-20. Czeczuga, B., Kiziewicz, B., Godlewska, A., 2003. Zoosporic fungi growing on leeches (Hirudinea). Pol. J. Environ. Stud. 12, 361-369. Czeczuga, B., Mazalska, B., Godlewska, A., Muszyńska, E., 2005. Aquatic fungi growing on dead fragments of submerged plants. Limnologica - Ecology and Management of Inland Waters, 35, 283-297. Da Silva, M.P., Munkvold, G., 2010. Interactions between lesion nematodes and Pythium ultimum on maize seedlings. Phytopathology 100, S28-S28. Dai, T.T., Lu, C.C., Lu, J., Dong, S., Ye, W., Wang, Y., Zheng, X., 2012. Development of a loop- mediated isothermal amplification assay for detection of Phytophthora sojae. FEMS Microbiol. Lett. 334, 27-34. Dake, G.N., 1995. Diseases of ginger (Zingiber officinale Rosc.) and their management. JOSAC 4, 40-48. De Cock, A.W., Mendoza, L., Padhye, A.A., Ajello, L., Kaufman, L., 1987. Pythium insidiosum sp. nov., the etiologic agent of pythiosis. J. Clin. Microbiol. 25, 344-349. De Cock, A.W., Robideau, G.P., Bala, K., Coffey, M.D., Abad, Z.G., Lévesque, C.A., 2010. Pythium, Pythiogeton and prov. name Phytopythium: The current status for the species in the genera. Phytopathology 100, S150-S150. Deadman, M., Al Hasani, H., Al Sa’di, A., 2006. Solarization and biofumigation reduce Pythium aphanideramtum induced damping-off and enhance vegetative growth of greenhouse cucumber in Oman. J. Plant Pathol. 88(3), 335-337. De-Guzman, C.C., Siemonsma, J.S., 1999. Plant Resources of South East Asia: Spices. Backhuys Publishers, Leiden, Netherlands.

123

References

Denman, S., Knoxdavies, P.S., Calitz, F.J., Lamprecht, S.C., 1995. Pathogenicity of Pythium irregulare, Pythium sylvaticum and Pythium ultimum var ultimum to lucerne (Medicago sativa). Australas. Plant Pathol. 24, 137-143. Dennis, C., Webster, J., 1971. Antagonistic properties of species groups of Trichoderma: I. Production of non-volatile antibiotics. Trans. Brit. Mycol. Soc.57, 25-39. Dhingra, O.D., Sinclair, J.B., 1995. Basic plant pathology methods., 2nd ed. CRC Press, United States of America. Dick, M., 2001. Straminipilous fungi: systematics of the peronosporomycetes including accounts of the marine straminipilous protists, the plasmodiophorids and similar organisms. Kluwer Academic Publishers, Netherlands. Dick, M.W., 1990. Keys to Pythium. The College of Estate Management, Whiteknights, Reading, Great Britain. Doan, H.K., Davis, R.M., Sartori, F.F., Marcum, D.B., 2013. First report of a Pythiogeton sp. causing root and basal stalk rot of wild rice in california. Plant Dis. 98, 851-851. Dohroo N.P., 2001. Etiology and management of storage rot of ginger in Himachal Pradesh. Indian Phytopathol. 54, 49-54. Dohroo, N.P., 1987. Pythium ultimum on Zingiber officinale. Indian Phytopathol. 40 (2), 275. Dohroo, N.P., 2005. Diseases of ginger, In: Ravindran, P.N., Babu, K.N. (Eds.), Ginger, the genus Zingiber. CRC Press: Boca Raton, pp. 305-340. Dohroo, N.P., Kansal, S., Mehta, P., Ahluwalia, N., 2012. Evaluation of eco-friendly disease management practices against soft rot of ginger caused by Pythium aphanidermatum. Plant Dis. Res. 27 (1), 1-5. Dohroo, N.P., Sharma, S.L., 1985. Pythium pleroticum on Zingiber officinale. Indian Phytopathol. 38, 391. Doyle, J.J., Doyle, J.L., 1990. Isolation of plant DNA from fresh tissue. Focus 12, 13-15. Drechsler, C., 1930. Some new species of Pythium. J. Wash. Acad. Sci. 20, 398-418. Drechsler, C., 1932. A species of Pythiogeton isolated form decaying leaf-sheaths of the common cat-tail. J. Wash. Acad. Sci. 22, 421-449. Drechsler, C., 1934. Pythium scleroteichum n. sp. causing mottle necrosis of sweet potatoes. J. Agr. Res. 49, 881-890. Drechsler, C., 1946. Several species of Pythium peculiar in their sexual development. Phytopathology 36, 781-864. Duan, Y.B., Yang, Y., Wang, J.X., Liu, C.C., He, L.L., Zhou, M.G., 2015. Development and application of loop-mediated isothermal amplification for detecting the highly benzimidazole- resistant isolates in Sclerotinia sclerotiorum. Sci. Rep. 5, 17278. 124

References

Eggertson, Q., 2012. Resolving the Pythium ultimum species complex. PhD theis. Carleton University Ottawa, Canada. El-Hissy, F., Khallil, A.R., Ali, E., 1994. Aquatic phycomycetes from egyptian soil (Delta Region). Microbiol. Res. 149, 271-282. El-Katatny, M.H., Abdelzaher, H.M.A., Shoulkamy, M.A., 2006. Antagonistic actions of Pythium oligandrum and Trichoderma harzianum against phytopathogenic fungi (Fusarium oxysporum and Pythium ultimum var. ultimum). Arch. Phytopathol. Plant Prot. 39, 289-301. English, P.B., Frost, A.J., 1984. Phycomycosis in a dog. Aust. Vet. J. 61, 291-292. Fleischmann, R.D., Alland, D., Eisen, J.A., Carpenter, L., White, O., Peterson, J., DeBoy, R., Dodson, R., Gwinn, M., Haft, D., Hickey, E., Kolonay, J.F., Nelson, W.C., Umayam, L.A., Ermolaeva, M., Salzberg, S.L., Delcher, A., Utterback, T., Weidman, J., Khouri, H., Gill, J., Mikula, A., Bishai, W., Jacobs, J.W.R., Venter, J.C., Fraser, C.M., 2002. Whole-Genome Comparison of Mycobacterium tuberculosis clinical and laboratory strains. J Bacteriol. 184, 5479-5490. Floch, G.L., Vallance, J., Benhamou, N., Rey, P., 2009. Combining the oomycete Pythium oligandrum with two other antagonistic fungi: Root relationships and tomato grey mold biocontrol. Biol. Control 50, 288-298. Foley, M.F., Deacon, J.W., 1986. Susceptibility of Pythium spp and other fungi to antagonism by the mycorparasite Pythium oligandrum. Soil Biol. Biochem. 18, 91-95. Francis, D.M., Gehlen, M.F., Stclair, D.A., 1994. Genetic-variation in homothallic and hyphal swelling isolates of Pythium ultimum var ultimum and P. ultimum var sporangiferum. Mol. Plant Microbe In. 7, 766-775. Fu, C.H., Chen, C.M., Hsieh, H.J., 2005. First report of Formosan michelia seedling root rot caused by Pythium splendens in Taiwan. Plant Dis. 89, 1361-1361. Fu, S., Qu, G., Guo, S., Ma, L., Zhang, N., Zhang, S., Gao, S., Shen, Z., 2011. Applications of Loop-Mediated Isothermal DNA Amplification. Appl. Biochem. Biotech. 163, 845-850. Fukuta, S., Takahashi, R., Kuroyanagi, S., Ishiguro, Y., Miyake, N., Nagai, H., Suzuki, H., Tsuji, T., Hashizume, F., Watanabe, H., Kageyama, K., 2014. Development of loop-mediated siothermal amplification assay for the detection of Pythium myriotylum. Lett. Appl. Microbiol. 2014 Mar 10. doi: 10.1111/lam.12244. Fukuta, S., Watanabe, H., Kageyama, K., Takahashi, R., Kuroyanagi, S., Miyake, N., Nagai, H., Suzuki, H., Hashizume, F., Tsuji, T., Taguchi, H., 2013. Detection of Pythium aphanidermatum in tomato using loop-mediated isothermal amplification (LAMP) with species-specific primers. Eur. J. Plant Pathol. 136, 689-701.

