Supplementary Data Figure S1. DDX3 expression is correlated with cell invasive activity and ATF4 expression. A, The protein lysates collected from confluent OECM1 and SAS cells were subjected to immunoblotting analysis; 3 batches of each line (upper panel) and the average intensity of DDX3/actin (lower panel) are shown. B, Cell growth (left panels) and Boydem chamber (up and right panels) assays of OECM1 cells transfected with indicated siRNAs. C, Boyden chamber assays of OECM1 cells transfected with the empty or FLAG-DDX3 expression vector. D, SAS and OECM1 cells were subjected to 3D invasion assay. Phase images were taken as indicated days after adding Matrigel. E, Representative images of primary tumors (tongue) and metastases (lymph node) in orthotopic OSCC models were taken by using the IVIS system. F, SAS/Luc2 cells isolated from lymph node (Meta) were cultured, and lysates from confluent parental (left lane) and meta SAS/Luc2 were subjected to immunoblotting analysis. G, SAS cells stably transfected with tetracycline-inducible shRNAs were treated with 2 µg/ml doxycyline for 5 days, and cell lysates were collected and subjected to immunoblotting analysis. H, SAS cells were incubated with AAV-shC or shD for 4 days, and cell lysates were collected and subjected to immunoblotting analysis. I, Tumor lysates from Fig. 2G were subjected to immunoblotting. Figure S2. Microarray-identified genes are enriched for pro-metastatic genes and ATF4 targets, and DDX3 is required for migration and ATF4 expression in all of the HNSCC cell lines examined. A, The log2 values of siD#1/siC obtained from two independent microarrays were plotted as a chart. Correlation coefficient (R) is labeled. B, Gene ontology analysis identified the top 10 biological processes that were enriched in downregulated or upregulated genes in DDX3 knockdown SAS cells according to p- value. C, Cellular functions and diseases that were negatively (–) or positively (+) affected by DDX3 knockdown, as predicted with Ingenuity Pathways Analysis. D, RT-qPCR analysis of known ATF4 target genes in siRNA-transfected OECM1 cells. E, Indicated cell lines were transfected with siC or siD#1 for 72 hours. The lysates were subjected to immunoblotting analysis. F, Indicated cell lines transfected as in panel E were subjected to Boyden chamber assays. Bar graph shows the relative migration efficiency (siD#1 vs. siC) of analyzed cell lines. Figure S3. DDX3 and ATF4 are required for EMT gene expression. A, shRNA vector- transfected SAS cells were subjected to the Boyden chamber (left) and 3D invasion (right) assays. Experiments were repeated three times to obtain mean ± SD. B, Immunoblotting of EMT-related proteins was analyzed in SAS cells transfected with indicated siRNA for 48 hours or shRNA for 72 hours. C, Immunfluorescence staining of E-cadherin and Vimentin in SAS cells transfected with control or 3 different DDX3 siRNAs for 48 hours. Figure S4. DDX3 does not regulate ATF4 protein stability. SAS cells transfected with siRNA for 48 hours were treated with MG132 for 4 hours and subsequently with cycloheximide for indicated time. Immunoblotting was performed using antibodies against indicated