(12) United States Patent (10) Patent No.: US 8,969,289 B2 Gosselin Et Al

US008969289B2

(12) United States Patent (10) Patent No.: US 8,969,289 B2 Gosselin et al. (45) Date of Patent: Mar. 3, 2015

(54) SERUMALBUMIN BINDING MOLECULES 6,518,018 B1 2/2003 Szostalk et al. 6,559,126 B2 5/2003 Tournaire et al. 6,660,492 B1 12/2003 Bode et al. (75) Inventors: Michael L. Gosselin, Boston, MA (US); 6,818,418 B1 1 1/2004 Lipovsek et al. David Fabrizio, Swampscott, MA (US); 7,115,396 B2 10/2006 Lipovsek et al. Joanna F. Swain, Concord, MA (US); 7,556,925 B2 7/2009 Koide et al. Tracy Mitchell, Billerica, MA (US); 7,598.352 B2 10/2009 Koide Ray Camphausen, Wayland, MA (US); 7,847,062 B2 12/2010 Chen et al. 7,858,739 B2 12/2010 Chen et al. Sharon T. Cload, Cambridge, MA (US); 8,067.201 B2 11/2011 Morin et al. Eric Furfine, Concord, MA (US); Paul 8,221,765 B2 7/2012 Camphausen et al. E. Morin, Pennington, NJ (US); Ranjan 8,258.265 B2 9/2012 Koide Mukherjee, Churchville, PA (US); 8,263,741 B2 9/2012 Koide Simeon I. Taylor, Skillman, NJ (US) 8,278.419 B2 10/2012 Jacobs et al. 8.293.482 B2 10/2012 Jacobs et al. 8.420,098 B2 * 4/2013 Camphausen et al...... 424,185.1 (73) Assignee: Bristol-Myers Squibb Company, 8,470,332 B2 * 6/2013 Camphausen et al...... 424,185.1 Princeton, NJ (US) 8,524.244 B2 * 9/2013 Camphausen et al...... 424,185.1 2002fOO19517 A1 2/2002 Koide (*) Notice: Subject to any disclaimer, the term of this 2002fOO61307 A1 5, 2002 Whitlow et al. 2003. O104520 A1 6/2003 Ellington et al. patent is extended or adjusted under 35 2003/0170753 A1 9, 2003 Koide U.S.C. 154(b) by 600 days. 2003. O186385 A1 10, 2003 Koide 2005/0255548 A1 1 1/2005 Lipovsek et al. (21) Appl. No.: 13/098,851 2007/0071675 A1 3, 2007 Wu et al. 2007/O160533 A1 7/2007 Chen et al. (22) Filed: May 2, 2011 2008.0193445 A1 8, 2008 Goetsch et al. 2008, 0220049 A1 9, 2008 Chen et al. 2009,0176654 A1 7/2009 Cappuccilli et al. (65) Prior Publication Data 2010, O144601 A1 6/2010 Jacobs et al. US 2011/0305663 A1 Dec. 15, 2011 (Continued) Related U.S. Application Data FOREIGN PATENT DOCUMENTS (60) Provisional application No. 61/330,672, filed on May CA 2293632 A1 12, 1998 3, 2010. DE 19646372 C1 6, 1997 (51) Int. Cl. (Continued) C07K I4/00 (2006.01) OTHER PUBLICATIONS A6 IK 47/48 (2006.01) CI2N 5/62 (2006.01) Keefe, Anthony D. et al., “Functional proteins from a random-se C07K 4/78 (2006.01) quence library.” Nature, vol. 410:715–718 (2001). A61 K38/00 (2006.01) King, Catherine A. et al. “DNA vaccines with single-chain Fv fused (52) U.S. Cl. to fragment C of tetanus toxin induce protective immunity against CPC ...... C07K 14/78 (2013.01); A61K 47/48238 lymphoma and myeloma,” Nature Medicine, vol. 4(11): 1281-1286 (2013.01): CI2N 15/62 (2013.01); A61 K38/00 (1998). (2013.01); A61 K47/48284 (2013.01) Kohler, G. et al., “Continuous cultures of fused cells Secreting anti USPC ...... 514/2:530/300: 530/350 body of predefined specificity.” Nature, vol. 256:495-497 (1975). Koide, Akiko et al., “Stabilization of a Fibronectin Type III Domain (58) Field of Classification Search by the Removal of Unfavorable Electrostatic Interactions on the None Protein Surface.” Biochemistry, vol. 40: 10326-10333 (2001). See application file for complete search history. (Continued) (56) References Cited U.S. PATENT DOCUMENTS Primary Examiner — Anand Desai (74) Attorney, Agent, or Firm — Nelson Mullins Riley & 5,235,041 A 8/1993 Cappello et al. Scarborough LLP; Jane E. Remillard, Esq.; Cynthia L. Kanik 5,514,581 A 5, 1996 Ferrarietal. 5,545,620 A 8, 1996 Wahl et al. 5,641,648 A 6, 1997 Ferrarietal. 5,770,697 A 6, 1998 Ferrarietal. (57) ABSTRACT 5,792,742 A 8, 1998 Gold et al. 6,018,030 A 1/2000 Ferrari et al. The present invention relates to an antibody-like protein 6,207,446 B1 3, 2001 SZostalk et al. based on the tenth fibronectin type III domain ('Fn3) that 6,214,553 B1 4/2001 Szostak et al. binds to serum albumin. The invention further relates to 6,258,558 B1 7/2001 SZostalk et al. fusion molecules comprising a serum albumin-binding "Fn3 6,261,804 B1 7/2001 SZostalk et al. 6,281,344 B1 8, 2001 SZOstalk et al. joined to a heterologous protein for use in diagnostic and 6,316,412 B1 1 1/2001 Ginsberg et al. therapeutic applications. 6,342,219 B1 1/2002 Thorpe et al. 6,383,775 B1 5, 2002 Duffet al. 6,462,189 B1 10/2002 Koide 33 Claims, 22 Drawing Sheets US 8,969,289 B2 Page 2

(56) References Cited WO 2011 (O35202 A2 3, 2011 WO 2011/051333 A1 5, 2011 U.S. PATENT DOCUMENTS WO 2011/051466 A1 5, 2011 WO 2011/092233 A1 8, 2011 2010/0152063 A1 6/2010 Cappuccilli et al. WO 2011/100700 A2 8, 2011 2010/0273216 A1 10, 2010 Morin et al. WO 2011 (103105 A1 8, 2011 2010, O298.541 A1 11, 2010 Wu et al. WO 2011/130324 A1 10, 2011 WO 2011/130328 A1 10, 2011 2011, 0021746 A1 1/2011 Cappuccilli et al. WO 2011/130354 A1 10, 2011 2011/0038866 A1 2/2011 Hastewell et al. WO 2011 137319 A2 11/2011 2011/01235.45 Al 52011 Marsh et al. WO 2011, 140.086 A2 11/2011 2011/O124527 A1 5/2011 Cappuccilli et al. WO 2011 150 133 A2 12/2011 2011/0275535 A1 11, 2011 Loew WO 2012/016245 A2 2/2012 2012/0208704 A1 8, 2012 Loew et al. WO 2012,088006 A1 6, 2012 2012/0270797 A1 10/2012 Wittrup et al. WO 2012/142515 A2 10/2012 2013,007.9243 A1 3, 2013 Diem et al. WO 2012/158678 A1 11, 2012 WO 2012/158739 A1 11/2012 FOREIGN PATENT DOCUMENTS WO 2013/049275 A1 4, 2013 OTHER PUBLICATIONS EP O962527 A1 12/1999 EP O985O39 B1 3, 2000 Koide, Akiko et al., “The FibronectinType III Domain as a Scaffold EP 1137941 B1 10, 2001 for Novel Binding Proteins.” J. Mol. Biol., vol. 284:1141-1151 EP 1266O25 B1 12/2002 (1998). EP 1477.561 B1 11, 2004 Koide, Shohei et al., “Directed Evolution of Fibronectin Type III EP 2141243 A2 1, 2010 Domain to Novel Ligand Binding Proteins.” FASEB J., vol. 11 (9 EP 2379.718 B1 10, 2011 Suppl.), Poster No. M40, p. A837, (1997). EP 2385,067 A1 11, 2011 EP 243921.2 A1 4/2012 Koide, Shohei et al., “Directed Evolution of Fibronectin Type III JP 2001-5.00531 1, 2001 Domain to Novel Ligand Binding Proteins.” The Faseb Journal, vol. WO 92fO2536 A1 2, 1992 11(9): A1155, Poster No. 1739 (1997). WO 93,03172 A1 2, 1993 Ku, Jung et al., “Alternate protein frameworks for molecular recog WO 95/11922 A1 5, 1995 nition.” Proc. Natl. Acad. Sci. USA, vol. 92:6552-6556 (1995). WO 96.22391 A1 T 1996 Kurz, Markus et al., “Psoralen photo-crosslinked mRNA-puromycin WO 98.12226 A1 3, 1998 conjugates: a novel template for the rapid and facile preparation of WO 98.31700 A1 7, 1998 WO 98.56915 A2 12/1998 mRNA-protein fusions.” Nucleic Acids Research, vol. 28(18):e83, 5 WO 99.51773 A1 10, 1999 pages (2000). WO OO34784 A1 6, 2000 Leahy, Daniel J. et al., "2.0 A Crystal Structure of a Four-Domain WO OO.34787 A1 6, 2000 Segment of Human Fibronectin Encompassing the RGD Loop and WO O1 O7657 A1 2, 2001 Synergy Region.” Cell, vol. 84:155-164 (1996). WO O1,64942 A1 9, 2001 Leahy, Daniel J. et al., “Structure of a Fibronectin Type III Domain WO O2,04523 A2 1, 2002 from Tenascin Phased by MAD Analysis of the Selenomethionyl WO O2,32925 A2 4/2002 WO O2/O81497 A2 10, 2002 Protein.” Science, vol. 258:987-991 (1992). WO O2/O88171 A2 11, 2002 Lee, Grace et al., “Strong Inhibition of Fibrogen Binding to Platelet WO O3,O22858 A2 3, 2003 Receptor Alpha2b beta 3 by RGD Sequences installed into the Pre WO O3 (104418 A2 12/2003 sentation Scaffold.” Prot. Eng., vol. 6:745-754 (1993). WO 2005/056764 A2 6, 2005 Lipovsek, Dasa et al., “Evolution of an Interloop Disulfide Bond in WO 2006/020258 A2 2, 2006 High-Affinity Antibody Mimics Based on Fibronectin Type III WO 2007/O12614 A2 2, 2007 WO 2007/044688 A1 4/2007 Domain and Selected by Yeast Surface Display: Molecular Conver WO 2007/062.188 A2 5/2007 gence with Single-Domain Camelid and Shark Antibodies,” J. Mol. WO 2007 O92537 A2 8, 2007 Biol., vol. 368: 1024-1041 (2007). WO 2007/096O76 A2 8, 2007 Lipovsek, Dasa et al., “In-vitro protein evolution by ribosome display WO 2007 121894 A2 11, 2007 and mRNA display,” Journal of Immunological Methods, vol. WO 2008/031098 A1 3, 2008 290:51-67 (2004). WO 2008/04897O A2 4/2008 Litvinovich, Sergei V. et al., “Interactions BetweenType III Domains WO 2008.066752 A2 6, 2008 WO WO 2008.066752 A2 6, 2008 in the 110 kDa Cell-binding Fragments of Fibronectin.” J. Mol. Biol. WO 2008/097497 A2 8, 2008 vol. 248:611-626 (1995). WO 2008, 108986 A2 9, 2008 Lombardo, A. et al., “Conformational flexibility and crystallization WO 2009/0231.84 A2 2, 2009 of tandemly linked type III modules of human fibronectin.” Protein WO 2009,025806 A2 2, 2009 Science, vol. 5:1934-1938 (1996). WO 2009/0583.79 A2 5, 2009 Main, Alison L. et al., “The Three-Dimensional Structure of the Tenth WO 2009,0731-15 A1 6, 2009 WO 2009/083804 A2 T 2009 Type III Module of Fibronectin: An Insight into RGD-Mediated WO 2009/086116 A2 T 2009 Interactions.” Cell, vol. 71:671-678 (1992). WO 2009/102421 A2 8, 2009 Mao, Yong et al., “Fibronectin fibrillogenesis, a cell-mediated matrix WO WO 2009/102421 A2 8, 2009 assembly process.” Matrix Biology, vol. 24:389-399 (2005). WO 2009,133208 A1 11, 2009 Markland, William et al., “Iterative Optimization of High-Affinity WO 2009, 142773 A2 11, 2009 Protease Inhibitors. Using Phage Display. 1. Plasmin.” Biochemistry, WO WO 2009,133208 A1 11, 2009 vol. 35:8045-8057 (1996). WO 2010/051274 A2 5, 2010 WO 2010/051310 A2 5, 2010 Markland, William et al., “Iterative Optimization of High-Affinity WO 2010, O60.095 A1 5, 2010 Protease Inhibitors. Using Phage Display. 2. Plasma Kallikrein and WO 2010/0699.13 A1 6, 2010 Thrombin.” Biochemistry, vol.35:8058-8067 (1996). WO 2010/093627 A2 8, 2010 Maruyama, Kazuo et al., “Oligo-capping: a simple method to replace WO 2010.093771 A1 8, 2010 the cap structure of eukaryotic mRNAs with oligoribonucleotides.” WO 2011 (020033 A2 2, 2011 Gene, vol. 138:171-174 (1994). US 8,969,289 B2 Page 3

(56) References Cited Smith, Temple F. et al., “The challenges of genome sequence anno tation of 'The devil is in the details.” Nature Biotechnology, vol. OTHER PUBLICATIONS 15:1222-1223 (1997). Tang, Lisa et al., “Pharmacokinetic Aspects of Biotechnology Prod Mattheakis, Larry C. et al., “An in vitro polysome display system for ucts,” Journal of Pharmaceutical Sciences, vol. 93 (9):2184-2204 identifying ligands from very large peptide libraries.” Proc. Natl. (2004). Acad. Sci. USA, vol. 91:9022-9026 (1994). Tokuriki, Nobuhiko et al., “Stability effects of mutations and protein McConnell, Stephen J. et al., “Tendamistat as a Scaffold for evolvability.” Current Opinion in Structural Biology, vol. 19:596-604 Conformationally Constrained Phage Peptide Libraries,” J. Mol. (2009). Biol., vol. 250:460-470 (1995). Meinke, A. et al., “Cellulose-Binding Polypeptides from Cel Tramontano, Anna et al., “The Making of the Minibody: an Engi lulomonas fimi: Endoglucanase D (CenD), a Family A beta-1,4- neered beta-Protein for the Display of Conformationally Constrained Glucanase.” Journal of Bacteriology, vol. 175(7): 1910-1918 (1993). Peptides,” Journal of Molecular Recognition, vol. 7:9-24 (1994). Muller, Christoph W. et al., “Structure of the NF-kappaB p50 Trinh, Ryan et al., “Optimization of codon pair use within the homodimer bound to DNA.” Nature, vol. 373:311-317 (1995). (GGGGS)3 linker sequence results in enhanced protein expression.” Muyldermans, Serge, “Single domain camel antibodies: current sta Molecular Immunology, vol. 40:717-722 (2004). tus.” Reviews in Molecular Biotechnology, vol. 74:277-302 (2001). Ackermann, Maximilian et al., “Anti-VEGFR2 and anti-IGF-1 R Nemoto, Naoto et al., “In vitro virus: Bonding of mRNA bearing Adnectins inhibit Ewing's sarcoma A673-Xenograft growth and nor puromycin at the 3'-terminal end to the C-terminal end of its encoded malize tumor vascular architecture.” Angiogenesis, vol. 15:685-695 protein on the ribosome in vitro.” FEBS Letters, vol. 414:405-408 (2012). (1997). Apte, Aaron N. et al., “Anchor-Ligated cDNA Libraries: A Technique Ngo, J. Thomas et al., “Computational Complexity Protein Structure for Generating a cDNA Library for the Immediate Cloning of the 5’ Prediction, and the Levinthal Paradox.” The Protein Folding Problem Ends of mRNAs.” BioTechniques, vol. 15(5):890-893 (1993). and Tertiary Structure Prediction, Birkhauser, Boston, MA. K. Merz Baggio, Rick et al., “Identification of epitope-like consensus motifs (Ed.), Chapter 14, pp. 491-495 (1994). using mRNA display,” Journal of Molecular Recognition, vol. Niemeyer, Christof M. et al., “Oligonucleotide-directed self-assem 15:126-134 (2002). bly of proteins: semisynthetic DNA streptavidin hybrid molecules Baron, Martin et al., “H NMR Assignment and Secondary Structure as connectors for the generation of macroscopic arrays and the con of the Cell Adhesion Type III Module of Fibronectin.” Biochemistry, struction of Supramolecular bioconjugates. Nucleic Acids Research, vol. 3 1:2068-2073 (1992). vol. 22(25):5530-5539 (1994). Baron, Martin et al., “Protein modules.” TIBS, vol. 16:13-17 (1991). Nilsen, Timothy W. “Trans-Splicing in Protozoa and Helminths.” Batori, Vincent et al., “Exploring the potential of the monobody Infections Agents and Disease, vol. 1:212-218 (1992). scaffold: effects of loop elongation on the stability of a fibronectin Nord, Karinet al., “A combinatorial library of an alpha-helical bac type III domain.” Protein Engineering, vol. 15(12): 1015-1020 terial receptor domain.” Prot. Eng., vol. 8:601-608 (1995). (2002). Nord, Karin et al., “Binding proteins selected from combinatorial Bianchi, Elisabetta et al., “High Level Expression and Rational libraries of an alpha-helical bacterial receptor domain.” Nature Mutagenesis of a Designed Protein, the Minibody.” J. Mol. Biol., vol. Biotechnology, vol. 15:772-777 (1997). 236:649-659 (1994). Nygren, Per-Akeet al., “Scaffolds for engineering novel binding sites Boder, Eric T. et al., “Directed evolution of antibody fragments with in proteins.” Current Opinion in Structural Biology, vol. 7:463-469 monovalent femtomolar antigen-binding affinity.” PNAS, vol. (1997). 97(20): 10701-10705 (2000). Parker, M.H. et al., “Antibody mimics based on human fibronectin Boder, Eric T. et al., “Yeast Surface display for screening combinato type three domain engineered for thermostability and high-affinity rial polypeptide libraries.” Nature Biotechnology, vol. 15:553-557 binding to vascular endothelial growth factor receptor two.” Protein (1997). Engineering, Design & Selection, vol. 18(9):435-444 (2005). Bork, Peer et al., “Go hunting in sequence databases but watch out for Plaxco, Kevin W. et al., “A Comparison of the Folding Kinetics and the traps.” TIG, vol. 12(10):425-427 (1996). Thermodynamics of Two Homologous Fibronectin Type III Mod Bork, Peer, “Powers and Pitfalls in Sequence Analysis: The 70% ules.” J. Mol. Biol., vol. 270:763-770 (1997). Hurdle.” Genome Research, vol. 10:398-400 (2000). Plaxco, Kevin W. et al., “Rapid refolding of a proline-rich all-beta Bork, Peer et al., “Proposed acquisition of an animal protein domain sheet fibronectin type III module.” Proc. Natl. Acad. Sci. USA. vol. by bacteria.” Proc. Natl. Acad. Sci. USA, vol. 89:8990-8994 (1992). 93: 10703-10706 (1996). Bork, P. et al., “The Immunoglobulin Fold, Structural Classification, Potts, Jennifer R. et al., “Fibronectin structure and assembly.” Cur Sequence Patterns and Common Core.” J. Mol. Biol., vol. 242:309 rent Biology, vol. 6:648-655 (1994). 320 (1994). Potts, Jennifer R. et al., “Structure and Function of Fibronectin Mod Brenner, Steven E., "Errors in genome annotation.” TIG, vol. ules.” Matrix Biology, vol. 15:313-320 (1996). 15(4): 132-133 (1999). Roberts, Richard W. et al., “RNA-peptide fusions for the in vitro Brock, Kenny V. et al., “Nucleotide sequencing of 5 and 3’ termini of selection of peptides and proteins.” Proc. Natl. Acad. Sci. USA. vol. bovine viral diarrhea virus by RNA ligation and PCR.” Journal of 94; 12297-12302 (1997). Virological Methods, vol. 38:39-46 (1992). Roberts, Richard W. “Totally invitro protein selection using mRNA Bruzik, James P. et al., “Spliced leader RNAS from lower eukaryotes protein fusions and ribosome display. Current Opinion in Chemical are trans-spliced in mammalian cells.” Nature, vol. 360(6405):692 Biology, vol. 3:268-273 (1999). 695 (1992). Rottgen, Peter et al., “A human pancreatic secretory trypsin inhibitor Caliceti, Paolo et al., “Pharmacokinetic and biodistribution proper presenting a hyperveriable highly constrained epitope via ties of poly(ethylene glycol)-protein conjugates.” Advanced Drug monovalent phagemid display.” Gene, vol. 164:243-250 (1995). Delivery Reviews, vol. 55:1261-1277 (2003). Scott, Jamie K. et al., “Searching for Peptide Ligands with an Epitope Campbell, lain D. et al., “Building proteins with fibronectin type III Library.” Science, vol. 249:386-390 (1990). modules, Fibronectin type III modules are versatile components of Shibata, K. et al., “An attempt to substitute the cell binding domain of many proteins. Recent structures of module pairs show how these human fibronectin in lambda phage J protein: Computer design and modules are joined together.” Structure, vol. 2:333-337 (1994). expression.” Biochimie, vol. 75:459-465 (1993). Choy, E.H.S. et al., “Efficacy of a novel PEGylated humanized anti Skolnick, Jeffrey et al., “From genes to protein structure and func TNF fragment (CDP870) in patients with rheumatoid arthritis: a tion: novel applications of computational approaches in the genomic phase II double-blinded, randomized, dose-escalating trial.” era.” TibTech, vol. 18:34-39 (2000). Rheumatology, vol. 41: 1133-1137 (2002). Smith, George P. et al., “Phage Display.” Chem. Rev., vol. 97:391 Clackson, Tim et al., “In vitro selection from protein and peptide 410 (1997). libraries.” TibTech, vol. 12(5):173-184 (1994). US 8,969,289 B2 Page 4

