US 20140059722A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0059722 A1 Krichevsky (43) Pub. Date: Feb. 27, 2014

(54) BIOSENSORS Publication Classification (71) Applicant: Bioglow LLC, St. Louis, MO (US) (51) Int. Cl. CI2N 5/82 (2006.01) (72) Inventor: Alexander Krichevsky, St. Louis,MO CI2O I/68 (2006.01) (US) (52) U.S. Cl. CPC ...... CI2N 15/8214 (2013.01); C12O 1/6897 (73) Assignee: Bioglow LLC, St. Louis, MO (US) (2013.01) USPC ...... 800/317:435/419; 435/252.3:435/468; (21) Appl. No.: 13/894,043 8OO/298 (57) ABSTRACT (22) Filed: May 14, 2013 Real-time monitoring of plant or environmental conditions is O O solved by Autoluminescent Phytosensor Plants (ALPS) dis Related U.S. Application Data closed herein that emit light in response to a specified stimu (60) Provisional application No. 61/647.323, filed on May lus or condition, which light emission is detected or measured 15, 2012. by a sensor.

PASTD

Plastic Genone

NUCLEUS LUX operon -D T7 RNA polymerase AYMANMemmoothamomomom Inducible sequence 7 promoter Promoter

T7 RNA polymerase mRNA CYTOSOL

Transit peptide-> 7 RNA polymerase protein Patent Application Publication Feb. 27, 2014 Sheet 1 of 10 US 2014/0059722 A1

sn=TonNL

uojadoXnT ?uuou39p??Seld |eun61-I THOSO.LAO Patent Application Publication Feb. 27, 2014 Sheet 2 of 10 US 2014/0059722 A1

STEIT(OTN)

yxn-1 quinqns

THOSO.LASO Zeun61-I | Patent Application Publication Feb. 27, 2014 Sheet 3 of 10 US 2014/0059722 A1

queIddoÁ??uu?Xoud suosuºspe?oe??e €eun61-I Patent Application Publication Feb. 27, 2014 Sheet 4 of 10 US 2014/0059722 A1

tyeun61 HSDIT XVO Patent Application Publication Feb. 27, 2014 Sheet 5 of 10 US 2014/0059722 A1

Patent Application Publication Feb. 27, 2014 Sheet 6 of 10 US 2014/0059722 A1

SO Xn-1Vuouedo

uoluadoXn-1 -9eun61-I---

8 Patent Application Publication Feb. 27, 2014 Sheet 7 of 10 US 2014/0059722 A1

sque?ue^Áue|duaxeIeuo???ppy

Patent Application Publication Feb. 27, 2014 Sheet 8 of 10 US 2014/0059722 A1

8

eun61-I Patent Application Publication Feb. 27, 2014 Sheet 9 of 10 US 2014/0059722 A1

o O O O X o -

Patent Application Publication Feb. 27, 2014 Sheet 10 of 10 US 2014/0059722 A1

od-Iqd

OLeun61-I US 2014/0059722 A1 Feb. 27, 2014

BOSENSORS genome, nor does it provide Suitable methods or vectors to integrate the LUX operon into plastidal genomes. Further 1.O BACKGROUND OF THE INVENTION more, it does not contemplate indirect luciferase pathway 0001. 1.1 Field of the Invention activation in plants (e.g., genetic relay assay as in PCT/US10/ 0002 Present invention relates to the field of biosensors. 253.66, etc.), thereby describing a different type of transgenic 0003) 1.2. Description of Related Art plants, as well as failing to provide for monitoring or Survey 0004 Commercial agriculture depends on monitoring of methods. Similarly, U.S. Pat. No. 7,049,483 contemplates various plant parameters, such as hydration, disease, ripe introduction of jellyfish luciferase and its substrate, ness, pest invasion, temperature, adequacy of nutrients, and coelenterazine, biosynthesis machinery into a plant to gener other conditions to achieve Successful yields. Since the begin ate bioluminescent plants. However, it does not contemplate ning of agriculture, farmers relied primarily on their intuition expression the jellyfish luciferase pathway from plastid and observation in assessing crop and field conditions. In genomes, does not provide for Suitable methods or vectors to recent decades, growers increasingly utilize various devices, integrate these genes into plastidal genomes, and does not including computerized systems, containing an assortment of contemplate indirect luciferase pathway activation in plants. sensing capabilities to more precisely follow plant, field, and Finally, this reference does not contemplate the use of biolu greenhouse conditions (Wolf, B. (1996) Diagnostic Tech minescent plants as phytosensors. nique for Improving Crop Production, Haworth Press, pp. 185-187). These new developments are continuously leading 0012. Therefore, a solid and robust system comprising an to optimization of agricultural production through improved autoluminescent plant phytosensor and a computerized moni planting, water management, and other practices. toring system is needed. The present invention provides for 0005. However, while these new evolving approaches light emitting plants, having light emission machinery inte have substantially enhanced phytomonitoring, the existing grated within their plastidal genome, and a method of moni methods are still cumbersome, imprecise, require complex toring and Surveying light emission thereof in order to utilize and expensive equipment and, in many cases, do not provide these plants as biosensors or phytosensors in agricultural and real-time monitoring of a crops condition. other settings. 0006 An additional challenge of today’s industrialized Society is environmental contamination. Increasing effects of 0013 The presently disclosed autoluminescent phytosen chemicals in the environment and their toxicity to human and sor (ALPS) plants, also referred as ALPS plants’ or simply animal health necessitate monitoring of pollutant levels. as “ALPS', address this need by providing a simple, inexpen Common pollutants, among others, include heavy metals sive, real-time monitoring alternative, Superior to other bio (cadmium, arsenic, mercury, etc), phenolic compounds, etc. sensor Systems. This technology can be widely used and find Environmental analysis is typically carried out in by sampling application in the monitoring of agricultural and horticultural of the Suspected polluted area and later analyzing the samples crops, including ornamentals, and in environmental protec using Sophisticated methods. Such as atomic absorption spec tion. Finally, ALPS can be used in basic plant research to trometry, ion chromatography, etc. These are time consuming monitor different plant parameters in real time and with high and expensive methods, which are not always available or precision. Currently available monitoring systems frequently feasible in practicality. measure indirect parameters (e.g., CO exchange rate (U.S. 0007. Therefore, there is a clear recognized need for an Pat. No. 6,701,665)), while ALPS produce signals directly in improved and robust phytosensing method capable of provid response to specific stimuli (dehydration, pest invasion, etc.). ing reliable real-time information. Moreover, while other reporter systems based on direct cou 0008 U.S. Pat. No. 6,701,665 teaches monitoring of natu pling of protein expression (e.g., GFP) in response to a given ral plant conditions using computerized systems; however, it stimulus have been contemplated, those have been proven to does not disclose transgenic plants, nor does it contemplate be impractical. For example, GFP could not be detected using measurement of active light emission or luminescence from visualization approaches (see Kooshkietal (2003) “Pathogen plants. inducible reporting in transgenic tobacco using a GFP con 0009 US patent application 2005/0114923 suggests uti struct”. Plant Science 165:213-219). ALPS provide for prac lizing expression of plant pigments, such as anthocyanins, tically feasible, real-time and direct response to very specific generally in response to contaminants. However, the applica stimuli. The technology is non-destructive to plants, does not tion describes phenotypcial changes in plants, such as pig require any external Substrates to be sprayed, and can be mentation, and does not relate to detecting plant autolumi remotely sensed. nescence or monitoring of light-emitting plants. The 0014 ALPS based on plastid-integrated light emission application also does not relate to or disclose genetic engi systems is a radically new concept. In the past, attempts to neering of plastids, nor does it disclose computerized moni incorporate complex metabolic pathways into transgenic toring methods. plants have been hampered by various limitations of genetic 0010 Patent applications PCT/US2008/009310, 60/953, engineering technology. Creation of the world's first autolu 337 and PCT/US10/25366 describe incorporation of minescent plant—a living plant organism capable of emitting luciferase and luciferin-related genes into plastids. PCT/US visible light on its own, without the need for any external 10/25366 contemplates a genetic relay assay for induction of chemical or light sources—has been initially reported by us light emission. These documents do not, however, disclose (Krichevsky et al. (2010) “Autoluminescent Plants”. PLoS the use of autoluminescent plants as phytosensors, or con ONE 5(11):e15461). Here, for the first time, we describe the template monitoring methods. use of autoluminescent plants as phytosensors that can be 0011 WO2007136432 contemplates bioluminescent used to monitor plant health, pathogen invasion, environmen plants containing LUX operon genes. However, it does not tal contamination, and other conditions and stimuli affecting disclose the expression of the LUX operon from the plastid plant growth and development. US 2014/0059722 A1 Feb. 27, 2014

2O SUMMARY OF THE INVENTION 0027 4. The autoluminescentphytosensor (ALPS) plant monitoring system of any one of 1-3, wherein said 0015. In one aspect, the present invention discloses the use environmental or plant physiological condition is of autoluminescent phytosensor plants (ALPS), containing Selected from the group consisting of hydration, disease, genetically engineered plastids expressing a fully functional pathogen or pest attack, pollution, nutrient deficiency, luciferase pathway and rendering the plants capable of emit temperature, pollution, ripeness, radiation exposure, ting light. In ALPS, the luciferase pathway is activated as a and senescence. result of a specific stimulus, such as drought, nutrient inad 0028 5. A transgenic plant cell containing a LUX equacy, abnormal temperature, pollution, etc. Light emission operon comprising LUX genes integrated within a plas commences when conditions present or induce Such stimulus, tidal genome therein, and ceases when the stimulus ends. 0029 wherein any or all of said LUX genes are sepa 0016. In another embodiment, the present invention con rated by an intercistronic expression element (IEE) templates methods of monitoring ALPS. The monitoring operably linked thereto, and methods involve the use of aluminescence sensor, preferably 0030 wherein expression of said LUX genes is a photosensor, placed on, in proximity to, or remotely to a enhanced by a heterologous translational leader plant. The sensor-collected data are used to interpret and sequence operably linked to one or more of said LUX monitor environmental conditions or a plant's physiological genes. State. 0.031 6. The transgenic plant cell of 5, wherein a heter 0017. In yet another embodiment, the present invention ologous translational leader sequence is linked to each contemplates a method for designing genetically engineered of said LUX genes. organisms, including but not limited to ALPS, with reduced 0.032 7. The transgenic plant cell of 5 or 6, wherein said regulatory requirements. Deregulation of transgenic plants heterologous translational leader sequence is selected for commercialization is an expensive and time-consuming from the group consisting of a T7g 10 leader sequence, a matter, a process that may take several years and typically canonical bacterial Shine-Dalgarno sequence requires multimillion dollar investment per crop. Equivalent AGGAGG, and an rbcL leader sequence. in-traits transgenic plants can be engineered in many ways, 0033 8. An autoluminescent plant cell, containing plas and the provided method encompasses genetic design of a tids that have an altered size, an altered shape, and/or transgenic organism that will result in reduced regulatory containing an altered number of plastids as compared to burdenas compared to a phenotypically equivalent transgenic an otherwise identical cell containing wild-type plastids. organism. 0034) 9. The autoluminescent plant cell of 8, wherein 0.018. Additional embodiments of the current invention light emission by said autoluminescent plant cell is describe methods to modify and enhance plant autolumines increased or decreased. cence, utilize a variety of light emission systems from various 0035) 10. The autoluminescent plant cell of 9, wherein organisms to generate autoluminescent plants, and to geneti said increase or decrease is in a range selected from the cally transform specific varieties of plants. group consisting of from about 0.1-fold to about 100 0019 More particularly, among its various aspects, the fold, from about 1-fold to about 50-fold, and from about present invention includes the following: 5-fold to about 25-fold. 0020) 1. An autoluminescentphytosensor (ALPS) plant 0.036 11. The autoluminescent plant cell of any one of monitoring System, comprising: 8-10, wherein said alteration of plastid size, shape, and/ 0021 (i) a plant containing a complete or partial or number of plastids is due to overexpression or Sup LUX operon integrated within a plastidal genome pression of chloroplast division genes. thereof, wherein expression or activity of said operon 0037 12. A cell, in which a LUX operon and a protein is induced or complemented by a nucleus-integrated exhibiting plastidal accD functionality are coexpressed, factor activated by an environmental or plant physi and wherein said accD is overexpressed. ological condition; 0038 13. The cell of 12, which is a bacterial cell or a 0022 (i) at least one luminescence data detecting plant cell. sensor positioned on, in proximity to, or remotely 0039) 14. The cell of 12 or 13, in which LUX operon from said plant, wherein said sensor detects lumines light output is increased. cence emitted from said plant; 0040 15. The cell of 14, wherein said increase in LUX 0023 (ii) at least one transmitter that receives said operon light output is in the range of from about 0.1-fold luminescence data from said sensor, and to about 1000-fold. 0024 (iii) a communication network that receives 0041 16. A transgenic or transplastomic plant of Petu said luminescence data from said transmitter and con nia cv. 'Perfectunia Blue', Nicotiana Alata cv. 'Whis veys it to a receiver. per Rose Shades', or Nicotiana Sylvestris cv. “Only the 0025 2. The autoluminescentphytosensor (ALPS) Lonely'. plant monitoring system of 1, wherein said plant is 0.042 17. A method of transforming a poinsettia plastid, Selected from the group consisting of an agronomic crop comprising introducing into said plastid an expression plant, a horticultural crop plant, and an ornamental plant. cassette comprising at least one transgene of interest, 0026 3. The autoluminescentphytosensor (ALPS) wherein said expression cassette is flanked by sequences plant monitoring system of 1 or 2, wherein said commu comprising about 100 to about 3,000 contiguous nucle nication network is selected from the group consisting of otides of SEQID NO:3. a telephone network, a cellular telephone network, a 0043. 18. A method of transforming a rose plastid, com computer network, a satellite network, and a combina prising introducing into said plastid an expression cas tion of any of the foregoing. sette comprising at least one transgene of interest, US 2014/0059722 A1 Feb. 27, 2014

