UNIVERSITY OF CINCINNATI
Date:______
I, ______, hereby submit this work as part of the requirements for the degree of: in:
It is entitled:
This work and its defense approved by:
Chair: ______
A thesis submitted to the
Division of Graduate Studies and Research
of the University of Cincinnati in partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
in the Department of Biological Sciences
of the College of Arts and Sciences
2008
Targeted Mutation of Genes Implicated in
DNA Replication and Repair in Sulfolobus acidocaldarius
by
Laura A. Runck
B.S., Bowling Green State University, 2001
Committee Chair: Dr. Dennis W. Grogan Abstract
The main goals of this research were to evaluate different experimental methods for gene cloning, disruption, and transfer to the Sulfolobus acidocaldarius genome, and to determine function of the genes in vivo. S. acidocaldarius and other hyperthermophilic archaea thrive at temperatures 80◦C and above which would typically render the DNA unstable. It is not well understood how the hyperthermophilic archaea such as Sulfolobus acidocaldarius maintain their DNA, but genomic analyses have found some homologs to known DNA repair and replication genes. These include genes implicated in nucleotide excision repair, photoreactivational repair, alternative excision repair, homologous recombinational repair, and DNA replication. Topoisomerase-mediated cloning of PCR products provided the most reliable cloning method, whereas disruption of cloned genes was more difficult. One cloned disruption (trpC::pyrE) made using restriction enzymes and ligase, and two linear PCR disruptions (phr::pyrE; uvde::pyrE) made by a direct PCR method, were tested for integration into the S. acidocaldarius genome. Analysis of successful transformants by PCR and sequencing indicate that all three disruptions have been integrated into the S. acidocaldarius via homologous recombination. In two cases the phenotypes have been confirmed. The trpC disruptant (DG251) is a tryptophan auxotroph and the phr disruptant (LR10) lacks photoreactivational repair. This work is significant because targeted gene disruption has not been reported for S. acidocaldarius and it provides more genetic tools for use in Sulfolobus spp. It also gives evolutionary insights into the diversity and similarities among the three domains of life, and even more specifically evolutionary insight into the molecular processes of the hyperthermophilic archaea.
iii
iv Acknowledgments
I would first like to thank Dr. Dennis Grogan for being a wonderful advisor and teacher, and for all of the time and help throughout my graduate career. I would also like to thank my research advisory committee, Dr. Brian Kinkle and Dr. Charlotte Paquin for their help and suggestions in making this research a success.
I would like to thank all past and present Grogan lab members – Reena Mackwan for helping me getting adjusted to the lab, Cynthia acidocaldarius Bellamy for starting our journal club, never ending support and help with everything and a great friendship,
Dominic Mao for being the practical one in the lab, always helping me on the chalk board and being a great friend, and Janine Rockwood for keeping the lab in shape and always being entertaining. Good luck to all of you guys!
I would also like to acknowledge my family and friends for their continued support even though you have no idea what I really do. Thanks!
Finally, I would like to thank my lovely husband, Mike for being so supportive and patient throughout my graduate career. I’m finally done with school!
v Table of Contents
Committee Approval Page i
Title Page ii
Abstract iii
Acknowledgments v
Table of Contents vi
List of Tables viii
List of Figures ix
List of Abbreviations xi
Chapter I. DNA Replication and Repair in Archaea
1. Background of Archaea 1
2. DNA Replication in Archaea 3
3. DNA Repair in Archaea 6
4. Importance of Studying These Archaeal Processes 9
5. Biology of Sulfolobus acidocaldarius 11
6. Genes Implicated in DNA Repair in Sulfolobus acidocaldarius 12
Based on Sequence Similarity
7. Genes Implicated in DNA Replication in Sulfolobus acidocaldarius 24
Based on Sequence Similarity
8. Determining Functions of Sulfolobus Genes 25
9. Gene Disruption 30
10. References 31
Chapter II. Evaluating Techniques for Cloning Sulfolobus Genes
vi 1. Methods Evaluated 45
2. Cloning by PCR, Restriction Digestion and Ligation 48
3. Cloning by PCR and –G (-A) Overhang Vectors 57
4. Summary 61
5. References 62
Chapter III. Evaluating Methods for Disruption of Sulfolobus Genes
1. Methods Evaluated 64
2. PCR, Restriction Digestion and Ligation 64
3. Overlap Extension PCR (OEP) 66
4. USER™ 68
5. Inverse PCR 70
6. Direct-Tailing by PCR 73
7. Summary 75
8. References 76
Chapter IV. Integration into the Sulfolobus acidocaldarius Genome
1. Introduction 79
2. Positive Control 79
3. Direct-Tailed Constructs 80
4. Phenotypic Determination of phr Mutant 82
5. Summary 84
6. Future Directions and Significance 85
7. References 86
vii List of Tables
Number Title Page
Table 2.1 Primers used to amplify genes cloned 46
Table 2.2 Summary of plasmids containing cloned genes with method 47
of cloning described
Table 3.1 Primers used for direct-tailing by PCR 74
Table 4.1 Sulfolobus acidocaldarius strains used for phenotypic 80
determination experiments
Table 4.2 Evidence for photoreactivational repair as a ratio between 84
photoreactivated:dark-maintained viability
viii List of Figures
Number Title Page
Figure 2.1 Gel verification of amplification of Sulfolobus solfataricus pyrE 50
Figure 2.2 Gel verification of Sso pyrE ligation into pNEB193 to create pLK3a 50
Figure 2.3 Screening pLK3a with SspI and SpeI to verify cloning 51
Figure 2.4 Restriction enzyme analysis to verify insertion of cml gene into 53
pLK3a
Figure 2.5 Map of pLK5a 53
Figure 2.6 Illustration of how the three homologs of Saccharomyces cerevisiae 55
RAD genes were cloned into pUC19
Figure 2.7 Restriction enzyme analysis verifying cloning of rad1 into pUC19, 56
creating pRAD1
Figure 2.8 Restriction enzyme analysis verifying cloning of rad2 into pUC19, 56
creating pLK6a
Figure 2.9 Restriction enzyme analysis verifying cloning of rad25 into pUC19, 57
creating pRAD25
Figure 2.10 Restriction enzyme analysis verifying cloning of phr into 60
TOPO vector
Figure 3.1 Map of pLK4A1f 63
Figure 3.2 General schematic of OEP 67
Figure 3.3 Schematic of USER method 70
Figure 3.4 Schematic of inverse PCR 72
Figure 3.5 Schematic of direct-tailing by PCR 75
ix Figure 4.1 Verification of phr-“tailed” Sso pyrE integration into PHR 81
locus via PCR screening of LR10 genomic DNA
Figure 4.2 Verification of uvde-“tailed” Sso pyrE integration into UVDE 81
locus via PCR screening of LR12 genomic DNA
Figure 4.3 Log survival of LR10, DG185, and DG251 after UV exposure 83
and white light illumination
x List of Abbreviations and Symbols aa…..amino acid
AER…..alternative excision repair amp…..ampicillin ampR…..ampicillin resistance ampS…..ampicilllin sensitive
A-T…...Adenine - Thymine
ATP…..adenosine 5’-triphosphate? bla…..betalactamase? bp…..base pairs cfu…..colony forming unit cml…..chloramphenicol acetyl transferase cmlR…..chloramphenicol acetyl transferase resistance cmlS…..chloramphenicol acetyl transferase sensitive
C-terminal…..carboxy-terminal?
CPDs…..cyclobutane pyrimidine dimers
DGS….Aspartic acid, Glycine, Serine
DNA…..deoxyribonucleic acid
DNase…..deoxyribonuclease dNTPs…..deoxyribonucleotide triphosphates ds…..double-stranded
DSB(s)…..double strand break(s)
FAD…..flavin adenine dinucleotide
xi Foa…..5-fluoroorotic acid
Foar….. 5-fluoroorotic acid resistance
G+C…..Guanine + Cytosine
GY…..Glycine, Tyrosine
HR…..Homologous recombination(al) hr…..hour
IPTG…..Isopropyl-β-D-1-thiogalactopyranoside kan…..kanamycin kb…..kilobase
Mbp…..mega base pairs
MCM…..minichromosome maintenance proteins mg…..milligram
Mg2+…..magnesium mins…..minutes ml…..milliliter
MMR…..mismatch repair
Mn2+…..manganese
MTHF…..methenyltetrahydrofolate
MW…..molecular weight standard
N-terminal…..amino-terminal
NEB…..New England Biolabs, Inc. (Ipswich, MA)
NER……Nucleotide excision repair nm…..nanometers
xii nt…..nucleotide
OB fold…..oligonucleotide/oligosaccharide binding fold
OEP…..Overlap extension PCR
ORBs…..origin recognition boxes
ORC…..origin recognition complex
RE(s)…..restriction endonuclease(s)
RNA…..ribonucleic acid
RPA…..Replication Protein A
PCNA…..proliferating cell nuclear antigen
PCR…..Polymerase chain reaction
PfuCx…..PfuTurbo® Cx Hotstart DNA Polymerase
PRE…..photoreactivation
Pyr<>Pyr…..pyrimidine dimer s…..second
Sac…..Sulfolobus acidocaldarius
Sdil…..Sulfolobus dilution buffer spp…...species ss…..single-stranded
SSBs…..single stranded binding proteins
Sso…..Sulfolobus solfataricus tRNA…..transfer ribonucleic acid
U…..unit
UDG…..Uracil DNA glycosylase
xiii USER™…..Uracil-specific excision reagent
UV…..ultraviolet
UVDE…..UV DNA damage endonuclease
µg…..microgram
µl…..microliter
WT…..wild type
Xgal…..5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside
XT…..xylose, tryptone media
YT…..yeast extract tryptone media
2-D…..2 dimensional
3’…..three prime end of DNA with a terminal hydroxyl group
5’…..five prime end of DNA with a terminal phosphate group
6-4PPs…..pyrimidine-pyrimidone 6-4 photoproducts
◦C…..degrees Celsius
Ψ-Ψ-C-G…..pseudouridine-pseudouridine-cytidine-guanine
T- Ψ-C-G…..threonine-pseudouridine-cytidine-guanine
Δ…..deletion
xiv Chapter I. DNA Replication and Repair in Archaea
1. Background of Archaea
Archaea are the third domain of life that were discovered by Woese and colleagues in the late 1970s using ribosomal RNAs (Fox et al., 1977). The archaea are phylogenetically separated into two main kingdoms, Euryarchaeota (methanogens, halophiles) and Crenarchaeota (sulfur metabolizers). The archaea are also physiologically diverse; the mesophilic and psychrophilic archaea are ubiquitous (Cavicchioli, 2006;
Forterre, 2002), while the habitats of extremophiles are extreme and finite, but also diverse (Kletzin, 2007).
There are many variations to the extreme environments that archaea, including the methanogens, thrive in such as temperatures ranging from 80 to 115◦C
(hyperthermophiles), volcanic solfataric fields and hot springs, submarine hydrothermal systems, and abyssal hot vent systems (Stetter, 1996). The environments are also diverse in the range of salinity, acidicity, alkalinity, and also ranges of anaerobic enviroments
(Kletzin, 2007). Methanogens (Methanothermus, Methanothermobacter,
Methanocaldococcus) and other archaea (Sulfolobus, Archaeoglobales, Thermococcales) inhabit thermophilic (50 to 80◦C) or hyperthermophilic (80◦C and up) environments. The
Halobacteriales, halophiles, inhabit hypersaline environments, which can vary in their pH range (neutral to alkaline) and various ions (NaCl and Mg2+) (Kletzin, 2007).
Thermococcales are an example of heterotrophic archaea that require elemental sulfur and grow under anaerobic conditions. Sulfolobus spp. are examples of hyperthermoacidophiles growing at temperatures exceeding 80◦C and at low pH (~3)
(Kletzin, 2007).
1 The archaea are cellularly similar to the bacteria because both are prokaryotic, however, molecularly the archaea are more closely related to eukaryotes (Whitman et al.,
1999). Archaea do have some defining characteristics which include: (a) ether-linked, branched-chain lipids, (b) unique DNA-dependent RNA polymerases, but more like eukarya than bacteria (Zillig et al., 1979), (c) unique side arm tRNA sequence of Ψ-Ψ-C-
G, as compared to T- Ψ-C-G for bacteria and eukarya, and the “D-loop” does not contain dihydrouridine (Gupta, 1984), (d) cell walls lacking peptidoglycan (Kandler and Hippe,
1977) and (e) limited antibiotic sensitivities as compared to bacteria (Cammarano et al.,
1985).
In general, molecular processes such as replication, recombination, and repair of
DNA in archaea are more similar to eukaryotes than bacteria (Bell and Jackson, 1998).
Therefore, archaea can be thought of as a more simplified version of the more complex eukaryotic system. However, more information is still needed about how archaea are replicating and repairing DNA.
Hyperthermophilic Archaea. As mentioned above, hyperthermophiles require environments (high temperatures) that would typically denature DNA in other organisms, suggesting that hyperthermophiles may have novel mechanisms or adaptations to maintain DNA stability in such conditions. However, the mechanisms that allow these organisms to thrive in extreme environments are not known. There are extrinsic factors such as high salt concentrations and small DNA-binding proteins which have been proposed as ways archaea provide DNA stability (Grogan, 1998). Reverse gyrase appears to be the only hyperthermophilic specific protein and was originally thought to be providing stability to the DNA exposed to high temperatures, however this was later
2 disproved by Marguet and Forterre (1994). So far there is little evidence for thermostability by intrinsic factors. Most hyperthermophilic archaea have a low G+C
DNA content suggesting that these organisms are using means other than hydrogen bonding to stabilize their DNA (Grogan, 1998 and 2000).
2. DNA Replication in Archaea
DNA replication is a process that must be accurate in propagating genetic information, but it must also allow for evolutionary selection. This process is energetically costly for the cell and once started, replication must be completed.
Replication is initiated at the origin of replication where a DNA helicase is recruited to unwind the dsDNA, exposing ssDNA. The ssDNA is stabilized through binding of single stranded binding (SSBs) proteins and synthesis of new DNA is initiated by primers, which are extended by DNA polymerases. Although these activities are analogous for all three domains, archaeal replication is more similar to eukaryotic replication as compared to bacteria (Kelman and White, 2005). Thus archaea could be used as a simplified model system for understanding the more complex eukaryotic DNA replication system.
Origins of Replication. Although archaeal chromosomal organization is more similar to bacteria than to eukaryotes, the number of origins of replication in archaea varies from one to several, whereas bacteria have only one origin of replication and eukarya have many (Robinson and Bell, 2005). For example, Sulfolobus spp. have three origins of replication (Lundgren et al., 2004; Robinson et al., 2004), Escherichia coli has one origin of replication (Mott and Berger, 2007), and Saccharomyces cerevisiae has over 400 origins of replication (Wyrick et al., 2001). A-T rich stretches of sequence
3 (Berquist and DasSarma, 2003; Robinson et al., 2004) similar to those found in bacteria
(Robinson and Bell, 2005) and origin recognition boxes (ORBs), which are inverted repeats that bind initiator proteins (Robinson et al., 2004), are common characteristics of archaeal origins of replication. It has been suggested that some archaea may have multiple origins of replication to compensate for their slow replication rate (Lundgren et al., 2004).
Initiation of Replication. In archaea, the Cdc6 proteins (Cdc6-1, Cdc6-2, Cdc6-
3) initiate replication by binding to the origin (Robinson et al., 2004), and are also thought to load the replicative helicase, MCM (minichromosome maintenance proteins)
(Lao-Sirieix et al., 2007). The archaeal MCM can vary in the number of subunits but in general is a ring-shaped structure comprised of an N-terminal, an AAA+ ATPase domain, and a C-terminal domain. The central hole of the ring is wide enough for dsDNA and positioned to the center of the hole are β-hairpins (Lao-Sirieix et al., 2007). In eukarya, the origin recognition complex (ORC) binds to the origin of replication and once bound it recruits Cdc6 and additional factors, such as MCM complex (Bell and Dutta, 2002).The exact mechanism of how MCM unwinds the DNA is unknown, but still results in ssDNA for elongation of DNA synthesis. In contrast, in bacterial systems the DNA is melted by the binding of the initiator protein, DnaA, to the origin, which along with the protein
DnaC, then recruits the replicative helicase, DnaB (Kornberg, 1988).
Once the ssDNA is exposed, it is stabilized with single-stranded binding proteins
(SSBs) (Lao-Sirieix et al., 2007). The SSBs have an oligonucleotide/oligosaccharide- binding fold (OB fold) which is used to bind to the DNA (Murzin, 1993). The archaeal
SSBs vary in similarity to the bacterial SSBs, which have an acidic C-terminal, and the
4 eukaryal SSB (Lao-Sirieix et al., 2007), Replication Protein A (RPA) (Brill and Stillman,
1991), which has a C-terminal zinc finger motif (Lao-Sirieix et al., 2007).
DNA Synthesis. DNA primases are DNA-dependent RNA polymerases that initiate DNA synthesis, once on the leading strand and several times on the lagging strand, and are required by DNA polymerases for replication. In archaea, primases are made up of a catalytic and regulatory subunit (Lao-Sirieix et al., 2007), which together are capable of synthesizing both RNA and DNA (Lao-Sirieix and Bell, 2004). The archaeal catalytic subunit is homologous to the eukaryal p48 catalytic subunit of the
DNA polymerase α-primase complex (Bocquier et al., 2001).
Once the primases generate primers, DNA polymerases extend primers to synthesize new DNA (Hubscher et al., 2002). Archaea use one to several B- and D- family replicative polymerases to synthesis DNA, whereas eukaryotes synthesize DNA using three B-family polymerases and bacteria use C-family polymerases (Lao-Sirieix et al., 2007). Unique to the archaea, are polymerases with “scan-ahead” capabilities for uracil in DNA, which result from the deamination of cytosine residues (White, 2007).
These polymerases have a pocket in the N-terminal domain that recognizes the uracil and will stall replication (Shuttleworth et al., 2004). It is assumed that uracil glycosylase is recruited to repair the template so that replication can be resumed (Dionne and Bell,
2005).
To increase processivity of primer extension, sliding clamps work to keep necessary replication proteins secured to the DNA (Yao et al., 1996). The sliding clamps are structurally and functionally similar across all domains, although differing in amino acid structure. All sliding clamps require an AAA+ ATPase clamp loader to load onto the
5 DNA. In eukaryotic and archaeal systems, RF-C loads the sliding clamp proliferating cell nuclear antigen (PCNA), which is a homotrimer (Cullmann et al., 1995; Lao-Sirieix et al.,
2007). In E. coli the β-clamp is a homodimer and is loaded onto the DNA via the γ- complex (Stukenberg et al., 1991; Kuriyan and O’Donnell, 1993).
3. DNA Repair in Archaea
Archaeal DNA repair pathways have some unique features, but are more similar to eukaryotic systems rather than bacterial. Specifically, for hyperthermophilic archaea, it would seem that there would be detrimental effects (blocking replication or introducing mutation) of the harsh environments on the DNA (Grogan, 2000); however, many archaea including, Sulfolobus acidocaldarius, seem to have high levels of genomic stability (Grogan et al., 2001).
Nucleotide Excision Repair. Nucleotide excision repair (NER) is used to repair various lesions such as: chemical adducts, inter- and intra-strand crosslinks, protein-DNA crosslinks, and UV photoproducts (White, 2007). Although different proteins are used in bacteria vs. eukaryotes, the general mechanism of NER is the same: the damage is recognized, excised, and the gap is filled by DNA polymerase and ligase. NER is also referred to as “dark repair” to differentiate between photoreactivational “light” repair
(White, 2007).
