Supplementary Data

Figure S1. DDX3 expression is correlated with cell invasive activity and ATF4 expression. A, The protein lysates collected from confluent OECM1 and SAS cells were subjected to immunoblotting analysis; 3 batches of each line (upper panel) and the average intensity of DDX3/actin (lower panel) are shown. B, Cell growth (left panels) and Boydem chamber (up and right panels) assays of OECM1 cells transfected with indicated siRNAs. C, Boyden chamber assays of OECM1 cells transfected with the empty or FLAG-DDX3 expression vector. D, SAS and OECM1 cells were subjected to 3D invasion assay. Phase images were taken as indicated days after adding Matrigel. E, Representative images of primary tumors (tongue) and metastases (lymph node) in orthotopic OSCC models were taken by using the IVIS system. F, SAS/Luc2 cells isolated from lymph node (Meta) were cultured, and lysates from confluent parental (left lane) and meta SAS/Luc2 were subjected to immunoblotting analysis. G, SAS cells stably transfected with tetracycline-inducible shRNAs were treated with 2 µg/ml doxycyline for 5 days, and cell lysates were collected and subjected to immunoblotting analysis. H, SAS cells were incubated with AAV-shC or shD for 4 days, and cell lysates were collected and subjected to immunoblotting analysis. I, Tumor lysates from Fig. 2G were subjected to immunoblotting.

Figure S2. Microarray-identified genes are enriched for pro-metastatic genes and ATF4 targets, and DDX3 is required for migration and ATF4 expression in all of the HNSCC cell lines examined. A, The log2 values of siD#1/siC obtained from two independent microarrays were plotted as a chart. Correlation coefficient (R) is labeled. B, Gene ontology analysis identified the top 10 biological processes that were enriched in downregulated or upregulated genes in DDX3 knockdown SAS cells according to p- value. C, Cellular functions and diseases that were negatively (–) or positively (+) affected by DDX3 knockdown, as predicted with Ingenuity Pathways Analysis. D, RT-qPCR analysis of known ATF4 target genes in siRNA-transfected OECM1 cells. E, Indicated cell lines were transfected with siC or siD#1 for 72 hours. The lysates were subjected to immunoblotting analysis. F, Indicated cell lines transfected as in panel E were subjected to Boyden chamber assays. Bar graph shows the relative migration efficiency (siD#1 vs. siC) of analyzed cell lines.

Figure S3. DDX3 and ATF4 are required for EMT gene expression. A, shRNA vector- transfected SAS cells were subjected to the Boyden chamber (left) and 3D invasion (right) assays. Experiments were repeated three times to obtain mean ± SD. B, Immunoblotting of EMT-related proteins was analyzed in SAS cells transfected with indicated siRNA for 48 hours or shRNA for 72 hours. C, Immunfluorescence staining of E-cadherin and Vimentin in SAS cells transfected with control or 3 different DDX3 siRNAs for 48 hours.

Figure S4. DDX3 does not regulate ATF4 protein stability. SAS cells transfected with siRNA for 48 hours were treated with MG132 for 4 hours and subsequently with cycloheximide for indicated time. Immunoblotting was performed using antibodies against indicated proteins.

Figure S5. DDX3 regulate ATF4 translation independent of ER Stress. A, SAS cells transfected with siRNA for 48 hours and subsequently treated with Thapsigargin for 2 hours. Cell lysates were subjected to immunoblotting using antibodies against indicated proteins. B, In vivo translation assay was performed in SAS cells that were transfected with the ATF4-RL reporter and indicated vectors for 48 hours followed by Thapsigargin treatment for 6 hours. Bar graph shows relative luciferase activity as calculated in Figure 5; mean ± SD was obtained from 3 repeated experiments.

Figure S6. The DDX3/CBC/eIF3 complex directly activates the translation of uORF-containing mRNAs in vitro and in vivo. A, In vitro transcribed mRNAs (RL or ATF4-RL) were each incubated with the SAS cell extract containing or not containing GST-DDX3 for 1 hour. The Renilla luciferase activity was subsequently measured. B, SAS cells were initially transfected with indicated shRNA-expressing vectors for 72 hours and then transfected with in vitro transcribed control (RL) or uORF-containing (ATF4, ATF5, DDIT3, CEBPA or ETV1) mRNA for 1 hour. The cell lysates were then collected for Renilla luciferase assay. C, Cells treated as in panel B were subjected to RT-qPCR analysis.

Figure S7. RT-qPCR analysis of luciferase mRNAs in the in vivo translation assay. A-F, RT- qPCR analysis of Fig. 4D and F-J. G, Cell transfected with indicated reporters were subjected to RT-qPCR analysis.

Figure S8. The CBC and eIF3 complexes are involved in the translation of uORF-containing mRNAs. A, The Venn diagrams shows unique or overlapped 5’ UTR CLIP tags among DDX3, eIF4A3 and CBP20 (left) and among DDX3, eIF4A3 and eIF3 (right). The numbers of DDX3-specific and eIF4A3-specific CLIP tags overlapping with CBP20 (left) or eIF3 (right) are labeled as blue and red, respectively. B, The Venn diagrams shows unique or overlapped 5’ UTR CLIP tags among DDX3, eIF3 and CBP20. The percentages of CLIP tags overlapping with uTIS and non-uTIS uTIS and non-uTIS containing genes retrieved from TISdb are labeled. C, RT-qPCR analysis of Fig. 5D. D, SAS cells transfected with indicated shRNA were subjected to immunoblotting. E, SAS cells transfected with indicated shRNA were subjected to immunoblotting. F, In vivo translation assay of indicated reporters cotransfected with indicated shRNAs for 48 hours. G, In vivo translation assay was performed in SAS cells that were initially transfected with the indicated shRNA vectors for 48 hours followed by the indicated overexpression vectors and the ATF4 reporter for further 24 hours. For panels E and F, relative luciferase activity was calculated as described in Figure 5.

Supplementary Table S1. List of sense shRNA or siRNA sequences. shRNA/siRNA Sense sequence shC GCUUCUACCAAAUACACUUGA shD GAAACAUUGAGCUUACUCGUU shATF4 GAAAGCCUAGGUCUCUUAGAU shCBP20 GGAUGAGUAUCGGCAGGACUA shCBP80 GGUGCGACGAGAUUGGUAUGU sheIF3g GUGACAGAGUACAAGAUAGAU sheIF3i GGAGAGCUCAACCAGUAUAGU Tet-shC CUUCGAAAUGUCCGUUCGGUU Tet-shD#1 GACCUGAACUCUUCAGAUA Tet-shD#2 CGCUUGGAACAGGAACUCUUU siC GCGCUUCUACCAAAUACACUUGAUA siD#1 CCUAGACCUGAACUCUUCAGAUAAU siD#2 GGGAGAAAUUAUCAUGGGAAACAUU siD#3 CACCAACGAGAGAGUUGGCAGUACA

Supplementary Table S2. Univariate and multivariate cox regression analyses in HNSCC patient samples.