(56) References Cited Hamers-Casterman, C. et al., “Naturally occurring antibodies devoid of light chains.” Nature, vol. 363:446-448 (1993). OTHER PUBLICATIONS Hammond, Philip W. et al., “In Vitro Selection and Characterization of Bcl-XL-binding Proteins from a Mix of Tissue-specific mRNA Clackson, Tim et al., “Making antibody fragments using phage dis Display Libraries.” The Journal of Biological Chemistry, vol. play libraries.” Nature, vol. 352:624-628 (1991). 276(24):20898-20906 (2001). Clarke, Jane et al., “Folding and Stability of a Fibronectin Type III Harpaz, Yahouda et al., “Many of the IMmunoglobulin Superfamily Domain of Human Tenascin.” J. Mol. Biol., vol. 270:771-778 (1997). Domains in Cell Adhesion Molecules and Surface Receptors Belong Connelly, Roberta et al., “Mitogenic properties of a bispecific single to a New Structural Set Which is Close to That Containing Variable chain Fv-lg fusion generated from CD2-specific mAb to distinct Domains,” J. Mol. Biol., vol. 238:528-539 (1994). epitopes.” International Immunology, vol. 10(12): 1863-1872 (1998). Hocking, Denise C. et al., “A Novel Role for the Integrin-binding Copie, Valerie et al., “Solution Structure and Dynamics of Linked III-10 Module in Fibronectin Matrix Assembly.” The Journal of Cell Cell Attachment Modules of Mouse Fibronectin Containing the RGD Biology, vol. 133(2):431-444 (1996). and Synergy Regions: Comparison wtih the Human Fibronectin Hocking, Denise C. et al., “Activation of Distinct alpha5beta1-medi Crystal Structure.” J. Mol. Biol., vol. 277:663-682 (1998). ated Signaling Pathways by Fibronectin’s Cell Adhesion and Matrix Cota, Ernesto et al., “Two Proteins with the Same Structure Respond Assembly Domains.” The Journal of Cell Biology, vol. 141(1):241 very Differently to Mutation: The Role of Plasticity in Protein Sta 253 (1998). bility.” J. Mol. Biol., vol. 302:713-725 (2000). Husimi, Y. et al., “Role of the Virus-type Strategy in Encoded Cujec, Thomas P. et al., “Selection of v-Abl Tyrosine Kinase Sub Molecular Evolution.” Progress in Biophysics and Molecular Biol strate Sequences from Randomized Peptide and Cellular Proteomic ogy, vol. 65(Suppl. 1):64 (1996). Libraries Using mRNA Display.” Chemistry & Biology, vol. 9:253 Hynes, Richard O. et al., “Integrins: Versability, Modulation, and 264 (2002). Signaling in Cell Adhesion.” Cell, vol. 69:11-25 (1992). Devlin, James J. et al., “Random Peptide Libraries: A Source of Jung, Gyoo Yeol et al., “Functional Protein Chip for Pathway Opti Specific Protein Binding Molecules.” Science, vol. 249:404–406 mization and in VitroMetabolic Engineering.” Science, vol.304:428 (1990). 431 (2004). DGENE Search Results, 33 pages (2005). Vuento, Matti et al., “Purification of Fibronectin from Human Plasma Dickinson, Craig D. et al., “Crystals of the Cell-binding Module of by Affinity Chromatography under Non-Denaturing Conditions.” Fibronectin Obtained from a Series of Recombinant Fragments Dif fering in Length.” J. Mol. Biol., vol. 238:123-127 (1994). Biochem. J., vol. 183:331-337 (1979). Dickinson, Craig D. et al., “Crystal Structure of the Tenth Type III Wang, Cheng-I et al., “Isolation of a High Affinity Inhibitor of Cell Adhesion Module of Human Fibronectin.” J. Mol. Biol., vol. Urokinase-type Plasminogen Activator by Phage Display of Ecotin.” 236:1079-1092 (1994). The Journal of Biological Chemistry, vol. 270(20): 12250-12256 Doerks, Tobiaset al., “Protein annotation: detective work for function (1995). prediction.” TIG, vol. 14(6):248-250 (1998). Watanabe, Takeshi et al., “Gene Cloning of Chitinase A1 from Bacil Ely, Kathryn R. et al., “Common molecular scaffold for two unrelated lus circulans WL-12 Revealed Its Evolutionary Relationship to Ser RGD molecules.” Protein Engineering, vol. 8 (8):823-827 (1995). ratia Chitinase and to the Type III Homology Units of Fibronectin.” Emanuel, Stuart L. et al., “A fibronectin scaffold approach to The Journal of Biological Chemistry, vol. 265:15659-15665 (1990). bispecific inhibitors of epidermal growth factor receptor and insulin Wells, James A., “Additivity of Mutational Effects in Proteins.” Bio like growth factor-I receptor.” mAbs, vol. 3(1):38-48 (2011). chemistry, vol. 29(37):8509-8517 (1990). Fenton, Bruce et al., “Pathophysiological effects of antibodies to Williams, Michael J. et al., “Solution Structures of Modular Proteins IGF-1R and VEGFR-2 plus fractionated radiation in DU145 prostate by Nuclear Magnetic Resonance.” Methods in Enzymology, vol. carcinoma xenografts,” Radiation Research Society 2005 Annual 245:451-469 (1994). Meeting, Abstract No. PP109, 1 page (2005). Williams, Alan F. et al., “The Immunoglobulin Superfamily—Do Ferguson, Kimberly C. et al., “The SL1 trans-spliced leader RNA mains for Cell Surface Recognition.” Ann. Rev. Immunol., vol. performs an essential embryonic function in Caenorhabditis elegans 6:381-405 (1988). that can also be supplied by SL2 RNA.” Genes & Development, vol. Wilson, David S. et al., “The use of mRNA display to select high 10:1543-1556 (1996). affinity protein-binding peptides.” PNAS, vol. 98 (7):3750-3755 GenBank Accession No. AAC48.614, MacLeod, J.N. et al., “Fibronectin mRNA splice variant in articular cartilage lacks bases (2001). encoding the V, III-15, and I-10 protein segments.” J. Biol. Chem. Xu, Lihui et al., “Directed Evolution of High-Affinity Antibody vol. 271 (31): 18954-18960 (1996), 2 pages, (1996). Mimics Using mRNA Display.” Chemistry & Biology, vol. 9:933 GenBank Accession No. CAA26536, Kornblihtt, A.R. et al., “Pri 942 (2002). mary structure of human fibronectin: differential splicing may gen Zdanov, Alexander et al., Structure of a single-chain antibody vari erate at least 10 polypeptides froma single gene.” EMBO J., vol. able domain (Fv) fragment complexed with a carbohydrate antigen at 4(7): 1755-1759 (1985), 7 pages, (1996). 1.7-A resolution, Proc. Natl. Acad. Sci. USA, vol. 91:6423-6427 GenBank Accession No. P07589, Skorstengaard, K. et al., "Com (1994). plete primary structure of bovine plasma fibronectin.” Eur, J. International Preliminary Report on Patentability and Written Opin Biochem., vol. 161(2):441-453 (1986), 9 pages, (1997). ion for Application No. PCT/US2009/003192, 12 pages, dated Nov. GenBank Accession No. X02761, Kornblihtt, A.R. et al., “Primary 23, 2010. structure of human fibronectin: differential splicing may generate at International Search Report for Application No. PCT/US2009/ least 10 polypeptides from a single gene.” EMBO.J., vol. 4(7): 1755 003192, 8 pages, dated Jun. 1, 2010. 1759 (1985), 4 pages, (1996). Notice of Opposition to European Patent No. 1137941 (Application Ghosh, Gourisankar et al., “Structure of NF-kappaB p50 homodimer No.99967 261.1), 29 pages, dated May 11, 2010. bound to a kappaB site.” Nature, vol. 373:303-310 (1995). International Search Report for Application No. PCT/US2011/ Goedert, M. et al., “Cloning and sequencing of the cDNA encoding 034998, 5 pages, dated Jul. 17, 2012. an isoform of microtubule-associated protein tau containing four International Preliminary Report on Patentability and Written Opin tandem repeats: differential expression of tau protein mRNAS in ion for Application No. PCT/US2011/034998, 10 pages, dated Nov. human brain.” The EMBO Journal, vol. 8(2):393-399 (1989). 6, 2012. Grant, Richard P. et al., “Structural Requirements for Biological International Search Report for Application No. PCT/US99/29317, 2 Activity of the Ninth and Tenth FIII Domains of Human Fibronectin.” pages, dated Apr. 6, 2000. The Journal of Biological Chemistry, vol. 272(10):6159-6166 International Preliminary Examination Report for Application No. (1997). PCT/US99/29317, 4 pages, dated Aug. 14, 2000. US 8,969,289 B2 Page 5

(56) References Cited Supplementary European Search Report for Application No. 01913159.8, 3 pages, dated Dec. 21, 2004. OTHER PUBLICATIONS Supplementary European Search Report for Application No. 99967261.1, 3 pages, dated Mar. 6, 2002. International Search Report for Application No. PCT/US01/32233, 3 European Office Action for Application No. 06013825.2, 9 pages, pages, dated Jun. 12, 2003. dated Sep. 17, 2008. International Preliminary Examination Report for Application No. European Office Action for Application No. 09167669.2, 7 pages, PCT/US01/32233, 5 pages, dated Dec. 10, 2003. dated Dec. 28, 2009. International Search Report for Application No. PCT/US01/06414, 5 Duan et al., “Fibronectin type III domain based monobody with high pages, dated Aug. 7, 2001. avidity.” Biochemistry 46(44): 12656-12664 (2007). Written Opinion for Application No. PCT/US01/06414, 5 pages, Lu et al., “Simultaneous blockade of both the epidermal growth dated Feb. 7, 2002. factor receptor and the insulin-like growth factor receptor signaling International Preliminary Examination Report for Application No. pathways in cancer cells with a fully human recombinant bispecific PCT/US01/06414, 6 pages, dated Aug. 27, 2002. antibody.” J. Biol. Chem. 279 (4):2856-2865 (2004). Partial European Search Report for Application No. 0198 16214, 5 pages, dated Feb. 25, 2005. * cited by examiner U.S. Patent Mar. 3, 2015 Sheet 1 of 22 US 8,969,289 B2

HSAPK Profile in nude ice 1))))

1) - 5. 100

1 - --Ouse 1-1

-House 1-2 1 1. 3. 4t 5. 6. time hrs

B HSA PK Profile in nude mice 1) -

e 1 OO) 3. . 10)

1) 3. 4.) 5. S) time hrs) FIGURE 1 U.S. Patent Mar. 3, 2015 Sheet 2 of 22 US 8,969,289 B2

A Comparison of SABA1.1 PK+!-HSA 1))) - --SABA, 1 M1 E -HSABA 1 M2 -HSABA, 1 M3 awa 1. --SABA 1 M4 --SABA,1+HSA M1

s --SABA1+HSA M2 10 --SABA,1+HSA M3

3. --SABA1+HSA M4

1 -

O. 1. 2 3. 4. 5 SO time thrs)

B Comparison of SABA 2.1 PK+-HSA 1) -

-- SABA, 2.1 1) - -H SABA. R.1 + HSA,

100 - e

1 O 5 1. 15 2. 25 3. time (hrs) FIGURE 2 U.S. Patent Mar. 3, 2015 Sheet 3 of 22 US 8,969,289 B2

Comparison of SABA3.1 PK Profile +f-HSA

-a-SABA3 all -HSAE, ,12

R - SABA3 F.3 100 -- SABA3 .4 -- SAB,3-HSA sil -- S&E,3-HSA 12 to | SABA3 -HSA 3. -HSBAHS,

time hrs)

10000 Comparison of SABA4.1 PK +/- HSA

--SARA4 wi: -a-SABA4+-SA ty -e-SABA4+-SAW -HSABA4+-ISA. iv -e-SABA4+-SA ty

E. EC: s s 3. tire hrs

FIGURE 2 (CONT) U.S. Patent Mar. 3, 2015 Sheet 4 of 22 US 8,969,289 B2

- SAEA2.: +/-FSA SABAA. f--SA SAEA3, +f-SA 3 ABA. ii-ii S.A

FIGURE 3 U.S. Patent Mar. 3, 2015 Sheet 5 of 22 US 8,969,289 B2

1OO.OOO -e Monkey 1 1.O.OOO -e Monkey 2

1.OOO

O 1OO 2OO 3OO 4OO 5OO 6OO Time hours

1OOOO cOMonkey 1

- 1. O OO cOMonkey 2

1. O

O.1 O 2O 40 60 8O 1OO 120 140 time hours

FIGURE 4 U.S. Patent Mar. 3, 2015 Sheet 6 of 22 US 8,969,289 B2

SABA .2

& s id: is a ix. 888.

FIGURES U.S. Patent Mar. 3, 2015 Sheet 7 of 22 US 8,969,289 B2

Time (min)

| - Olaf Ratio

FIGURE 6 U.S. Patent Mar. 3, 2015 Sheet 8 of 22 US 8,969,289 B2

A binding to HuSA domains

Si is a S. star &

FIGURE 7 U.S. Patent Mar. 3, 2015 Sheet 9 of 22 US 8,969,289 B2

PK and dose proportionality of SABA1.2 in 1 OOOC - cynomolgus monkeys

1 OOOO

1 OOO

1 OO | E-monkey 54-485 1mpk O -Hmonkey 104-003 impk mpk 1 O - --monkey88-7281mpk - x-Monkey 123-891Ompk --Monkey C14826 10mpk --Monkey C14814 10mpk O 2O 4O SOC 8O time (hrs)

FIGURE 8 U.S. Patent Mar. 3, 2015 Sheet 10 of 22 US 8,969,289 B2

1CO r

e 1 OO S.

1. --Monkey MO6088 w -HMonkey 38-186 SC -HMlonkey 38-179 SC

1. 2OO 3) 4O) 5) SOO time hrs

FIGURE 9 U.S. Patent Mar. 3, 2015 Sheet 11 of 22 US 8,969,289 B2

s3.i g

E-383 & 5:373 bp.

a $3.3

FIGURE 10 U.S. Patent Mar. 3, 2015 Sheet 12 of 22 US 8,969,289 B2

Time (min) 4C 8C 2O 180 200

| | 9.s kicks.

s-s s 9,

his O

-8 - ---- 0.0 OS O S 2O 2.5 Mola Ratio

FIGURE 11 U.S. Patent Mar. 3, 2015 Sheet 13 of 22 US 8,969,289 B2

exas

X as six stres

sess v

www.sixwsssssswww.xxws'sswww.swiss

FIGURE 12 U.S. Patent Mar. 3, 2015 Sheet 14 of 22 US 8,969,289 B2

K B-kiotho. 3% uSA perK 12

Hiss-tagged FGF2 SASA-FGF2,

FIGURE 13 U.S. Patent Mar. 3, 2015 Sheet 15 of 22 US 8,969,289 B2

EK parental cets, 3% HuSA park 1 2

FGF N is 6-tagged FGF2 SABA-FGF2 y

Ex-site 3, SS ERK 12

S N. His3-3gged G-2 S&S&-Gyi

SS$8

FIGURE 14 U.S. Patent Mar. 3, 2015 Sheet 16 of 22 US 8,969,289 B2

Plasma Glucose 3 gest-tisse lay estasia

------

SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSX

FIGURE 15 U.S. Patent Mar. 3, 2015 Sheet 17 of 22 US 8,969,289 B2

xxxxxxxNayasayayayanyayasayasamsayaya.Nasayayananayanayanayayasanayan: xxxxxxxx xxxxxxxxxxxx xxxxx xxxxxxxxxxxx xxxxx xxxxxx xxxxx xxxxxx xxxxxxxxxxxx xxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxx 8 & SS is is is $ 3.38 SSS $3, $8; S: ims (h

FIGURE 16 U.S. Patent Mar. 3, 2015 Sheet 18 of 22 US 8,969,289 B2

FIGURE 17 U.S. Patent Mar. 3, 2015 Sheet 19 of 22 US 8,969,289 B2

Study WCck 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 20 21 22 23 24 25 26 27 28 29 3031. 32 1 2 3 4 5 6 7, 8 9

e - O i :

FIGURE 18 U.S. Patent Mar. 3, 2015 Sheet 20 of 22 US 8,969,289 B2

HbAc 8.50 After 14 Days of Treatment in ob/ob Mice (24 hours post dose) 8.00 7.50 7.00 6.50 -0- Vehicle (HSA 6mpk) 6.00 -- SABA1-FGF21v1 0.01 mpk O oso SABA1-FGF21v1 0.1 mpk 5.5 ~$o SABA1-FGF21v1 1 mpk 5.00 O 7 * PaO.05 WS Weh Time (Days) () = Change from Baseline

FIGURE 19 U.S. Patent Mar. 3, 2015 Sheet 21 of 22 US 8,969,289 B2

-O- SABA1-FGF21v1, IV, 0.08 mg/kg -- SABA1-FGF21v1, SC, 0.08 mg/kg

O 72 144, 216 E88 36 43 5.

Time (h)

