Object Oriented Programming and Classes in MATLAB1
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
BUGS Code for Item Response Theory
JSS Journal of Statistical Software August 2010, Volume 36, Code Snippet 1. http://www.jstatsoft.org/ BUGS Code for Item Response Theory S. McKay Curtis University of Washington Abstract I present BUGS code to fit common models from item response theory (IRT), such as the two parameter logistic model, three parameter logisitic model, graded response model, generalized partial credit model, testlet model, and generalized testlet models. I demonstrate how the code in this article can easily be extended to fit more complicated IRT models, when the data at hand require a more sophisticated approach. Specifically, I describe modifications to the BUGS code that accommodate longitudinal item response data. Keywords: education, psychometrics, latent variable model, measurement model, Bayesian inference, Markov chain Monte Carlo, longitudinal data. 1. Introduction In this paper, I present BUGS (Gilks, Thomas, and Spiegelhalter 1994) code to fit several models from item response theory (IRT). Several different software packages are available for fitting IRT models. These programs include packages from Scientific Software International (du Toit 2003), such as PARSCALE (Muraki and Bock 2005), BILOG-MG (Zimowski, Mu- raki, Mislevy, and Bock 2005), MULTILOG (Thissen, Chen, and Bock 2003), and TESTFACT (Wood, Wilson, Gibbons, Schilling, Muraki, and Bock 2003). The Comprehensive R Archive Network (CRAN) task view \Psychometric Models and Methods" (Mair and Hatzinger 2010) contains a description of many different R packages that can be used to fit IRT models in the R computing environment (R Development Core Team 2010). Among these R packages are ltm (Rizopoulos 2006) and gpcm (Johnson 2007), which contain several functions to fit IRT models using marginal maximum likelihood methods, and eRm (Mair and Hatzinger 2007), which contains functions to fit several variations of the Rasch model (Fischer and Molenaar 1995). -
Operator Overloading ______
Chapter 10: Operator Overloading _________________________________________________________________________________________________________ Consider the following C++ code snippet: vector<string> myVector(kNumStrings); for(vector<string>::iterator itr = myVector.begin(); itr != myVector.end(); ++itr) *itr += "Now longer!"; Here, we create a vector<string> of a certain size, then iterate over it concatenating “Now longer!” to each of the strings. Code like this is ubiquitous in C++, and initially does not appear all that exciting. However, let's take a closer look at how this code is structured. First, let's look at exactly what operations we're performing on the iterator: vector<string> myVector(kNumStrings); for(vector<string>::iterator itr = myVector.begin(); itr != myVector.end(); ++itr) *itr += "Now longer!"; In this simple piece of code, we're comparing the iterator against myVector.end() using the != operator, incrementing the iterator with the ++ operator, and dereferencing the iterator with the * operator. At a high level, this doesn't seem all that out of the ordinary, since STL iterators are designed to look like regular pointers and these operators are all well-defined on pointers. But the key thing to notice is that STL iterators aren't pointers, they're objects, and !=, *, and ++ aren't normally defined on objects. We can't write code like ++myVector or *myMap = 137, so why can these operations be applied to vector<string>::iterator? Similarly, notice how we're concatenating the string “Now longer!” onto the end of the string: vector<string> myVector(kNumStrings); for(vector<string>::iterator itr = myVector.begin(); itr != myVector.end(); ++itr) *itr += "Now longer!"; Despite the fact that string is an object, somehow C++ “knows” what it means to apply += to strings. -
Property Mapping: a Simple Technique for Mobile Robot Programming
Property Mapping: a simple technique for mobile robot programming Illah R. Nourbakhsh The Robotics Institute, Carnegie Mellon University Pittsburgh, PA 15213 [email protected] Abstract In this paper we present robot observability as a The mobile robot programming problem is a software predictor for diagnostic transparency. Then, we present a engineering challenge that is not easily conquered using language-independent technique called property mapping contemporary software engineering best practices. We for constructing robot programs that are diagnostically propose robot observability as a measure of the diagnostic transparent and thereby achieve high degrees of transparency of a situated robot program, then describe reliability. property mapping as a simple, language-independent approach to implementing reliable robot programs by maximizing