125

References

Fullerton, R.A., Harris, F.M., 1998. Control of rhizomes rot of ginger in Fiji. A report ot the Ginger Council of Fiji. Gao, J.Y., Yang, Z.H., Ren, P.Y., Li, Q.J., 2006. Reproductive ecology of Rhynchanthus beesianus W. W. Smith (Zingiberaceae) in South Yunnan, China: A ginger with bird pollination syndrome. J. Integr. Plant Biol. 48, 1294-1299. Garren, K.H., 1971. Peristence of Pythium myriotylum in Soils. Phytopathology 61, 596. Garzón, C.D., Geiser, D.M., Moorman, G.W., 2005. Amplified fragment length polymorphism analysis and internal transcribed spacer and CoxII sequences reveal a species boundary within Pythium irregulare. Phytopathology 95, 1489-1498. Garzón, C.D., Geiser, D.M., Moorman, G.W., 2005. Diagnosis and population analysis of Pythium species using AFLP fingerprinting. Plant Dis. 89, 81-89. Garzón, C.D., Yánez, J.M., Moorman, G.W., 2007. Pythium cryptoirregulare, a new species within the P. irregulare complex. Mycologia 99, 291-301. Gerbore, J., Benhamou, N., Vallance, J., Le Floch, G., Grizard, D., Regnault-Roger, C., Rey, P., 2014a. Biological control of plant pathogens: advantages and limitations seen through the case study of Pythium oligandrum. Environ. Sci. Pollut. Res. 21, 4847-4860. Gerbore, J., Vallance, J., Yacoub, A., Delmotte, F., Grizard, D., Regnault-Roger, C., Rey, P., 2014b. Characterization of Pythium oligandrum populations that colonize the rhizosphere of vines from the Bordeaux region. FEMS Microbiol. Ecol. 90, 153-167. Ghosh, R., Datta, M., Purkayastha, R.P., 2006. Intraspecific strains of Pythium aphanidermatum induced disease resistance in ginger and response of host proteins. Indian J. Exp. Biol. 44, 68. Ghosh, R., Purkayastha, R.P., 2003. Molecular diagnosis and induced systemic protection against rhizome rot disease of ginger caused by Pythium aphanidermatum. Curr. Sci. India 85, 1782- 1787. Gilbert, R.L., Cother, E.J., Nicol, H.I., 1995. Mathematical-methods to compare growth-curves of Pythium arrhenomanes and 11 other Pythium species as an aid to their identification. Mycol. Res. 99, 19-30. Gill, H.S., 1978. Identification of Phytophthora species by disc electrophoresis. Phytopathology 68, 163. Gómez‐Alpízar, L., Saalau, E., Picado, I., Tambong, J.T., Saborío, F., 2011. A PCR‐RFLP assay for identification and detection of Pythium myriotylum, causal agent of the cocoyam root rot disease. Lett. Appl. Microbiol. 52, 185-192. Graham, K.M., 1971. Plant diseases of Fiji. Her Majesty's Stationery Office, Lodon. GRP, 2009. Techinical Annual Report - 2008/2009. Ginger Research Programme, NARC, Kapurkot, Salyan, Nepal. 126

References

Gupta, M., Dohroo, N.P., Gangta, V., Shanmugam, V., 2010. Effect of microbial inoculants on rhizome disease and growth parameters of ginger. Indian Phytopathol. 63, 438-441. Gupta, S.L., Paijwar, M.S., Rizvi, G., 2013. Biological management of rot disease of ginger (Zingiber officinales Rosc.). Trends Biosci. 6(3), 302 Hamid A, 1942. Indian water moulds III, The Indian Academy of Science, pp. 206-215. Hamilton, K., 2011. Ginger and chemotherapy: A literature review. Shadows: New Zeal. J. Med. Radiat. Tech. 54, 23-28. Harvey, P., Lawrence, L., 2008. Managing Pythium root disease complexes to improve productivity of crop rotations. Outlooks Pest Manage. 19, 127-129. Harvey, P.R., Butterworth, P.J., Hawke, B.G., Pankhurst, C.E., 2000. Genetic variation among populations of Pythium irregulare in southern Australia. Plant Pathol. 49, 619-627. Haware, M.P., Joshi, L.K., 1974. Studies on soft rot of ginger from Madhya Pradesh. Indian Phytopathol. 27, 158-161. He, S.S., Zhang, B.X., Ge, Q.X., 1992. On the antagonism by hyperparasite Pythium oligandrum. Acta Phytopathol. Sin. 22, 77-82. Hendrix, F.F., Campbell, W.A., 1973. Pythiums as plant pathogens. Annu. Rev. Phytopathol. 11, 77-98. Herrero, M.L.U.Z., Klemsdal, S.S., 1998. Identification of Pythium aphanidermatum using the RAPD technique. Mycol. Res. 102, 136-140. Ho, H.H., 2009. The genus Pythium in Taiwan, China (1) - a synoptic review. Front. Biol. China 4, 15-28. Ho, H.H., 2011. The genus Pythium in Taiwan (2)-an Illustrated diagnostic key. Mycotaxon 116, 33-47. Hogarth, J., 2000. Buderim Ginger: an export success story: a history of the ginger industry of Queensland. Hogarth & Buderim Ginger Ltd, Yandina, Queensland. Holmes, K.A., Nayagam, S.D., Craig, G.D., 1998. Factors affecting the control of Pythium ultimum damping-off of sugar beet by Pythium oligandrum. Plant Pathol. 47, 516-522. Hoppe, P.E., 1966. Pythium species still viable after 12 years in air-dried muck soil. Phytopathology 56, 1411. Horner, N.R., Grenville-Briggs, L.J., van West, P., 2012. The oomycete Pythium oligandrum expresses putative effectors during mycoparasitism of Phytophthora infestans and is amenable to transformation. Fungal Biol. 116, 24-41. Hsieh, H.J., Chang, H.S., 1976. Five species of Pythium, two species of Pythiogeton new for Taiwan and Pythium afertile. Bot. Bull. Acad. Sinica (Taipei), 17, 141-150.

127

References

Huang, J.H., Chen, C.Y., Lin, Y.S., Ann, P.J., Huang, H.C., Chung, W.H., 2013. Six new species of Pythiogeton in Taiwan, with an account of the molecular phylogeny of this genus. Mycoscience 54, 130-147. Hutchins, D.R., Johnston, K.G., 1972. Phycomycosis in the horse. Aust. Vet. J. 48, 269-278. Ichitani, T., Amemiya, J., 1980. Pythium gracile isolated from the foci of granular dermatitis in the horse (Equus caballus). Trans. Mycol. Soc. Japan 21, 263–265. Ichitani, T., Goto, H., 1982. Distribution of Pythium zingiberum causing rhizome rot in ginger- growing and its surrounding uncultivated soils. Ann. Phytopath. Soc. Japan 48, 674-676. Ichitani, T., Shinsu, T., 1980. Pythium zingiberum causing rhizome rot of ginger plant and its distribution. Ann. Phytopath. Soc. Japan 46 435-441 in Japanese (English abstract). Ichitani, T., Shinsu, T., 1981. Detection zingiberum causing rhizome rot disease of ginger of pythium from soils of surrounding area of continuous indoor cropping for immature rhizome production. Ann. Phytopath. Soc. Japan 47, 158-165. Ikeda, A., Ichitani, T., 1985. Density of Pythium zingiberum oospores in relation to infection of Chenopodium quinoa seedlings. Bull. Univ. Osaka Pref., Ser. B 37, 13-18. Ikeda, S., Shimizu, A., Shimizu, M., Takahashi, H., Takenaka, S., 2012. Biocontrol of black scurf on potato by seed tuber treatment with Pythium oligandrum. Biol. Control 60, 297-304. ISPS, 2005. Experiences in Collaboration: Ginger Pests and Diseases. Indo-Swiss Project Sikkim, India, p. 75. Ito, S., Tokunaga, Y., 1933 Studies on the rot-disease of rice seedlings caused by Pythium species. J. Facul. Agri., Hokkaido Imperial University 32, 201-233. Ito, T., 1944. Some aquatic species of Phycomycetes found in Kyoto. J. Jpn. Botany 20, 51-60. Jacobs, R.P., 1982. Pythiaceous fungi associated with the decomposition of Nymphoides peltata. A. van Leeuw. J. Microbiol. 48, 433-445. Janes, M.E., Nannapaneni, R., Johnson, M.G., 1999. Identification and characterization of two bacteriocin-producing bacteria isolated from garlic and ginger root. J. Food Prot. 62, 899-899. Jee, H.J., Ho, H.H., Cho, W.D., 2000. Pythiogeton zeae sp. nov. causing root and basal stalk rot of corn in Korea. Mycologia 92, 522-527. Jeffers, S.N., Martin, S.B., 1986. Comparison of two media selective for Phytophthora and Pythium species. Plant Dis. 70, 1038-1043. Jiang, Y.N., Haudenshield, J.S., Hartman, G.L., 2012. Characterization of Pythium spp. from soil samples in Illinois. Can. J. Plant Pathol. 34, 448-454. Jones, E.E., Deacon, J.W., 1995. Comparative physiology and behaviour of the mycoparasites Pythium acanthophoron, P. oligandrum and P. mycoparasiticum. Biocontrol Sci. Techn. 5, 27-40. 128