FIGURE 20

US 8,969,289 B2 1. 2 SERUMALBUMIN BINDING MOLECULES domain binds to HSA with a K, of 200 nM or less at pH range of 5.5 to 7.4. In another embodiment, the 'Fn3 domain binds RELATED APPLICATIONS to HSA with a K of 200 nM or less at pH 5.5. In some aspects, provided herein is a polypeptide compris This application claims the benefit of U.S. Provisional ing a 'Fn3 domain, wherein the 'Fn3 domain binds to HSA Application No. 61/330,672, filed May 3, 2010, which appli and comprises an amino acid sequence at least 70% identical cation is hereby incorporated by reference in its entirety. to SEQ ID NO: 2. In one embodiment, the 'Fn3 domain comprises one or more of a BC loop comprising the amino SEQUENCE LISTING acid sequence set forth in SEQID NO: 5, a DE loop compris 10 ing the amino acid sequence set forth in SEQID NO: 6, and The instant application contains a Sequence Listing which an FG loop comprising the amino acid sequence set forth in has been submitted in ASCII format via EFS-Web and is SEQID NO: 7. hereby incorporated by reference in its entirety. Said ASCII In any of the foregoing aspects and embodiments, the copy, created on Aug. 11, 2011, is named COTH5291.txt and 'Fn3 domain also binds to one or more of rhesus serum is 548,400 bytes in size. 15 albumin (RhSA), cynomolgous monkey serum albumin (CySA), or murine serum albumin (MuSA). In certain INTRODUCTION embodiments, the 'Fn3 domain does not cross-react with one or more of RhSA, CySA or MuSA. The utility of many therapeutics, particularly biologicals In any of the foregoing aspects and embodiments, the Such as peptides, polypeptides and polynucleotides, Suffer "Fn3 domain binds to HSA with a K, of 1 uM or less. In from inadequate serum half-lives. This necessitates the some embodiments, the 'Fn3 domain binds to HSA with a administration of such therapeutics at high frequencies and/or K of 500 nM or less. In other embodiments, the "Fn3 higher doses, or the use of Sustained release formulations, in domain binds to HSA with a K of at least 200 nM, 100 nM, order to maintain the serum levels necessary for therapeutic 50 nM, 20 nM, 10 nM, or 5 nM. effects. Frequent systemic administration of drugs is associ 25 In any of the foregoing aspects and embodiments, the ated with considerable negative side effects. For example, 'Fn3 domain binds to domain I or II of HSA. In one embodi frequent systemic injections representa considerable discom ment, the "Fn3 domain binds to both domains I and II of fort to the Subject, and pose a high risk of administration HSA. In some embodiments, the 'Fn3 domain binds to HSA related infections, and may require hospitalization or fre at a pH range of 5.5 to 7.4. In other embodiments, the "Fn3 quent visits to the hospital, in particular when the therapeutic 30 domain binds to HSA with a K of 200 nM or less at pH 5.5. is to be administered intravenously. Moreover, in long term In another embodiment, the "Fn3 domain binds to HSA with treatments daily intravenous injections can also lead to con a K of at least 500 nM, 200 nM, 100 nM, 50 nM, 20 nM, 10 siderable side effects of tissue scarring and vascular patholo nM, or 5 nM at a pH range of 5.5 to 7.4. In one embodiment, gies caused by the repeated puncturing of vessels. Similar the 'Fn3 domain binds to HSA with a K, of at least 500 nM, problems are known for all frequent systemic administrations 35 200 nM, 100 nM, 50 nM, 20 nM, 10 nM, or 5 nM at pH 5.5. of therapeutics, such as, for example, the administration of In any of the foregoing aspects and embodiments, the insulin to diabetics, or interferon drugs in patients suffering serum half-life of the polypeptide in the presence of serum from multiple sclerosis. All these factors lead to a decrease in albumin is at least 2-fold greater than the serum half-life of patient compliance and increased costs for the health System. the polypeptide in the absence of serum albumin. In certain This application provides compounds that increase the 40 embodiments, the serum half-life of the polypeptide in the serum half-life of various therapeutics, compounds having presence of serum albumin is at least 5-fold, 7-fold, 10-fold, increased serum half-life, and methods for increasing the 12-fold, 15-fold, 20-fold, 22-fold, 25-fold, 27-fold, or 30-fold serum half-life of therapeutics. Such compounds and meth greater than the serum half-life of the polypeptide in the ods for increasing the serum half-life of therapeutics can be absence of serum albumin. In some embodiments, the serum manufactured in a cost effective manner, possess desirable 45 albumin is any one of HSA, RhSA, CySA, or MuSA. biophysical properties (e.g., Tm, Substantially monomeric, or In any of the foregoing aspects and embodiments, the well-folded), and are of a size Small enough to permit tissue serum half-life of the polypeptide in the presence of serum penetration. albumin is at least 20 hours. In certain embodiments, the serum half-life of the polypeptide in the presence of serum SUMMARY OF THE INVENTION 50 albumin is at least 2 hours, 2.5 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, The present invention relates to serum albumin binding 15 hours, 20 hours, 25 hours, 30 hours, 40 hours, 50 hours, 75 fibronectin type III tenth ("Fin3) domains, and their use. Also hours, 90 hours, 100 hours, 110 hours, 120 hours, 130 hours, disclosed herein are fusion molecules comprising serum 150 hours, 170 hours, or 200 hours. In some embodiments, albumin binding 'Fn3, and their use. 55 the half-life of the polypeptide is observed in a primate (e.g., In one aspect, the present invention provides a polypeptide human or monkey) or a murine. comprising a fibronectin type III tenth ("Fin3) domain, In one aspect, the present invention provides a polypeptide wherein the 'Fn3 domain binds to domain I or II of human comprising a 'Fn3 domain, wherein the 'Fn3 domain binds serum albumin (HSA) with a K, of 1 uMorless, and wherein to HSA and comprises a BC loop comprising the amino acid the serum half-life of the polypeptide in the presence of 60 sequence set forth in SEQID NO:5, a DE loop comprising the albumin is at least 5-fold greater than the serum half-life of amino acid sequence set forth in SEQID NO: 6, and an FG the polypeptide in the absence of serum albumin. In one loop comprising the amino acid sequence set forth in SEQID embodiment, the 'Fn3 domain comprises a modified amino NO: 7. In another aspect, the 'Fn3 domain comprises one or acid sequence in one or more of the BC, DE and FG loops more of a BC loop comprising the amino acid sequence set relative to the wild-type "Fn3 domain. 65 forth in SEQID NO: 5, a DE loop comprising the amino acid In certain embodiments, the 'Fn3 domain binds to HSA at sequence set forth in SEQID NO: 6, and an FG loop com a pH range of 5.5 to 7.4. In one embodiment, the "Fn3 prising the amino acid sequence set forth in SEQID NO: 7. US 8,969,289 B2 3 4 In one aspect, the present invention provides a polypeptide In any of the foregoing aspects and embodiments, the comprising a 'Fn3 domain, wherein the 'Fn3 domain binds serum half-life of the polypeptide in the presence of serum to HSA and comprises a BC loop comprising the amino acid albumin is at least 20 hours. In certain embodiments, the sequence set forth in SEQID NO:9, a DE loop comprising the serum half-life of the polypeptide in the presence of serum amino acid sequence set forth in SEQID NO: 10, and an FG 5 albumin is at least 2 hours, 2.5 hours, 3 hours, 4 hours, 5 loop comprising the amino acid sequence set forth in SEQID hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, NO: 11. In another aspect, the 'Fn3 domain comprises one or 15 hours, 20 hours, 25 hours, 30 hours, 40 hours, 50 hours, 75 more of a BC loop comprising the amino acid sequence set hours, 90 hours, 100 hours, 110 hours, 120 hours, 130 hours, forth in SEQID NO:9, a DE loop comprising the amino acid 150 hours, 170 hours, or 200 hours. In some embodiments, 10 the half-life of the polypeptide is observed in a primate (e.g., sequence set forth in SEQID NO: 10, and an FG loop com human or monkey) or a murine. prising the amino acid sequence set forth in SEQID NO: 11. In one aspect, the present invention provides a fusion In one aspect, the present invention provides a polypeptide polypeptide comprising a fibronectin type III tenth ("Fn3) comprising a "Fn3 domain, wherein the 'Fn3 domain binds domain and a heterologous protein, wherein the 'Fn3 to HSA and comprises a BC loop comprising the amino acid 15 domain binds to HSA with a K, of 1 uM or less. In certain sequence set forth in SEQID NO: 13, a DE loop comprising embodiments, the "Fn3 domain comprises an amino acid the amino acid sequence set forth in SEQID NO: 14, and an sequence at least 70% identical to SEQ ID NO: 4. In one FG loop comprising the amino acid sequence set forth in SEQ embodiment, the "Fn3 domain comprises a BC loop having ID NO: 15. In another aspect, the "Fn3 domain comprises the amino acid sequence set forth in SEQID NO:5, a DE loop one or more of a BC loop comprising the amino acid sequence having the amino acid sequence set forth in SEQID NO: 6, set forth in SEQID NO: 13, a DE loop comprising the amino and an FG loop having the amino acid sequence set forth in acid sequence set forth in SEQID NO: 14, and an FG loop SEQ ID NO:7. In another embodiment, the 'Fn3 domain comprising the amino acid sequence set forth in SEQID NO: comprises one or more of a BC loop having the amino acid 15. sequence set forth in SEQID NO: 5, a DE loop having the In one aspect, the present invention provides a polypeptide 25 amino acid sequence set forth in SEQID NO: 6, and an FG comprising a 'Fn3 domain, wherein the 'Fn3 domain binds loop having the amino acid sequence set forth in SEQID NO: to HSA and comprises a BC loop comprising the amino acid 7. sequence set forth in SEQID NO: 17, a DE loop comprising In one embodiment, the heterologous protein is selected the amino acid sequence set forth in SEQID NO: 18, and an from fibroblast growth factor 21 (FGF21), insulin, insulin FG loop comprising the amino acid sequence set forth in SEQ 30 receptor peptide, GIP (glucose-dependent insulinotropic ID NO: 19. In another aspect, the "Fn3 domain comprises polypeptide), bone morphogenetic protein 9 (BMP-9), amy one or more of a BC loop comprising the amino acid sequence lin, peptideYY (PYY), pancreatic polypeptide (PP), inter set forth in SEQID NO: 17, a DE loop comprising the amino leukin 21 (IL-21), glucagon-like peptide 1 (GLP-1), Plecta acid sequence set forth in SEQID NO: 18, and an FG loop sin, Progranulin, Osteocalcin (OCN), Apelin, or a comprising the amino acid sequence set forth in SEQID NO: 35 polypeptide comprising a 'Fn3 domain. In other embodi 19. ments, the heterologous protein is selected from GLP-1. In any of the foregoing aspects and embodiments, the Exendin 4, adiponectin, IL-1Ra (Interleukin 1 Receptor "Fn3 domain also binds to one or more of rhesus serum Antagonist), VIP (vasoactive intestinal peptide), PACAP (Pi albumin (RhSA), cynomolgous monkey serum albumin tuitary adenylate cyclase-activating polypeptide), leptin, (CySA), or murine serum albumin (MuSA). In some embodi 40 INGAP (islet neogenesis associated protein), BMP (bone ments, the "Fn3 domain does not cross-react with one or morphogenetic protein), and osteocalcin (OCN). In one more of RhSA, CySA or MuSA. In certain embodiments, the embodiment, the heterologous protein comprises the "Fn3 domain binds to HSA with a K, of 1 uM or less. In sequence set forth in SEQID NO: 118. other embodiments, the 'Fn3 domain binds to HSA with a In certain embodiments, the heterologous protein com K of at least 1.5uM, 1.2 uM, 1 uM, 700 nM, 500 nM, 300 45 prises a second 'Fn3 domain that binds to a target protein nM, 200 nM, 100 nM, 75 nM, 50 nM, 25 nM, 10 nM, or 5 nM. other than serum albumin. In other embodiments, the fusion In any of the foregoing aspects and embodiments, the polypeptide further comprises a third 'Fn3 domain that "Fn3 domain binds to domain I or II of HSA. In certain binds to a target protein. In one embodiment, the third 'Fn3 embodiments, the 'Fn3 domain binds to both domains I and domain binds to the same target as the second 'Fn3 domain. II of HSA. In certain embodiments, the 'Fn3 domain binds to 50 In other embodiments, the third 'Fn3 domain binds to a HSA at a pH range of 5.5 to 7.4. In one embodiment, the "Fn3 different target than the second 'Fn3 domain. domain binds to HSA with a K, of 200 nM or less at pH 5.5. In one embodiment, the 'Fn3 domain of the fusion In another embodiment, the "Fn3 domain binds to HSA with polypeptide also binds to one or more of rhesus serum albu a K of at least 500 nM, 200 nM, 100 nM, 50 nM, 20 nM, 10 min (RhSA), cynomolgous monkey serum albumin (CySA), nM, or 5 nM at a pH range of 5.5 to 7.4. In one embodiment, 55 or murine serum albumin (MuSA). In other embodiments, the the 'Fn3 domain binds to HSA with a K, of at least 500 nM, 'Fn3 domain does not cross-react with one or more of RhSA, 200 nM, 100 nM, 50 nM, 20 nM, 10 nM, or 5 nM at pH 5.5. CySA or MuSA. In any of the foregoing aspects and embodiments, the In certain embodiments, the "Fng domain of the fusion serum half-life of the polypeptide in the presence of serum polypeptide binds to HSA with a K, of 1 uM or less. In some albumin is at least 2-fold greater than the serum half-life of 60 embodiments, the "Fng domain binds to HSA with a K of the polypeptide in the absence of serum albumin. In certain 500 nM or less. In other embodiments, the 'Fn3 domain embodiments, the serum half-life of the polypeptide in the binds to HSA with a K of at least 200 nM, 100 nM, 50 nM, presence of serum albumin is at least 5-fold, 7-fold, 10-fold, 20 nM, 10 nM, or 5 nM. 12-fold, 15-fold, 20-fold, 22-fold, 25-fold, 27-fold, or 30-fold In other embodiments, the 'Fn3 domain of the fusion greater than the serum half-life of the polypeptide in the 65 polypeptide binds to domain I or II of HSA. In one embodi absence of serum albumin. In some embodiments, the serum ment, the 'Fn3 domain binds to both domains I and II of albumin is any one of HSA, RhSA, CySA, or MuSA. HSA. In some embodiments, the "Fn3 domain binds to HSA US 8,969,289 B2 5 6 at a pH range of 5.5 to 7.4. In other embodiments, the "Fn3 FIG. 2. Half-life determination of SABA1-4 in mice. FIG. domain binds to HSA with a K of 200 nM or less at pH 5.5. 2A: SABA1.1 FIG. 2B: SABA2.1 FIG. 2C: SABA3.1; and In another embodiment, the 'Fn3 domain binds to HSA with FIG. 2D: SABA41. a K of at least 500 nM, 200 nM, 100 nM, 50 nM, 20 nM, 10 FIG.3. Graph showing summary of half-life enhancement nM, or 5 nM at a pH range of 5.5 to 7.4. In one embodiment, in mice of SABA1-4 when co-injected with HSA. the 'Fn3 domain binds to HSA with a K, of at least 500 nM, FIG. 4. Half-life determination for SABA1.1 (FIG. 4A) 200 nM, 100 nM, 50 nM, 20 nM, 10 nM, or 5 nM at pH 5.5. and SABA5.1 (FIG. 4B) in cynomolgous monkey. In some embodiments, the serum half-life of the fusion FIG. 5. SABA1.2 binding to albumins from human, mouse polypeptide in the presence of serumalbumin is at least 5-fold and rat by direct binding ELISA assay. greater than the serum half-life of the polypeptide in the 10 FIG. 6. Determination of SABA1.1 and HSA stoichiom absence of serum albumin. In certain embodiments, the etry. SABA1.1 and HSA bind with a stoichiometry of 1:1. serum half-life of the fusion polypeptide in the presence of FIG. 7. Biacore analysis of SABA1.2 binding to recombi serum albumin is at least 2-fold, 5-fold, 7-fold, 10-fold, nant domain fragments of HSA. 12-fold, 15-fold, 20-fold, 22-fold, 25-fold, 27-fold, or 30-fold FIG.8. Pharmacokinetic profile for SABA1.2 in monkeys greater than the serum half-life of the polypeptide in the 15 dosed at 1 mpk and 10 mpk. absence of serum albumin. In some embodiments, the serum FIG.9. Pharmacokinetic profile for SABA1.2 in monkeys albumin is any one of HSA, RhSA, CySA, or MuSA. dosed intravenously or Subcutaneously at 1 mpk. In certain embodiments, the serum half-life of the fusion FIG. 10. Plamsid map of the pET29b vector used in the polypeptide in the presence of serum albumin is at least 20 productive expression of FGF21 and SABA fusions. hours. In certain embodiments, the serum half-life of the FIG. 11. Representative isothermal titration calorimetry of fusion polypeptide in the presence of serum albuminis at least a SABA-FGF21 V1 fusion with HSA at 37° C. in PBS buffer. 2 hours, 2.5 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, Values determined in this assay: N=0.87: K, 3.8x10 M: 8 hours, 9 hours, 10 hours, 12 hours, 15 hours, 20 hours, 25 A=-15360 cal/mole. hours, 30 hours, 40 hours, 50 hours, 75 hours, 90 hours, 100 FIG. 12. SPR sensogram data for the binding of SABA1 hours, 110 hours, 120 hours, 130 hours, 150 hours, 170 hours, 25 FGF21v1 to HSA (A), CySA (B), and MuSA (C), or SABA1 or 200 hours. In some embodiments, the half-life of the fusion FGF21 v3 to HSA (D), CySA (E), and MuSA (F) at 37° C. polypeptide is observed in a primate (e.g., human or monkey) FIG. 13. Comparison of His-tagged FGF21 vs. SABA1 or a murine. FGF21v1 activity in stimulating pERK 1/2 levels in HEK In any of the foregoing aspects and embodiments, the B-Klotho cells in the presence of human serum albumin. "Fn3 domain comprises a sequence selected from SEQ ID 30 FIG. 14. Comparison of FGF1, His6-tagged FGF21 and NO: 8, 12, 16, 20, and 24-44. SABA1-FGF21 V1 activity in stimulating pERK 1/2 levels in In one aspect, the present invention provides a polypeptide HEK parental cells vs. HEK B-Klotho cells. Representative comprising a fibronectin type III tenth ('Fn3) domain, graphs of dose response stimulation of p.RK 1/2 levels in wherein the "Fn3 domain (i) comprises a modified amino HEK parental cells (FIG. 14A) and HEKB-Klotho expressing acid sequence in one or more of the AB, BC, CD, DE, EF and 35 cells (FIG. 14B). Data is plotted as meanisem of triplicate FG loops relative to the wild-type "Fn3 domain, (ii) binds to samples. a target molecule not bound by the wild-type "Fn3 domain, FIGS. 15A and B. Examination of in vivo efficacy of and (iii) comprises a C-terminal tail having a sequence (ED), SABA1-FGF21v1 in diabetic ob?ob mice. Postprandial wherein n is an integer from 3 to 7. In certain embodiments, plasma glucose levels. the "Fn3 domain comprises an amino acid sequence having 40 FIG. 16. SABA and FGF21 fusions increased t-27-fold at least 60% identity with the amino acid sequence set forth in compared to His-tagged FGF21 in monkeys. residues 9-94 of SEQ ID NO: 1. In one embodiment, the FIGS. 17A and B. Shows two views of the HuSA/ C-terminal tail further comprises an E, I or EI at the N-termi SABA1.2 complex with the second view (FIG. 17B) rotated nus. In some embodiments, the C-terminal tail enhances the 70° about the vertical axis from first view (FIG. 17A). The solubility and/or reduces aggregation of the polypeptide. 45 HuSA is shown in a surface representation with SABA1.2 In certain embodiments, the 'Fn3 domain comprises a shown as a cartoon, i.e., with the B-strands as arrows and the modified amino acid sequence in each of the BC, DE and FG loops as strings. The diversified loops on SABA1.2 are shown loops relative to the wild-type "Fn3 domain. In other in black, while the contacting residues on the HuSA are embodiments, the polypeptide binds to the target with a K of shown in a lighter shade of gray. The three structural domains 1 uM or less. 50 of HuSA are marked (i.e., I, II and III). In some aspects, the present invention provides a pharma FIG. 18. Schematic of Dose Escalation and Treatment ceutical composition comprising the polypeptide of any of Cohorts (see Example A9). Study week indicates overall the foregoing aspects and embodiments. In certain embodi duration of the study. Weeks (Wk) within each cohort indicate ments, the pharmaceutical composition comprises Succinic duration from the start of treatment in that cohort. (a) Treat acid, glycine, and Sorbitol. In exemplary embodiments, the 55 ment in a given cohort will not begin until approximately 4 composition comprises 5 nM to 30 mM succinic acid, 5% to weeks after the last subject in the previous cohort completes 15% sorbitol, and 2.5% to 10% glycine at pH 6.0. In certain the Day 29 visit to allow for PK analyses. (b) Rows 1, 2, or 3 embodiments, the composition comprises 10 mM Succinic in each cohort indicate subgroups that begin at 1-week stag acid, 8% sorbitol, and 5% glycine at pH 6.0. In other embodi gered intervals (15-day interval between subgroups 1 and 2 in ments, the pharmaceutical composition further comprises a 60 Cohort 1). Group 1 will comprise 1 SABA1.2 treated subject physiologically acceptable carrier. and 1 placebo subject: Group 2 will comprise 4 SABA1.2 treated subjects and 1 placebo subject: Group 3 will comprise BRIEF DESCRIPTION OF THE DRAWINGS AND 5 (for Cohort 1) or 4 (for Cohorts 2 and 3) SABA1.2 treated TABLES subjects and 1 (for all cohorts) placebo subjects. Arrows () 65 indicate treatment (Days 1 and 15 for each group); Solid lines FIG. 1. In vivo HSA half-life in mice. HSA was injected (-) indicate active observation period; and dotted lines (...) into mice at 20 mg/kg (FIG. 1A) or 50 mg/kg (FIG. 1B). indicate safety follow-up. US 8,969,289 B2 7 8 FIG. 19. Levels of HbA1c in ob/ob mice after 14 days of under U.S. Copyright Registration No. TXU51 0087, and is treatment with SABA1-FGF21v1. publicly available through Genentech, Inc., South San Fran FIG. 20. Mean plasma concentration vs. time profile cisco, Calif. The ALIGN-2 program should be compiled for (meaniSD) of SABA1-FGF21v1 in Monkeys. use on a UNIX operating system, preferably digital UNIX FIG. 21. Examples of orthogonally protected amino acids V4.0D. All sequence comparison parameters are set by the for use in solid phase peptide synthesis (top). Other building ALIGN-2 program and do not vary. blocks useful for solid phase synthesis are also illustrated For purposes herein, the '% amino acid sequence identity of (bottom). a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as DETAILED DESCRIPTION OF THE INVENTION 10 a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given Definitions amino acid sequence B) is calculated as follows: 100 times the fraction X/Y where X is the number of amino acid resi As used herein, the following terms and phrases shall have dues scored as identical matches by the sequence alignment the meanings set forth below. Unless defined otherwise, all 15 program ALIGN-2 in that programs alignment of A and B, technical and Scientific terms used herein have the same and where Y is the total number of amino acid residues in B. meaning as commonly understood to one of ordinary skill in It will be appreciated that where the length of amino acid the art. sequence A is not equal to the length of amino acid sequence The singular forms “a,” “an and “the include plural B, the '% amino acid sequence identity of A to B will not equal reference unless the context clearly dictates otherwise. the 96 amino acid sequence identity of B to A. The terms “comprise' and “comprising are used in the The term “therapeutically effective amount” refers to an inclusive, open sense, meaning that additional elements may amount of a drug effective to treat a disease or disorder in a be included. mammal and/or relieve to some extent one or more of the The term “including is used to mean “including but not symptoms associated with the disorder. limited to”. “Including and “including but not limited to are 25 The term "SABA refers to a Serum Albumin Binding used interchangeably. AdnectinsTM. AdnectinsTM (Adnexus, a Bristol-Myers The term “antibody-like protein’ refers to a non-immuno Squibb R&D Company) are ligand binding scaffold proteins globulin protein having an “immunoglobulin-like fold', i.e., based on the tenth fibronectin type III domain, i.e., the tenth comprising about 80-150 amino acid residues that are struc module of Fn3, ('Fn3). turally organized into a set of beta or beta-like Strands, form 30 The half-life (t) of an amino acid sequence or compound ing beta sheets, where the beta or beta-like strands are con can generally be defined as the time taken for the serum nected by intervening loop portions. The beta sheets form the concentration of the polypeptide to be reduced by 50% in vivo stable core of the antibody-like protein, while creating two due to, e.g., degradation of the sequence or compound and/or “faces' composed of the loops that connect the beta or beta clearance or sequestration of the sequence or compound by like strands. As described herein, these loops can be varied to 35 natural mechanisms. The half-life can be determined in any create customized ligand binding sites, and Such variations manner known in the art, Such as by pharmacokinetic analy can be generated without disrupting the overall stability of the sis. See e.g., M. Gibaldi & D Perron “Pharmacokinetics”, protein. An example of Such an antibody-like protein is a published by Marcel Dekker, 2nd Rev. edition (1982). Half “fibronectin-based scaffold protein', by which is meant a life can be expressed using parameters such as the ta-alpha, polypeptide based on a fibronectin type III domain (Fn3). In 40 t-beta and the area under the curve (AUC). An "increase in one aspect, an antibody-like protein is based on a tenth half-life” refers to an increase in any one of these parameters, fibronectin type III domain ('Fn3). any two of these parameters, or all three these parameters. In By a "polypeptide' is meant any sequence of two or more certain embodiments, an increase in half-life refers to an amino acids, regardless of length, post-translation modifica increase in the ta-beta, either with or without an increase in tion, or function. “Polypeptide.” “peptide.” and “protein’ are 45 the t-alpha or the AUC or both. used interchangeably herein. The term “PK is an acronym for “pharmokinetic' and “Percent (%) amino acid sequence identity” herein is encompasses properties of a compound including, by way of defined as the percentage of amino acid residues in a first example, absorption, distribution, metabolism, and elimina sequence that are identical with the amino acid residues in a tion by a subject. A “PK modulation protein’ or “PK moiety’ second sequence, after aligning the sequences and introduc 50 refers to any protein, peptide, or moiety that affects the ing gaps, if necessary, to achieve the maximum percent pharmokinetic properties of a biologically active molecule sequence identity, and not considering any conservative Sub when fused to or administered together with the biologically stitutions as part of the sequence identity. Alignment for pur active molecule. poses of determining percent amino acid sequence identity Overview can be achieved in various ways that are within the skill in the 55 Fn3 refers to a type III domain from fibronectin. An Fn3 art, for instance, using publicly available computer Software domain is Small, monomeric, Soluble, and stable. It lacks such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign disulfide bonds and, therefore, is stable under reducing con (DNASTAR) software. Those skilled in the art can determine ditions. The overall structure of Fn3 resembles the immuno appropriate parameters for measuring alignment, including globulin fold. Fn3 domains comprise, in order from N-termi any algorithms needed to achieve maximal alignment over the 60 nus to C-terminus, a beta or beta-like Strand, A.; a loop, AB; a full-length of the sequences being compared. For purposes beta or beta-like strand, B; a loop, BC; a beta or beta-like herein, however, 96 amino acid sequence identity values are strand, C; a loop, CD; a beta or beta-like strand, D; a loop, DE; obtained as described below by using the sequence compari a beta or beta-like strand, E; a loop. EF: a beta or beta-like son computer program ALIGN-2. The ALIGN-2 sequence strand, F: a loop, FG, and a beta or beta-like strand, G. The comparison computer program was authored by Genentech, 65 seven antiparallel B-strands are arranged as two beta sheets Inc. has been filed with user documentation in the U.S. Copy that form a stable core, while creating two “faces' composed right Office, Washington D.C., 20559, where it is registered of the loops that connect the beta or beta-like strands. Loops US 8,969,289 B2 9 10 AB, CD, and EF are located at one face and loops BC, DE, and missible to the extent that the structural conformation is not so FG are located on the opposing face. Any or all of loops AB, altered as to disrupt ligand binding. Methods for generating BC, CD, DE, EF and FG may participate in ligand binding. 'Fn3 ligand specific binders have been described in PCT There are at least 15 different modules of Fn3, and while the Publication Nos. WO 00/034787, WO 01/64942, and WO sequence homology between the modules is low, they all 02/032925, disclosing high affinity TNFC. binders, PCT Pub share a high similarity in tertiary structure. lication No. WO 2008/097497, disclosing high affinity AdnectinsTM (Adnexus, a Bristol-Myers Squibb R&D VEGFR2 binders, and PCT Publication No. WO 2008/ Company) are ligand binding scaffold proteins based on the 066752, disclosing high affinity IGFIR binders. Additional tenth fibronectin type III domain, i.e., the tenth module of references discussing "Fn3 binders and methods of selecting Fn3, ("Fn3). The amino acid sequence of a naturally occur 10 binders include PCT Publication Nos. WO 98/056915, WO ring human 'Fn3 is set forth in SEQID NO: 1: 02/081497, and WO 2008/031098 and U.S. Publication No. 2003 186385. As described above, amino acid residues corresponding to (SEQ ID NO: 1) 15 residues 21-30, 51-56, and 76-87 of SEQID NO: 1 define the VSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVOEF BC, DE and FG loops, respectively. However, it should be TWPGSKSTATISGLKPGWDYTITWYAWGRGOSPASSKPISINYRT understood that not every residue within the loop region (the AB, CD and EF loops are underlined, and the needs to be modified in order to achieve a 'Fn3 binder having BC, FG, and DE loops are emphasized in bold). strong affinity for a desired target, Such as human serum albumin. For example, in many of the examples described In SEQID NO:1, the AB loop corresponds to residues 15-16, herein, only residues corresponding to amino acids 23-30 of the BC loop corresponds to residues 21-30, the CD loop the BC loop and 52-55 of the DE loop were modified to corresponds to residues 39-45, the DE loop corresponds to produce high affinity 'Fn3 binders. Accordingly, in certain residues 51-56, the EF loop corresponds to residues 60-66, embodiments, the BC loop may be defined by amino acids and the FG loop corresponds to residues 76-87. (Xu et al., 25 corresponding to residues 23-30 of SEQID NO: 1, and the Chemistry & Biology 20029:933-942). The BC, DE and FG DE loop may be defined by amino acids corresponding to loops align along one face of the molecule and the AB, CD residues 52-55 of SEQID NO: 1. Additionally, insertions and and EF loops align along the opposite face of the molecule. In deletions in the loop regions may also be made while still SEQID NO: 1, beta strand A corresponds to residues 9-14, producing high affinity "Fn3 binders. For example, SEQID beta strand B corresponds to residues 17-20, beta strand C 30 NO: 4 (SABA 1) is an example of an HSA binder in which the corresponds to residues 31-38, beta strand D corresponds to FG loop contains a four amino acid deletion, i.e., the 11 residues 46-50, beta strand E corresponds to residues 57-59, residues corresponding to amino acids 21-29 of SEQ ID beta strand F corresponds to residues 67-75, and beta strand G NO:1 were replaced with seven amino acids. SEQ ID NO: corresponds to residues 88-94. The strands are connected to 113 is an example of an HSA binder in which the FG loop each other through the corresponding loop, e.g., strands A and 35 contains an amino acid insertion, i.e., the 11 residues corre B are connected via loop AB in the formation strand A, loop sponding to amino acids 21-29 of SEQ ID NO:1 were AB, strand B, etc. The first 8 amino acids of SEQ ID NO:1 replaced with twelve amino acids. (italicized above) may be deleted while still retaining binding Accordingly, in some embodiments, one or more loops activity of the molecule. Residues involved in forming the selected from BC, DE, and FG may be extended or shortened hydrophobic core (the “core amino acid residues’) include 40 in length relative to the corresponding loop in wild-type the amino acids corresponding to the following amino acids human "Fn3. In some embodiments, the length of the loop of SEQ ID NO: 1: L8, V10, A13, L18, 120, W22, Y32, I34, may be extended by from 2-25 amino acids. In some embodi Y36, F48, V50, A57, I59, L62, Y68, I70, V72, A74, I88, I90 ments, the length of the loop may be decreased by 1-11 amino and Y92, wherein the core amino acid residues are repre acids. In particular, the FG loop of 'Fn3 is 12 residues long, sented by the single letter amino acid code followed by the 45 whereas the corresponding loop in antibody heavy chains position at which they are located within SEQID NO: 1. See ranges from 4-28 residues. To optimize antigen binding, e.g., Dickinson et al., J. Mol. Biol. 236: 1079-1092 (1994). therefore, the length of the FG loop of 'Fn3 may be altered in "Fn3 are structurally and functionally analogous to anti length as well as in sequence to cover the CDR3 range of 4-28 bodies, specifically the variable region of an antibody. While residues to obtain the greatest possible flexibility and affinity "Fn3 domains may be described as “antibody mimics” or 50 in antigen binding. In some embodiments, the integrin-bind “antibody-like proteins, they do offer a number of advan ing motif "arginine-glycine-aspartic acid' (RGD) may be tages over conventional antibodies. In particular, they exhibit replaced by a polar amino acid-neutral amino acid-acidic better folding and thermostability properties as compared to amino acid sequence (in the N-terminal to C-terminal direc antibodies, and they lack disulphide bonds, which are known tion). to impede or prevent proper folding under certain conditions. 