proteins. Figure S5. DDX3 regulate ATF4 translation independent of ER Stress. A, SAS cells transfected with siRNA for 48 hours and subsequently treated with Thapsigargin for 2 hours. Cell lysates were subjected to immunoblotting using antibodies against indicated proteins. B, In vivo translation assay was performed in SAS cells that were transfected with the ATF4-RL reporter and indicated vectors for 48 hours followed by Thapsigargin treatment for 6 hours. Bar graph shows relative luciferase activity as calculated in Figure 5; mean ± SD was obtained from 3 repeated experiments. Figure S6. The DDX3/CBC/eIF3 complex directly activates the translation of uORF-containing mRNAs in vitro and in vivo. A, In vitro transcribed mRNAs (RL or ATF4-RL) were each incubated with the SAS cell extract containing or not containing GST-DDX3 for 1 hour. The Renilla luciferase activity was subsequently measured. B, SAS cells were initially transfected with indicated shRNA-expressing vectors for 72 hours and then transfected with in vitro transcribed control (RL) or uORF-containing (ATF4, ATF5, DDIT3, CEBPA or ETV1) mRNA for 1 hour. The cell lysates were then collected for Renilla luciferase assay. C, Cells treated as in panel B were subjected to RT-qPCR analysis. Figure S7. RT-qPCR analysis of luciferase mRNAs in the in vivo translation assay. A-F, RT- qPCR analysis of Fig. 4D and F-J. G, Cell transfected with indicated reporters were subjected to RT-qPCR analysis. Figure S8. The CBC and eIF3 complexes are involved in the translation of uORF-containing mRNAs. A, The Venn diagrams shows unique or overlapped 5’ UTR CLIP tags among DDX3, eIF4A3 and CBP20 (left) and among DDX3, eIF4A3 and eIF3 (right). The numbers of DDX3-specific and eIF4A3-specific CLIP tags overlapping with CBP20 (left) or eIF3 (right) are labeled as blue and red, respectively. B, The Venn diagrams shows unique or overlapped 5’ UTR CLIP tags among DDX3, eIF3 and CBP20. The percentages of CLIP tags overlapping with uTIS and non-uTIS uTIS and non-uTIS containing genes retrieved from TISdb are labeled. C, RT-qPCR analysis of Fig. 5D. D, SAS cells transfected with indicated shRNA were subjected to immunoblotting. E, SAS cells transfected with indicated shRNA were subjected to immunoblotting. F, In vivo translation assay of indicated reporters cotransfected with indicated shRNAs for 48 hours. G, In vivo translation assay was performed in SAS cells that were initially transfected with the indicated shRNA vectors for 48 hours followed by the indicated overexpression vectors and the ATF4 reporter for further 24 hours. For panels E and F, relative luciferase activity was calculated as described in Figure 5. Supplementary Table S1. List of sense shRNA or siRNA sequences. shRNA/siRNA Sense sequence shC GCUUCUACCAAAUACACUUGA shD GAAACAUUGAGCUUACUCGUU shATF4 GAAAGCCUAGGUCUCUUAGAU shCBP20 GGAUGAGUAUCGGCAGGACUA shCBP80 GGUGCGACGAGAUUGGUAUGU sheIF3g GUGACAGAGUACAAGAUAGAU sheIF3i GGAGAGCUCAACCAGUAUAGU Tet-shC CUUCGAAAUGUCCGUUCGGUU Tet-shD#1 GACCUGAACUCUUCAGAUA Tet-shD#2 CGCUUGGAACAGGAACUCUUU siC GCGCUUCUACCAAAUACACUUGAUA siD#1 CCUAGACCUGAACUCUUCAGAUAAU siD#2 GGGAGAAAUUAUCAUGGGAAACAUU siD#3 CACCAACGAGAGAGUUGGCAGUACA