An NER pathway like that of bacteria (UvrABC) is present in mesophilic archaea, whereas all archaea, including hyperthermophiles have several homologues of the eukaryotic NER system (XPF-ERCC1, and Fen-1/XPG, XPB, XPD) (Goosen and
Moolenaar, 2008), although homologs of the eukaryotic damage recognition proteins,
6 XPA and XPC, are missing (Grogan, 2004). This may suggest that archaea are using several proteins for various functions, or that they are using unknown proteins to repair damage that would typically be repaired by NER (White, 2007).
Base Excision Repair. This type of repair recognizes DNA bases damaged by oxidation, hydrolysis, and methylation. The damaged base is removed by DNA glycosylases, creating an abasic site and/or a modified 3’ end. These sites or modified ends are further processed by an AP endonuclease into substrates for DNA polymerase, and then DNA ligase seals the gap. This type of repair exists in all three domains of life
(Grogan, 2007; White, 2007).
Mismatch Repair. Mismatch repair (MMR) detects and corrects mismatched bases such as substitutions and insertion-deletions, typically generated during DNA replication (Kunkel and Erie, 2005; White, 2007). To summarize, the mismatch is detected (MutS and MutL), a nick is made in the newly synthesized, unmethylated DNA
(MutH), DNA containing the mismatch is excised (DNA helicase II and ss exonucleases), and the gap is filled and ligated (DNA polymerase and DNA ligase) (Iyer et al., 2006;
Kunkel and Erie, 2005). Based on genomic analyses it has been found that only the hyperthermophilic archaea are missing a conventional MMR system, specifically the damage recognition proteins, MutS and MutL, and as a result may have a novel MMR pathway or may lack MMR (Grogan, 2004).
Photoreactivation. Cyclobutane pyrimidine dimers and 6-4-photoproducts are the major lesions caused by UV radiation, and lead to distortion in the helix. This distortion can in turn block replication by stalling the DNA polymerase and transcription.
To circumvent these lesions, the damage is reversed. Photolyase is an enzyme that uses
7 light energy to reverse the dimerization (“light repair”). Typically, photolyases are only found in those archaea that maybe exposed to UV in their natural habitat. For example, archaea that inhabit the deep seas are not exposed to UV and therefore would not require such a protein (Kelman and White, 2005).
Alternative Excision Repair. The substrates of DNA photolyase are also substrates for ultraviolet DNA damage endonuclease (UVDE) which is used to repair
UV-induced damage in a light-independent manner. UVDE creates a single stranded break in the DNA by making an incision 5’ to the lesion, and this break initiates the alternative repair process. This type of repair appears in a number of bacteria and eukaryotes, but is missing from most archaea; one notable exception is Sulfolobus acidocaldarius (Chen et al., 2005).
Translesion Synthesis. Also found in archaea is a Y family error-prone DNA polymerase (S. solfataricus, Dpo4 (Boudsocq et al., 2001); S. acidocaldarius, Dbh
(Boudsocq et al., 2004)) which can bypass ultraviolet (UV) photoproducts (pyrimidine dimers and abasic sites) and potentially cause frameshift mutations when replicating undamaged DNA (Grogan, 2007). This type of polymerase is found in bacteria and eukaryotes, and is also typically found in archaea that are exposed to UV radiation, like
Sulfolobus. Photolyases are found in accordance with these Y family polymerases, suggesting that both may be essential for survival when heavily exposed to UV (Kelman and White, 2005).
Homologous Recombinational Repair. Double strand breaks (DSBs) are detrimental for a cell and pose the problem that the opposite strand cannot be used to repair the damage. However, homologous recombinational (HR) repair is initiated by
8 DSBs and can also repair stalled replication forks (Grogan, 2007). One potential downfall for HR repair is the requirement of > 50nt of sequence for strand exchange (Grogan,
2007). Of the sequenced archaeal genomes, all have homologs to the eukaryal double strand break proteins RadA/Rad51, Mre11, Rad50, and also Hjc, the Holliday-junction resolvase (White, 2007). It is also common to find the archaeal Rad50 and Mre11 genes in a complex with HerA and NurA (Constantinesco et al., 2004).
The DSBs initiate exonuclease activity to create single strands which can anneal to the complementary strand in the other DNA duplex. These strands cross to give the
Holliday junction, which physically links to the strands together. The DNA is synthesized using the other strand as a template and then it is ligated. The Holliday junction will move across the chromosome to fill in the gap in a process referred to as branch migration. Because the strands are still linked another nick needs to be created to resolve the Holliday junction and separate the duplexes. This is done by proteins called resolvases, which nick the strands. Resolvases have been identified across all domains;
RuvC and RusA in E. coli, Hjc and Hje in archaea, Cce1 in S. cerevisiae and Ydc2 in S. pombe (Lui and West, 2004).
4. Importance of Studying These Archaeal Processes
Archaeal replication and repair are an important focus as these processes may hold valuable information about the evolutionary divergence between the three domains.
In most cases, the archaeal information processes resemble that of the eukaryotes, and therefore could provide a more simplified understanding of the more complex eukaryotic
9 systems. The archaea also resemble the bacteria in the chromosomal and cellular arrangement (Allers and Mevarech, 2005).
Hyperthermophilic archaeal proteins have many potential uses in biotechnology
(Adams and Kelly, 1998; Niehaus et al., 1999; Vielle and Zeikus, 2001) because they are thermostable and are usually resistant to denaturation by chemicals (Niehaus et al., 1999).
The thermophilic protein Taq polymerase, isolated from Thermus aquaticus (Chien et al.,
1976), was crucial in the efficiency of PCR because the protein can withstand the repeated high temperatures needed to denature the DNA (Saiki et al., 1988). Other
(hyper-) thermophilic polymerases (Pfu, Vent, Velocity, Phusion) have also been utilized to enhance PCR.
It is important to understand how the hyperthermophilic archaea are replicating and repairing their DNA at such potentially detrimental temperatures. It would seem that such conditions would cause extensive damage to the DNA, and therefore highly efficient repair would be needed to allow replication and survival of the cell (Grogan, 1998). The archaeal chromosome arrangement is similar to that of bacteria, but the mechanism of replication is more like that of the eukaryotes. Genomic analyses of sequenced archaeal species have shown that most are missing parts of conventional repair pathways like those found in bacteria and eukaryotes, suggesting that the archaea are using novel pathways or proteins to successfully repair any damaged DNA.
To help address how hyperthermophilic archaea are replicating and repairing their
DNA and what genes are being used, the function of genes that have tentatively been identified based on sequence similarity in Sulfolobus acidocaldarius, a model hyperthermophilic archaeon, will be explored using targeted mutation. The genes of
10 interest are implicated in nucleotide excision repair, light-driven DNA repair by photoreactivation, alternative excision repair, homologous recombinational repair, replication, and other related processes. As functions of these genes are determined, the functions that seem to be missing based on genomic analyses may be found.
5. Biology of Sulfolobus acidocaldarius
Sulfolobus was the first genus of hyperthermoacidophilic archaea to be discovered and characterized from terrestrial solfataras by Brock and colleagues in the early 1970s, who named the first species Sulfolobus acidocaldarius (Brock et al., 1972). Sulfolobus spp. have been isolated from soils and many geothermal hot springs around the world including Yellowstone National Park, Italy, Dominica, El Salvador, Japan, eastern
Russia, and Iceland (Brock et al., 1972; Whitaker et al., 2003). Sulfolobus spp. are hyperthermophilic acidophilic archaea with optimal growth conditions of 80◦C and pH3, and also are obligate aerobes. Other general characteristics of the genus described by
Brock et al. (1972) include having lobed-spherical cells, being sulfur oxidizers, and having a cell wall that does not contain peptidoglycan.
The genome of Sulfolobus acidocaldarius (2.2Mbp) has been sequenced (Chen et al., 2005), as have those of Sulfolobus solfataricus (3.0Mbp) (She et al., 2001) and
Sulfolobus tokodaii (2.7Mbp) (Kawarabayasi et al., 2001). All three genomes encode the enzymes for metabolizing sulfur from hydrogen sulfide to yield sulfuric acid (Chen et al.,
2005). S. acidocaldarius has been used for genetic fidelity studies due to its relatively low mutation rate (0.0018 mutations per genome per replication) (Grogan et al., 2001) despite living in a potentially DNA-damaging environment (oxidation, hydrolysis,
11 decomposition of DNA, helical distortion) (Lindahl, 1993). It has also been observed that S. acidocaldarius has general homologous recombination activities in spite of such temperatures (Grogan, 1996) which normally render the structure of DNA unstable
(Grogan, 1998).
6. Genes Implicated in DNA Repair in Sulfolobus acidocaldarius Based on Sequence
Similarity
Nucleotide Excision Repair. Nucleotide excision repair (NER) can repair a variety of DNA lesions: chemical adducts, inter- and intra-strand crosslinks, protein-
DNA crosslinks, and UV photoproducts. In bacteria, the UvrABC genes make up the
NER pathway, whereas in eukaryotes, homologs of S. cerevisiae RAD1-4, 7, 10, 14, 16,
23, 25-27 and RADH (SRS2) are the genes involved in NER. Bacterial NER (Aravind et al., 1999; Goosen and Moolenaar, 2008) starts with damage recognition by UvrA. Once a lesion is found, UvrB is recruited and binds tightly to the DNA and UvrA dissociates.
UvrC is then engaged and makes a 3’ incision followed by a 5’ incision flanking the damage. After the incisions are made, the helicase, UvrD, removes the damaged DNA, and the gap is filled and the remaining nick is sealed by ligase. In eukaryotic systems (de
Laat et al., 1999), homologs of human XPC and S. cerevisiae Rad4, act as the damage recognition protein, recruiting the general transcription factor TFIIH, which contains helicases homologous to human XPB and S. cerevisiae Rad25, and human XPD and S. cerevisiae Rad3 to separate the strands about the lesion. Homologs of human XPA and S. cerevisiae Rad14 then verify the damage in the open DNA and recruits replication protein A (RPA), homolog of S. cerevisiae Rfa, to stabilize the open DNA complex. RPA
12 also helps to position the endonucleases homologous to human XPG and S. cerevisiae
Rad2, and ERCC1-XPF (S. cerevisiae Rad10-Rad1), so that they can make incisions 3’ and 5’ of the lesion. Once the damaged DNA is removed, the gap is filled and ligated with general replication factors.
Archaeal NER is not clearly defined, but so far homologs to several eukaryotic
NER genes have been found in all archaea, and the Euryarchaeota have homologs of the bacterial uvrABC genes (Goosen and Moolenaar, 2008), an exception being the mesophilic crenarchaeote, Cenarchaeum symbiosum which has a complete bacterial uvrABC nucleotide excision repair system (Hallam et al., 2006). It is assumed that in archaea lacking the Uvr system, NER is more like eukaryotic NER, based on existing similarities of the replication and transcription mechanisms between the two domains
(Goosen and Moolenaar, 2008). Of the archaeal genomes that have been sequenced, all have homologs to S. cerevisiae RAD3/human XPD and S. cerevisiae RAD25/human
XPB (Goosen and Moolenaar, 2008) which are helicase proteins involved in unwinding the DNA near the lesion and also are components of the transcription initiation factor
TFIIH (Schaeffer et al., 1993 and 1994). All species of archaea also have a homolog of S. cerevisiae RAD2/human XPG which makes an incision 3’ of the lesion (O’Donovan et al., 1994), and most archaea also have a homolog of S. cerevisiae RAD1/human XPF which makes an incision 5’ of the lesion (Brookman et al., 1996). It would seem that hyperthermophilic archaea utilize a eukaryotic-like RAD system for NER, however, the damage recognition proteins, S. cerevisiae RAD4/human XPC and S. cerevisiae
RAD14/human XPA, are not found (Grogan, 2004). This could suggest either that archaea are employing the RAD proteins in other processes such as transcription
13 initiation (Goosen and Moolenaar, 2008; Schaeffer et al., 1993 and 1994), or that there are other proteins unique to the archaea that are functioning in place of RAD4/XPC and
RAD14/XPA.
Saccharomyces cerevisiae RAD25, a homolog of human gene XPB, is a DNA- dependent ATPase and helicase that can unwind DNA (de Laat et al., 1999). There is still much research to be done to functionally characterize this gene in vivo. S. cerevisiae
RAD1 (XPF in humans) incises the DNA 5’ of the lesion with specificity for 3’-flaps. In humans this gene forms a heterodimer with ERCC1 (de Laat et al., 1998), whereas the
Sulfolobus solfataricus RAD1 homolog associates with the heterotrimeric proliferating cell nuclear antigen (PCNA) (Dionne et al., 2003). The RAD1-PCNA and XPF-ERCC1 complexes are very similar in structure and sequence suggesting similar function
(Roberts et al., 2003).
Homologs of the S. cerevisiae RAD1 and human XPF genes are found in
Sulfolobus acidocaldarius and other crenarchaea, but contain only the C-terminal nuclease domain of the human XPF which pertains to the 3’ flap endonuclease activity
(White, 2003). Euryarchaeal and eukaryotic XPF homologs also contain an N-terminal helicase domain (Allers and Mevarech, 2005) . These genes complex with PCNA, homolog of ERCC1 in human and Rad10 in yeast (Bardwell et al., 1994), both in vivo and in vitro, and this complex seems to be necessary for incision of the DNA (de Laat et al., 1999). S. cerevisiae RAD2, human XPG, and Schizosaccharomyces pombe Rad13
(Qui et al., 1998) make an incision 3’ of the lesion with substrate specificity for 5’ flaps, and homologs of these proteins occur in Halobacterium sp. NRC-1 (Berquist et al., 2007) and Sulfolobus acidocaldarius (Chen et al., 2005). S. cerevisiae RAD2 has homology to
14 the FEN-1 family endonucleases which seem to function during replication in processing
Okazaki fragments, in base excision repair (BER), and end joining. The 3’ incision made by RAD2 during NER is needed before the 5’ incision of RAD1-PCNA is made (de Laat et al., 1999). The RAD2 and RAD1-PCNA nucleases are not ATP-dependent but do require metal ions, Mg2+ or Mn2+, for cleavage. In eukaryotes, ~24 - 32 nucleotides around and including the damaged DNA are removed via NER (Wood, 1997).
A knockout of rad2 in Halobacterium sp. NRC-1 using ura3 as the selectable marker determined this gene to be essential (Berquist et al., 2007). In this study, the rad2 gene was PCR-amplified from genomic DNA and ligated into a plasmid containing ura3.
This plasmid was transformed into Halobacterium sp. NRC-1 Δura3, with selection for uracil prototrophy indicating integration of the plasmid into the chromosome. Selection for loss of plasmid via homologous recombination was done by 5-fluoroorotic acid (Foa) resistance. To determine whether the knockout or wild type allele was integrated, PCR was used. If the gene is non-essential, both wild-type and deletion should be recovered. If the gene is essential only the wild type recombinant will be recovered. In the case of rad2, 40 Foar colonies were screened and all had wild type rad2 suggesting this gene is essential for survival. A similar study has also been done in S. cerevisiae (Qiu et al.,
1998), showing that a strain with a mutation in rad2 only is not as UV-sensitive as a double mutant of rad2 exo1; EXO1 is a RAD2-like nuclease.
Alternative Excision Repair. Ultraviolet (UV) light can have detrimental effects on a cell’s survival by damaging the DNA in such a way as to stop replication and transcription leading to mutations or cell death. These types of lesions can be repaired using Nucleotide Excision Repair (NER), photoreactivation (described below), or
15 Alternative Excision Repair (AER). AER is a pathway that repairs UV-damaged DNA
(CPDs and 6-4PPs) through ultraviolet DNA damage endonuclease (UVDE) (Kisker,
2007; Yasui and McCready, 1998). This enzyme makes an incision just 5’ to the lesion, and this single stranded break in the DNA initiates the alternative repair process
(Bowman et al., 1994; Yajima et al., 1995; Yasui and McCready, 1998). Initially, UVDE was thought to only repair UV-induced damage, however, further biochemical and genetics studies in S. pombe have shown the repair capacity is much more vast and includes abasic sites, dihydrouracil, and mismatches (Takao et al., 1996; Doetsch et al.,
2006).
UVDE is a single protein that introduces a nick just 5’ to both CPDs and 6-4PPs
(Goosen and Moolenaar, 2008), leaving a 3’-hydroxyl and a 5’- phosphoryl group
(Kisker, 2007). This process is not dependent on ATP but does require metal ions Mg2+
(Yasui and McCready, 1998) or Mn2+ (Paspaleva et al., 2007) for activation. This type of repair is common in bacteria and some eukaryotes and has been found specifically in
Thermus thermophilus HB27 (Paspaleva et al., 2007; Brüggemann and Chen, 2006),
Bacillus subtilis (Yasui and McCready, 1998), Schizosaccharomyces pombe (Bowman et al., 1994; Takao et al., 1996), Deinococcus radiodurans (Earl et al., 2002), and
Neurospora crassa (Ishii et al., 1991). A homolog of UVDE has also been found in
Sulfolobus acidocaldarius (Chen et al., 2005). No similar repair pathway has been found in Saccharomyces cerevisiae, Escherichia coli, (McCready and Cox, 1993), T. thermophilus HB8 (Brüggemann and Chen, 2006) Sulfolobus solfataricus or any other archaeon (Chen et al., 2005), except Haloarcula marismortui (Baliga et al., 2004). The
16 mechanism of repair is thought to be absent from humans as well (Yasui and McCready,
1998).
The protein structure of UVDE is a TIM barrel fold which is similar in structure but not in sequence to the AP endonuclease Endo IV as shown in T. thermophilus
(Paspaleva et al., 2007). It is also suggested that a groove with metal ions at the bottom of the protein may be used for damage recognition, as is also similar to Endo IV. Sequence analyses comparing bacterial and eukaryotic UVDE homologs show that all bacterial
UVDE homologs lack the 228aa N-terminal region and the highly charged C-terminal domain which are present in eukaryotic UVDE (Paspaleva et al., 2007). For S. pombe, it was shown in vitro that the N-terminal one-third region of UVDE can be deleted and the cells can still survive UV irradiation, while deletion of any of the two-thirds of C- terminal leads to UV sensitivity. This suggests that the C-terminal two-thirds are required for the enzymatic activity of UVDE (Takao et al., 1996). The potential damage recognition residues and metal residues are well conserved across species (Goosen and
Moolenaar, 2008).
Photoreactivation. The major photoproducts of UV (200-300nm) irradiation are cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone 6-4 photoproducts (6-
4 PPs) (Yasui and McCready, 1998). The pyrimidine dimers block replication and transcription, which kills the cell. However, it can also cause a mutation if replication does persist beyond the lesion (Sancar, 1994). Photoreactivation (Kelner, 1949), the reversal of short wavelength UV effects with visible light (Rupert et al., 1958), was first discovered in Streptomyces griseus ATC3326 by Albert Kelner (1949a) when looking at the recovery of UV-irradiated cells. It was noted that temperature was not a factor but
17 that cultures exposed to sunlight had a recovery of 100,000 – 400,000-fold increase over controls that were kept in the dark, which showed no recovery. It was also found that recovery was proportional to duration of time in sunlight or artificial illumination and the rapidity of recovery was proportional to the intensity of the light source within certain limits (Kelner, 1949a). Similar studies were conducted and corroborating results were found in Escherichia coli (Rupert et al., 1958), Penicillium notatum, and Saccharomyces cerevisiae (Kelner, 1949).
The enzyme responsible for photoreactivation is photolyase. Photolyase binds to the dimers in the DNA in a light-independent step, but requires the energy from light
(300-500nm) to convert the dimers back to pyrimidines (Sancar et al., 1984; Sancar,
1994; Goosen and Moolenaar, 2008). The actual photolyase –DNA complex is still unknown. However, the basic enzymatic reaction was explained by Rupert et al. (1958) as shown below:
PRE + Pyr <> Pyr → PRE · Pyr <> Pyr → PRE · Pyr – Pyr → PRE + Pyr – Pyr
In E. coli, the in vitro turnover rate of 2.4 dimers/photolyase molecule/min (Sancar et al.,
1984) was similar to the in vivo studies in E. coli Bs-1 of 4.5 dimers/photolyase molecule/min (Harm, 1970).