55 "Fn3 generally begin with the amino acid residue corre Exemplary serum albumin 'Fn3 based binders are predomi sponding to number 1 of SEQID NO: 1. However, domains nantly monomeric with Tm's averaging ~65°C. with amino acid deletions are also encompassed by the inven The BC, DE, and FG loops of "Fn3 are analogous to the tion. In some embodiments, amino acid residues correspond complementary determining regions (CDRS) from immuno ing to the first eight amino acids of SEQID NO: 1 are deleted. globulins. Alteration of the amino acid sequence in these loop 60 Additional sequences may also be added to the N- or C-ter regions changes the binding specificity of 'Fn3. 'Fn3 minus. For example, an additional MG sequence may be domains with modifications in the AB, CD and EF loops may placed at the N-terminus of 'Fn3. The M will usually be also be made in order to produce a molecule that binds to a cleaved off, leaving a G at the N-terminus. In some embodi desired target. The protein sequences outside of the loops are ments, extension sequences may be placed at the C-terminus analogous to the framework regions from immunoglobulins 65 of the 'Fn3 domain, e.g., EIDKPSQ (SEQ ID NO. 54), and play a role in the structural conformation of the 'Fn3. EIEKPSQ (SEQID NO: 60), or EIDKPSQLE (SEQID NO: Alterations in the framework-like regions of "Fn3 are per 61). Such C-terminal sequences are referred to herein as tails US 8,969,289 B2 11 12 or extensions and are further described herein. In some scaffold regions relative to the corresponding amino acids embodiments, a His6-tag may be placed at the N-terminus or shown in SEQID NO: 1. In an exemplary embodiment, the the C-terminus. sequences of the beta Strands may have anywhere from 0 to The non-ligand binding sequences of "Fn3, i.e., the 10, from 0 to 8, from 0 to 6, from 0 to 5, from 0 to 4, from 0 “'Fn3 scaffold', may be altered provided that the 'Fn3 5 to 3, from 0 to 2, or from 0 to 1 conservative substitutions retains ligand binding function and/or structural stability. In across all 7 scaffold regions relative to the corresponding some embodiments, one or more of Asp7, Glu 9, and Asp 23 amino acids shown in SEQ ID NO: 1. In certain embodi are replaced by another amino acid, such as, for example, a ments, the core amino acid residues are fixed and any Substi non-negatively charged amino acid residue (e.g., ASn, LyS, tutions, conservative Substitutions, deletions or additions etc.). These mutations have been reported to have the effect of 10 occur at residues other than the core amino acid residues. In promoting greater stability of the mutant 'Fn3 at neutral pH exemplary embodiments, the BC, DE, and FG loops as rep as compared to the wild-type form (See, PCT Publication No. WO 02/04523). A variety of additional alterations in the resented by (X), (X), and (X), respectively, are replaced "Fn3 scaffold that are either beneficial or neutral have been with polypeptides comprising the BC, DE and FG loop disclosed. See, for example, Batori et al., Protein Eng. 2002 15 sequences from any of the HSA binders shown in Table 2 15(12):1015-20; Koide et al., Biochemistry 2001 below (i.e., SEQID NOs: 4, 8, 12, 16, 20, and 24-44 in Table 40(34): 10326-33. 2). The 'Fn3 scaffold may be modified by one or more con In certain embodiments, Antibody-like proteins based on servative substitutions. As many as 5%, 10%, 20% or even the 'Fn3 scaffold can be defined generally by the sequence: 30% or more of the amino acids in the 'Fn3 scaffold may be altered by a conservative substitution without substantially altering the affinity of the 'Fn3 for a ligand. For example, the (SEQ ID NO: 3) scaffold modification preferably reduces the binding affinity EVVAATPTSLLI(X)YYRITYGETGGNSPVOEFTV (X) ATISGLKPG of the 'Fn3 binder for a ligand by less than 100-fold, 50-fold, VDYTITVYAV (X) ISINYRT 25-fold, 10-fold, 5-fold, or 2-fold. It may be that such changes 25 will alter the immunogenicity of the 'Fn3 in vivo, and where In SEQID NO:3, the BC loop is represented by X, the DE the immunogenicity is decreased, such changes will be desir loop is represented by X, and the FG loop is represented by able. As used herein, "conservative substitutions' are resi X. X represents any amino acid and the Subscript following dues that are physically or functionally similar to the corre the X represents an integer of the number of amino acids. In sponding reference residues. That is, a conservative 30 particular, X, y and Z may each independently be anywhere Substitution and its reference residue have similar size, shape, from 2-20, 2-15, 2-10, 2-8, 5-20, 5-15, 5-10, 5-8, 6-20, 6-15, electric charge, chemical properties including the ability to 6-10, 6-8, 2-7, 5-7, or 6-7 amino acids. In preferred embodi form covalent or hydrogen bonds, or the like. Preferred con ments, X is 9 amino acids, y is 6 amino acids, and Zis 12 amino servative substitutions are those fulfilling the criteria defined acids. The sequences of the beta Strands may have anywhere for an accepted point mutation in Dayhoff et al., Atlas of 35 from 0 to 10, from 0 to 8, from 0 to 6, from 0 to 5, from 0 to Protein Sequence and Structure 5:345-352 (1978 & Supp.). 4, from 0 to 3, from 0 to 2, or from 0 to 1 substitutions, Examples of conservative substitutions are substitutions deletions or additions across all 7 scaffold regions relative to within the following groups: (a) Valine, glycine; (b) glycine, the corresponding amino acids shown in SEQID NO: 1. In an alanine; (c) valine, isoleucine, leucine; (d) aspartic acid, exemplary embodiment, the sequences of the beta Strands glutamic acid; (e) asparagine, glutamine, (f) serine, threo 40 may have anywhere from 0 to 10, from 0 to 8, from 0 to 6, nine; (g) lysine, arginine, methionine; and (h) phenylalanine, from 0 to 5, from 0 to 4, from 0 to 3, from 0 to 2, or from 0 to tyrosine. 1 conservative substitutions across all 7 scaffold regions rela In certain embodiments, antibody-like proteins based on tive to the corresponding amino acids shown in SEQID NO: the "Fn3 scaffold can be defined generally by following the 1. In certain embodiments, the core amino acid residues are Sequence: 45 fixed and any Substitutions, conservative Substitutions, dele tions or additions occurat residues other than the core amino acid residues. In exemplary embodiments, the BC, DE, and (SEQ ID NO: 2) FG loops as represented by (X), (X), and (X), respectively, EVVAAT (X) SLLI(X)YYRITYGE(X) QEFTV (X) ATI(X) DYT are replaced with polypeptides comprising the BC, DE and 50 FG loop sequences from any of the HSA binders shown in ITVYAV (X) ISINYRT. Table 2 below (i.e., SEQID NOs: 4, 8, 12, 16, 20, and 24-44 In SEQID NO:2, the AB loop is represented by X, the CD in Table 2). loop is represented by X, the EF loop is represented by X, 'Fn3 Domains with EDTails the BC loop is represented by X, the DE loop is represented In one aspect, the present invention provides a polypeptide by X, and the FG loop is represented by X. X represents any 55 comprising a fibronectin type III tenth ("Fin3) domain, amino acid and the Subscript following the X represents an wherein the 'Fn3 domain (i) comprises a modified amino integer of the number of amino acids. In particular, a may be acid sequence in one or more of the AB, BC, CD, DE, EF and anywhere from 1-15, 2-15, 1-10, 2-10, 1-8, 2-8, 1-5, 2-5, 1-4, FG loops relative to the wild-type "Fn3 domain, (ii) binds to 2-4, 1-3, 2-3, or 1-2 amino acids; and b, c, X, y and Z may each a target molecule not bound by the wild-type 'Fn3 domain, independently be anywhere from 2-20, 2-15, 2-10, 2-8, 5-20, 60 and (iii) comprises a C-terminal tail having a sequence (ED), 5-15, 5-10, 5-8, 6-20, 6-15, 6-10, 6-8, 2-7, 5-7, or 6-7 amino whereinn is an integer from 2-10, 2-8, 2-5, 3-10, 3-8,3-7, 3-5, acids. In preferred embodiments, a is 2 amino acids, b is 7 or 4-7, or wherein n is 2, 3, 4, 5, 6, 7, 8, 9, or 10. amino acids, c is 7 amino acids, X is 9 amino acids, y is 6 In certain embodiments, the 'Fn3 domain comprises an amino acids, and Z is 12 amino acids. The sequences of the amino acid sequence having at least 60%. 65%, 70%, 75%, beta strands may have anywhere from 0 to 10, from 0 to 8, 65 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with the from 0 to 6, from 0 to 5, from 0 to 4, from 0 to 3, from 0 to 2, amino acid sequence set forth in residues 9-94 of SEQID NO: or from 0 to 1 substitutions, deletions or additions across all 7 1. In certain embodiments, the 'Fn3 domain comprises SEQ US 8,969,289 B2 13 14 ID NO: 1, 2 or 3. In certain embodiments, the "Fn3 domain DE, or FG loops are modified relative to the wild-type 'Fn3 comprises the amino acids 9-94 of SEQID NO: 1. domain. In another embodiment, all three of the BC, DE, and In certain embodiments, the "Fn3 domain with an ED tail FGloops are modified relative to the wild-type'Fn3 domain. comprises an E, I or EI at the C-terminus just before the ED In other embodiments, a SABA comprises a sequence having repeats. In some embodiments, the ED repeats enhance the at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% solubility and/or reduces aggregation of the 'Fn3 domain. identity to any one of the 26 core SABA sequences shown in In certain embodiments, a 'Fn3 domain with an ED tail Table 2 (i.e., SEQID NO: 4, 8, 12, 16, 20, and 24-44) or any comprises a modified amino acid sequence in each of the BC, one of the extended SABA sequences shown in Table 2 (i.e., DE and FG loops relative to the wild-type 'Fn3 domain. In SEQ ID NO: 89-116, minus the 6xHIS tag). other embodiments, a "Fn3 domain with an ED tail binds to 10 In certain embodiments, a SABA as described herein may a desired target with a K, of 1 uM or less. comprise the sequence as set forth in SEQ ID NO: 2 or 3, Serum Albumin Binders wherein the BC, DE, and FG loops as represented by (X), "Fn3 domains are cleared rapidly from circulation via (X), and (X), respectively, are replaced with a respective set renal filtration and degradation due to their small size of ~10 of specified BC, DE, and FG loops from any of the 26 core kDa (ta-15-45 minutes in mice; 3 hours in monkeys). In 15 SABA sequences (i.e., SEQ ID NOs: 4, 8, 12, 16, 20, and certain aspects, the application provides "Fn3 domains that 24-44 in Table 2), or sequences at least 75%, 80%, 85%, 90%, bind specifically to serum albumin, e.g., human serum albu 95%, 97%, 98%, or 99% identical to the BC, DE and FG loop min (HSA) to prolong the to of the "Fn3 domain. sequences of the 26 core SABA sequences. In exemplary HSA has a serum concentration of 600 uM and at of 19 embodiments, a SABA as described herein is defined by SEQ days inhumans. The extended t of HSA has been attributed, ID NO:3 and has a set of BC, DE and FG loop sequences from in part, to its recycling via the neonatal Fc receptor (FcRn). any of the 26 core SABA sequences (i.e., SEQID NOs: 4, 8, HSA binds FcRn in a pH-dependent manner after endosomal 12, 16, 20, and 24-44 in Table 2). The scaffold regions of such uptake into endothelial cells; this interaction recycles HSA SABA may have anywhere from 0 to 20, from 0 to 15, from 0 back into the bloodstream, thereby shunting it away from to 10, from 0 to 8, from 0 to 6, from 0 to 5, from 0 to 4, from lysosomal degradation. FcRn is widely expressed and the 25 0 to 3, from 0 to 2, or from 0 to 1 substitutions, conservative recycling pathway is thought to be constitutive. In the major substitutions, deletions or additions relative to the scaffold ity of cell types, most FcRn resides in the intracellular sorting amino acids residues of SEQID NO: 1. For example, SABA1 endosome. HSA is readily internalized by a nonspecific has the core sequence set forth in SEQID NO. 4 and com mechanism of fluid-phase pinocytosis and rescued from deg prises BC, DE, and FG loops as set forth in SEQID NO: 5-7, radation in the lysosome by FcRn. At the acidic pH found in 30 respectively. Therefore, a SABA based on the SABA1 core the endosome, HSA’s affinity for FcRn increases (5 Mat pH may comprise SEQID NO: 2 or 3, wherein (X), comprises 6.0). Once bound to FcRn, HSA is shunted away from the SEQ ID NO. 5, (X), comprises SEQID NO: 6, and (X). lysosomal degradation pathway, transcytosed to and released comprises SEQ ID NO: 7. Similar constructs are contem at the cell surface. plated utilizing the set of BC, DE and FG loops from the other In one aspect, the disclosure provides antibody-like pro 35 SABA core sequences. The scaffold regions of such SABA teins comprising a serum albumin binding "Fn3 domain. In may comprise anywhere from 0 to 20, from 0 to 15, from 0 to exemplary embodiments, the serum albumin binding "Fn3 10, from 0 to 8, from 0 to 6, from 0 to 5, from 0 to 4, from 0 proteins described herein bind to HSA with a K, of less than to 3, from 0 to 2, or from 0 to 1 substitutions, conservative 3 uM, 2.5uM, 2 uM, 1.5uM, 1 uM, 500 nM, 100 nM, 50 nM, substitutions, deletions or additions relative to the scaffold 10 nM, 1 nM, 500 pM, 100 p.M. 100 pM, 50 pM or 10 p.M. In 40 amino acids residues of SEQID NO: 1. Such scaffold modi certain embodiments, the serum albumin binding Fn3 pro fications may be made, so long as the SABA is capable of teins described herein bind to HSA with a K of less than 3 binding serum albumin, e.g., HSA, with a desired K. uM, 2.5uM, 2 uM, 1.5 uM, 1 uM, 500 nM, 100 nM, 50 nM, In certain embodiments, a SABA (e.g., a SABA core 10 nM, 1 nM, 500 pM, 100 pM. 100 pM, 50 pM or 10 pMat sequence or a sequence based thereon as described above) a pH range of 5.5 to 7.4 at 25°C. or 37°C. In some embodi 45 may be modified to comprise an N-terminal extension ments, the serum albumin binding "Fn3 proteins described sequence and/or a C-terminal extension sequence. Exemplary herein bind more tightly to HSA at a pH less than 7.4 as extension sequences are shown in Table 2. compared to the binding affinity for HSA at a pH of 7.4 or For example, SEQ ID NO: 89 designated as SABA1.1 greater. comprises the core SABA 1 sequence (SEQID NO: 4) with an In certain embodiments, the HSA binding "Fn3 proteins 50 N-terminal sequence MGVSDVPRDLE (SEQ ID NO: 45, described herein may also bind serum albumin from one or designated as AdNT1), and a C-terminal sequence EIDKPSQ more of monkey, rat, or mouse. In certain embodiments, the (SEQ ID NO: 54, designated as AdCT1). SABA1.1 further serum albumin binding 'Fn3 proteins described herein bind comprises a His6 tag at the C-terminus, however, it should be to rhesus serum albumin (RhSA) or cynomolgous monkey understood that the His6 tag is completely optional and may serum albumin (CySA) with a K, of less than 3 uM, 2.5uM, 55 be placed anywhere within the N- or C-terminal extension 2 uM, 1.5uM, 1 uM, 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, sequences. Further, any of the exemplary N- or C-terminal 500 pM or 100 p.M. extension sequences provided in Table 2 (SEQID NO: 45-64 In certain embodiments, the serum albumin binding "Fn3 and 215), and any variants thereof, can be used to modify any proteins described herein bind to domain I and/or domain II of given SABA core sequence provided in Table 2. In certain HSA. In one embodiment, the serum albumin binding "Fn3 60 embodiments, a linker sequence provided in Table 2 (SEQID proteins described herein do not bind to domain III of HSA. NOs: 65-88. 216-221 and 397) may be used as a C-terminal In certain embodiments, the serum albumin binding Fn3 tail sequence, either alone or in combination with one of SEQ (SABA) comprises a sequence having at least 40%, 50%, ID NOS: 54-64 or 215. 60%, 70%, 75%, 80% or 85% identity to the wild-type 'Fn3 In certain embodiments, the C-terminal extension domain (SEQID NO: 1). In one embodiment, at least one of 65 sequences (also called “tails'), comprise E and D residues, the BC, DE, or FG loops is modified relative to the wild-type and may be between 8 and 50, 10 and 30, 10 and 20, 5 and 10. "Fn3 domain. In another embodiment, at least two of the BC, and 2 and 4 amino acids in length. In some embodiments, tail US 8,969,289 B2 15 16 sequences include ED-based linkers in which the sequence antigens, or cell signaling proteins. The fusion may beformed comprises tandem repeats of ED. In exemplary embodiments, by attaching the second moiety to either end of the SABA the tail sequence comprises 2-10, 2-7, 2-5, 3-10, 3-7, 3-5, 3, 4 molecule, i.e., SABA-therapeutic molecule or therapeutic or 5 ED repeats. In certain embodiments, the ED-based tail molecule-SABA arrangements. sequences may also include additional amino acid residues, In exemplary embodiments, the therapeutic moiety is such as, for example: EI, EID, ES, EC, EGS, and EGC. Such VEGF, VEGF-R1, VEGF-R2, VEGF-R3, Her-1, Her-2, Her sequences are based, in part, on known Adnectin TM tail 3, EGF-I, EGF-2, EGF-3, Alpha3, cMet, ICOS, CD40L, sequences, such as EIDKPSQ (SEQ ID NO: 54), in which LFA-I, c-Met, ICOS, LFA-I, IL-6, B7.1, W1.2, OX40, IL-Ib, residues D and Khave been removed. In exemplary embodi TACI, IgE, BAFF or BLyS, TPO-R, CD19, CD20, CD22, ments, the ED-based tail comprises an E, I or E1 residues 10 CD33, CD28, IL-I-R1, TNF-alpha, TRAIL-R1, Complement before the ED repeats. Receptor 1, FGFa, Osteopontin, Vitronectin, Ephrin A1-A5, In other embodiments, the tail sequences may be combined Ephrin B1-B3, alpha-2-macroglobulin, CCL1, CCL2. CCL3, with other known linker sequences (e.g., SEQID NO: 65-88. CCL4, CCL5, CCL6, CCL7, CXCL8, CXCL9, CXCL10, 216-221 and 397 in Table 2) as necessary when designing a CXCL11, CXCL12, CCL13, CCL14. CCL15, CXCL16, SABA fusion molecule, e.g., SEQ ID NO: 147 (SABA1 15 CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, FGF21v16), in which EIEDEDEDEDED (SEQID NO: 62) is PDGF, TGFb, GMCSF, SCF, p40 (IL12/IL23), ILIb, ILIa, joined with GSGSGSGS (SEQID NO: 71). IL1ra, IL2, IL3, IL4, IL5, IL6, IL8, IL1O, IL12, IL15, IL23, Fusions of Serum Albumin Binding AdnectinTM (SABA) Fas, FasL, Flt3 ligand, 41 BB, ACE, ACE-2, KGF, FGF-7, One aspect of the present invention provides for conjugates SCF, Netrin1.2, IFNa,b,g, Caspase-2,3,7,8,10, ADAMS1.S5, comprising a serum albuminbinding Fn3 (SABA) and at least 8,9,15.TS1, TS5: Adiponectin, ALCAM, ALK-I, APRIL, one additional moiety. The additional moiety may be useful Annexin V, Angiogenin, Amphiregulin, Angiopoietin-1.2.4. for any diagnostic, imaging, or therapeutic purpose. B7-1/CD80, B7-2/CD86, B7-H1, B7-H2, B7-H3, Bcl-2, In certain embodiments, the serum half-life of the moiety BACE-I, BAK, BCAM, BDNF, bNGF, bECGF, BMP2,3,4, fused to the SABA is increased relative to the serum half-life 5,6,7,8: CRP, Cadherin 6, 8, 11: Cathepsin A.B,C,D.E.L.S.V. of the moiety when not conjugated to the SABA. In certain 25 X; CD1 1a/LFA-1, LFA-3, GP2b3a, GH receptor, RSV F embodiments, the serum half-life of the SABA fusion is at protein, IL-23 (p40, p19), IL-12, CD80, CD86, CD28, least 20, 40, 60, 80, 100, 120, 150, 180, 200, 400, 600, 800, CTLA-4, alpha4-beta1, alpha-4-beta7, TNF/Lymphotoxin, 1000, 1200, 1500, 1800, 1900, 2000, 2500, or 3000% longer IgE, CD3, CD20, IL-6, IL-6R, BLYS/BAFF, IL-2R, HER2, relative to the serum half-life of the moiety when not fused to EGFR, CD33, CD52, Digoxin, Rho (D), Varicella, Hepatitis, the SABA. In other embodiments, the serum half-life of the 30 CMV, Tetanus, Vaccinia, Antivenom, Botulinum, Trail-R1, SABA fusion is at least 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5 Trail-R2, cMet, TNF-R family, such as LANGF-R, CD27. fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 10-fold, CD30, CD40, CD95, Lymphotoxin afb receptor, WsI-I, 12-fold, 13-fold, 15-fold, 17-fold, 20-fold, 22-fold, 25-fold, TL1A/TNFSF15, BAFF, BAFF-R/TNFRSF13C, TRAIL 27-fold, 30-fold, 35-fold, 40-fold, or 50-fold greater than the R2/TNFRSF10B, TRAIL R2/TNFRSF10B, Fas/TNFRSF6 serum half-life of the moiety when not fused to the SABA. In 35 CD27/TNFRSF7, DR3/TNFRSF25, HVEM/TNFRSF14, some embodiments, the serum half-life of the SABA fusion is TROY/TNFRSF19, CD40 Ligand/TNFSF5, BCMA/TN at least 2 hours, 2.5 hours, 3 hours, 4 hours, 5 hours, 6 hours, FRSF17, CD30/TNFRSF8, LIGHT/TNFSF14, 4-1BB/TN 7 hours, 8 hours, 9 hours, 10 hours, 15 hours, 20 hours, 25 FRSF9, CD40/TNFRSF5, GITR/GammaNFRSF 18, hours, 30 hours, 35 hours, 40 hours, 50 hours, 60 hours, 70 Osteoprotegerin/TNFRSF1 IB, RANK/TNFRSF1 IA, hours, 80 hours, 90 hours, 100 hours, 110 hours, 120 hours, 40 TRAIL R3/TNFRSF10C, TRAIL/TNFSFIO, TRANCE/ 130 hours, 135 hours, 140hours, 150 hours, 160 hours, or 200 RANKL/TNFSF11, 4-1BB Ligand/TNFSF9, TWEAK/TN hours. FSF12, CD40 Ligand/TNFSFS, Fas Ligand/TNFSF6, RELT/ In certain embodiments, the SABA fusion proteins bind to TNFRSF19L, APRIL/TNFSF13, DcR3/TNFRSF6B, TNF HSA with a K of less than 3 uM, 2.5uM, 2 uM, 1.5uM, 1 RI/TNFRSFIA TRAIL R1/TNFRSFIOA, TRAIL uM, 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, 500 pM, 100 p.M. 45 R4/TNFRSF10D, CD30 Ligand/TNFSF8, GITR Ligand/ 100 pM, 50 pM or 10 p.M. In certain embodiments, the SABA TNFSF18, TNFSF18, TACI/TNFRSF13B, NGF R/TN fusion proteins bind to HSA with a Kofless than 3 uM, 2.5 FRSF16, OX40 Ligand/TNFSF4, TRAIL R2/TNFRSF10B, uM, 2 uM, 1.5 uM, 1 uM, 500 nM, 100 nM, 50 nM, 10 nM, 1 TRAIL R3/TNFRSF10C, TWEAK R/TNFRSF12, BAFF/ nM,500 pM, 100 pM. 100 pM, 50 pM or 10pMata pH range BLyS/TNFSF13, DR6/TNFRSF21, TNF-alpha/TNFSF1A, of 5.5 to 7.4 at 25° C. or 37° C. In some embodiments, the 50 Pro-TNF-alpha/TNFSF1A, Lymphotoxin beta R/TNFRSF3, SABA fusion proteins bind more tightly to HSA at a pH less Lymphotoxin beta R (LTbR)/Fc Chimera, TNF RI/TNFRS than 7.4 as compared to binding at pH 7.4. FIA, TNF-beta/TNFSF1B, PGRP-S, TNF RI/TNFRSFIA, Accordingly, the SABA fusion molecules described herein TNF RII/TNFRSFIB, EDA-A2, TNF-alpha/TNFSFIA, are useful for increasing the half-life of a therapeutic moiety EDAR, XEDAR, TNF RI/TNFRSFIA. (e.g., FGF21) by creating a fusion between the therapeutic 55 Of particular interest are human target proteins that are moiety and the SABA. Such fusion molecules may be used to commercially available in purified form as well as proteins treat conditions which respond to the biological activity of the that bind to these target proteins. Examples are: 4EBP1, therapeutic moiety contained in the fusion. The present inven 14-3-3 Zeta, 53BP1, 2B4/SLAMF4, CCL21/6Ckine, 4-1BB/ tion contemplates the use of the SABA fusion molecules in TNFRSF9, 8D6A, 4-1BB Ligand/TNFSF9, 8-oxo-dC, diseases caused by the disregulation of any of the following 60 4-Amino-1,8-naphthalimide, A2B5, Aminopeptidase LRAP/ proteins or molecules. ERAP2, A33, Aminopeptidase N/ANPEP, Aag. Aminopepti Heterologous Moiety dase P2/XPNPEP2, ABCG2, Aminopeptidase P1/XPNPEP1, In some embodiments, the SABA is fused to a second ACE, Aminopeptidase PILS/ARTS1, ACE-2, Amnionless, moiety that is a small organic molecule, a nucleic acid, or a Actin, Amphiregulin, beta-Actin, AMPK alpha 1/2, Activin protein. In some embodiments, the SABA is fused to a thera 65 A, AMPK alpha 1, Activin AB, AMPK alpha 2, Activin B, peutic moiety that targets receptors, receptor ligands, viral AMPKbeta1, Activin C, AMPKbeta 2, Activin RIA/ALK-2, coat proteins, immune system proteins, hormones, enzymes, Androgen R/NR3C4, Activin RIB/ALK-4, Angiogenin, US 8,969,289 B2 17 18 Activin RIIA, Angiopoietin-1, Activin RIIB, Angiopoietin-2, tion Factor X, Caspase-4, Coagulation Factor XI, Caspase-6, ADAMS, Angiopoietin-3, ADAM9, Angiopoietin-4, Coagulation Factor XIV/Protein C, Caspase-7, COCO, ADAM1 O. Angiopoietin-like 1, ADAM12, Angiopoietin Caspase-8, Cohesin, Caspase-9, Collagen I, Caspase-10, Col like 2, ADAM15, Angiopoietin-like 3, TACE/ADAM17, lagen II, Caspase-12, Collagen IV, Caspase-13, Common Angiopoietin-like 4, ADAM19, Angiopoietin-like 7/CDT6, gamma Chain/IL-2R gamma, Caspase Peptide Inhibitors, ADAM33, Angiostatin, ADAMTS4, Annexin A1/Annexin I, COMP/Thrombospondin-5, Catalase, Complement Compo ADAMTS5, Annexin A7, ADAMTS1, Annexin A10, nent CIrLP. beta-Catenin, Complement Component CIqA, ADAMTSL-1/Punctin, Annexin V, Adiponectin/Acrp30, Cathepsin 1, Complement Component CIqC. Cathepsin 3. ANP, AEBSF, AP Site, Aggrecan, APAF-I, Agrin, APC, Complement Factor D. Cathepsin 6, Complement Factor I, AgRP APE, AGTR-2, APJ, AIF, APLP-I, Akt, APLP-2, Akt1, 10 Cathepsin A, Complement MASP3, Cathepsin B. Connexin Apollipoprotein AI, Akt2, Apollipoprotein B, Akt3, APP. 43, Cathepsin C/DPPI, Contactin-1, Cathepsin D. Contactin Serum Albumin, APRIL/TNFSF13, ALCAM, ARC, ALK-I, 2/TAG1, Cathepsin E. Contactin-4, Cathepsin F. Contactin-5, Artemin, ALK-7, Arylsulfatase AJARSA, Alkaline Phos Cathepsin H. Corin, Cathepsin L. Cornulin, Cathepsin O, phatase, ASAH2/N-acylsphingosine Amidohydrolase-2, CORS26/CliqTNF.3, Cathepsin S, Rat Cortical Stem Cells, alpha 2u-Globulin, ASC, alpha-1-Acid Glycoprotein, 15 Cathepsin V. Cortisol, Cathepsin XITJ2, COUP-TFI/NR2F1, ASGR1, alpha-Fetoprotein, ASK1, ALS, ATM, Ameloblastic CBP, COUP-TF II/NR2F2, CCI, COX-I, CCK-A R, COX-2, ATRIP, AMICA/JAML, Aurora A, AMIGO, Aurora B, CCL28, CRACC/SLAMF7, CCR1, C-Reactive Protein, AMIG02, Axin-1, AMIG03, AXI, Aminoacylase/ACY1, CCR2, Creatine Kinase, Muscle/CKMM, CCR3, Creatinine, AZurocidin/CAP37/HBP. Aminopeptidase A/ENPEP. CCR4, CREB, CCR5, CREG, CCR6, CRELD1, CCR7, B4GALT1, BIM, B7-1/CD80, 6-Biotin-17-NAD, B7-2/ CRELD2, CCR8, CRHBP, CCR9, CRHR-I, CCR1O, CD86, BLAME/SLAMF8, B7-H1/PD-L1, CXCL13/BLC/ CRIM1, CD155/PVR, Cripto, CD2, CRISP-2, CD3, CRISP BCA-1, B7-H2, BLIMP1, B7-H3, BIk, B7-H4, BMI-I, 3, CD4, Crossveinless-2, CD4+/45RA-, CRTAM, CD4+/ BACE-I, BMP-1/PCP, BACE-2, BMP-2, Bad, BMP-3, 45RO, CRTH-2, CD4+/CD62L-/CD44, CRY1, CD4+/ BAFF/TNFSF13B, BMP-3b/GDF-10, BAFF R/TNFRSF CD62L+/CD44, Cryptic, CD5, CSB/ERCC6, CD6, CCL27/ 13C, BMP-4, Bag-1, BMP-5, BAK, BMP-6, BAMBI/NMA, 25 CTACK, CD8, CTGF/CCN2, CD8+/45RA-, CTLA-4, BMP-7, BARD 1, BMP-8, Bax, BMP-9, BCAM, BMP-10, CD8+/45RO-, Cubilin, CD9, CX3CR1, CD14, CXADR, Bcl-10, BMP-15/GDF-9B, Bcl-2, BMPR-IA/ALK-3, Bcl-2 CD27/TNFRSF7, CXCL16, CD27 Ligand/TNFSF7, related protein A1, BMPR-IB/ALK-6, Bcl-w, BMPR-II, Bcl CXCR3, CD28, CXCR4, CD30/TNFRSF8, CXCR5, CD30 x, BNIP3L, Bcl-XL, BOC, BCMA/TNFRSF17, BOK, Ligand/TNFSF8, CXCR6, CD31/PECAM-1, Cyclophilin A, BDNF, BPDE, Benzamide, Brachyury, Common beta Chain, 30 CD34, Cyró1/CCN1, CD36/SR-B3, Cystatin A, CD38, Cys B-Raf, beta IG-H3, CXCL14/BRAK, Betacellulin, BRCA1, tatin B, CD40/TNFRSF5, Cystatin C, CD40 Ligand/TN beta-Defensin 2. BRCA2, BID, BTLA, Biglycan, Bub-1, FSF5, Cystatin D, CD43, Cystatin E/M, CD44, Cystatin F, Bik-like Killer Protein, c-jun, CD90/Thyl, c-Rel, CD94, CD45, Cystatin H, CD46, Cystatin H2, CD47, Cystatin S, CCL6/C10, CD97, CIq R1/CD93, CD151, CIqTNF1, CD48/SLAMF2, Cystatin SA, CD55/DAF, Cystatin SN, CD160, CldTNF4, CD163, CldTNF5, CD164, Complement 35 CD58/LFA-3, Cytochrome c, CD59, Apocytochrome c, Component CIr, CD200, Complement Component CIs, CD68, Holocytochrome c, CD72, Cytokeratin 8, CD74, CD200 R1, Complement Component C2, CD229/SLAMF3, Cytokeratin 14, CD83, Cytokeratin 19, CD84/SLAMF5, Complement Component C3a, CD23/Fc epsilon R11, Cytonin, D6, DISP1, DAN, Dkk-1, DANCE, Dkk-2, Complement Component C3d, CD2F-10/SLAMF9, Comple DARPP-32, Dkk-3, DAX1/NROB1, Dkk-4, DCC, DLEC, ment Component C5a, CD5L, Cadherin-4/R-Cadherin, 40 DCIR/CLEC4A, DLL1, DCAR, DLL4, DcR3/TNFRSF6B, CD69, Cadherin-6, CDC2, Cadherin-8, CDC25A, Cadherin d-Luciferin, DC-SIGN, DNA Ligase IV, DC-SIGNR/CD299, 11, CDC25B, Cadherin-12, CDCP1, Cadherin-13, CDO, DNA Polymerase beta, DcTRAILR1/TNFRSF23, DNAM-I, Cadherin-17, CDX4, E-Cadherin, CEACAM-1/CD66a, DcTRAIL R2/TNFRSF22, DNA-PKcs, DDR1, DNER, N-Cadherin, CEACAM-6, P-Cadherin, Cerberus 1,VE-Cad DDR2, Dopa Decarboxylase/DDC, DEC-205, DPCR-I, herin, CFTR, Calbindin D, c0MP, CalcineurinA, Chem R23, 45 Decapentaplegic, DPP6, Decorin, DPP A4, Dectin-1/ Calcineurin B, Chemerin, Calreticulin-2, Chemokine Sam CLEC7A, DPPA5/ESG1, Dectin-2/CLEC6A, DPPII/QPP/ pler Packs, CaMKinase II, Chitinase 3-like 1, cAMP, Chitot DPP7, DEP-1/CD148, DPPIV/CD26, Desert Hedgehog, riosidase/CHIT1, Cannabinoid R1, Chk1, Cannabinoid DR3/TNFRSF25, Desmin, DR6/TNFRSF21, Desmoglein-1, R2/CB2/CNR2, Chk2, CAR/NR1 I3, CHL-1/L1CAM-2, DSCAM, Desmoglein-2, DSCAM-L1, Desmoglein-3, Carbonic Anhydrase I, Choline Acetyltransferase/CbAT, Car 50 DSPG3, Dishevelled-1, Ditk, Dishevelled-3, Dynamin, bonic Anhydrase II, Chondrollectin, Carbonic Anhydrase III, EAR2/NR2F6, Eph A5, ECE-I, EphA6, ECE-2, EphA7, Chordin, Carbonic Anhydrase IV. Chordin-Like 1, Carbonic ECF-L/CHI3L3, EphA8, ECM-I, EphB1, Ecotin, EphB2, Anhydrase VA, Chordin-Like 2. Carbonic Anhydrase VB, EDA, EphB3, EDA-A2, EphB4, EDAR, EphB6, EDG-I, CINC-I, Carbonic Anhydrase VI, CINC-2, Carbonic Anhy Ephrin, EDG-5, Ephrin-A1, EDG-8, Ephrin-A2, eEF-2, Eph drase VII, CINC-3, Carbonic Anhydrase VIII, Claspin, Car 55 rin-A3, EGF, Ephrin-A4, EGFR, Ephrin-A5, EGR1, Ephrin bonic Anhydrase IX, Claudin-6, Carbonic Anhydrase X, B, EG-VEGF/PK1, Ephrin-B1, eIF2 alpha, Ephrin-B2, CLC, Carbonic Anhydrase XII, CLEC-I, Carbonic Anhy eIF4E, Ephrin-B3, EIk-I, Epigen, EMAP-II, Epimorphin/ drase XIII, CLEC-2, Carbonic Anhydrase XIV, CLECSF Syntaxin 2, EMMPRIN/CD147, Epiregulin, CXCL5/ENA, 13/CLEC4F, Carboxymethyl Lysine, CLECSF8, Carbox EPR-1/Xa Receptor, Endocan, ErbB2, Endoglin/CD105, ypeptidase A1/CPA1, CLF-I, Carboxypeptidase A2, CL-P1/ 60 ErbB3, Endoglycan, ErbB4, Endonuclease III, ERCC1, COLEC12, Carboxypeptidase A4 Clusterin, Carboxypepti Endonuclease IV, ERCC3, Endonuclease V, ERK1/ERK2, dase B1, Clusterin-like 1, Carboxypeptidase E/CPE, CMG-2, Endonuclease VIII, ERK1, Endorepellin/Perlecan, ERK2, Carboxypeptidase X1, CMV UL146, Cardiotrophin-1, CMV Endostatin, ERK3, Endothelin-1, ERK5/BMK1, Engrailed UL147, Carnosine Dipeptidase 1, CNP. Caronte, CNTF, 2, ERR alpha/NR3B1, EN-RAGE, ERR beta/NR3B2, CART. CNTF R alpha, Caspase, Coagulation Factor 65 Enteropeptidase/Enterokinase, ERR gamma/NR3B3, CCL1 II/Thrombin, Caspase-1, Coagulation Factor I11/Tissue Fac 1/Eotaxin, Erythropoietin, CCL24/Eotaxin-2, Erythropoietin tor, Caspase-2, Coagulation Factor VII, Caspase-3, Coagula R. CCL26/Eotaxin-3, ESAM, EpCAM/TROP-1, ER alpha/