wherein said expression cassette is flanked by sequences 0.053 24. An autoluminescentphytosensor (ALPS) comprising about 100 to about 3,000 contiguous nucle plant monitoring system, comprising: otides of SEQID NO:4. 0054 (i) an autoluminescent plant of any one of 0044) 19. A method of transforming a petunia plastid, 21-23, wherein activity of said luciferase pathway is comprising introducing into said plastid an expression induced or complemented by a nucleus-integrated cassette comprising at least one transgene of interest, factor; wherein said expression cassette is flanked by sequences 0055 (ii) at least one luminescence data detecting comprising about 100 to about 3,000 contiguous nucle sensor positioned on, in proximity to, or remotely otides of SEQID NO:5. from said plant, wherein said sensor detects lumines 0045. 20. A plastid transformation vector comprising an cence emitted from said plant; expression cassette, 0056 (iii) at least one transmitter that receives said 0046 wherein said expression cassette comprises luminescence data from said sensor, and luciferase pathway genes arranged in the form of an 0057 (iv) a communication network that receives operon driven by an operably linked, common pro said luminescence data from said transmitter and con moter that drives expression of said luciferase path veys it to a receiver. Way genes: 0.058 25. The autoluminescentphytosensor plant moni 0047 wherein at least one additional promoter is toring system of any one of 1-4, transgenic plant cell of present and operably linked to at least one of said any one of 5-7, plastids of any one of 8-11, cell of any luciferase pathway genes within said operon, and one of claims 12-15, transgenic or transplastomic plant which drives expression of at least one of said of 16, plastid of any one of 17-19, or expression cassette luciferase pathway genes; of 20, comprising LUX nucleotide sequences shown in 0048 wherein said expression cassette is present and SEQID NOS:6-10, operably linked for expression, and functioning within a plastid of a plant cell; and which are expressed. 0049 wherein said plant cell is autoluminescent. 0059 26. The autoluminescentphytosensor plant moni 0050 21. An autoluminescent plant expressing a func toring system of any one of 1-4, transgenic plant cell of tioning luciferase pathway, comprising luciferase and any one of 5-7, plastids of any one of 8-11, cell or one or more luciferin biosynthesis genes integrated in a plastids of any one of 12-15, transgenic or transplas plastid genome, wherein said luciferase pathway is tomic plant of 16, plastid of any one of 17-19, or expres obtainable from Cnidaria (Coelenterates) or Cteno sion cassette of 20, comprising LUX nucleotide phores (e.g., Aequorea Victoria, Periphylla periphylla, sequences shown in SEQID NOs:6-11, operably linked or Renilla reniformis, or Obelia or Mnemiopsis species); for expression, and which are expressed. orders of Coleoptera, Collembola, Hemiptera, Diptera 0060 27. The autoluminescentphytosensor plant moni (e.g., Photinus pyralis, or Arachnocampa luminosa or toring system, transgenic plant cell, plastids or cell, Orfelia fultoni); Dinoflagellata or Radiolaria (e.g., Gon transgenic or transplastomic plant, or expression cas vaulax polvedra or Thalassicolla species); Annelids sette of 25 or 26, further comprising, operably linked for (e.g., Diplocardia longa, Chaetopterus variopedatus, or expression, the LUX nucleotide sequence shown in SEQ Odontosyllis species); Mollusca (e.g., Pholas dactylus, ID NO:12, and which is expressed. Watasenia Scintillans, or Latia species); Crustacea (e.g., 0061) 28. The autoluminescentphytosensor plant moni Vargula hilgendorfii, Cypridina hilgendorfii, or Mega toring system, transgenic plant cell, plastids or cell, nyctiphanes norvegica); Fungi (e.g., Panellus stipticus transgenic or transplastomic plant, or expression cas or Mycena citricolor); Echinodermata (e.g., Ophiopsila sette of any one of 25-27, further comprising, operably Californica); or Diplopoda or Chilopoda (e.g., Lumi linked for expression, the LUX nucleotide sequence nodesmus Sequoiae or Orphaneus brevilabatus). shown in SEQID NO:13, and which is expressed. 0051 22. The autoluminescent plant of 21, wherein said 0062. 29. The plant of any one of 1-4 or 16, further plastid is selected from the group consisting of a pro comprising at least one gene or factor that renders said plastid, an etioplast, a chloroplast, a chromoplast, an plant incapable of sexual reproduction. amyloplast, an elaioplast, a gerontoplast, a leucoplast, 0.063. 30. The plant of 29, comprising LUX nucleotide and a photoheterotrophic plastid. sequences selected from the group consisting of: 0.052 23. An autoluminescent plant, expressing a func 0064 i) LUX nucleotide sequences shown in SEQID tioning luciferase pathway comprising luciferase and NOs:6-10; one or more luciferin biosynthesis genes integrated in a 0065 ii) LUX nucleotide sequences shown in SEQ nuclear genome, wherein said luciferase pathway is ID NOs:6-11; obtainable from Collembola, Hemiptera, Diptera 0.066 iii) LUX nucleotide sequences shown in SEQ (Arachnocampa luminosa or Orfelia filtoni): ID NOS:6-10, and LUX nucleotide sequence SEQID Dinoflagellata or Radiolaria (e.g., Gonyaulax polvedra NO:12: or Thalassicolla species); Annelids (e.g., Diplocardia 0067 iv) LUX nucleotide sequences shown in SEQ longa, Chaetopterus variopedatus, or Odontosyllis spe ID NOS:6-11, and LUX nucleotide sequence SEQID cies); Mollusca (e.g., Pholas dactylus, Watasenia scin NO:12: tillans, or Latia species); Crustacea (e.g., Vargula 0068 v) LUX nucleotide sequences shown in SEQ hilgendorfii, Cypridina hilgendorfii, or Meganyctiph ID NOS:6-10, and LUX nucleotide sequence SEQID anes norvegica); Fungi (e.g., Panellus stipticus or NO:13; Mycena citricolor); Echinodermata (e.g., Ophiopsila 0069 vi) LUX nucleotide sequences shown in SEQ Californica); or Diplopoda or Chilopoda (e.g., Lumi ID NOS:6-11, and LUX nucleotide sequence SEQID nodesmus Sequoiae or Orphaneus brevilabatus). NO:13; US 2014/0059722 A1 Feb. 27, 2014

0070 vii) LUX nucleotide sequences shown in SEQ rhizome, a tuber, a stolon, a corm, a bulb, an offset, a cell ID NOS:6-10, and LUX nucleotide sequences SEQID of said plant in culture, a tissue of said plant in culture, an NOS:12 and 13; and organ of said plant in culture, and a callus. 0071 viii) LUX nucleotide sequences shown in SEQ 0.091 42. A method of producing an autoluminescent ID NOS:6-11, and LUX nucleotide sequence SEQID plant, comprising asexually propagating a cutting of said NOS:12 and 13. plant or progeny of any one of 1-4, 16, or 36-38. 0072. 31. A method of decreasing regulatory require 0092. Further scope of the applicability of the present ments necessary for approval of use of a genetically invention will become apparent from the detailed description engineered organism, comprising producing said and drawings provided below. However, it should be under genetically engineered organism employing two or stood that the detailed description and specific examples, more steps that Substitute or eliminate the use of a patho while indicating preferred embodiments of the invention, are gen, pest, or antibiotic resistance nucleotide sequence in given by way of illustration only since various changes and said genetically engineered organism, or that eliminate modifications within the spirit and scope of the invention will or reduce the use of a pathogen or a pest in generating become apparent to those skilled in the art from this detailed said genetically engineered organism. description. (0073. 32. The method of 31, wherein said genetically engineered organism is a transgenic plant, and said steps 3.O BRIEF DESCRIPTION OF THE DRAWINGS are selected from the group consisting of: 0093. The above and other aspects, features, and advan 0074 i) substituting Agrobacterium-mediated trans tages of the present invention will be better understood from formation with a non-Agrobacterium transformation the following detailed descriptions taken in conjunction with method; the accompanying drawing(s), all of which are given by way 0075 ii) substituting a pathogenic or pest nucleic of illustration only, and are not limitative of the present inven acid sequence with a functionally equivalent non tion, in which: pathogen or non-pest nucleic acid sequence; 0094 FIG. 1: Shows induction of plant autoluminescence 0076 iii) eliminating or removing a selection or anti by means of a Genetic Relay Assay, where an activator (e.g., biotic resistance marker, T7 RNA polymerase. T7RNAP) expression is driven by an 0077 iv) substituting a selection marker with a native inducible promoter in the nucleus. When the inducible pro allele; moter is stimulated, the T7 RNA polymerase protein will be 0078 v) using intragenic or cis-genetic transfer; and transcribed and targeted to a plastid (e.g., a chloroplast) using 0079 vi) using a gene coding for a protein with His an N-terminally fused plastid transit peptide. The LUX genes tory of Safe Use (HOSU) or a familiar protein. in the chloroplast will be driven by the sequence responsive to 0080 33. The method of 32, wherein said non-Agro the activator, e.g., T7 promoter, to which T7 RNA polymerase bacterium transformation method is selected from the binds and thus activates LUX transcription. group consisting of biolistic transformation, whiskers 0.095 FIG. 2: Shows induction of plant autoluminescence mediated transformation, microinjection, PEG-medi by means of the Genetic Reconstitution Assay. A partial LUX ated transformation, and electroporation. operon, devoid one of the genes required for light emission I0081. 34. The method of 32 or 33, wherein iv) com (e.g., LUX A luciferase subunit), is integrated under a con prises substituting a mutant allele of rrn 16 that confers stitutive promoter (e.g., Prrn promoter) into the plastidal spectinomycin resistance for a aadA selection marker. genome. The missing LUX A luciferase subunit is introduced I0082 35. A nucleotide sequence encoding a self-en under the control of a cis-acting element, e.g., an upstream hancing transgene expression loop, comprising: activating sequence (UAS), into the nucleus. The nucleus also I0083) a nucleotide sequence of an inducible pro contains an integrated sequence coding for an activator of the moter, operably linked to a transgene of interest, and cis-aciting element, e.g., mGal4-VP16, driven by an inducible 0084 a nucleotide sequence encoding an inducer that promoter. When the inducible promoter is stimulated, the induces said inducible promoter, operably linked to, mGal4-VP16 protein is produced, imported into the nucleus, and positioned downstream of, said transgene of and activates expression of the LUX A subunit, which in turn interest. is transported into the chloroplast via an N-terminally fused I0085 36. Progeny of said plant of any one of 1-4 or 16. transit peptide. Once LUX A is within the plastid, the fully I0086) 37. The progeny of 36, which are produced sexu functionalluciferase pathway is reconstituted, and light emis ally or asexually. sion commences. I0087 38. The progeny of 37, which are produced asexu 0096 FIG.3: Shows examples of monitoring of plant light ally from cuttings. emission. I0088 39. A part of said plant or progeny of any one of (0097 FIG. 4: Shows unexpected and unorthodox effects 1-4, 16, or 36-38. of various genetic elements on expression of the LUX operon. I0089 40. The part of said plant or progeny of 39, which (A) Addition of 15aa-long TetC DB to LUX A and B subunits is selected from the group consisting of a protoplast, a essentially abolishes light emission, instead of expected cell, a tissue, an organ, a cutting, and an explant. increase. Plated bacterial cultures with and without DBs 0090 41. The part of said plant or progeny of 39, which (LUX+DB and LUX-DB, respectively) are shown. (B) While is selected from the group consisting of an inflorescence, addition of translational leaders would be expected to a flower, a sepal, a petal, a pistil, a Stigma, a style, an enhance light emission in plastids, actual experimental results ovary, an ovule, an embryo, a receptacle, a seed, a fruit, demonstrate that some leaders (e.g., atbBL) cause a decrease a stamen, a filament, an anther, a male or female game in light emission, while others increase light emission (e.g., tophyte, a pollen grain, a meristem, a terminal bud, an T7g1OL). Thus, results of modifications of LUX genes with axillary bud, a leaf, a stem, a root, a tuberous root, a translational leaders cannot be predicted and can only be US 2014/0059722 A1 Feb. 27, 2014 demonstrated experimentally. Shown are typical transplas using pBGL-T7p-LUX-Tobacco vector; (B) Transgenic tomic plants containing LUX genes modified with either atpB plants in high humidity conditions (magenta box) containing or T7g 10 leaders (LUX--atpBL and LUX--T7g 10L, respec LUX operon driven by T7 promoter integrated into plastidal tively) regenerating from callus in tissue culture. Light emis genome and expressing T7RNAP under drought-inducible sion detected using ChemiDoc XRS Molecular Imager, rd29A promoter (left-hand plant, pl.)I-rd29A), silent under inverse images shown. high humidity conditions, as compared to T7RNAP driven by 0098 FIG.5: Shows enhancement of light emission of the constitutive NOS promoter (right-hand plant, pIDI-PC) under LUX operon by co-expression with plastidal accD. (A) Bac the same conditions. Images taken using BioRad Chemidoc terial cultures of E. coli expressing LUX operon with XRS Molecular Imager, inverse image shown. “+accD') or without ("-accD') accD, or control cultures not containing LUX operon or accD (“Control'), were imaged 4.O DETAILED DESCRIPTION OF THE using ChemiDoc XRS Molecular Imager. Upper panel: cul INVENTION ture plates in light; Lower panel: photographic exposure of the plates. (B) accD DNA fragment cloned and co-expressed 0104. The following detailed description of the invention with the LUX operon; marker 1kb NEB (upper panel); sche is provided to aid those skilled in the art in practicing the matic representation of the expression vector containing the present invention. Even so, the following detailed description LUX operon and the plastidal accD (lower panel). should not be construed to unduly limit the present invention, 0099 FIG. 6: Shows options for expressing LUX operon as modifications and variations in the embodiments herein on a single vector in a plastid of a plant cell. (A) LUX genes discussed may be made by those of ordinary skill in the art expressed in the form of an operon; (B) an additional pro without departing from the spirit or scope of the present moter introduced between the LUX genes to enhance tran inventive discovery. scription of the LUX genes. While one additional promoter is 0105. The contents of each of the references discussed in shown, multiple promoters can be used; (C) Genes of the this specification, including the references cited therein, are LUX operon, together constituting a complete and fully func herein incorporated by reference in their entirety. tionalluciferase pathway, expressed from separate promoters on a single vector. 4.1 Autoluminescnet Phytosensor Plants (ALPS) and Related 0100 FIG.7: Shows increasing transgene expression via a Methods self-enhancing transgene expression loop. An activator-in ducible promoter (e.g., T7 promoter) is placed upstream of a 4.1.1 Autoluminescent Plants transgene that requires enhanced expression, followed by an activator (e.g., T7 RNA polymerase) that activates the induc 0106 The term “autonomously luminescent” or “autolu ible promoter. The initial levels of T7RNA polymerase are minescent as used herein refers to a plant or plant cell geneti produced by transcription upstream of the expression cas cally engineered to comprise a fully functional luciferase sette. For example, (A) transcription of the expression cas pathway, rendering the plant or cell capable of emitting light. sette integrated into the Trn I/Trn A region of the chloroplast The transgenic autoluminescent plant, as used herein, genome can be induced by the read-through transcription includes at least one plant cell. A "plant cell refers to any cell from the upstream native Prrn promoter. Once initial copies of of a plant, either taken directly from a seed or plant, orderived the T7RNAP polypeptide are produced, they bind to the T7 through culture from a cell taken from a plant. A plant cell promoter and continue transcribing the expression cassette. includes, for example, cells from undifferentiated tissue (e.g., Additional T7RNAP copies produced enhance the transcrip callus), plant seeds, propagules, gametophytes, sporophytes, tion of the expression cassette even further, and so on and so pollen, microspores, and embryos. forth, thus causing a self-enhancing positive feedback loop. 0107. In one aspect, the present invention relates to a trans Many variants of the self-enhancing transgene expression genic autoluminescent plant based on a bacterial LUX operon loop can be envisioned. In certain embodiments (B.C), pre expressed from a plant plastidal genome. The plant includes a ferred combinations contemplate the use of operator heterologous nucleotide sequence, which includes a bacterial sequences, promoters directly upstream to inducible pro LUX operon, including LUX A LUX B, LUX C, LUX D, moter to produce initial T7RNAP transcripts, and placing LUX E, and LUX G genes, which may or may not contain T7RNAP upstream to T7 promoters. Abbreviations: T7p– additional transgenes. The LUX operon is integrated within a T7 promoter: Term a terminator; T7RNAP T7 RNA poly plastid (e.g., a chloroplast) genome. The LUX operon can be merase; Op—an operator, e.g. LacO: Prrn—Prrn promoter. derived from any luminescent bacterium. Examples of a 0101 FIG. 8: Shows maps of vectors pBGL, pBGL-T7p, nucleotide sequence encoding the full LUX operon is pre and pBGL-T7p-LUX-Tobacco. Abbreviations: T7g10 T7 sented in GenBank under accession numbers AY341062 promoter, aadA-spectinomycin resistance gene; TpsbA (Vibrio fischeri (Vibrio fischeristrain ATCC 7744 lux operon, psbA terminator; Fre—E. coli Fre gene: Trn I and Trn A complete sequence; EU192082 (Vibrio harveyi/ Vibrio har tobacco homologues recombination sequences. veyiBCB440 lux operon, complete sequence); AF403784 0102 FIG. 9: Shows exemplary restriction digest of vec (Photorhabdus luminescens, (formally referred as Xenorhab tors pBGL-T7p and p3GL-T7p-LUX-Tobacco. Bands corre dus luminescens IPhotorhabdus luminescens lux operon, sponding to the promoter, aadA gene, and the terminator are complete sequence); and AB261992 (Shewanellahanedai shown for pBGL-T7p; bands corresponding to the LUX (Shewanellahanedai lux operon (luxC, luxD, luxA, luxB, operon, Trn I, and Trn A sequences are shown for p3LG-T7p luxE, luxG) genes and flanking regions, strain: NCIMB LUX-Tobacco; 1 kb Ladder (NEB) used for standard. 2157); and M63594 (Photobacterium leiognathi, strain (0103 FIG. 10: Shows ALPS plants. (A) Transgenic N. ATCC 25521); and DQ988873 (Photobacterium phospho tabacum plant produced using one of the p) vectors on reum (Photobacterium phosphoreum strain ATCC 11040, genetic background of a transplastomic tobacco plant made complete LUX and RIB operons). US 2014/0059722 A1 Feb. 27, 2014