The first Phr protein was identified in E.coli (Sancar et al., 1984). Recently photolyase homologues were found in humans (Yasui and McCready, 1998; van der Spek et al., 1996), although there is not much evidence to suggest that humans actually have photoreactivational repair (Li et al., 1993). Other organisms such as Diplococcus pneumoniae (Ellsion and Beiser, 1960), Haemophilus influenzae (Goodgal et al., 1957),
Bacillus subtilis (Kelner, 1964), and Bacillus firmus OF4 (Quirks et al., 1993) all lack photoreactivational repair. It has been estimated that about 50% of sequenced bacterial
18 genomes contain a photolyase homologue, and only about 25% of sequenced archaeal genomes contain a homologue. It is thought that most organisms did have a photolyase gene, but through evolution it was lost (Goosen and Moolenaar, 2008). However, there does not seem to be a pattern as to which organisms have photoreactivating activities and those that do not, and therefore its presence is unpredictable (Sancar, 1994).
DNA photolyase proteins have been isolated from yeast (Iwatsuki et al., 1980) and two in E. coli (Snapka and Sutherland, 1980; Sancar et al., 1984) and were found to differ in molecular weights (51,000, 35,000 and 53,994) and absorption peaks. Because two different molecular weights were found in E. coli it was also thought that it may have two different photolyases, phrA and phrB (phr) (Snapka and Sutherland, 1980). However, there has been much controversy as to whether phrA actually plays a role in photoreactivation with several groups now suggesting that it does (Dorrell et al., 1993 and 1995; Husain and Sancar, 1987). Most photolyases studied are considered flavoproteins because the chromophore flavin adenine dinucleotide (FAD) is found upon denaturation (Saccharomyces cerevisiae (Iwatsuki et al., 1980); Streptomyces griseus
(Eker et al., 1981)). Interestingly, this chromophore is missing in E. coli (Snapka and
Sutherland, 1980). It is logical to utilize a chromophore to absorb the light energy that is needed to convert dimers back to pyrimidines (Sancar and Sancar, 1984). Depending on the type of photolyase, another coenzyme is also utilized; either a methenyltetrahydrofolate (MTHF) or a 8-hydroxy-5-deazariboflavin (Carell et al., 2001).
The E.coli (PhrB) photolyase is dependent on MTHF (Sancar et al., 1984) and the yeast
(PHR1) photolyase is dependent on 8-hydroxy-5-deazariboflavin (Aravind et al., 1999).
19 Related processes. Reverse gyrase (rgy) was first isolated from S. acidocaldarius
DSM 639 by Mirambeau and colleagues in 1984 and characterized as being a thermophilic ATP-dependent topoisomerase able to relax negatively supercoiled DNA but not positively supercoiled DNA in vitro; in other words, it introduces positive supercoils in closed circular DNA (Forterre et al., 1985; Rodríguez and Stock, 2002).
This gene seems to be more related to the eukaryotic type II topoisomerase based on the aforementioned characteristics and its lack of gyrase-like activity and sensitivity to gyrase inhibitors (Mirambeau et al., 1984). Sequence analysis showed rgy to have two domains, C-terminal and N-terminal. The C-terminal domain was found to be related to bacterial type I topoisomerase (E. coli topA and topB) and also to Saccharomyces cerevisiae top3. The N-terminal seems to be unique and contains several helicase motifs and an ATP-binding site (Confalonieri et al., 1993). There was some debate about whether reverse gyrase is a type I or II topoisomerase, however, it has been resolved that it is a type IA topoisomerase (Forterre et al., 1985; Kikuchi and Asai, 1984).
The exact role of rgy in vivo is still not clear, but the following mechanism is typical of such topoisomerases. Type I topoisomerases cleave one strand of the DNA, whereas type II cleave both strands. In both cases, there are three steps of action: cleavage, strand passage, and religation. A single strand cleavage of the phosphate backbone is the result of the topoisomerase uses of a tyrosine residue as a nucleophile.
After cleavage, the enzyme is covalently bound to the linear strand of DNA and the uncut strand can pass through adding helical turns, which increases positive helical turns. The strand is then ligated back together and the topoisomerase is released (Rodríguez and
Stock, 2002). To summarize, reverse gyrase increases the DNA linking number, which
20 in turn introduces positive supercoils in the double helix (Déclais et al., 2001). The positive supercoiling is thought to prevent unwinding at high temperatures (Rodríguez and Stock, 2002).
Reverse gyrase is thought to be the only hyperthermophile-specific protein as it is absent in mesophiles and moderate thermophiles (Forterre, 2002; Bouthier de la Tour et al., 1990), however a recent study found that there is an exception, Thermus thermophilius HB27 (Brüggemann and Chen, 2006). The T. thermophilus HB27 strain does not have a fully intact reverse gyrase, but rather only the C-terminal end which corresponds to a type I topoisomerase. It was also discovered that reverse gyrase is not essential for survival up to 90◦C in the hyperthermophile Thermococcus kodakaraensis
KOD1 after rgy was disrupted by trpE (Atomi et al., 2004). Reverse gyrase has been found in methanogens and sulfur-dependent organisms (Bouthier de la Tour et al., 1990), as well as several strains of the extremely thermophilic bacterial order Thermotogales
(Bouthier de la Tour et al., 1991). These results suggest again that rgy has a role in survival at high temperature although its role is not yet clear.
Reverse gyrase seems to play a role in DNA repair as shown after UV irradiation by Napoli et al. (2004). In their study, Sulfolobus solfataricus cells were treated with UV and it was found in vitro that rgy forms a stable covalent bond with the UV-damaged
DNA and in vivo rgy is shown to translocate to the DNA. Both are specific effects of UV- induced damage. From these results it can be suggested that rgy is playing a role in repairing the UV irradiation damage of the DNA, but it is not clear whether it is a direct or indirect participation.
21 nurA and herA. Homologous recombination initiation requires 3’-overhangs in the DNA which are required for loading of the recombinase and also for strand invasion to occur. The major bacterial proteins for the recombinational repair pathway, also called double strand break (DSB) repair, are RecA and those that make up the RecBCD complex. This complex encompasses a helicase, endonuclease, and a 3’- 5’ and 5’- 3’ exonuclease. Bacteria also use the RecFOR pathway and the SbcC-SbcD complex for
DSBs (Constantinesco et al., 2002). Neither the RecBCD or RecFOR complexes have been found in eukaryotes or archaea. However, there are homologs to the SbcC (Rad50), and SbcD (Mre11) exonuclease proteins found in both eukaryotes and archaea (Sharples and Leach, 1995; Aravind et al., 1999). In yeast these proteins are associated with Xrs2 and in humans, Nbs1; these proteins are thought to be possible functional analogs
(Constantinesco et al., 2002). There are no known homologs found to either Xrs2 or Nbs1 in archaea or bacteria (Aravind et al., 1999).
In order to produce the 3’ tails for homologous recombinational repair, a 5’-3’ nuclease and a helicase are needed in addition to RAD50 and Mre11. In two separate studies by Constantinesco and colleagues, two such proteins were found. NurA (Nuclease repair of Archaea) was isolated and characterized by Constantinesco et al. (2002) as being a single-stranded endonuclease and a 5’-3’ exonuclease of single- and double- stranded (ds) DNA in S. acidocaldarius. It was also found that nurA is in an operon-like complex with rad50 and mre11. In 2004, Constantinesco et al. showed that there was yet a fourth gene, herA (helicase repair of Archaea), which is a unique helicase in that it can load onto either the 3’ or 5’ end of DNA to unwind it, and it was also found in an operon and co-transcribed with the rad50, mre11, and nurA in S. acidocaldarius.
22 This four-gene complex is found in most thermophilic archaea and hypothesized to be involved in the initiation steps of homologous recombination (Constantinesco et al.,
2004). Using immunoprecipitation assays in which the DNA was treated with DNase, it was found that Rad50, Mre11, and HerA form a complex in the absence of DNA, suggesting that there is a direct interaction of these three proteins; the direct action of
NurA could not be determined (Quasier et al., 2008). In an in vitro binding assay and an in vivo two-hybrid and co-immunoprecipitation assay of NurA in S. tokodaii (Wei et al.,
2008), NurA was found to directly interact with ss-binding DNA proteins (SSBs). This direct interaction inhibited the ssDNA endonuclease and ss- and ds-DNA exonuclease activity of NurA. The significance and mechanism of the inhibition is not known.
Three conserved motifs were found after looking at multiple alignments of all available archaeal nurA sequences. Two motifs were conserved in the N-terminal both with the same amino acid triplet DGS, and one amino acid motif in the C-terminal, GY.
The single-stranded (ss) endonuclease activity of NurA on closed circular DNA and the
5’-3’ exonuclease activity of ss and ds linear DNA were both found to be dependent on
Mn2+ (Constantinesco et al., 2002).
Based on genomic analyses, the herA gene is highly conserved among archaea.
The N-terminal contains the Walker A motif, while the C-terminal contains the B motif
(Constantinesco et al., 2004). Like that of FtsK and TrwB, which are involved in cell division and plasmid transfer in bacteria, and also helicases and ATPases of the AAA+ superfamily, HerA has similar helicase activity (Manzan et al., 2004). HerA and FtsK are grouped together as ATPases based on similar sequence and structure. Even though HerA
23 is phyletically archaeal and FtsK is bacterial, it is suggested that they may have a common ancestor and function similarly in their respective domains (Iyer et al., 2004).
HerA homologs have been found in all archaea, some bacteria, and no eukaryotic organisms to date, but functionally these have not been distinguished (Constantinesco et al., 2004). Homologues of HerA have been reported in S. acidocaldarius (Constantinesco et al., 2004), Pyrococcus abyssi in which the protein is named MlaA, Mre-11 complex- linked ATPase in Archaea (Manzan et al., 2004), and most recently Sulfolobus tokodaii
(Zhang et al., 2008). A helicase activity similar to that of HerA protein was discovered in
E. coli, but as the combination of two separate proteins; RecB acts in 3’ – 5’ manner, and
RecD, 5’ – 3’ (Taylor and Smith, 2003; Dillingham et al., 2003). Quasier et al. (2008) found that HerA was progressively recruited to UV-damaged DNA from the exponential phase to stationary phase (~50% bound 24hrs after treatment). Zhang et al. (2008) found that HerA of S. tokodaii was able to unwind blunt-ended double-stranded DNA, whereas
HerA in S. acidocaldarius was found to not be able to use blunt-ended only DNA as a substrate (Constantinesco et al., 2004).
7. Genes Implicated in DNA Replication in Sulfolobus acidocaldarius Based on
Sequence Similarity
Sulfolobus spp. were found to have three bi-directional origins of replication
(Lundgren et al., 2004; Chen et al., 2005) like eukaryotes which have multiple origins of replication, whereas bacteria have one (Kelman and White, 2005). Typically, origins are rich in stretches of adenine (A) and thymine (T), and also contain inverted repeats
24 (Kelman and White, 2005). The three origins of replication in S. acidocaldarius were
630, 570, and 1020 kb apart (Lundgren et al., 2004). In Sulfolobus acidocaldarius and
S. solfataricus, all three origins initiate replication synchronously, but termination of replication is asynchronous due to uneven distribution of the origins along the chromosome (Lundgren et al., 2004).
Replication is initiated by the binding of Orc1/Cdc6 homologs to the origin of replication. In Sulfolobus, these proteins are referred to as Cdc6-1, Cdc6-2, and Cdc6-3
(She et al., 2001). Using 2-D gel analysis, it was found that two of three origins of replication are adjacent to a Cdc6 gene. Specifically, Cdc6-1 is next to oriC1 and Cdc6-3 is adjacent to oriC2 (Lundgren et al., 2004). Cdc6-2 was not found to be near any origin of replication and is thought to act as a repressor of replication. Cdc6-1 and Cdc6-3 are present in G1 and S phases, while Cdc6-2 is present in G2 and binds to oriC1 and oriC2 potentially blocking the two other Cdc6 genes from initiating replication at those origins
(Lundgren et al., 2004; Robinson et al., 2004; Wang et al., 2007).
8. Determining Functions of Sulfolobus Genes
The overall project goal was to determine the function of the genes of interest
(described above) in vivo using targeted gene disruption in Sulfolobus acidocaldarius.
Targeted gene disruption has not been reported for S. acidocaldarius, and development of an efficient and easy method is important for genetic studies in this species. There are however several genetic tools that have be used in Sulfolobus spp. such as selectable genes, electroporation, shuttle plasmids, homologous recombination, etc.
25 Selectable genes. Selectable markers have been used in genetic manipulations in understanding bacterial and eukaryotic mechanisms. Advances in genetic techniques have also been made in archaeal species, especially since the development of more stable, efficient shuttle vectors (see below). Several commonly used archaeal selectable markers are pyrE and pyrF genes and their homologs. Selectable markers are needed for genetic transformations and several have been developed for use in Sulfolobus acidocaldarius
(Grogan, 1991; Grogan and Gunsalus, 1993). First, uracil auxotrophs that are deficient in pyrEF, which function in pyrimidine nucleotide metabolism, are isolated. The enzymes encoded by pyrEF are responsible for converting orotate to uridine-5’-phosphate in the
UMP pathway. However, if 5-fluoro-orotate (5-FOA) is added to the medium, a toxic product, 5-fluorouridine-5’-phosphate is produced which inhibits cell growth; PyrE+ or
PyrF+ strains will not survive on this medium. If uracil is also added, PyrE- / PyrF- mutants can be positively selected (Atomi and Imanaka, 2008).
Electroporation. Electroporation is used for DNA uptake in cells by applying high voltage electric pulses which temporarily introduces pores in the cell membrane
(Tsong, 1991). There are several factors that influence the efficiency of electroporation, such as the strength of the voltage applied, the length of the electric pulse, temperature at which the cells are maintained, conformation, concentration of DNA, and ionic composition of medium (Neumann et al., 1982). Conditions for electroporation in
Sulfolobus were optimized by Schleper et al. (1992) using the SSV1 viral DNA for transfection experiments and by Kurosawa and Grogan (2005) using pyrEF sequences.
Shuttle plasmids. Shuttle plasmids in Sulfolobus spp. are being developed but there have been many difficulties in efficient cloning such as low transformation
26 efficiencies, inefficient selection, and instability of vectors which have slowed the genetic developments in Sulfolobus. However, as progress continues vectors are being created that are more stable, allowing for more information about archaeal molecular, physiological, and genetic characteristics.
The first Sulfolobus plasmid came from the cryptic plasmid, pGT5 from
Pyrococcus abyssi and was used to construct three stable shuttle vectors for the euryarchaeote Pyrococcus furiosus, the crenarchaeote Sulfolobus acidocaldarius, and E. coli (Aravalli and Garrett, 1997). pAG1 was constructed from pGT5 and the E. coli plasmid pUC19 and found to be a stable high copy number plasmid. A second vector, pAG2, was also stable but the copy number was reduced from pAG1 by adding the
Rom/Rop gene from pBR322 into pAG1. A S. solfataricus alcohol dehydrogenase gene was added to pAG2 as an archaeal selectable marker to create plasmid pAG21, which was also a stable low copy number plasmid. These vectors have potential for use in other hyperthermophilic archaea with their selectable markers, stability, and low or high copy number (Aravalli and Garrett, 1997).
Virus particle SSVI (Sulfolobus spindle-shaped virus 1) discovered in Sulfolobus shibatae (Schleper et al., 1992) was also used to create plasmids for use in Sulfolobus, first by ligating it into pBluescript II KS, to create the high copy number shuttle vector pKMSD48 which replicated in S. solfataricus and E. coli (Stedman et al., 1999).
Jonuscheit et al. (2003) constructed several S. solfataricus/E. coli shuttle vectors as derivatives of the S. shibatae virus SSV1. One unstable shuttle vector, pMJ02, incorporated the S. solfataricus P1 beta-galactosidase gene (lacS) and pUC18 into pKMSD48 and another vector, pSSV64, added S. solfataricus pyrEF genes to
27 pKMSD48, which was much more stable. A third vector, pMJ03, was constructed by adding the pyrEF genes to pJM02 vector, making it much more stable (Jonuscheit et al.,
2003). Results showed that unlike the wild-type SSV1 and pSSV64 with free plasmid copies, these plasmids only integrated into the chromosome and were not UV-inducible
(Schleper et al., 1992). Based on results with pMJ03, and to an extent pMJ02, it was shown that the pyrEF genes can be efficiently expressed and used as selectable markers
(Jonuscheit et al., 2003).
Schleper et al. (1995) discovered the large multicopy plasmid, pNOB8 from
Sulfolobus of unknown species in Noboribetsu, Japan. It has a very high copy number of
20-40 per chromosome which causes growth retardation in recipient cells. Also, pNOB8 was found to go through extensive genetic variation in Sulfolobus spp. (Schleper et al.,
1995; Elferink et al., 1996).
Another high copy number vector, pSSVrt for Sulfolobus solfataricus, was constructed from the Sulfolobus islandicus REY15/4 genetic element pSSVx and the
E.coli plasmid pUC19 containing the ampicillin resistance gene bla, but was shown to need the help of the virus SSV2 for efficient transformation (Aucelli et al., 2006). A derivative of pSSVrt was made by removing a redundant sequence in the E.coli plasmid to make pMSSV. Further, a smaller lacS cassette was added to the multiple cloning site in pMSSV to make pMSSVlacS (Aucelli et al., 2006).
The small multicopy plasmid, pRN1 from S. islandicus has also been used to create a series of shuttle vectors for Sulfolobus acidocaldarius, Sulfolobus solfataricus, and E. coli (Berkner et al., 2007). Because it was not clear which regions of pRN1 would be important for replication, transposition was used to create a series of potential shuttle
28 vectors that are non-integrative (designated pA-pN). Further, the S. solfataricus pyrEF genes were added as selectable markers. Vector pJlacS was constructed from one of these plasmids, pJ, by the addition of the tf55αlacS cassette. Most of these vectors were stable in both hosts and did not cause growth retardation (Berkner et al., 2007).
Homologous Recombination. Homologous recombination enables selectable markers and engineered mutations to be transferred to the chromosome using transformation and selection. The first report of homologous recombination in hyperthermophilic archaea was a study by Grogan (1996) in which Sulfolobus acidocaldarius showed chromosomal gene exchange. As stated previously, it is surprising that such activities are available in organisms that grow at temperatures that would seem to destabilize DNA (Grogan, 1998).
A later study by Hansen et al. (2005) explored the conjugational mechanism of marker exchange and showed that intragenic recombination events occur most often at the site of mutation and not between them, and that all strains could serve equally as donor or recipient. It was also shown that the distance between mutations, ranging from
1154 down to about 10bp, did not, for the most part, affect recombination frequency. A quantitative study of recombination (Kurosawa and Grogan, 2005) between exogenous
DNA and the Sulfolobus acidocaldarius chromosome were done by electroporating PyrE- strains with a functional pyrE sequence. Vectors carrying the functional pyrE did not replicate in Sulfolobus, and therefore the PyrE+ phenotype could only occur via recombination. In the same study, a series of DNAs were PCR amplified that varied in length, and overlapped the pyrE deletion in the Sulfolobus acidocaldarius chromosome.
These PCR fragments were electroporated into pyrE deletion mutants, MR31, and the
29 results showed that the length of overlap was proportional to efficiency of transformation and that homologous recombination events were responsible for the Pyr+ recombinants produced (Kurosawa and Grogan, 2005).