US 8,969,289 B2 23 24 din-2, TROY/TNFRSF 19, Thrombospondin-4, Trypsin 1, 3, Chloride intracellular channel protein 4, Chloride intracel Thymopoietin, Trypsin 2/PRSS2, Thymus Chemokine-1, lular channel protein 5, CHRNA3 protein, Clcn3e protein, Trypsin 3/PRSS3, Tie-1, Tryptase-5/Prss32, Tie-2. Tryptase CLCNKB protein, CNGA4 protein, Cullin-5, Cyclic GMP alpha/TPS1, TIM-I/KIM-I/HAVCR, Tryptase beta-1/MCPT gated potassium channel, Cyclic-nucleotide-gated cation 7, TIM-2, Tryptase beta-2/TPSB2, TIM-3, Tryptase epsilon/ channel 4, Cyclic-nucleotide-gated cation channel alpha 3. BSSP-4, TIM-4, Tryptase gamma-1/TPSG1, TIM-5, Tryp Cyclic-nucleotide-gated cation channel beta 3, Cyclic-nucle tophan Hydroxylase, TIM-6, TSC22, TIMP-I, TSG, TIMP-2, otide-gated olfactory channel, Cystic fibrosis transmembrane TSG-6, TIMP-3, TSK, TIMP-4, TSLP, TL1A/TNFSF15, conductance regulator, Cytochrome B-245 heavy chain, TSLP R, TLR1, TSP50, TLR2, beta-III Tubulin, TLR3, Dihydropyridine-sensitive L-type, calcium channel alpha-2/ TWEAK/TNFSF12, TLR4, TWEAK R/TNFRSF 12, TLR5, 10 delta Subunits precursor, FXYD domain-containing ion trans Tyk2, TLR6, Phospho-Tyrosine, TLR9, Tyrosine Hydroxy port regulator 3 precursor, FXYD domain-containing ion lase, TLX/NR2E1, Tyrosine Phosphatase Substrate I. Ubiq transport regulator 5 precursor, FXYD domain-containing uitin, UNC5H3, Ugi, UNC5H4, UGRP1, UNG, ULBP-I, ion transport regulator 6 precursor, FXYD domain-contain uPA, ULBP-2, uPAR, ULBP-3, URB, UNC5H1 UVDE, ing ion transport regulator 7, FXYD domain-containing ion UNC5H2, Vanilloid R1, VEGF R, VASA, VEGF R1/Flt-1, 15 transport regulator 8 precursor, G protein-activated inward Vasohibin, VEGF R2/KDR/Flk-1, Vasorin, VEGFR3/FU-4, rectifier potassium channel 1, G protein-activated inward rec Vasostatin, Versican, Vav-1, VG5Q, VCAM-1, VHR, VDR/ tifier potassium channel 2, G protein-activated inward recti NR1 I1, Vimentin, VEGF, Vitronectin, VEGF-B, VLDLR, fier potassium channel 3, G protein-activated inward rectifier VEGF-C. v WF-A2, VEGF-D, Synuclein-alpha, Ku70, potassium channel 4. Gamma-aminobutyric-acid receptor WASP Wnt-7b, WIF-I, Wnt-8a WISP-1/CCN4, Wnt-8b, alpha-1 subunit precursor, Gamma-aminobutyric-acid recep WNK1, Wnt-9a, Wnt-1, Wnt-9b, Wnt-3a, Wnt-10a, Wnt-4, tor alpha-2 subunit precursor, Gamma-aminobutyric-acid Wnt-10b, Wnt-5a, Wnt-11, Wnt-5b, winvNS3, Wnt7a, XCR1, receptor alpha-3 subunit precursor, Gamma-aminobutyric XPE/DDB1, XEDAR, XPE/DDB2, Xg, XPF, XIAP, XPG, acid receptor alpha-4 Subunit precursor, Gamma-aminobu XPA, XPV, XPD, XRCC1, Yes, YY1, EphA4. tyric-acid receptor alpha-5 subunit precursor, Gamma-ami Numerous human ion channels are targets of particular 25 nobutyric-acid receptor alpha-6 Subunit precursor, Gamma interest. Non-limiting examples include 5-hydrox aminobutyric-acid receptor beta-1 subunit precursor, ytryptamine 3 receptor B subunit, 5-hydroxytryptamine 3 Gamma-aminobutyric-acid receptor beta-2 subunit precur receptor precursor, 5-hydroxytryptamine receptor 3 subunit Sor, Gamma-aminobutyric-acid receptor beta-3 Subunit pre C, AAD 14 protein, Acetylcholine receptor protein, alpha cursor, Gamma-aminobutyric-acid receptor delta Subunit Subunit precursor, Acetylcholine receptor protein, beta Sub 30 precursor, Gamma-aminobutyric-acid receptor epsilon Sub unit precursor, Acetylcholine receptor protein, delta Subunit unit precursor, Gamma-aminobutyric-acid receptor gamma-1 precursor, Acetylcholine receptor protein, epsilon subunit subunit precursor, Gamma-aminobutyric-acid receptor precursor, Acetylcholine receptor protein, gamma Subunit gamma-3 subunit precursor, Gamma-aminobutyric-acid precursor, Acid sensing ion channel 3 splice variant b, Acid receptor pi Subunit precursor, Gamma-aminobutyric-acid sensing ion channel 3 splice variant c, Acid sensing ion chan 35 receptor rho-1 subunit precursor, Gamma-aminobutyric-acid nel 4. ADP-ribose pyrophosphatase, mitochondrial precursor, receptor rho-2 subunit precursor, Gamma-aminobutyric-acid Alpha1 A-Voltage-dependent calcium channel, Amiloride receptor theta subunit precursor, GluR6 kainate receptor, sensitive cation channel 1, neuronal, Amiloride-sensitive cat Glutamate receptor 1 precursor, Glutamate receptor 2 precur ion channel 2, neuronal Amiloride-sensitive cation channel 4. Sor, Glutamate receptor 3 precursor, Glutamate receptor 4 isoform 2, Amiloride-sensitive sodium channel, Amiloride 40 precursor, Glutamate receptor 7. Glutamate receptor B. sensitive Sodium channel alpha-Subunit, Amiloride-sensitive Glutamate receptor delta-1 subunit precursor, Glutamate Sodium channel beta-subunit, Amiloride-sensitive sodium receptor, ionotropic kainate 1 precursor, Glutamate receptor, channel delta-Subunit, Amiloride-sensitive sodium channel ionotropic kainate 2 precursor, Glutamate receptor, ionotro gamma-Subunit, Annexin A7, Apical-like protein, ATP-sen pickainate 3 precursor, Glutamate receptor, ionotropic kain sitive inward rectifier potassium channel 1, ATP-sensitive 45 ate 4 precursor, Glutamate receptor, ionotropic kainate 5 pre inward rectifier potassium channel 10, ATP-sensitive inward cursor, Glutamate NMDA receptor subunit 3A precursor, rectifier potassium channel 11, ATP-sensitive inward rectifier Glutamate NMDA receptor subunit 3B precursor, potassium channel 14, ATP-sensitive inward rectifier potas Glutamate NMDA receptor subunit epsilon 1 precursor, sium channel 15, ATP-sensitive inward rectifier potassium Glutamate NMDA receptor subunit epsilon 2 precursor, channel 8, Calcium channel alpha12.2 Subunit, Calcium 50 Glutamate NMDA receptor subunit epsilon 4 precursor, channel alpha12.2 subunit, Calcium channel alpha1E sub Glutamate NMDA receptor subunit Zeta 1 precursor, Gly unit, delta19 delta40 delta46 splice variant, Calcium-acti cine receptor alpha-1 chain precursor, Glycine receptor vated potassium channel alpha Subunit 1, Calcium-activated alpha-2 chain precursor, Glycine receptor alpha-3 chain pre potassium channel beta Subunit 1, Calcium-activated potas cursor, Glycine receptor beta chain precursor, H/ACA ribo sium channel beta subunit 2, Calcium-activated potassium 55 nucleoprotein complex subunit 1, High affinity immunoglo channel beta subunit 3, Calcium-dependent chloride channel bulin epsilon receptor beta-subunit, Hypothetical protein 1, Cation channel TRPM4B, CDNA FLJ90453 fis, clone DKFZp31310334, Hypothetical protein DKFZp761M1724, NT2RP300 1542, highly similar to Potassium channel tet Hypothetical protein FLJ12242, Hypothetical protein ramerisation domain containing 6, CDNA FLJ90663 fis, FLJ14389, Hypothetical protein FLJ14798, Hypothetical clone PLACE 1005031, highly similar to Chloride intracel 60 protein FLJ14995, Hypothetical protein FLJ16180, Hypo lular channel protein 5, CGMP-gated cation channel beta thetical protein FLJ16802, Hypothetical protein FLJ32069, subunit, Chloride channel protein, Chloride channel protein Hypothetical protein FLJ37401, Hypothetical protein 2, Chloride channel protein 3, Chloride channel protein 4, FLJ38750, Hypothetical protein FLJ40162, Hypothetical Chloride channel protein 5, Chloride channel protein 6, Chlo protein FLJ41415, Hypothetical protein FLJ90576, Hypo ride channel protein C1C-Ka, Chloride channel protein C1C 65 thetical protein FLJ90590, Hypothetical protein FLJ90622, Kb, Chloride channel protein, skeletal muscle, Chloride Hypothetical protein KCTD15, Hypothetical protein intracellular channel 6, Chloride intracellular channel protein MGC15619, Inositol 1,4,5-trisphosphate receptor type 1, US 8,969,289 B2 25 26 Inositol 1,4,5-trisphosphate receptor type 2, Inositol 1,4,5- gated channel Subfamily D member 2, Potassium Voltage trisphosphate receptor type 3. Intermediate conductance cal gated channel subfamily D member 3, Potassium voltage cium-activated potassium channel protein 4. Inward rectifier gated channel Subfamily E member 1, Potassium Voltage potassium channel 13, Inward rectifier potassium channel 16, gated channel Subfamily E member 2, Potassium Voltage Inward rectifier potassium channel 4. Inward rectifying K(+) gated channel Subfamily E member 3, Potassium Voltage channel negative regulator Kir2.2v, Kainate receptor Subunit gated channel Subfamily E member 4, Potassium Voltage KA2a, KCNH5 protein, KCTD 17 protein, KCTD2 protein, gated channel Subfamily F member 1, Potassium Voltage Keratinocytes associated transmembrane protein 1, KV chan gated channel Subfamily G member 1, Potassium Voltage nel-interacting protein 4, Melastatin 1, Membrane protein gated channel Subfamily G member 2, Potassium Voltage MLC1, MGC 15619 protein, Mucolipin-1, Mucolipin-2, 10 gated channel Subfamily G member 3, Potassium Voltage Mucolipin-3, Multidrug resistance-associated protein 4. gated channel Subfamily G member 4, Potassium Voltage N-methyl-D-aspartate receptor 2C subunit precursor, gated channel Subfamily H member 1, Potassium Voltage NADPH oxidase homolog 1, Nav1.5, Neuronal acetylcholine gated channel Subfamily H member 2, Potassium Voltage receptor protein, alpha-10 subunit precursor, Neuronal ace gated channel subfamily H member 3, Potassium voltage tylcholine receptor protein, alpha-2 subunit precursor, Neu 15 gated channel Subfamily H member 4, Potassium Voltage ronal acetylcholine receptor protein, alpha-3 subunit precur gated channel subfamily H member 5, Potassium voltage Sor, Neuronal acetylcholine receptor protein, alpha-4 Subunit gated channel Subfamily H member 6, Potassium Voltage precursor, Neuronal acetylcholine receptor protein, alpha-5 gated channel subfamily H member 7, Potassium voltage Subunit precursor, Neuronal acetylcholine receptor protein, gated channel subfamily H member 8, Potassium voltage alpha-6 subunit precursor, Neuronal acetylcholine receptor gated channel subfamily KQT member 1, Potassium voltage protein, alpha-7 Subunit precursor, Neuronal acetylcholine gated channel subfamily KQT member 2, Potassium voltage receptor protein, alpha-9 subunit precursor, Neuronal acetyl gated channel subfamily KQT member 3, Potassium voltage choline receptor protein, beta-2 subunit precursor, Neuronal gated channel subfamily KQT member 4, Potassium voltage acetylcholine receptor protein, beta-3 subunit precursor, Neu gated channel subfamily KQT member 5, Potassium voltage ronal acetylcholine receptor protein, beta-4 Subunit precur 25 gated channel Subfamily S member 1, Potassium Voltage Sor, Neuronal Voltage-dependent calcium channel alpha 2D gated channel Subfamily S member 2, Potassium Voltage subunit, P2X purinoceptor 1, P2X purinoceptor 2, P2X gated channel subfamily S member 3, Potassium voltage purinoceptor 3, P2X purinoceptor 4, P2X purinoceptor 5, gated channel Subfamily V member 2, Potassium Voltage P2X purinoceptor 6, P2X purinoceptor 7, Pancreatic potas gated channel, subfamily H. member 7, isoform 2, Potassium/ sium channel TALK-Ib, Pancreatic potassium channel 30 Sodium hyperpolarization-activated cyclic nucleotide-gated TALK-Ic, Pancreatic potassium channel TALK-Id, Phosp channel 1, Potassium/sodium hyperpolarization-activated holemman precursor, Plasmolipin, Polycystic kidney disease cyclic nucleotide-gated channel 2, Potassium/sodium hyper 2 related protein, Polycystic kidney disease 2-like 1 protein, polarization-activated cyclic nucleotide-gated channel 3. Polycystic kidney disease 2-like 2 protein, Polycystic kidney Potassium/sodium hyperpolarization-activated cyclic nucle disease and receptor for egg jelly related protein precursor, 35 otide-gated channel 4, Probable mitochondrial import recep Polycystin-2, Potassium channel regulator, Potassium chan tor subunit TOM40 homolog, Purinergic receptor P2X5, iso nel subfamily K member 1, Potassium channel subfamily K form A. Putative 4 repeat Voltage-gated ion channel, Putative member 10, Potassium channel subfamily K member 12, chloride channel protein 7, Putative GluR6 kainate receptor, Potassium channel subfamily K member 13, Potassium chan Putative ion channel protein CATSPER2 variant 1, Putative nel subfamily K member 15, Potassium channel subfamily K 40 ion channel protein CATSPER2 variant 2, Putative ion chan member 16, Potassium channel subfamily K member 17, nel protein CATSPER2 variant 3, Putative regulator of potas Potassium channel subfamily K member 2, Potassium chan sium channels protein variant 1, Putative tyrosine-protein nel subfamily K member 3, Potassium channel subfamily K phosphatase TPTE, Ryanodine receptor 1, Ryanodine recep member 4, Potassium channel subfamily K member 5, Potas tor 2, Ryanodine receptor 3, SH3 KBP1 binding protein 1, sium channel subfamily K member 6, Potassium channel 45 Short transient receptor potential channel 1, Short transient subfamily K member 7, Potassium channel subfamily K receptor potential channel 4. Short transient receptor poten member 9, Potassium channel tetramerisation domain con tial channel 5, Short transient receptor potential channel 6, taining 3, Potassium channel tetramerisation domain contain Short transient receptor potential channel 7, Small conduc ing protein 12, Potassium channel tetramerisation domain tance calcium-activated potassium channel protein 1, Small containing protein 14, Potassium channel tetramerisation 50 conductance calcium-activated potassium channel protein 2, domain containing protein 2, Potassium channel tetramerisa isoform b. Small conductance calcium-activated potassium tion domain containing protein 4, Potassium channel tet channel protein 3, isoform b. Small-conductance calcium ramerisation domain containing protein 5. Potassium channel activated potassium channel SK2, Small-conductance cal tetramerization domain containing 10, Potassium channel tet cium-activated potassium channel SK3, Sodium channel, ramerization domain containing protein 13, Potassium chan 55 Sodium channel beta-1 subunit precursor, Sodium channel nel tetramerization domain-containing 1, Potassium Voltage protein type II alpha subunit, Sodium channel protein type III gated channel Subfamily A member 1, Potassium Voltage alpha Subunit, Sodium channel protein type IV alpha subunit, gated channel Subfamily A member 2, Potassium Voltage Sodium channel protein type IXalpha subunit, Sodium chan gated channel Subfamily A member 4, Potassium Voltage nel protein type Valpha Subunit, Sodium channel protein type gated channel Subfamily A member 5, Potassium Voltage 60 VII alpha subunit, Sodium channel protein type VIII alpha gated channel Subfamily A member 6, Potassium Voltage Subunit, Sodium channel protein type X alpha subunit, gated channel Subfamily B member 1, Potassium Voltage Sodium channel protein type XI alpha subunit, Sodium- and gated channel Subfamily B member 2, Potassium Voltage chloride-activated ATP-sensitive potassium channel, gated channel Subfamily C member 1, Potassium Voltage Sodium/potassium-transporting ATPase gamma chain, gated channel Subfamily C member 3, Potassium Voltage 65 Sperm-associated cation channel 1, Sperm-associated cation gated channel Subfamily C member 4, Potassium Voltage channel 2, isoform 4, Syntaxin-1B1, Transient receptor gated channel Subfamily D member 1, Potassium Voltage potential cation channel Subfamily A member 1, Transient US 8,969,289 B2 27 28 receptor potential cation channel subfamily M member 2, phylatoxin, Fmet-leu-phe, APJ like, Interleukin-8 type A, Transient receptor potential cation channel subfamily M Interleukin-8 type B, Interleukin-8 type others, C. C member 3, Transient receptor potential cation channel Sub Chemokinetype 1 through type 11 and other types, C X—C family M member 6, Transient receptor potential cation chan Chemokine (types 2 through 6 and others), C X3-C nel subfamily M member 7, Transient receptor potential cat Chemokine, Cholecystokinin CCK, CCK type A, CCK type ion channel subfamily V member 1, Transient receptor B, CCK others, Endothelin, Melanocortin (Melanocyte potential cation channel subfamily V member 2, Transient stimulating hormone, Adrenocorticotropic hormone, Mel receptor potential cation channel subfamily V member 3, anocortin hormone), Duffy antigen, Prolactin-releasing pep Transient receptor potential cation channel subfamily V tide (GPR10), NeuropeptideY (type 1 through 7), Neuropep member 4, Transient receptor potential cation channel Sub 10 tide Y. NeuropeptideY other, Neurotensin, Opioid (type D, K. family V member 5, Transient receptor potential cation chan M, X). Somatostatin (type 1 through 5), Tachykinin (Sub nel subfamily V member 6, Transient receptor potential chan stance P(NK1), Substance K (NK2), Neuromedin K (NK3), nel 4 epsilon splice variant, Transient receptor potential Tachykinin like 1, Tachykinin like 2, Vasopressin/vasotocin channel 4 Zeta splice variant, Transient receptor potential (type 1 through 2), Vasotocin, Oxytocin/mesotocin, Cono channel 7 gamma splice variant, Tumor necrosis factor, 15 pressin, Galanin like, Proteinase-activated like, Orexin & alpha-induced protein 1, endothelial. Two-pore calcium neuropeptides FF.ORFP Chemokine receptor-like, Neuro channel protein 2, VDAC4 protein, Voltage gated potassium medin U like (Neuromedin U, PRXamide), hormone protein channel Kv3.2b, Voltage gated sodium channel beta1B sub (Follicle stimulating hormone, Lutropin-choriogonadotropic unit, Voltage-dependent anion channel, Voltage-dependent hormone, Thyrotropin, Gonadotropin type I, Gonadotropin anion channel 2, Voltage-dependent anion-selective channel type II), (Rhod).opsin, Rhodopsin Vertebrate (types 1-5), protein 1, Voltage-dependent anion-selective channel protein Rhodopsin Vertebrate type 5, Rhodopsin Arthropod, Rhodop 2, Voltage-dependent anion-selective channel protein 3, Volt sin Arthropod type 1, Rhodopsin Arthropod type 2, Rhodop age-dependent calcium channel gamma-1 subunit, Voltage sin Arthropod type 3, Rhodopsin Mollusc, Rhodopsin, Olfac dependent calcium channel gamma-2 subunit, Voltage-de tory (Olfactory II fam 1 through 13), Prostaglandin pendent calcium channel gamma-3 subunit, Voltage 25 (prostaglandin E2 subtype EP1, Prostaglandin E2/D2 sub dependent calcium channel gamma-4 subunit, Voltage type EP2, prostaglandin E2 subtype EP3, Prostaglandin E2 dependent calcium channel gamma-5 subunit, Voltage subtype EP4, Prostaglandin F2-alpha, Prostacyclin, Throm dependent calcium channel gamma-6 Subunit, Voltage boxane, Adenosine type 1 through 3, Purinoceptors, dependent calcium channel gamma-7 Subunit, Voltage Purinoceptor P2RY1-4,6,1 1 GPR91, Purinoceptor P2RY5, dependent calcium channel gamma-8 subunit, Voltage 30 8,9,10 GPR35,92,174, Purinoceptor P2RY12-14 GPR87 dependent L-type calcium channel alpha-1C Subunit, (UDP-Glucose), Cannabinoid, Platelet activating factor, Voltage-dependent L-type calcium channel alpha-1D sub Gonadotropin-releasing hormone, Gonadotropin-releasing unit, Voltage-dependent L-type calcium channel alpha-IS hormone type I, Gonadotropin-releasing hormone type II, Subunit, Voltage-dependent L-type calcium channel beta-1 Adipokinetic hormone like, Corazonin, Thyrotropin-releas Subunit, Voltage-dependent L-type calcium channel beta-2 35 ing hormone & Secretagogue, Thyrotropin-releasing hor Subunit, Voltage-dependent L-type calcium channel beta-3 mone, Growth hormone secretagogue, Growth hormone Subunit, Voltage-dependent L-type calcium channel beta-4 secretagogue like, Ecdysis-triggering hormone (ETHR), Subunit, Voltage-dependent N-type calcium channel alpha Melatonin, Lysosphingolipid & LPA (EDG), Sphingosine 1B subunit, Voltage-dependent P/O-type calcium channel 1-phosphate Edg-1. Lysophosphatidic acid Edg-2, Sphin alpha-1A subunit, Voltage-dependent R-type calcium chan 40 gosine 1-phosphate Edg-3. Lysophosphatidic acid Edg-4. nel alpha-1E Subunit, Voltage-dependent T-type calcium Sphingosine 1-phosphate Edg-5, Sphingosine 1-phosphate channel alpha-1G subunit, Voltage-dependent T-type calcium Edg-6, Lysophosphatidic acid Edg-7, Sphingosine 1-phos channel alpha-1H subunit, Voltage-dependent T-type calcium phate Edg-8, Edg Other Leukotriene B4 receptor, Leukot channel alpha-1 I subunit, Voltage-gated L-type calcium riene B4 receptor BLT1, Leukotriene B4 receptor BLT2, channel alpha-1 subunit, Voltage-gated potassium channel 45 Class A Orphan/other, Putative neurotransmitters, SREB, beta-1 subunit, Voltage-gated potassium channel beta-2 Sub Mas proto-oncogene & Mas-related (MRGs), GPR45 like, unit, Voltage-gated potassium channel beta-3 subunit, Volt Cysteinyl leukotriene, G-protein coupled bile acid receptor, age-gated potassium channel KCNA7. The Nav1.x family of Free fatty acid receptor (GP40, GP41, GP43), Class B Secre human Voltage-gated sodium channels is also a particularly tin like, Calcitonin, Corticotropin releasing factor, Gastric promising target. This family includes, for example, channels 50 inhibitory peptide, Glucagon, Growth hormone-releasing Nav1.6 and Nav1.8. hormone, Parathyroid hormone, PACAP Secretin, Vasoactive In other embodiments, the therapeutic protein may be a intestinal polypeptide, Latrophilin, Latrophilin type 1, Latro G-Protein Coupled Receptors (GPCRs). Exemplary GPCRs philin type 2. Latrophilin type 3, ETL receptors, Brain-spe include but are not limited to Class A Rhodopsin like recep cific angiogenesis inhibitor (BAI), Methuselah-like proteins tors such as Muscatinic (Muse.)acetylcholine Vertebrate type 55 (MTH), Cadherin EGF LAG (CELSR), Very large G-protein 1, Muse, acetylcholine Vertebrate type 2, Muse, acetylcholine coupled receptor, Class C Metabotropic glutamate/phero Vertebrate type 3, Muse, acetylcholine Vertebrate type 4: mone, Metabotropic glutamate group I through III, Calcium Adrenoceptors (Alpha Adrenoceptors type 1, Alpha Adreno sensing like, Extracellular calcium-sensing, Pheromone, cal ceptors type 2. Beta Adrenoceptors type 1, Beta Adrenocep cium-sensing like other, Putative pheromone receptors, tors type 2. Beta Adrenoceptors type 3. Dopamine Vertebrate 60 GABA-B, GABA-B subtype 1, GABA-B subtype 2, type 1, Dopamine Vertebrate type 2, Dopamine Vertebrate GABA-B like, Orphan GPRC5, Orphan GPCR6, Bride of type 3. Dopamine Vertebrate type 4. Histamine type 1. His sevenless proteins (BOSS), Taste receptors (T1R), Class D tamine type 2. Histamine type 3. Histamine type 4, Serotonin Fungal pheromone, Fungal pheromone A-Factor like type 1, Serotonin type 2, Serotonin type 3, Serotonin type 4. (STE2.STE3), Fungal pheromone B like (BAR.BBR.RCB, Serotonin type 5, Serotonin type 6, Serotonin type 7, Seroto 65 PRA), Class E cAMP receptors, Ocular albinism proteins, nin type 8, other Serotonin types, Trace amine, Angiotensin Frizzled/Smoothened family, frizzled Group A (FZ type 1, Angiotensin type 2, Bombesin, Bradykinin, C5a ana 1&2&4&5&7-9), frizzled Group B (FZ3& 6), frizzled Group US 8,969,289 B2 29 30 C (other), Vomeronasal receptors, Nematode chemorecep titis C viral infection (HCV)), interferon alfa-n3 (oral), tors, Insectodorant receptors, and Class ZArchaeal/bacterial/ belatacept, transdermal insulin patches, AMG-531, MBP fingal opsins. 