Supplementary Table S3. List of genes that showed more than two-fold changes upon DDX3 knockdown. ProbeName Exp1 Exp2 Average GeneSymbol A_33_P3672756 -3.2457285 -3.1393843 -3.1925564 LOC284561 A_24_P126060 -3.16082 -2.8644743 -3.01264715 DDX3X A_23_P19663 -2.6272717 -3.0723238 -2.84979775 CTGF A_22_P00014730 -2.6604695 -2.8590827 -2.7597761 lnc-SLC2A4RG-1 A_33_P3323959 -2.618907 -2.7437034 -2.6813052 RELN A_23_P381102 -2.5932717 -2.7077975 -2.6505346 CCDC74B A_24_P250922 -2.7136197 -2.5842419 -2.6489308 PTGS2 A_23_P69030 -2.7204385 -2.5039654 -2.61220195 COL8A1 A_23_P409093 -2.4106035 -2.4617586 -2.43618105 ANO4 A_19_P00315452 -2.2802095 -2.4505363 -2.3653729 LOC100130938 A_22_P00006060 -2.3473585 -2.3487363 -2.3480474 lnc-FAM131B-1 A_33_P3257297 -2.4315958 -2.2441187 -2.33785725 CFAP58 A_23_P2857 -2.2206445 -2.4522054 -2.33642495 CCDC70 A_23_P413157 -2.6971874 -1.9361424 -2.3166649 CXorf58 A_23_P121064 -2.275794 -2.3201835 -2.29798875 PTX3 A_23_P147786 -2.3058267 -2.239805 -2.27281585 RIMS2 A_19_P00321743 -2.193635 -2.274543 -2.234089 LOC100130938 A_24_P200219 -2.312551 -2.0688639 -2.19070745 UPK1B A_24_P391230 -2.189209 -2.1288314 -2.1590202 CYYR1 A_23_P323801 -1.7217016 -2.4646688 -2.0931852 BEST3 A_22_P00000938 -1.9366587 -2.1961193 -2.066389 LINC00704 A_19_P00322533 -2.08633 -2.022108 -2.054219 CRNDE A_33_P3379381 -2.0799832 -2.0108426 -2.0454129 WDR78 A_23_P326020 -2.1263115 -1.94181 -2.03406075 CSMD3 A_21_P0014483 -2.1743498 -1.8527889 -2.01356935 FGD5-AS1 A_22_P00008272 -1.9366459 -2.0696526 -2.00314925 CRNDE A_22_P00011688 -1.7390351 -2.1885347 -1.9637849 PDGFRB A_33_P3419190 -1.9389725 -1.987857 -1.96341475 AREG A_23_P405878 -1.908002 -2.0068078 -1.9574049 C12orf54 A_23_P259071 -1.9079303 -1.9981002 -1.95301525 AREG A_22_P00023317 -1.8614713 -2.040125 -1.95079815 LINC01468 A_23_P28834 -1.9107575 -1.9524698 -1.93161365 PHACTR3 A_22_P00008144 -2.3607192 -1.4584756 -1.9095974 LOC101927841 A_23_P102037 -2.0481038 -1.7292266 -1.8886652 COQ10B A_24_P709377 -1.8542476 -1.8928032 -1.8735254 PAX8-AS1 A_23_P145529 -1.781932 -1.9212033 -1.85156765 PKIB A_21_P0006938 -1.6937836 -2.0082424 -1.851013 LOC101927435 A_33_P3286873 -2.0457375 -1.6438757 -1.8448066 CD247 A_19_P00802607 -1.7883825 -1.8810377 -1.8347101 lnc-HK2-1 A_33_P3339070 -1.691214 -1.9489719 -1.82009295 LINC00704 A_22_P00000428 -1.9464568 -1.6747723 -1.81061455 lnc-AC073263.1-2 A_21_P0001880 -1.7863463 -1.8343409 -1.8103436 LINC01293 A_23_P104438 -1.7556653 -1.8254089 -1.7905371 MYPN A_22_P00010577 -1.8206011 -1.7209879 -1.7707945 RBM26-AS1 A_22_P00009085 -1.6835133 -1.836864 -1.76018865 LOC100507006 A_33_P3353051 -1.8678111 -1.6140289 -1.74092 C6orf48 A_24_P299474 -1.819312 -1.6609211 -1.74011655 TENM2 A_23_P48339 -1.9330316 -1.5418372 -1.7374344 IFT88 A_24_P137897 -1.7275401 -1.7334242 -1.73048215 IFRD1 A_33_P3279847 -1.8562082 -1.5746613 -1.71543475 RAET1E A_24_P88696 -1.6541246 -1.7635082 -1.7088164 SCG2 A_21_P0009321 -1.6703386 -1.7080823 -1.68921045 LOC101929494 A_33_P3242952 -1.784726 -1.5831519 -1.68393895 FAM72A A_23_P323563 -1.7429676 -1.6167072 -1.6798374 PLEKHG2 A_32_P148796 -1.8590623 -1.497307 -1.67818465 UBXN2B A_23_P136355 -1.670816 -1.6830916 -1.6769538 HHAT A_22_P00016662 -1.5427251 -1.8106337 -1.6766794 lnc-TPCN2-3 A_24_P392110 -1.6700263 -1.631584 -1.65080515 PSG8 A_33_P3219651 -1.4481697 -1.8377308 -1.64295025 BMPER A_22_P00001157 -1.787301 -1.4912459 -1.63927345 lnc-AMOTL2-2 A_23_P25913 -1.7394953 -1.5211887 -1.630342 DNAL1 A_19_P00321124 -1.6819874 -1.5729942 -1.6274908 LINC01468 A_23_P83028 -1.808528 -1.4400455 -1.62428675 RECK A_23_P110403 -1.8456964 -1.4006863 -1.62319135 PDLIM3 A_23_P408271 -1.5464616 -1.678075 -1.6122683 HSD17B11 A_33_P3676515 -1.842968 -1.3732009 -1.60808445 SSR4P1 A_33_P3330443 -1.4424543 -1.7716012 -1.60702775 FAM110B A_33_P3339650 -1.6458865 -1.5638001 -1.6048433 DST A_33_P3422802 -1.8666205 -1.3335284 -1.60007445 ULBP1 A_24_P340954 -2.0483584 -1.1231933 -1.58577585 ANKUB1 A_23_P56746 -1.6612763 -1.5040951 -1.5826857 FAP A_22_P00009680 -1.5783309 -1.581565 -1.57994795 LINC01468 A_21_P0010463 -1.5067692 -1.6502743 -1.57852175 lnc-RGL4-4 A_23_P214897 -1.5241747 -1.6255037 -1.5748392 AKAP12 A_24_P10214 -1.6632866 -1.4688582 -1.5660724 STXBP6 A_23_P123096 -1.8771805 -1.247964 -1.56257225 GNGT1 A_23_P33914 -1.8049889 -1.3057299 -1.5553594 NUP62CL A_23_P7144 -1.4911841 -1.6177455 -1.5544648 CXCL1 A_21_P0014889 -1.5632972 -1.5408263 -1.55206175 LOC100507431 A_23_P256391 -1.6275969 -1.4561663 -1.5418816 GOLGA4 A_24_P88801 -1.8331041 -1.2467017 -1.5399029 NPHP1 A_22_P00007883 -1.6460829 -1.4319769 -1.5390299 HSD17B11 A_32_P24376 -1.5455374 -1.5202719 -1.53290465 KRTAP2-3 A_23_P393645 -1.5389519 -1.5204979 -1.5297249 ADAMTS13 A_33_P3358213 -1.4388162 -1.6138109 -1.52631355 PADI6 A_22_P00006860 -1.2920699 -1.7444043 -1.5182371 LOC100506731 A_24_P923251 -1.4974527 -1.5314447 -1.5144487 TGM2 A_19_P00316340 -1.5548075 -1.4710512 -1.51292935 LOC100506860 A_21_P0007288 -1.6216068 -1.4026613 -1.51213405 lnc-SORL1-1 A_33_P3322363 -1.6044059 -1.4197297 -1.5120678 HMSD A_32_P191840 -1.7463703 -1.2759438 -1.51115705 LOC644662 A_33_P3369854 -1.5606927 -1.4542378 -1.50746525 DNAJB13 A_23_P362148 -1.3981452 -1.6145984 -1.5063718 DNER A_22_P00013529 -1.1508566 -1.8607652 -1.5058109 lnc-RP11-410N8.4.1-1 A_33_P3292540 -1.801526 -1.1977948 -1.4996604 CDKN2C A_23_P139704 -1.2475443 -1.7512751 -1.4994097 DUSP6 A_32_P147078 -1.5616099 -1.4298372 -1.49572355 SLC8A1 A_23_P7313 -1.4533982 -1.5325089 -1.49295355 SPP1 A_23_P324523 -1.606515 -1.3780217 -1.49226835 IQCK A_19_P00322611 -1.3993506 -1.5845408 -1.4919457 lnc-SPAG1-3 A_24_P141629 -1.721394 -1.258488 -1.489941 FAM111A A_33_P3245218 -1.6476098 -1.3307381 -1.48917395 TENM2 A_33_P3357949 -1.281642 -1.6954688 -1.4885554 ETV1 A_24_P413884 -1.6309708 -1.3449526 -1.4879617 CENPA A_23_P41344 -1.4213963 -1.549527 -1.48546165 EREG A_32_P151800 -1.5152607 -1.454196 -1.48472835 FAM72D A_33_P3242578 -1.1716088 -1.7932242 -1.4824165 LOC100506731 A_32_P125803 -1.5142707 -1.4337196 -1.47399515 RBM26-AS1 A_23_P80068 -1.5863676 -1.332366 -1.4593668 BTG3 A_21_P0000742 -1.4353567 -1.4823217 -1.4588392 MYLK-AS1 A_23_P147845 -1.496854 -1.4138316 -1.4553428 PDXDC1 A_21_P0000132 -1.6189545 -1.290361 -1.45465775 C16orf93 A_33_P3217819 -1.6227431 -1.272262 -1.44750255 CCNE2 A_23_P52676 -1.3062023 -1.5877361 -1.4469692 CATSPER1 A_21_P0011912 -1.5018419 -1.3891207 -1.4454813 XLOC_l2_007986 A_22_P00004713 -1.5310625 -1.346868 -1.43896525 LOC100506844 A_24_P354689 -1.1933165 -1.6782331 -1.4357748 SPOCK1 A_23_P259292 -1.2209215 -1.646813 -1.43386725 C1QTNF5 A_33_P6809500 -1.3485937 -1.5106803 -1.429637 LOC100506844 A_22_P00016017 -1.33458 -1.5088573 -1.42171865 LOC101928117 A_33_P6819918 -1.489893 -1.3530647 -1.42147885 LOC100506844 A_23_P404494 -1.3161341 -1.526021 -1.42107755 IL7R A_33_P6822486 -1.4481926 -1.3894616 -1.4188271 LOC100506844 A_21_P0011781 -1.4580649 -1.3794479 -1.4187564 PSG8 A_23_P365738 -1.5226011 -1.3100911 -1.4163461 ARC A_21_P0000640 -1.2379047 -1.592989 -1.41544685 LINC00460 A_23_P119196 -1.5397748 -1.2899265 -1.41485065 KLF2 A_23_P2271 -1.5354248 -1.2884545 -1.41193965 PTHLH A_23_P200670 -1.3684416 -1.4513121 -1.40987685 WDR78 A_33_P6812270 -1.3954382 -1.4221125 -1.40877535 LOC100506844 A_22_P00014210 -1.4315314 -1.3772277 -1.40437955 MYLK-AS1 A_33_P3262670 -1.260593 -1.5311065 -1.39584975 MAP7D3 A_23_P217564 -1.5763254 -1.2018299 -1.38907765 ACSL4 A_23_P114445 -1.1672325 -1.605699 -1.38646575 MAGEE1 A_23_P94840 -1.2201096 -1.5527854 -1.3864475 DYNLRB2 A_23_P59388 -1.4092531 -1.3579609 -1.383607 DST A_23_P354908 -1.4658389 -1.2992978 -1.38256835 NMNAT2 A_24_P390060 -1.4747415 -1.2901697 -1.3824556 IQCD A_23_P21134 -1.4873363 -1.2768316 -1.38208395 DDIT3 A_23_P161190 -1.2124683 -1.5443982 -1.37843325 VIM