9. Gene Disruption
Selectable marker. Many variations of gene disruption have been developed to understand gene function in eukaryotes, bacteria, mesophilic archaea and such a method is essential for genetic studies of hyperthermophilic archaea. Several disruption methods for archaea have utilized the pyrE and pyrF genes, and their homologs, for such experiments as a way to select integration into the chromosome. The gene of interest is disrupted with the pyrE (or pyrF) gene, transformed into a PyrE- or PyrF- cell, and via homologous recombination, the disrupted gene of interest is integrated into the chromosome. The pyrE(F) gene acts as the selectable marker.
The pyrF homolog, ura3, was used in the first report of gene disruption carried out in Saccharomyces cerevisiae by Scherer and Davis (1979). Their method of disruption has lead to the disruption of several hundreds of S. cerevisiae genes (Lorenz et al., 1995) and paved the way for many other species gene disruptions. This method has now been utilized in Halobacterium sp. NRC-1 (Berquist et al., 2007). The pyrF gene was also used to disrupt the trpE gene in Thermococcus kodakaraensis (Sato et al., 2002 and 2005). In Thermus thermophilus, pyrE was used to disrupt leuB (Tamakoshi et al.,
1999), and in Salmonella typhimurium pyrE was used to disrupt Mud1 (Neuhard et al.,
1985). Another pyrE homolog, ura5, was used for gene disruption in Cryptococcus gattii
(Narasipura et al., 2006).
30 The strategy planned for S. acidocaldarius was to disrupt the genes of interest using the Sulfolobus solfataricus (Sso) pyrE gene which will act as a selectable marker.
The Sso pyrE is used for disruption because it has little sequence similarity (~60%) to S. acidocaldarius pyrE gene in the chromosome, and therefore will not recombine at the Sac pyrE locus. However, the disrupted gene will be electroporated into a S. acidocaldarius cell that is PyrE -, so that the Sso pyrE restores the PyrE+ phenotype of the cell.
10. References
Adams, Michael W. W., and Robert M. Kelly. 1998. Finding and using hyperthermophilic enzymes. TIBTECH 16:329-332.
Allers, Thorsten and Moshe Mevarech. 2005. Archaeal genetics-the third way. Nature Reviews 6:58-73.
Aravalli, Rajagopal N., and Roger A. Garrett. 1997. Shuttle vectors for hyperthermophilic archaea. Extremophiles 1:183-191.
Aravind, L., D. Roland Walker, and Eugene V. Koonin. 1999. Conserved domains in DNA repair proteins and evolution of repair systems. Nucleic Acids Research 27:1223- 1242.
Atomi, Haruyuki and Tadayuki Imanaka. 2008. Targeted disruption as a tool for establishing gene function in hyperthermophilic archaea. Thermophiles, Biology and Technology at High Temperatures. Frank Robb, Garabed Antranikian, Dennis Grogan, and Arnold Driessen, eds. New York: Taylor and Francis Press 213-223.
Atomi, Haruyuki, Rie Matsumi, and Tadayuki Imanaka. 2004. Reverse gyrase is not a prerequisite for hyperthermophilic life. Journal of Bacteriology 186:4829-2833.
Aucelli, Tiziana, Patrizia Contursi, Michel Girfoglio, Mosè Rossi, and Raffaele Cannio. 2006. A spreadable, non-integrative and high copy number shuttle vector for Sulfolobus solfataricus based on the genetic element pSSVx from Sulfolobus islandicus. Nucleic Acids Research 34:e114.
Baliga, Nitin S., Richard Bonneau, Marc T. Facciotti, Min Pan, Gustavo Glusman, Eric W. Deutsch, Paul Shannon, Yulun Chiu, Rueyhung Sting Weng, Rueichi Richie Gan, Pingliang Hung, Shailesh V. Date, Edward Marcotte, Leroy Hood, and Wailap Victor Ng.
31 2004. Genome sequence of Haloarcula marismortui: A halophilic archaeon from the Dead Sea. Genome Research 14:2221-2234.
Bardwell, A.Jane, Lee Bardwell, Alan E. Tomkinson, and Errol C. Friedberg. 1994. Specfic cleavage of model recombination and repair intermediated by the yeast Rad1- Rad10 DNA endonuclease. Science 265:2082-2085.
Bell, Stephen D. and Anindya Dutta. 2002. DNA replication in eukaryotic cells. Annual Review of Biochemistry 71:333-374.
Bell, Stephen D. and Stephen P. Jackson. 1998. Transcription and translation in Archaea: a mosaic of eukaryal and bacterial features. Trends in Microbiology 6:222-228.
Berkner, Silvia, Dennis Grogan, Sonja-Verena Albers, and Georg Lipps. 2007. Small multicopy, non-integrative shuttle vectors based on the plasmid pRN1 for Sulfolobus acidocaldarius and Sulfolobus solfataricus model organisms of the (cren-)archaea. Nucleic Acids Research 35:e88.
Berquist, Brian R., Priya DasSarma, and Shiladitya DasSarma. 2007. Essential and non- essential DNA replication genes in the model halophilic archaeon, Halobacterium sp. NRC-1. BMC Genetics 8:31-43.
Berquist, Brian R. and Shiladitya DasSarma. 2003. An archaeal chromosomal autonomously replicating sequence element from an extreme halophile, Halobacterium sp. strain NRC-1. Journal of Bacteriology 185:5959-5966.
Bocquier, Arnaud A., Lidong Liu, Isaac K.O. Cann, Kayoko Komori, Daisuke Kohda, and Yoshizumi Ishino. 2001. Archaeal primase: bridging the gap between RNA and DNA polymerases. Current Biology 11:452-456.
Boudsocq, Francois, Shigenori Iwai, Fumio Hanaoka, and Roger Woodgate. 2001. Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion by-pass properties akin to eukaryotic poleta. Nucleic Acids Research 219:4607-4616.
Boudsocq, Francois, Robert J. Kokoska, Brian S. Plosky, Alexandra Vaisman, Hong Ling, Thomas A. Kunkel, Wei Yang, and Roger Woodgate. 2004. Investigating the role of the little finger domain of the Y-family DNA polymerases in low fidelity synthesis and translesion replication. The Journal of Biological Chemistry 279: 32932-32940.
Bouthier de la Tour, Claire, Christiane Portemer, Robert Huber, Patrick Forterre, and Michel Duguet. 1991. Reverse gyrase in thermophilic eubacteria. Journal of Bacteriology 173:3921-3923.
32 Bouthier de la Tour, Claire, Christiane Portemer, Marc Nadal, Karl O. Stetter, Patrick Forterre, and Michel Duguet. 1990. Reverse gyrase, a hallmark of hyperthermophilic archaebacteria. Journal of Bacteriology 172:6803-6808.
Bowman, Krista K., Khalifah Sidik, Colin A. Smith, John-Stephen Taylor, Paul W. Doetsch, and Greg A. Freyer. 1994. A new ATP-independent DNA endonuclease from Schizosaccharomyces pombe that recognizes cyclobutane pyrimidine dimers and 6-4 photoproducts. Nucleic Acids Research 22:3026-3032.
Brill, Steven J. and Bruce Stillman. 1991. Replication factor-A from Saccharomyces cerevisiae is encoded by three essential genes coordinately expressed at S phase. Genes and Development 5:1589-1600.
Brock, Thomas, Katherine M. Brock, Robert T. Belly, and Richard L. Weiss. 1972. Sulfolobus: A new genus of sulfur-oxidizing bacteria living at low pH and high temperature. Archives of Mikrobiology 84:54-68.
Brookman, Kerry W., Jane E. Lamerdin, Michael P. Thelen, Mona Hwang, Joyce T. Reardon, Aziz Sancar, Zi-Qiang Zhou, Christi A. Walter, Christopher N. Parris, and Larry H. Thompson. 1996. ERCC4 (XPF) encodes a human nucleotide excision repair protein with eukaryotic recombination homologs. Molecular and Cellular Biology 16:6553-6562.
Brüggerman, Holger and Chaoyin Chen. 2006. Comparative genomics of Thermus thermophilus: Plasticity of the megaplasmid and its contribution to a thermophilic lifestyle. Journal of Biotechnology 124:654-661.
Cammarano, P., A. Teichner, P. Londei, M. Acca, B. Nicolaus, J. L. Sanz, and R. Amils. 1985. Insensitivity of archaebacterial ribosomes to protein synthesis inhibitors. Evolutionary implications. EMBO 4: 811-816.
Carell, Thomas, Lars T. Burgdorf, Lal Mohan Kundu, and Michaela Cichon. 2001. The mechanism of action of DNA photolyases. Current Opinion in Chemistry Biology 5:491- 498.
Cavicchioli, Ricardo. 2006. Cold-adapted Archaea. Nature Reviews: Microbiology 4:331-343.
Chen, Lanming, Kim Brügger, Marie Skovgaard, Peter Redder, Qunxin She, Elfar Torarinsson, Bo Greve, Mariana Awayez, Arne Zibat, Hans-Peter Klenk, and Roger Garrett. 2005. The genome of Sulfolobus acidocaldarius, a model organism of the Crenarchaeota. Journal of Bacteriology 187: 4992-4999.
Chien, Alice, David B. Edgar, and John M. Trela. 1976. Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus. Journal of Bacteriology 127:1550-1557.
33
Confalonieri, Fabrice, Christiane Elie, Marc Nadal, Claire Bouthier de La Tour, Partick Forterre, and Michel Duguet. 1993. Reverse gyrase: A helicase-like domain and a type I topoisomerase in the same polypeptide. PNAS. 90:4753-4757.
Constantinesco, Florence, Patrick Forterre, and Christiane Elie. 2002. NurA, a novel 5’-3’ nuclease gene linked to rad50 and mre11 homologs of thermophilic Archaea. EMBO 3:537-542.
Constantinesco, Florence, Patrick Forterre, Eugene V. Koonin, L. Aravind, and Christiane Elie. 2004. A bipolar DNA helicase gene, herA, clusters with rad50, mre11, and nurA genes in thermophilic archaea. Nucleic Acids Research 32:1439- 1447.
Cullmann, Gerhard, Karen Fien, Ryuji Kobayashi, and Bruce Stillman. 1995. Characterization of the five replication factor C genes of Saccharomyces cerevisiae. Molecular and Cellular Biology 15:4661-4671.
Declais, Anne-Cecile, Claire Bouthier de la Tour, and Michel Duguet. 2001. Reverse gyrases from bacteria and archaea. Methods in Enzymology 334: 146-162. de Laat, Wouter L., Nicolaas G. J. Jaspers, and Jan H. J. Hoeijmakers. 1999. Molecular mechanism of nucleotide excision repair. Genes and Development 13:768-785. de Laat, Wouter L., Anneke M. Sijbers, Hanny Odijk, Nicolaas G. J. Jaspers, and Jan H. J. Hoeijmakers. 1998. Mapping of interaction domains between human repair proteins ERCC1 and XPF. Nucleic Acids Research 26:4146-4152.
Dillingham, Mark S., Maria Spies, and Stephen C. Kowalczykowski. 2003. RecBCD enzyme is a bipolar DNA helicase. Nature 423:893-897.
Dionne, Isabelle and Stephen D. Bell. 2005. Characterization of an archaeal family 4 uracil DNA glycosylase and its interaction with PCNA and chromatin proteins. Biochemical Journal 387:859-863.
Dionne, Isabelle, Ravi K. Nookala, Stephen P. Jackson, Aidan J. Doherty, and Stephen D. Bell. 2003. A hetertrimeric PCNA in the hyperthermophilic archaeon Sulofolobus solfataricus. Molecular Cell 11:275-282.
Doetsch, Paul W., Vladimir Bejanski, and Binwei Song. 2006. The ultraviolet damage endonuclease (UVDE) protein and alternative excision repair: a highly diverse system for damage recognition and processing. DNA Damage Recognition, Vladimir Beljanski and Binwei Song , eds. New York: Taylor and Francis Press 223-237.
Dorrell, Nick, Ahmed H. Ahmed, Sharon H. Moss. 1993. Photoreactivation in a phrB mutant of Eschericihia coli K-12: Evidence for the role of a second protein in photorepair. Photochemistry and Photobiology 58:831-835.
34
Dorrell, Nick, David J. Davies, and Sharon H. Moss. 1995. Evidence of photoenzymatic repair due to the phrA gene in a phrB mutant of Escherichia coli K-12. Journal of Photochemistry and Photobiology 28:87-92.
Earl, Ashlee M., Sara K. Rankin, Kwang-Pyo Kim, Oleana N. Lamendola, and John R. Battista. 2002. Genetic evidence that the uvsE gene product of Deinococcus radiodurans R1 is a UV damage endonuclease. Journal of Bacteriology 184:1003-1009.
Eker, A.P.M., R.H. Dekker, and W. Berends. 1981. Photoreactivating enzyme from Streptomyces griseus-IV. On the nature of the chromophoric cofactor in Streptomyces griseus photoreactivating enzyme. Photochemistry and Photobiology 33:65-72.
Elferink, Marieke G. L., Christa Schleper, and Wolfram Zillig. 1996. Transformation of the extremely thermoacidophilic archaeon Sulfolobus solfataricus via a self-spreading vector. FEMS Microbiology Letters 137:31-35.
Ellsion, S.A., and S.M.Beiser. 1960. The ultraviolet inactivation of pneumococcus transforming factor. Radiation Research 12:381-388.
Forterre, Patrick. 2002. A hot story from comparative genomics: reverse gyrase is the only hyperthermophilic-specific protein. TRENDS in Genetics 18:236-238.
Forterre, Patrick. 2002. Evolution of the Archaea. Theoretical Population Biology 61:409-422.
Forterre, Patrick, Gilles Mirambeau, Christine Jaxel, Marc Nadal, and Michel Duguet. 1985. High positive supercoiling in vitro catalyzed by an ATP and polyethylene glycol- stimulated topoisomerase from Sulfolobus acidocaldarius. The EMBO Journal 4:2123- 2128.
Fox, George E., Linda J. Magrum, William E. Balch, Ralph S. Wolfe, and Carl R. Woese. 1977. Classification of methanogenic bacteria by 16S ribosomal RNA characterization. PNAS 74:4537-4541.
Goodgal, Sol H., Claud S. Rupert, and Roger M. Herriott. 1957. Photoreactivation of Hemophilus influenzae transforming factor for streptomycin resistance by an extract of Escherichia coli B. p341-343. W.D. McElroy and B. Glass [ed.], The chemical basis of heredity. Johns Hopkins Press, Baltimore.
Goosen, Nora and Geri F. Moolenaar. 2008. Repair of UV damage in bacteria. DNA Repair 7:353-379.
Grogan, Dennis W. 2007. Chapter 5: Mechanisms of genome stability and evolution. In Ricardo Cavicchioli (Ed.), Archaea: Molecular and Cellular Biology. ASM Press, Washington, D.C. 120-138.
35
Grogan, Dennis W. 2004. Stability and repair of DNA in hyperthermophilic archaea. Current Issues in Molecular Biology 6:137-144.
Grogan, Dennis W. 2000. The question of DNA repair in hyperthermophilic archaea. Trends in Microbiology 8:180-185.
Grogan, Dennis W. 1998. Hyperthermophiles and the problem of DNA instability. Molecular Microbiology 28:1043-1049.
Grogan, Dennis W. 1996. Exchange of genetic markers at extremely high temperatures in the archaeon Sulfolobus acidocaldarius. Journal of Bacteriology 178:3207-3211.
Grogan, Dennis W. 1991. Selectable mutant phenotypes of the extremely thermophilic archaebacterium Sulfolobus acidocaldarius. Journal of Bacteriology 173:7725-7727. Grogan, Dennis W., Geraldine T. Carver, and John W. Drake. 2001. Genetic fidelity under harsh conditions: Analysis of spontaneous mutation in the thermoacidophilic archaeon Sulfolobus acidocaldarius. PNAS 98:7928-7933.
Grogan, Dennis W., and Robert P. Gunsalus. 1993. Sulfolobus acidocaldarius synthesizes UMP via a standard de novo pathway: results of a biochemical-genetic study. Journal of Bacteriology 175:1500-1507.
Grogan, Dennis W., G.T. Carver, and J.W. Drake. 2001. Genetic fidelity under harsh conditions: analysis of spontaneous mutation in the thermoacidophilic archaeon Sulfolobus acidocaldarius. Proceedings of the National Academy of Science USA 98:7928-7933.
Goosen, Nora and Geri F. Moolenaar. 2008. Repair of UV damage in bacteria. DNA Repair 7:353-379.
Gupta, Ramesh. 1984. Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs. Journal of Biological Chemistry 259:9461-9471.
Hallam, Steven J., Konstantinos T. Konstantinidis, Nik Putnam, Christa Schleper, Yoh- ichi Watanabe, Junichi Sugahara, Christina Preston, Jose de la Torre, Paul M. Richardson, and Edward F. DeLong. 2006. Genomic analysis of the uncultivated marine crenarchaeote Cenarchaeum symbiosum. PNAS 103:18296-18301.
Hansen, Josh E., Amy C. Dill, and Dennis W. Grogan. 2005. Conjugational genetic exchange in the hyperthermophilic archaeon Sulfolobus acidocaldarius: Intragenic recombination with minimal dependence on marker separation. Journal of Bacteriology 187:805-809.
36 Harm, Walter. 1970. Analysis of photoenzymatic repair of UV lesions in DNA in single light flashes. V. Determination of the reaction-rate constants in E.coli cells. Mutation Research 10:277-290.
Hubscher, Ulrich, Giovanni Maga, and Silvio Spadari. 2002. Eukaryotic DNA Polymerases. Annual Review of Biochemistry 71:133-163.
Husain, Intisar and Aziz Sancar. 1987. Photoreactivation in phr mutants of Escherichia coli K-12. Journal of Bacteriology 169:2367-2372.
Ishii, Chizu, Kiyoshi Nakamura, and Hirokazu Inoue. 1991. A novel phenotype of an excision-repair mutant in Neurospora crassa: Mutagen sensitivity of the mus-18 mutant is specific to UV. Molecular and General Genetics 228:33-39.
Iwatsuki, Norio, Cheol O. Joe, and Harold Werbin. 1980. Evidence that deoxyribonucleic acid photolyase from Baker’s yeast is a flavoprotein. Biochemistry 19:1172-1176.
Iyer, Lakshminarayan M., Kira S. Makarova, Eugene V. Koonin, and L. Aravind. 2004. Comparative genomics of the FtsK-HerA superfamily of pumping ATPases: implications for the origins of chromosome segregation, cell division, and viral capsid packaging. Nucleic Acids Research 32:5260-5279.
Iyer, Ravi R., Anna Pluciennik, Vickers Burdett, and Paul L. Modrich. 2006. DNA Mismatch repair: functions and mechanisms. Chemical Reviews 106:302-323.
Jonuscheit, Melanie, Erika Martusewitsch, Kenneth M. Stedman, and Christa Schleper. 2003. A reporter gene system for the hyperthermophilic archaeon Sulfolobus solfataricus based on a selectable and integrative shuttle vector. Molecular Microbiology 48:1241- 1252.
Kandler, Otto and Hans Hippe. 1977. Lack of peptidoglycan in the cell walls of Methanosarcina barkeri. Archaeal Microbiology 113:57-60.
Kawarabayasi, Yutaka, Yumi Hino, Hiroshi Horikawa, Koji Jin-no, Mikio Takahashi, Mitsuo Sekine, Sin-ichi Baba, Akiho Ankai, Hiroki Kosugi, Akira Hosoyama, Shigehiro Fukui, Yoshimi Nagai, Keiko Nishijima, Rie Otsuka, Kidekazu nakazawa, Minako Takamiya, Yumiko Kato, Takio Yoshizawa, Toshihiro Tanaka, Yutaka Kudoh, Jun Yamazaki, Norihiro Kushida, Akio Oguchi, Ken-ichi Aoki, Sayaka Masuda, Masao Yanagii, Masami Nishimura, Akihiko Yamagishi, Tairo Oshima, and Hisasi Kikuchi. 2001. Complete genome sequence of an aerobic thermoacidophilic Crenarchaeon, Sulfolobus tokodaii strain 7. DNA Research 8:123-140.