8298, Xerecept, opebacan, AIDSVAX, GV-1001, LymphoS In other embodiments, the SABA fusions described herein can, ranpirinase, Lipoxysan, lusupultide, MP52 (beta-tricalci may comprise any of the following active polypeptides: umphosphate carrier, bone regeneration), melanoma vaccine, BOTOX, Myobloc, Neurobloc, Dysport (or other serotypes sipuleucel-T, CTP-37. Insegia, Vitespen, human thrombin of botulinum neurotoxins), alglucosidase alfa, daptomycin, (frozen, surgical bleeding), thrombin, TransMID, alfime YH-16, choriogonadotropin alfa, filgrastim, cetrorelix, inter prase, Puricase, terlipressin (intravenous, hepatorenal Syn leukin-2, aldesleukin, teceleukin, denileukin diftitox, inter drome), EUR-1008M, recombinant FGF-I (injectable, vascu feron alfa-n3 (injection), interferon alfa-n1, DL-8234, inter 10 lar disease), BDM-E, rotigaptide, ETC-216, P-113, MBI feron, Suntory (gamma-la), interferon gamma, thymosin 594AN, duramycin (inhaled, cystic fibrosis), SCV-07, OPI alpha 1, tasonermin, DigiFab, ViperaTAb, EchiTAb, CroFab, 45, Endostatin, Angiostatin, ABT-510, Bowman Birk nesiritide, abatacept, alefacept, Rebif eptoterminalfa, teri Inhibitor Concentrate, XMP-629,99mTc-Hynic-Annexin V. paratide (osteoporosis), calcitonin injectable (bone disease), kahalalide F, CTCE-9908, teverelix (extended release), oza calcitonin (nasal, osteoporosis), etanercept, hemoglobin 15 relix, romidepsin, BAY-50-4798, interleukin-4, PRX-321, glutamer 250 (bovine), drotrecogin alfa, collagenase, carper Pepscan, iboctadekin, rh lactoferrin, TRU-015, IL-21, ATN itide, recombinant human epidermal growth factor (topical 161, cilengitide, Albuferon, Biphasix, IRX-2, omega inter gel, wound healing), DWP-401, darbepoetin alfa, epoetin feron, PCK-3145, CAP-232, pasireotide, huN901-DM1, ova omega, epoetin beta, epoetin alfa, desirudin, lepirudin, biva rian cancer immunotherapeutic vaccine, SB-249553, lirudin, nonacog alpha, Mononine, eptacog alfa (activated), Oncovax-CL, OncoVax-P. BLP-25, CerVax-16, multi recombinant Factor VIII+VWF, Recombinate, recombinant epitope peptide melanoma vaccine (MART-I, gp100, tyrosi Factor VIII, Factor VIII (recombinant), Alphanate, octocog nase), nemifitide, ra AT (inhaled), ra AT (dermatological), alfa, Factor VIII, palifermin, Indikinase, tenecteplase, CGRP (inhaled, asthma), pegSunercept, thymosin beta-4, alteplase, pamiteplase, reteplase, nateplase.monteplase, fol plitidepsin, GTP-200, ramoplanin, GRASPA, OBI-I, litropin alfa, rRSH, hpFSH, micafungin, pegfilgrastim, 25 AC-100, Salmon calcitonin (oral, eligen), calcitonin (oral, lenograstim, nartograstim, sermorelin, glucagon, eXenatide, osteoporosis), examorelin, capromorelin, Cardeva, Velafer pramlintide, imiglucerase, galsulfase, Leucotropin, molgra min, 131I-TM-601, KK-220, TP-10, ularitide, depelestat, mostim, triptorelin acetate, histrelin (Subcutaneous implant, hematide, Chrysalin (topical), rNAPc2, recombinant Factor Hydron), deslorelin, histrelin, nafarelin, leuprolide sustained VIII (PEGylated liposomal), bFGF, PEGylated recombinant release depot (ATRIGEL), leuprolide implant (DUROS), 30 staphylokinase variant, V-10153, SonoLysis Prolyse, Neu goserelin, Somatropin, Eutropin, KP-102 program, Somatro roVax, CZEN-002, islet cell neogenesis therapy, rGLP-1. pin, somatropin, mecasermin (growth failure), enfuvirtide, BIM-51077, LY-548806, exenatide (controlled release, Med Org-33408, insulin glargine, insulin glulisine, insulin (in isorb), AVE-0010, GA-GCB, avorelin, AOD-9604, lina haled), insulin lispro, insulin detemir, insulin (buccal, Rapid clotide acetate, CETi-I, Hemospan, VAL (injectable), fast Mist), mecasermin rinfabate, anakinra, celmoleukin, 99mTc 35 acting insulin (injectable, Viadel), intranasal insulin, insulin apcitide injection, myelopid, Betaseron, glatiramer acetate, (inhaled), insulin (oral, eligen), recombinant methionyl Gepon, SargramoStim, oprelvekin, human leukocyte-derived human leptin, pitrakinra Subcutaneous injection, eczema), alpha interferons, Bilive, insulin (recombinant), recombinant pitrakinra (inhaled dry powder, asthma), Multikine, human insulin, insulinaspart, mecasermin, Roferon-A, inter RG-1068, MM-093, NBI-6024, AT-001, PI-0824, Org feron-alpha 2, Alfaferone, interferon alfacon-1, interferon 40 39141, Cpn1O (autoimmune diseases/inflammation), alpha, AvoneX recombinant human luteinizing hormone, dor talactoferrin (topical), rEV-131 (ophthalmic), rEV-131 (res nase alfa, trafermin, Ziconotide, taltirelin, diboterminalfa, piratory disease), oral recombinant human insulin (diabetes), atosiban, becaplermin, eptifibatide, Zemaira, CTC-1 11, RPI-78M, oprelvekin (oral), CYT-99007 CTLA4-Ig, DTY Shanvac-B, HPV vaccine (quadrivalent). NOV-002, oct 001, Valategrast, interferon alfa-n3 (topical), IRX-3, RDP-58, reotide, lanreotide, ancestim, agallsidase beta, agallsidase alfa, 45 Tauferon, bile salt stimulated lipase, Merispase, alkaline laronidase, prezatide copper acetate (topical gel), rasbu phosphatase, EP-2104R, Melanotan-II, bremelanotide, ATL ricase, ranibiZumab, Actimmune, PEG-Intron, Tricomin, 104, recombinant human microplasmin, AX-200, SEMAX, recombinant house dust mite allergy desensitization injec ACV-I, Xen-2174, CJC-1008, dynorphin A, SI-6603, LAB tion, recombinant human parathyroid hormone (PTH) 1-84 GHRH, AER-002, BGC-728, malaria vaccine (virosomes, (Sc, osteoporosis), epoetin delta, transgenic antithrombin III, 50 PeviPRO), ALTU-135, parvovirus B 19 vaccine, influenza Granditropin, Vitrase, recombinant insulin, interferon-alpha vaccine (recombinant neuraminidase), malaria/HBV Vac (oral lozenge), GEM-2 IS, vapreotide, idursulfase, omapatri cine, anthrax vaccine, Vacc-5q. Vacc-4X, HIV Vaccine (oral), lat, recombinant serum albumin, certolizumab pegol, glu HPV vaccine, Tat Toxoid, YSPSL, CHS-13340, PTH(1-34) carpidase, human recombinant C1 esterase inhibitor (an liposomal cream (Novasome), Ostabolin-C, PTH analog gioedema), lanoteplase, recombinant human growth 55 (topical, psoriasis), MBRI-93.02, MTB72F vaccine (tubercu hormone, enfuvirtide (needle-free injection, Biojector 2000), losis), MVA-Ag85 A vaccine (tuberculosis), FAR-404, VGV-I, interferon (alpha), lucinactant, aviptadil (inhaled, BA-210, recombinant plague F1V vaccine, AG-702, OxSO pulmonary disease), icatibant, ecallantide, omiganan, Auro Dro1, rBetV1, Der-p1/Der-p2/Der-p7 allergen-targeting vac grab, pexiganan acetate, ADI-PEG-20, LDI-200, degarelix, cine (dust mite allergy), PR1 peptide antigen (leukemia), cintredekin besudotox, FavId, MDX-1379, ISAtX-247, lira 60 mutant ras vaccine, HPV-16 E7 lipopeptide vaccine, labyrin glutide, teriparatide (osteoporosis), tifacogin, AA-4500, thin vaccine (adenocarcinoma), CML vaccine, WT1-peptide T4N5 liposome lotion, catumaxomab, DWP-413, ART-123, vaccine (cancer), IDD-5, CDX-1 10, Pentrys, Norelin, Cyto Chrysalin, desmoteplase, amediplase, corifolitropin alpha, Fab, P-9808, VT-111, icrocaptide, telbermin (dermatological, TH-9507, tediuglutide, Diamyd, DWP-412, growth hormone diabetic foot ulcer), rupintrivir, reticulose, rGRF, P1A, alpha (Sustained release injection), recombinant G-CSF, insulin (in 65 galactosidase A, ACE-011, ALTU-140, CGX-1160, angio haled, AIR), insulin (inhaled, Technosphere), insulin (in tensin therapeutic vaccine, D-4F, ETC-642. APP-018, haled, AERX), RGN-303, DiaPep277, interferon beta (hepa rhMBL, SCV-07 (oral, tuberculosis), DRF-7295, ABT-828, US 8,969,289 B2 31 32 ErbB2-specific immunotoxin (anticancer), DT388IL-3, TST SABA-X-Cys-X-Y or Y-X-Cys-X-SABA, wherein 10088, PRO-1762, Combotox, cholecystokinin-B/gastrin-re SABA is a SABA polypeptide as described herein (including ceptor binding peptides, 1 1 1 ln-hEGF. AE-37, trastuzumab any N-terminal and/or C-terminal extensions), X is an DM1, Antagonist G, IL-12 (recombinant), PM-02734, IMP optional polypeptide linker (suitable linkers include, for 321, rhIGF-BP3, BLX-883, CUV-1647 (topical), L-19 based 5 example, any one of SEQID NOs: 65-88,216-221 or 397), radioimmunotherapeutics (cancer), Re-188-P-2045, AMG CyS is a cysteine residue, X is a chemically derived spacer 386, DC/I540/KLH vaccine (cancer), VX-001, AVE-9633, (examples of suitable spacers are shown in Table 1), and Y is AC-9301, NY-ESO-I vaccine (peptides), NA17A2 peptides, a therapeutic moiety as described herein. In exemplary melanoma vaccine (pulsed antigen therapeutic), prostate can embodiments, the chemically derived spacer contains a male cer vaccine, CBP-501, recombinant human lactoferrin (dry 10 imide moiety which may used to conjugate the therapeutic eye), FX-06, AP-214, WAP-8294A2 (injectable), ACP-HIP moiety to the C-terminal Cys of the SABA polypeptide, or to SUN-1 1031, peptide YY 3-36 (obesity, intranasal), FGLL, conjugate the SABA polypeptide to the C-terminal Cys of the atacicept, BR3-Fc, BN-003, BA-058, human parathyroid hor therapeutic moiety, by Michael addition as described further mone 1-34 (nasal, osteoporosis), F-18-CCR1, AT-1001 (ce herein. liac disease? diabetes), JPD-003, PTH(7-34) liposomal cream 15 In other aspects, a SABA may be bound to two or more (Novasome), duramycin (ophthalmic, dry eye), CAB-2, therapeutic moieties. For example, two moieties can be bound CTCE-0214, GlycoPEGylated erythropoietin, EPO-Fc. to a SABA in various arrangements, such as for example, CNTO-528, AMG-1 14, JR-013, Factor XIII, aminocandin, from N-terminus to C-terminus of a fusion sequence, as fol PN-951, 716155, SUN-E7001, TH-0318, BAY-73-7977, lows: X-Y-SABA, X-SABA-Y, or SABA-X-Y, wherein X teverelix (immediate release), EP-51216, hCGH (controlled and Y represent two different therapeutic moieties. The two release, Biosphere), OGP-I, sifuvirtide, TV-4710, ALG-889, different therapeutic moieties may be selected from any of the Org-41259, rhCCIO, F-991, thymopentin (pulmonary dis moieties disclosed herein. eases), r(m)CRP hepatoselective insulin, subalin, L 19-IL-2 1. FGF21 fusion protein, elafin, NMK-150, ALTU-139, EN-122004, Fibroblast Growth Factor 21 (FGF21) is a member of the rhTPO, thrombopoietin receptor agonist (thrombocytopenic 25 FGF family of signaling proteins. These proteins function by disorders), AL-108, AL-208, nerve growth factor antagonists binding and activating FGF receptors, members of the cell (pain), SLV-317, CGX-1007, INNO-105, oral teriparatide surface tyrosin kinase family. FGF21 is an atypical member (elligen), GEM-OS1, AC-162352, PRX-302, LFn-p24 fusion of the family since it does not bind heparin but requires vaccine (Therapore), EP-1043, S. pneumoniae pediatric vac B-klotho, a single pass transmembrane protein as a co-recep cine, malaria vaccine, Neisseria meningitidis Group B vac 30 tor for activity. These receptors have a wide tissue distribution cine, neonatal group B streptococcal vaccine, anthrax vac but B-klotho expression is restricted to certain tissues (liver, cine, HCV vaccine (gpE1+gpE2+MF-59), otitis media adipose and pancreas) and it is the tissue selective expression therapy, HCV vaccine (core antigen+ISCOMATRIX), hPTH of B-klotho that imparts the target specificity for FGF21. In (1-34) (transdermal, VialDerm), 768974, SYN-101, PGN vitro studies indicate that FGFR1c (an isoform of FGFR1) 0052, aviscumine, BIM-23190, tuberculosis vaccine, multi 35 and FGFR4 are the preferred receptors in white adipose tissue epitope tyrosinase peptide, cancer vaccine, enkastim, APC and liver, respectively. 8024, G1-5005, ACC-OO1, TTS-CD3, vascular-targeted FGF21 functions as a metabolic regulator, and disregula TNF (solid tumors), desmopressin (buccal controlled-re tion of FGF21 may lead to various metabolic disorders. lease), onercept, TP-9201. FGF21 increases glucose uptake in 3T3-L1 adipocytes and In other exemplary embodiments, the SABA is fused to a 40 primary human adipocyte cultures by inducing ERK phos moiety selected from, but not limited to, the following: phorylation and GLUT1 expression. In INS-1E cells and FGF21 (Fibroblast Growth Factor 21), GLP-1 (glucagon-like isolated islets, FGF21 induces ERK and AKT phosphoryla peptide 1), Exendin 4, insulin, insulin receptor peptide, GIP tion. In liver cell lines, FGF21 stimulated typical FGF signal (glucose-dependent insulinotropic polypeptide), adiponec ing (ERK phosphorylation) and decreased glucose produc tin, IL-1Ra (Interleukin 1 Receptor Antagonist), VIP (vaso 45 tion. As described further below, the SABA-FGF21 fusions active intestinal peptide), PACAP (Pituitary adenylate described herein may be used for treating or preventing a cyclase-activating polypeptide), leptin, INGAP (islet neo variety of metabolic diseases and disorders. genesis associated protein), BMP-9 (bone morphogenetic In one aspect, the application provides FGF21 fused to a protein-9), amylin, PYY3-36 (Peptide YY), PP (Pancre serum albumin binding 'Fn3 (i.e., SABA) and uses of such atic polypeptide), IL-21 (interleukin 21), plectasin, PRGN 50 fusions, referred to herein generically as FGF21-SABA (Progranulin), Atstrrin, IFN (interferon), Apelin and osteo fusions. The FGF21-SABA fusions refer to fusions having calcin (OCN). various arrangements including, for example, SABA-FGF21, In other exemplary embodiments, the SABA is fused to one FGF21-SABA, FGF21-SABA-FGF21, etc. Certain exem or more additional 'Fn3 domains. For example, the SABA plary constructs are shown in Table 2. It should be under may be fused to one, two, three, four or more additional "Fn3 55 stood, however, that FGF21 as disclosed herein includes domains. The additional 'Fn3 domains may bind to the same FGF21 variants, truncates, and any modified forms that retain or different targets other than serum albumin. FGF21 functional activity. That is, FGF-21 as described In certain embodiments, the application provides a herein also includes modified forms, including fragments as SABA-Y fusion that may be represented by the formula: well as variants in which certain amino acids have been SABA-X-Y or Y-X-SABA, wherein SABA is a SABA 60 deleted or substituted, and modifications wherein one or more polypeptide as described herein (including any N-terminal amino acids have been changed to a modified amino acid, or and/or C-terminal extensions). X is a polypeptide linker a non-naturally occurring amino acid, and modifications such (suitable linkers include, for example, any one of SEQ ID as glycosylations so long as the modified form retains the NOs: 65-88,216-221 or 397), and Y is a therapeutic moiety as biological activity of FGF-21. described herein. 65 For example, wild-typefull-length FGF21 is shown in SEQ In certain embodiments, the application provides a ID NO: 117. All the FGF21 variants presented in Table 2 SABA-Y fusion that may be represented by the formula: contain the core FGF21 sequence set forth in SEQ ID NO: US 8,969,289 B2 33 34 118. Various N-terminal sequences, such as those set forth in ments, the insulin receptor peptide comprises amino acids any one of SEQ ID NOs: 119-124, can be added to the 687 to 710 of the insulin receptor (KTDSQILKELEESS N-terminus of the core FGF21 sequence (SEQ ID NO:118) FRKTFEDYLH: SEQID NO: 175). The insulin receptor is a and retain functional activity. Additionally, a His6-tag may be transmembrane receptor tyrosine kinase activated by the hor added to the N-terminus (e.g., SEQ ID NO: 128-131). The mone insulin. Activation of the insulin receptor triggers a core FGF21 sequence lacks a C-terminal serine which may or signaling cascade that eventually results in transport of a may not be added to the C-terminus of the core sequence glucose transporter to the cell Surface, so that cells can take up without affecting its activity. Furthermore, FGF21 and SABA glucose from the blood. Uptake of glucose occurs primarily in fusion molecules can be joined in the order FGF21-SABA, or adipocytes and myocytes. Dysfunction of the insulin receptor SABA-FGF21 (including any optional terminal extension 10 is associated with insulin insensitivity or resistance, which and linker sequences as described herein and known in the often leads to diabetes mellitus type 2 and other complica art) without affecting the FGF21 functional activity (see, e.g., tions that result when cells are unable to take up glucose. Example B6). Other disorders associated with mutations in the insulin In exemplary embodiments, the application provides a receptor gene include Donohue Syndrome and Rabson-Men SABA-FGF21 fusion, wherein the FGF21 portion comprises 15 denhall Syndrome. Therefore, exemplary uses for the SABA a sequence of SEQID NO: 117-118 or 125-131, or a sequence insulin receptorpeptide fusions described herein may include having at least 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, the treatment of subjects with disorders like diabetes mellitus or 99% identity with any one of SEQ ID NO: 117-118 or type 2 or other disorders associated with insufficient cellular 125-131. In certain embodiments, the SABA-FGF21 fusion glucose uptake, Donohue Syndrome and Rabson-Menden comprises a sequence of any one of SEQID NOs: 132-174, or hall Syndrome. a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 4. BMP-9 97%, 98%, or 99% identity with any one of SEQ ID NOs: In certain aspects, the present invention describes SABA 132-174. and BMP-9 fusion molecules. Various BMP-9 compositions In certain embodiments, the application provides a SABA are described in U.S. Pat. Nos. 5,661,007 and 6,287,816, FGF21 fusion that may be represented by the formula: 25 incorporated herein by reference in its entirety. The bone SABA-X-FGF21 or FGF21-X-SABA, wherein SABA is a morphogenetic proteins (BMPs) belong to the TGF-B family SABA polypeptide as described herein (including any N-ter of growth factors and cytokines BMPs induce formation of minal and/or C-terminal extensions). X is a polypeptide bone and cartilage, and mediate morphogenetic changes in linker (suitable linkers include, for example, any one of SEQ many other tissues. BMP signaling is essential for embryonic ID NOs: 65-88, 216-221 or 397), and FGF21 is an FGF21 30 development as well as growth and maintenance of postnatal peptide as described herein. tissues. The signaling pathway has also been associated in 2. Insulin diseases ranging from spinal disorders to cancer to reflux In another aspect, the present invention describes SABA induced esophagitis, and more. and insulin fusion molecules. Insulin is a hormone that regu Over twenty BMPs have been discovered. Of these mol lates the energy and glucose metabolism in the body. The 35 ecules, BMP-9 is primarily expressed in nonparenchymal polypeptide is secreted into the blood by pancreatic B-islet liver cells, and has been implicated in proliferation and func cells, where it stimulates glucose uptake from the blood by tion of hepatocytes, in particular, hepatic glucose production. liver, muscle, and fat cells, and promotes glycogenesis and BMP-9 also appears to play other roles in apoptosis of cancer lipogenesis. Malfunctioning of any step(s) in insulin secre cells, signaling in endothelial cells, osteogenesis, chondro tion and/or action can lead to many disorders, including the 40 genesis, cognition, and more. Accordingly, the SABA dysregulation of oxygen utilization, adipogenesis, glycogen BMP-9 fusion polypeptides described herein may be useful esis, lipogenesis, glucose uptake, protein synthesis, thermo for treating various diseases and disorders. Such as, for genesis, and maintenance of the basal metabolic rate. This example, the treatment of various types of wounds and dis malfunctioning results in diseases and/or disorders that eases exhibiting degeneration of the liver, as well as in the include, but are not limited to, hyperinsulinemia, insulin 45 treatment of other diseases and/or disorders that include bone resistance, insulin deficiency, hyperglycemia, hyperlipi and/or cartilage defects, periodontal disease and various can demia, hyperketonemia, diabetes mellitus, and diabetic neph CS. ropathy. Accordingly, the SABA-insulin fusion polypeptides 5. Amylin described herein may be useful in treating subjects with such In Some aspects, the present invention describes SABA and diseases and/or disorders. 50 amylin fusion molecules. Amylin (or islet amyloid polypep In exemplary embodiments, insulin moieties that can be tide, IAPP) is a small peptide hormone of 37 amino acids applied to the present invention include naturally occurring secreted by pancreatic B-cells. Amylin is secreted concur insulin, biosynthethic insulin, insulin derivatives and analogs. rently with insulin, and is thought to play a role in controlling Insulin analogs are analogs of naturally-occurring insulin insulin secretion, glucose homeostasis, gastric emptying, and proteins such as human insulin or animal forms of insulin, to 55 transmitting satiety signals to the brain. Amylin forms fibrils, which at least one amino acid residue has been Substituted, which have been implicated in apoptotic cell death of pancre added and/or removed. Such amino acids can be synthetic or atic B-cells. Consistent with this finding, amylin is commonly modified amino acids. Insulin derivatives are derivatives of found in pancreatic islets of patients suffering from diabetes either naturally-occurring insulin or insulin analogs which mellitus type 2 or harboring insulinoma, a neuroendocrine have been chemically-modified, for example by the addition 60 tumor. of one or more specific chemical groups to one or more amino Amylin may be used as a therapeutic for patients with acids. Exemplary insulin analogs are described in U.S. Pat. diabetes mellitus. Preparation of amylin peptides is described No. 7,476,652, incorporated herein by reference in its in U.S. Pat. No. 5,367,052, incorporated by reference herein entirety. in its entirety. Similarly, U.S. Pat. Nos. 6,610,824 and 7,271, 3. Insulin Receptor Peptide 65 238 (incorporated by reference herein in its entirety) In one aspect, the present invention describes SABA and describes agonist analogs of amylin formed by glycosylation insulin receptor peptide fusion molecules. In certain embodi of Asn. Ser and/or Thr residues, which may be used to treat or US 8,969,289 B2 35 36 prevent hypoglycemic conditions. Accordingly, the SABA 36-amino acid protein released by cells in the ileum and colon amylin fusion polypeptide described herein may for example in response to feeding. PYY is secreted in the pancreas and be useful in the treatment of Subjects with hypoglycemia, helps control energy homeostasis through inhibition of pan obesity, diabetes, eating disorders, insulin-resistance Syn creatic secretions such as, for example, insulin thus leading to drome, and cardiovascular disease. Preparation of SABA an increased blood glucose level and signaling a need for Amylin fusions is described in the Examples. reduced feeding. There are two major forms of PYY, the In one aspect, the application provides Amylin fused to a full-length form (1-36) and the truncated form (3-36). The serum albumin binding "Fn3 (i.e., SABA) and uses of such most common form of circulating PYY immunoreactivity is fusions, referred to herein generically as SABA-Amylin PYY. PYY has higher affinity to Y2 receptor than fusions. The SABA-Amylin fusions refer to fusions having 10 various arrangements including, for example, SABA-Amylin PYY. In addition PYY has similar high potency at the and Amylin-SABA. In exemplary embodiments, the SABA Y2 receptor, Suggesting that residues 4-12 are not important Amylin fusions are arranged such that the C-terminus of the with this receptor (K. McCrea, et al., 2-36|K4.RYYSA(19 Amylin peptide is free, which permits amidation of the car 23)PP a novel Y5-receptor preferring ligand with strong boxy terminus. Certain exemplary SABA-Amylin fusion 15 stimulatory effect on food intake, Regul. Pept 871-3 (2000), constructs are shown in Table 2. It should be understood, pp. 47-58.). Furthermore, even shorter PYY fragment ana however, that Amylin as disclosed herein includes Amylin logues based on the structure of PYY(22-36) and (25-36) variants, truncates, and any modified forms that retain Amylin have been described, showing Y2 selectivity over the other functional activity. That is, Amylin as described herein also NPY receptors (Y1, Y4 and Y5). See e.g., U.S. Pat. Nos. includes modified forms, including fragments as well as vari 5,604.203, and 6,046,167, incorporated by reference herein. ants in which certain amino acids have been deleted or sub PYY peptides and functional derivatives coupled to reactive stituted, and modifications wherein one or more amino acids groups are described in U.S. Pat. No. 7,601.691, incorporated have been changed to a modified amino acid, or a non-natu by reference herein. rally occurring amino acid, and modifications such as glyco PYY has been implicated in a number of physiological Sylations so long as the modified form retains the biological 25 activities including nutrient uptake, cell proliferation, lipoly activity of Amylin. Exemplary Amylin sequences are pre sis, and vasoconstriction. In particular, PYY has been sented in Table 2 as SEQID NOS: 296-303. shown to reduce appetite and food intake in humans (see e.g. In exemplary embodiments, the application provides a Batterham et al., Nature 418:656-654, 2002). Accordingly, SABA-Amylin fusion, wherein the Amylin portion com exemplary uses for the SABA-PYY fusion polypeptides prises a sequence of any one of SEQ ID NO: 296-303, or a 30 described herein may include the treatment of obesity, diabe sequence having at least 70%, 75%, 80%, 85%, 90%. 95%, tes, eating disorders, insulin-resistance syndrome, and car 97%, 98%, or 99% identity with any one of SEQ ID NOs: diovascular disease. 296-303. In certain embodiments, the SABA-Amylin fusion In one aspect, the application provides PYY fused to a comprises a sequence of any one of SEQID NOs: 304-328, or serum albumin binding "Fn3 (i.e., SABA) and uses of such a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 35 fusions, referred to herein generically as SABA-PYY 97%, 98%, or 99% identity with any one of SEQ ID NOs: fusions. The SABA-PYY fusions refer to fusions having vari 304-328. ous arrangements including, for example, SABA-PYY and In certain embodiments, the application provides a SABA PYY-SABA. In exemplary embodiments, the SABA-PYY Amylin fusion that may be represented by the formula: fusions are arranged such that the C-terminus of the PYY SABA-X-Amylin, wherein SABA is a SABA polypeptide as 40 peptide is free, which permits amidation of the carboxy ter described herein (including any N-terminal and/or C-termi minus. Certain exemplary SABA-PYY fusion constructs are nal extensions). X is a polypeptide linker (suitable linkers shown in Table 2. It should be understood, however, that PYY include, for example, any one of SEQ ID NOs: 65-88. 