A_23_P112113 -1.4761848 -1.2788383 -1.37751155 KIAA0196 A_22_P00018205 -1.362404 -1.3900003 -1.37620215 lnc-ZNF643-1 A_24_P49190 -1.5102072 -1.2409889 -1.37559805 C17orf58 A_33_P3846177 -1.5050904 -1.244709 -1.3748997 B4GALNT1 A_23_P43580 -1.2417641 -1.5074353 -1.3745997 CNTRL A_32_P41487 -1.4989204 -1.2460157 -1.37246805 HMGN2 A_19_P00322815 -1.5413256 -1.2020192 -1.3716724 CDKN2B-AS1 A_23_P61149 -1.6126366 -1.1250916 -1.3688641 INPP5D A_21_P0003027 -1.7454481 -0.9733766 -1.35941235 LOC644662 A_32_P16854 -1.4383287 -1.2800359 -1.3591823 ANAPC13 A_19_P00316187 -1.6051224 -1.1119529 -1.35853765 LINC00888 A_19_P00316836 -1.2934275 -1.4161472 -1.35478735 LINC01291 A_24_P167338 -1.4066386 -1.2960377 -1.35133815 RAB30 A_23_P208523 -1.4517025 -1.2480435 -1.349873 LENG1 A_24_P795371 -1.3999066 -1.2962961 -1.34810135 NR2F2-AS1 A_23_P56578 -1.6035749 -1.0758866 -1.33973075 VIT A_23_P23765 -1.4499893 -1.2218657 -1.3359275 ITGB3BP A_32_P36694 -1.2413926 -1.4302193 -1.33580595 JAZF1 A_23_P99360 -1.4709024 -1.1985645 -1.33473345 TRIM13 A_33_P3390708 -1.2622961 -1.4068307 -1.3345634 TMEM2 A_23_P67980 -1.236373 -1.4316993 -1.33403615 KLF7 A_23_P93524 -1.4958047 -1.1669925 -1.3313986 SAMD3 A_33_P3375145 -1.6324378 -1.0275064 -1.3299721 LURAP1L A_22_P00018146 -1.1535277 -1.5055107 -1.3295192 lnc-ZNF516-4 A_23_P145694 -1.2715615 -1.381957 -1.32675925 ASNS A_23_P111311 -1.2064589 -1.4469166 -1.32668775 AKAP12 A_33_P3705884 -1.3199526 -1.3326197 -1.32628615 LINC00662 A_23_P84334 -1.3474398 -1.3050975 -1.32626865 TMEM39A A_32_P300427 -1.0517015 -1.5979881 -1.3248448 APCDD1L A_19_P00318187 -1.1466569 -1.5004541 -1.3235555 LOC102724861 A_22_P00013157 -1.1385083 -1.5042931 -1.3214007 TTC39A-AS1 A_24_P98109 -1.5240511 -1.1152582 -1.31965465 SNX10 A_21_P0008704 -1.251656 -1.3837585 -1.31770725 lnc-POTEB-4 A_23_P8253 -1.2471629 -1.3861405 -1.3166517 RAET1E A_21_P0002371 -1.3054914 -1.3196012 -1.3125463 lnc-SH3BP4-3 A_23_P56559 -1.221574 -1.4024992 -1.3120366 DHRS9 A_24_P13041 -1.21653 -1.4063902 -1.3114601 RTKN2 A_23_P307328 -1.3656645 -1.2501202 -1.30789235 WHSC1 A_23_P318904 -1.4037533 -1.2000427 -1.301898 SERTAD4 A_22_P00013974 -0.84650236 -1.7545118 -1.30050708 lnc-RTN4-1 A_22_P00004712 -1.3455315 -1.2552242 -1.30037785 LOC100506844 A_33_P3376971 -1.1999435 -1.3977861 -1.2988648 CHAC1 A_33_P3286859 -1.2777281 -1.3155332 -1.29663065 ATP8A2 A_33_P3234984 -1.4469295 -1.1452861 -1.2961078 IFT81 A_21_P0000036 -1.4156119 -1.1751169 -1.2953644 RDM1 A_32_P152437 -1.2135326 -1.3670692 -1.2903009 AKAP12 A_23_P130429 -1.4836531 -1.0908351 -1.2872441 ROCK1 A_32_P222383 -1.4373674 -1.1343603 -1.28586385 HMGN2 A_24_P233786 -1.2698545 -1.2893963 -1.2796254 FAM129A A_23_P305507 -1.4053278 -1.1484041 -1.27686595 TOP1 A_21_P0010656 -1.4510508 -1.1012058 -1.2761283 XLOC_l2_001122 A_33_P3363188 -1.2156029 -1.3320552 -1.27382905 FLJ43315 A_24_P374382 -1.489318 -1.0570307 -1.27317435 TOP1P2 A_23_P11859 -1.3784685 -1.1603241 -1.2693963 HSD17B7 A_33_P3401295 -1.4807863 -1.0577325 -1.2692594 CRCT1 A_33_P3303146 -1.2723254 -1.2650132 -1.2686693 ATG4C A_33_P3278573 -1.2547692 -1.282515 -1.2686421 MAGIX A_32_P83845 -1.2543945 -1.2801213 -1.2672579 HEY1 A_33_P3318841 -1.2448268 -1.2888131 -1.26681995 C5orf63 A_24_P343255 -1.3243647 -1.2065821 -1.2654734 KLHDC3 A_23_P153360 -1.3670751 -1.1620235 -1.2645493 SMIM7 A_32_P42197 -1.3834134 -1.143713 -1.2635632 HNRNPA1 A_23_P121795 -1.5087955 -1.0165663 -1.2626809 SORBS2 A_23_P389391 -1.2316008 -1.2866087 -1.25910475 SLC12A4 A_21_P0013514 -1.2740022 -1.2419175 -1.25795985 XLOC_l2_014504 A_23_P42868 -1.2122512 -1.3022857 -1.25726845 IGFBP1 A_32_P70315 -1.2868471 -1.2274189 -1.257133 TIMP4 A_22_P00008743 -1.2045747 -1.3040537 -1.2543142 TRAF3IP2-AS1 A_23_P143958 -1.2824076 -1.2206001 -1.25150385 RPL22L1 A_23_P98310 -1.3042499 -1.1984596 -1.25135475 CSTF3 A_33_P3263569 -1.4189366 -1.083625 -1.2512808 AKNAD1 A_23_P250800 -1.20261 -1.2971897 -1.24989985 ST3GAL6 A_23_P14473 -1.3319216 -1.1678143 -1.24986795 CNIH1 A_22_P00008145 -1.4484181 -1.0495003 -1.2489592 lnc-IL6-2 A_22_P00019560 -1.3699192 -1.1279864 -1.2489528 lnc-SFN-1 A_23_P214821 -1.1341124 -1.3574821 -1.24579725 EDN1 A_24_P759477 -1.4489974 -1.0387726 -1.243885 ITGB8 A_21_P0000629 -1.2608156 -1.2231303 -1.24197295 SARS A_33_P3370634 -1.3659648 -1.1107646 -1.2383647 CNIH1 A_23_P259621 -1.3674011 -1.1083717 -1.2378864 LAT2 A_23_P129014 -1.2838573 -1.1902391 -1.2370482 EFCAB11 A_21_P0012925 -1.221776 -1.2430953 -1.23243565 XLOC_l2_012210 A_22_P00005150 -1.3528136 -1.1010715 -1.22694255 lnc-DHX38-5 A_32_P40288 -1.0588694 -1.3942393 -1.22655435 TMEM200A A_23_P61487 -1.356576 -1.0880117 -1.22229385 LRRC20 A_23_P55998 -1.2590914 -1.1798706 -1.219481 SLC1A5 A_23_P94552 -1.3832169 -1.0551071 -1.219162 TMEM2 A_22_P00014498 -0.8875923 -1.5485274 -1.21805985 lnc-SHISA9-2 A_24_P140475 -1.4835078 -0.9485116 -1.2160097 SORBS2 A_22_P00021652 -1.0232863 -1.4023852 -1.21283575 LOC101927963 A_23_P202143 -1.2532988 -1.1709527 -1.21212575 NOLC1 A_33_P3294654 -1.3455896 -1.0783529 -1.21197125 RSG1 A_23_P399255 -1.2532731 -1.166292 -1.20978255 RNF182 A_23_P104876 -1.3387295 -1.0789495 -1.2088395 SPA17 A_33_P3388391 -1.3904037 -1.0271707 -1.2087872 GJB4 A_23_P218476 -1.2438678 -1.1708049 -1.20733635 B9D2 A_23_P53467 -1.3722382 -1.0341626 -1.2032004 IKBIP A_24_P11900 -0.8183241 -1.5858501 -1.2020871 MYH15 A_32_P176911 -1.1944199 -1.2080779 -1.2012489 LINC00239 A_33_P3314276 -0.712046 -1.6854811 -1.19876355 ASPHD1 A_23_P353125 -1.057342 -1.3394991 -1.19842055 FSIP1 A_33_P3389188 -1.194951 -1.1957397 -1.19534535 TFAM A_23_P163143 -1.347848 -1.0422963 -1.19507215 ACYP1 A_23_P329261 -1.1463561 -1.2411805 -1.1937683 KCNJ2 A_33_P3290573 -1.4185055 -0.9679686 -1.19323705 FAM46A A_23_P115743 -1.1971302 -1.1872977 -1.19221395 FAM204A A_21_P0011823 -0.82029575 -1.5574102 -1.188852975 XLOC_l2_007449 A_24_P538478 -0.9732895 -1.4011503 -1.1872199 MED28 A_33_P3354858 -1.3453649 -1.0289941 -1.1871795 COQ10B A_23_P361584 -1.002605 -1.3647628 -1.1836839 TMEM154 A_23_P87351 -1.269268 -1.097332 -1.1833 RRM1 A_23_P122531 -1.2624903 -1.0956945 -1.1790924 C6orf48 A_24_P396231 -1.2428675 -1.1132401 -1.1780538 LAMP2 A_24_P391431 -1.2652245 -1.086915 -1.17606975 TAF9B A_24_P393864 -1.3612157 -0.98858535 -1.174900525 PHTF1 A_32_P200238 -1.263734 -1.0821314 -1.1729327 UCA1 A_23_P314642 -1.2609196 -1.0847044 -1.172812 ZNF280C A_23_P54144 -1.235947 -1.1054387 -1.17069285 BMP4 A_33_P3342285 -1.2862474 -1.055027 -1.1706372 RAP1A A_21_P0001343 -1.2628098 -1.076868 -1.1698389 lnc-ABCD3-1 A_33_P3422289 -1.2435427 -1.0905547 -1.1670487 lnc-TMED5-1 A_32_P15799 -1.2802992 -1.0537844 -1.1670418 HMGN2 A_21_P0006968 -1.1417065 -1.1919602 -1.16683335 SFTA1P A_32_P235796 -1.1906891 -1.1427284 -1.16670875 BBS12 A_24_P134727 -1.2806492 -1.052515 -1.1665821 TFAM A_23_P256223 -1.3496771 -0.98271275 -1.166194925 VBP1 A_23_P144578 -1.2874107 -1.0442171 -1.1658139 GNPDA2 A_23_P50108 -1.2643546 -1.0665444 -1.1654495 NDC80 A_23_P334955 -1.2070584 -1.1231704 -1.1651144 FAM167A A_23_P54041 -1.2636566 -1.0571594 -1.160408 THTPA A_24_P398940 -1.2824974 -1.0368853 -1.15969135 CASC4 A_23_P398491 -1.2126158 -1.1049528 -1.1587843 C15orf57 A_24_P225616 -1.304203 -1.012763 -1.158483 RRM2 A_33_P3335865 -1.1417207 -1.1748877 -1.1583042 WDR35 A_21_P0014708 -1.2441214 -1.0707369 -1.15742915 ATP6V1E2 A_33_P3323928 -1.08882 -1.2255664 -1.1571932 OLMALINC A_22_P00009113 -1.0865794 -1.221962 -1.1542707 THAP9-AS1 A_32_P90483 -1.0623697 -1.2413 -1.15183485 STXBP4 A_23_P204158 -1.2153434 -1.0872812 -1.1513123 RNFT2 A_19_P00321782 -0.81321293 -1.4861597 -1.149686315 LINC-PINT A_32_P168886 -1.2264137 -1.0720434 -1.14922855 EIF4H A_23_P408955 -1.3841991 -0.90858734 -1.14639322 E2F2 A_22_P00007025 -0.82817316 -1.4639626 -1.14606788 lnc-GIP-1 A_21_P0007073 -1.2468505 -1.0424132 -1.14463185 lnc-SCD-1 A_22_P00010175 -1.2410307 -1.043829 -1.14242985 FGD5-AS1 A_21_P0013292 -1.2185802 -1.0646019 -1.14159105 EIF4H A_33_P3270657 -1.2072954 -1.0746919 -1.14099365 FAM111B A_24_P260639 -1.1293287 -1.1523275 -1.1408281 HIST1H1D A_23_P126836 -1.0020452 -1.2784535 -1.14024935 TNFSF4 A_21_P0013556 -1.2633704 -1.0158596 -1.139615 XLOC_l2_014711 A_23_P155301 -0.97245705 -1.3056564 -1.139056725 NEK11 A_24_P28977 -1.1266375 -1.150301 -1.13846925 TRPC1 A_33_P3256738 -1.1037914 -1.1716332 -1.1377123 ARHGEF39 A_33_P3337318 -0.7240512 -1.550681 -1.1373661 HNRNPA2B1 A_22_P00002938 -1.2035118 -1.0705446 -1.1370282 LOC648987 A_33_P3358312 -1.0843096 -1.1890631 -1.13668635 OTUD6B A_23_P96641 -1.2161595 -1.054944 -1.13555175 PRPS2 A_23_P45011 -1.0293331 -1.2408643 -1.1350987 PPP1R14C A_22_P00024789 -1.1926708 -1.0769252 -1.134798 lnc-ZRANB1-2 A_23_P108673 -1.0852394 -1.1839466 -1.134593 EVA1A A_32_P162250 -1.2385206 -1.0294333 -1.13397695 ARHGAP18 A_23_P75038 -1.2456989 -1.0212069 -1.1334529 DCLRE1A A_23_P128728 -1.3008574 -0.96603394 -1.13344567 ARG2 A_23_P302060 -1.0729756 -1.1868129 -1.12989425 IFNE A_33_P3314341 -1.1488782 -1.1104692 -1.1296737 KIAA1958 A_33_P3344831 -1.0648049 -1.1936458 -1.12922535 TMEM45A A_23_P204630 -1.2864362 -0.9694815 -1.12795885 NTN4 A_24_P879740 -1.0427918 -1.2120891 -1.12744045 MAP1B A_33_P3234989 -1.3535666 -0.90112406 -1.12734533 IFT81 A_22_P00004907 -1.1181474 -1.1342069 -1.12617715 LINC00460 A_33_P3316983 -1.2075291 -1.0440636 -1.12579635 BBIP1 A_33_P3387856 -1.3084755 -0.93910074 -1.12378812 CENPN A_24_P49371 -1.190074 -1.0470637 -1.11856885 C4orf27 A_24_P288754 -1.1391296 -1.0941677 -1.11664865 PIGA A_23_P328836 -1.0792435 -1.1438965 -1.11157 LCOR A_24_P344416 -1.5109835 -0.7114204 -1.11120195 DSC3 A_21_P0014072 -1.1857643 -1.0356317 -1.110698 LOC100507670 A_23_P65278 -1.1955843 -1.0245777 -1.110081 NBEA A_23_P136964 -1.1596994 -1.0578114 -1.1087554 RPGR A_24_P291826 -0.96138656 -1.2550402 -1.10821338 SYTL3 A_33_P3691860 -1.2601725 -0.9535236 -1.10684805 FAM122B A_23_P4133 -1.1936626 -1.0187935 -1.10622805 AOC2 A_21_P0000303 -0.7920679 -1.4199203 -1.1059941 SNORA75 A_23_P88069 -1.0514622 -1.1602211 -1.10584165 LHFP A_33_P3302861 -1.084601 -1.126918 -1.1057595 RPGRIP1L A_23_P429491 -1.1867685 -1.0218191 -1.1042938 DDIAS A_22_P00015379 -1.1631137 -1.0444727 -1.1037932 LOC101929494 A_33_P6817354 -1.3548651 -0.85243315 -1.103649125 FGD5-AS1 A_32_P197340 -1.0880041 -1.1179196 -1.10296185 ERICH2 A_33_P3274194 -0.76394933 -1.4385524 -1.101250865 KCNIP4 A_33_P3332666 -0.9398256 -1.2620158 -1.1009207 SPHK2 A_22_P00007431 -0.802 -1.3998164 -1.1009082 lnc-GSDMD-3 A_32_P207169 -1.1454116 -1.055378 -1.1003948 SERTAD4-AS1 A_23_P78980 -1.0982724 -1.1005564 -1.0994144 B3GNT3 A_23_P141974 -1.1270313 -1.0709637 -1.0989975 TPM4 A_23_P205713 -1.1733341 -1.0209846 -1.09715935 STXBP6 A_33_P3371718 -1.1553394 -1.0336132 -1.0944763 SAT1 A_24_P321581 -1.0417018 -1.1452179 -1.09345985 SLC38A4 A_33_P3763412 -0.96265465 -1.2217546 -1.092204625 LOC102724434 A_21_P0005741 -1.2922173 -0.89100933 -1.091613315 lnc-SPAG1-2 A_24_P236235 -1.1690475 -1.0035771 -1.0863123 FLRT2 A_33_P3333156 -1.0755571 -1.0959553 -1.0857562 C11orf70 A_23_P254978 -1.1588154 -1.0106239 -1.08471965 TATDN1 A_23_P145024 -1.0009212 -1.1684836 -1.0847024 ADRB2 A_33_P3225487 -1.1885624 -0.9805681 -1.08456525 HSD17B7 A_33_P3619171 -1.0357304 -1.1287622 -1.0822463 PMAIP1 A_23_P17065 -1.1637602 -0.9942517 -1.07900595 CCL20 A_33_P3358779 -1.0046239 -1.1497207 -1.0771723 OR9Q2 A_21_P0011401 -1.2946337 -0.8553853 -1.0750095 LOC100996255 A_23_P258612 -0.995778 -1.1538373 -1.07480765 ATP8A2 A_23_P15844 -1.0212741 -1.1278828 -1.07457845 BRIP1 A_24_P156113 -1.1643372 -0.97641283 -1.070375015 EHD2 A_23_P147826 -1.0728621 -1.0675459 -1.070204 RAP2C A_32_P218025 -1.2599107 -0.88005793 -1.069984315 LOC100506253 A_22_P00016257 -1.2326206 -0.90729576 -1.06995818 lnc-TMED5-1 A_33_P3315375 -1.159399 -0.9803 -1.0698495 SLFN11 A_24_P382253 -1.2130336 -0.92565536 -1.06934448 RPRD1A A_23_P164958 -1.1191044 -1.0193157 -1.06921005 CCDC8 A_33_P3300262 -1.3713264 -0.76707983 -1.069203115 VIT A_23_P161218 -0.7878185 -1.3505422 -1.06918035 ANKRD1 A_22_P00001885 -1.169733 -0.96718985 -1.068461425 lnc-B3GAT2-2 A_24_P468810 -1.1443692 -0.9913759 -1.06787255 RBBP4 A_33_P3221458 -1.1318059 -1.0027852 -1.06729555 ZNF204P A_21_P0006969 -1.0702429 -1.0634452 -1.06684405 SFTA1P A_23_P357365 -1.1825514 -0.9506616 -1.0666065 STAG1 A_24_P870620 -1.1059057 -1.0242605 -1.0650831 PTN A_24_P108301 -1.0343246 -1.0950899 -1.06470725 RTTN A_33_P3373805 -0.9681077 -1.1593752 -1.06374145 LOC255187 A_21_P0000356 -0.96345997 -1.1606406 -1.062050285 SCARNA11 A_23_P333705 -1.0524635 -1.0695809 -1.0610222 NEK3 A_21_P0010703 -1.1871362 -0.92826796 -1.05770208 lnc-C1orf177-2 A_33_P3286372 -0.9012956 -1.2138947 -1.05759515 C2orf48 A_23_P25019 -1.1219187 -0.9918184 -1.05686855 PRIM1 A_24_P192301 -0.89340496 -1.2192302 -1.05631758 SEMA3A A_23_P92334 -1.1643773 -0.9465894 -1.05548335 TMEM156 A_33_P3268532 -1.0069733 -1.1018661 -1.0544197 PCK2 A_32_P95729 -1.1413355 -0.96586883 -1.053602165 FANCI A_33_P3324839 -0.8139367 -1.2922481 -1.0530924 SYNGAP1 A_22_P00003499 -1.177886 -0.9258184 -1.0518522 LOC100506282 A_24_P37519 -1.1077747 -0.9948768 -1.05132575 LZTFL1 A_23_P155765 -1.2199545 -0.88026243 -1.050108465 HMGB2 A_23_P76882 -1.0817004 -1.0179387 -1.04981955 CCNB1IP1 A_33_P3238976 -1.1929703 -0.90372753 -1.048348915 TRMT5 A_32_P98975 -1.2189044 -0.8757477 -1.04732605 C15orf57 A_23_P121956 -1.1753551 -0.91665465 -1.046004875 THG1L A_24_P111996 -1.2832808 -0.8083652 -1.045823 HFE A_33_P3377691 -0.835517 -1.2547388 -1.0451279 C4orf46 A_24_P417189 -1.0697064 -1.0205153 -1.04511085 DUSP9 A_33_P3323822 -1.0150347 -1.0748701 -1.0449524 GATAD2B A_23_P433152 -1.2264171 -0.86282825 -1.044622675 C4orf33 A_23_P57474 -1.03267 -1.0560695 -1.04436975 OSBP2 A_23_P116264 -1.1256485 -0.95969003 -1.042669265 NRGN A_33_P3474319 -1.1046257 -0.9807083 -1.042667 SLC37A2 A_33_P3312119 -0.966311 -1.1146317 -1.04047135 C6orf99 A_33_P3269588 -1.0909376 -0.98460585 -1.037771725 GABPA A_22_P00008143 -1.044035 -1.0279485 -1.03599175 LOC101927841 A_23_P211047 -1.1125307 -0.9562074 -1.03436905 BACH1 A_24_P68311 -1.2609605 -0.8000056 -1.03048305 SYNE2 A_24_P364057 -1.0165849 -1.0418878 -1.02923635 C11orf70 A_24_P379765 -1.1751376 -0.8811427 -1.02814015 MOB1A A_33_P3338733 -1.0569574 -0.99850935 -1.027733375 MITF A_23_P91850 -1.0446253 -1.006698 -1.02566165 IL20RB A_24_P200848 -1.131648 -0.9188093 -1.02522865 SNX13 A_23_P93690 -1.0778943 -0.9688417 -1.023368 MCM7 A_23_P145904 -1.213277 -0.83046913 -1.021873065 H2AFV A_23_P255444 -1.0986791 -0.943668 -1.02117355 DAPP1 A_23_P202905 -0.71069956 -1.3299984 -1.02034898 TIRAP A_22_P00007027 -0.89051396 -1.1482663 -1.01939013 lnc-GIT1-1 A_23_P426663 -1.1082773 -0.9287015 -1.0184894 MITF A_33_P3410599 -1.065187 -0.96823895 -1.016712975 FAM46A A_24_P282237 -0.7390788 -1.2903934 -1.0147361 PRIM2 A_23_P215341 -0.9788436 -1.050252 -1.0145478 FKBP14 A_33_P3369401 -0.939393 -1.0887241 -1.01405855 CYP24A1 A_22_P00010173 -1.2019938 -0.82604504 -1.01401942 FGD5-AS1 A_21_P0000893 -1.045084 -0.981369 -1.0132265 IQCH-AS1 A_22_P00022017 -1.1068621 -0.91920996 -1.01303603 LOC100506801 A_24_P14260 -1.0743427 -0.9517159 -1.0130293 CARD8 A_22_P00011229 -1.1555142 -0.8684702 -1.0119922 lnc-OR10H1-1 A_23_P156826 -0.876194 -1.1449537 -1.01057385 ADTRP A_24_P179504 -1.0245113 -0.99560255 -1.010056925 WDR66 A_23_P96965 -1.1098422 -0.9092951 -1.00956865 SYNC A_32_P137266 -1.1486655 -0.87043005 -1.009547775 EFCAB7 A_23_P200222 -1.0415956 -0.97566146 -1.00862853 LRP8 A_24_P414786 -1.1173716 -0.8987857 -1.00807865 CDC40 A_32_P133916 -0.8762025 -1.136254 -1.00622825 BNC2 A_22_P00001912 -0.8534689 -1.1581388 -1.00580385 PRIM2 A_24_P296254 -1.152216 -0.85790026 -1.00505813 ARHGAP11A A_23_P140309 -1.0927888 -0.91664404 -1.00471642 MAPK1IP1L A_23_P28815 -0.80727196 -1.2015133 -1.00439263 CYP24A1 A_33_P3313785 -0.9698763 -1.0383042 -1.00409025 CCDC14 A_33_P3251144 -1.0053579 -1.002429 -1.00389345 CDCA7L A_23_P119337 -1.0715227 -0.9360142 -1.00376845 ATF5 A_23_P356139 -1.0489384 -0.95856094 -1.00374967 FAM178A A_33_P3287879 -0.8863593 -1.1201172 -1.00323825 HIST1H3H A_23_P340131 -0.97042227 -1.0354166 -1.002919435 PRSS16 A_23_P361419 -1.1348065 -0.87014 -1.00247325 DEPDC1B A_23_P30799 -0.9089669 -1.0950651 -1.002016 HIST1H3F A_19_P00322333 -1.0597086 -0.9409317 -1.00032015 LOC101059954 A_24_P388810 -1.0916348 -0.9086171 -1.00012595 SRP19 A_24_P281975 1.0666314 0.9337187 1.00017505 GNPTAB A_23_P55706 1.0002548 1.0026531 1.00145395 RELB A_23_P27606 1.0263577 0.9866859 1.0065218 IL27RA A_23_P6708 1.0943508 0.9202566 1.0073037 NCBP2-AS2 A_23_P120710 1.0451307 0.97074306 1.00793688 TTC3 A_33_P3262191 1.1329614 0.88642883 1.009695115 CPNE7 A_21_P0011934 1.0046754 1.015944 1.0103097 LINC00342 A_24_P54178 1.1246003 0.8967361 1.0106682 TMED5 A_23_P214766 0.96077645 1.067297 1.014036725 HIVEP2 A_33_P3369461 1.0761389 0.95218325 1.014161075 AMIGO1 A_23_P329870 1.148715 0.8800517 1.01438335 RHBDF2 A_23_P101392 1.1204152 0.9087085 1.01456185 TMEM38A A_23_P217135 1.0975857 0.93435955 1.015972625 ZNF275 A_23_P76823 1.0860724 0.947803 1.0169377 ADSSL1 A_23_P103201 1.0823603 0.95273983 1.017550065 PNRC2 A_21_P0012472 1.2481346 0.78878504 1.01845982 LOC101928992 A_21_P0007505 1.1405654 0.90054184 1.02055362 lnc-MLXIP-1 A_23_P207811 1.0661898 0.9775179 1.02185385 PAIP1 A_22_P00021091 1.3196445 0.72543573 1.022540115 lnc-ABCC3-1 A_22_P00006201 1.1320924 0.9194689 1.02578065 SMKR1 A_23_P124905 1.0733796 0.97989935 1.026639475 NPTX1 A_23_P204579 1.1005896 0.9553308 1.0279602 TDG A_23_P44964 1.0752105 0.9862652 1.03073785 FAM171A1 A_33_P3398564 1.1067181 0.95868874 1.03270342 ACAP3 A_23_P125078 1.0657797 1.0002319 1.0330058 SLC26A11 A_23_P24616 1.1617575 0.9060439 1.0339007 SIAE A_23_P66481 0.8456416 1.2263669 1.03600425 RTN4RL1 A_23_P422851 1.131217 0.9415655 1.03639125 CABLES1 A_33_P3393766 1.158019 0.9148912 1.0364551 C17orf96 A_24_P362540 1.1596204 0.9136687 1.03664455 ASAP2 A_23_P50535 1.1060201 0.9721012 1.03906065 DMPK A_33_P3670415 1.1006137 0.9782875 1.0394506 NAT8L A_24_P121956 1.1693916 0.910554 1.0399728 TMEM86B A_21_P0007438 1.3500652 0.7313906 1.0407279 lnc-LGALS12-2 A_24_P295010 1.1790537 0.9068713 1.0429625 SERPINB9 A_33_P3253249 1.0174235 1.0696602 1.04354185 FTH1 A_21_P0000751 1.2580808 0.829009 1.0435449 PSMD6-AS2 A_33_P3415440 1.0587425 1.0292655 1.044004 MAP3K2 A_23_P210554 1.2936026 0.7969694 1.045286 SPATA2 A_23_P78053 1.0401276 1.053198 1.0466628 FAM117A A_23_P113283 0.9616595 1.1332664 1.04746295 ZMAT3 A_33_P3386150 0.8981623 1.1975999 1.0478811 NRADDP A_33_P3352970 1.241599 0.85501766 1.04830833 IRAK2 A_23_P49499 1.0680771 1.0307628 1.04941995 ST6GALNAC2 A_24_P40978 1.0202657 1.0793304 1.04979805 CYHR1 A_24_P9883 1.0622238 1.037962 1.0500929 AP5B1 A_23_P26511 1.1425418 0.958229 1.0503854 GDPD3 A_24_P273253 1.2082891 0.8935318 1.05091045 AHNAK2 A_33_P3263890 1.3037778 0.80284923 1.053313515 PRRX1 A_23_P160466 1.2273436 0.88117874 1.05426117 SLC19A2 A_33_P3412016 1.0638323 1.0466098 1.05522105 SEMA4B A_24_P288424 1.1055804 1.0096657 1.05762305 SLMO2 A_23_P46844 1.118351 0.9974127 1.05788185 TRIM8 A_33_P3410259 1.0723677 1.0442662 1.05831695 MRPL23-AS1 A_33_P3302393 1.1675493 0.9500418 1.05879555 KLHL36 A_23_P17855 1.1021891 1.0164938 1.05934145 TRIOBP A_24_P373768 1.0772954 1.0433311 1.06031325 GIPR A_33_P3358621 1.0831461 1.0407013 1.0619237 LOC100506036 A_33_P3371999 0.98653513 1.1410025 1.063768815 TPPP A_21_P0014073 1.1605304 0.96743107 1.063980735 LOC101927886 A_24_P193582 1.1424103 0.985816 1.06411315 DEF8 A_33_P3313302 1.0093066 1.1200594 1.064683 PARP6 A_24_P98975 1.0510035 1.0793629 1.0651832 ANKRD13A A_23_P258221 1.1937637 0.9377957 1.0657797 ABCC5 A_23_P45871 1.1977464 0.9343687 1.06605755 IFI44L A_33_P8086411 1.2179384 0.9172096 1.067574 SMKR1 A_24_P416177 1.1970547 0.9386949 1.0678748 ADCY7 A_23_P314250 1.0894319 1.0466661 1.068049 FAM78A A_23_P88470 1.0675898 1.0692474 1.0684186 TRPM7 A_32_P114284 0.9991607 1.1417212 1.07044095 IKZF2 A_23_P55011 1.1097041 1.031846 1.07077505 SLC38A10 A_32_P96036 0.9411002 1.2017522 1.0714262 MEX3A A_23_P211850 1.169445 0.9754362 1.0724406 ABHD6 A_33_P3215575 1.1029072 1.0457412 1.0743242 ARHGEF10L A_23_P60324 1.1091062 1.0436047 1.07635545 UBAC1 A_23_P318284 1.2451096 0.9090758 1.0770927 GPD1L A_33_P3342613 1.1217566 1.0364105 1.07908355 ZDHHC8 A_23_P63209 1.2111225 0.94757515 1.079348825 HSD11B1 A_23_P382705 1.1307601 1.0294274 1.08009375 TMTC2 A_33_P3244274 1.1594877 1.001318 1.08040285 RNF208 A_21_P0000102 1.1652986 0.9969539 1.08112625 MTRNR2L2 A_21_P0003289 1.0831461 1.0796577 1.0814019 lnc-MINA-3 A_23_P69329 1.1681207 1.0046812 1.08640095 HYAL1 A_33_P3231670 1.1764964 1.0021582 1.0893273 RNF208 A_24_P921321 1.1091967 1.0709605 1.0900786 PTPRJ A_24_P185117 1.2122183 0.9683056 1.09026195 RILP A_24_P277807 1.1523428 1.0288466 1.0905947 SNX3 A_23_P394166 1.1822348 1.0036689 1.09295185 CNOT7 A_24_P98249 1.1897489 0.99855715 1.094153025 TACC1 A_23_P346093 1.3630548 0.8292555 1.09615515 TMC8 A_23_P59005 1.0664959 1.1258324 1.09616415 TAP1 A_23_P127995 1.2095374 0.9831848 1.0963611 CLNS1A A_23_P98350 1.001506 1.1962987 1.09890235 BIRC3 A_23_P252283 1.1998615 1.0016851 1.1007733 RNF135 A_23_P88893 1.1744863 1.0276737 1.10108 DEF8 A_23_P349676 1.1761675 1.0318872 1.10402735 FBXO41 A_23_P82065 1.3056936 0.90639395 1.106043775 ELOVL4 A_23_P33759 1.0356627 1.1767035 1.1061831 DHRS3 A_33_P3330099 1.1509598 1.0617995 1.10637965 ARSD A_22_P00012581 1.4239529 0.78908056 1.10651673 lnc-PTPN14-1 A_23_P344531 1.1839585 1.0319896 1.10797405 SYNPO A_21_P0000101 1.1737709 1.0442429 1.1090069 MTRNR2L2 A_23_P10182 1.2741317 0.94473416 1.10943293 ACOX2 A_33_P3398513 1.2012315 1.0255504 1.11339095 LOC728819 A_23_P368195 1.3587855 0.86957836 1.11418193 LSM11 A_23_P302568 1.1064596 1.1263571 1.11640835 SLC30A3 A_32_P131143 1.3794627 0.85381895 1.116640825 CECR5-AS1 A_32_P143048 1.1861485 1.0520228 1.11908565 ZFYVE9 A_23_P163258 1.1785545 1.0601034 1.11932895 PARP6 A_23_P126075 1.128826 1.111826 1.120326 KCNK1 A_33_P3357530 1.1366053 1.1044196 1.12051245 SLC12A7 A_23_P130027 1.1614075 1.0836458 1.12252665 EPN3 A_24_P56484 1.1605215 1.0921925 1.126357 BRMS1L A_21_P0011289 1.3908305 0.8634863 1.1271584 XLOC_l2_004562 A_33_P3342160 1.343789 0.91211224 1.12795062 ATG2B A_32_P116556 1.3967878 0.8602729 1.12853035 ZNF469 A_23_P301925 1.3309364 0.9270726 1.1290045 COX1 A_23_P200710 1.0825748 1.1766167 1.12959575 PIK3C2B A_22_P00017844 1.2632576 0.999156 1.1312068 ZCCHC2 A_23_P371835 1.0645343 1.1985465 1.1315404 GATA5 A_32_P175739 1.2472981 1.0169412 1.13211965 HK2 A_23_P202345 1.2631663 1.0055102 1.13433825 ADO A_23_P99771 1.1957132 1.0735283 1.13462075 PNMA1 A_33_P3418170 1.1222997 1.1477518 1.13502575 DDX58 A_23_P217475 1.1225891 1.1518087 1.1371989 IDS A_23_P146444 1.1424646 1.1333687 1.13791665 CORO2A A_23_P90804 1.261797 1.0184604 1.1401287 MAP4K4 A_22_P00019908 1.2127048 1.0688524 1.1407786 lnc-WNT1-2 A_23_P55356 1.3177795 0.9644141 1.1410968 VMO1 A_23_P345692 1.229332 1.0568123 1.14307215 IL17D A_23_P201287 1.2083167 1.0795975 1.1439571 KIF1B A_23_P10559 1.2864493 1.0055276 1.14598845 AATK A_24_P193295 1.1248207 1.1692238 1.14702225 RAB15 A_22_P00000865 1.2351594 1.063748 1.1494537 LOC101927609 A_23_P80839 1.2515982 1.0483665 1.14998235 MAP6D1 A_23_P146417 1.2645149 1.0369911 1.150753 TMEM245 A_24_P71700 1.3312701 0.9749698 1.15311995 ZBTB47 A_23_P42353 1.404736 0.90664005 1.155688025 ETV7 A_23_P29248 1.2043037 1.1098653 1.1570845 TST