References

Jooju, B., 2005. Evaluation of genetic diversity of Pythium spp. causing soft of ginger using phenotypic and molecular methods. MPhil Thesis, Bharathidasan Univeristy, Thiruchirapalli. Kageyama, K., 2014. Molecular taxonomy and its application to ecological studies of Pythium species. J. Gen. Plant Pathol. 80, 314-328. Kageyama, K., Kobayashi, M., Tomita, M., Ku bota, N., Suga, H., Hyakumachi, M., 2002. Production and evaluation of monoclonal antibodies for the detection of Pythium sulcatum in soil. J. Phytopathol. 150, 97-104. Kageyama, K., Nakashima, A., Kajihara, Y., Suga, H., Nelson, E.B., 2005. Phylogenetic and morphological analyses of Pythium graminicola and related species. J. Gen. Plant Pathol. 71, 174-182. Kageyama, K., Senda, M., Asano, T., Suga, H., Ishiguro, K., 2007. Intra-isolate heterogeneity of the ITS region of rDNA in Pythium helicoides. Mycol. Res. 111, 416-423. Kammarnjesadakul, P., Palaga, T., Sritunyalucksana, K., Mendoza, L., Krajaejun, T., Vanittanakom, N., Tongchusak, S., Denduangboripant, J., Chindamporn, A., 2011. Phylogenetic analysis of Pythium insidiosum Thai strains using cytochrome oxidase II (CoxII) DNA coding sequences and internal transcribed spacer regions (ITS). Med. Mycol. 49, 289- 295. Karaca, G., Tepedelen, G., Belghouthi, A., Paul, B., 2008. A new mycoparasite, Pythium lycopersicum, isolated in Isparta, Turkey: morphology, molecular characteristics, and its antagonism with phytopathogenic fungi. FEMS Microbiol. Lett. 288, 163-170. Karmakar, N.C., Ghosh, R., Purkayastha, R.P., 2003. Plant defence acitivators inducing systemic resistance in Zingiber officinale Rosc. against Pythium aphanidermatum (Edson) Fitz. Indian J. Biotech. 2, 591-595. Kavitha, P.G., Thomas, G., 2008a. Defence transcriptome profiling of Zingiber zerumbet (L.) Smith by mRNA differential display. J. Biosciences 33, 81-90. Kavitha, P.G., Thomas, G., 2008b. Expression analysis of defense-related genes in Zingiber (Zingiberaceae) species with different levels of compatibility to the soft rot pathogen Pythium aphanidermatum. Plant Cell Rep. 27, 1767-1776. Kavitha, P.G., Thomas, G., 2008c. Population genetic structure of the clonal plant Zingiber zerumbet (L.) Smith (Zingiberaceae), a wild relative of cultivated ginger, and its response to Pythium aphanidermatum. Euphytica 160, 89-100. Kernaghan, G., Reeleder, R.D., Hoke, S.M.T., 2008. Quantification of Pythium populations in ginseng soils by culture dependent and real-time PCR methods. App. Soil Ecol. 40, 447-455. Kibblewhite, M.G., Ritz, K., Swift, M.J., 2008. Soil Health in Agricultural Systems. Philos. T. R. Soc. B. 363, 685-701. 129

References

Kim, C.H., Hahn, K.D., Park, K.S., 1996. Survey of rhizome rot incidence of ginger in major production areas in Korea. Korean J. Plant Pathol. 12, 336-344 (English abstract). Kim, C.H., Yang, S.S., Hahn, K.D., 1998. Effects of soil disinfection, fungicide application and narrow ridge cultivation on development of ginger rhizome rot caused by Pythium myriotylum on the fields. Korean J. Plant Pathol. 14(3), 253-259. Kim, C.H., Yang, S.S., Hahn, K.D., Kim, C., Yang, S., Hahn, K., 1997a. Ecology of ginger rhizome rot development caused by Pythium myriotylum. Korean J. Plant Pathol. 13, 184-190. Kim, C.H., Yang, S.S., Park, K.S., 1997b. Pathogencity and mycological characteristics of Pythium myriotylum causing rhizome rot of ginger. Korean J. Plant Pathol. 13(3), 152-157. Kiran, A.G., Augustine, L., Varghese, S., Thomas, G., 2012. Reactive oxygen species sequestration, hypersensitive response and salicylic acid signalling together hold a central role in Pythium resistance in Zingiber zerumbet (Zingiberaceae), 6th International Zingiberaceae Symposium Calicut University Campus, Calicut, Kerala, India, pp. 32-33. Kizhakkayil, J., Sasikumar, B., 2011. Diversity, characterization and utilization of ginger: a review. Plant Genetic Resources -Characterization and Utilization 9, 464-477. Kobriger, K., Hagedorn, D.J., 1984. Additional Pythium species associated with the bean root rot complex in Wiscosin’s Central Sands. Plant Dis. 68, 595-596 Krell, J., Stebbing, J., 2012. Ginger: the root of cancer therapy? Lancet Oncol. 13, 235-236. Kroon, L.P.N.M., Bakker, F.T., van den Bosch, G.B.M., Bonants, P.J.M., Flier, W.G., 2004. Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genet. Biol. 41, 766-782. Krywienczyk, J., Dorworth, C.E., 1980. Serological relationships of some fungi of the genus Pythium. Can. J. Bot. 58, 1412-1417. Kubota, M., Abiko, K., 2000. Damping off of cabbage seedling caused by Pythium zingiberis (in Japanese with English summary). Proc. Kansai Plant Prot. 42, 51-52. Kubota, M., Nakasuji, S., Shimizu, M., Nishi, K., 2006a. Damping-off of cabbage plug seedlings caused by Pythium ultimum var. ultimum in Japan. J. Gen. Plant Pathol. 72, 123-125. Kubota, M., Nakasuji, S., Shimizu, M., Nishi, K., 2006b. Pathogenicity of Pythium ultimum var. ultimum to cabbage seedlings. Annu. Rep. Kansai Plant Protect. Soc. 48, 49-50. Kumar, A., Avasthe, R.K., Borah, T.R., Lepcha, B., Pandey, B., 2012. Organic mulches affecting yield, quality and diseases of ginger in mid hills of North Eastern Himalayas. Indian J. Hortic. 69, 439-442. Kumar, A., Reeja, S. T., Bhai, R. S., Shiva, K. N. (2008). Distribution of Pythium myriotylum Drechsler causing soft rot of ginger. JOSAC 17 (1):5-10