robot observability. Examples from real- The Robot Programming Problem world, working robots are given in Lisp and Java. A mobile robot is a situated automata, or a module that comprises one part of a closed system together with the Introduction environment. Fig. 1 shows the standard depiction of a robot, with its outputs labeled as actions and the outputs The recent availability of inexpensive, reliable robot of the environment in turn labeled as percepts. chassis (e.g. ActivMedia Pioneer, IS-Robotics Magellan, Nomad Scout) has broadened the accessibility of mobile robotics research. Because these robots consist of fixed E hardware out-of-the-box, this technology is shifting the actions A P percepts emphasis of mobile robot research from a joint hardware and software design process toward hardware-unaware R mobile robot programming. This is a software design problem, and yet software Figure 1: The standard view of an embedded robot engineering best practices are not very helpful. -
C++ Properties -- a Library Solution
Document Number: SC22/WG21/N1615=04-0055 Date: 2004-04-09 Author: Lois Goldthwaite Email: [email protected] C++ Properties -- a Library Solution N1600 is a summary of the "property" language extension that is proposed for C++/CLI. I can't help feeling that this is an effort to impose an alien idiom on C++. There is too much of "the compiler will perform black magic behind your back" in it. There are too many ways in which the programmer must be aware that some [pseudo-]data members must be handled in different ways from [real] data members. The C++/CLI draft spec (N1608)says in 8.8.4 and 18.4 that "A property is a member that behaves as if it were a field." I think "behaves" is absolutely the wrong word to use here. A property is behavior that pretends to be state. From an OO design point of view, I think this is A Bad Idea. Behaviour should be visible; state should not. Further on, the document continues, "the X and Y properties can be read and written as though they were fields. In the example above, the properties are used to implement data hiding within the class itself." The subtle advantage of "hiding" a private data member by treating it as a public data member escapes me. Properties are just syntactic saccharine for getter and setter member functions for individual fields. C++ experts have spent years trying to educate people NOT to use public data, to use member functions instead, and now we propose to introduce something that looks just like public data? Do we really want to try to teach people that public fields are still bad, but properties are good, even though they look just the same from outside the class? Moreover, these public fields have side effects! There is a danger that too many novice programmers will prototype their designs using public fields, with the intent of changing them to properties later, if and when it proves necessary, and the general quality of code will suffer because of it. -
A Quick Reference to C Programming Language
A Quick Reference to C Programming Language Structure of a C Program #include(stdio.h) /* include IO library */ #include... /* include other files */ #define.. /* define constants */ /* Declare global variables*/) (variable type)(variable list); /* Define program functions */ (type returned)(function name)(parameter list) (declaration of parameter types) { (declaration of local variables); (body of function code); } /* Define main function*/ main ((optional argc and argv arguments)) (optional declaration parameters) { (declaration of local variables); (body of main function code); } Comments Format: /*(body of comment) */ Example: /*This is a comment in C*/ Constant Declarations Format: #define(constant name)(constant value) Example: #define MAXIMUM 1000 Type Definitions Format: typedef(datatype)(symbolic name); Example: typedef int KILOGRAMS; Variables Declarations: Format: (variable type)(name 1)(name 2),...; Example: int firstnum, secondnum; char alpha; int firstarray[10]; int doublearray[2][5]; char firststring[1O]; Initializing: Format: (variable type)(name)=(value); Example: int firstnum=5; Assignments: Format: (name)=(value); Example: firstnum=5; Alpha='a'; Unions Declarations: Format: union(tag) {(type)(member name); (type)(member name); ... }(variable name); Example: union demotagname {int a; float b; }demovarname; Assignment: Format: (tag).(member name)=(value); demovarname.a=1; demovarname.b=4.6; Structures Declarations: Format: struct(tag) {(type)(variable); (type)(variable); ... }(variable list); Example: struct student {int -
Lecture 2: Introduction to C Programming Language [email protected]