A_33_P3238171 0.88272625 1.4315434 1.157134825 ZDHHC8 A_23_P24716 1.2408352 1.075123 1.1579791 TMEM132A A_23_P128323 1.2174348 1.1017585 1.15959665 SCNN1A A_22_P00010191 1.2581517 1.0636768 1.16091425 LINC00310 A_33_P3418120 1.2723694 1.0571213 1.16474535 IPPK A_23_P349416 1.1315069 1.1988715 1.1651892 ERBB3 A_33_P3392537 1.2364421 1.0975128 1.16697745 TK2 A_23_P35205 1.2114706 1.1279002 1.1696854 RCAN3 A_23_P308097 1.2601918 1.0855657 1.17287875 PPP2CB A_21_P0000778 1.119039 1.2267421 1.17289055 ZSWIM8-AS1 A_23_P64721 0.98915195 1.3566923 1.172922125 HCAR3 A_32_P34444 1.4030681 0.94664437 1.174856235 FHOD3 A_33_P3413815 1.4049813 0.9492521 1.1771167 LAMB2P1 A_24_P286898 1.4392195 0.92210287 1.180661185 MAPK8 A_33_P3377459 1.3035021 1.0650086 1.18425535 PAPD5 A_33_P3294608 1.2757607 1.0965071 1.1861339 MVP A_33_P3404744 1.2705312 1.1160326 1.1932819 KIAA1958 A_23_P86100 0.98046535 1.4097748 1.195120075 KLHDC9 A_33_P3799936 1.2558204 1.1371136 1.196467 ARHGEF10L A_23_P381261 1.2435045 1.153565 1.19853475 ADCY4 A_24_P926960 1.3298169 1.0674381 1.1986275 MEGF6 A_33_P3423420 0.84358704 1.5584426 1.20101482 ZNF750 A_33_P3378126 1.2566019 1.1455951 1.2010985 FBXO32 A_33_P3365134 1.2611638 1.1427928 1.2019783 PPP1R13B A_23_P205830 1.2934303 1.1117611 1.2025957 BTBD1 A_24_P397386 1.289052 1.1179668 1.2035094 LIFR A_23_P415643 1.204712 1.2037896 1.2042508 ZNF48 A_23_P160214 1.435907 0.9834872 1.2096971 TTC39A A_21_P0013295 1.5414686 0.8876405 1.21455455 XLOC_l2_013783 A_23_P203743 1.3257109 1.1061684 1.21593965 GAB2 A_33_P3254380 1.3564816 1.0773 1.2168908 SLC9A7 A_33_P3423941 1.4731603 0.96289825 1.218029275 IFITM1 A_24_P232696 1.2481052 1.1913109 1.21970805 SMARCD1 A_23_P151209 1.296939 1.1455193 1.22122915 CSRNP2 A_33_P3389153 1.3490239 1.095521 1.22227245 STK10 A_19_P00322911 1.4314117 1.0131369 1.2222743 TWIST2 A_23_P202810 1.2191577 1.2365475 1.2278526 OVOL1 A_22_P00003684 1.5875716 0.8713875 1.22947955 lnc-CDH1-1 A_33_P3248265 1.3908638 1.0700196 1.2304417 LTB A_23_P383031 1.5777078 0.8996839 1.23869585 CC2D1B A_24_P119131 1.484814 0.99416023 1.239487115 TMEM120B A_23_P420373 1.1739782 1.3068002 1.2403892 DNMT3A A_23_P72737 1.2429789 1.2423121 1.2426455 IFITM1 A_33_P3402035 1.2848511 1.214116 1.24948355 TRAF4 A_24_P406814 1.3905907 1.1135921 1.2520914 FAM53B A_33_P3340769 1.413085 1.0962945 1.25468975 ADAM9 A_33_P3211260 1.4862957 1.0260177 1.2561567 DBNL A_32_P515431 1.3704158 1.1432554 1.2568356 LOC100132057 A_33_P3342563 1.3393693 1.1792831 1.2593262 PITPNM3 A_23_P345065 1.3308314 1.1957035 1.26326745 SCLY A_33_P3340309 1.2461414 1.2810574 1.2635994 ZNF768 A_23_P100141 1.2590094 1.2699404 1.2644749 UNKL A_33_P3227716 0.7164878 1.8127222 1.264605 GATSL3 A_23_P10591 1.3092346 1.2202312 1.2647329 METRNL A_23_P42498 1.3408136 1.192069 1.2664413 SNX3 A_23_P358709 1.1573782 1.3813761 1.26937715 AHRR A_23_P94216 1.4233994 1.1192085 1.27130395 LONRF1 A_23_P380371 1.423603 1.1227444 1.2731737 IPMK A_22_P00015251 1.6109983 0.94542843 1.278213365 lnc-SPAG5-1 A_23_P415021 0.91136986 1.6458422 1.27860603 METTL7A A_21_P0014365 1.3138622 1.2434983 1.27868025 GACAT2 A_33_P3325753 1.2985854 1.2626348 1.2806101 TRIOBP A_24_P176079 1.4548264 1.106554 1.2806902 WASF3 A_33_P3260317 1.513248 1.0525838 1.2829159 NR6A1 A_23_P257743 1.3191919 1.2497196 1.28445575 SHB A_23_P103617 1.1588992 1.4134464 1.2861728 ANXA9 A_33_P3216427 1.4078941 1.1676302 1.28776215 DGKQ A_23_P37569 1.4346123 1.1444569 1.2895346 MAN2A2 A_23_P210253 1.3599092 1.2217549 1.29083205 DGKD A_32_P201773 1.4227896 1.1622047 1.29249715 AMMECR1 A_23_P57760 1.3699684 1.2185669 1.29426765 PXYLP1 A_21_P0001233 1.4343656 1.1558342 1.2950999 lnc-LBR-1 A_21_P0000109 1.3716812 1.2267122 1.2991967 MTRNR2L9 A_24_P592012 1.2739574 1.3271645 1.30056095 ZBTB46 A_21_P0000697 1.2290726 1.3868246 1.3079486 LOC100505912 A_23_P101407 1.2018603 1.4178658 1.30986305 C3 A_24_P520767 1.5014588 1.1233582 1.3124085 LOC149351 A_33_P3290924 1.3260908 1.2988023 1.31244655 BAG1 A_23_P217054 1.2659034 1.401703 1.3338032 DCAF10 A_33_P3354569 1.3878937 1.283946 1.33591985 GPD2 A_24_P645765 1.3817883 1.296117 1.33895265 KLHL42 A_33_P3400374 1.3580141 1.327817 1.34291555 HELZ2 A_24_P23258 1.3454038 1.3477212 1.3465625 GRAMD4 A_23_P146654 1.392827 1.304448 1.3486375 BAG1 A_23_P137543 1.4112166 1.2869377 1.34907715 ZNF362 A_23_P421306 1.3218757 1.3779306 1.34990315 SYT12 A_33_P3781228 1.9786631 0.72520345 1.351933275 CEBPB-AS1 A_33_P3227990 1.3458242 1.3750563 1.36044025 MBP A_24_P687594 1.4584479 1.2678304 1.36313915 LIX1L A_21_P0000108 1.4767982 1.2668276 1.3718129 MTRNR2L8 A_24_P300777 1.5948935 1.1619205 1.378407 ADAM8 A_23_P345674 1.4714985 1.2985438 1.38502115 ZNF71 A_32_P409222 1.7365533 1.0362749 1.3864141 ZNF628 A_33_P3427102 1.4813234 1.3099747 1.39564905 TTL A_24_P413126 1.7418921 1.0545292 1.39821065 PMEPA1 A_24_P941166 1.5217981 1.2919407 1.4068694 ZNF425 A_23_P41804 1.5037308 1.324091 1.4139109 NKD2 A_33_P3211929 1.459195 1.376915 1.418055 RCOR2 A_33_P3262814 1.4221278 1.4205894 1.4213586 REEP3 A_33_P3225091 1.4926171 1.3580785 1.4253478 NUMBL A_33_P3228450 1.3129827 1.5420941 1.4275384 FXYD3 A_23_P111621 1.5866376 1.2829267 1.43478215 GTF2IRD1 A_24_P322474 1.6060104 1.2645931 1.43530175 PDE4A A_22_P00022238 1.8261176 1.0449408 1.4355292 LINC01391 A_21_P0000103 1.5783646 1.2948303 1.43659745 MTRNR2L3 A_21_P0007097 1.7400613 1.13733 1.43869565 BEND7 A_33_P3316978 1.6906959 1.1870494 1.43887265 RNF207 A_22_P00016450 1.6253719 1.2567959 1.4410839 lnc-TMEM63A-1 A_23_P26583 1.9590799 0.9417925 1.4504362 NLRC5 A_33_P3290919 1.5208416 1.4152956 1.4680686 BAG1 A_23_P258018 1.6669298 1.2750436 1.4709867 MYL5 A_33_P3238290 1.5135862 1.4287852 1.4711857 FAM65C A_23_P164047 1.7174882 1.2481489 1.48281855 MMD A_32_P109794 1.6465225 1.3236656 1.48509405 STYX A_24_P849801 1.5507671 1.4466771 1.4987221 RPL22 A_33_P3236102 1.6074324 1.3961592 1.5017958 IER5L A_23_P379945 1.588153 1.4660807 1.52711685 CCDC88C A_33_P3235611 1.7349558 1.3231031 1.52902945 SLC46A1 A_24_P941167 1.9815588 1.0856237 1.53359125 APOL6 A_23_P102391 1.9339461 1.1461887 1.5400674 SLC40A1 A_32_P73452 1.7836785 1.3187767 1.5512276 ANO8 A_23_P55256 1.7614441 1.347804 1.55462405 ZNF652 A_23_P133691 1.8084483 1.3014102 1.55492925 RRAGD A_21_P0000107 1.6931628 1.4498385 1.57150065 MTRNR2L7 A_33_P3271051 1.7408514 1.4066486 1.57375 CYTH3 A_23_P65442 1.6607724 1.5024128 1.5815926 IRF9 A_23_P64617 1.7780552 1.4024177 1.59023645 FZD4 A_33_P3220470 1.6800221 1.6074947 1.6437584 SMAD6 A_23_P44505 1.7910041 1.5208262 1.65591515 KLF11 A_23_P391443 1.730939 1.5837566 1.6573478 PPM1H A_33_P3806965 1.6516505 1.6738724 1.66276145 FLJ13744 A_33_P3264505 1.8776065 1.4655906 1.67159855 FCF1 A_22_P00012227 1.8057957 1.5579795 1.6818876 lnc-PPIA-1 A_21_P0000100 1.8796692 1.5050374 1.6923533 MTRNR2L1 A_33_P3296198 1.9116766 1.4833525 1.69751455 C5orf63 A_33_P3246505 1.6446995 1.7542952 1.69949735 MAP3K8 A_21_P0000106 1.848858 1.5730839 1.71097095 MTRNR2L6 A_23_P407206 1.9873616 1.4515938 1.7194777 CLN8 A_23_P385500 1.872818 1.7026404 1.7877292 RNF166 A_33_P3828101 1.9399099 1.6647863 1.8023481 CCDC112 A_32_P163739 1.9331665 1.7159042 1.82453535 KIAA1257 A_23_P144384 1.9552221 1.7045269 1.8298745 GALNT7 A_23_P43255 1.9418325 1.7775747 1.8597036 FAM49B A_23_P15174 2.0118237 1.7503978 1.88111075 MT1F A_23_P147641 1.9968606 1.8190851 1.90797285 TCEA2 A_23_P118150 1.9529887 1.9082737 1.9306312 ARL6IP1 A_24_P393372 2.0648308 1.8420843 1.95345755 PACS2 A_23_P120883 2.1434941 1.834985 1.98923955 HMOX1 A_24_P108291 2.2854683 1.7744865 2.0299774 IMPACT A_23_P207507 2.2520933 1.8550639 2.0535786 ABCC3 A_23_P97700 2.2837095 1.9624747 2.1230921 TXNIP A_23_P339818 2.472693 2.135277 2.303985 ARRDC4 A_23_P53126 2.4631734 2.1588936 2.3110335 LMO2 A_23_P312358 2.4683824 2.419169 2.4437757 BEND7