0108. Other combinations of luciferin/luciferase can pathway, e.g., T7 RNA polymerase (T7RNAP) is integrated potentially be employed to generate autoluminescent plants. into the nuclear genome. When the nucleus integrated induc Genes encoding for luciferase and biosynthesis of corre ible promoter is activated by a certain stimulus (e.g., drought, sponding luciferin can be expressed in the form of synthetic nutrient deficiency, pests, etc.) it commences the expression operons in plant plastids. The term “operon” refers to a nucle of the T7 RNA polymerase expression which, in turn, is otide sequence which codes for a group of genes transcribed localized to the plastid via an N-terminal targeting transit together. The term “gene' refers to chromosomal DNA, plas peptide. Once T7RNAP is within the plastid, it binds to the T7 mid DNA, cDNA, synthetic DNA, or other DNA that encodes promoter and activates expression of the LUX operon, and the a peptide, polypeptide, protein, or RNA molecule, and ALPS commence to glow in response to the stimulus. regions flanking the coding sequence involved in the regula 0113. In yet another embodiment, the luciferase pathway tion of expression. Some genes can be transcribed into mRNA can be activated in response to a stimulus via a genetic recon and translated into polypeptides (structural genes); other stitution assay (FIG. 2). Here, partial LUX operon lacking genes can be transcribed into RNA (e.g., rRNA, tRNA); and one of the genes required for light emission, for example other types of genes function as regulators of expression LUX A Subunit, is integrated under a constitutive promoter (regulator genes). Alternatively, luciferase and luciferin bio into the plastidal genome. While the partial LUX operon is synthesis genes can be expressed as monocistronic units in a expressed in the plastid, light emission does not occur since plant's nucleus. Examples of expressed luciferase/luciferin the luciferase lacks one of its subunits for functionality. The biosynthesis genes include, but are not limited to, luciferase missing LUX A luciferase subunit is introduced under the pathways from Cnidaria (Coelenterates); or Ctenophores control of a cis-acting element, Such as an upstream activating (e.g. Aequorea Victoria, Periphylla periphylla, or Renilla sequence (UAS), into the nucleus. The nucleus also contains reniformis, or Obelia or Mnemiopsis species); or orders of an integrated gene coding for an activator of the cis-aciting Coleoptera, Collembola, Hemiptera, Diptera (e.g. Photinus element, e.g., mGal4-VP16, driven by an inducible promoter. pyralis, or Arachnocampa luminosa or Orfelia fultoni); or When the inducible promoter is activated by a stimulus (e.g., Dinoflagellata or Radiolaria (e.g., Gonyaulax polvedra or drought, nutrient deficiency, pests, etc.), the mGal4-VP16 Thalassicolla species); or Annelids (e.g., Diplocardia longa, protein is produced, imported into the nucleus, and activates or Chaetopterus variopedatus or Odontosyllis species); or expression of LUX A subunit, which in turn is transported Mollusca (e.g. Pholas dactylus, or Watasenia scintillans or into the chloroplast via an N-terminally fused transit peptide Latia species); or Crustacea (e.g. Vargula hilgendorfii, or sequence. Once within the chloroplast, the fully functional Cypridina hilgendorfii, or Meganyctiphanes norvegica); or luciferase pathway is reconstituted and light emission com Fungi (e.g. Panellus stipticus or Mycena citricolor); or Echi CCCS. nodermata (e.g. Ophiopsila Californica); or Diplopoda or 0114 ALPS plants can be based on luminescence systems Chilopoda (e.g. Luminodesmus Sequoiae or Orphaneus other than the LUX operon, such as those derived from biolu brevilabatus). One skilled in the art can further appreciate that minescent pathways of Cnidaria (Coelenterates); or Cteno genes encoding for the luciferase or luciferin biosynthesis phores (e.g. Aequorea Victoria, Periphylla periphylla, or genes can be further optimized for expression in a given Renilla reniformis, or Obelia or Mnemiopsis species); or cellular compartment or environment, and be integrated in orders of Coleoptera, Collembola, Hemiptera, Diptera (e.g. nuclear, plastidal, or mitochondrial genomes, or otherwise Photinus pyralis, or Arachnocampa luminosa or Orfelia full stably expressed in a plant cell. Methods of cloning of corre toni); or Dinoflagellata or Radiolaria (e.g., Gonyaulax poly sponding genes and producing transgenic or transplastomic edra or Thalassicolla species); or Annelids (e.g., Diplocardia plants are known in the art. longa, or Chaetopterus variopedatus or Odontosyllis spe cies); or Mollusca (e.g. Pholas dactylus, or Watasenia scin 4.1.2. Autoluminescet Phytosensor Plants (ALPS) tillans or Latia species); or Crustacea (e.g. Vargula hilgen 0109) Autoluminescent phytosensor plants described dorfii, or Cypridina hilgendorfii, or Meganyctiphanes herein are based on activation of a functional luciferase path norvegica); or Fungi (e.g. Panellus stipticus or Mycena citri way integrated into a plastidal genome as a result of a certain color); or Echinodermata (e.g. Ophiopsila Californica); or stimulus or condition, using inducible sequences described Diplopoda or Chilopoda (e.g. Luminodesmus sequoiae or herein and in the section “Inducible Promoters' below. Orphaneus brevillabatus). If genes of the bioluminescent sys 0110. In one aspect, the invention relates to direct activa tems are expressed in the form of a synthetic operon in plant tion of a plastid-integrated luciferase pathway by a stimulus. plastids, they can be activated indirectly similarly to LUX For example, certain plastidal promoters are known to be operon based ALPS. If those bioluminescent systems are activated by a stimulus, e.g., the light-activated PpsbA pro expressed from the nuclear DNA, they can be activated by moter can drive direct expression of the LUX operon in the being directly driven by an inducible promoter. plastid. Thus, plastid genome-integrated luciferase pathway 4.1.3 Transgenic Organisms and Plants Designed, expression can be activated directly by a stimulus. Engineered, or Contemplated for Decreased Regulatory 0111. In another aspect, the invention relates to indirect Requirements activation of the luciferase pathway in response to a stimulus. Examples of indirect activation include genetic relay and 0115 Deregulation of transgenic plants and other organ genetic reconstitution assays (FIGS. 1 and 2). isms for commercialization is an expensive and time-con 0112. In one embodiment, the genetic relay assay (FIG. 1) Suming matter. Deregulation of a transgenic plant may cost contemplates integration of LUX operon, or any other tens of millions of dollars and take several years to achieve. luciferase pathway, into plastidal genome. Expression of the Reducing deregulation costs of any transgenic organism is LUX operon is driven by an inducible element, e.g., a T7 highly commercially attractive. promoter. Then, a sensory element, such as an inducible pro 0116. A phenotypically/genetically equivalent transgenic moter, driving an activator of the plastid-integrated luciferase plant can be engineered in many ways. Here we claim a US 2014/0059722 A1 Feb. 27, 2014

method comprised of steps intended for engineering of trans the transfer of beneficial genes lost during domestication genic crops, or other organisms, with decreased regulatory from a wild plant into a domesticated variety. These types of requirements. For example, to overexpress gene A in plant X transfers are especially beneficial since they might not require in a plant, one may use the strong viral CaMV35S promoter deregulation at all. and introduction of the expression cassette into the plants 0.122 The method of present invention is applicable to nuclear genome using Agrobacterium-mediated transforma plants, or to other transgenic organisms such as genetically tion. However, overexpression of gene A in plant X can also modified farm animals or commercial varieties of fish. beachieved by using strong plant promoter, such as the Ubiq uitin promoter, and the expression cassette can be introduced 4.1.4 Monitoring and Survey using biolistic bombardment. The first method uses plant pest sequences, while the second method does not, which Subjects I0123. According to one aspect of the present invention, plants made by the first method to much higher regulatory there is provided a system for monitoring of ALPS compris requirements than a plant made by the second method. While ing at least one sensor positioned on a plant, in proximity to a both methods result in a similar plant X overexpressing trans plant (e.g., pivot sprinkler irrigation system), or remotely to a gene A, deregulation of a plant made by the first method will plant (e.g., satellite, drone, or UAV or any other type of be significantly more costly and time consuming as compared aircraft) (FIG. 3), a transmitter, and a communication net to the plant made by the second method. work conveying the sensor-collected data. Examples of com 0117. In the above example, the bombardment method is munication networks can include a telephone network, a cel typically less effective in generating transgenic plants than lular telephone network, a computer network, a satellite using Agrobacterium-mediated transformation. Thus, use of network, or a combination of any two or more of these. a technically less effective method may demonstrate intent to Computerized networks are highly preferable. do so in order to ease deregulation. While solitary steps (e.g., 0.124 One preferred embodiment of the invention use of plant promoters instead of CaMV35S) might be cus includes at least one sensor and at least one transmitter for tomary in certain routine research projects, the claimed transmitting a signal including the data. The invention can method constitutes two or more steps directed towards reduc also include at least one receiver receiving a command signal, ing deregulation of the same transgenic plant. as well as at least one storage device for storing the collected 0118. Although this aspect of the invention is illustrated in data. Yet another embodiment includes a network selected conjunction with an example, it is evident that many alterna from the group consisting of a telephone network, a cellular tives, modifications, and variations of the method will be telephone network, a computer network, a satellite network, apparent to those skilled in the art. Accordingly, any combi and a combination of any of these, and the network may nation of, or use of approaches aimed at easing the deregu integrate wire and/or wireless communication, and may lation burden are deemed to be encompassed by the method. include at least one user client. Some examples of approaches that can constitute steps of the 0.125. In another aspect of the invention, the spectrum of method are demonstrated below. light emission of the luciferase can be modified by methods 0119. One such example can include the use of natural known in the art, e.g., mutagenesis or co-expression of fluo plant alleles instead of selection markers. For example, a rescent proteins. Thus different stimulican initiate light emis natural plant allele comprising a mutation in the Small ribo sion of different wavelengths from the same plant, or from Somal RNA (rm16) gene confers resistance to spectynomicin different plants, which might be advantageous under different and can be used instead of the known selection markeraadA, conditions or for different purposes. thus potentially eliminating the need for marker excision for Successful deregulation of a transgenic crop. Using the native 4.2. Improvements of Autoluminescent Plants Comprising allele instead of a selection marker can be construed as LUXOperon Genes designing a crop for easing deregulation. Another technique that may constitute an indication of the method is selection 4.2.1 Unexpected Characteristics of Functional Genetic marker removal as known in the art. Elements in Enhancement of LUXOperon Light Emission in 0120 In another example, use of genes encoding for Transplastomic Plants “familiar proteins’ can be indicative of the use of the method. 0.126 Various genetic elements, e.g., prokaryotic, eukary “Familiar proteins' are proteins known to have been previ otic, organellal, viral, and others, are known in the art to ously consumed as food or feed, or have track record of safe enhance expression of transgenes. In the case of plastids, the exposure to human or animals, or otherwise have a History of art describes certain elements that can improve transgene Safe Use (HOSU). It is also beneficial to move away from use expression, for example downstream boxes (DBS) and trans of potential pest and microbial genes, and use plant genes to lational leaders. Unexpectedly, the effects of these and other achieve the same phenotypical result. Especially undesirable genetic elements on LUX operon expression in plastids was are DNA sequences designated under 7 CFR 340, or organ found to be completely unpredictable. For example, down isms classified as pathogens (for example, Agrobacterium), stream boxes (e.g., 15C.-long TetC DB (FIG. 4A) or 5C.-long pests (for example, pest plants or other pests) or unknown Ec/DB), known in the art to enhance and improve transgene organisms. Preferred DNA sequences are from organisms expression and thus expected to augment light emission of that are not pests, from plants, from well characterized mate plastid-expressed LUX operon, when fused to LUX A and B rial, and non-coding regulatory regions. The method encom Subunits, have caused a dramatic decrease in light emission. passes engineering or Substitution of undesired sequences Essential abolishment of light emission of the LUX operon with the preferred sequences. containing DB Sequences fused to luciferase Subunits A and 0121. In yet another example of the invention, intragenic B, as compared to constructs without DBS, is contradictory to and cis-genetic transfer of genes from one plant to another as the expected enhancement of light emission. This effect has a safe alternative is contemplated. This includes, for example, been observed in both bacteria and transplastomic plants US 2014/0059722 A1 Feb. 27, 2014 carrying DB-containing LUX transgenes as compared to con the T7g 10 leaders, the expression cassette became genetically trol constructs without DB boxes. Thus, unexpectedly, the unstable, spontaneously losing large pieces of DNA, prevent LUX operon has behaved in an unpredictable and opposing ing generation of autolumniescent plants. manner when use of elements known in the art has been 4.2.2 Autoluminescent Plants with Altered Size, Shape, and/ attempted. or Number of Plastids 0127. In another example, the art teaches that addition of 0.130 Modifications in the expression of chloroplast divi transcriptional leaders is expected to enhance expression and sion genes have been known to produce altered forms of activity of transgenes in plant plastids. Several translational chloroplasts. Particularly, modifications in expression of leaders have been experimentally tested for their ability to plant Min and other chloroplast division-related genes have increase activity of the LUX genes and the results, again, been known to generate macrochloroplasts, where a plant cell were unexpected and diverse. For example, addition of atpB contains a reduced number of abnormally large chloroplasts, leaders to LUX genes expressed in plastids has caused or minichloroplasts, where a plant cell contains a large num reduced light emission, while addition of T7g 10 leaders ber of smaller chloroplasts (e.g. Collettietal, Current Biogloy caused increased light emission (FIG. 4B). Thus, while con (2000), 10:507-16; Reddy et al, Planta (2002), 215:167-76). temporary art suggests that translational leaders should lead Note also U.S. Pat. No. 6,982,364. to enhanced transgene expression, in the case of the LUX 0131 Enlarged chloroplasts (e.g., macrochloroplasts) can operon, the effect can only be established empirically since be instrumental for improvement of chloroplast genetic different types of translational leaders produced different, modification methods, particularly by bombardment, since and opposing, unpredictable effects. they present larger targets for particle penetration. To gener 0128. In yet another example, the effect of the use of ate plants with macrochloroplasts and thus improved trans intercistronic expression elements (IEE) (e.g., Zhou et al. formation capacity, we have overexpressed the tobacco MiniD (2007) “Identification of a plastid intercistronic expression gene (NtMinD, GeneBank EF606850) in transplastomic element (IEE) facilitating the expression of stable translat autoluminescent plants containing plastid-expressed LUX able monocistronic mRNAs from operons. Plant J.; 52(5): operon. NtMinD, driven by the NOS promoter and termina 961-72; 5'-TAGGATCGTTTATTTACAACGGAATGG tor, have been cloned into pCAMBIA 1300 vector and used to TATACAAAGTCAACAGATCTCAA-3' (SEQID NO 1) on produce NtMinD-overexpressing transgenic plants on the expression of LUX genes was not known. In contemporary background of transplastomic autoluminescent plants using art, IEE elements are thought to function by directing RNA Agrobacterium-mediated transformation. cleavage and evidently serving as binding site for pentatri 0.132. The art teaches that in instances of alteration of copeptide repeat (PPR) proteins. While here we provide, by chloroplast shape or size, for example using overexpression way of example only, the use of SEQ ID NO:1, other PPR of Min genes, there is a compensation in chloroplast number, binding sites known in the art can be used in the present and overall cellular plastidal Volume remains constant invention. Extensive experimentation with SEQID NO:1 has (Reddy et al. Planta (2002), 215:167-76). Therefore, light demonstrated that plastid transformation vectors containing output of the NtMiniD overexpressing autoluminescent plants IEE sites introduced between LUX genes, and particularly in was not expected to change. However, unexpectedly, autolu instances where LUX genes of the vectors have been driven minescent plants with altered chloroplast size have exhibited by the classical bacterial Shine-Dalgarno (SD) sequence a notable increase in light emission in tissue-culture regener AGGAGG ribosome binding site, or T7g 10, or the rbcL ating plants as compared to control plants. Similar results of leader sequences, produced transplastomic autoluminescent enhanced light emission have been noticed when other genes plants with Superior light emission properties, multiple fold regulating chloroplast shape and size, including Arabidopsis brighter than the control plants. Particularly preferable com (AtMinD1 At5g24020 and AtMinE1 Atlg69390) and binations of IEE/leader sequences were those where all of the bacterial genes (e.g., E. coli EcMiniD or EcMinC GeneBank LUX operon genes have been separated by the IEE sites, and J03153, translationally fused to rubisco plastid targeting further, the luciferase subunits LUX A and Bhave been driven peptide), have been overexpressed in transplastomic autolu by the T7gL leader and the rest of the LUX genes (C-D-E or minescent plants. One skilled in the art can appreciate that a C-D-E-G) driven by either rbcL or the bacterial SD sequence. variety of genes involved in plastidal division processes (e.g., Transformation vectors in which all of the LUX subunit have FtsZ. ARC, etc.) can be used to generate transgenic plants been separated by IEE sites and driven by either rbcL or with altered chloroplast shape, size, and/or number on the classical SD sequence have also produced enhanced light background of transplastomic autoluminescent plants, thus output as compared to the control plants. However, when the modifying light emission, and the present invention encom GFP gene was preceded by an IEE site at its 5' terminus, passes all Such possibilities. positioned similarly to the IEE preceding the LUX genes, has 4.2.3 Enhancement of LUXOperon Light Output by accD, a been placed in a vector downstream of IEE-containing LUX Subunit of Plant Acetyl-CoA Carboxylase, and by Multiple operon, no GFP expression could be detected in transpl Promoters atomic plants made with the vector. I0133. In plants, overexpression of acetyl-CoA carboxy 0129. This negative result demonstrates that the effect of lase (ACCase) subunit accD (SEQID NO:2) has been known IEE on a specific luminescent or fluorescent gene cannot be to influence fatty acid content in certain plant tissues (Madoka predicted, being dependent on the specific ORF expressed, et al. Plant Cell Physiol. 43(12): 1518-1525 (2002) and position within the operon, and other factors. Thus, the effects JP2001000300038). However, it was not known if accD of IEE on expression in cases of luminescent or fluorescent would have any effect on substrates of the bacterialluciferase, proteins, such as LUX proteins or GFP can only be deter nor if overexpression accD or its co-expression with the LUX mined experimentally, and cannot be anticipated. In yet operon would have any effect on light emission. another instance, in transformation vectors where all of the 0.134 Experimentally, we have discovered that overex LUX subunits have been separated by IEE sites and driven by pression of the plant accDenhances light output of the LUX US 2014/0059722 A1 Feb. 27, 2014 operon. For example, accD co-expressed with the LUX tions in the selective agent or regeneration medium compo operon in bacteria has resulted in cultures several fold sition will yield the same result and the present invention brighter than those lacking accD (FIG. 5A). These results encompasses all such variations. demonstrate that accD can be potent enhancer of LUX operon 0.139. In another embodiment, the present invention mediated light emission. relates to certain plant chloroplast sequences useful for tar 0135) In yet another aspect of the present invention, while geting integration of transgenes into chloroplast genomes. It in the described LUX-operon based autoluminescent plants is beneficial to know the exact sequence of the region of the LUX genes are introduced into a chloroplast genome in the chloroplast genome where a transgene of interest can be form of a single operon driven by a single promoter (FIG. integrated, to be used as targeting sequences in the plastid 6A), the operon can be further split by an additional promoter transformation vector. Homologous recombination sequence to enhance transcription of the downstream genes sequences derived from tobacco are known in the art, and (FIG. 6B), or each gene of the operon can be driven by a those are frequently used as targeting sequences in transfor separate promoter (FIG. 6C), which may further enhance mation vectors to generate transplastomic tobacco plants. transcription of the individual LUX genes and thus generate However, when these sequences are used to generate trans brighter autoluminescent plants. plastomic plants of other species (e.g., tomato or petunia), transformation efficiency is dramatically reduced. Further, it 4.2.4 Transformation of Ornamental Species is well known in the art that the highest plastid transformation 0.136 Transformation of plastids of ornamental plant spe efficiency is achieved when the targeting sequences have full cies can be useful for generation of ornamental phytosensors, or close to 100% homology to the transformed plastidal as well as for new varieties of constitutively glowing orna genome. mental plants. Plastid transformation of certain varieties of 0140 We have therefore sequenced and identified regions Solanaceae species (e.g., tobacco or petunia) have been of the chloroplast genome of poinsettia (SEQID NO:3), rose known in the art. However, it is also known that a great (SEQ ID NO:4), and petunia (SEQ ID NO:5) suitable for variability in regeneration and transformation capacity exists targeting of transgenes. These sequences can be used as between different, frequently very close, cultivars of the same homologous recombination targeting sequences within chlo species. For example, protocols for regeneration and trans roplast transformation vectors for the transformation of poin formation of N. tabacum cv. Samsun and Xanthi are known; settia, rose, or petunia, respectively, and to integrate a variety however, these methodologies are ineffective on N. tabacum of transgenes including, but not limited to, the LUX operon, cv. Wisconsin 38. Similarly, while regeneration and transfor into plastidal genomes of these commercially important orna mation protocols for certain petunia cultivars (e.g., Pink mental species. Wave) are known, our experimental results indicated that these protocols are ineffective on otherpetunia cultivars, e.g., 4.2.5 Altering the Intensity and Qualitative Properties of the cv. Avalanche. Light Emitted by ALPS Enhancing Light Emission by ALPS 0137 Identification of suitable methods and conditions 0.141. A potential limitation of the applicability of LUX for regeneration and transformation of additional cultivars of operon-based technologies, particularly in plants, is low lev ornamental plants is therefore needed to extend the line of els of light emission in plants expressing naturally occurring future transgenic and transplastomic ornamental plant prod LUX genes. ucts. We have experimentally determined that explants of 0142. This problem has been solved by providing several cultivars (i) Petunia cv. “Perfectunia Blue'; (ii) Nicotiana means of enhancing light emission, which is instrumental in Alata cv. 'Whisper Rose Shades'; and (iii) Nicotiana Sylves providing useful, highly autoluminescent phytosensor tris cv. “Only the Lonely can be regenerated and trans (ALPS) plants. formed in tissue culture. Leaf explants of these cultivars have 0143. The present invention encompasses the use of novel been derived from plants grown in sterile magenta boxes, artificial DNA sequences, i.e., SEQID NOS:6-13 and 16-17, transferred to a medium containing MS salts (Caisson), 1 shown in the section entitled "Nucleotide and Amino Acid mg/L BAP, 0.1 mg/L NAA, 1:1000 MS Vitamin Solution Sequences of the Invention, variously encoding for LUX and (Phytotechnology M553),30g/L Sucrose, 7-8 g/L Phytoagar, other polypeptides, useful in enhancing autoluminescence in at pH 5.8, and cultured under a light intensity of 2000 lux plants. These include sequences comprising specific muta and a temperature of 26-28°C. Vigorous plant regeneration tions in the LuxC and LuxE genes that are highly effective in started several weeks after transfer of the leaf explants to the enhancing light emission in an organism, Such as a bacterium medium. Regenerating meristems have been excised and or plant, containing these genes in a mutated LUX operon. transferred to medium containing MS salts (Caisson), 30 g/L Thus, these sequences are useful in all of the plant cells, Sucrose, 7-8 g/L Phytoagar, at pH 5.8 for rooting. Rooted plants, expression cassettes, vectors, methods, etc., disclosed plants can be transferred to Soil and maintained in greenhouse and claimed herein that employ LUX operon sequences, and or other soil conditions. Notably, this protocol did not work the terms “LUX”, “LUX gene”, “LUX operon”, and the like for a large number of other ornamental tobacco or petunia as used herein encompass the use not only of naturally occur cultivars, including Nicotiana Avalon, Nicotiana Perfume ring LUX operon gene sequences, but the following novel Red, Avalanche Petunia, and others. artificial sequences as well. 0138 Nuclear and plastidal DNA of the regenerating cul 0144. These novel artificial DNA sequences are as fol tivars can transformed via methods known in the art (e.g., lows: Agrobacterium-mediated or biolistic transformation), and (0145 SEQID NO:6: artificial LuxA nucleotide sequence: plants can be regenerated using the above described method. 0146 SEQID NO:7: artificial Lux B nucleotide sequence: It was found that 500 mg/L of spectinomycin is particularly 0147 SEQID NO:8: artificial Lux Cnucleotide sequence, effective in regenerating transplastomic plants of these culti incorporating Ala Gly mutation at amino acid position 389; vars. One skilled in the art can appreciate that minor varia 0148 SEQID NO:9: artificial Lux D nucleotide sequence: US 2014/0059722 A1 Feb. 27, 2014