130

References

Kumar, A., Sarma, Y.R., 2004. Characterization of Ralstonia solanacearum causing bacterial wilt in ginger. Indian Phytopathol. 58 (1), 12-17 Kumar, M., Shukla, P.K., 2006. Single-stranded conformation polymorphism of large subunit of ribosomal RNA is best suited to diagnosing fungal infections and differentiating fungi at species level. Diagn. Micr. Infec. Dis. 56, 45-51. Kyuchukova, M.A., Buttner, C., Gabler, J., Bar-Yosef, B., Grosch, R., Klaring, H.P., 2006. Evaluation of a method for quantification of Pythium aphanidermatum in cucumber roots at different temperatures and inoculum densities. J. Plant Dis. Prot. 113, 113-119. Laing, S.A.K., Deacon, J.W., 1991. Video microscopical comparison of mycoparasitism by Pythium oligandrum, P. nunn and an unnamed Pythium species. Mycol. Res. 95, 469-479. Langner, E., Greifenberg, S., Gruenwald, O., 1998. Ginger: History and use. Adv. Ther. 15, 25-44. Le, D.P., 2010. Pathogenicity, morphological and genetic diversity of soft rot disease pathogen, Pythium myriotylum Drechsl. on ginger (Zingiber officinale Roscoe). Master thesis of Plant Protection. The University of Queensland. Le, P.D., Smith, M.K., Aitken, E.A.B., 2010. Pythium spp. on ginger (Zingiber officinale Roscoe) in Australia, in: Sterling, G.R. (Ed.), Proceedings of the sixth Australasian soilborne diseases symposium., Twin Waters, Queensland, p. 62. ISBN 978-0-646-53983-6 Lee, S., Garzón, C.D., Moorman, G.W., 2010. Genetic structure and distribution of Pythium aphanidermatum populations in Pennsylvania greenhouses based on analysis of AFLP and SSR markers. Mycologia 102, 774-784. Lee, S., Moorman, G.W., 2008. Identification and characterization of simple sequence repeat markers for Pythium aphanidermatum, P. cryptoirregulare, and P. irregulare and the potential use in Pythium population genetics. Curr. Genet. 53, 81-93. Lee, Y.S., Hoy, J.W., 1992. Interactions among Pythium species affecting root rot of sugarcane. Plant Dis. 79, 735-739. Lévesque, C.A., 2011. Fifty years of oomycetes - from consolidation to evolutionary and genomic exploration. Fungal Diver. 50, 35-46. Lévesque, C.A., De Cock, A.W.A.M., 2004. Molecular phylogeny and taxonomy of the genus Pythium. Mycol. Res. 108, 1363-1383. Li, Y., Mao, L.G., Yan, D.D., Liu, X.M., Ma, T.T., Shen, J., Liu, P.F., Li, Z., Wang, Q.X., Ouyang, C.B., Guo, M.X., Cao, A.C., 2014. First report in china of soft rot of ginger caused by Pythium aphanidermatum. Plant Dis. 98, 1011. Li, Y.P., You, M.P., Barbetti, M.J., 2014. Species of Pythium associated with seedling root and hypocotyl disease on common bean (Phaseolus vulgaris) in Western Australia. Plant Dis. 98, 1241-1247. 131

References

Lin, L.T., Chang, S.S., Leu, L.S., 1971. Soft rot of ginger. Plant Prot. Bul. Taiwan 13, 54-67. Littrell, R.H., McCarter, S., 1970. Effect of soil temperature on virulence of Pythium aphanidermatum and Pythium niyriotylum to rye and tomato. Phytopathology 60, 704-707. Liu, K.-L., Porras-Alfaro, A., Kuske, C.R., Eichorst, S.A., Xie, G., 2012. Accurate, rapid taxonomic classification of fungal large-subunit rRNA genes. Appl. Environ. Microbiol. 78, 1523-1533. Liu, P.S.W., 1977a. Diseases caused by Phytophthora and Pythium in Sabah, Malaysia, Technical Bulletin. Department of Agriculture, Sabah, Malaysia, p. 25. Liu, P.S.W., 1977b. A supplement to a host list of plant diseases in Sabah, Malaysia. Commonwealth mycological institute, Kew. Lomavatu, M.F., Conroy, J., Aitken, E.B., 2009. Molecular identification of Pythium isolates of ginger from Fiji and Australia., in: Williamson, P. (Ed.), 17th Biennial Australasian Plant Pathology Society Conference., Newcastle, NSW. Lucas, B., Griffiths, P.D., 2004. Evaluation of common bean accessions for resistance to Pythium ultimum. Hortscience 39, 1193-1195. Lumsden, R.D., Ayers, W.A., Dow, R.L., 1975. Differential isolation of Pythium species from soil by means of selective media, temperature and pH. Can. J. Microbiol. 21, 606-612. Martin, F., 1990. Taxonomic classification of asexual isolates of based on cultural characteristics and mitochondrial DNA restriction patterns. Exp. Mycol. 14, 47-56. Martin, F., 2008. Pythium genetics, Oomycete genetics and genomics. John Wiley & Sons, Inc., pp. 213-239. Martin, F., Hancock, J., 1987. The use of Pythium oligandrum for biological control of preemergence damping-off caused by P. ultimum. Phytopathology 77, 1013-1020. Martin, F.K., 1992. Pythium, In: Singleton, L.L., Mihail, J.D., Rush, C.M. (Eds.), Methods for research on soilborne phytopathogenic fungi. APS Press, St. Paul, Minn. Martin, F.N., 1990. Variation in the ribosomal DNA repeat unit within single-oospore isolates of the genus Pythium. Genome 33, 585-591. Martin, F.N., 2000. Phylogenetic relationships among some Pythium species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia 92, 711-727. Martin, F.N., Kistler, H.C., 1990. Species-specific banding patterns of restriction endonuclease- digested mitochondrial DNA from the genus Pythium. Exp. Mycol. 14, 32-46. Martin, R.R., James, D., Lévesque, C.A., 2000. Impacts of molecular diagnostic technologies on plant disease management. Annu. Rev. Phytopathol. 38, 207-239. Mathur, K., Ram, D., Poonia, J., Lodha, B. C., 2002. Integration of soil solarization and pesticides for management of rhizome rot of ginger. Indian Phytophathol. 55, 345-347.

132

References

Matsumoto, C., Kageyama, K., Suga, H., Hyakumachi, M., 1999. Phylogenetic relationships of Pythium species based on ITS and 5.8S sequences of the ribosomal DNA. Mycoscience 40, 321-331. Matsumoto, C., Kageyama, K., Suga, H., Hyakumachi, M., 2000. Intraspecific DNA polymorphisms of Pythium irregulare. Mycol. Res. 104, 1333-1341. McCarter, S., Littrell, R., 1970. Comparative pathogenicity of Pythium aphanidermatum and Pythium myriotylum to twelve plant species and intraspecific variation in virulence. Phytopathology 60, 264-268. McLeod, A., Botha, W.J., Meitz, J.C., Spies, C.F.J., Tewoldemedhin, Y.T., Mostert, L., 2009. Morphological and phylogenetic analyses of Pythium species in South Africa. Mycol. Res. 113, 933-951. McQuilken, M.P., Whipps, J.M., Cooke, R.C., 1990. Control of damping-off in cress and sugar-beet by commercial seed-coating with Pythium oligandrum. Plant Pathol. 39, 452-462. McRae, W., 1911. Soft rot of ginger in the Rangpur district, East Bengal (East Pakistan). Agr. J. India 6, 139-146. Mette Madsen, A., de Neergaard, E., 1999. Interactions between the mycoparasite Pythium oligandrum and sclerotia of the plant pathogen Sclerotinia sclerotiorum. Eur. J. Plant Pathol. 105, 761-768. Minden, M.V., 1916. Beitrage zur biologie und systematik einheimsche submerser Phycomyceten. Falk Mykolog Untersuch Berichte 2, 146-255. Mircetich, S.M., Kraft, J.M., 1973. Efficiency of various selective media in determining Pythium population in soil. Mycopath. Mycol. Appl. 50, 151. Mitani, Y., Lezhava, A., Kawai, Y., Kikuchi, T., Oguchi-Katayama, A., Kogo, Y., Itoh, M., Miyagi, T., Takakura, H., Hoshi, K., 2007. Rapid SNP diagnostics using asymmetric isothermal amplification and a new mismatch-suppression technology. Nat. Methods 4, 257-262. Moralejo, E., Clemente, A., Descals, E., Belbahri, L., Calmin, G., Lefort, F., Spies, C.F.J., McLeod, A., 2008. Pythium recalcitrans sp. nov. revealed by multigene phylogenetic analysis. Mycologia 100, 310-319. Morin, P.A., Luikart, G., Wayne, R.K., 2004. SNPs in ecology, evolution and conservation. Trends Ecol. Evol. 19, 208-216. Morita, Y., Tojo, M., 2007. Modifications of PARP medium using fluazinam, miconazole, and nystatin for detection of Pythium spp. in soil. Plant Dis. 91, 1591-1599. Mu, J.H., Bollon, A.P., Sidhu, R.S., 1999. Analysis of β-tubulin cDNAs from taxol-resistant Pestalotiopsis microspora and taxol-sensitive Pythium ultimum and comparison of the taxol- binding properties of their products. Mol. Gen. Genet. 262, 857-868. 133