Kelman, Zvi and Malcolm F. White. 2005. Archaeal DNA replication and repair. Current Opinion in Microbiology 8:669-676.
37 Kelner, Albert. 1964. Correlation between genetic transformability and non- photoreactivability in Bacillus subtilis. Journal of Bacteriology 87:1295-1303.
Kelner, Albert. 1949. Photoreactivation of ultraviolet-irradiated Escherichia coli, with special reference to the dose-reduction principle and to ultraviolet-induced mutation. Journal of Bacteriology 58:511-522.
Kelner, Albert. 1949a. Effect of visible light on the recovery of Streptomyces griseus conidia from ultra-violet irradiation injury. PNAS 35:73-79.
Kikuchi, Akihiko and Keiko Asai. 1984. Reverse gyrase-a topoisomerase which introduces positive superhelical turns into DNA. Nature 309:677-681.
Kisker, Caroline. 2007. When one protein does the job of many. Structure 15:1163-1165.
Kletzin, Arnulf. 2007. Chapter 2: General characteristics and important model organisms. In Ricardo Cavicchioli (Ed.) Archaea: Molecular and Cellular Biology. ASM Press, Washington, D.C. 14-92.
Kondo, Satoru, Akihiko Yamagishi, and Tairo Oshima. 1991. Positive selection for uracil auxotrophs of the sulfur-dependent thermophilic archaebacterium Sulfolobus acidocaldarius by use of 5-fluoroorotic acid. Journal of Bacteriology 173:7698-7700.
Kornberg, Arthur. 1988. DNA replication. The Journal of Biological Chemistry 263:1-4.
Kunkel, Thomas A. and Dorothy A. Erie. 2005. DNA Mismatch repair. Annual Review of Biochemistry 74:681-710.
Kuriyan, John and Mike O’Donnell. 1993. Sliding clamps of DNA polymerases. The Journal of Molecular Biology 234:915-925.
Kurosawa, Norio and Dennis W. Grogan. 2005. Homologous recombination of exogenous DNA with the Sulfolobus acidocaldarius genome: Properties and uses. FEMS Microbiology Letters 253:141-149.
Lao-Sirieix, Si-Huoy and Stephen D. Bell. 2004. The heterodimeric primase of the hyperthermophilic archaeon Sulfolobus solfataricus possesses DNA and RNA primase, polymerase and 3’-terminal nucleotidyl transferase activities. Journal of Molecular Biology 344:1251-1263.
Lao-Sirieix, Si-Houy, Victoria L. Marsh, and Stephen D. Bell. 2007. Chapter 3: DNA replication and cell cycle. In Ricardo Cavicchioli (Ed.), Archaea: Molecular and Cellular Biology. ASM Press, Washington, D.C. 93-109.
Li, Ywan Feng, Sang-Tae Kim, and Aziz Sancar. 1993. Evidence for lack of DNA photoreactivating enzyme in humans. PNAS 90:4389-4393.
38
Lindahl, Tomas. 1993. Instability and decay of the primary structure of DNA. Nature 362:709-715.
Liu, Yilun and Stephen C. West. 2004. Happy Hollidays: 40th anniversary of the Holliday junction. Nature Reviews. Molecular Cell Biology 5:937-946.
Lorenz, Michael C., R. Scott Muir, Eric Lim, John McElver, Shane C. Weber, and Joseph Heitman. 1995. Gene disruption with PCR products in Saccharomyces cerevisiae. Gene 158:113-117.
Lundgren, Magnus, Anders Andersson, Lanming Chen, Peter Nilsson, and Rolf Bernander. 2004. Three replication origins in Sulfolobus species: Synchronous intiation of chromosome replication and asynchronous termination. PNAS 101:7046-7051.
Manzan, Angelo, Gunter Pfeiffer, Melissa L. Hefferin, Cara E. Lang, James P. Carney, and Karl-Peter Hopfner. 2004. MlaA, a hexameric ATPase linked to the Mre11 complex in archaeal genomes. EMBO 5:54-59.
Marguet, Evelyne and Patrick Forterre. 1994. DNA stability at temperatures typical for hyperthermophiles. Nucleic Acids Research 22:1681-1686.
McCready, Shirley J., and Brett Cox. 1993. Repair of 6-4 photoproducts in Saccharomyces cerevisiae. Mutation Research 293:233-240.
Mirambeau, Gilles, Michel Duguet, and Patrick Forterre. 1984. ATP-dependent DNA topoisomerase from the archaebacterium Sulfolobus acidocaldarius. Journal of Molecular Biology 179:559-563.
Mott, Melissa L. and James M. Berger. 2007. DNA replication initiation: mechanisms and regulation in bacteria. Nature Reviews Microbiology 5:343-354.
Murzin, Alexey G. 1993. OB (oligonucleotide/oligosaccharide binding)-fold: common structural and functional solution for non-homologous sequences. The EMBO Journal 12:861-867.
Napoli, Alessandra, Anna Valenti, Vincenzi Salerno, Marc Nadal, Florence Garnier, Mosè Rossi, and Maria Ciaramella. 2004. Reverse gyrase recruitment to DNA after UV light irradiation in Sulfolobus solfataricus. The Journal of Biological Chemistry 279:33192-33198.
Narasipura, Srinivas D., Ping Ren, Madhu Dyavaiah, Ivan Auger, Vishnu Chaturvedi, and Sudha Chaturvedi. 2006. An efficient method for homologous gene reconstitution in Cryptococcus gattii using URA5 auxotrophic marker. Mycopathologia 162:401-409.
39 Niehaus, F., C. Bertoldo, M. Kähler, and G. Antranikian. 1999. Extremophiles as a source of novel enzymes for industrial applications. Applied Microbiology and Biotechnology 51:711-729.
Neuhard, Jan, Elisabeth Stauning, and Rodney A. Kelln. 1985. Cloning and characterization of the pyrE gene and of PyrE::Mud1 (Ap lac) fusions from Salmonella typhimurium. European Journal of Biochemistry 146:597-603.
Neumann, E., M. Schaefer-Ridder, Y. Wang, and P. H. Hofschneider. 1982. Gene transfer into mouse lyoma cells by electroporation in high electric fields. The EMBO Journal 1:841-845.
O’Donovan, Anne, Adelina A. Davies, Jonathan G. Moggs, Stephen C. West, and Richard D. Wood. 1994. XPG endonuclease makes the 3’ incision in human DNA nucleotide excision repair. Nature 371:432-435.
Paspaleva, Keti, Ellen Thomassen, Navraj S. Pannu, Shigenori Iwai, Geri F. Moolenaar, Nora Goosen, and Jan Pieter Abrahams. 2007. Crystal structure of the DNA repair enzyme Ultraviolet Damage Endonuclease. Structure 15:1316-1324.
Quasier, Achim, Florence Constantinesco, Malcolm F. White, Patrick Forterre, and Christiane Elie. 2008. The Mre11 protein interactions with both Rad50 and the HerA bipolar helicase and is recruited to DNA following gamma irradiation in the archaeon Sulfolobus acidocaldarius. BMC Molecular Biology 9:25.
Qui, Junzhuan, Min-Xin Guan, Adam M. Bailis, and Binghui Shen. 1998. Saccharomyces cerevisiae exonuclease-1 plays a role in UV resistance that is distinct from nucleotide excision repair. Nucleic Acids Research 26:3077-3083.
Quirks, Philip G., David B. Hicks, and Terry A. Krulwich. 1993. Cloning of the cta operon from alkaliphilic Bacillus firmus OF4 and characterization of the pH-regulated cytochrome caa3 oxidase it encodes. The Journal of Biological Chemistry 268:678-685.
Roberts, J. A., Stephen D. Bell, and Malcolm F. White. 2003. An archaeal XPF repair endonuclease dependent on a heterotrimeric PCNA. Molecular Microbiology 48:361-371.
Robinson, Nicholas P. and Stephen D. Bell. 2005. Origins of DNA replication in the three domains of life. FEBS Journal 272:3757-3766.
Robinson, Nicholas P., Isabelle Dionne, Magnus Lundgren, Victoria L. Marsh, Rolf Bernander, and Stephen D. Bell. 2004. Identification of two origins of replication in the single chromosome of the archaeon Sulfolobus solfataricus. Cell 116:25-38.
Rodríguez, A. Chapin, and Daniela Stock. 2002. Crystal structure of reverse gyrase: insights into the positive supercoiling of DNA. The EMBO Journal 21:418-426.
40 Rupert, Claud S., Sol H. Goodgal, and Roger M. Herriott. 1958. Photoreactivation in vitro of ultraviolet inactivated Hemophilus influenzae transforming factor. The Journal of General Physiology 41:451-471.
Saiki, Randall K., David H. Gelfand, Susanne Stoffel, Stephen J. Scharf, Russell Higuchi, Glenn T. Horn, Kary B. Mullis, and Henry A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.
Sancar, Aziz. 1994. Structure and function of DNA photolyase. Biochemistry 33:2-9.
Sancar, Aziz, and Gwendolyn B. Sancar. 1984. Escherichia coli DNA photolyase is a flavoprotein. Journal of Molecular Biology 172:223-227.
Sancar, Aziz, Frances W. Smith, and Gwendolyn B. Sancar. 1984. Purification of Escherichia coli DNA Photolyase. The Journal of Biological Chemistry 259:6028-6032.
Sancar, Gwendolyn B., Frances W. Smith, Matthew C. Lorence, Claud S. Rupert, and Aziz Sancar. 1984. Sequences of the Escherichia coli photolyase gene and protein. The Journal of Biological Chemistry 259:6033-6038.
Sato, Takaaki, Toshiaki Fukui, Karuyuki Atomi, and Tadayuki Imanaka. 2005. Improved and versatile transformation system allowing multiple genetic manipulations of the hyperthermophilic archaeon Thermococcus kodakaraensis. Applied and Environmental Microbiology 71:3889-3899.
Sato, Takaaki, Toshiaki Fukui, Karuyuki Atomi, and Tadayuki Imanaka. 2002. Targeted gene disruption by homologous recombination in the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1. Journal of Bacteriology 185:210-220.
Schaeffer, L., V. Moncollin, R. Roy, A. Staub, M. Mezzina, A. Sarasin, G. Weeda, J. H. J. Hoeijmakers, and J. M. Egly. 1994. The ERCC2/DNA repair protein is associated with the class II BTF2/TFIIH transcription factor. The EMBO Journal 13:2388-2392.
Schaeffer, L., R. Roy, S. Humbert, V. Moncollin, W. Vermeulen, J. H. Hoeijamkers, P. Chambon, and J.M. Egly. 1993. DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. Science 260:58-63.
Scherer, Stewart and Ronald W. Davis. 1979. Replacement of chromosome segments with altered DNA sequences constructed in vivo. PNAS 76:4951-4955.
Schleper, Christa, Ingelore Holz, Davorin Janekovic, John Murphy, and Wolfram Zillig. 1995. A multicopy plasmid of the extremely thermophilic archaeon Sulfolobus effects its transfer to recipients by mating. Journal of Bacteriology 177:4417-4426.
41 Schleper, Christa, Klaus Kubo, and Wolfram Zillig. 1992. The particle SSVI from the extremely thermophilic archaeon Sulfolobus is a virus: Demonstration of infectivity and of transfection with viral DNA. PNAS 89:7645-7649.
Sharples, Gary J., and David R. F. Leach. 1995. Structural and functional similarities between the SbcCD proteins of Escherichia coli and the RAD50 and MRE11 (RAD32) recombination and repair proteins of yeast. Molecular Microbiology 17:1215-1217.
She, Qunxin, R.K. Singh, F. Confalonieri, Y. Zivanovic, G. Allard, M.J. Awayez, C.C.Y. Chan-Weiher, I.G. Clausen, B.A. Curtis, A. De Moors, et al. 2001. The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proceedings of the National Academy of Science USA 98:7835-7840.
Shuttleworth, Gillian, Mark J. Fogg, Michael R. Kurpiewski, Linda Jen-Jacobson, and Bernard A. Connolly. 2004. Recognition of the pro-mutagenic base uracil by family B DNA polymerases from Archaea. Journal of Molecular Biology 337:621-634.
Snapka, Robert M., and Betsy M. Sutherland. 1980. Escherichia coli photoreactivating enzyme: purification and properties. Biochemistry 19:4201-4208.
Stedman, Kenneth M., Crista Schleper, Evelyn Rumpf, and Wolfram Zillig. 1999. Genetic requirements for the function of the archaeal virus SSVI in Sulfolobus solfataricus: Construction and testing of viral shuttle vectors. Genetics 152:1397-1405.
Stetter, Karl O. 1996. Hyperthermophilic prokaryotes. FEMS Microbiology Reviews 18:149-158.
Stukenberg, P. Todd, Patricia S. Studwell-Vaughn, and Mike O’Donnell. 1991. Mechanism of the sliding β-clamp of DNA polymerase III holoenzyme. The Journal of Biological Chemistry 266:11328-11334.
Takao, Masashi, Rie Yonemasu, Kazuo Yamamoto, and Akira Yasui. 1996. Characterization of a UV endonuclease gene from the fission yeast Schizosaccharomyces pombe and its bacterial homolog. Nucleic Acids Research 24:1267-1271.
Tamakoshi, Masatada, Takuro Yaoi, Tairo Oshima, and Akihiko Yamagishi. 1999. An efficient gene replacement and deletion system for an extreme thermophile, Thermus thermophilus. FEMS Microbiology Letters 173:431-437.
Taylor, Andrew F., and Gerald R. Smith. 2003. RecBCD enzyme is a DNA helicase with fast and slow motors of opposite polarity. Nature 423:889-893.
Tsong, Tian Y. 1991. Electroporation of cell membranes. Biophysical Journal 60:297- 306.
42 van der Spek, P.J., K. Kobayashi, D. Bootsma, M. Takao, A.P.M. Eker, and Akira Yasui. 1996. Cloning, tissue expression and mapping a human photolyase homolog with similarity to plant blue-light receptors. Genomics 37:177-182.
Vieille, Claire and Gregory J. Zeikus. 2001. Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiology and Molecular Biology Reviews 65:1-43.
Wang, Jun, Pei-Xia Jiang, Hui Feng, Ying Feng, and Zheng-Guo He. 2007. Three eukaryote-like Orc1/Cdc6 proteins functionally interact and mutually regulate their activities of binding to the replication origin in the hyperthermophilic archaeon Sulfolobus solfataricus P2. Biochemical and Biophysical Research Communications 363:63-70.
Wei, Tao, Songtao Zhang, Shanshan Zhu, Duohong Sheng, Jinfeng Ni, and Yulong Shen. 2008. Physical and functional interaction between archaeal single-stranded DNA-binding protein and the 5’-3’ nuclease NurA. Biochemical and Biophysical Research Communications 367:523-529.
Whitaker, Rachel J., Dennis W. Grogan, and John W. Taylor. 2003. Geographic barriers isolate endemic populations of hyperthermophilic archaea. Science 301:976-978.
White, Malcolm F. 2007. Chapter 15: DNA repair. In Roger Garrett and Hans-Peter Klenk (Eds.) Archaea: Evolution, Physiology, and Molecular Biology. Blackwell Publishing Ltd., Malden, MA 171-183.
White, Malcolm F. 2003. Archaeal DNA repair: paradigms and puzzles. Biochemical Society Transactions 31:690-693. Whitman, William B., Felicitas Pfeifer, Paul Blum, and Albrecht Klein. 1999. What archaea have to tell biologists. Genetics 152: 1245-1248.
Wood, Richard D. 1997. Nucleotide Excision Repair in Mammalian Cells. The Journal of Biological Chemistry 272:23465-23468.
Wyrick, John J., Jennifer G. Aparicio, Ting Chen, John D. Barnett, Ezra G. Jennings, Richard A. Young, Stephen P. Bell, and Oscar M. Aparicio. 2001. Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: High-resolution mapping of replication origins. Science 294:2357-2360.
Yajima, Hirohiko, Masashi Takao, Shinji Yasuhira, Ji He Zhao, Chizu Ishii, Hirokazu Inoue, and Akira Yasui. 1995. A eukaryotic gene encoding an endonuclease that specifically repairs DNA damaged by ultraviolet light. The EMBO Journal 14:2393- 2399.
Yao, Nina, Jennifer Turner, Zi Kelman, P. Todd Stukenberg, Frank Dean, David Shechter, Zhen-Qiang Pan, Jerard Hurwitz, and Mike O’Donnell. 1996. Clamp loading,
43 unloading and intrinsic stability of the PCNA, β and gp45 sliding clamps of human, E.coli and T4 replicases. Genes to Cells 1:101-113.
Yasui, Akira, and Shirley J. McCready. 1998. Alternative repair pathways for UV- induced DNA damage. BioEssays 20:291-297.
Zhang, Songtai, Tao Wei, Guihua Hou, Chao Zhang, Pengjuan Liang, Jinfeng Ni, Duohong Sheng, and Yulong Shen. 2008. Archaeal DNA helicase HerA interacts with Mre11 homologue and unwinds blunt-ended double-stranded DNA and recombination intermediates. DNA Repair 7:380-391.
Zillig, Wolfram, Karl O. Stetter, and Davorin Janekovic. 1979. DNA-dependent RNA polymerase from the archaebacterium Sulfolobus acidocaldarius. European Journal of Biochemistry 96:587-604.
44 Chapter II. Evaluating Techniques for Cloning Sulfolobus Genes
1. Methods Evaluated
The first objective of the project was to clone several genes of interest in plasmids to later be disrupted for analyzing gene function. There are many advantages for cloning the genes in small multicopy E. coli plasmids. An abundance of the DNA can be obtained in several hours, many manipulations of the genes can be made with ease and control, selectable markers are available to select for the desired phenotype, and the genes can be transported from one species to another if a shuttle vector is used. The methods evaluated in greatest detail were PCR, digestion by restriction enzymes (REs), and ligation, direct cloning of PCR products by ligation, and direct cloning of PCR products by topoisomerase. Four genes were cloned by the first method and ten genes were cloned by the last method.
All restriction enzymes, pUC19, pNEB193, Phusion polymerase, T4 DNA ligase, and Antarctic phosphatase were purchased from New England Biolabs unless otherwise noted. GC Cloning™ & Amplification Kit (pSMART®GCLK) was purchased from
Lucigen®. TOPO TA Cloning® Kit was purchased from Invitrogen™. Table 2.1 lists primers used for cloning. Table 2.2 lists the constructed clones.