0149 SEQ ID NO:10: artificial Lux E nucleotide 0169. One skilled in the art will recognize that the indi sequence, incorporating Gln Glu mutationatamino acid posi vidual sequences disclosed herein can be used in combina tion 167; tion, as indicated above, in any order, and are independent of 0150 SEQ ID NO:11: artificial Lux G nucleotide one another. Sequence; 0170 As used herein, the phrase “operably linked for 0151 SEQ ID NO:12: artificial E. coli Fre nucleotide expression' and the like encompasses nucleic acid sequences Sequence; linked in the 5' to 3' direction in such a way as to facilitate 0152 SEQID NO:13: artificial V fischeri Yellow Fluores expression of an included nucleotide coding sequence. cent Protein nucleotide sequence; 0153. SEQID NO:14: amino acid sequence of wild-type Altering the Qualitative Properties of Light Emitted by ALPS Photobacterium leiognathi LuxC protein; 0171 The wavelength, and therefore the color, of the 0154 SEQID NO:15: amino acid sequence of wild-type ALPS emitted light can be modified. The color of the light Photobacterium leiognathi LuxE protein; emitted by plant-expressed luciferase can be changed and (O155 SEQ ID NO:16: artificial Lux C nucleotide modified by either of the two following exemplary sequence without Ala Gly mutation at amino acid position approaches: (i) change in luciferase properties using directed 389. Compare to SEQID NO:8: evolution and protein engineering, as is known in the art to 0156 SEQ ID NO:17: artificial Lux E nucleotide change enzymatic properties of different luciferases, or (ii) sequence without Gln Glu mutation at amino acid position coupling expression with an appropriate chromophore or 167. Compare to SEQID NO:10. fluorescent protein. For example, Enhanced Green Fluores 0157 Although not listed above, the present invention also cent Protein (EGFP) has an excitation peak at approx. 490 encompasses the amino acid sequences of the proteins nm, and an emission peak at about 510 nm. Co-expression of encoded by the nucleotide sequences listed. Such amino acid the bacterial luciferase (emitting at approx. 490 nm) with sequences can be deduced by, for example, by conventional EGFP can facilitate a shift of the luminescence peak, e.g., the translation known in the art. EGFP will be excited by luciferase emitted light and the final 0158 More particularly, the present invention employs: plant glow will be at 510 nm. Another example is the LuxY 0159. 1. A nucleic acid construct, comprising the nucle encoded Yellow Fluorescence Protein (YFP) from certain V. otide sequences shown in SEQID NOs: 6-10, operably linked fischeri. The YFP causes a shift in the luminescence of bac for expression. terial luciferase from approx.490 nm to a higher wavelength, (0160 2. A nucleic acid construct, comprising the nucle resulting in the emission of a yellow, rather than a blue-green, otide sequences shown in SEQID NOS:6-11, operably linked light. for expression. 0172. As noted above, artificial sequences SEQID NOs: 0161 3. The nucleic acid construct of 1 or 2, further com 12 and 13, encoding FRE and YFP proteins, respectively, prising, operably linked for expression, the nucleotide further improve light output and change the emitted light sequence shown in SEQID NO:12. color, respectively, of the autoluminescent plants encom 0162 4. The nucleic acid construct of any one of 1-3, passed by the present invention. further comprising, operably linked for expression, the nucle 0173. In one embodiment, the light output improving otide sequence shown in SEQID NO:13. (e.g., FRE) or color altering (e.g., YFP) genes can be 0163 5. The nucleic acid construct of any one of 1-4, expressed from either the chloroplast genome, or alterna which is an expression cassette. tively from the nuclear genome and targeted into chloroplasts 0164 6. An expression vector, comprising the expression using appropriate plastid or chloroplast targeting sequences. cassette of 5. 0.174. In yet another embodiment, the same ALPS can be 0.165. The novel mutations in the structural LUX genes C made to emit different wavelengths of light in response to (encoding an Ala Gly mutation at amino acid position 389 different stimuli. In yet another embodiment, different ALPS (SEQ ID NO: 8)) and E (encoding a Gln Glu mutation at can be made to emit different wavelengths of light in response amino acid position 167 (SEQ ID NO:10)) greatly enhance to the same or different stimuli. The present invention encom light emission of the LUX operon. passes all Such possible combinations, which clearly have a 0166 Artificial sequences SEQID NOS:12 and 13, encod variety of different practical utilities. ing FRE and YFP proteins, respectively, are designed to fur ther improve light output and change the emitted light color, 4.2.6. Self-Enhancing Transgene Expression Loops respectively, of the autoluminescent plants encompassed by (0175 Certain methods to enhance autoluminescence the present invention. using a variety of co-factors, directed evolution/mutagenesis, 0167. These nucleic acid constructs, expression cassettes, and other methods have been described previously by and vectors can be used to enhance autoluminescence in any Krichevsky in Patent applications PCT/US2008/009310, of the plants or methods of the present invention. U.S. 60/953,337, and PCT/US 10/25366. Here, we describe 0168 As indicated above, preferred combinations of the yet another novel approach to enhance gene expression—and artificial sequences disclosed herein include, but are not lim in particular expression of genes involved in autolumines ited to: SEQID NOS:6-10 in combination: SEQID NOS:6-11 cence—using a self-enhancing transgene expression loop. in combination; or further, combination of SEQID NOS:6-10 0176). In one embodiment, this method comprises an in combination or SEQID NOS:6-11 in combination, further expression cassette comprising an inducible promoter, placed in combination with SEQID NO:12; and further, such fore upstream of a transgene, the expression of which needs to be going combinations, further in combination with SEQ ID enhanced, followed by a polymerase or a transcription factor NO:13. In each of these cases, the nucleotide sequences are that activates the inducible promoter (FIG. 7). An example of operably linked for expression, and are expressed. such a promoter/inducer pair is the T7 promoter and T7 RNA US 2014/0059722 A1 Feb. 27, 2014