216 as disclosed herein includes PYY variants, truncates, and any 221 or 397), and Amylin is an Amylin peptide as described modified forms that retain PYY functional activity. That is, herein. Preferably, the Amylin peptide is amidated at the 45 PYY as described herein also includes modified forms, C-terminus. The Amylin peptide may additionally comprise a including fragments as well as variants in which certain Cys'7 or Cys’7 disulfide bond. amino acids have been deleted or substituted, and modifica In certain embodiments, the application provides a SABA tions wherein one or more amino acids have been changed to Amylin fusion that may be represented by the formula: a modified amino acid, or a non-naturally occurring amino SABA-X-Cys-X-Amylin, wherein SABA is a SABA 50 acid, and modifications such as glycosylations so long as the polypeptide as described herein (including any N-terminal modified form retains the biological activity of PYY. Exem and/or C-terminal extensions). X is an optional polypeptide plary PYY sequences are presented in Table 2 as SEQ ID linker (suitable linkers include, for example, any one of SEQ NOS: 329-337 and 408-418. IDNOs: 65-88,215-221 or 397), Cys is a cysteine residue, X In exemplary embodiments, the application provides a is a chemically derived spacer (examples of suitable spacers 55 SABA-PYY fusion, wherein the PYY portion comprises a are shown in Table 1), and Amylin is an Amylin peptide as sequence of any one of SEQID NO: 329-337 or 408-418; a described herein. Preferably, the Amylin peptide is amidated sequence having at least 70%, 75%, 80%, 85%, 90%. 95%, at the C-terminus. The Amylin peptide may additionally com 97%, 98%, or 99% identity with any one of SEQ ID NOs: prise a Cys' or Cys’ disulfide bond. In exemplary embodi 329-337 or 408-418; a sequence having residues 3-36, 13-36, ments, the chemically derived spacer contains a maleimide 60 21-36, 22-36, 24-36, or 25-36 of any one of SEQ ID NOs: moiety which may used to conjugate the Amylin peptide to 329-333 or 335-337; a sequence having at least 70%, 75%, the C-terminal Cys of the SABA polypeptide by Michael 80%, 85%, 90%. 95%, 97%, 98%, or 99% identity with a addition as described further herein. sequence having residues 3-36, 13-36, 21-36, 22-36, 24-36, 6. PYY or 25-36 of any one of SEQID NOs: 329-333 or 335-337; or In other aspects, the present invention describes SABA and 65 any one of the foregoing sequences having a V31L Substitu PYY fusion molecules. Peptide YY (also known as PYY. tion. In certain embodiments, the SABA-PYY fusion com Peptide Tyrosine Tyrosine, or Pancreatic Peptide YY) is a prises a sequence of any one of SEQID NOs: 338-344, or a US 8,969,289 B2 37 38 sequence having at least 70%, 75%, 80%, 85%, 90%. 95%, In exemplary embodiments, the application provides a 97%, 98%, or 99% identity with any one of SEQ ID NOs: SABA-PP fusion, wherein the PP portion comprises a 338-344 sequence of any one of SEQID NO:345-357, or a sequence In certain embodiments, the application provides a SABA having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, PYY fusion that may be represented by the formula: SABA 5 or 99% identity with any one of SEQ ID NOs: 345-357. In X-PYY, wherein SABA is a SABA polypeptide as described certain embodiments, the SABA-PP fusion comprises a herein (including any N-terminal and/or C-terminal exten sequence of any one of SEQID NOS: 358-364, or a sequence sions), X is a polypeptide linker (Suitable linkers include, for having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, example, any one of SEQID NOs: 65-88. 216-221 or 397), or 99% identity with any one of SEQID NOS: 358-364. and PYY is a PYY peptideas described herein. Preferably, the 10 In certain embodiments, the application provides a SABA PYY peptide is amidated at the C-terminus. PP fusion that may be represented by the formula: SABA-X- In certain embodiments, the application provides a SABA PP, wherein SABA is a SABA polypeptide as described PYY fusion that may be represented by the formula: SABA herein (including any N-terminal and/or C-terminal exten X-Cys-X-PYY, wherein SABA is a SABA polypeptide as sions), X is a polypeptide linker (suitable linkers include, for described herein (including any N-terminal and/or C-termi 15 example, any one of SEQID NOs: 65-88,216-221 or 397), nal extensions). X is an optional polypeptide linker (suitable and PP is a PP peptide as described herein. Preferably, the PP linkers include, for example, any one of SEQID NOs: 65-88. peptide is amidated at the C-terminus. 215-221 or 397), Cys is a cysteine residue, X is a chemically In certain embodiments, the application provides a SABA derived spacer (examples of Suitable spacers are shown in PP fusion that may be represented by the formula: SABA-X- Table 1), and PYY is a PYY peptide as described herein. Cys-X-PP, wherein SABA is a SABA polypeptide as Preferably, the PYY peptide is amidated at the C-terminus. In described herein (including any N-terminal and/or C-termi exemplary embodiments, the chemically derived spacer con nal extensions), X is an optional polypeptide linker (Suitable tains a maleimide moiety which may used to conjugate the linkers include, for example, any one of SEQID NOs: 65-88. PYY peptide to the C-terminal Cys of the SABA polypeptide 215-221 or 397), Cys is a cysteine residue, X is a chemically by Michael addition as described further herein. 25 derived spacer (examples of Suitable spacers are shown in 7. Pancreatic Polypeptide Table 1), and PP is a PP peptide as described herein. Prefer In some aspects, the present invention describes SABA and ably, the PP peptide is amidated at the C-terminus. In exem Pancreatic polypeptide fusion molecules. Pancreatic plary embodiments, the chemically derived spacer contains a polypeptide (PP) is a member of the pancreatic polypeptide maleimide moiety which may used to conjugate the PP pep hormone family that also includes neuropeptideY (NPY) and 30 tide to the C-terminal Cys of the SABA polypeptide by peptideYY (PYY). PP is a 36 amino acid protein released by Michael addition as described further herein. pancreatic polypeptide cells in response to eating, exercising, 8. Interleukin 21 (IL-21) and fasting. PP is found in the pancreas, gastrointestinal tract, In another aspect, the present invention describes SABA and CNS, where it affects gallbladder contraction, pancreatic and IL-21 fusion molecules. IL-21 is a type I cytokine that secretion, intestinal mobility, as well as metabolic functions 35 shares the common receptor Y-chain with IL-2, IL-4, IL-7, Such as glycogenolysis and reduction in fatty acid levels. PP IL-9, and IL-15. IL-21 is expressed in activated human CD4+ has also been implicated in food intake, energy metabolism, T cells, up-regulated in Th2 and Th17 subsets of T helper and expression of hypothalamic peptides and gastric ghrelin. cells, T follicular cells and NKT cells. The cytokine has a role In addition, PP is reduced in conditions associated with in regulating the function of all of these cell types. B cells are increased food intake. PP may also be involved in tumoro 40 also regulated by IL-21. Depending on the interplay with genesis, such as rare malignant tumors of the pancreatic pep costimulatory signals and on the developmental stage of a B tide cells. PP may be administered to patients, for example, to cell, IL-21 can induce proliferation, differentiation into Ig reduce hepatic glucose production (U.S. Pat. No. 5,830.434). producing plasma cells, or apoptosis in both mice and Exemplary uses for the SABA-PP fusion polypeptides dis humans. Alone and in combination with Th cell-derived closed herein may include the treatment of obesity, diabetes, 45 cytokines, IL-21 can regulate class Switch recombination to eating disorders, insulin-resistance syndrome, and cardiovas IgG, IgA, or IgE isotypes, indicating its important role in cular disease. shaping the effector function of B cells. Thus, through its In one aspect, the application provides PP fused to a serum multiple effects on immune cells, IL-21 plays a role in many albumin binding 'Fn3 (i.e., SABA) and uses of such fusions, aspects of the normal immune response. referred to herein generically as SABA-PP fusions. The 50 As a regulator of the immune system, the use of IL-21 as an SABA-PP fusions refer to fusions having various arrange immunostimulator for cancer therapy—either alone or in ments including, for example, SABA-PP and PP-SABA. In combination with other therapies, use as an adjunct to immu exemplary embodiments, the SABA-PP fusions are arranged notherapy, and use as a viral therapy have been studied, such that the C-terminus of the PP peptide is free, which among other uses where up-regulation of the immune system permits amidation of the carboxy terminus. Certain exem 55 is desired. Particular cancers treated both clinically and pre plary SABA-PP fusion constructs are shown in Table 2. It clinically have been metastatic melanoma, renal cell carci should be understood, however, that PP as disclosed herein noma, colon carcinoma, pancreatic carcinoma, mammary includes PP variants, truncates, and any modified forms that carcinoma, thyoma, head and neck Squamous cell carcinoma, retain PP functional activity. That is, PPas described herein and gliomas (for a review, see Sondergaard and Skak, Tissue also includes modified forms, including fragments as well as 60 Antigens, 74(6): 467-479, 2009). Additionally, IL-21 variants in which certain amino acids have been deleted or up-regulation has been linked to various human T cell-medi Substituted, and modifications wherein one or more amino ated or T cell-linked inflammatory pathologies including acids have been changed to a modified amino acid, or a Crohn's disease (CD), ulcerative colitis, the major forms of non-naturally occurring amino acid, and modifications such inflammatory bowel disease (IBD), Helicobacter pylori-re as glycosylations so long as the modified form retains the 65 lated gastritis, celiac disease, atopic dermatitis (AD), sys biological activity of PP. Exemplary PP sequences are pre temic lupus erthyematosus, rheumatoid arthritis, and psoria sented in Table 2 as SEQID NOs: 345-357. sis (for a review, see Monteleone etal, Trends Pharmacol Sci, US 8,969,289 B2 39 40 30(8), 441-7, 2009). Exemplary IL-21 proteins are described tion 8 can be replaced by a wide variety of natural (or unnatu in U.S. Pat. Nos. 6,307,024 and 7,473,765, which are herein ral) amino acids, including glycine, serine, threonine, or incorporated by reference. valine to produce DPP-IV resistant GLP-1 analogs. However, Exemplary uses for the SABA-IL21 fusion polypeptides DPP-IV resistant GLP-1 analogs still have a relatively short described herein include the treatment of certain types of 5 pharmacokinetic half-life because they are eliminated via cancers, viral-related diseases, as well as various T cell-me renal clearance. For example, the potent and DPP-IV resistant diated or T cell-linked inflammatory disorders such as GLP-1 receptor agonist, synthetic exendin-4 (SEQ ID NO: Crohn's disease (CD), ulcerative colitis, the major forms of 228; active pharmaceutical ingredient in Byetta), must still be inflammatory bowel disease (IBD), Helicobacter pylori-re administered twice daily in human diabetic patients because lated gastritis, celiac disease, atopic dermatitis (AD), sys 10 it is rapidly cleared by the kidney. temic lupus erthyematosus, rheumatoid arthritis, and psoria Another approach to produce long-acting GLP-1 receptor S1S. agonists has been to express a DPP-IV resistant GLP-1 analog In one aspect, the application provides IL-21 fused to a in the same open reading frame as along-lived protein such as serum albumin binding 'Fn3 (i.e., SABA) and uses of such albuminor transferrin. One Such fusion protein, albiglutide, a fusions, referred to herein generically as SABA-IL21 fusions. 15 DPP-IV resistant GLP-1 analog fused to human serum albu The SABA-IL21 fusions refer to fusions having various min, is currently being evaluated in phase III clinical trials. In arrangements including, for example, SABA-IL-21 and all cases reported, the active fusion protein has had the DPP IL21-SABA. Certain exemplary SABA-IL21 fusion con IV resistant GLP-1 receptor agonist at the amino terminus of structs are shown in Table 2. It should be understood, how the fusion protein, c-terminal fusions are markedly less ever, that IL-21 as disclosed herein includes IL-21 variants, potent. truncates, and any modified forms that retain IL-21 functional In exemplary embodiments, a SABA-GLP-1 fusion pro activity. That is, IL-21 as described herein also includes tein comprises from N-terminus to C-terminus: a DPP-IV modified forms, including fragments as well as variants in resistant GLP-1 receptor agonist (potentially including which certain amino acids have been deleted or substituted, sequences based on GLP-1 or exendin-4), a linker, and a and modifications wherein one or more amino acids have 25 SABA been changed to a modified amino acid, or a non-naturally Exemplary uses for the SABA-GLP-1 and SABA-Exendin occurring amino acid, and modifications such as glycosyla fusion polypeptides include the treatment of diabetes, obe tions so long as the modified form retains the biological sity, irritable bowel syndrome and other conditions that activity of IL-21. Exemplary IL-21 sequences are presented would be benefited by lowering plasma glucose, inhibiting in Table 2 as SEQID NOs: 286-287. 30 gastric and/or intestinal motility and inhibiting gastric and/or In exemplary embodiments, the application provides a intestinal emptying, or inhibiting food intake. SABA-IL21 fusion, wherein the IL-21 portion comprises a In one aspect, the application provides GLP-1 or Exendin sequence of any one of SEQID NO: 286-287, or a sequence fused to a serum albumin binding 'Fn3 (i.e., SABA) and uses having at least 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, of such fusions, referred to herein generically as SABA or 99% identity with any one of SEQ ID NOs: 286-287. In 35 GLP-1 or SABA-Exendin fusions. The SABA-GLP-1 or certain embodiments, the SABA-IL21 fusion comprises a SABA-Exendin fusions refer to fusions having various sequence of any one of SEQID NOS: 290-295, or a sequence arrangements including, for example, SABA-GLP-1, GLP having at least 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, 1-SABA, SABA-Exendin and Exendin-SABA. Certain or 99% identity with any one of SEQID NOS: 290-295. exemplary SABA-GLP-1 and SABA-Exendin fusion con In certain embodiments, the application provides a SABA 40 structs are shown in Table 2. It should be understood, how IL21 fusion that may be represented by the formula: SABA ever, that GLP-1 and Exendin as disclosed herein includes X-IL21 or IL21-X-SABA, wherein SABA is a SABA GLP-1 and Exendin variants, truncates, and any modified polypeptide as described herein (including any N-terminal forms that retain GLP-1 or Exendin functional activity. That and/or C-terminal extensions). X is a polypeptide linker is, GLP-1 and Exendin as described herein also includes (suitable linkers include, for example, any one of SEQ ID 45 modified forms, including fragments as well as variants in NOs: 65-88,216-221 or 397), and IL21 is an IL-21 peptideas which certain amino acids have been deleted or substituted, described herein. and modifications wherein one or more amino acids have 9. Glucagon-like Peptide 1 (GLP-1)/Exendin-4 been changed to a modified amino acid, or a non-naturally In another aspect, the present invention describes SABA occurring amino acid, and modifications such as glycosyla and GLP-1 fusion molecules. Glucagon-like peptide 1 (GLP 50 tions so long as the modified form retains the biological 1) is a 30 or 31 amino acid peptide (SEQID NOs: 226 and activity of GLP-1 or Exendin. Exemplary GLP-1 sequences 227) released from enteroendocrine L cells in response to are presented in Table 2 as SEQ ID NOs: 226-227 and an nutrient ingestion. This hormone can act by multiple mecha exemplary Exendin sequence is presented in Table 2 as SEQ nisms to modulate glucose homeostasis and exertantidiabetic ID NO: 228. effects. GLP-1 signaling enhances glucose-dependent insulin 55 In exemplary embodiments, the application provides a secretion, inhibits glucagon Secretion in a glucose-dependent SABA-GLP-1 fusion, wherein the GLP-1 portion comprises manner, delays gastric emptying, leads to reduced food intake a sequence of any one of SEQID NO: 226-227, or a sequence and body weight, and causes an increase in beta cell mass in having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, animal models. or 99% identity with any one of SEQ ID NOs: 226-227. In The therapeutic utility of native GLP-1 is limited because 60 certain embodiments, the SABA-GLP-1 fusion comprises a it has a half-life of less than 2 minutes in vivo due to its rapid sequence of any one of SEQID NOS: 229-232, or a sequence degradation by the ubiquitous protease, dipeptidyl peptidase having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, IV (DPP-IV). Because DPP-IV preferentially cleaves amino or 99% identity with any one of SEQID NOS: 229-232. terminal dipeptides with alanine or proline at the second In certain embodiments, the application provides a SABA position, one strategy to increase the half-life is to alter the 65 GLP-1 fusion that may be represented by the formula: SABA second amino acid (position 8) in active GLP-1 such that the X-GLP-1 or GLP-1-X-SABA, wherein SABA is a SABA peptide is no longer a DPP-IV substrate. The alanine in posi polypeptide as described herein (including any N-terminal US 8,969,289 B2 41 42 and/or C-terminal extensions). X is a polypeptide linker modifications such as glycosylations so long as the modified (suitable linkers include, for example, any one of SEQ ID form retains the biological activity of Plectasin. An exem NOs: 65-88. 216-221 or 397), and GLP-1 is a GLP-1 peptide plary Plectasin sequence is presented in Table 2 as SEQ ID as described herein. NO: 237. In exemplary embodiments, the application provides a In exemplary embodiments, the application provides a SABA-Exendin fusion, wherein the Exendin portion com SABA-Plectasin fusion, wherein the Plectasin portion com prises SEQID NO: 228, or a sequence having at least 70%, prises SEQID NO. 237, or a sequence having at least 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, or 99% identity to 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with SEQID NO: 228. In certain embodiments, the SABA-Exen SEQIDNO: 237. In certain embodiments, the SABA-Plecta din fusion comprises a sequence of any one of SEQID NOs: 10 233-236, or a sequence having at least 70%, 75%, 80%, 85%, sinfusion comprises a sequence of any one of SEQID NOs: 90%. 95%, 97%, 98%, or 99% identity with any one of SEQ 238-239, or a sequence having at least 70%, 75%, 80%, 85%, ID NOS: 233-236. 90%. 95%, 97%, 98%, or 99% identity with any one of SEQ In certain embodiments, the application provides a SABA ID NOS: 238-239. Exendin fusion that may be represented by the formula: 15 In certain embodiments, the application provides a SABA SABA-X-Exendinor Exendin-X-SABA, wherein SABA is Plectasin fusion that may be represented by the formula: a SABA polypeptide as described herein (including any SABA-X-Plectasin or Plectasin-X-SABA, wherein SABA N-terminal and/or C-terminal extensions), X is a polypep is a SABA polypeptide as described herein (including any tide linker (suitable linkers include, for example, any one of N-terminal and/or C-terminal extensions), X is a polypep SEQ ID NOs: 65-88. 216-221 or 397), and Exendin is an tide linker (suitable linkers include, for example, any one of Exendin peptide as described herein. SEQ ID NOs: 65-88. 216-221 or 397), and Plectasin is a 10. Plectasin Plectasin peptide as described herein. In another aspect, the present invention describes SABA 11. Progranulin (PRGN) and Atstrrin and Plectasin fusion molecules. Plectasin is a novel bacteri In another aspect, the present invention describes SABA cidal antimicrobial peptide isolated from a fungus, the 25 and Progranulin or SABA and Atstrrin fusion molecules. saprophytic ascomycete Pseudoplectania nigrella. In vitro, Progranulin and Atstrrin, an engineered protein comprising 3 plectasin can kill Staphylococcus aureus and Streptococcus fragments from Progranulin, are tumor necrosis factor (TNF) pneumonia, including numerous strains resistant to conven receptor binders that antagonize TNF signaling. Progranulin tional antibiotics, rapidly at rates comparable to both Vanco and Atstrrin prevent inflammation in mouse models of arthri mycin and penicillin, but without cytotoxic effect on mam 30 tis. See e.g., Tang, W. et al., The Growth Factor Progranulin malian cells. In vivo, plectasin also shows extremely low Binds to TNF Receptors and Is Therapeutic Against Inflam toxicity in mice and can cure the peritonitis and pneumonia matory Arthritis in Mice, Science, ScienceExpress, Mar. 10, caused by S. pneumoniae as efficaciously as Vancomycin and 2011, Supplementary Material. SABA fusions of either pro penicillin. See e.g., Mygind PH, et al., Plectasin is a peptide tein may be potential therapeutics for TNFC.-mediated dis antibiotic with therapeutic potential from a saprophytic fun 35 CaSCS. gus, Nature 437:975-980 (2005); Brinch KS, et al., Plectasin In one aspect, the application provides Progranulin or shows intracellular activity against Staphylococcus aureus in Atstrrinfused to a serum albuminbinding "Fn3 (i.e., SABA) human THP-1 monocytes and in the mouse peritonitis model, and uses of Such fusions, referred to herein generically as Antimicrob Agents Chemother 53:4801-4808 (2009);3. Hara SABA-PRGN or SABA-AtStrrin fusions. The SABA-PRGN S. et al., Plectasin has antibacterial activity and no effect on 40 or SABA-Atstrrin fusions refer to fusions having various cell viability or IL-8 production, Biochem Biophys Res Com arrangements including, for example, SABA-PRGN, PRGN mun 374:709–713 (2008); and Ostergaard C, et al., High SABA, SABA-Atstrrin and Atstrrin-SABA. Certain exem cerebrospinal fluid (CSF) penetration and potent bactericidal plary SABA-PRGN and SABA-Atstrrinfusion constructs are activity in CSF of NZ2114, a novel plectasin variant, during shown in Table 2. It should be understood, however, that experimental pneumococcal meningitis, Antimicrob Agents 45 Progranulin and Atstrrin as disclosed herein includes Pro Chemother 53:1581-1585 (2009). Given these characteris granulin and Atstrrin variants, truncates, and any modified tics, plectasin is an attractive candidate to serve as a prospec forms that retain Progranulin or Atstrrin functional activity. tive antibiotics product. See e.g., Xiao-Lan J, et al., High That is, Progranulin and Atstrrin as described herein also Level Expression of the Antimicrobial Peptide Plectasin in includes modified forms, including fragments as well as vari Escherichia coli, Curr Microbiol 61:197-202 (2010). Accord 50 ants in which certain amino acids have been deleted or sub ingly, the SABA-plectasin fusion polypeptides described stituted, and modifications wherein one or more amino acids herein may be used as antibacterial agents. have been changed to a modified amino acid, or a non-natu In one aspect, the application provides Plectasin fused to a rally occurring amino acid, and modifications such as glyco serum albumin binding 'Fn3 (i.e., SABA) and uses of such Sylations so long as the modified form retains the biological fusions, referred to herein generically as SABA-Plectasin 55 activity of Progranulin or Atstrrin. Exemplary Progranulin fusions. The SABA-Plectasin fusions refer to fusions having sequences are presented in Table 2 as SEQID NOs: 240-241 various arrangements including, for example, SABA-Plecta and an exemplary Atstrrin sequence is presented in Table 2 as sin and Plectasin-SABA. Certain exemplary SABA-Plectasin SEQID NO: 242. fusion constructs are shown in Table 2. It should be under In exemplary embodiments, the application provides a stood, however, that Plectasin as disclosed herein includes 60 SABA-PRGN fusion, wherein the PRGN portion comprises a Plectasin variants, truncates, and any modified forms that sequence of any one of SEQID NO: 240-241, or a sequence retain Plectasin functional activity. That is, Plectasin as having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, described herein also includes modified forms, including or 99% identity with any one of SEQ ID NOs: 240-241. In fragments as well as variants in which certain amino acids certain embodiments, the SABA-PRGN fusion comprises a have been deleted or substituted, and modifications wherein 65 sequence of any one of SEQID NOS: 243-246, or a sequence one or more amino acids have been changed to a modified having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, amino acid, or a non-naturally occurring amino acid, and or 99% identity with any one of SEQID NOS: 243-246. US 8,969,289 B2 43 44 In certain embodiments, the application provides a SABA activity of OCN. Exemplary OCN sequences are presented in PRGN fusion that may be represented by the formula: SABA Table 2 as SEQID NOs: 365-378. X-PRGN or PRGN-X-SABA, wherein SABA is a SABA In exemplary embodiments, the application provides a polypeptide as described herein (including any N-terminal SABA-OCN fusion, wherein the OCN portion comprises a and/or C-terminal extensions). X is a polypeptide linker sequence of any one of SEQID NO: 365-378, or a sequence (suitable linkers include, for example, any one of SEQ ID having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, NOs: 65-88. 