References

Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probe. 16, 223-229. Nair, R.A., Thomas, G., 2007. Isolation, characterization and expression studies of resistance gene candidates (RGCs) from Zingiber spp. TAG. Theor. Appl. Genet. 116, 123-134. Nair, R.A., Thomas, G., 2012. Functional genetic diversity at nucleotide binding site (NBS) loci: Comparisons among soft rot resistant and susceptible Zingiber taxa. Biochem. Syst. Ecol. 44, 196-201. Nair, R.A., Thomas, G., 2013. Molecular characterization of ZzR1 resistance gene from Zingiber zerumbet with potential for imparting Pythium aphanidermatum resistance in ginger. Gene 516, 58-65. Nambiar, K.K.N., Sarma, Y.R., 1974. Mosaic diseas of ginger (Zingiber officinale Rosc.). Arecanut and Spices Bulletin 6, 3-4. Nascimento, C.D.A., Gomes, E.P.C., Souza, J.I.D., Pires-Zottarelli, C.L.A., 2012. Zoosporic true fungi and heterotrophic straminipiles assemblages from soil of Brazilian Cerrado areas. Fungal Ecol. 5, 114-123. Nechwatal, J., Lebecka, R., 2014. Genetic and phenotypic analyses of Pythium isolates from reed suggest the occurrence of a new species, P. phragmiticola, and its involvement in the generation of a natural hybrid. Mycoscience 55, 134-143. Nechwatal, J., Wielgoss, A., Mendgen, K., 2005. Pythium phragmitis sp. nov., a new species close to P. arrhenomanes as a pathogen of common reed (Phragmites australis). Mycol. Res. 109, 1337-1346. Nepali, M.B., Prasad, R.B., Sah, D.N., 2000. Survey of ginger growing areas in Syanja, Palpa, Gulni and Arghaknach districts with special emphasis in rhizome rot disease. Bulletin Lumle Agricultural Research Station, Nepal. Nicoll, R., Henein, M.Y., 2009. Ginger (Zingiber officinale Rosc.): A hot remedy for cardiovascular disease? Int. J. Cardiol. 131, 408-409. Nishijima, K.A., Alvarez, A.M., Hepperly, P.R., Shintaku, M.H., Keith, L.M., Sato, D.M., Bushe, B.C., Armstrong, J.W., Zee, F.T., 2004. Association of Enterobacter cloacae with rhizome rot of edible ginger in Hawaii. Plant Dis. 88, 1318-1327. Nishino, T., Shinsu, T., Sakaguchi, S., 1984. Studies on the virus disease of ginger. 2. Aphid species and their seasonal prevalence on ginger. Kyushu Plant Prot. Res. 30, 112-115. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63-63. Nyochembeng, L.M., Pacumbaba, R.P., Beyl, C.A., 2002. Calcium enhanced zoospore production of Pythium myriotylum in vitro. J. Phytopathol. 150, 396-398. 134

References

Okubara, P.A., Schroeder, K.L., Paulitz, T.C., 2005. Real-time polymerase chain reaction: applications to studies on soilborne pathogens. Can. J. Plant Pathol. 27, 300-313. Olaya, G., Heidel, T., Abad, G., Abad, J., Watrin, C., 2006. Pythium species associated with corn seedling diseases in the USA, pathogenicity and sensitivity to mefenoxam and azoxystrobin. Phytopathology 96, S87-S87. Overy, D.P., Frisvad, J.C., 2005. Mycotoxin production and postharvest storage rot of ginger (Zingiber officinale) by Penicillium brevicompactum. J. Food Prot. 68, 607-607. Pacumbaba, R.P., Wutoh, J.G., Eyango, S.A., Tambong, J.T., Nyochembeng, L.M., 1992. Isolation and pathogenicity of rhizosphere fungi of cocoyam in relation to cocoyam root rot disease. J. Phytopathol. 135, 265-273. Pandey, A.K., Awasthi, L.P., Srivastva, J.P., Sharma, N.K., 2010. Management of rhizome rot disease of ginger (Zingiber officinale Rosc.). J. Phytology. 2, 18-20. Pankhurst, C.E., McDonald, H.J., Hawke, B.G., 1995. Influence of tillage and crop rotation on the epidemiology of Pythium infections of wheat in a red-brown earth. Soil Biol. Biochem. 27, 1065-1073. Papavizas, G.C., 1985. Trichoderma and Gliocladium: biology, ecology and potential for biocontrol. Annu. Rev. Phytopathol. 23, 23-54. Park, M., 1935. Report of the work of the Mycological Division, Ceylon, 1934. Administration Report Director of Agriculture, pp. D126-D133. Park, M., 1937. Report of the work of the Mycological Division, Ceylon, 1936. Administration Report Director of Agriculture, pp. D28-D35. Park, M., Bae, J., Lee, D.S., 2008. Antibacterial activity of 10-gingerol and 12-gingerol isolated from ginger rhizome against periodontal bacteria. Phytother. Res. 22, 1446-1449. Paul, B., Galland, D., Bhatnagar, T., Dulieu, H., 1998. A new species of Pythium isolated from the Burgundy region in France. FEMS Microbiol. Lett. 158, 207-213. Pegg, K.G., Stirling, G.R., 1994. Ginger, In: Persley, D. (Ed.), Diseases of Vegetable Crops. Department of Primary Industries, Queensland, pp. 55-57. Perneel, M., Tambong, J.T., Adiobo, A., Floren, C., Saborío, F., Lévesque, A., Höfte, M., 2006. Intraspecific variability of Pythium myriotylum isolated from cocoyam and other host crops. Mycol. Res. 110, 583-593. Pettitt, T.R., Wainwright, M.F., Wakeham, A.J., White, J.G., 2011. A simple detached leaf assay provides rapid and inexpensive determination of pathogenicity of Pythium isolates to ‘all year round’ (AYR) chrysanthemum roots. Plant Pathol. 60, 946-956.