polymerase (T7RNAP). The initial levels of T7RNAP can be that produce seeds or fruit with a high oil content, e.g., greater induced by an upstream transcription of the expression cas than about 10%. Exemplary oil seed crops or oil crop plants sette integrated within the host genome. For example, tran include, for example, plants of the genus Camelina, coconut, Scription of the expression cassette integrated into the Trn I/ cotton, peanut, rapeseed (canola), safflower, Sesame, Soy Trn A region of a chloroplast genome can be induced by the bean, wheat, flax, Sunflower, olive, corn, palm, Sugarcane, read-through transcription from the upstream native Prrn pro castor bean, Switchgrass, Miscanthus, and Jatropha. moter. Once initial copies of the T7RNAP polypeptide are 0182. A plant cell typically contains a “plastid,” which produced, they bind to the T7 promoter and transcribe the refers to an organelle with its own genetic machinery in a expression cassette. Additional T7RNAP copies produced plant cell. Examples of a plastid include chloroplasts, chro enhance the transcription of the expression cassette even fur moplasts, etioplasts, gerontoplasts, leucoplasts, proplastids, ther, thus forming a self-enhancing loop, and increasing amyloplasts, etc. The plastids of higher plants are an attrac expression of the transgene of interest. tive target for genetic engineering. Plant plastids are major 0177. One skilled in the art will appreciate that multiple biosynthetic centers that, in addition to photosynthesis, may variants of the self-enhancing transgene expression loop can be responsible for production of important compounds Such be contemplated, and these all are encompassed by the as amino acids, complex carbohydrates, fatty acids, and pig present invention. In one example (FIG. 7B), when overex ments. Plastids are derived from a common precursor known pression of a transgene may be lethal, an operator sequence as a proplastid, and thus the plastids present in a given plant (Op) might be placed before the T7RNAP to disable loop species all have the same genetic content. Plant cells may activity until the desired time. Similarly, the operator contain anywhere between 500-10,000 copies of a 120-160 sequence can be placed before the T7 promoter. In another kilobase circular plastidal genome, and can therefore be engi example (FIG. 7B), instead of relying on native upstream neered to contain multiple copies of a particular gene of transcription, an active promoter (such as Prrn) can be imme interest, integrated within the aforementioned plastidal diately upstream to T7p to initiate production of initial genome, which potentially can result in very high levels of T7RNAP. In yet anotherexample (FIG.7C), the T7RNAP can transgene expression. In addition, plastids of most plants are be placed upstream to the T7 promoter. maternally inherited. Consequently, unlike transgenes 0.178 Although this aspect of the invention is illustrated in expressed in the cell nucleus, heterologous genes expressed conjunction with specific embodiments, it is evident that in plastids are not pollen disseminated. Thus, a trait intro many alternatives, modifications, and variations will be duced into a plant plastid will not be transmitted by pollen to apparent to those skilled in the art, which are all encompassed wild-type relatives, thereby preventing undesired transgene by the present invention. escape. 4.3. Description of Certain Invention Elements 4.3.2. Vectors 0179 Although the invention is demonstrated by specific 0183. The term “vector as used herein refers to a vehicle examples provided herein, including descriptions of certain used for introduction of a nucleotide sequence into a host. A elements that may or may not be used in the creation of vector may be a plasmid, cosmid, phage, transposon, virus, or autoluminescent phytosenor plants and methods for monitor any other suitable vehicle known in the art. Preferably, the ing thereof, it is evident that many alternatives, modifications, vector is a plasmid. A vector may include regulatory and variations will be apparent to those skilled in the art. sequences useful for expression of a gene product in a host Exemplary alternatives described herein are intended to be including, but not limited to, a promoter, ribosomal binding encompassed by the appended claims. site, and termination sequences. 0184. In one embodiment, for the transformation of 4.3.1 Plants nuclear host DNA, the vector is a binary vector or another type of nucleus transforming vector. A “binary vector” refers 0180. The term “plant” is used broadly herein to refer to a to a vector that includes a modified T-region from Tiplasmid, eukaryotic organism containing a plastid, and being at any which allows replication in E. coli and in Agrobacterium stage of development. The term “plant as used herein refers cells, and usually includes selection marker genes. Multiple to a whole plant or apart of a plant (e.g., a plant cutting, a plant binary and other plant nucleus transformation vectors are cell, a plant cell culture, a plant organ, a plant seed, and a known in the art. plantlet), a seed, a cell- or a tissue-culture derived from a 0185. In another embodiment, the vector is a plastid (chlo plant, plant organ (e.g., embryos, pollen, ovules, seeds, roplast) transformation vector. Typically, a transgene expres leaves, flowers, branches, fruit, kernels, ears, cobs, husks, sion cassette in a chloroplast transformation vector is flanked stalks, roots, root tips, anthers, etc.). The term “plant” by a “homologous recombination site,” which is a DNA includes any monocot or dicot. The terms “transgenic.” region that is homologous to a region of the genome of a “transformed, and “transfected as used herein include any plastid. The homologous recombination sites (HRs) enable cell, cell line, callus, tissue, plant tissue, or plant into which a site-specific integration of a transgene expression cassette nucleic acid heterologous to the host cell has been introduced. into a plastidal genome by the process of homologous recom 0181 Any plant may be used in the practice of the present bination. Homologous recombination is a process that natu invention. For example, Nicotiana tabacum (tobacco) can be rally occurs in plastids and differs from random transgene used, as it is frequently employed as a model organism in integration into the plant nuclear genome. Multiple plastid plant research, and a large amount of data regarding its biol transformation vectors are known in the art. Similarly, mito ogy has been accumulated. Obviously, also of particular chondrial transformation vectors are encompassed within the importance are commercial agronomic and horticultural food Scope of this invention. and ornamental crops, including Soy, corn, and cotton, and 0186 Heterologous nucleotide sequences can be used in high-value, as well as non-food crops such as oilseed crops the vectors, and include functional elements, which influence US 2014/0059722 A1 Feb. 27, 2014

the generation, multiplication, function, use, or value of the 4.3.4. Inducible Promoters heterologous nucleotide sequence or vector used within the Scope of the present invention. Examples of functional ele 0190. An “inducible' promoter refers to a promoter that is ments include replication origins (ORI), which make possible regulated in response to a stress, a condition, or a stimulus. an amplification of the heterologous nucleotide sequence or Examples of inducible promoters include a tetracycline vector according to the invention in, for example, E. coli or in repressor System, Lac repressor System, copper-inducible plastids; multiple cloning sites (MCSs), which permit and system, salicylate-inducible system (Such as the PR la sys facilitate the insertion of one or more nucleic acid sequences; tem), and an alcohol-inducible system. Further examples homologous recombination sites, allowing stable recombina include inducible promoters that are regulated in response to tion of transgenes into plastid genomes; and border environmental, hormonal, chemical, and/or developmental sequences, which make possible Agrobacterium-mediated stress or stimuli. Such stresses or stimuli include heat (e.g., transfer of the heterologous nucleotide sequence or vector tomato hsp70 promoter or hsp80 promoter); cold: light; into plant cells for the transfer and integration into the plant drought (e.g., Arabidopsis rd29A promoter); hormones. Such genome. Such as, for example, the right or left border of the as abscisic acid; chemicals, such as methyl jasmonate, Sali T-DNA or the vir region, and transcriptional and translational cylic acid; increased Salinity; pathogens (e.g., promoter of the enhancers. Further additional sequences optionally include PRP1 gene); heavy metals (e.g., heavy metal-inducible met RNA processing signals, e.g., introns, which can be posi allothionein I promoter and the promoter controlling expres tioned upstream or downstream, or within a polypeptide sion of the tobacco gene cdiGRP, wounds (e.g., pin II pro encoding sequence in the heterologous nucleotide sequence. moter), and radiation. Intron sequences are known in the art to aid in the expression 0191 In yet another aspect of the invention, in addition to of heterologous nucleotide sequences in plant cells. the naturally occurring inducible promoters, an inducible promoter can be specifically designed to be responsive to a specific stimulus. For example, pathogen inducible promot 4.3.3. Promoters and Terminators ers can be designed and synthetically produced (Raveendra 0187. The heterologous nucleotide sequence or vector G. M., “Designing pathogen-inducible synthetic promoters described herein can include regulatory sequences useful for and functional validation of a new eukaryotic promoter-probe expression of a gene product in a host, such as a promoter. A vector'; Graduate Thesis, Department of Biotechnology, promoter drives expression of an operably linked nucleotide College of Agriculture, Dharwad University of Agricultural sequence. The term “operably linked as used herein refers to Sciences, Dharwad). linkage of a promoter to a nucleotide sequence Such that the (0192 The term “tissue-specific' promoter as used herein promoter mediates transcription of the nucleotide sequence. refers to a promoter that drives expression of an operably A “coding sequence” refers to a nucleotide sequence that linked nucleotide sequence in a particular tissue. A tissue encodes a specific peptide, polypeptide, or proteinamino acid specific promoter drives expression of a gene in one or more sequence. A promoter is typically located upstream (5') to a cell types in a specific organ (such as leaves, or seeds), spe coding sequence. cific tissues (such as embryo or cotyledon), or specific cell 0188 A wide variety of promoters is known in the art and types (such as seed storage cells or leaf parenchyma). can be used to facilitate expression of a gene in the heterolo Examples include the Gentiana triflora promoter for chalcone gous nucleotide sequence. Examples of promoters include synthase (NCBI accession AB005484), a seed-specific pro constitutive promoters, plant tissue-specific promoters, plant moter, Such as the B-conglycinin, napin, and phaseolin pro development-specific promoters, inducible promoters, circa moters; mature leaves-specific promoters, such as the SAG dian rhythm promoters, viral promoters, male germline-spe promoter from Arabidopsis. cific promoters, female germline-specific promoters, flower 0193 Promoters responsible to the circadian rhythm cycle specific promoters, and vegetative shoot apical meristem can also be used in the heterologous nucleotide sequence or specific promoters. Inducible promoters that respond to vector. Such promoters include the native ELF3 promoter and various internal and/or external stimuli affecting plants are the promoter from the chlorophylla/b binding protein (CAB2 particularly useful in the ALPS plants and monitoring sys promoter). tems disclosed herein. 0194 Transgene expression can also be regulated by a terminator sequence. Examples and use of the terminator 0189 A "constitutive' promoter refers to a promoter that sequences are known in the art, and include the psbA photo causes a gene to be expressed in all cell types at all times. An system II reaction center terminator or gene rps 16 terminator example of a constitutive plastid promoter is a 16S rRNA for plastid-expressed genes, Cauliflower Mosaic Virus gene promoter (Prrn). Examples of nuclear genomic consti (CaMV) 35S terminator, or Arabidopsis Heat Shock Protein tutive plant promoters include the cauliflower mosaic virus 18.2 or Ubiquitin 5 (UBQ 5) terminators for nucleus-ex (CaMV) 35S promoter or native plant ubiquitin promoter, pressed transgenes. which confer constitutive, high-level expression in most plant cells; the nopaline synthase promoter, the octopine synthase promoter, cauliflower mosaic virus 19S promoter; rice actin1 4.3.5. Markers and Marker Removal Systems promoter, mannopine synthase promoter, and a histone oran 0.195. In addition, the heterologous nucleotide sequence or actin promoter. Further suitable constitutive promoters vector can include a nucleotide sequence for a selectable include the Rubisco small subunit (SSU) promoter, leguminB and/or screenable marker. A “selection marker” refers to a promoter, TR dual promoter, ubiquitin promoter, and Super protein necessary for Survival or growth of a transformed promoter. Different heterologous nucleotide sequences or plant cell grown in a selective culture regimen. Typical selec vectors can contain different promoters to prevent gene tion markers include sequences that encode proteins, which silencing when several consecutive genes on a chromosome confer resistance to selective agents, such as antibiotics, her are expressed from the same promoter. bicides, or other toxins. Examples of selection markers US 2014/0059722 A1 Feb. 27, 2014 include genes conferring resistance to antibiotics, such as When the luciferase gene is expressed, the targeting sequence spectinomycin, Streptomycin, tetracycline, amplicillin, kana is included in the translated polypeptide. The targeting mycin, G 418, neomycin, bleomycin, hygromycin, methotr sequence then directs the polypeptide into a plastid, such as a exate, dicamba, glufosinate, or glyphosate. chloroplast. 0196. Various other selection markers confer a growth 0202 Typically, the chloroplast targeting sequence related advantage to transformed cells over non-transformed encodes a polypeptide extension (called a chloroplast transit cells. Examples include selection markers for B-glucu peptide (CTP) or transit peptide (TP)). The polypeptide ronidase (in conjunction with, for example, cytokininglucu extension is typically linked to the N-terminus of the heter ronide), mannose-6-phosphate isomerase (in conjunction ologous peptide encoded by the heterologous nucleotide with mannose), and UDP-galactose 4-epimerase (in conjunc Sequence. tion with, for example, galactose). 0203 Examples of a chloroplast targeting sequence 0197) Selection markers include those that confer resis include a sequence that encodes the tobacco ribulose bispho tance to spectinomycin (e.g., encoded by the resistance gene, sphate carboxylase (Rubisco) small subunit (RbcS) transit aadA), Streptomycin, kanamycin, lincomycin, gentamycin, peptide, Arabidopsis thaliana EPSPS chloroplast transit pep hygromycin, methotrexate, bleomycin, phleomycin, blastici tide, the Petunia EPSPS chloroplast transit peptide, and the din, Sulfonamide, phosphinothricin, chlorSulfuron, bromoxy rice rbcS gene chloroplast targeting sequence. nil, glyphosate, 2,4-D, atrazine, 4-methyltryptophan, nitrate, 0204 Further examples of a chloroplast target peptide S-aminoethyl-L-cysteine, lysine? threonine, aminoethyl-cys include the small subunit (SSU) of ribulose-1,5-biphosphate teine or betaine aldehyde. Preferably, the selection marker is carboxylase, and the light harvesting complex protein I and functional in plastids. Preferred are the genes aadA protein II. Incorporation of a suitable chloroplast targeting (GeneBank NC 009838), mptII (GeneBank FM177583), peptide has been shown to target heterologous protein BADH (GeneBank AY050316), aph A-6 (GeneBank sequences to chloroplasts in transgenic plants. Those skilled X07753). Especially preferred selection markers are natu in the art will recognize that various chimeric constructs can rally occurring alleles, such as mutation in the Small riboso be made, if needed, that utilize the functionality of aparticular mal RNA (rm16) gene that confers resistance to spectinomy CTP to import a given gene product into a chloroplast. cin, and which can be used instead of the known selection (0205. Other CTPs that may be useful in practicing the marker aadA, or selection markers with History of Safe Use, present invention include PsRbcS-derived CTPs (Pisum sati Such as mptII. vum Rubisco small subunit CTP); AtRbcS CTP (Arabidopsis 0198 After a heterologous nucleotide sequence has been thaliana Rubisco small subunit 1A CTP, CTP1); AtShkG introduced into a host cell, it may be advantageous to remove CTP(CTP2); AtShkGZm CTP (CTP2synthetic; codon opti or delete certain sequences from the plastome or genome of mized for monocot expression); PhShkG CTP (Petunia the plant or cell. For example, it may be advantageous to EPSPS; CTP4; codon optimized for monocot expression); remove a selection marker gene that has been introduced into TaWaxy CTP (Triticum aestivum granule-bound starch syn a genome if the selection marker is no longer necessarily thase CTP synthetic, codon optimized for corn expression): required after the selection phase. Methods for directed dele OsWaxy CTP (Oryza sativa starch synthase CTP): NtRbcS tion of sequences are known in the art. For example, the CTP (Nicotiana tabacum ribulose 1.5-bisphosphate carboxy nucleotide sequence encoding a selection marker preferably lase small subunit chloroplast transit peptide); ZmAS CTP includes a homology-based excision element, such as Cre-lox (Zea mays anthranilate synthase alpha 2 subunit gene CTP); and attB/attP recognition sequences, which allow removal of and RgASCTP (Ruta graveolens anthranilate synthase CTP). the selection marker genes using site-specific recombinases. Other transit peptides that may be useful include the maize 0199. In one embodiment, the heterologous nucleotide cab-m7 signal sequence and the pea (Pisum sativum) glu sequence or vector includes reporter genes. Reporter genes tathione reductase signal sequence. encode readily quantifiable proteins which, via their color or enzyme activity for example, facilitate assessment of the 4.3.7. Plant Sterility transformation efficiency, the site or time of expression, or the identification of transgenic plants. Examples of reporter 0206. In one aspect of the invention, ALPS or other plants genes include green fluorescent protein (GFP), luciferase, described herein can be rendered sterile and incapable of B-Galactosidase, 3-Glucuronidase (GUS), R-Locus gene reproduction. For example, the heterologous nucleotide product, B-Lactamase, Xy 1E gene product, alpha-amylase, sequence may include a sterility operon, which refers to one and tyrosinase. or more genes rendering the plant incapable of reproduction. Sterility operons and other methods to render plant sterile are 4.3.6. Plastid Targeting Sequences known in the art. 0200. In another embodiment of the present invention, the 0207. In yet another aspect, the heterologous nucleotide heterologous nucleotide sequence includes a plastid targeting sequence includes a toxin-encoding sequence operably sequence. A "plastid targeting sequence' as used herein refers linked to a plant-embryo specific promoter. Production of the to a nucleotide sequence that encodes a polypeptide toxin in the developing plant embryos will lead to cell death sequence, which can direct a second polypeptide to a plastid within those embryos, thus terminating their development of the plant cell. Preferably, the plastid targeting sequence is and leaving the plant sterile. a chloroplast targeting sequence. 0201 It is known in the art that non-chloroplast proteins 4.3.8. Sequence Variants may be targeted to the chloroplast by use of protein fusions 0208. The present invention further relates to variants of with a peptide encoded by a chloroplast targeting sequence. the nucleotide and protein sequences described herein. Vari For example, luciferase genes of a heterologous nucleotide ants may occur naturally, Such as a natural allelic variant. sequence can be fused with a plastid targeting sequence. Other variants include those produced by nucleotide substi US 2014/0059722 A1 Feb. 27, 2014