45 Table 2.1. Primers used to amplify genes cloned. Tm Primer (◦C) Sequence (5’-3’) GCA GCC TAG GTA CCG ATA TGA GAG AGG TTT ATC CAT SsoPEAvrKpnr1 64.8 TGC SsoPEFKpnAvrf1 64.1 GCA CCT AGG ACG TGT CTT AAT CTC ACA AAG CCC TTA T SaRad1f1 69.7 GAG GCG CGC CGG CTA CCG TTA TCA GAT GAG TAT GCA GT GAG GCG CGC CGG CGT CAG TTG AGA GAG GTA AAT AAG SaRad1r1 69.8 GT SacRAD2XPGf1 73 GAG GCG CGC CGG CAC GTT CGC CTG TGA CTG ATC AAG A SacRAD2XPGr1 73.1 GAG GCG CGC CGG CTT AGT ACC AAC CTT TCC ACC GCC T SaRad2f1 (RAD25) 69.7 GAG GCG CGC CGG CTC ATC ATT TCT CAG ACC TTA CGA GA SaRad2r1(RAD25) 70 GAG GCG CGC CGG CAT TGC CCT TAA CTC TAT AGC TAC CA Saci1227f (PHR) 59.7 AAG AGA GAC CAC CGG TCT GAA TGT Saci1227r (PHR) 59.7 CCT TGG TCA TGC CTT CGT GCT AAA Saci0839f (RGY) 60.4 ACG AAG GCT ATC TCC TGC AGC ATT Saci0839r (RGY) 60 TGG TAT AGA ACG CCC AAG CTC CTT NXSaci1096f (UVDE) 68.8 GAACGCCGGCTCGAGCAAGAGGGTCAATCGATAATTGG NXSaci1096r (UVDE) 68.6 GAGGCCGGCTCGAGGGGCGTTTGGTATACTGTTCTATC SaHerAf 54.9 TTTGCTCTATTAGGCGGGTTATTC SaHerAr 54.2 GCCACCGAATTAAAGGTAAAGAAG SaNurAf 53.4 GTTATACGAAGTGCCATAGAGATTG SaNurAr 53.2 TCTAGGAGAACAAATAGAGAAGGAG SaOriC1f 54 GGTTACTTAACACAAACCTCGTTAC SaOriC1r 54.5 CTTACTAGCCAAGATACCACAAGTT SaOriC2f 55.3 GTGCAAATAATGGACTCCTTCTGAT SaOriC2r 54.3 TTCCTCAAGATGACCATTAGGTAAC SaOriC3f 53.3 ACGTACTTCTCCTTAGTGGATTT SaOriC3r 53 AATCAAGATAATCCATCGGAAGC ANSaci0722f (cdc6-1) 70 GAGGCGCGCCGGCGAAACAATCGATATGAGAACCAGC ANSaci0722r (cdc6-1) 70.5 GAGGCGCGCCGGCGTTACCTCATAGGGAAGACCAAAT ANXSaci0903f (cdc6-2) 73.4 GAGGCGCGCCGGCTCGAGAGTTTCGGTCAAGTCTCTGGGTCA ANXSaci0903r (cdc6-2) 73.8 GAGGCGCGCCGGCTCGAGTCCCTCTACCACTTTGCCTTGTGT ANXSaci0001f (cdc6-3) 71.2 GAGGCGCGCCGGCTCGAGATACAGGAGGTTAAGAAGGAGGAC ANXSaci0001r (cdc6-3) 71.8 GAGGCGCGCCGGCTCGAGCTCATACTCTAACTGCATTGCCTC
46
Table 2.2. Summary of plasmids containing cloned genes with method of cloning described. Plasmid Method of Construction pLK1a Sso pyrEF in pUC19; pyrEF PCR amplified with AvrII sites on ends pLK2a Sso pyrFE in pUC19; pyrEF PCR amplified with AvrII sites on ends pLK3a Sso pyrE in pNEB193; pyrE PCR amplified with AvrII sites on ends pLKRAD1r pUC19 digested with XmaI and rad1 with NgoMIV; backward orientation; pLKRAD1f pUC19 digested with XmaI and rad1 with NgoMIV; forward orientation; pUC19 digested with XmaI and rad25 PCR product with NgoMIV; backward pLKRAD25r orientation pUC19 digetsed with XmaI and rad25 PCR product with NgoMIV; forward pLKRAD25f orientation pPCBE12 digested with SpeI and pyrE PCR product digested with AvrII; pLK4a1f forward orientation pPCBE12 digested with SpeI and pyrE PCR product digested with AvrII; pLK4a2r backward orientation pLK3a and p34S-CM digested with HindIII; cml to right of pyrE; forward pLKCMHind2 orientation pLK3a and p34S-CM digested with HindIII; cml to right of pyrE; backward pLKCMHind6 orientation pLKCMSal1 pLK3a and p34S-CM digested with Sal I; cml right of pyrE; forward orientation pLKCMSma1 pLK3a and p34S-CM digested with SmaI; cml left of pyrE; forward orientation pLKCMXma1 pLK3a and p34S-CM digested with XmaI; cml left of pyrE; forward orientation pLKCMPst1 pLK3a and p34S-CM digested with PstI; cml right of pyrE; forward orientation pLK5a pLKCMSal1 digested with AvaII (deletes portion of amp gene); ampS cmlR pLK5b pLKCMHind2 digested with AvaII (deletes portion of amp gene); ampS cmlR pLK5c pLKCMXma1 digested with AvaII (deletes portion of amp gene); ampS cmlR pLK6a rad2 PCR product digested with NgoMIV and pUC19 with XmaI pLKPHR phr PCR product cloned into TOPO cloning vector pLKRGY rgy PCR product cloned into TOPO cloning vector pLKUVDE uvde PCR product cloned into TOPO cloning vector pLKcdc6-1 cdc6-1 PCR product cloned into TOPO cloning vector pLRHerA herA PCR product cloned into TOPO cloning vector pLRNurA nurA PCR product cloned into TOPO cloning vector pLROriC1 oriC1 PCR product cloned into TOPO cloning vector pLRcdc6-2 cdc6-2 PCR product cloned into TOPO cloning vector pLRcdc6-3 cdc6-3 PCR product cloned into TOPO cloning vector pLROriC2 oriC2 PCR product cloned into TOPO cloning vector pLK5a and pLRNurA digested with AscI; NurA put into pLK5a for allele pLK8a replacement;
47
2. Cloning by PCR, Restriction Digestion and Ligation
The first cloning method attempted involved PCR of the gene from the S. acidocaldarius genomic DNA, restriction digestion and ligation. The gene was amplified using primers with flanking sequences that corresponded to recognition sites for REs compatible with a restriction site in the multiple cloning site of lacZ on a plasmid in which the gene was to be ligated. The PCR products and plasmid were digested with their respective enzymes and ligated together. Ligation mixtures were transformed into E.coli and plated on media containing Xgal and IPTG to score for Lac- colonies, which indicates disruption of the lacZ gene by insertion of the gene of interest. Gel electrophoresis and screening of the plasmid DNA with REs were used to further confirm ligation of the gene into the plasmid. This approach was successful in the cloning of pLK3a and S. cerevisiae RAD homologs, as follows.
pyrE cassette donor pLK3a. The Sulfolobus solfataricus (Sso) pyrE gene was cloned into pNEB193 to provide a convenient source of Sso pyrE to be used as a means of disruption and selection in S. acidocaldarius. Using Phusion polymerase (Finnzymes
OY, Espoo, Finland), Sso pyrE was amplified from pMJ03 (Jonuscheit et al., 2003) using primers SsoPEFAvrKpnf1 and SsoPEAvrKpnr1 (Table 2.1) which add flanking AvrII and KpnI restriction sites on both ends. The PCR program was as follows: initial denaturation at 98◦C for 30s, followed by 28 cycles of 98◦C for 7s, 64◦C for 20s, 72◦C for 45s, and final extension at 72◦C for 7mins. Amplification of Sso pyrE (711bp) was confirmed via gel analysis (Fig. 2.1). This product was then digested with AvrII for 1 hour at 37◦C. Inactivation of AvrII was not necessary due to pNEB193 having no
48 recognition sequences for AvrII. pNEB193 was digested with XbaI for 1 hour at 37◦C and treated with Antarctic phosphatase for 15mins at 37◦C to reduce self-ligation. XbaI was not heat inactivated because there are no XbaI sites in Sso pyrE. Both digested products were ligated together using T4 DNA ligase overnight; the desired ligation would not recreate AvrII or XbaI restriction sites. Gel analysis was again used to verify ligation
(ligated vector referred to as pLK3a) (Figure 2.2). The ligation mixture was chemically transformed into DH5α cells by incubating the ligation and cells on ice for 30mins, briefly heat-shocking at 42◦C, followed by immediate incubation on ice for 2mins. To each reaction, 800µl of SOC medium was added and then incubated at 37◦C for 45mins.
The transformed cells were spread on plates containing YT + amp (200µg/ml) + Xgal
(20mg/ml) + IPTG (200mg/ml) for selection of ampR and lacZα- transformants (white colonies). These colonies were then streaked for isolation and single colonies were grown in 3mL YT media + 12µl amp (50mg/ml). The plasmid DNA was extracted following protocol given in the QIAprep® Miniprep Handbook (QIAGEN) for plasmid purification using the QIAprep Spin Miniprep Kit. Potential clones were screened with REs SpeI and
SspI, and analyzed via gel electrophoresis (Fig. 2.3). If Sso pyrE is in forward orientation
(in reference to transcription), the resulting fragments are 2123, 1165, and 183bp. Clones
7, 9, 12 and 24 were sequenced (Cincinnati Children’s Hospital), verifying insertion of
Sso pyrE in forward orientation and clones 9 and 12 were kept for further studies.
Although possible, Sso pyrE was never found to ligate in the “backward” orientation.
49 bp MW 1 2 3 4
3675
2323 1929
1371 1264
711 702
Figure 2.1. Gel verification of amplification of Sulfolobus solfataricus pyrE (711bp) from pMJ03. MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: pNEB193 digested with XbaI, no phosphatase treatment, overnight ligation; lane 2: pNEB193 digested with XbaI, phosphatase treated, overnight ligation; lane 3: Sso. pyrE a1; lane 4: S.so pyrE b1. 1 “a” and “b” are from two separate amplifications of Sso pyrE.
1 2 3 4 MW bp
3432 3675 unligated pNEB193 2323 1929
Figure 2.2. Gel verification of Sso pyrE ligation into pNEB193 to create pLK3a (3432bp). Lane 1: 8.5hr ligation of pyrE a1 and pNEB193; lane 2: 20hr ligation of pyrE a1 and pNEB193; lane 3: 8.5hr ligation of pyrE b1 and pNEB193; lane 4: 20hr ligation of pyrE b1 and pNEB193; MW: Molecular Weight standard Lambda DNA. 1 Sso pyrE from separate PCR amplifications.
50 bp MW 1 2 3 4 5 6 7 8 9 10
3675 2323 2123 1929
1371 1264 1126
702
183
Figure 2.3. Screening of pLK3a with SspI and SpeI to verify cloning. Lane 1: Molecular standard (lambda DNA digested with BstEII). Lane 2: pLK3a #7 Lane 3: pLK3a #9 Lane 4: pLK3a #12 Lane 5: pLK3a #17 Lane 6: pLK3a #18 Lane 7: pLK3a #24. Fragments indicated by arrows: 2123, 1126, 183bp.
A chloramphenicol acetyl transferase (cml) gene was added to pLK3a to make an alternative convenient source of Sso pyrE in the form of a pyrEcml cassette. The cml gene was used as an alternative selectable marker in E. coli because many of the plasmids used in later studies are derivatives of pUC19 making them all ampicillin resistant. The cml gene was digested from p34S-CM (Dennis and Zylstra, 1998) using several different REs
(HindIII, PstI, SalI, and XmaI/SmaI). In p34S-CM, the same restriction sites are on both sides of the gene to make it easy to remove from p34S-CM to another plasmid. pLK3a was digested with the same REs to give compatible ends for ligation of cml into the
51 vector, placing it directly next to the pyrE gene, thus giving a pyrEcml cassette in a plasmid, pLK3CM. Verification of cml ligation into pLK3a was done by selecting for transformants on plates containing only chloramphenicol. Those isolates were then streaked on plates containing both chloramphenicol and ampicillin to verify ampR and cmlR. Those clones were further screened using REs (Fig. 2.4).
Because many plasmids used later for disruption studies contained an ampicillin resistance gene, a portion of the amp gene in pLK3CM was deleted to allow for alternative selection of transformants. pLK3CM was digested with AclI to remove a portion of the ampicillin gene and ligated back together resulting in the ampS and cmlR plasmid, pLK5a (Fig. 2.5). This was verified by streaking colonies on selective plates containing chloramphenicol only, and chloramphenicol and ampicillin to verify the plasmids were ampS.
52 bp MW 1 2 3 4 5 6
3675
2323 1929 1520 1371 1264 1235
907
702 617
Figure 2.4. Restriction enzyme analysis to verify insertion of cml gene into pLK3a; creating pLK3CM. MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: pLK3CM 1; lane 2: pLK3Cm 1 with BspEI and AseI; lane 3: pLK3CM 2; lane 4: pLK3CM 2 with BspEI and AseI; lane 5: pLK3CM 3; lane 6: pLK3CM 3 with BspEI and AseI. Forward orientation:1520, 1235, 907, 617, 59bp.
Δ
Figure 2.5. Map of pLK5a, which was constructed by digesting pLK3CM with AclI, deleting part of the amp gene to make the plasmid ampS and cmlR.
53 Homologs of S. cerevisiae RAD genes. Homologs of S. cerevisiae RAD1
(Saci0604), RAD2 (Saci0775) and RAD25 (Saci1326) were all amplified from the S. acidocaldarius strain DG185 using Taq polymerase. Saci0604 amplified with primers
SaRad1f1 and SaRad1r1, Saci0775 amplified with primers SacRAD2XPGf1 and
SacRAD2XPGr1 and Saci1326 amplified with primers SaRad2f1 and SaRad2r1 (Table
2.1). All primer sets include 5’ “tails” encoding recognition sequences for AscI and
NgoMIV. The S. acidocaldarius loci were all amplified using the same PCR protocol:
95◦C for 2mins, 28 cycles of 95◦C for 22s, 52◦C for 22s, and 72◦C for 1min 33s, followed by a final extension of 3mins at 72◦C. PCR amplifications were verified via gel analyses.
All three plasmids were constructed using the same protocol as illustrated in
Figure 2.6. pUC19 was digested with XmaI at 37◦C for 1hr, treated with Antarctic phosphatase to reduce self-ligation, and incubated at 65◦C for 20mins to heat inactivate both enzymes. All PCR products (Saci0604, Saci0775, and Saci1326) were digested with
NgoMIV for 1hr at 37◦C and then heat inactivated at 80◦C for 20mins. Genes were ligated into the lacZα gene in pUC19 overnight using T4 DNA ligase. Ligations were chemically transformed into DH5α cells and ampR lacZα- transformants were selected on media containing YT + amp (200µg/ml) + Xgal (20mg/ml) + IPTG (200mg/ml). White colonies (lacZα-) were streaked for isolation and grown in 3mL YT + 12µl amp
(50mg/ml). Plasmid DNA was extracted as previously described and cloning of genes was verified via restriction digestion and gel analysis (Figures 2.7-2.9).
54 0
A B 412; XmaI
GCCGGC rad1
CGGCCG PC R
GCCGGC GCCGGC 1626 CGGCCG CGGCCG XmaI digestion NgoMIV digestion
CCGG C G C GGGCC G CGGCC CCGGG C
Ligate
pRAD1 C
Figure 2.6. Illustration of how the three homologs of Saccharomyces cerevisiae RAD genes were cloned into pUC19. (A) The gene is PCR amplified from the Sulfolobus acidocaldarius chromosome with NgoMIV engineered into the primers. (B) pUC19 is digested with XmaI to give compatible sticky ends to the gene. (C) Gene and linear plasmid are ligated together to form recombinant molecule (cloned gene).
55 bp MW 1 2 3 4 5 6 7 8 9 10 11 12
3675 3011 2323 1929 1371 1264
702 697
Figure 2.7. Restriction enzyme analysis verifying cloning of rad1in pUC19, creating pRAD1 (3718bp). MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: pRAD1 6a; lane 2: pRAD1 6a digested with PstI; lane 3: pRAD1 6b; lane 4: pRAD1 6b digested with PstI; lane 5: pRAD1 6c; lane 6: pRAD1 6c digested with PstI ; lane 7: pRAD1 6d; lane 8: pRAD1 6e digested with PstI; lane 9: pRAD1 6e; lane 10: pRAD1 6e digested with PstI; lane 11: pUC19 (control); lane 12: pUC19 digested with PstI (control). pRAD1 6e in forward orientation – 697, 3011bp.
bp MW 1 2 3 4 5 6 7 8
3675 2751 2323 1929
1371 1264
702 672 654
Figure 2.8. Restriction enzyme analysis verifying cloning of rad2 into pUC19, creating pLK6a (4077bp). MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: pLK6a #1; lane 2: pLK6a #2; lane 3: pLK6a #3; lane 4: pUC19 (control); lane 5: pLK6a #1 digested with HindIII; lane 6: pLK6a #2 digested with HindIII; lane 7: pLK6a #3 digested with HindIII; lane 8: pUC19 digested with HindIII (control). Fragments: pUC19 digestion – 2686bp, linear; pLK6a digestion – 2751, 672, 654bp.
56 bp MW 1 2 3 4 5 6 7 8 9 10 11 12
3675 3369 2323 1929 1371 1264
702 630
Figure 2.9. Restriction enzyme analysis verifying cloning of rad25 into pUC19, creating pRAD25 (3999bp). MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: pRAD25 2.5a; lane 2: pRAD25 2.5a digested with PstI; lane 3: pRAD25 2.5b; lane 4: pRAD25 2.5b digested with PstI; lane 5: pRAD25 2.5c; lane 6: pRAD25 2.5c digested with PstI; lane 7: pRAD25 2.5d; lane 8: pRAD25 2.5d digested with PstI; lane 9: pRAD25 2.5e; lane 10: pRAD25 2.5e digested with PstI; lane 11: pUC19; lane 12: pUC19 digested with PstI. Fragments: pRAD25 digestion, backward orientation – 3369, 630bp.
This method was successful for cloning of four genes (pyrE, Saci0604, Saci0775 and Saci1326), thus providing an abundance of DNA, ease and control for later manipulations, and the option to transport the clone from E.coli to S. acidocaldarius.
3. Cloning by PCR and –G (-A) Overhang Vectors.
Although successful in some cases, the RE and ligation proved to be inefficient and tedious. There are limitations based on restriction sites available in the cloning vector for ligation. In most cases, sequences for REs can be incorporated into primers for amplification of the gene of interest but still the inefficiency of ligation can be a problem.
An alternative cloning method was therefore attempted using commercial cloning kits.
Lucigen® and Invitrogen™ both provide cloning kits that allow for direct cloning of
PCR products. Lucigen® utilizes ligation at single-base overhangs, while Invitrogen™
57 uses topoisomerase-mediated DNA joining of Taq-amplified PCR products. Although there were no limitations based on sequence for either kit, any attempt to clone a gene using the kit from Lucigen® was unsuccessful. The Invitrogen™ cloning kit proved to be extremely efficient, simple and successful for all genes that remained to be cloned (rgy, phr, uvde, oriC1, oriC2, cdc6-1, cdc6-2, cdc6-3, nurA, herA).
GC Cloning. In Lucigen’s (Middleton, WI, USA) GC Cloning ™ &
Amplification Kit (pSMART® GCLK), the amplified target is directly ligated into the provided vector via complementary –G to –C overhangs. First the primers are phosphorylated using T4 Polynucleotide kinase and then the target is amplified using a non-proofreading polymerase that adds a –G onto the end of the PCR product, or a –G can be added using EconoTaq enzyme after initial PCR. The target is then ligated into pSMART®GCLK using CloneSmart® DNA ligase at RT for 30 mins., followed by incubation at 70◦C for 15 mins. The ligation is transformed into E. cloni® 10G
Chemically Competent cells and plated on YT kanamycin (kan) (30µg/ml). After several attempts, no genes were successfully cloned by this method. Because blue-white screening cannot be used with this method, all transformants appear white on the plate and therefore potentially extensive screening is needed to determine true transformants.
Approximately 60 potential transformants from one cloning reaction were screened using restriction enzymes, and all were found to be empty vectors.