Supplementary Table S4. GO terms enriched in DDX3 knockdown-upregulated or -downregulated genes analyzed by DAVID software. GO term enriched in siDDX3-downregulated genes Count % PValue GO:0016043~cellular component organization 129 0.2880879 7.17E-08 GO:0071840~cellular component organization or biogenesis 129 0.2880879 3.66E-07 GO:0030030~cell projection organization 39 0.087096342 2.06E-05 GO:0006928~movement of cell or subcellular component 48 0.107195498 3.22E-05 GO:0044699~single-organism process 216 0.48237974 5.31E-05 GO:0032989~cellular component morphogenesis 38 0.084863102 6.53E-05 GO:0048856~anatomical structure development 108 0.24118987 7.73E-05 GO:0048858~cell projection morphogenesis 27 0.060297468 8.21E-05 GO:0006259~DNA metabolic process 31 0.069230426 9.58E-05 GO:0006996~organelle organization 80 0.178659163 1.16E-04 GO:0032990~cell part morphogenesis 27 0.060297468 1.22E-04 GO:0032502~developmental process 109 0.24342311 1.63E-04 GO:0048519~negative regulation of biological process 93 0.207691277 1.95E-04 GO:1902589~single-organism organelle organization 42 0.093796061 2.11E-04 GO:0044767~single-organism developmental process 106 0.236723391 2.21E-04 GO:0007049~cell cycle 43 0.0960293 2.28E-04 GO:0022402~cell cycle process 37 0.082629863 2.43E-04 GO:0006260~DNA replication 14 0.031265354 2.98E-04 GO:0000278~mitotic cell cycle 29 0.064763947 3.27E-04 GO:0000902~cell morphogenesis 34 0.075930144 4.27E-04 GO:0048523~negative regulation of cellular process 86 0.1920586 5.09E-04 GO:0044763~single-organism cellular process 199 0.444414668 5.25E-04 GO:0048869~cellular developmental process 81 0.180892403 5.33E-04 GO:0031175~neuron projection development 25 0.055830988 7.07E-04 GO:0040007~growth 27 0.060297468 9.18E-04 GO:0022607~cellular component assembly 57 0.127294654 0.001126353 GO:0040011~locomotion 38 0.084863102 0.001135636 GO:0009653~anatomical structure morphogenesis 57 0.127294654 0.001266447 GO:0048666~neuron development 27 0.060297468 0.001507803 GO:0010712~regulation of collagen metabolic process 5 0.011166198 0.001699552 GO:0001568~blood vessel development 19 0.042431551 0.001703282 GO:0044246~regulation of multicellular organismal metabolic process 5 0.011166198 0.001884345 GO:0048589~developmental growth 19 0.042431551 0.001940125 GO:0048646~anatomical structure formation involved in morphogenesis 30 0.066997186 0.002221458 GO:0048812~neuron projection morphogenesis 18 0.040198312 0.002230667 GO:0042692~muscle cell differentiation 14 0.031265354 0.002270907 GO:1903047~mitotic cell cycle process 25 0.055830988 0.00231083 GO:0072359~circulatory system development 26 0.058064228 0.002373064 GO:0072358~cardiovascular system development 26 0.058064228 0.002373064 GO:0045446~endothelial cell differentiation 7 0.015632677 0.002463982 GO:0007409~axonogenesis 15 0.033498593 0.002650247 GO:0010975~regulation of neuron projection development 15 0.033498593 0.002650247 GO:0071103~DNA conformation change 12 0.026798874 0.002745797 GO:0009605~response to external stimulus 46 0.102729019 0.002868565 GO:0030154~cell differentiation 72 0.160793247 0.002907585 GO:0071456~cellular response to hypoxia 8 0.017865916 0.002968996 GO:0001944~vasculature development 19 0.042431551 0.003148515 GO:0048468~cell development 44 0.09826254 0.003190549 GO:0055002~striated muscle cell development 8 0.017865916 0.003364188 GO:0010927~cellular component assembly involved in morphogenesis 12 0.026798874 0.003567287 GO:0040012~regulation of locomotion 22 0.04913127 0.00359736 GO:0036294~cellular response to decreased oxygen levels 8 0.017865916 0.003952064 GO:0048661~positive regulation of smooth muscle cell proliferation 6 0.013399437 0.004210588 GO:0045595~regulation of cell differentiation 36 0.080396623 0.004496237 GO:0048731~system development 81 0.180892403 0.00461491 GO:0007275~multicellular organism development 90 0.200991558 0.004728177 GO:2000145~regulation of cell motility 21 0.04689803 0.004801563 GO:0061564~axon development 15 0.033498593 0.005109028 GO:0003158~endothelium development 7 0.015632677 0.005314989 GO:0048667~cell morphogenesis involved in neuron differentiation 16 0.035731833 0.00544074 GO:0044782~cilium organization 10 0.022332395 0.005609391 GO:0001558~regulation of cell growth 14 0.031265354 0.005638907 GO:0071453~cellular response to oxygen levels 8 0.017865916 0.005761929 GO:0033036~macromolecule localization 57 0.127294654 0.005795219 GO:0051270~regulation of cellular component movement 22 0.04913127 0.005896202 GO:0055001~muscle cell development 8 0.017865916 0.005972139 GO:0006334~nucleosome assembly 8 0.017865916 0.006188028 GO:0040008~regulation of growth 19 0.042431551 0.006254799 GO:0031503~protein complex localization 7 0.015632677 0.006301195 GO:0016477~cell migration 29 0.064763947 0.006304543 GO:0001525~angiogenesis 14 0.031265354 0.006851297 GO:0030307~positive regulation of cell growth 8 0.017865916 0.006870696 GO:0044707~single-multicellular organism process 105 0.234490151 0.007287762 GO:0042073~intraciliary transport 4 0.008932958 0.007339119 GO:0050804~modulation of synaptic transmission 11 0.024565635 0.007370434 GO:0044085~cellular component biogenesis 58 0.129527893 0.007496506 GO:0031344~regulation of cell projection organization 17 0.037965072 0.008591752 GO:0051128~regulation of cellular component organization 48 0.107195498 0.0086943 GO:0044843~cell cycle G1/S phase transition 10 0.022332395 0.008836564 GO:0033280~response to vitamin D 4 0.008932958 0.008906488 GO:0048870~cell motility 31 0.069230426 0.009048157 GO:0051674~localization of cell 31 0.069230426 0.009048157 GO:0055013~cardiac muscle cell development 5 0.011166198 0.009581001 GO:0032965~regulation of collagen biosynthetic process 4 0.008932958 0.009757878 GO:0000280~nuclear division 17 0.037965072 0.010198904 GO:0031497~chromatin assembly 8 0.017865916 0.010485157 GO:0016049~cell growth 14 0.031265354 0.010488401 GO:0009888~tissue development 38 0.084863102 0.01103356 GO:0014070~response to organic cyclic compound 23 0.051364509 0.011255548 GO:0055006~cardiac cell development 5 0.011166198 0.011399828 GO:0007163~establishment or maintenance of cell polarity 8 0.017865916 0.011484514 GO:0048514~blood vessel morphogenesis 15 0.033498593 0.011592269 GO:0002823~negative regulation of adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains 4 0.008932958 0.011598466 GO:0061512~protein localization to cilium 4 0.008932958 0.011598466 GO:0032496~response to lipopolysaccharide 11 0.024565635 0.012127601 GO:0044236~multicellular organism metabolic process 7 0.015632677 0.012432782 GO:0048638~regulation of developmental growth 11 0.024565635 0.012504258 GO:0008361~regulation of cell size 8 0.017865916 0.012553345 GO:0060249~anatomical structure homeostasis 12 0.026798874 0.013254969 GO:0006310~DNA recombination 10 0.022332395 0.013615344 GO:0006270~DNA replication initiation 4 0.008932958 0.01362542 GO:0006935~chemotaxis 16 0.035731833 0.013764624 GO:0042330~taxis 16 0.035731833 0.014123757 GO:0010942~positive regulation of cell death 17 0.037965072 0.014411014 GO:0034728~nucleosome organization 8 0.017865916 0.014474194 GO:0002820~negative regulation of adaptive immune response 4 0.008932958 0.01470959 GO:0006809~nitric oxide biosynthetic process 5 0.011166198 0.014898113 GO:0007423~sensory organ development 15 0.033498593 0.015021747 GO:0048518~positive regulation of biological process 93 0.207691277 0.015433618 GO:0045664~regulation of neuron differentiation 16 0.035731833 0.015537513 GO:0048167~regulation of synaptic plasticity 7 0.015632677 0.015675603 GO:0000082~G1/S transition of mitotic cell cycle 9 0.020099156 0.015781056 GO:0032964~collagen biosynthetic process 4 0.008932958 0.015841229 GO:0022008~neurogenesis 32 0.071463665 0.015885344 GO:0042493~response to drug 13 0.029032114 0.015988285 GO:0002237~response to molecule of bacterial origin 11 0.024565635 0.016252433 GO:0007017~microtubule-based process 17 0.037965072 0.01687616 GO:0030182~neuron differentiation 28 0.062530707 0.01736948 GO:0010976~positive regulation of neuron projection development 9 0.020099156 0.017781039 GO:0048285~organelle fission 17 0.037965072 0.017922038 GO:0046209~nitric oxide metabolic process 5 0.011166198 0.018136045 GO:0030031~cell projection assembly 13 0.029032114 0.018202294 GO:0043065~positive regulation of apoptotic process 16 0.035731833 0.018363153 GO:0048588~developmental cell growth 8 0.017865916 0.01899832 GO:0042226~interleukin-6 biosynthetic process 3 0.006699719 0.019045059 GO:0002710~negative regulation of T cell mediated immunity 3 0.006699719 0.019045059 GO:0040017~positive regulation of locomotion 13 0.029032114 0.019282791 GO:0032200~telomere organization 7 0.015632677 0.019462207 GO:0050767~regulation of neurogenesis 18 0.040198312 0.019551924 GO:0043068~positive regulation of programmed cell death 16 0.035731833 0.019724936 GO:0048699~generation of neurons 30 0.066997186 0.020045142 GO:0048513~animal organ development 59 0.131761133 0.020275525 GO:0065004~protein-DNA complex assembly 9 0.020099156 0.020370656 GO:0048659~smooth muscle cell proliferation 6 0.013399437 0.020454409 GO:0006333~chromatin assembly or disassembly 8 0.017865916 0.020498805 GO:0032963~collagen metabolic process 6 0.013399437 0.021186179 GO:0008104~protein localization 48 0.107195498 0.021240691 GO:0010605~negative regulation of macromolecule metabolic process 46 0.102729019 0.02144402 GO:0006936~muscle contraction 11 0.024565635 0.021550285 GO:0045408~regulation of interleukin-6 biosynthetic process 3 0.006699719 0.021562365 GO:2001057~reactive nitrogen species metabolic process 5 0.011166198 0.021779917 GO:2000026~regulation of multicellular organismal development 36 0.080396623 0.021780459 GO:0007067~mitotic nuclear division 13 0.029032114 0.022199197 GO:0051290~protein heterotetramerization 4 0.008932958 0.022217163 GO:0045596~negative regulation of cell differentiation 17 0.037965072 0.022448146 GO:0001654~eye development 11 0.024565635 0.022807533 GO:0051240~positive regulation of multicellular organismal process 31 0.069230426 0.022922799 GO:0061061~muscle structure development 16 0.035731833 0.023195553 GO:0048660~regulation of smooth muscle cell proliferation 6 0.013399437 0.023483223 GO:0033993~response to lipid 21 0.04689803 0.02349163 GO:0043010~camera-type eye development 10 0.022332395 0.023571627 GO:0007010~cytoskeleton organization 26 0.058064228 0.023616543 GO:0045103~intermediate filament-based process 4 0.008932958 0.0236365 GO:0034080~CENP-A containing nucleosome assembly 4 0.008932958 0.0236365 GO:0061641~CENP-A containing chromatin organization 4 0.008932958 0.0236365 GO:1904407~positive regulation of nitric oxide metabolic process 4 0.008932958 0.0236365 GO:0045429~positive regulation of nitric oxide biosynthetic process 4 0.008932958 0.0236365 GO:0000904~cell morphogenesis involved in differentiation 19 0.042431551 0.024193528 GO:0051726~regulation of cell cycle 23 0.051364509 0.024237295 GO:0051239~regulation of multicellular organismal process 51 0.113895216 0.024828368 GO:0032879~regulation of localization 48 0.107195498 0.024991753 GO:0022612~gland morphogenesis 6 0.013399437 0.025100594 GO:0044259~multicellular organismal macromolecule metabolic process 6 0.013399437 0.025100594 GO:0008285~negative regulation of cell proliferation 17 0.037965072 0.025833371 GO:0045927~positive regulation of growth 9 0.020099156 0.025958151 GO:0009612~response to mechanical stimulus 8 0.017865916 0.026249659 GO:0060271~cilium morphogenesis 9 0.020099156 0.02651297 GO:0070925~organelle assembly 17 0.037965072 0.026516698 GO:2000273~positive regulation of receptor activity 4 0.008932958 0.026619372 GO:0051054~positive regulation of DNA metabolic process 8 0.017865916 0.026816275 GO:0002456~T cell mediated immunity 5 0.011166198 0.026922701 GO:0044770~cell cycle phase transition 15 0.033498593 0.027000697 GO:0051179~localization 100 0.223323954 0.02745736 GO:0030335~positive regulation of cell migration 12 0.026798874 0.027924408 GO:0043044~ATP-dependent chromatin remodeling 5 0.011166198 0.028031039 GO:0048522~positive regulation of cellular process 83 0.185358882 0.028164866 GO:0051146~striated muscle cell differentiation 9 0.020099156 0.028262281 GO:0044711~single-organism biosynthetic process 29 0.064763947 0.028622315 GO:0060560~developmental growth involved in morphogenesis 8 0.017865916 0.028702768 GO:0006323~DNA packaging 8 0.017865916 0.028702768 GO:0042384~cilium assembly 8 0.017865916 0.029406116 GO:0051145~smooth muscle cell differentiation 4 0.008932958 0.029794004 GO:0031055~chromatin remodeling at centromere 4 0.008932958 0.029794004 GO:0050793~regulation of developmental process 42 0.093796061 0.029818898 GO:0035994~response to muscle stretch 3 0.006699719 0.029874959 GO:0031346~positive regulation of cell projection organization 10 0.022332395 0.031746829 GO:0031667~response to nutrient levels 12 0.026798874 0.032016605 GO:0071496~cellular response to external stimulus 9 0.020099156 0.032455138 GO:0003012~muscle system process 12 0.026798874 0.03245856 GO:0006939~smooth muscle contraction 5 0.011166198 0.032733762 GO:0060445~branching involved in salivary gland morphogenesis 3 0.006699719 0.032885672 GO:0045931~positive regulation of mitotic cell cycle 6 0.013399437 0.033255164 GO:0051130~positive regulation of cellular component organization 26 0.058064228 0.03353744 GO:0032846~positive regulation of homeostatic process 8 0.017865916 0.033596781 GO:0051276~chromosome organization 26 0.058064228 0.033827986 GO:1903409~reactive oxygen species biosynthetic process 5 0.011166198 0.033977166 GO:0034613~cellular protein localization 33 0.073696905 0.034051786 GO:2000147~positive regulation of cell motility 12 0.026798874 0.034356442 GO:1903428~positive regulation of reactive oxygen species biosynthetic process 4 0.008932958 0.034913148 GO:0001503~ossification 11 0.024565635 0.035217559 GO:0033273~response to vitamin 5 0.011166198 0.035247776 GO:0045666~positive regulation of neuron differentiation 10 0.022332395 0.035385495 GO:0071824~protein-DNA complex subunit organization 9 0.020099156 0.035761074 GO:0044706~multi-multicellular organism process 8 0.017865916 0.035837479 GO:0036499~PERK-mediated unfolded protein response 3 0.006699719 0.036009684 GO:2000379~positive regulation of reactive oxygen species metabolic process 5 0.011166198 0.036545634 GO:0007584~response to nutrient 7 0.015632677 0.037024505 GO:0007062~sister chromatid cohesion 6 0.013399437 0.037351361 GO:0070727~cellular macromolecule localization 33 0.073696905 0.037460661 GO:0060284~regulation of cell development 20 0.044664791 0.037571033 GO:0048640~negative regulation of developmental growth 5 0.011166198 0.037870774 GO:0070482~response to oxygen levels 10 0.022332395 0.037880536 GO:0051301~cell division 15 0.033498593 0.038196326 GO:0007166~cell surface receptor signaling pathway 50 0.111661977 0.038349626 GO:0002709~regulation of T cell mediated immunity 4 0.008932958 0.038561758 GO:0030334~regulation of cell migration 17 0.037965072 0.03909381 GO:0010977~negative regulation of neuron projection development 6 0.013399437 0.039510521 GO:0034976~response to endoplasmic reticulum stress 9 0.020099156 0.040178655 GO:0051272~positive regulation of cellular component movement 12 0.026798874 0.040187278 GO:0030239~myofibril assembly 4 0.008932958 0.04045608 GO:0030282~bone mineralization 5 0.011166198 0.040602982 GO:0071216~cellular response to biotic stimulus 7 0.015632677 0.040725246 GO:0034097~response to cytokine 19 0.042431551 0.041005413 GO:0006461~protein complex assembly 30 0.066997186 0.041096168 GO:0070271~protein complex biogenesis 30 0.066997186 0.041405892 GO:0072593~reactive oxygen species metabolic process 8 0.017865916 0.041410083 GO:0007411~axon guidance 8 0.017865916 0.042275725 GO:0034508~centromere complex assembly 4 0.008932958 0.0423967 GO:0006336~DNA replication-independent nucleosome assembly 4 0.008932958 0.0423967 GO:0071295~cellular response to vitamin 3 0.006699719 0.042582316 GO:0032967~positive regulation of collagen biosynthetic process 3 0.006699719 0.042582316 GO:0070374~positive regulation of ERK1 and ERK2 cascade 7 0.015632677 0.042617266 GO:0097485~neuron projection guidance 8 0.017865916 0.043130576 GO:0031214~biomineral tissue development 6 0.013399437 0.04405304 GO:0045428~regulation of nitric oxide biosynthetic process 4 0.008932958 0.044383303 GO:0034724~DNA replication-independent nucleosome organization 4 0.008932958 0.044383303 GO:0007155~cell adhesion 34 0.075930144 0.044759476 GO:0007018~microtubule-based movement 8 0.017865916 0.044958581 GO:0007612~learning 6 0.013399437 0.045235614 GO:0010714~positive regulation of collagen metabolic process 3 0.006699719 0.046023507 GO:0044253~positive regulation of multicellular organismal metabolic process 3 0.006699719 0.046023507 GO:0051150~regulation of smooth muscle cell differentiation 3 0.006699719 0.046023507 GO:0022610~biological adhesion 34 0.075930144 0.046622302 GO:0032501~multicellular organismal process 115 0.256822547 0.048610966 GO:0048545~response to steroid hormone 11 0.024565635 0.048787954 GO:0009892~negative regulation of metabolic process 47 0.104962258 0.048817284 GO:0051262~protein tetramerization 6 0.013399437 0.048896489 GO:0009991~response to extracellular stimulus 12 0.026798874 0.049395418 GO:0021537~telencephalon development 8 0.017865916 0.049468725 GO term enriched in siDDX3-upregulated genes Count % PValue GO:0007183~SMAD protein complex assembly 3 0.006617112 0.011393157 GO:0032480~negative regulation of type I interferon production 4 0.008822816 0.014083648 GO:0031098~stress-activated protein kinase signaling cascade 9 0.019851336 0.015885804 GO:0031333~negative regulation of protein complex assembly 6 0.013234224 0.016162715 GO:0010038~response to metal ion 10 0.02205704 0.017025807 GO:0048518~positive regulation of biological process 83 0.183073428 0.017027103 GO:0046597~negative regulation of viral entry into host cell 3 0.006617112 0.021439557 GO:0006879~cellular iron ion homeostasis 4 0.008822816 0.022907276 GO:0010954~positive regulation of protein processing 3 0.006617112 0.023764401 GO:0006796~phosphate-containing compound metabolic process 52 0.114696605 0.023860845 GO:0006793~phosphorus metabolic process 52 0.114696605 0.024661591 GO:0070676~intralumenal vesicle formation 2 0.004411408 0.02520907 GO:0034395~regulation of transcription from RNA polymerase II promoter in response to iron 2 0.004411408 0.02520907 GO:1903319~positive regulation of protein maturation 3 0.006617112 0.026187534 GO:1990267~response to transition metal nanoparticle 6 0.013234224 0.026553692 GO:0071704~organic substance metabolic process 150 0.330855593 0.033103358 GO:0016310~phosphorylation 39 0.086022454 0.034151821 GO:0051403~stress-activated MAPK cascade 8 0.017645632 0.03497904 GO:0016567~protein ubiquitination 17 0.037496967 0.036431214 GO:0032147~activation of protein kinase activity 9 0.019851336 0.036474342 GO:0046835~carbohydrate phosphorylation 3 0.006617112 0.036806912 GO:0010035~response to inorganic substance 12 0.026468447 0.037292096 GO:0045860~positive regulation of protein kinase activity 12 0.026468447 0.037751118 GO:0006821~chloride transport 5 0.01102852 0.039669569 GO:0031281~positive regulation of cyclase activity 4 0.008822816 0.042333888 GO:0048522~positive regulation of cellular process 73 0.161016388 0.04315811 GO:0043549~regulation of kinase activity 17 0.037496967 0.043419412 GO:0016236~macroautophagy 7 0.015439928 0.045050307 GO:0045859~regulation of protein kinase activity 16 0.035291263 0.045545234 GO:0060255~regulation of macromolecule metabolic process 87 0.191896244 0.045577949 GO:0046596~regulation of viral entry into host cell 3 0.006617112 0.045669621