tutions, deletions, or additions. The Substitutions, deletions, self-ligation of the PCR products, and introducing the phage or additions may involve one or more nucleotides or amino T7 gene 10 promoter (T7g10p) into the construct. Nicotiana acids. These variants may be altered in coding regions, non tabacum plastidal TpsbA terminator was cloned as a NdeI/ coding regions, or both. Alterations in the coding regions may PstI PCR fragment amplified using forward 5'-CAGT produce conservative or non-conservative amino acid Substi CATATGATCCTGGCCTAGTCTATAGG-3 (SEQ ID tutions, deletions, or additions. Preferably, the variant is a NO:22) and reverse 5'-CTGTCTGCAGTCGAATAT silent substitution, addition, or deletion, which does not alter AGCTCTTCTTTCTTATTTC-3 (SEQ ID NO:23) primers. the properties and activities of the protein encoded by the The resulting vector has been designated as pBGL-T7p (FIG. nucleotide sequence described herein. Conservative substitu 8). tions are also preferred. 0213. The Photobacterium leiognathi LUX operon has 0209. A variant of a sequence can comprise a sequence been cloned downstream of the aadA selection marker in having at least about 90% sequence identity, and more pref pBGL-T7p. The operon has been PCR amplified using for erably at least about 95%, 96%, 97%, 98%, or 99% sequence ward 5'-CAACGAATTCCCAAAGGAGATTACAT identity, to a claimed nucleotide or amino acid sequence, and GATTAAG-3' (SEQ ID NO:24) and reverse 5'-CGTTC which exhibits the same or similar biological activity as the CGCGGTTACGTATAGCTAAATGCATCAG-3 (SEQ ID reference sequence, plus or minus about 25%, about 20%, NO:25), and cloned using EcoRI/SacII. Optionally, the vector about 15%, about 10%, about 5%, or less. For example, a may contain a flavin reductase to enhance light output capac variant nucleotide sequence that is at least about 95% identi ity. In one instance, E. coli Fre flavin reductase containing cal to a claimed nucleotide sequence is identical to the latter phage T7 translational leader has been PCR amplified using sequence, except that the variant nucleotide sequence may forward 5'-GCACCGCGGAGACCACAACGGTTTC include up to five point mutations per each 100 nucleotides of CCTCTAGAAATAATTTTGTTTAACTTTAAGAA the reference nucleotide sequence described herein. GGAGATATACCATGACAACCTTAAGCTGTAAAG-3' 0210. To determine percent identity of two nucleic acid (SEQ ID NO:26) and reverse 5'-CTGTGGTACCTCA sequences, the sequences are aligned for optimal comparison GATAAATGCAAACGCATCGCCAAAC-3 (SEQ ID purposes (e.g., gaps can be introduced in one or both of a first NO:27) primers and cloned by three way ligation downstream and second nucleotide sequence for optimal alignment). For of the LUX operon using SacII/KpnI. Homologous recombi example, when aligning a first sequence to a second sequence nation (HR) sequences, used to integrate the LUX expression having 10 nucleotides, at least 70%, preferably at least 80%, cassette into the plastidal genome, were cloned on the left more preferably at least 90% of the 10 nucleotides between and right-flank sides of the cassette. The Trn I and Trn A the first and second sequences are aligned. When a position in tobacco HR sequences, known in the art, have been PCR the first sequence is occupied by the same nucleotide as the amplified from the genome of Nicotiana tabacum, and cloned corresponding position in the second sequence, then the mol using AgeI/AscI and NotI/PstI, respectively, to flank the LUX ecules are identical at that position. The percent identity expression cassette. The resulting vector, pFBGL-T7p-LUX between the two sequences is a function of the number of Tobacco (FIG. 8) has been verified using restriction digest identical positions shared by the sequences, taking into and sequencing. Representative DNA digests, as well as maps account the number of gaps, the length of the sequences, and of the p3GL-T7p and pbGL-T7p-LUX-Tobacco vectors, are the length of each gap that need to be introduced for optimal shown in FIGS. 8 and 9, respectively. alignment of the two sequences. Algorithms known in the art, e.g., ClustalW or Lalign, can be used to determine percent Example 2 identity between the two sequences. 0211. The following examples describe various aspects of Generation of Autoluminescent Plants the present invention, and are merely intended to be illustra 0214. Plastids of any plant species can potentially be tive rather than limiting of the compounds, compositions, and transformed by a chloroplast transformation vector carrying methods useful therein. the LUX operon. In this particular instance, we used Nicoti ana tabacum (tobacco) plants for demonstration purposes. 5.0 EXAMPLES Transplastomic tobacco plants have been generated accord ing to methods known in the art. Briefly, 0.6 micron gold Example 1 particles (BioRad) coated with pBGL-T7p-LUX-Tobacco vector DNA were bombarded into leaves of aseptically grown Construction of Chloroplast Transformation Vectors 4-6 weeks old tobacco plants using PDS-1000/He Biolistic 0212. In one aspect of the invention, the chloroplast trans Particle Delivery System (system settings: bombardment He formation vector has been constructed based on Bioglow’s pressure approx. 250 psi above rapture disk pressure, rapture cloning vector p3GL (FIG. 8). The aadA selection marker disks of 1,100 psi were used; distance from the top of the was PCR amplified using forward 5'-GCTTCCATGGGG chamber 9 cm third slot, chamber vacuum pressure 28 in GAAGCGGTGATCGCCGAAG-3 (SEQ ID NO:18) and Hg). The bombarded leaves were incubated at 25-26°C. in eVeSe 5'-GTATGCATGCTTATTTGCCGACTACCT dark for 2-3 days and dissected to 5x5 mm squares, which TGGTGATC-3' (SEQID NO:19) were placed in deep Petri dishes containing 50 ml of RMOP primers and cloned using NcoI/SphI into pBGL. Primers medium (RMOP per liter: MS salts, Caisson, cathi MSP01, 5'-TTTCCCTCTAGAAATAATTTTGTT according to manufacturers instructions; 100 mg myo-inosi TAACTTTAAGAAGGAGATATACCATGGGGGAAG tol; 1 mg thiamine HCl; 1 mg 6-benzylamino purine; 0.1 mg CGGTGATCGCCGAAG-3 (SEQID NO:20) and 5'-CCGT 1-naphthaleneacetic acid; 30 gr Sucrose; 6 g phytoblend, TGTGGTCTCCCTATAGTGAGTCGTAT (Caisson), pH=5.8 adjusted with KOH), supplemented with TAATTTCGCGGCGCGCCTACCGGTTTAA AC-3 (SEQ 500 ug/ml of spectinomycin (Sigma). The Petri dishes were ID NO:21) were used to PCR the whole vector, followed by sealed with parafilm and cultivated under cool-white fluores US 2014/0059722 A1 Feb. 27, 2014 cent lamps (~2,000 lux) with 16 hlight/8 h dark cycle at 27° fused T7RNAP and transit peptide. The resulting vector has C. Transplastomic plants appeared within 4-8 weeks post been designated as plI-PC (Positive Control). Then, the NOS bombardment. As the T7 promoter is not expressible on its promoter was replaced using AscI/NcoI by Arabidiopsis own in chloroplasts, the expressionaadA and the LUX operon rd29A promoter, amplified using primers 5'-CATCAG was driven by the read-through transcription from native GCGCGCCTCTATCATTTAATCTGAGTCC-3' (SEQ ID chloroplast genome beyond the limits of the integrated NO:30) and 5'-CTGATTCCATGGTTTCCAAA expression cassette. Indeed, transplastomic plants generated GATTTTTTTCTTTCCAATAG-3' (SEQ ID NO:31) and using pBGL-T7p-LUX-Tobacco were resistant to spectino Arabidopsis genomic DNA as a template, and the resulting mycin, and exhibited very low levels of active light emission. vectors were designated as plI-rd29A. pl.)I-PC and pl)I- The plants were transferred and further aseptically main rd29A have been used to generate transgenic plants using tained in magenta boxes on MSO medium (MSO per liter: MS standard transformation methods on a background of the salts, Caisson, catiMSP01, according to manufacturers transplastomic line described in Example 2 (made using instructions; 30 gr sucrose; 6 g phytoblend (Caisson), pH=5.8 pBGL-T7p-LUX-Tobacco). adjusted with KOH) supplemented with 500 g/ml of specti nomycin (Sigma) under cool-white fluorescent lamps (1,900 Example 4 2,000 lux) with 16hlight/8h dark cycle at 26°C. Some of the Monitoring of Autoluminescent Phytosensor (ALPS) plants have been transferred to soil in the greenhouse for Plants propagation. 0216 Monitoring of light emission can be accomplished via a plethora of methods and sensors as discussed herein. In Example 3 one instance, and to demonstrate the feasibility of the inven tion, FIG. 10 shows detection of light emission from pl)I-PC Generation of Autoluminescnet Phytosensor (ALPS) transformed as compared to plI-rd29A transformed lines. Plants The images were taken using a BioRad ChemiDoc XRS 0215 Transplastomic plants produced using pBGL-T7p Molecular Imager when the plants were grown in tissue cul LUX-Tobacco as described in Example 2 were used to gen ture magenta boxes (inverse images shown for light detec erate ALPS plants, where T7 RNA Polymerase (T7RNAP) is tion). In conditions of 100% humidity within the magenta expressed in the nucleus and the resulting polypeptide is boxes, the Arabidopsis rd29A drought-inducible promoter is transported to the chloroplast by N-terminal fusion of a transit not expected to be active, and thus the transgenic line made peptide to activate LUX operon expression. T7RNAP expres using p-rd29A does not emit light. On the other hand, the sion can be driven by any promoter in the nucleus. For this line generated using p)I-PC exhibits constitutive T7RNAP example, we chose the drought inducible rd29A of Arabidop expression, and thus emits light continuously even under high sis and constitutive NOS promoters (with NOS-driven humidity conditions, as shown in FIG. 10. T7RNAP plants used as positive control), and binary vectors 0217. This example demonstrates that light emission of carrying rd29A-T7RNAP and NOS-T7RNAP have been des ALPS phytosensors can be differentially controlled by spe ignated as pI-rd29A and plI-PC (Positive Control), respec cific promoters, according to the activity of a promoter under tively. The base vector contained the following expression a given set of conditions. This principle can be further cassette: AscI-NOS promoter-MCS (SalI-BglII-Sad-EcoRI employed to generate a variety of ALPS phytosensors for the Kpni-HindIII-BamHI-PstI-Stul)-NOS terminator. Tobacco abundance and variety of different conditions and stimuli ribulose 1.5-bisphosphate carboxylase transit peptide (Rbc described herein. STP) was PCR amplified using primers 5'-CTTCAA 0218. The invention being thus described, it will be obvi GATCTCCATGGCTTCCTCAGTTCTTTCCTC-3' (SEQ ous that the same may be varied in many ways. Such varia ID NO:28) and 5'-GTAGGGAATTCGCATTGCACTCTTC tions are not to be regarded as a departure from the spirit and CGCCGTTG-3' (SEQ ID NO:29) and cloned as a BglII/ Scope of the invention, and all Such modifications as would be EcoRI fragment, followed by cloning of T7RNAP as an obvious to one skilled in the art are intended to be included EcoRI./HindIII PCR fragment, resulting in translationally within the scope of the following claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 31

<21 Os SEQ ID NO 1 &211s LENGTH: 50 &212s. TYPE: DNA &213s ORGANISM: UNKNOWN 22 Os. FEATURE: 223 OTHER INFORMATION: PLASTIDAL IEE ELEMENT

<4 OOs SEQUENCE: 1

taggat.cgtt tatttacaac ggaatggitat acaaagttcaa cagat citcaa SO

<21 Os SEQ ID NO 2 &211s LENGTH: 1539

US 2014/0059722 A1 Feb. 27, 2014 22

- Continued tittaattatg gaacggittag gggtttgt at Cataaggatt titcgagtgtt tdgga catcC 360 caggaggatt cocqaaaaac agcagaaaat ttctatt cta tdattittaga tigcgt.ccaag 42O accggagtgt to atacgga C9gggaggta gtagaatttic ctgatgtgaa tetct accca 48O gaagcc tatt ctaaaaag.ca gcc tacttgt atgactg.cgg aatctitctga gact attact 54 O tatttagcgg aaagagggct acctatggtg ttaagttgga ttatcc.cagt tagtgaaaaa 6OO gtat ct caaa tigagittata taatgaagtg gcc.gctgaac atgggcatga tataaacaat 660 attgaacaca ttctaacatt tatttgct ct gttaatgaag atggggagaa agc.cgatagt 72 O gtatgtagga atttitttgga gaattggitat gactic ctaca agaatgccac aaa catctitt 78O aatgatt.cca accaaacaag aggtt atgat tatttaaaag Ctcaatggcg agagtgggitt 84 O atgaaaggitt tagctgaccc acgaaggcgt. Cttgattatt ctaatgaatt aaatc.cggit c 9 OO ggtacacctgaacgttgtat cqaaattatt caaagtaata ttgatgcaac cqggataaaa 96.O

Cacatt accg tdggctttga agctaatggit agtgaac agg aaattagaga atctatggaa 1 O2O cittitt tatgg aaaaagttgc accqcatctt aaagat.cccc aataa 1065

<210s, SEQ ID NO 7 &211s LENGTH: 981 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ARTIFICIAL LUX B NECLEOTIDE SEQUENCE

<4 OO > SEQUENCE: 7 atgaactittg gattgtttitt cotaaatttic caaccagaag gaatgacttic cqaaatggta 6 O ctagataata tdgttgatac agtag cattg gtaga caaag atgacitat catttcaag.cgt. 12 O gtattggtgt ctdaacat catttct coaaa aatggcatta taggggagcc cittaa.ccgct 18O atat ctitt cottt taggit ct aaccalagaga atagaaatag gttctittgaa totaggittata 24 O acgacccacc atcctgtaag aattgg.cgaa cagactggat tattagat.ca gatgtc.ttac 3OO ggtcgttt cq ttittaggttt atcagattgc gttaatgatt togaaatgga ttitttittaaa 360 cgaaaacgta gttcacaa.ca acaacaattic gaag catgtt atgaaattitt aaatgaagcc 42O ttaactacga attattgcca agcggatgat gattittittca attitt cogag gat cagtgta 48O aatc.cc catt gtat citctgaggittaaacaa tacattttgg catcttctat giggtgtagtt 54 O gaatgggc.cg Ctcgaalaagg tott cctitta acgtatagat ggagtgatag tittagcagaa 6OO aaagagaagt attatcagcg ttact tagcg gttgctaaag agaacaatat agatgtttca 660 aatat cqatc atcaattitcc ticttcttgta aat attaacg aaaatcgaag aatagcacga 72 O gatgaagtac gtgagtacat t cagagittat gitat cagaag cct atcc cac tdaccctaat 78O attgaact tc gtgtagaaga attgatcgaa caa.cacgcag ticgggaaagt catgaatat 84 O tatgatticta cqatgcacgc tigt caaagtt actggttcta aaaatttatt attat cittitt 9 OO gaat citatga aaaataaaga tigacgtcact aaactitatica acatgttcaa ccaaaaaatc 96.O aaggataact taataaagtg a 981

<210s, SEQ ID NO 8 &211s LENGTH: 1437 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2014/0059722 A1 Feb. 27, 2014 23

- Continued <223> OTHER INFORMATION: ARTIFICIAL LUX C NUCLEOTIDE SEQUENCE, INCORPORATING ALA TO GLY MUTATION AT AMINO ACID POSITION 389

<4 OOs, SEQUENCE: 8 atgatcaaaa aaatcc ct at gataattggg ggagtagt cc agaac acat C C9gtt atgga 6 O atgagaga at taacattaaa caataataaa gttaa cattc caattat cac acaaagtgat 12 O gtagaa.gcta ttcaat ct cit aaatattgag aacaaattga caataaatca gattgtaaat 18O titcc tittata citg taggcca aaaatggaaa totgagacgt. atagt cqtcg attaactitat 24 O atcagagatt taatcaaatt cittaggittat agt caggaaa toggctaaatt ggaagctaat 3OO tggattagta tdatat tatgttctaaaagt gctittatatg acatagtaga aaatgattta 360 agtagt cqtc at at cattga tigaatggatt CCC caaggtgaatgctatgt aaaag cattg 42O cctaagggta agt ccgtaca cittgttagca ggaaatgttc ctittatcagg agtaacctic c 48O atactaagag caattcttac aaaaaatgaa tdcattatta aaact agttc agcagaccca 54 O tttact.gc.ca citgcacttgt taact cittitt atagacgttg atgcc.galaca toctataa.ca 6OO cgatcc atta gtgtaatgta ttggit cocat tctgaagatt tag caatticc caaacaaata 660 atgtcttgttg Ctgacgttgt tatagcatgg ggaggggacg atgcaataala atgggcaact 72 O gaacatgcac cittct cacgc agacatattgaaatt cqgac cqaaaaaatc cattt coatt 78O gtcgataatc ctacggat at taaggcagct gct at cqgag togct catga catttgttitt 84 O tatgat cago aag catgctt Ctcaacco aa gatatatatt at atcggaga ttcaattgat 9 OO attittctittg atgaattago toaac agitta aataaatata aagacatttit acctaaaggg 96.O gaacgaaatt t catgagaa ggcagcttitc tocct tactgaaagaga.gtg tctttitcgca 1 O2O aaatataaag ttcaaaaagg togaatcc.caa tottggttgc titacccaaag to cagcggga 108 O agttittggaa atcaac ctitt gag togttct gcgtatatto atcaggtaaa tdatataagt 114 O gaagtaatac Cct tcgtaca taaaggagtt act caaactg. tagct at cqc gcc ttgggaa 12 OO t caagttitta aatacagaga tattittggct gag catggtg Ctgagcgitat cattgaagca 126 O ggaatgaata acatttitt cq t taggaggit gcc cacgatg ggatgcgacc Cttgcaacgt 132O ttggittaatt at atttctica togaacgt.cct agtacatata caacaaaaga tigittagtgta 1380 aaaatagaac agacaaggta t cittgaagaa gataaattct tagttitttgt accqtag 1437