TA TOPO Cloning®. As an alternative approach to GC cloning that would still be more efficient than PCR and REs, cloning was attempted using Invitrogen™’s TOPO
TA Cloning® Kit, K4500-01 (Carlsbad, CA, USA) which is designed to clone specifically the PCR products amplified using Taq polymerase. The linearized vector has
58 single 3’-thymidine overhangs to allow for easy ligation with the 3’-adenosine overhang of the Taq-amplified PCR products. The vector is “activated” via the covalent binding of the Vaccinia virus Topoisomerase I. This topoisomerase cleaves the phosphodiester backbone after 5’-CCCTT in one strand (Shuman, 1991). As a result, a covalent bond is made between the 3’ phosphate of the cleaved strand and a tyrosyl residue of the topoisomerase. The 5’ hydroxyl of the cleaved strand can attack the covalent bond between the DNA and topoisomerase causing the reaction to be reversed and the enzyme to be released (Shuman, 1994).
Ten S. acidocaldarius genes (phr, rgy, uvde, nurA, herA, cdc6-1, cdc6-2, cdc6-3, oriC1, oriC2) were amplified using Taq polymerase and verified using gel electrophoresis. Each PCR product was then separately cloned into the pCR®2.1-
TOPO® vector by incubating at RT for 5 mins. The cloning step was followed by chemical transformation using competent DH5α cells. Two µl of the cloning reaction, which included 0.5 to 4.0µl of PCR product, 1µl of salt solution (provided), dH2O added to a total volume of 5.0µl, and 1µl of TOPO vector, pCR®2.1-TOPO®, was added to the competent cells and incubated on ice for 30mins. The cells were heat-shocked for 30s at
42◦C followed by immediate incubation on ice. To each reaction, 250µl of SOC medium was added and the cultures were aerated at 37◦C for 1hr. The transformation mixtures were spread on prewarmed plates containing YT amp (50µg/ml) + Xgal (40mg/ml), and after an overnight incubation at 37◦C, all colonies were counted and white colonies were streaked for isolation. Several isolates were grown in 3ml YT + 12µl amp (50mg/ml) and plasmid DNA was extracted using the QIAprep Spin Miniprep Kit. Each clone was screened using restriction enzymes. Figure 2.10 is a representative screening done with
59 pPHR. These clones were incubated with HincII which cuts only in the phr gene and not in pCR®2.1-TOPO®.
MW 1 2 3 4 5 6 7 8 9 10 bp
4433 4324 3675
2323 1929
1371 1264
870
702
Figure 2.10. Restriction enzyme analysis verifying cloning of phr into TOPO vector. MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: pPHR1 digested with HincII; lane 2: pPHR2 digested with HincII; lane 3: pPHR3 digested with HincII; lane 4: pPHR4 digested with HincII; lane 5: pPHR5 digested with HincII; lane 6: pPHR6 digested with HincII; lane 7: pPHR7 digested with HincII; lane 8: pPHR8 digested with HincII; lane 8: pPHR9 digested with HincII; lane 9: pPHR9 digested with HincII; lane 10: pPHR10 digested with HincII. Fragments: 4433 and 870bp.
This method proved to be much more efficient than PCR and REs and GC cloning. The remaining genes (phr, rgy, nurA, herA, uvde, oriC1, oriC2, cdc6-1, cdc6-2, and cdc6-3) were all cloned using this kit. It should be noted that oriC3 was not cloned because it did not successfully amplify via PCR. It is expected that this problem can be overcome by improved design of primers.
60 4. Summary
For all cloning techniques attempted, there are general disadvantages. Each technique requires PCR, and the choice of polymerase used can greatly affect success of the amplification and cloning. First, the lower the fidelity of the polymerase, the greater the chance of creating mutations (Barnes, 1994). This can be potentially problematic in the case of amplifying selectable markers. Many polymerases also have proofreading exonuclease activities which can lead to the removal of overhanging nucleotides making them blunt and therefore keeping the target from ligating to the complementary overhangs of the appropriate vector. Two other disadvantages of some polymerases are the addition of a single nucleotide on the 3’ end of the target (Taq polymerase can add an adenine (Clark, 1988)) and the production of a blunt-ended PCR product which are not conducive for ligation. Ways to overcome these potential problems would be using a high fidelity polymerase (Phusion, Vent, Velocity), purifying the PCR targets of the PCR reaction components, and incorporating flanking restriction sites in the primers which give the option for creating sticky ends, regardless of the polymerase used, which are more conducive for ligation.
The advantages of using PCR and restriction digestion for cloning are that it is cheap relative to purchasing a cloning kit and restriction sites can be created in primer design. There are however, many disadvantages such as the availability of restriction sites that can be used for ligation, efficient cutting of the enzyme, and also efficient ligation.
One way to get around the lack of restriction sites would be to create restriction sites in the primers used to amplify the targeted gene. This still leaves the inefficiency of cutting and ligation. Some enzymes do not cut well or require more enzyme or longer incubation
61 time to cut efficiently. There are also several enzymes that give blunt ends or minimal overhang which are not conducive for ligation. Overall, this method was found to be the most time consuming and least efficient.
Purchasing a cloning kit can be expensive, but the TOPO TA cloning was the most efficient of all three methods and required the least amount of time. However, one potential disadvantage of the TOPO cloning is the requirement of using Taq polymerase which does not have high fidelity (error rate of 8.0 x 10-6 (Cline et al., 1996)) and therefore increases the chances of creating a mutation in the PCR product. This disadvantage only becomes a problem if a mutation occurs in the sequence that is required for homologous recombination to integrate the disruption into the Sac chromosome; otherwise, a mutation in the gene is not a problem because the gene function is not being preserved. GC cloning has the advantage of using a high fidelity polymerase (i.e. Phusion DNA polymerase, error rate 4.4 x 10-7 (NEB)), but the disadvantage of no initial blue-white screening, resulting in potentially extensive screening for true transformants. TA cloning has the advantage of blue-white screening which limits the number of further screenings needed to find true transformants, and also was successful without having to repeat the experiment several times before recovering those transformants.
5. References
Barnes, Wayne M. 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lamba bacteriophage templates. PNAS 91:2216-2220.
Clark, James M. 1988. Novel non-templated nucleotide addition reactions catalyzed by prokaryotic and eukaryotic DNA polymerase. Nucleic Acids Research 16:9677-9686.
62 Cline, Janice, Jeffery C. Braman, and Holly H. Hogrefe. 1996. PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases. Nucleic Acids Research 24:3546- 3551.
Dennis, Jonathon J. and Gerben J. Zylstra. 1998. Improved antibiotic-resistance cassettes through restriction site elimination using Pfu DNA polymerase PCR. Biotechniques 25:772-776.
Jonuscheit, Melanie, Erika Matusewitsch, Kenneth M. Stedman, and Christa Schleper. 2003. A reporter gene system for the hyperthermophilic archaeon Sulfolobus solfataricus based on a selectable and integrative shuttle vector. Molecular Microbiology 48:1241- 1252.
Shuman, Stewart. 1991. Recombination mediated by Vaccinia virus DNA Topoisomerase I in Escherichia coli is sequence specific. PNAS 88:10104-10108.
Shuman, Stewart. 1994. Novel approach to molecular cloning and polynucleotide synthesis using Vaccinia DNA Topoisomerase. Journal of Biological Chemistry 269:32678-32684.
63 Chapter III. Evaluating Methods For Disruption of Sulfolobus Genes
1. Methods Evaluated
The second objective of the project was to disrupt the genes of interest in order to analyze the function in Sulfolobus acidocaldarius. For most methods attempted, Sso pyrE was to be inserted into the targeted gene as a means of disruption, although one approach
(“allele replacement”) created a deletion and was designed to use Sso pyrE only as a means of selection. The techniques evaluated included PCR, REs, and ligation, overlap extension PCR, the USER™ method and inverse PCR. Many techniques were limited by the restriction sites available and had low efficiency of transformation. In this part of the project, a positive control disruption was constructed using PCR, REs, and ligation, and two other disruptions (phr, uvde) were made using direct-tailing.
2. PCR, REs, and ligation
As was done for cloning, PCR, REs and ligation were also attempted as a method of disruption. For this technique, the genes that could be used were limited based on restriction sites available. There were also several variations of REs used to attempt disruption with this method.
Positive Control Experiment. Previously constructed by Phil Clark, pPCBE12 was used as a positive control for the ability to achieve disruption in a Sulfolobus gene. pPCBE12 contains part of the S. acidocaldarius gene trpC which encodes the enzyme indole 3-glycerol phosphate synthase. The clone was digested with SpeI for 1hr at 37◦C followed by heat inactivation at 65◦C for 20mins. It was then treated with Antarctic
64 Phosphatase (New England Biolabs, Beverly, MA) to reduce self-ligation which was also heat inactivated at 65◦C for 5mins. Sso pyrE was amplified from pMJ03 with flanking
AvrII restriction sites. This product was digested with AvrII for 1hr at 37◦C. These two digested products were then ligated overnight using T4 DNA ligase at 16◦C. Ligations were transformed into chemically competent DH5α cells as previously described.
Transformants were selected on media containing amp (200µg/ml). Colonies were streaked for isolation and then grown in 3ml YT + 12µl ampicillin (50mg/ml). Plasmid
DNA was extracted using alkaline lysis (Zhou et al., 1990). These clones were then screened using several different REs to verify the insertion of Sso pyrE. After several screenings, Sso pyrE was found to have ligated successfully in both forward (pLK4A1f,
Fig. 3.1) and backward (pLK4A2r) orientation into the Sac trpC gene.
trpC amp
pyrE
trpC
Figure 3.1. Map of pLK4A1f. This plasmid was constructed as a positive control for disruption of a S. acidocaldarius gene with Sso pyrE.
65 3. Overlap Extension PCR (OEP)
As mentioned in the previous cloning chapter, there are several limitations to using PCR, REs, and ligation as a means of cloning. These same limitations and problems were also constraining for disruption techniques. Several variations of RE digestion and ligation were attempted with two genes, for example, but no disruptions were found. An alternative method was to try overlap extension PCR (OEP), which eliminates the need for REs and ligation.
OEP is construction of a recombinant molecule by the extension of the overlap by
DNA polymerase (Horton et al., 1989) (Fig. 3.2). Primers to each target contain complementary sequences so that when mixed in a second reaction of denaturing and reannealing, the targets will overlap by the ~20nt of complementary sequence on the 3’ ends and act as primers for each other (Horton et al., 1989; Stemmer et al., 1995). The advantages of overlap extension PCR are that it does not require restriction enzymes or ligation, and the approach is simple and quick. It does however rely on the fidelity and proofreading ability of the DNA polymerase used, appropriate conditions for the PCR program used, primer design, and efficient annealing between the PCR products. Early uses of this technique were to create a linear recombinant molecule that most times would require the insertion of that molecule into a cloning vector using restriction enzymes
(Warrens et al., 1997; Horton et al., 1989). An advantage of using a gene clone as one of the targets is there are no limitations based on restriction enzymes or ligation for incorporating the recombinant molecule into a cloning vector; this is accomplished in the second PCR reaction. However, the disadvantage is the chance of incorporating a
66 mutation in the vector during PCR. This can be circumvented by the use of a high fidelity polymerase such as Phusion (New England Biolabs, Beverly, MA).
A
Inverse PCR
B pyrE
pLK3a PCR pyrE
C
PCR pyrE +
Figure 3.2. General schematic of OEP. (A) The cloned gene is inversely amplified with primers which have ~20nt of Sso pyrE sequence. (B) Sso pyrE is PCR amplified from pLK3a with primers which have ~20nt of gene sequence. (C) Both PCR products are mixed together in another PCR reaction in which DNA polymerase should create a recombinant molecule by extension of the ~20nt complementary overhangs.
Several variations of OEP protocols (Ge and Rudolph, 1997; Kirsch and Joly,
1998; Stemmer et al., 1995; Warrens et al., 1997; Wurch et al., 1998; Xiao et al., 2007) were attempted using the clone pRAD1f with no success. Results were analysed on agarose gels and either there were no bands present after PCR or bands of molecular weights inconsistent with desired products were shown.
67 4. USER™
An alternative method to OEP, which was originally developed as a cloning technique, is the USER™ (uracil-specific excision reagent; New England Biolabs,
Beverly, MA) method and it was evaluated as a modified disruption technique (Nour-
Eldin et al., 2006) using the clone pLK6a (Table 2.2) containing the Saci0775 gene
(homolog of S. cerevisiae RAD2). The basic principle of the method (Fig. 3.3) is to inversely amplify a vector creating overhangs complementary to Sso pyrE, which is amplified with primers containing uracil and treated with the USER™ enzyme creating
3’- complementary overhangs to the vector. These two products are annealed to construct the disrupted clone.
The first step was to inversely amplify pLK6a using the high fidelity polymerase,
Phusion polymerase (Finnzymes) with primers delRad2xpgf
(5’-TTAATTAAGCCTCAGCCCAGACGGCGTTAAAGGAATTGGT-3’) and delRad2xpgr (5’-TCATAATCTTGGCTTGCAGCAGCCGCTGAGGCTTAATTAA-3’) which add sequences for RE (PacI) and a nicking enzyme (Nt.BbvCI) to create overhangs compatible for ligation with Sso pyrE. The Sso pyrE gene is amplified using PfuTurbo®
Cx Hotstart DNA Polymerase (PfuCx) (Stratagene) with primers (UxCassPyrEf: 5’-
GGCTTAAUTGTGCTGCAAGGCGATTAAGTTGG-3’ and UxCassCmlr: 5’-
GGCTTAAUGAGCTCGCGAATTTCTGCCATTCA-3’) that include a single uracil each. PfuCx has high fidelity but most importantly, is not stalled by the presence of uracil
(Greagg et al., 1999; Fogg et al., 2002). Five µg of the amplified vector is digested with
40 U PacI overnight at 37◦C. Twenty units of the nicking enzyme, Nt.BbvCI, as well as an additional 20 U PacI are added to the reaction and incubated for 2 hours at 37◦C. At
68 this point the vector is linearized with 8 nucleotide (nt) long, 3’-single-stranded overhangs on each end. These ends are not complementary and therefore recircularization is reduced. All PCR reagents, REs, and nicking enzyme are removed from the DNA by purification using Montage™ PCR centrifugal filter devices (Millipore, Bedford, MA,
USA).
The amplified pyrEcml cassette was treated with the USER enzyme, a mixture of uracil DNA glycosylase (UDG) and endonuclease VIII, cleaving the cassette to produce
3’-overhangs compatible to the linearized vector. UDG excises the uracil while leaving the phosphodiester backbone intact (Lindahl, 1982; Lindahl et al., 1977). Endonuclease
VIII is a DNA glycosylase-lyase that breaks the phosphodiester backbone 3’ and 5’ of the excision, releasing the base-free deoxyribose (Jiang et al., 1997; Lindahl et al., 1977;
Melamede et al., 1994). One unit of the USER vector, 10 U of the amplified cassette, and
1 U of USER enzyme were mixed and incubated for 20mins at 37◦C, and then incubated at 25◦C for 20 mins. Annealing of the vector and cassette should occur without the addition of ligase due to the length of the complementary 3’-overhangs. The construct is then transformed into chemically competent DH5α E.coli cells. Transformants are selected on media containing ampicillin.
69 ……..T 5’ T……. .5’ ...... T A……. USER ...... A T……. …….U pyrE cml A……...... A U……. USER +
Figure 3. 3. Schematic of USER method. The cloned gene is inversely amplified and digested with REs to create 3’ overhangs. The pyrEcml cassette is amplified from pLKwith primers containing uracil. Both PCR products are mixed together and the USER is added. These pieces should anneal at the complementary overhangs to create a recombinant molecule without the use of ligase.
This technique was not successful and the development of primers can be complicated. Each PCR component was successfully amplified but no transformants were ever recovered. One problem could be that the ends needed for annealing were overdigested by Nt. BbvCI, which has capabilities to cleave double-stranded vector DNA
(Bitinaite et al., 2007). Another suggestion could be to treat the cassette with the USER enzyme first and then incubate the treated cassette with the vector, as incubation with the vector could have decreased the USER activity. It is also possible that the centrifugal concentrators used to clean up the PCR reaction did not remove the polymerases used, and therefore the exonuclease activities of the polymerases were activated by the lack of dNTPs in the mixture. An alternative clean up would be to use SureClean (Bioline) which is a precipitation reagent able to remove polymerases, etc. from the DNA after PCR.
5. Inverse PCR
Allele replacement relies on two single crossovers to first integrate a circular
DNA into the host genome and then excise a similar circular DNA leaving an engineered mutation behind (Hamilton et al., 1989; Sato et al., 2002 and 2005). This method uses Sso
70 pyrE only as a means of selection for integration in Sulfolobus, whereas inverse PCR was used to delete a portion of the gene, thus forming the mutation.
To test this approach (Fig. 3.4), a portion of the nurA gene was deleted using inverse PCR of pLRNurA (Table 2.2). For this process Velocity polymerase was used, which has high fidelity and the ability to amplify large fragments of DNA. The primers used for the inverse PCR are flanked with AvrII restriction sites to allow for later religation of the circularized ΔnurA plasmid. Gel analysis was used to verify linearization of the plasmid. It was then digested with AvrII for 1hr at 37◦C and then ligated back together overnight at 16◦C using T4 DNA ligase. The ligation was transformed into chemically competent DH5α cells and transformants were selected for on media containing ampicillin. Transformants were streaked for isolation and then grown in 3ml
YT + 12µl amp (50mg/ml). Verification of the deleted nurA plasmid, pLR8a (Table 2.2) was done by screening with REs.
71 pLRNurA
A Inverse PCR
B AvrII digestion
C Ligation
Figure 3.4. Schematic of inverse PCR. (A) Part of the nurA gene is deleted via inverse PCR of pLRNurA; the plasmid is linearized. (B) The PCR product is digested with AvrII creating complementary ends; AvrII recognition sites were incorporated into the primers. (C) Ligase is added to recircularized the plasmid; pLR8a (ΔnurA).
72
The next step was to introduce Sso pyrE onto the plasmid as a selectable marker for use in Sulfolobus. Amplifying Sso pyrE using the same primers as were used for cloning, it was then digested with KpnI. KpnI cannot be heat inactivated and therefore the digestion was purified using SureClean. pLR8a was also digested with KpnI, treated with
Antarctic phosphatase to reduce self-ligation, and purified using SureClean. The two components were then ligated together overnight at 16◦C using T4 DNA ligase. Prior to transformation the ligase was heat inactivated at 65◦C for 10mins. The ligation mixture was then transformed into chemically competent DH5α cells, and transformants were selected for on media containing ampicillin (200µg/ml). Transformants were streaked for isolation and grown in 3ml YT + 12µl ampicillin (50mg/ml). Plasmid DNA was extracted as described previously and subjected to screening using REs.
This method proved to be difficult because of the limitations of REs available for inserting Sso pyrE, and has so far not been successful.
6. Direct-Tailing by PCR
As an alternative to all previous disruption techniques, direct-tailing was attempted. This technique has been most notably used to disrupt genes in Saccharomyces cerevisiae (Lorenz et al., 1995). A major advantage to this technique is that it requires only PCR, and no cloning or restriction enzymes. However, one disadvantage is that there is not an abundance of the disruption construct, and it cannot be analyzed as thoroughly as a cloned disruption. Sulfolobus acidocaldarius has a restriction modification system
(Chen et al., 2005), which means it will degrade any GGCC sequences (Prangishvili et
73 al., 1985) in the DNA that are unmethylated (Grogan, 2003). Disruptions carried on
plasmids can be protected from this system by being propagated into E.coli strain
ER2566 [pEsaBC4I], which can methylate GGCC sequences (Grogan, 2003; Kurosawa
and Grogan, 2005). However, this is not feasible for the direct-tailing techniques, and
therefore any sequence that is amplified during PCR should not contain GGCC
sequences. This method also requires homologous recombination to integrate the
disrupted DNA into the chromosome, which for Sulfolobus should be relatively efficient
(Grogan, 1996).