CSCI-UA 201 Joanna Klukowska Lecture 2: Introduction to C Programming Language [email protected] Lecture 2: Introduction to C Programming Language Notes include some materials provided by Andrew Case, Jinyang Li, Mohamed Zahran, and the textbooks. Reading materials Chapters 1-6 in The C Programming Language, by B.W. Kernighan and Dennis M. Ritchie Section 1.2 and Aside on page 4 in Computer Systems, A Programmer’s Perspective by R.E. Bryant and D.R. O’Hallaron Contents 1 Intro to C and Unix/Linux 3 1.1 Why C?............................................................3 1.2 C vs. Java...........................................................3 1.3 Code Development Process (Not Only in C).........................................4 1.4 Basic Unix Commands....................................................4 2 First C Program and Stages of Compilation 6 2.1 Writing and running hello world in C.............................................6 2.2 Hello world line by line....................................................7 2.3 What really happens when we compile a program?.....................................8 3 Basics of C 9 3.1 Data types (primitive types)..................................................9 3.2 Using printf to print different data types.........................................9 3.3 Control flow.......................................................... 10 3.4 Functions........................................................... 11 3.5 Variable scope........................................................ 12 3.6 Header files......................................................... -
A Tutorial Introduction to the Language B
A TUTORIAL INTRODUCTION TO THE LANGUAGE B B. W. Kernighan Bell Laboratories Murray Hill, New Jersey 1. Introduction B is a new computer language designed and implemented at Murray Hill. It runs and is actively supported and documented on the H6070 TSS system at Murray Hill. B is particularly suited for non-numeric computations, typified by system programming. These usually involve many complex logical decisions, computations on integers and fields of words, especially charac- ters and bit strings, and no floating point. B programs for such operations are substantially easier to write and understand than GMAP programs. The generated code is quite good. Implementation of simple TSS subsystems is an especially good use for B. B is reminiscent of BCPL [2] , for those who can remember. The original design and implementation are the work of K. L. Thompson and D. M. Ritchie; their original 6070 version has been substantially improved by S. C. Johnson, who also wrote the runtime library. This memo is a tutorial to make learning B as painless as possible. Most of the features of the language are mentioned in passing, but only the most important are stressed. Users who would like the full story should consult A User’s Reference to B on MH-TSS, by S. C. Johnson [1], which should be read for details any- way. We will assume that the user is familiar with the mysteries of TSS, such as creating files, text editing, and the like, and has programmed in some language before. Throughout, the symbolism (->n) implies that a topic will be expanded upon in section n of this manual. -
Command $Line; Done
http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA -
Property Conveyances As a Programming Language
Property Conveyances as a Programming Language Shrutarshi Basu∗ Nate Foster James Grimmelmann Harvard University Cornell University Cornell Law School & Cornell Tech Cambridge, MA, USA Ithaca, NY, USA New York, NY, USA [email protected] [email protected] [email protected] Abstract 1 Introduction Anglo-American law enables property owners to split up Many legal issues depend on vague, open-ended standards. rights among multiple entities by breaking their ownership For example, nuisance law prohibits “unreasonable” interfer- apart into future interests that may evolve over time. The con- ence with neighbors’ use of land. What counts as “unreason- veyances that owners use to transfer and subdivide property able” depends on an eight-factor balancing test, and many of rights follow rigid syntactic conventions and are governed the individual factors are themselves vague and open-ended, by an intricate body of interlocking doctrines that determine including “the social value that the law attaches to the pri- their legal eect. These doctrines have been codied, but mary purpose of the conduct;” and “the suitability of the only in informal and potentially ambiguous ways. particular use or enjoyment invaded to the character of the This paper presents preliminary work in developing a locality.” [American Law Institute 1979] A lawyer who wants formal model for expressing and analyzing property con- to know whether a client’s cement plant will be considered veyances. We develop a domain-specic language capable a nuisance will have to research numerous previous cases, of expressing a wide range of conveyances in a syntax ap- gather extensive facts about the plant and its neighbors, and proximating natural language. -