<210s, SEQ ID NO 9 &211s LENGTH: 948 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ARTIFICIAL LUX D NUCLEOTIDE SEQUENCE

<4 OOs, SEQUENCE: 9 atggaaaata cacaacatag tittacctatt gat cacgtaa togacatagg togacaac cqt 6 O tacat caggg tdtgggaaac taalacctaaa aacaaagaaa citaaaagaaa taataccata 12 O gtgatagcgt CC9gttittgc aagaagaatg gat cactittg Ctggattagc tigaat at Ctt 18O gccaacaatig gatt.ccgagt tattagatac gatt cactaa at catgtggg cittgttctagt 24 O ggtgaaatta aacagtttag tatgtctgta gg taalacatt ctittgctaac gigtaattgat 3OO tggcttaaag aacgaaatat caacaatatt ggactaattig caagttcctt aagtgc.ccgt. 360 atagoctato aagtagcc.gc agaaattgat titatic ct tcc titata acagc agttggggitt 42O US 2014/0059722 A1 Feb. 27, 2014 24

- Continued gtgaatttac gttctact ct togaaaaag.ca cittaaatatg attatttgca gatggaagtic 48O aatacgattic ctdaag actt aatatttgaa gogg cataatc taggttcaaa agtttttgttg 54 O actgattgtt ttgaaaacaa citgggattct ttagacticaa citattaataa aatttgtgag 6OO cittgat attc cqtt catago ttt cacttct gatggggatg attgggtttgtcaiacatgaa 660 gtaaaacacic tagtgtccaa totaaaatct gacaaaaaaa agatatactic tittagttggit 72 O agttcc catg atttggggga aaatttggtc gttttacgaa atttctatoa aag tatgact 78O aaagctgctg. tct cattgga taggcaattg gttgaattag ttgatgaaat Catagalacca 84 O aattittgagg atttaa.ccgt aattacagtic aatgaaagaa gacittaaaaa taaaatagaa 9 OO aatgaaataa taalacagact agcagat.cga gttcttgctt ccgtataa 948

<210s, SEQ ID NO 10 &211s LENGTH: 1122 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ARTIFICAL LUX E NUCLEOTIDE SEQUENCE, INCORPORATING GLN TO GLU MUTATION AT AMINO ACID POSITION 167

<4 OOs, SEQUENCE: 10 atgtccacct tactaalacat cqatgcaacg gagattaaag titagtacca gatagatgat 6 O ataatc.ttta caagtagt co attaactitta ttatttgaag atcaagaaaa aattcagaaa 12 O gaattaatac ttgaaagttt toattatcat tataaccata ataaagatta caagtattat 18O tgtaat attc agggggttga tigagaacatt caatcaattig acgacattcc agtattt cot 24 O a catccatgt ttaaatactic ticgtott cat acago cqatig agagtaatat agaaaattgg 3OO titta catcat cogg tactaa aggcgittaag tot catattg c tagggatag goagt caatt 360 gaaagattac taggat cagt taattatggt atgaaat atc ttggagaatt to atgaacat 42O caacttgaac ttgtaaatat giggaccagat cqtttitt cog cittcaaacgt gtggttcaaa 48O tatgttatga gtttagtaga attgttatat cotact actt ttact.gtgga aaatgatgag 54 O atagattittgaacaaactat cittggctitta aaag.cgatac aacgaaaagg aaaaggaata 6OO tgtttaatag gaccgc citta ttittatatac ttgttatgcc attatatgaa agaacataat 660 atagaattta atgcaggggc ticacatgttt attattacgg gagggggatg gaaaacaaaa 72 O caaaaagagg cqttaaatag goaagattitc aatcaacttic titatggaaac attct cotta 78O titt catgagt cacaaattag agacatattt aatcaagttgaattgaatac atgtttcttic 84 O gaagattct c ttcaacgaaa acatgtgcca ccttgggitat atgct cqtgc attagat cot 9 OO gttactittga citc.ccgtaga agacgggcag gaaggcttga tigt Cittatat ggacgc.ctic C 96.O agta catcat atc.cgactitt catcgttacg gatgatattg gcattgtaag goat ctaaaa 1 O2O gagg cagatc cct tccalagg tacaa.ccgta gaaattgtta gacgt Cittaa cacacgaga.g 108 O caaaagggitt gttctittatc tatggctaca agt cittaaat aa 1122

<210s, SEQ ID NO 11 &211s LENGTH: 705 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ARTIFICIAL LUX G NUCLEOTIDE SEQUENCE

<4 OOs, SEQUENCE: 11 US 2014/0059722 A1 Feb. 27, 2014 25

- Continued atgat citt.ca actgtaaagt caaaaaagtt gaa.gcatc.cg attcacatat ttataaagtic 6 O tittatcaaac ccgataagtg titt cqattitt aaa.gcaggcc aatatgttat tdtgtaccta 12 O aacgggaaaa atttaccatt tagtatagcc aactgtc.cta catgitaatga attattggaa 18O ttacatgtag gcgggtctgt aaaagaat cit gcaattgaag caatat caca ctitt attaat 24 O gcttittatat atcaaaaaga atttactatt gatgctic cqc atggagacgc ctdgttacga 3OO gatgagt citc aatcto cqct tttgttaata gctggcggca caggtttatc atatat caat 360 agtattittaa gttgctgcat ttctaaacaa citatic ccaac cqatc tattt atactggggt 42O gtcaacaatt gta accttitt gtatgcagat caacaattaa aaactittggc cqcacaatat 48O cgtaat atta attatat coc togtagttgag aat cittaata cagattggca aggaaaaatt 54 O gggaatgtaa tagatgcagt aatcgaagat tittagtgacc titt cagattt cqa catctat 6OO gtttgtggac cct tcggitat gtc.ca.gaaca gctaaagata ttctaatttic acaaaagaaa 660 gcaaacatag gigaagatgta titcagatgct ttittcttaca cqtga 7Os

<210s, SEQ ID NO 12 &211s LENGTH: 702 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ARTIFICIAL E COLI FRE NUCLEOTIDE SEQUENCE

<4 OOs, SEQUENCE: 12 atgact actic titt Cttgtaa ggtgacatca gtggaggcta taactgacac agtgtacaga 6 O gttagaatcg taccagatgc agcatttagt tittagggc.cg gtcaat attt gatggttgta 12 O atggacgaga gagataagag acc attcagc atggcct cta Ctccagatga gaaagggittt 18O atcgaactgc acattggagc at cagagat.c aattitat acg caaaagcagt catggacagg 24 O atcttaaagg accatcagat tttgttgat attic ct cacg gcgaagcatg gct tagggat 3OO gatgaggaaa gacctatgat t ct catcgct ggcggaacag ggttctictta cqctaggtot 360 at actic ct ca cc.gc.cctago acgtaatcca aatagggata ttaccattta citggggtggit 42O agagaagagc agcacctitta Cacctittgc gaattggagg cccttagctt aaa.gcatcct 48O ggtctacaag ttgttgc.cagt titcgaacaa cct gaggcag gatggagagg gcgtacagga 54 O acagtgctaa citgcc.gttitt acaggat cat ggcactic titg citgagcacga tatttatatt 6OO gccggtagat t caaatggc taagattgca C9tgaccttt tttgttctga aagaaatgcc 660 agggaagata gattgttcgg tatgctitt C gcatt cattt ga 7 O2

<210s, SEQ ID NO 13 &211s LENGTH: 585 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: ARTIFICIAL W. FISCHERI YELLOW FLOURESCENT PROTEIN NUCLEOTIDE SEQUENCE

<4 OOs, SEQUENCE: 13 atgtttaaag gaattgttgga aggcattgga at cattgaga agataga cat atatacagac 6 O cittgacaagt atgccatcag attcc ctdaa alacatgttga acggcattaa aaaagagt ct 12 O tccattatgt ttaacggctg. Ctttcttaca gtgaccagog ttaatagcaa catcgtctgg 18O tittgat attt ttgagaagga agctaggaala Ctggata cat ttagagaata taaggttgga 24 O US 2014/0059722 A1 Feb. 27, 2014 26

- Continued gatagagt ca atttggg tac attcc caaag tittggtgctg. Catctggagg acatattittg 3OO agtgcaagaa tat cittgcgt togctag tatt attgagatta tagagaatga agattat caa 360 cagatgtgga titcagattico tdagaactitt actgagttct taattgacaa agactatatt 42O gctgtcgatg gitat ct ctitt aacaatcgac actataaaaa acaat cagtt ttittatt agt 48O ttgc.cgittaa aaatagctica aaataccaac atgaaatgga ggaaaaaggg agatalaggtt 54 O aacgtggagt ttctaataa gattalacgct aat cagtgtt ggtga 585

<210s, SEQ ID NO 14 &211s LENGTH: 478 212. TYPE: PRT <213> ORGANISM: Photobacterium leiognathi <4 OOs, SEQUENCE: 14 Met Ile Llys Lys Ile Pro Met Ile Ile Gly Gly Val Val Glin Asn Thr 1. 5 1O 15 Ser Gly Tyr Gly Met Arg Glu Lieu. Thir Lieu. Asn. Asn. Asn Llys Val Asn 2O 25 3O Ile Pro Ile Ile Thr Glin Ser Asp Val Glu Ala Ile Glin Ser Lieu. Asn 35 4 O 45 Ile Glu Asn Llys Lieu. Thir Ile Asin Glin Ile Val Asn Phe Leu Tyr Thr SO 55 6 O Val Gly Gln Lys Trp Llys Ser Glu Thr Tyr Ser Arg Arg Lieu. Thr Tyr 65 70 7s 8O Ile Arg Asp Lieu. Ile Llys Phe Lieu. Gly Tyr Ser Glin Glu Met Ala Lys 85 90 95 Lieu. Glu Ala Asn Trp Ile Ser Met Ile Lieu. Cys Ser Llys Ser Ala Lieu. 1OO 105 11 O Tyr Asp Ile Val Glu Asn Asp Lieu. Ser Ser Arg His Ile Ile Asp Glu 115 12 O 125 Trp Ile Pro Glin Gly Glu. Cys Tyr Val Lys Ala Lieu Pro Lys Gly Lys 13 O 135 14 O Ser Val His Leu Lleu Ala Gly Asn Val Pro Leu Ser Gly Val Thir Ser 145 150 155 160 Ile Lieu. Arg Ala Ile Lieu. Thir Lys Asn. Glu. Cys Ile Ile Llys Thir Ser 1.65 17O 17s Ser Ala Asp Pro Phe Thr Ala Thr Ala Lieu Val Asn. Ser Phe Ile Asp 18O 185 19 O Val Asp Ala Glu. His Pro Ile Thr Arg Ser Ile Ser Val Met Tyr Trp 195 2OO 2O5 Ser His Ser Glu Asp Lieu Ala Ile Pro Lys Glin Ile Met Ser Cys Ala 21 O 215 22O Asp Val Val Ile Ala Trp Gly Gly Asp Asp Ala Ile Llys Trp Ala Thr 225 23 O 235 24 O Glu. His Ala Pro Ser His Ala Asp Ile Lieu Lys Phe Gly Pro Llys Llys 245 250 255 Ser Ile Ser Ile Val Asp Asn Pro Thr Asp Ile Lys Ala Ala Ala Ile 26 O 265 27 O Gly Val Ala His Asp Ile Cys Phe Tyr Asp Glin Glin Ala Cys Phe Ser 27s 28O 285 Thr Glin Asp Ile Tyr Tyr Ile Gly Asp Ser Ile Asp Ile Phe Phe Asp 29 O 295 3 OO US 2014/0059722 A1 Feb. 27, 2014 27

- Continued Glu Lieu Ala Glin Glin Lieu. Asn Llys Tyr Lys Asp Ile Lieu Pro Lys Gly 3. OS 310 315 32O Glu Arg Asn. Phe Asp Glu Lys Ala Ala Phe Ser Lieu. Thr Glu Arg Glu 3.25 330 335 Cys Lieu. Phe Ala Lys Tyr Llys Val Glin Lys Gly Glu Ser Glin Ser Trp 34 O 345 35. O Lieu. Lieu. Thr Glin Ser Pro Ala Gly Ser Phe Gly Asn Gln Pro Leu Ser 355 360 365 Arg Ser Ala Tyr Ile His Glin Val Asn Asp Ile Ser Glu Val Ile Pro 37 O 375 38O Phe Val His Lys Ala Val Thr Glin Thr Val Ala Ile Ala Pro Trp Glu 385 390 395 4 OO Ser Ser Phe Llys Tyr Arg Asp Ile Lieu Ala Glu. His Gly Ala Glu Arg 4 OS 41O 415 Ile Ile Glu Ala Gly Met Asn. Asn. Ile Phe Arg Val Gly Gly Ala His 42O 425 43 O Asp Gly Met Arg Pro Lieu. Glin Arg Lieu Val Asn Tyr Ile Ser His Glu 435 44 O 445 Arg Pro Ser Thr Tyr Thr Thr Lys Asp Val Ser Val Lys Ile Glu Gln 450 45.5 460 Thr Arg Tyr Lieu. Glu Glu Asp Llys Phe Leu Val Phe Val Pro 465 470 47s

<210s, SEQ ID NO 15 &211s LENGTH: 373 212. TYPE: PRT <213> ORGANISM: Photobacterium leiognathi <4 OOs, SEQUENCE: 15 Met Ser Thr Lieu Lleu. Asn Ile Asp Ala Thr Glu Ile Llys Val Ser Thr 1. 5 1O 15 Glu Ile Asp Asp Ile Ile Phe Thr Ser Ser Pro Leu. Thir Lieu. Leu Phe 2O 25 3O Glu Asp Glin Glu Lys Ile Gln Lys Glu Lieu. Ile Lieu. Glu Ser Phe His 35 4 O 45 Tyr His Tyr Asn His Asn Lys Asp Tyr Lys Tyr Tyr Cys Asn Ile Glin SO 55 6 O Gly Val Asp Glu Asn. Ile Glin Ser Ile Asp Asp Ile Pro Val Phe Pro 65 70 7s 8O Thir Ser Met Phe Lys Tyr Ser Arg Lieu. His Thr Ala Asp Glu Ser Asn 85 90 95 le Glu Asn Trp Phe Thir Ser Ser Gly. Thir Lys Gly Val Lys Ser His 1OO 105 11 O le Ala Arg Asp Arg Glin Ser Ile Glu Arg Lieu. Lieu. Gly Ser Val Asn 115 12 O 125 yr Gly Met Lys Tyr Lieu. Gly Glu Phe His Glu. His Glin Lieu. Glu Lieu. 13 O 135 14 O Val Asn Met Gly Pro Asp Arg Phe Ser Ala Ser Asn Val Trp Phe Lys 45 150 155 160 yr Val Met Ser Lieu Val Glin Leu Lleu Tyr Pro Thr Thr Phe Thr Val 1.65 17O 17s Glu Asn Asp Glu Ile Asp Phe Glu Glin Thir Ile Lieu Ala Lieu Lys Ala 18O 185 19 O US 2014/0059722 A1 Feb. 27, 2014 28