135

References

Philip, S., 2005. Pathogenicity and characterization of Pythium species causing soft rot of ginger, in: Parthasarathy, V.A. (Ed.), Abstracts of M.Sc.and Ph.D Dissertations on spice crops, Calicut. Indian Institute of Spices Research. p.26. Plaats-Niterink, A.J.V.D., 1981. Monograph of the genus Pythium. Stud. Mycol. 21, 1-244. Ploetz, R.C., 2004. Influence of temperature on Pythium splendens induced root disease on carambola, Averrhoa carambola. Mycopathologia 157, 225-231. Porter, D.M., 1970. Peanut wilt caused by Pythium myriotylum. Phytopathology 60, 393. Priekule, I., 2007. First report of Pythium ultimum var. ultimum causing damping-off on okra in Japan. Plant Pathol. 56, 1042-1042. Pringsheim, N., 1858. Contribution to morphology and systematics of algae. 2, The Saprolegniales. Jb Wiss. Bot., 1: 284-306. Rafin, C., Brygoo, Y., Tirilly, Y., 1995. Restriction analysis of amplified ribosomal DNA of Pythium spp. isolated from soilless culture systems. Mycol. Res. 99, 277-281. Rai, M.K., 1993. Identity and taxonomy of hitherto unreported pathogen causing leaf-spot disease of ginger in India. Mycotaxon 46, 329-333. Rajan, K.M., Agnihotri, V.P., 1989. Pythium induced rhizome rot of ginger, problems and progress., In: Agnihotri, V.P., Sing, N., Chaube, H.S., Sing, V.S., Dwivedi, T.S. (Eds.), Perspective in Phythopathology. Today and Tomorrow's Principles and Publishers, New Delhi, pp. 189-198. Rajan, P.P., Gupa, S.R., Sarma Y.R., Jackson, G.V.H., 2002. Diseases of ginger and their control with Trichoderma harzianum. Indian Phytophathol. 55, 173-177. Rakesh, K.N., Dileep, N., Noor Nawaz, A.S., Junaid, S. 2013. Antifungal activity of cow urine against fungal pathogens causing rhizome rot of ginger. Environ. Ecol. 31, 1241-1244 Ram, D., Mathur, K., Lodha, B.C., Webster, J., 2000. Evaluation of resident biocontrol agents as seed treatments against ginger rhizome rot. Indian Phytopathol. 53(4), 450-454. Ramakrishnan, T.S., 1949. The occurrence of Pythium vexans de Bary in South India. Indian Phytopathol. 2, 27-30. Rames, E.K., Smith, M.K., Hamill, S.D., De Faveri, J., 2013. Mircrobial indicators related to yield and disease and changes in soil microbial community structure with ginger farm management practices. Australas. Plant Pathol. 42, 685-692. Rands, R.D., Dopp, E., 1938. Pythium root rot of sugarcane. USDA Tech. Bul. 666, 1-96. Rathore, V.R.S., Mathur, K., Lodha, B.C., 1992. Acitivty of volatile and non-volatile substrances produced by Trichoderma viride on ginger rhizome rot pathogens. Indian Phytopathol. 45, 253-254.

136

References

Rey, P., Le Floch, G., Benhamou, N., Salerno, M.-I., Thuillier, E., Tirilly, Y., 2005. Interactions between the mycoparasite Pythium oligandrum and two types of sclerotia of plant pathogenic fungi. Mycol. Res. 109, 779-788. Ribeiro, W.R.C., Butler, E.E., 1995. Comparison of the mycoparasites Pythium periplocum, Pythium acanthicum and Pythium oligandrum. Mycol. Res. 99, 963-968. Robertson, G.I, 1980. The genus Pythium in New Zealand. New Zeal. J. Bot. 18 (1), 73-102 Robideau, G.P., Gachon, C.M.M., Hu, C.-H., Küpper, F.C., Rintoul, T.L., Sarhan, E., Verstappen, E.C.P., Zhang, Y., Bonants, P.J.M., Ristaino, J.B., Lévesque, C.A., De Cock, A.W.A.M., Coffey, M.D., Voglmayr, H., Brouwer, H., Bala, K., Chitty, D.W., Désaulniers, N., Eggertson, Q.A., 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol. Ecol. Resour. 11, 1002-1011. Sagar, S.D., Kulkarni, S., Hegde, Y.R., 2009. Molecular variability in Pythium aphanidermatum causing rhizome rot of ginger. Indian Phytopathol. 62, 217-222. Samejima, N., Ichitani, T., 1988. Behaviors of Pythium butleri and P. zingiberum in and around cucumber stem segments buried in recolonized autoclaved soil. Ann. Phytopathol. Soc. Japan 54, 15-19. Sánchez, J., Sánchez-Cara, J., Gallego, E., 2000. Suitability of ten plant baits for the rapid detection of pathogenic Pythium species in hydroponic crops. Eur. J. Plant Pathol. 106, 209-214. Sarma, Y.R., 1994. Rhizome rot of ginger and tumeric, In: Chadha, K.L., Rethium, P. (Eds.), Advances in Horticulture. Malhotra Publisher, New Delhi. Sasikumar, B., Zachariah, J.T., Shamina, A., 2000. Characterisation of ginger germplasm based on isozyme polymorphism., In: Kumar, M.N.a.R.R. (Ed.), Recent Advances in Plants. Crops. Res. Allied Publishers, New Delhi, pp. 251-255. Schenk, A., 1859. Algologische Mittheilungen 5. Verh. phys. med. Ges. Würzburg 9, 12-31. Schroeder, K., Martin, F.N., de Cock, A., Lévesque, C.A., Spies, C., Okubara, P., Paulitz, T.C., 2013. Molecular detection and quantification of Pythium species - evolving taxonomy, new tools and challenges. Plant Dis. 97 (1), 1-20 Schroeder, K.L., Okubara, P.A., Tambong, J.T., Lévesque, C.A., Paulitz, T.C., 2006. Identification and quantification of pathogenic Pythium spp. from soils in Eastern Washington using real- time polymerase chain reaction. Phytopathology 96, 637-647. Schroeder, K.L., Paulitz, T.C., 2006. Quantification of Pythium species in soils from dryland cereal- based cropping systems using real-time PCR. Phytopathology 96, S105-S105. Senapati, A.K., Sugata, G., 2005. Screening of ginger varieties against rhizome rot disease complex in eastern ghat high land zone of Orissa. Indian Phytopathol. 58, 437-439.

137

References

Shahare, K.C., Asthana, R.P., 1962. Rhizome rot of ginger and its control. Indian Phytopathol. 15, 77-78. Shaista, J.K., Fatima, A., Zaidi, N., Ejaz, N., 2010. Effect of different stabilizers on the antibacterial activity of "ginger garlic paste". J. Appl. Sci. Envir. Manage. 13, 103-109. Shanmugam, V., Dohroo, N.P., Gupta, M., Gangta, V., Dohroo, A., 2010. First report of Pythium splendens on ginger. J. Plant Pathol. 92, S109. Shanmugam, V., Gupta, S., Dohroo, N.P., 2013. Selection of a compatible biocontrol strain mixture based on co-cultivation to control rhizome rot of ginger. Crop Prot. 43, 119-127. Sharma, B.R., Dutta, S., Roy, S., Debnath, A., De Roy, M., 2010. The effects of soil physico- chemical properties on rhizome rot and wilt disease complex incidence of ginger under hill agro-climatic region of West Bengal. Plant Pathol. J. 26(2), 198-202. Sharma, N.D., Jain, A.C., 1977. A check-list and selected bibliography of ginger diseases of the world. Trop. Pest Manage. 23, 474-481. Shukla, Y., Singh, M., 2007. Cancer preventive properties of ginger: A brief review. Food Chem. Toxicol. 45, 683-690. Sigobodhla, T.E., Dimbi, S., Masuka, A.J., 2010. First report of Pythium myriotylum causing root and stem rot on tobacco in Zimbabwe. Plant Dis. 94, 1067-1067. Silva-Rojas, H.V., Creswell, T.C., Phillips, J.L., Abad, J.A., Abad, Z.G., 2004. Two putative new species of Pythiogeton associated with cypress and English Ivy in North Carolina. Phytopathology 94, S95-S96. Singh, A.K., 2011. Management of rhizome rot caused by Pythium, Fusarium and Ralstonia spp. in ginger (Zingiber officinale) under natural field conditions. Indian J. Agr. Sci. 81, 268-270. Singletary, K., 2010. Ginger. Nutr. Today 45, 171. Smith, M., Abbas, R., 2011. Controlling Pythium and Associated Pests in Ginger., RIRDC Publication No. 11/128, Canberra. Smith, M.K., Smith, J.P., Stirling, G.R., 2011. Integration of minimum tillage, crop rotation and organic amendments into a ginger farming system: Impacts on yield and soilborne diseases. Soil Till. Res. 114, 108-116. Song, H., Buhay, J.E., Whiting, M.F., Crandall, K.A., 2008. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. PNAS 105, 13486-13491. Sonko, R., Njue, E., Ssebuliba, J.M., Jager, A.d., 2005. The Horticultural sector in Uganda., in: Assche, I.J.V. (Ed.), Scripta Horticulturae. International Society for Horticultural Science, Belgium.