Supplementary Table S2. Univariate and multivariate cox regression analyses in HNSCC patient samples. Supplementary Table S3. List of genes that showed more than two-fold changes upon DDX3 knockdown. ProbeName Exp1 Exp2 Average GeneSymbol A_33_P3672756 -3.2457285 -3.1393843 -3.1925564 LOC284561 A_24_P126060 -3.16082 -2.8644743 -3.01264715 DDX3X A_23_P19663 -2.6272717 -3.0723238 -2.84979775 CTGF A_22_P00014730 -2.6604695 -2.8590827 -2.7597761 lnc-SLC2A4RG-1 A_33_P3323959 -2.618907 -2.7437034 -2.6813052 RELN A_23_P381102 -2.5932717 -2.7077975 -2.6505346 CCDC74B A_24_P250922 -2.7136197 -2.5842419 -2.6489308 PTGS2 A_23_P69030 -2.7204385 -2.5039654 -2.61220195 COL8A1 A_23_P409093 -2.4106035 -2.4617586 -2.43618105 ANO4 A_19_P00315452 -2.2802095 -2.4505363 -2.3653729 LOC100130938 A_22_P00006060 -2.3473585 -2.3487363 -2.3480474 lnc-FAM131B-1 A_33_P3257297 -2.4315958 -2.2441187 -2.33785725 CFAP58 A_23_P2857 -2.2206445 -2.4522054 -2.33642495 CCDC70 A_23_P413157 -2.6971874 -1.9361424 -2.3166649 CXorf58 A_23_P121064 -2.275794 -2.3201835 -2.29798875 PTX3 A_23_P147786 -2.3058267 -2.239805 -2.27281585 RIMS2 A_19_P00321743 -2.193635 -2.274543 -2.234089 LOC100130938 A_24_P200219 -2.312551 -2.0688639 -2.19070745 UPK1B A_24_P391230 -2.189209 -2.1288314 -2.1590202 CYYR1 A_23_P323801 -1.7217016 -2.4646688 -2.0931852 BEST3 A_22_P00000938 -1.9366587 -2.1961193 -2.066389 LINC00704 A_19_P00322533 -2.08633 -2.022108 -2.054219 CRNDE A_33_P3379381 -2.0799832 -2.0108426 -2.0454129 WDR78 A_23_P326020 -2.1263115 -1.94181 -2.03406075 CSMD3 A_21_P0014483 -2.1743498 -1.8527889 -2.01356935 FGD5-AS1 A_22_P00008272 -1.9366459 -2.0696526 -2.00314925 CRNDE A_22_P00011688 -1.7390351 -2.1885347 -1.9637849 PDGFRB A_33_P3419190 -1.9389725 -1.987857 -1.96341475 AREG A_23_P405878 -1.908002 -2.0068078 -1.9574049 C12orf54 A_23_P259071 -1.9079303 -1.9981002 -1.95301525 AREG A_22_P00023317 -1.8614713 -2.040125 -1.95079815 LINC01468 A_23_P28834 -1.9107575 -1.9524698 -1.93161365 PHACTR3 A_22_P00008144 -2.3607192 -1.4584756 -1.9095974 LOC101927841 A_23_P102037 -2.0481038 -1.7292266 -1.8886652 COQ10B A_24_P709377 -1.8542476 -1.8928032 -1.8735254 PAX8-AS1 A_23_P145529 -1.781932 -1.9212033 -1.85156765 PKIB A_21_P0006938 -1.6937836 -2.0082424 -1.851013 LOC101927435 A_33_P3286873 -2.0457375 -1.6438757 -1.8448066 CD247 A_19_P00802607 -1.7883825 -1.8810377 -1.8347101 lnc-HK2-1 A_33_P3339070 -1.691214 -1.9489719 -1.82009295 LINC00704 A_22_P00000428 -1.9464568 -1.6747723 -1.81061455 lnc-AC073263.1-2 A_21_P0001880 -1.7863463 -1.8343409 -1.8103436 LINC01293 A_23_P104438 -1.7556653 -1.8254089 -1.7905371 MYPN A_22_P00010577 -1.8206011 -1.7209879 -1.7707945 RBM26-AS1 A_22_P00009085 -1.6835133 -1.836864 -1.76018865 LOC100507006 A_33_P3353051 -1.8678111 -1.6140289 -1.74092 C6orf48 A_24_P299474 -1.819312 -1.6609211 -1.74011655 TENM2 A_23_P48339 -1.9330316 -1.5418372 -1.7374344 IFT88 A_24_P137897 -1.7275401 -1.7334242 -1.73048215 IFRD1 A_33_P3279847 -1.8562082 -1.5746613 -1.71543475 RAET1E A_24_P88696 -1.6541246 -1.7635082 -1.7088164 SCG2 A_21_P0009321 -1.6703386 -1.7080823 -1.68921045 LOC101929494 A_33_P3242952 -1.784726 -1.5831519 -1.68393895 FAM72A A_23_P323563 -1.7429676 -1.6167072 -1.6798374 PLEKHG2 A_32_P148796