- Continued Ile Glin Arg Lys Gly Lys Gly Ile Cys Lieu. Ile Gly Pro Pro Tyr Phe 195

Ile Tyr Luell Lieu. Cys His Tyr Met Lys Glu. His Asn Ile Glu Phe Asn 21 O 215 22O

Ala Gly Ala His Met Phe Ile Ile Thr Gly Gly Gly Trp Thr Lys 225 23 O 235 24 O

Glin Glu Ala Lieu. Asn Arg Glin Asp Phe Asn Glin Lell Luell Met Glu 245 250 255

Thir Phe Ser Lieu. Phe His Glu Ser Glin Ile Arg Asp Ile Phe ASn Glin 26 O 265 27 O

Wall Glu Luell Asn Thr Cys Phe Phe Glu Asp Ser Lell Glin Arg Llys His 28O 285

Wall Pro Pro Trp Val Tyr Ala Arg Ala Lieu. Asp Pro Wall Thir Lieu. Thir 29 O 295 3 OO

Pro Wall Glu Asp Gly Glin Glu Gly Luell Met Ser Met Asp Ala Ser 3. OS 310 315

Ser Thir Ser Tyr Pro Thr Phe Ile Val Thr Asp Asp Ile Gly Ile Wall 3.25 330 335

Arg His Luell Lys Glu Pro Asp Pro Phe Glin Gly Thir Thir Wall Glu Ile 34 O 345 35. O

Wall Arg Arg Lieu. Asn. Thir Arg Glu Gln Lys Gly Ser Luell Ser Met 355 360 365

Ala Thir Ser Lieu Lys 37 O

SEQ ID NO 16 LENGTH: 1437 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: ARTIFICAL LUX C NUCLEOTIDE SEQUENCE WITHOUT ALA TO GLY MUTATION AT AMINO ACID POSITION 38.9

<4 OOs, SEQUENCE: 16 atgatcaaaa aaatcc citat gataattggg ggagtag to c agaacacatc cggittatgga 6 O atgagagaat taaCattaala Caataataaa. gttaa cattc Caattat CaC acaaagtgat 12 O gtagaa.gcta ttcaat ct ct aaatattgag aacaaattga Caataaatca gattgtaaat 18O tt cott tata Ctgtaggc.ca aaaatggaaa tctgagacgt. atagt catcg attalactitat 24 O atcagagatt taatcaaatt cittaggittat agt caggaaa tggctaaatt ggaagctaat 3OO tggattagta tgat attatg ttctaaaagt gctittatatg acatagtaga aaatgattta 360 agtagt cqtc atat cattga tgaatggatt CCC caaggtg aatgctatot aaaag cattg Cctaagggta agt ccgtaca cittgttagca ggaaatgttc ctittatcagg agtaacctic c at actalagag Caattcttac aaaaaatgaa tgcatt atta aaact agttc agcagaccca 54 O tttact.gc.ca ctgcacttgt taact citt tt atagacgttg atgcc.galaca to Ctataa.ca cgatcc atta gtgtaatgta ttggit cocat tctgaagatt tagcaatticc caaacaaata 660 atgtcttgttg Ctgacgttgt tatagcatgg ggaggggacg atgcaataaa atgggcaact 72 O gaacatgcac cittct cacgc aga catattg aaatt.cggac cgaaaaaatc cattt coatt gtcgataatc citacggatat taaggcagct gct at cqgag tggct catga catttgttitt 84 O tatgat cago aag catgctt Ctcaa.cccala gatatatatt at atcggaga ttcaattgat 9 OO US 2014/0059722 A1 Feb. 27, 2014 29

- Continued attittctittg atgaattago toaac agitta aataaatata aagacatttit acctaaaggg 96.O gaacgaaatt t catgagaa ggcagcttitc tocct tactgaaagaga.gtg tctttitcgca 1 O2O aaatataaag ttcaaaaagg togaatcc.caa tottggttgc titacccaaag to cagcggga 108 O agttittggaa atcaac ctitt gag togttct gcgtatatto atcaggtaaa tdatataagt 114 O gaagtaatac cct tcgtaca taaag cagtt act caaactg tagctat cqc gcc ttgggaa 12 OO t caagttitta aatacagaga tattittggct gag catggtg Ctgagcgitat cattgaagca 126 O ggaatgaata acatttitt cq t taggaggit gcc cacgatg ggatgcgacc Cttgcaacgt 132O ttggittaatt at atttctica togaacgt.cct agtacatata caacaaaaga tigittagtgta 1380 aaaatagaac agacaaggta t cittgaagaa gataaattct tagttitttgt accqtag 1437

<210s, SEQ ID NO 17 &211s LENGTH: 1122 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ARTIFICAL LUX E NUCLEOTIDE SEQUENCE WITHOUT GLN TO GLU MUTATION AT AMINO ACID POSITION 167

<4 OOs, SEQUENCE: 17 atgtccacct tactaalacat cqatgcaacg gagattaaag titagtacca gatagatgat 6 O ataatc.ttta caagtagt co attaactitta ttatttgaag atcaagaaaa aattcagaaa 12 O gaattaatac ttgaaagttt toattatcat tataaccata ataaagatta caagtattat 18O tgtaat attc agggggttga tigagaacatt caatcaattig acgacattcc agtattt cot 24 O a catccatgt ttaaatactic ticgtott cat acago cqatig agagtaatat agaaaattgg 3OO titta catcat cogg tactaa aggcgittaag tot catattg c tagggatag goagt caatt 360 gaaagattac taggat cagt taattatggt atgaaat atc ttggagaatt to atgaacat 42O caacttgaac ttgtaaatat giggaccagat cqtttitt cog cittcaaacgt gtggttcaaa 48O tatgttatga gtttagtaca attgttatat cotact actt ttact.gtgga aaatgatgag 54 O atagattittgaacaaactat cittggctitta aaag.cgatac aacgaaaagg aaaaggaata 6OO tgtttaatag gaccgc citta ttittatatac ttgttatgcc attatatgaa agaacataat 660 atagaattta atgcaggggc ticacatgttt attattacgg gagggggatg gaaaacaaaa 72 O caaaaagagg cqttaaatag goaagattitc aatcaacttic titatggaaac attct cotta 78O titt catgagt cacaaattag agacatattt aatcaagttgaattgaatac atgtttcttic 84 O gaagattct c ttcaacgaaa acatgtgcca ccttgggitat atgct cqtgc attagat cot 9 OO gttactittga citc.ccgtaga agacgggcag gaaggcttga tigt Cittatat ggacgc.ctic C 96.O agta catcat atc.cgactitt catcgttacg gatgatattg gcattgtaag goat ctaaaa 1 O2O gagg cagatc cct tccalagg tacaa.ccgta gaaattgtta gacgt Cittaa cacacgaga.g 108 O caaaagggitt gttctittatc tatggctaca agt cittaaat aa 1122

<210s, SEQ ID NO 18 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer

<4 OOs, SEQUENCE: 18 US 2014/0059722 A1 Feb. 27, 2014 30

- Continued gctt CC atgg gggaag.cggit gat.cgc.cgala g 31

<210s, SEQ ID NO 19 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: PCR Primer

<4 OOs, SEQUENCE: 19 gtatgcatgc titatttgc.cg act accttgg tdatc 35

<210s, SEQ ID NO 2 O &211s LENGTH: 72 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 2O titt.cccticta gaaataattt ttittaactt taagaaggag atataccatgggggaag.cgg 6 O tgat cqc.cga ag 72

<210s, SEQ ID NO 21 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 21 cc.gttgttggt CtcCctatag tagt citat taattitcgcg gcgc.gc.ctac C9gtttaaac 6 O

<210s, SEQ ID NO 22 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 22 cagt catatg atcctggcct agtictatagg 3 O

<210s, SEQ ID NO 23 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 23 ctgtctgcag togaatatag ct cittctitt c ttattitc 37

<210s, SEQ ID NO 24 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 24 caacgaattic ccaaaggaga ttacatgatt aag 33 US 2014/0059722 A1 Feb. 27, 2014 31

- Continued <210s, SEQ ID NO 25 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 25 cgttcc.gcgg ttacgtatag ctaaatgcat cag 33

<210s, SEQ ID NO 26 &211s LENGTH: 90 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 26 gcaccc.cgga gaccacaacg gtttic cct ct agaaataatt ttgttta act ttaagaagga 6 O gatataccat gacaac citta agctgtaaag 9 O

<210s, SEQ ID NO 27 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 27 ctgtgg tacct cagataaat gcaaacgcat cqccaaac 38

<210s, SEQ ID NO 28 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 28 cittcaagatc. tccatggctt cotcagttct titcctic 36

<210s, SEQ ID NO 29 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 29 gtagggaatt cqcattgcac tott.ccgc.cg ttg 33

<210s, SEQ ID NO 3 O &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 30 catcagg.cgc gcct citat catttaatctgagt cc 34

<210s, SEQ ID NO 31 &211s LENGTH: 4 O &212s. TYPE: DNA US 2014/0059722 A1 Feb. 27, 2014 32

- Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: PCR primer <4 OOs, SEQUENCE: 31 citgatt coat gigttitccaaa gattitttitt c titt coaatag 4 O

1. An autoluminescentphytosensor (ALPS) plant monitor ing at least one transgene of interest, wherein said expression ing System, comprising: cassette is flanked by sequences comprising about 100 to (i) a plant containing a complete or partial LUX operon about 3,000 contiguous nucleotides of SEQID NO:4. integrated within a plastidal genome thereof, wherein 11. A method of transforming apetunia plastid, comprising expression or activity of said operon is induced or introducing into said plastid an expression cassette compris complemented by a nucleus-integrated factor activated ing at least one transgene of interest, wherein said expression by an environmental or plant physiological condition; cassette is flanked by sequences comprising about 100 to (i) at least one luminescence data detecting sensor posi about 3,000 contiguous nucleotides of SEQID NO:5. tioned on, in proximity to, or remotely from said plant, 12. An autoluminescent plant expressing a functioning wherein said sensor detects luminescence emitted from luciferase pathway, comprising luciferase and one or more said plant; luciferin biosynthesis genes integrated in a plastid genome, (ii) at least one transmitter that receives said luminescence wherein said luciferase pathway is obtainable from Cnidaria data from said sensor; and (Coelenterates) or Ctenophores (e.g., Aequorea Victoria, Per (iii) a communication network that receives said lumines iphylla periphylla, or Renilla reniformis, or Obelia or Mine cence data from said transmitter and conveys it to a miopsis species); orders of Coleoptera, Collembola, Hemi receiver. ptera, Diptera (e.g., Photinus pyralis, or Arachnocampa 2. A transgenic plant cell containing a LUX operon com luminosa or Orfelia fultoni); Dinoflagellata or Radiolaria prising LUX genes integrated within a plastidal genome (e.g., Gonyaulax polvedra or Thalassicolla species); Anne therein, lids (e.g., Diplocardia longa, Chaetopterus variopedatus, or wherein any or all of said LUX genes are separated by an Odontosyllis species); Mollusca (e.g., Pholas dactylus, intercistronic expression element (IEE) operably linked Watasenia Scintillans, or Latia species); Crustacea (e.g., Var thereto, and gula hilgendorfii, Cypridina hilgendorfii, or Meganyctiph wherein expression of said LUX genes is enhanced by a anes norvegica); Fungi (e.g., Panellus stipticus or Mycena heterologous translational leader sequence operably citricolor); Echinodermata (e.g., Ophiopsila Californica); or linked to one or more of said LUX genes. Diplopoda or Chilopoda (e.g., Luminodesmus sequoiae or 3. The transgenic plant cell of claim 2, wherein said heter Orphaneus brevilabatus). ologous translational leader sequence is selected from the 13. An autoluminescent plant, expressing a functioning group consisting of a T7g 10 leader sequence, a canonical luciferase pathway comprising luciferase and one or more bacterial Shine-Dalgarno sequence AGGAGG, and an rbcL luciferin biosynthesis genes integrated in a nuclear genome, leader sequence. wherein said luciferase pathway is obtainable from Collem 4. An autoluminescent plant cell, containing plastids that bola, Hemiptera, Diptera (Arachnocampa luminosa or Orfe have an altered size, an altered shape, and/or containing an lia filtoni); Dinoflagellata or Radiolaria (e.g., Gonyaulax altered number of plastids as compared to an otherwise iden polvedra or Thalassicolla species); Annelids (e.g., Diplocar tical cell containing wild-type plastids. dia longa, Chaetopterus variopedatus, or Odontosyllis spe 5. The autoluminescent plant cell of claim 4, wherein said cies); Mollusca (e.g., Pholas dactylus, Watasenia scintillans, alteration of plastid size, shape, and/or number of plastids is or Latia species); Crustacea (e.g., Vargula hilgendorfii, Cyp due to overexpression or Suppression of chloroplast division ridina hilgendorfii, or Meganyctiphanes norvegica); Fungi genes. (e.g., Panellus stipticus or Mycena citricolor); Echinoder 6. A cell, in which a LUX operon and a protein exhibiting mata (e.g., Ophiopsila Californica); or Diplopoda or plastidal accD functionality are coexpressed, and wherein Chilopoda (e.g., Luminodesmus Sequoiae or Orphaneus said accD is overexpressed. brevilabatus). 7. The cell of claim 6, which is a bacterial cell or a plant 14. An autoluminescentphytosensor (ALPS) plant moni cell. toring System, comprising: 8. A transgenic or transplastomic plant of Petunia cv. “Per (i) an autoluminescent plant of claim 12 or 13, wherein fectunia Blue'. Nicotiana Alata cv. 'Whisper Rose Shades'. activity of said luciferase pathway is induced or comple or Nicotiana Sylvestris cv. “Only the Lonely. mented by a nucleus-integrated factor, 9. A method of transforming a poinsettia plastid, compris ing introducing into said plastid an expression cassette com (ii) at least one luminescence data detecting sensor posi prising at least one transgene of interest, wherein said expres tioned on, in proximity to, or remotely from said plant, sion cassette is flanked by sequences comprising about 100 to wherein said sensor detects luminescence emitted from about 3,000 contiguous nucleotides of SEQID NO:3. said plant; 10. A method of transforming a rose plastid, comprising (iii) at least one transmitter that receives said luminescence introducing into said plastid an expression cassette compris data from said sensor; and US 2014/0059722 A1 Feb. 27, 2014

(iv) a communication network that receives said lumines nucleotide sequence in said genetically engineered organism, cence data from said transmitter and conveys it to a or that eliminate or reduce the use of a pathogen or a pest in receiver. generating said genetically engineered organism. 15. The autoluminescentphytosensor plant monitoring sys 19. The method of claim 18, wherein said genetically engi tem of claim 1, transgenic plant cell of claim 2 or 3, plastids neered organism is a transgenic plant, and said steps are of claim 4 or 5, cell of claim 6 or 7, transgenic or transplas selected from the group consisting of: tomic plant of claim 8, or plastid of any one of claims 9-11, i) Substituting Agrobacterium-mediated transformation comprising LUX nucleotide sequences shown in SEQ ID with a non-Agrobacterium transformation method; NOs:6-10, operably linked for expression, and which are ii) Substituting a pathogenic or pest nucleic acid sequence expressed. with a functionally equivalent non-pathogen or non-pest 16. The autoluminescentphytosensor plant monitoring sys nucleic acid sequence; tem, transgenic plant cell, plastids or cell, or transgenic or iii) eliminating or removing a selection or antibiotic resis transplastomic plant of claim 15, further comprising, oper tance marker; ably linked for expression, the LUX nucleotide sequence iv) substituting a selection marker with a native allele; shown in SEQID NO:12, and which is expressed. V) using intragenic or cis-genetic transfer; and 17. The plant of claim 1 or 8, further comprising at least one Vi) using a gene coding for a protein with History of Safe gene or factor that renders said plant incapable of sexual Use (HOSU) or a familiar protein. reproduction. 20. The method of claim 19, wherein said non-Agrobacte 18. A method of decreasing regulatory requirements nec rium transformation method is selected from the group con essary for approval of use of a genetically engineered organ sisting of biolistic transformation, whiskers-mediated trans ism, comprising producing said genetically engineered formation, microinjection, PEG-mediated transformation, organism employing two or more steps that Substitute or and electroporation. eliminate the use of a pathogen, pest, or antibiotic resistance