The Sso pyrE gene is amplified with primers (Table 3.1) that have ~50bp of
flanking sequence that corresponds to the gene to be disrupted (Fig. 3.5). The target
genes used for this method were DNA photolyase (phr) and UV damage endonuclease
(uvde). The Sso pyrE gene was amplified using a high fidelity polymerase, Phusion. This
PCR product (referred to as phr-“tailed” Sso pyrE or uvde-“tailed” Sso pyrE) was verified
via gel analysis.
Table 3.1. Primers used for direct-tailing by PCR.
Primer Sequence (5' - 3') CAACGAGACGAGAAAATGAAGGAAAATGCCTTGAATAAAGGAATTAAATTTA SacPhr::cassf1 CCGCACAGATGCGTAA GGAGAA ATCCACTAATTTTGTCGCAAAATACCTCTCTCCCAGTCTCCAGTCGACAATTATAGTCCT SacPhr::cassr1 GTCGGGTTTCGCCA Saci1096 CACTTAGAATTATTCACTGTTGAGAGTAGGTTACGTATCCAAGTCTAGGGGTA DTf3 CCACGTGTCTTAATCTC Saci1096 GATTCACCTTAATAAATCCTCTAATCCAGTTTGTTTAACTCCTAATGCAGCTGG DTr2 CACGACAGGTTTC
74 pyrE
pLK3a
amp
PCR
phr pyrE phr
Figure 3.5. Schematic of direct-tailing by PCR. The Sso pyrE is PCR amplified from pLK3a with “tails” of ~50bp of the gene being disrupted, which also provide the sequence for homologous recombinational integration into the chromosome.
7. Summary
For most disruption techniques attempted, there are a number of technical problems. As described in the previous chapter, most have limitations based on restriction sites available, which cannot always be eliminated with primer design. Also, each method requires PCR, and therefore the same potential problems with polymerase activities still exist. For some methods, it is hard to diagnose why something did not work because the numbers of parameters to adjust are so extensive. Currently, one cloned gene has been disrupted, the positive control (trpC::pyrE), using PCR, REs, and ligation. Two other
75 genes (phr and uvde) have been disrupted using PCR; however these disruptions are in the form of PCR product (i.e. they are not cloned).
8. References
Bitinaite, Jurate, Michelle Rubino, Kamini Hingorani Varma, Ira Schildkraut, Romualdas Vaisvila, and Rita Vaiskunaite. 2007. USER™ friendly DNA engineering and cloning method by uracil excision. Nucleic Acids Research 35:1992-2002.
Chen, Lanming, Kim Brügger, Marie Skovgaard, Peter Redder, Qunxin She, Elfar Torarinsson, Bo Greve, Mariana Awayez, Arne Zibat, Hans-Peter Klenk, and Roger A. Garrett. 2005. The genome of Sulfolobus acidocaldarius, a model organism of the Crenarchaeota. Journal of Bacteriology 187:4992-4999.
Fogg, Mark J., Laurence H. Pearl and Bernard A. Connolly. 2002. Structural basis for uracil recognition by archaeal family B DNA polymerases. Nature Structural Biology 9:922-927.
Ge, Liming and Peter Rudolph. 1997. Simultaneous introduction of multiple mutations using overlap extension PCR. Biotechniques 22:28-31.
Greagg, Martin A., Mark J. Fogg, George Panayotou, Steven J. Evans, Bernard A. Connolly and Laurence H. Pearl. 1999. A read-ahead function in archaeal DNA polymerases detect promutagenic template-strand uracil. PNAS 96:9045-9050.
Grogan, Dennis W. 2003. Cytosine methylation by the SuaI restriction-modification system: implications for genetic fidelity in a hyperthermophilic archaeon. Journal of Bacteriology 185:4657-4661.
Grogan, Dennis W. 1996. Exchange of genetic markers at extremely high temperatures in the archaeon Sulfolobus acidocaldarius. Journal of Bacteriology 178:3207-3211.
Hamilton, Carol M., Martí Aldea, Brian k. Washburn, Paul Babitzke, and Sidney R. Kushner. 1989. New method for generating deletions and gene replacements in Escherichia coli. Journal of Bacteriology 171:4617-4622.
Horton, Robert M., Henry D. Hunt, Steffan N. Ho, Jeffrey K. Pullen and Larry R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes; gene splicing by overlap extension. Gene77:61-68.
Jiang, Dongyan, Zafer Hatahet, Robert J. Melamede, Yoke Wah Kow, and Susan S. Wallace. 1997. Characterization of Escherichia coli endonuclease VIII. The Journal of Biological Chemistry 272:32230-32239.
76
Kirsch, Ralf D. and Etienne Joly. 1998. An improved PCR-mutagenesis strategy for two- site mutagenesis or sequence swapping between related genes. Nucleic Acids Research 26:1848-1850.
Kurosawa, Norio and Dennis W. Grogan. 2005. Homologous recombination of exogenous DNA with the Sulfolobus acidocaldarius genome: Properties and uses. FEMS Microbiology Letters 253:141-149.
Lindahl, Tomas. 1982. DNA Repair Enzymes. Annual Review in Biochemistry 51:61-87.
Lindahl, Tomas, Siv Ljungquist, Wolfgang Siegert, Barbro Nyberg, and Berit Sperens. 1977. DNA N-glycosidases: Properties of uracil-DNA glycosidase from Escherichia coli. The Journal of Biological Chemistry 252:3286-3294.
Lorenz, Michael C., R. Scott Muir, Eric Lim, John McElver, Shane C. Weber and Joseph Heitman. 1995. Gene disruption with PCR products in Saccharomyces cerevisiae. Gene 158:113-117.
Melamede, Robert J., Zafer Hatahet, Yoke Wah Kow, Hiroshi Ide, and Susan S. Wallace. 1994. Isolation and characterization of endonuclease VIII from Escherichia coli. Biochemistry 33:1255-1264.
Nour-Eldin, Hussam H., Bjarne G. Hansen, Morten H. H. Nørholm, Jacob K. Jensen, and Barbara A Halkier. 2006. Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments. Nucleic Acids Research 34:e122.
Prangishvili, D. A., R. P. Vashakidze, M. G. Chelidze, and I. Yu. Gabriadze. 1985. A restriction endonuclease SuaI from the thermoacidophilic archaebacterium Sulfolobus acidocaldarius. FEBS Lett 192:57-60.
Sato, Takaaki, Toshiaki Fukui, Haruyuki Atomi, and Tadayuki Imanaka. 2005. Improved and versatile transformation system allowing multiple genetic manipulations of the hyperthermophilic archaeon Thermococcus kodakaraensis. Applied and Environmental Microbiology 71:3889-3899.
Sato, Takaaki, Toshiaki Fukui, Haruyuki Atomi, and Tadayuki Imanaka. 2003. Targeted gene disruption by homologous recombination in the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1. Journal of Bacteriology 185:210-220.
Stemmer, Willem P.C., Andreas Crameri, Kim D. Ha, Thomas M. Brennan, and Herbert L. Heyneker. 1995. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene 164:49-53.
77 Warrens, Anthony N., Michael D. Jones, and Robert I. Lechler. 1997. Splicing by overlap extension by PCR using asymmetric amplification: an improved technique for the generation of hybrid proteins of immunological interest. Gene 186:29-35.
Wurch, Thierry, Fabrice Lestienne, and Petrus J. Pauwels. 1998. A modified overlap extension PCR method to create chimeric genes in the absence of restriction enzymes. Biotechnology Techniques 12:653-657.
Xiao, Yue-Hua, Men-Hui Yin, Lei Hou, Ming Luo and Yan Pei. 2007. Asymmetric overlap extension PCR method bypassing intermediate purification and the amplification of wild-type template in site-directed mutagenesis. Biotechnology Letters 29:925-930.
Zhou, Chen, Yujun Yang and Ambrose Y. Jong. 1990. Mini-prep in ten minutes. Biotechniques 8:172-173.
78 Chapter IV. Integration into the Sulfolobus acidocaldarius Genome
1. Introduction
In this portion of the project, the positive control (trpC::pyrE) and the direct- tailed constructs (phr and uvde) were electroporated into Sulfolobus acidocaldarius
MR31 cells and then integrated into the chromosome via homologous recombination.
PyrE+ transformants were selected and integration into the appropriate S. acidocaldarius locus (TrpC, PHR, UVDE) was verified using PCR and sequencing. Phenotypic determination of LR10 using UV irradiation confirmed Saci1227 is functioning as a DNA photolyase as predicted from its sequence similarity to known DNA photolyases.
2. Positive Control
Plasmid pLK4A1f (Table 3.2) was used to confirm that a cloned, disrupted gene could be integrated into the Sulfolobus acidocaldarius chromosome, and to provide a strain that could serve as a control in phenotypic comparisons. The plasmid was extracted, as previously described, from DH5α and then transformed into the methylating
E. coli strain ER2566 [pEsaBC4I] (Grogan, 2003; Kurosawa and Grogan, 2005) to protect the plasmid from degradation by the restriction modification system of Sulfolobus acidocaldarius (Chen et al., 2005). The newly methylated plasmid was again purified, and electroporated into S. acidocaldarius MR31 cells. PyrE+ transformants were selected on XT media containing tryptophan (0.04% final concentration) and incubated at 76-
78◦C for 6 days. Integration via homologous recombination into the trpC Saci1427 locus in the S. acidocaldarius chromosome was verified by PCR with pyrE and trpC primers
79 and sequencing (Cincinnati Children’s Hospital). The resulting tryptophan auxotroph was designated DG251. This work was done by Dr. Dennis W. Grogan.
3. Direct-tailed Constructs
The PCR products representing phr and uvde genes (Saci1227 and Saci1096, respectively) disrupted by pyrE (Chapter IV) were separately electroporated into
Sulfolobus acidocaldarius MR31 electrocompetent cells. Transformants were selected on
XT media lacking uracil. Although each electroporation only produced two colonies for
LR10 and two for LR12, various PCR reactions indicated successful insertion of Sso pyrE into the phr locus and also into the uvde locus (Figures 4.1 and 4.2). Verification of the insertion was done by sequencing PCR products at the junction between the phr and
Sso pyrE gene and separately, uvde and Sso pyrE. The resulting strains were designated
LR10 (phr::pyrE) and LR12 (uvde::pyrE).
Table 4.1 Sulfolobus acidocaldarius strains used for phenotypic determination experiments.
Strain Genotype DG185 Wildtype DG251 trpC::Sso pyrE LR10 phr::Sso pyrE LR12 uvde::Sso pyrE
80 bp MW 1 2 3 4
2323 1929 2171
1598 1371 1264 1371
702 711
Figure 4.1. Verification of phr-“tailed” Sso pyrE integration into PHR locus via PCR screening of LR10 genomic DNA. MW: Molecular Weight standard Lambda DNA digested with BstEII; lane 1: Sso pyrE (711bp); lane 2: WT PHR (1371bp); lane 3: phr-“tailed” Sso pyrE1 (1598bp); lane 4: LR10 PHR (2171bp). 1 phr-“tailed” Sso pyrE also includes part of the pLK3a sequence adding more ~100nt to the PCR product.
bp MW 1 2 3 4
2323
1929 1673 1548 1371 1264 1184
913
702 636
489
Figure 4.2. Verification of uvde-“tailed” Sso pyrE integration into UVDE locus via PCR screening and RE analysis of LR12 genomic DNA. MW: Molecular Weight standard lambda BstEII; lane 1: WT UVDE; lane 2: LR12 UVDE; lane 3: WT UVDE digested with HindIII; lane 4: LR12 UVDE digested with HindIII.
81 4. Phenotypic Determination of phr Mutant
The next step was to determine the phenotype of LR10 (phr::pyrE) and LR12
(uvde::pyrE) using UV irradiation to produce cyclobutane pyrimidine dimers and (6-4) pyrimidine-pyrimidone adducts (Yasui and McCready, 1998) which are substrates for
DNA photolyases (Rupert et al., 1958). Control strains used for these experiments were
DG185 (WT) and DG251 (trpC::pyrE). All strains were grown in 5ml XT (+ 30µl tryptophan (0.5%) for DG251) with continuous aeration at 76-78◦C to an OD600 between
0.2-0.3. Cells were pelleted by centrifugation at 10,000 x g for 10mins and pellets were resuspended in 5ml Sulfolobus dilution buffer (Sdil) (Grogan, 1997). All further experimental steps were completed under dim red light, except where noted, and followed the protocol as used by Grogan (1997).
Resuspended cells (5ml) were evenly poured into Petri plates (Fisherbrand) and exposed to UV for 5, 10, 20, and 30 seconds. Twenty microliters were pipetted from the
UV-exposed culture to a microtiter plate containing 180µl of Sdil buffer. Serial 1:10 dilutions of each exposure were made and then 70µl of each appropriate dilution was spread on an XT plate containing 30µl tryptophan (0.5%), which is required by DG251, a tryptophan auxotroph. These plates were not exposed to white light and therefore are referred to as the “DARK” results. The remaining mixtures were then exposed to direct white light for 1 hour. After exposure, 70µl of each dilution was plated in the dark as explained above; these were referred to as the “LIGHT” results. All plates were incubated at 76-78◦C for 6 days. This method was repeated on different days to generate multiple independent measurements.
82 It was predicted that lack of photoreversal would make LR10 more sensitive to
UV treatment after light exposure than DG185 (WT) and DG251 (trpC::pyrE) under these same conditions. The results support this indicating that LR10 lacks photoreactivational repair as there is no increase in colony yield after the UV-treated cells were exposed to white light (Figure 4.3). In contrast, both DG185 and DG251, showed an increase in colony yields after white light exposure when compared to the cells kept in the dark (Figure 4.3). This indicates that photoreactivational repair is occurring in these strains and not in LR10. The results of strain DG185 are consistent with those found in the study by Grogan (1997), in which S. acidocaldarius DG185 was originally shown to have photoreactivational repair.
Survival of LR10, DG185, and DG251 After UV Exposure and Photoreactivation
0.000
-0.500
-1.000
) -1.500 l m / LR10 light u f
c -2.000 ( LR10 dark
l a v
i DG185 light
v -2.500 r
u DG185 dark S
G -3.000 DG251 light V A
DG251 dark g o
L -3.500
-4.000
-4.500
-5.000 0 10 20 30 Time of UV exposure (s)
Figure 4.3. Log survival for LR10, DG185, and DG251 after UV exposure and white light illumination. Values are average survival for five independent experiments. Open symbols indicate white light exposure; closed symbols indicate dark-maintained.
83 When ratios of the LIGHT to DARK experiments are directly compared for each strain (Table 4.2; values >1 indicate photoreactivational repair), there is an ~10 fold increase in DG185 and ~50 fold increase in DG251 viability. However, for LR10 the ratio of LIGHT:DARK did not significantly differ from 1, again suggesting no photoreactivational repair.
Table 4.2. Evidence for photoreactivational repair as a ratio of photoreactivated:dark-maintained viability. Ratios were calculated as: (AVG photoreactivated cfu/ml)/(AVG dark-maintained cfu/ml), and are from five independent experiments.
UV Dose Strain 0s 5s 10s 20s 30s LR10 1.000 0.540 0.713 1.003 0.948 DG185 1.000 1.130 0.897 8.729 11.747 DG251 1.000 1.028 1.203 29.275 47.442
5. Summary
Genetic analyses of strain LR10 show that a phr mutant has been made, while phenotypic experiments confirm that, as predicted from its sequence similarity to known
DNA photolyases, Saci1227 is functioning as a DNA photolyase in Sulfolobus acidocaldarius. These results also corroborate the evidence found by Grogan (1997) that
Sulfolobus acidocaldarius does have photoreactivational repair, and more tests will be used to determine whether the DNA photolyase of S. acidocaldarius influences another form of UV repair, i.e. dark repair by NER or UVDE. It is not yet known whether this
DNA photolyase has additional functions. Its substrates are the same as those of other
DNA repair pathways (NER, UVDE), and therefore it could be assisting those pathways by acting as an accessory protein. Finally, although the mechanism of photoreactivation is similar across domains, the chromophore used to absorb the light-energy to cleave the
84 photoproducts differs (Chapter I). Confirming which chromophore is used by Sulfolobus photolyase will give further information about its similarities and divergence from other organisms.
6. Future Directions and Significance
Phenotypic determinations of LR12 will also be conducted using DG185 and
DG251 as control strains. The experiments will be similar to those above, except the will typically not be exposed to visible light. Under these conditions, LR12 is predicted to be more sensitive to UV treatment than DG185 and DG251. LR12 is not expected to differ significantly from DG185 and DG251 after white light exposure because the phr gene is still functional for all three strains, and therefore the DNA can be repaired by photoreactivation. However, because uvde is not light-dependent, the viability of the cells will mostly be affected in the dark.
If preliminary results for strain LR12 indicate uvde to be a DNA repair gene,
Sulfolobus would be only the second archaeon known to date to have this property
(Baliga et al., 2004; Chen et al., 2005). Further tests will need to be conducted to determine whether it is the only system able to repair UV lesions in the dark (i.e. without contribution from photoreactivation) or, alternatively if there is some NER-like mechanism which can also repair these UV lesions.
There are also plans to disrupt more potential DNA replication and repair genes using direct-tailing by PCR. Further attempts using inverse PCR to disrupt a cloned gene will also be made, as there are many advantages to using a cloned disruption once it is constructed (Chapter I). Successfully disrupting more genes using these methods could
85 lead to finding more genes that are functioning in DNA repair that were not found from genomic analyses.
In addition, it would be useful to develop other genetic tools for Sulfolobus spp.
Having a second selectable marker for use in Sulfolobus for inverse PCR would enable the disruption of two genes (i.e. phr and uvde), making double mutants. If a phr and uvde double mutant strain was made and the cells were subjected to UV irradiation, the results could give information about any other type of DNA repair, i.e. NER.
This research is significant because targeted gene disruption has not been reported for Sulfolobus acidocaldarius. Also, more genetic tools for cloning and disruption have been developed for use in Sulfolobus spp., which enhance the genetic studies that can be conducted in hyperthermophilic archaea. By disrupting genes and determining their phenotype we can provide evolutionary insight into the diversity and similarity of archaea as compared to bacteria and eukaryotes.
7. References
Baliga, Nitin S., Sarah J. Bjork, Richard Bonneau, et al. 2004. Systems level insights into the stress response to UV radiation in the halophilic archaeon Halobacterium NRC-1. Genome Research 14:1025-1035.
Chen, Lanming, Kim Brügger, Marie Skovgaard, Peter Redder, Qunxin She, Elfar Torarinsson, Bo Greve, Mariana Awayez, Arne Zibat, Hans-Peter Klenk, and Roger A. Garrett. 2005. The genome of Sulfolobus acidocaldarius, a model organism of the Crenarchaeota. Journal of Bacteriology 187:4992-4999.
Grogan, Dennis W. 2003. Cytosine methylation by the SuaI restriction-modification system: implications for genetic fidelity in a hyperthermophilic archaeon. Journal of Bacteriology 185:4657-4661.
86 Grogan, Dennis W. 1997. Photoreactivation in an archaeon from geothermal environments. Microbiology 143:1071-1076.
Kurosawa, Norio and Dennis W. Grogan. 2005. Homologous recombination of exogenous DNA with the Sulfolobus acidocaldarius genome: Properties and uses. FEMS Microbiology Letters 253:141-149.
Rupert, Claud S., Sol H. Goodgal, and Roger M. Herriott. 1958. Photoreactivation in vitro of ultraviolet inactivated Hemophilus influenzae transforming factor. The EMBO Journal 21:418-426.
Yasui, Akira, and Shirley J. McCready. 1998. Alternative repair pathways for UV- induced DNA damage. BioEssays 20:291-297.
87