138

References

Southern, J.W., 1976. Comparative pathogenicity of Pythium myriotylum and P. irregulare to the soybean cultivar bragg. Phytopathology 66, 1380. Sparrow, F.K., 1932. Observations on the aquatic fungi of Cold Spring Habor. Mycologia 24, 268- 303. Spies, C.F.J., Mazzola, M., Botha, W.J., Langenhoven, S.D., Mostert, L., McLeod, A., 2011a. Molecular analyses of Pythium irregulare isolates from grapevines in South Africa suggest a single variable species. Fungal Biol. 115, 1210-1224. Spies, C.F.J., Mazzola, M., McLeod, A., 2011b. Characterisation and detection of Pythium and Phytophthora species associated with grapevines in South Africa. Eur. J. Plant Pathol. 131, 103-119. Spies, C.F.J., Meitz-Hopkins, J.C., Langenhoven, S.D., Pretorius, M.C., McLeod, A., 2014. Two clonal lineages of Phytophthora citrophthora from citrus in South Africa represent a single phylogenetic species. Mycologia 106, 1106-1118. Stanghellini, M.E., 1971. The sporangium of Pythium ultimum as a survival structure in soil. Phytopathology 61, 157. Stanghellini, M.E., Kronland, W.C., 1985. Bioassay for quantification of Pythium aphanidermatum in soil. Phytopathology 75, 1242-1245. Stanghellini, M.E., Mohammadi, M., Förster, H., Adaskaveg, J.E., 2014. Pythium brassicum sp. nov.: a novel plant family-specific root pathogen. Plant Disease 98, 1619-1625. Stirling, A.M., 2002. Erwinia chrysanthemi, the cause of soft rot in ginger (Zingiber officinale) in Australia. Australas. Plant Pathol. 31, 419-420. Stirling, A.M., 2004. The causes of poor establishment of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol. 33, 203-210. Stirling, G.R., Eden, L.M., Ashley, M.G., 2004. Sudden wilt of capsicum in tropical and subtropical Australia: a severe form of Pythium root rot exacerbated by high soil temperatures. Australas. Plant Pathol. 33, 357-366. Stirling, G.R., Smith, J.P., Hamill, S.D., Smith, M.K., 2010. Identifying and developing soils that are suppressive to Pythium rhizome rot of ginger, in: Sterling, G.R. (Ed.), Proceedings of the sixth Australasian soilborne diseases symposium., Twin Waters, Queensland, p. 89. Stirling, G.R., Smith, M.K., Smith, J.P., Stirling, A.M., Hamill, S.D., 2012. Organic inputs, tillage and rotation practices influence soil health and suppressiveness to soilborne pests and pathogens of ginger. Australas. Plant Pathol. 41, 99-112. Stirling, G.R., Turaganivalu, U., Stirling, A.M., Lomavatu, M.F., Smith, M.K., 2009. Rhizome rot of ginger (Zingiber officinale) caused by Pythium myriotylum in Fiji and Australia. Australas. Plant Pathol. 38, 453-460. 139

References

Stoilova, I., Krastanov, A., Stoyanova, A., Denev, P., Gargova, S., 2007. Antioxidant activity of a ginger extract (Zingiber officinale). Food Chem. 102, 764-770. Suffert, F., Guibert, M., 2007. The ecology of a Pythium community in relation to the epidemiology of carrot cavity spot. Appl. Soil Ecol. 35, 488-501. Suryanarayana, V., Pant, R.P., 2008. Mosaic and veinal fleck on ginger in Karnataka - A viral disease associated with isometric particles. Indian J. Virol. 19, 124-124. Takahashi, M., 1954a. On the morphology and taxonomy of some species of the genus Pythium which causes crop diseases. Ann. Phytopathol. Soc. Japan 18, 113-118. Takahashi, M., 1954b. Pythium zingiberum causing rhizome rot of ginger plant an its distribution. Ann. Phytopathol. Soc. Japan 18, 435-441. Takenaka, S., Ishikawa, S., 2013. Biocontrol of sugar beet seedling and taproot diseases caused by Aphanomyces cochlioides by Pythium oligandrum treatments before transplanting. Japan Agricul. Res. Quart. 47, 75-83. Takenaka, S., Sekiguchi, H., Nakaho, K., Tojo, M., Masunaka, A., Takahashi, H., 2008. Colonization of Pythium oligandrum in the tomato rhizosphere for biological control of bacterial wilt disease analyzed by real-time PCR and confocal laser-scanning microscopy. Phytopathology 98, 187-195. Tambong, J.T., Poppe, J., Höfte, M., 1999. Pathogenicity, electrophoretic characterisation and in planta detection of the cocoyam root rot disease pathogen, Pythium myriotylum. Eur. J. Plant Pathol. 105, 597-607. Tanina, K., Tojo, M., Date, H., Nasu, H., Kasuyama, S., 2004. Pythium rot of chingensai (Brassica campestris L. chinensis group) caused by Pythium ultimum var. ultimum and Pythium aphanidermatum. J. Gen. Plant Pathol. 70, 188-191. Tao, Y., Zeng, F., Ho, H., Wei, J., Wu, Y., Yang, L., He, Y., 2011. Pythium vexans causing stem rot of Dendrobium in Yunnan province, China. J. Phytopathol. 159, 255-259. Teakle, D.S., 1960. Species of Pythium in Queensland. Queensland J. Agr. Sci. 17, 15-31. Teakle, D.S., 1962. Investigation on the genus Pythium in Queensland. Master thesis of Agricultural Science. The University of Queensland. Thomas, K.M., 1938. Detailed Administration Report of the Government Mycologist., Madras for the year 1937-1938, p. 21. Tojo, M., Kuroda, K., Suzuki, H., 2004. First report of stem rot of Guiana chestnut (Pachira aquatica) caused by Pythium splendens. Plant Dis. 88, 84-84. Tojo, M., Nakazono, E., Tsushima, S., Morikawa, T., Matsumoto, N., 1998. Characterization of two morphological groups of isolates of Pythium ultimum var. ultimum in a vegetable field. Mycoscience 39, 135-144. 140

References

Tojo, M., Ono, H., Nakashima, C., Yoneyama, S., Jayakody, J.A.S., 2005. First report of root rot of cocoyam caused by Pythium myriotylum in Sri Lanka. Plant Dis. 89, 1132-1132. Tomioka, K., Takehara, T., Osaki, H., Sekiguchi, H., Nomiyama, K., Kageyama, K., 2013. Damping-off of soybean caused by Pythium myriotylum in Japan. J. Gen. Plant Pathol. 79, 162-164. Trujillo, E.E., 1964. Disease of ginger (Zingiber officinale) in Hawaii. Circular Hawaii Agricultural Expirment Station, University of Hawaii. Tsai, Y.P., 1991. List of Plant disease in Taiwan. The plant protection society of the republic of China and the Phytopathological society of the Republic of China, Taichung, Taiwan. Tsao, P.H., Ocana, G., 1969. Selective isolation of species of Phytophthora from natural soils on an improved antibiotic medium. Nature 223, 636-638. Tsror, L., Hazanovsky, M., Mordechai‐Lebiush, S., Ben‐David, T., Dori, I., Matan, E., 2004. Root rot and wilt of Kangaroo paw (Anigozanthos manglesii) caused by Pythium myriotylum (Drechs.) in Israel. J. Phytopathol. 152, 114-117. Tyler, B.M., Tripathy, S., Zhang, X., Dehal, P., Jiang, R.H., Aerts, A., Arredondo, F.D., Baxter, L., Bensasson, D., Beynon, J.L., 2006. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313, 1261-1266. Tzean, S.S., Estey, R.H., 1981. Species of Phytophthora and Pythium as nematode-destroying fungi. J. Nematol. 13, 160-163. Urrea, K.E., Rupe, J.C., Rothrock, C.S., Steger, A.J., Anders, M.M, Rojas, A.J., Chilvers, M.I., 2013. Effect of crop rotation on Pythium spp. population composition in Arkansas soybean fields. Phytopathology 103, 150-151. Uzuhashi, S., Tojo, M., Kakishima, M., 2010. Phylogeny of the genus Pythium and description of new genera. Mycoscience 51, 337-365. Vallance, J., Déniel, F., Barbier, G., Guerin-Dubrana, L., Benhamou, N., Rey, P., 2012. Influence of Pythium oligandrum on the bacterial communities that colonize the nutrient solutions and the rhizosphere of tomato plants. Can. J. Microbiol. 58, 1124-1134. Vallance, J., Le Floch, G., Déniel, F., Barbier, G., Lévesque, C.A., Rey, P., 2009. Influence of Pythium oligandrum biocontrol on fungal and oomycete population dynamics in the rhizosphere. Appl. Environ. Microbiol. 75, 4790-4800. Vasala, P.A., 2010. Ginger, In: Peter, K.V. (Ed.), Handbook of herbs and spices. Woodhead Publishing, pp. 195-206. Vasseur, V., Rey, P., Bellanger, E., Brygoo, Y., Tirilly, Y., 2005. Molecular characterization of Pythium group F isolates by ribosomal- and intermicrosatellite-DNA regions analysis. Eur. J. Plant Pathol. 112, 301-310. 141