Dealing with Properties
Dealing with Properties Martin Fowler [email protected] lmost every object you create needs properties: some statement about the object. A person may have a height, a company may have a CEO, a flight may have a flight Anumber. There are a number of ways to model properties. In this article I will explore some of these ways and when you may want to use them. I’ve often seen patterns touch on this subject, but they usually only cover part of the picture. Here I want to cover the issue more broadly to give a better discussion of the options. The most common, and the simplest case is to use a Fixed Property, that is just declare the attribute on the class. In the vast majority of cases that is all you need to do. Fixed properties begin to fail when you have a large amount of them, or you need to change them frequently, possibly at run time. These forces lead you to the varieties of Dynamic Property. All dynamic properties have the quality of a parameterized attribute where to query a property you need to use a query method with a parameter. The simplest of these is the Flexible Dynamic Property where the parameter is just a string. This makes it easy to define and use properties, but is difficult to control. If you need that control you can use a Defined Dynamic Property where your parameters must be instances of some class. A further step of control allows you to strongly type your dynamic property with a Typed Dynamic Property. -
The C Programming Language
The C programming Language The C programming Language By Brian W. Kernighan and Dennis M. Ritchie. Published by Prentice-Hall in 1988 ISBN 0-13-110362-8 (paperback) ISBN 0-13-110370-9 Contents ● Preface ● Preface to the first edition ● Introduction 1. Chapter 1: A Tutorial Introduction 1. Getting Started 2. Variables and Arithmetic Expressions 3. The for statement 4. Symbolic Constants 5. Character Input and Output 1. File Copying 2. Character Counting 3. Line Counting 4. Word Counting 6. Arrays 7. Functions 8. Arguments - Call by Value 9. Character Arrays 10. External Variables and Scope 2. Chapter 2: Types, Operators and Expressions 1. Variable Names 2. Data Types and Sizes 3. Constants 4. Declarations http://freebooks.by.ru/view/CProgrammingLanguage/kandr.html (1 of 5) [5/15/2002 10:12:59 PM] The C programming Language 5. Arithmetic Operators 6. Relational and Logical Operators 7. Type Conversions 8. Increment and Decrement Operators 9. Bitwise Operators 10. Assignment Operators and Expressions 11. Conditional Expressions 12. Precedence and Order of Evaluation 3. Chapter 3: Control Flow 1. Statements and Blocks 2. If-Else 3. Else-If 4. Switch 5. Loops - While and For 6. Loops - Do-While 7. Break and Continue 8. Goto and labels 4. Chapter 4: Functions and Program Structure 1. Basics of Functions 2. Functions Returning Non-integers 3. External Variables 4. Scope Rules 5. Header Files 6. Static Variables 7. Register Variables 8. Block Structure 9. Initialization 10. Recursion 11. The C Preprocessor 1. File Inclusion 2. Macro Substitution 3. Conditional Inclusion 5. Chapter 5: Pointers and Arrays 1. -
R Programming for Data Science
R Programming for Data Science Roger D. Peng This book is for sale at http://leanpub.com/rprogramming This version was published on 2015-07-20 This is a Leanpub book. Leanpub empowers authors and publishers with the Lean Publishing process. Lean Publishing is the act of publishing an in-progress ebook using lightweight tools and many iterations to get reader feedback, pivot until you have the right book and build traction once you do. ©2014 - 2015 Roger D. Peng Also By Roger D. Peng Exploratory Data Analysis with R Contents Preface ............................................... 1 History and Overview of R .................................... 4 What is R? ............................................ 4 What is S? ............................................ 4 The S Philosophy ........................................ 5 Back to R ............................................ 5 Basic Features of R ....................................... 6 Free Software .......................................... 6 Design of the R System ..................................... 7 Limitations of R ......................................... 8 R Resources ........................................... 9 Getting Started with R ...................................... 11 Installation ............................................ 11 Getting started with the R interface .............................. 11 R Nuts and Bolts .......................................... 12 Entering Input .......................................... 12 Evaluation ...........................................