Supplementary Table S5. List of upstream transcription factors potentially involved in DDX3-regulated genes predicted by IPA software. Upstream Regulator Expr Log Ratio Predicted Activation State Activation z-score p-value of overlap ATF4 -0.873 Inhibited -3.249 0.000218 YAP1 0.336 Inhibited -2.615 0.000188 CCND1 -0.234 Inhibited -2.543 0.00645 SMARCA4 0.355 Inhibited -2.279 0.0000759 FOXO1 0.133 Inhibited -2.037 0.00242 ASXL1 0.102 Inhibited -2 0.016 ZNF217 0.129 Activated 2 0.0119 DACH1 Activated 2 0.0175 MEOX2 Activated 2.236 0.00346 CDKN2A 0.162 Activated 3.037 0.000316

Supplementary Table S6. Percentages of siDDX3-downregulated, DDX3-upregulated or non-target genes overlapping with uTIS or non-uTIS genes from TIS-db or with uORF-containing genes from uORFdb. Asterisk indicates p<0.05 by using chi-square test (siDDX3- downregulated or non-target vs siDDX3-upregulated). TIS-db uORFdb uTIS 2358 genes non-uTIS 2050 genes 111 genes siDDX3-downregulated 300 genes 19.7% (59/300)* 10.7% (32/300) 2% (6/300) siDDX3-upregulated 247 genes 7.7% (19/247) 8.9% (22/247) 0.8% (2/247) Non-target 377 genes 11.9% (45/377) 11.4% (43/377) 0.5% (2/377)

Supplementary Table S7. Percentages of CBP20 CLIPs or eIF3 CLIPs overlapping with DDX3 CLIPs or eIF4A3 CLIPs. Asterisks indicates p<0.0001 by using one sample t-test for testing equal proportion (DDX3 vs eIF4A3).

Supplementary Table S8. Percentages of DDX3 CLIPs, CBP20 CLIPs, eIF3 CLIPs or eIF4A3 CLIPs overlapping with uTIS or non-uTIS genes from TIS-db. eIF4A3-DDX3 and DDX3- eIF4A3 represents eIF4A3-specific CLIPs and DDX3-specific CLIPs, respectively. Asterisks and double asterisks indicates p<0.05 and p<0.001 by using chi-square test of independence (DDX3, CBP20 or eIF3 vs eIF4A3; DDX3-eIF4A3 vs eIF4A3- DDX3).