References

Villa, N.O., Kageyama, K., Asano, T., Suga, H., 2006. Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-Tubulin gene sequences. Mycologia 98, 410-422. Voglmayr, H., Bonner, L.J., Dick, M.W., 1999. Taxonomy and oogonial ultrastructure of a new aero-aquatic peronosporomycete, Medusoides gen. nov. (Pythiogetonaceae fam. nov.). Mycol. Res. 103, 591-606. Voravuthikunchai, S.P., Limsuwan, S., Supapol, O., Subhadhirasakul, S., 2006. Antibacterial activity of extracts from family zingiberaceae against foodborne pathogens. J. Food Safety 26, 325-334. Wahyuni, S., Xu, D.H., Bermawie, N., Tsunematsu, H., Ban, T., 2003. Genetic relationships among ginger accessions based on AFLP marker. J. Bioteknologi Pertanian 8, 60-68. Wang, P.H., Chang, C.W., 2003. Detection of the low-germination-rate resting oospores of Pythium myriotylum from soil by PCR. Lett. Appl. Microbiol. 36, 157-161. Wang, P.H., Chung, C.Y., Lin, Y.S., Yeh, Y., 2003. Use of polymerase chain reaction to detect the soft rot pathogen, Pythium myriotylum, in infected ginger rhizomes. Lett. Appl. Microbiol. 36, 116-120. Wang, P.H., White, J.G., 1997. Molecular characterization of Pythium species based on RFLP analysis of the internal transcribed spacer region of ribosomal DNA. Physiol. Mol. Plant P. 51, 129-129. Ward, E., Foster, S.J., Fraaije, B.A., Mccartney, H.A., 2004. Plant pathogen diagnostics: immunological and nucleic acid-based approaches. Ann. Appl. Biol. 145, 1-16. Watanabe, G.M., 1974. Fungi isolated from the underground parts of sugar cane in relation to the poor ratooning in Taiwan. (2) Pythium and Pythiogeton. Tran. Mycol. Soc. Jap. 15, 343-357. Watanabe, H., Kageyama, K., Taguchi, Y., Horinouchi, H., Hyakumachi, M., 2008. Bait method to detect Pythium species that grow at high temperatures in hydroponic solutions. J. Gen. Plant Pathol. 74, 417-424. Watanabe, H., Taguchi, Y., Hyakumachi, M., Kageyama, K., 2007. Pythium and Phytophthora species associated with root and stem rots of kalanchoe. J. Gen. Plant Pathol. 73, 81-88. Watanabe, T., 1984. Detection and quantitative estimations of Pythium aphanidermatum in soil with cucumber seeds as a baiting substrate. Plant Dis. 68, 697. Watanabe, T., 2010. Pictorial atlas of soil and seed fungi: morphologies of cultured fungi and key to species. CRC Press/Taylor & Francis, Boca Raton. Webster, J., Weber, R., 2007. Introduction to fungi. Cambridge University Press, Cambridge, UK. Weiland, J.E., 2011. Influence of isolation method on recovery of Pythium species from forest nursery soils in Oregon and Washington. Plant Dis. 95, 547-553.

142

References

Whipps, J.M., 1987. Effect of media on growth and interactions between a range of soil-borne glasshouse pathogens and antagonistic fungi. New Phytol. 107, 127-142. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal rna genes for phylogenetics, In: Innis M. A., G.D.H., Sninsky J. J. And White T. J. (Ed.), PCR Protocols: A guide to methods and applications. Academic Press, Inc. , California, pp. 315-322. Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V., 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531- 6535. Wright, H., 2011. Ginger: pungent, yet soothing to the stomach. (EN on Foods). Envir. Nutr. 34, 8. Yabing, D., Yang, Y., Wang, Y., Pan, X., Wu, J., Cai, Y., Li, T., Zhao, D., Wang, J., Zhou, M., 2015. Loop-mediated isothermal amplification for the rapid detection of the F200Y mutant genotype of carbendazim-resistant isolates of Sclerotinia sclerotiorum. Plant Dis. http://dx.doi.org/10.1094/PDIS-10-15-1185-RE Yacoub, A., Gerbore, J., Magnin, N., Chambon, P., Dufour, M.C., Corio-Costet, M.F., Guyoneaud, R., Rey, P., 2016. Ability of Pythium oligandrum strains to protect Vitis vinifera L., by inducing plant resistance against Phaeomoniella chlamydospora, a pathogen involved in Esca, a grapevine trunk disease. Biol. Control 92, 7-16. Yang, K.D., Kim, H.M., Lee, W.H., So, I.Y., 1988. Studies on rhizome rot of ginger caused by Fuzarium oxysporum f. sp. zingiberi and Pythium zingiberum. Korean J. Plant Pathol. 4, 271- 277. Yuan, J., Feng, K., Qi, J., Zhang, B., Li, L., Li, C., Qu, Z., 2011. Efficacy of Bacillaceae and Bacillus against ginger rhizome Pythium rot., in: Reddy, M.S., Wang, Q. (Eds.), 2nd Asian plant growht-promoting rhizobacteria (PCPR) for sustainable agriuculture, Beijing, China. Yuan, J.D., Zhang, Y.L., Qi, J.S., Zhang, B., Xu, Z.T., Li, L., Li, C.S., 2013. Pathogen identification of ginger stalk rot from Shandong province. Acta Phytopath. Sin. 43, S525. Yuen, G.Y., Xia, J.Q., Sutula, C.L., 1998. A sensitive ELISA for Pythium ultimum using polyclonal and species-specific monoclonal antibodies. Plant Dis. 82, 1029-1032. Zachariah, T.J., 2008. Ginger, In: Parthasarathy, V.A., Chempakam, B., Zachariah, T.J. (Eds.), Chemistry of Spices. CABI, Wallingford, UK, pp. 70-96. Zebrowska, E., 1976. Nikoflora kilku zbiornikow wodnych Puszczy Kampinoskiej. Acta Mycol. 12, 77-89. Zhang, B.Q., Yang, X.B., 2000. Pathogenicity of Pythium populations from corn-soybean rotation fields. Plant Dis. 84, 94-99. Zitnick-Anderson, K.K., Nelson, B.D., 2014. Identification and pathogenicity of Pythium on soybean in North Dakota. Plant Dis. 99, 31-38. 143

Appendix

Appendix 1

Fig A1: A maximum likelihood tree showing phylogenetic relationships among Pythium spp. and the outgroup Ph. sojae using combined DNA sequences of certain nuclear and mitochondrial genes

(length above 25.800 bp). The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are displayed). All sequence data of P. myriotylum and P. zingiberis were retrieved from whole genome data in this study.

Sequences of other Pythium spp. and Ph. sojae were from genome data deposited in Genbank.

Sequences for some genes in P. aphanidermatum, P. arrhenomanes, and P. iwayamai were not available and thus were treated as missing data in the sequence alignment and the tree construction.

144

Appendix

Appendix 2

Fig A2: A maximum likelihood tree showed phylogenetic relationships among Pythium species using DNA sequences encoded from CoxII gene The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are displayed).

145

Appendix

Appendix 3

Fig A3: A maximum likelihood tree showed phylogenetic relationships among Pythium species using DNA sequences encoded from CoxI gene The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications) (only bootstrap values

greater than 50% are displayed).

146

Appendix

Appendix 4

Fig A4: A maximum likelihood tree showed phylogenetic relationships among Pythium species using DNA sequences encoded from β-tubulin gene The numbers at the nodes are the percentage of the trees from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are displayed).

147