216-221 or 397), and PRGN is a Progranulin or 99% identity with any one of SEQ ID NOs: 365-378. In peptide as described herein. certain embodiments, the SABA-OCN fusion comprises a In exemplary embodiments, the application provides a sequence of any one of SEQID NOs: 379-396, or a sequence SABA-Atstrrin fusion, wherein the Atstrrin portion com 10 having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, prises SEQID NO: 242, or a sequence having at least 70%, or 99% identity with any one of SEQID NOs: 379-396. 75%, 80%, 85%, 90%. 95%, 97%, 98%, or 99% identity to In certain embodiments, the application provides a SABA SEQID NO: 242. In certain embodiments, the SABA-Atstr OCN fusion that may be represented by the formula: SABA rin fusion comprises a sequence of any one of SEQID NOs: X-OCN or OCN-X-SABA, wherein SABA is a SABA 247-250, or a sequence having at least 70%, 75%, 80%, 85%, 15 polypeptide as described herein (including any N-terminal 90%. 95%, 97%, 98%, or 99% identity with any one of SEQ and/or C-terminal extensions). X is a polypeptide linker ID NOS: 247-25O. (suitable linkers include, for example, any one of SEQ ID In certain embodiments, the application provides a SABA NOs: 65-88,216-221 or 397), and OCN is an OCN peptide as Atstrrin fusion that may be represented by the formula: described herein. SABA-X-Atstrrin or Atstrrin-X-SABA, wherein SABA is a In certain embodiments, the application provides a SABA SABA polypeptide as described herein (including any N-ter OCN fusion that may be represented by the formula: SABA minal and/or C-terminal extensions), X is a polypeptide X-Cys-X-OCN or OCN-X-Cys-X-SABA, wherein linker (suitable linkers include, for example, any one of SEQ SABA is a SABA polypeptide as described herein (including ID NOs: 65-88. 216-221 or 397), and Atstrrin is an Atstrrin any N-terminal and/or C-terminal extensions), X is an peptide as described herein. 25 optional polypeptide linker (suitable linkers include, for 12. Osteocalcin (OCN) example, any one of SEQID NOs: 65-88,216-221 or 397), In certain aspects, the present invention describes SABA CyS is a cysteine residue, X is a chemically derived spacer and Osteocalcin fusion molecules. Osteocalcin (OCN, also (examples of suitable spacers are shown in Table 1), and OCN known as Bone Gla Protein, or BGP) is a 49 amino acid is an OCN peptide as described herein. In exemplary embodi protein produced by osteoblasts, and secreted into the blood 30 ments, the chemically derived spacer contains a maleimide stream and bone matrix. Plasma OCN levels are subjected to moiety which may used to conjugate the OCN peptide to the biological variations including diurnal cycle, season, gender, C-terminal Cys of the SABA polypeptide, or to conjugate the age and menstrual cycle. OCN exists as carboxylated, uncar SABA polypeptide to the C-terminal Cys of the OCN peptide, boxylated and undercarboxylated forms, the uncarboxylated by Michael addition as described further herein. and undercarboxylated forms are involved in the regulation of 35 13. Interferon Lambda (IFN8) energy metabolism through stimulating insulin secretion, In another aspect, the present invention describes SABA pancreatic B-cell proliferation and enhancing insulin sensi and interferon-lambda (IFN-6) fusion molecules. Human tivity which is partially mediated through adiponectin. Insu interferons (IFNs) are classified into three major types: Type lin promotes bone remodeling, and its signaling in osteo I, Type II and Type III. Type IIFNs are expressed as a first line blasts increases the release of uncarboxylated and/or 40 of defense against viral infections. The primary role of type I undercarboxylated OCN into circulation, which in turn IFN is to limit viral spread during the first days of a viral improves glucose handling. Accordingly, the SABA-OCN infection allowing Sufficient time for generation of a strong fusion polypeptides described herein may be used in the adaptive immune response against the infection. Type II and treatment of insulin related disorders, including the dysregu Type III IFNs display some of the antiviral properties of type lation of oxygen utilization, adipogenesis, glycogenesis, lipo 45 IIFNS. genesis, glucose uptake, protein synthesis, thermogenesis, IFN-ö is a Type III IFN. Humans encode three IFN-8 and maintenance of the basal metabolic rate. This malfunc molecules: IFN-81 (IL-29), IFN-62 (IL-28A) and IFN-63 tioning results in diseases and/or disorders that include, but (IL-28B). As described in U.S. Pat. No. 7,135,170, IL-28 and are not limited to, hyperinsulinemia, insulin resistance, insu IL-29 have been shown to be useful in the treatment of hepa lin deficiency, hyperglycemia, hyperlipidemia, hyperketone 50 titis virus infection. Importantly, IL-28 and IL-29 were shown mia, diabetes mellitus, and diabetic nephropathy. to possess these antiviral activities without some of the tox In one aspect, the application provides OCN fused to a icities associated with the use of other previously known IFN serum albumin binding "Fn3 (i.e., SABA) and uses of such therapies. One of the toxicities related to type IIFN therapy is fusions, referred to herein generically as SABA-OCN myelosuppression. This is due to type I IFN suppression of fusions. The SABA-OCN fusions refer to fusions having 55 bone marrow progenitor cells. Because IL-29 does not sig various arrangements including, for example, SABA-OCN nificantly Suppress bone marrow cell expansion or B cell and OCN-SABA. Certain exemplary SABA-OCN fusion proliferation as seen with Type I IFN treatment, IL-29 will constructs are shown in Table 2. It should be understood, have less toxicity associated with treatment. Similar results however, that OCN as disclosed herein includes OCN vari would be expected with IL-28A and IL-28B. ants, truncates, and any modified forms that retain OCN func 60 Accordingly, exemplary uses for the SABA-IFN-8 fusion tional activity. That is, OCN as described herein also includes polypeptides described herein include the treatment of a sub modified forms, including fragments as well as variants in ject with a viral infection, including, for example, viral infec which certain amino acids have been deleted or substituted, tions such as hepatitis A, hepatitis B, hepatitis C, and hepatitis and modifications wherein one or more amino acids have D. The SABA-IFN-8 fusion polypeptides described herein been changed to a modified amino acid, or a non-naturally 65 may also be used as an antiviral agent to treat viral infections occurring amino acid, and modifications such as glycosyla associated with respiratory syncytial virus, herpes virus, tions so long as the modified form retains the biological Epstein-Barr virus, influenza virus, adenovirus, parainflu US 8,969,289 B2 45 46 enza virus, rhino virus, coxsackie virus, vaccinia virus, west ciated with improvement in insulin sensitivity in preclinical nile virus, dengue virus, Venezuelan equine encephalitis models of diabetes (C Dray, et al., Cell Metabolism 8: 437 virus, pichinde virus and polio virus. The SABA-IFN-8 445 (2008)). Accordingly, exemplary uses for the SABA fusion polypeptides described herein may be used to treat Apelin fusion polypeptides described herein may include the Subjects having either a chronic or acute viral infection. treatment of diabetes, obesity, eating disorders, insulin-resis In certain embodiments, the SABA-IFNö fusions tance syndrome and cardiovascular disease (e.g., heart fail described herein may provide benefits over IFNö polypep ure, atherosclerosis, and hypertension). tides fused to other pharmacokinetic moieties, such as, for In one aspect, the application provides Apelin fused to a example, PEG. In particular, the SABA-IFNö fusions pro serum albumin binding 'Fn3 (i.e., SABA) and uses of such vided herein may provide a significant improvement in serum 10 fusions, referred to herein generically as SABA-APLN half-life of the IFNö molecule as compared to PEG-IFNö fusions. The SABA-APLN fusions refer to fusions having conjugates. Such increases in half-life may permit a dosing various arrangements including, for example, SABA-APLN regimen with a decreased frequency, e.g., a SABA-IFNö and APLN-SABA. Certain exemplary SABA-APLN fusion fusion may permit once monthly dosing as compared to more constructs are shown in Table 2. It should be understood, frequent dosing, such as once weekly dosing, with other IFNö 15 however, that Apelinas disclosed herein includes Apelin vari therapeutics like PEG-IFNö conjugates. ants, truncates, and any modified forms that retain Apelin In one aspect, the application provides IFNö fused to a functional activity. That is, Apelin as described herein also serum albumin binding "Fn3 (i.e., SABA) and uses of such includes modified forms, including fragments as well as vari fusions, referred to herein generically as SABA-IFNö ants in which certain amino acids have been deleted or sub fusions. The SABA-IFNö fusions refer to fusions having stituted, and modifications wherein one or more amino acids various arrangements including, for example, SABA-IFNö have been changed to a modified amino acid, or a non-natu and IFNö-SABA. Certain exemplary SABA-IFNö fusion rally occurring amino acid, and modifications such as glyco constructs are shown in Table 2. It should be understood, Sylations so long as the modified form retains the biological however, that IFNö as disclosed herein includes IFNö vari activity of Apelin. Exemplary Apelin sequences are presented ants, truncates, and any modified forms that retain IFNö func 25 in Table 2 as SEQID NOs: 419–423. tional activity. That is, IFNö as described herein also includes In exemplary embodiments, the application provides a modified forms, including fragments as well as variants in SABA-APLN fusion, wherein the Apelin portion comprises a which certain amino acids have been deleted or substituted, sequence of any one of SEQID NO: 419–423, or a sequence and modifications wherein one or more amino acids have having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, been changed to a modified amino acid, or a non-naturally 30 or 99% identity with any one of SEQ ID NOs: 419–423. In occurring amino acid, and modifications such as glycosyla certain embodiments, the SABA-APLN fusion comprises a tions so long as the modified form retains the biological sequence of any one of SEQID NOs: 424–430, or a sequence activity of IFNö. Exemplary IFNö sequences are presented in having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, Table 2 as SEQID NOs: 251-257. or 99% identity with any one of SEQID NOs: 424–430. In exemplary embodiments, the application provides a 35 In certain embodiments, the application provides a SABA SABA-IFNö fusion, wherein the IFNö portion comprises a APLN fusion that may be represented by the formula: SABA sequence of any one of SEQID NO: 251-257, or a sequence X-APLN or APLN-X-SABA, wherein SABA is a SABA having at least 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, polypeptide as described herein (including any N-terminal or 99% identity with any one of SEQ ID NOs: 251-257. In and/or C-terminal extensions). X is a polypeptide linker certain embodiments, the SABA-IFNö fusion comprises a 40 (suitable linkers include, for example, any one of SEQ ID sequence of any one of SEQID NOS: 258-285, or a sequence NOs: 65-88,216-221 or 397), and APLN is an APLN peptide having at least 70%, 75%, 80%, 85%, 90%. 95%, 97%, 98%, as described herein. or 99% identity with any one of SEQID NOS: 258-285. 15. Other AdnectinsTM In certain embodiments, the application provides a SABA In certain aspects, the application provides SABA fused to IFNö fusion that may be represented by the formula: SABA 45 a 'Fn3 domain that binds to a target molecule other than X-IFNö or IFNö-X-SABA, wherein SABA is a SABA serum albumin (e.g., HSA), resulting in an AdnectinTM dimer polypeptide as described herein (including any N-terminal fusion molecule of SABA-'Fn3 or 'Fn3-SABA configura and/or C-terminal extensions). X is a polypeptide linker tion. In other aspects, the application provides SABA fused to (suitable linkers include, for example, any one of SEQ ID two or more 'Fn3 domains thus forming a multimer. For NOs: 65-88,216-221 or 397), and IFNö is an IFNö peptideas 50 example, in one embodiment, the application provides SABA described herein. fused to two 'Fn3 domains, "Fn3, and "Fn3, wherein each 14. Apelin 'Fn3, and 'Fn3, binds to a different target molecule, and In another aspect, the application provides SABA and Ape neither binds to serum albumin (e.g., HSA). The configura lin fusion molecules. Apelin is the endogenous ligand for the tion of the resulting AdnectinTM trimer may be: SABA G-protein coupled receptor, APJ. The apelin gene encodes a 55 'Fn3-'Fn3 'Fn3-SABA-'Fn3 or 'Fn3-'Fn3 77 amino acid preproprotein that is cleaved to shorter active SABA fragments. The full-length mature peptide is apelin-36, but In exemplary embodiments, the SABA is fused to a "Fn3 apelin-17 and apelin-13 are also active (M. Kleinz, et al., domain comprising any one of SEQ ID NOs: 1-3, or a Pharmacol. Ther. 107: 198-211 (2005)). Apelin is widely sequence having at least 50%, 60%. 65%, 70%, 75%, 80%, expressed in the central nervous system and peripheral tis 60 85%, 90%, 95%, 97%, 98%, or 99% identity with any one of Sues, and cellular expression includes endothelial cells and SEQ ID NOs: 1-3, wherein the BC, DE and FG loops have adipocytes (Supra). Apelin has been shown to produce been modified relative to the sequences of the wild-type BC, vasodilation and improve the hemodynamic and cardiac pro DE and FG loops, respectively, and wherein the 'Fn3 file of patients with heart failure, as well as prevent athero domain binds to a target (other than integrin) with a Kofless Sclerosis in preclinical models (AG Japp, et al., Circ. 121: 65 than 500 LM. The "Fn3 domain may additional comprise an 1818-1827 (2010); and HY Chun, et al., J. Clin. Invest. 118: N-terminal and/or C-terminal extension as described herein. 3343-3354 (2008)). In addition, apelin administration is asso In certain embodiments, the "Fn3 domain binds to a target US 8,969,289 B2 47 48 that is a therapeutic moiety as described herein. In exemplary age site that is cleavable by an enzyme in the blood or target embodiments, in a fusion comprising one additional "Fn3 tissue. Such embodiments can be used to release atherapeutic domain, the 'Fn3 domain binds to VEGFR2, TNFO, IGF1R, proteins for better delivery or therapeutic properties or more or EGFR. In exemplary embodiments, in a fusion comprising efficient production. two additional 'Fn3 domain, the 'Fn3 domains bind to 5 SABA-Neuropeptide Fusions VEGFR2 and IGF1R, or EGFR and IGF1R. In certain embodiments, the application provides SABA Conjugation/Linkers neuropeptide fusions. Exemplary nueropeptides include, for SABA fusions may be covalently or non-covalently linked. example, Amylin, PYY and PP. The SABA-neuropeptide In some embodiments, a serum albumin binding 'Fn3 may fusions may be constructed as polypeptide fusions or as con be directly or indirectly linked to a heterologous molecule via 10 jugates linked via a chemically derived spacer. In one a polypeptide linker. Suitable linkers for joining a SABA to a embodiment, a SABA-neuropeptide fusion is a polypeptide protein of interest are those which allow the separate domains fusion comprising a SABA, an amino acid linker, and a neu to fold independently of each other forming a three dimen ropeptide. Since many neuropeptides are amidated at the sional structure that does not disrupt the functionality of C-terminus, an exemplary arrangement of a fusion protein is either member of the fusion protein. Exemplary linkers are 15 from N-terminus to C-terminus, a SABA, an amino acid provided in Table 2 as SEQID NOs: 65-88,216-221 and 397. linker, and a neuropeptide. In another embodiment, a SABA The disclosure provides a number of suitable linkers, neuropeptide fusion contains a chemically derived spacer that including glycine-serine based linkers, glycine-proline based links the SABA to the neuropeptide. Exemplary arrange linkers, as well as the linker having the amino acid sequence ments of SABA-neuropeptide conjugates are as follows: (1) PSTSTST (SEQ ID NO: 85). In some embodiments, the SABA-Cys-chemically derived spacer-neuropeptide, or (2) linker is a glycine-serine based linker. These linkers comprise SABA-amino acid linker-Cys-chemically derived spacer glycine and serine residues and may be between 8 and 50, 10 neuropeptide. SABA-neuropeptide fusions may be produced and 30, and 10 and 20 amino acids in length. Examples in host cells, such as micro-organisms or mammalian cells as include linkers having an amino acid sequence (GS), (SEQ described further herein. The peptide components of a ID NO: 72), G(GS) (SEQID NO: 67), and G(GS),G (SEQ 25 SABA-neuropeptide fusion linked by a chemically derived ID NO: 69). Other linkers contain glutamic acid, and include, spacer may be produced either by host cells or by chemical for example, (GSE) (SEQ ID NO: 74) and GGSE GGSE synthesis, or a combination thereof. In an exemplary embodi (SEQ ID NO: 78). Other exemplary glycine-serine linkers ment, a SABA-neuropeptide fusion linked by a chemically include (GS) (SEQID NO: 71), (GGGGS), (SEQ ID NO: derived spacer is assembled from a SABA produced in host 80), (GGGGS) (SEQIDNO:81), and (GGGGS),G (SEQID 30 cells (such as E. coli) and a neuropeptide produced by chemi NO: 82). In some embodiments, the linker is a glycine-proline cal synthesis. Further details on producing SABA-neuropep based linker. These linkers comprise glycine and proline resi tide fusions are described below and in the Examples. dues and may be between 3 and 30, 10 and 30, and 3 and 20 Many neuropeptides contain a C-terminal C.-amide group amino acids in length. Examples include linkers having an which is important for their biological activity. For example, amino acid sequence (GP)G (SEQ ID NO: 83), (GP)sG 35 Amylin, PYY and PP peptides all have C-terminal amida (SEQIDNO: 84), and GPG. In otherembodiments, the linker tions. In mammalian cells, the C-amidation can be processed may be a proline-alanine based linker having between 3 and by peptidyl-glycine O-amidating monooxygenase (PAM), a 30, 10 and 30, and 3 and 20 amino acids in length. Examples binfunctional enzyme catalyzing the conversion of peptidyl of proline alanine based linkers include, for example, (PA) glycine Substrates into C.-amidated products. (SEQIDNO: 86), (PA) (SEQIDNO: 87) and (PA), (SEQID 40 There are various techniques for producing C-terminally NO: 88). It is contemplated, that the optimal linker length and amidated peptides. For example, peptide precursors (with a amino acid composition may be determined by routine C-terminal-glycine or -glycine-lysine-arginine or other experimentation by methods well known in the art. extension) may be processed in vitro by a purified PAM In some embodiments, the fusions described herein are enzyme. PAM and methods for using PAM to produce C-ter linked to the SABA via a polypeptide linker having a protease 45 minally amidated peptides are known to those of skill in the site that is cleavable by a protease in the blood or target tissue. art. See, e.g., U.S. Pat. No. 4,708,934, U.S. Pat. No. 5,789,234 Such embodiments can be used to release a therapeutic pro and U.S. Pat. No. 6,319.685. C-terminal amidation may also tein for better delivery or therapeutic properties or more effi be accomplished in mammalian expression systems which cient production. express endogenous PAM. The fusion protein may be Additional linkers or spacers, may be introduced at the 50 expressed as a precursor molecule extended by a -glycine or C-terminus of an Fn3 domain between the Fn3 domain and a -glycine-lysine-arginine sequence. When expressed as a the polypeptide linker. Additional linkers or spacers may be secretory protein in eukaryotic cells (e.g., CHO, NIH 3T3 and introduced at the N-terminus of an Fn3 domain between the BHK), the protein may be cleaved by the endogenous PAM Fn3 domain and the polypeptide linker. enzyme and result in the C-terminal carboxyamides. See, e.g., In some embodiments, a therapeutic moiety may be 55 Endocrinology (1991) V129:553-555 (1991); and Molecular directly or indirectly linked to a SABA via a polymeric linker. and Cellular Endocrinology 91:135-141 (1993). C-terminal Polymeric linkers can be used to optimally vary the distance amidation may also be accomplished in mammalian expres between each component of the fusion to create a protein sion systems in which human PAM is co-expressed. See, e.g., fusion with one or more of the following characteristics: 1) Chinese Journal of Biotechnology (2002) v18:20-24 (2002). reduced or increased steric hindrance of binding of one or 60 In addition to in vitro PAM enzymatic conversion of more protein domains when binding to a protein of interest, 2) COOH to CONH carboxamide terminion proteins of inter increased protein stability or solubility, 3) decreased protein est may be created using Merrifield synthesis. Merrifield syn aggregation, and 4) increased overall avidity or affinity of the thesis permits a Maleimide moiety to be attached to the N-ter protein. mini of the peptide during the Merrifield synthesis process. In some embodiments, a therapeutic moiety is linked to a 65 The maleimide moiety allows the creation of conjugates SABA via a biocompatible polymer such as a polymeric between two amino acid sequences (including, for example, a Sugar. The polymeric Sugar can include an enzymatic cleav SABA and a carboxy amidated neuropeptide) using a variety US 8,969,289 B2 49 50 of non-amino acid moieties placed between the two polypep- tion reaction are that it can be readily performed on proteins, tide domains that can serve as a spacer. Examples of Suitable it offers high yields under gentle conditions that are favorable non-amino acid moieties that can be used as spacers are to protein molecules, and it is highly specific with few side shown below in Table 1. Benefits of the maleimide conjuga- products. TABLE 1 Exemplary Linkers/Spacer for Conjugation of a SABAMolecule to Peptides Having a Maleimide Moiety at the N-Terminus. Linker/Spacer Structure or Sequence 1 6-aminohexanoic acid (Ahk) O

"N--->OH 2 (GS) Gly-Ser-Gly-Ser-Gly-Ser-Gly-Ser-Gly-Ser 3 PEG (9-atoms) N-1-N-N-1a r OH O 4 PEG (13-atoms) O 2N-1- N-1so 2 OH

5 PEG (16-atoms) O

H2NS-1-N-O N-1so 3 OH

6 PEG(20-atom) H "Nu-1S-1'Nu-1N1\-'Nu-1Nu-N OH O r 7 PEG(40-atom) O HN n-1N1 O N-1so OH

8 4-(N-maleimidomethyl)- O cyclohexane-1-carboxylic acid N (MCC) HO N O O 9 3-Maleimidobenzoic acid (MB) O N

N HO O

O 10 4-((Iodoacetyl)aminomethyl) O cyclohexane-1-carboxylic acid (IAC) HO NH I O 11 3-(iodoacetyl)-aminobenzoic acid I (IAB) NH HO O US 8,969,289 B2 51 52 In some embodiments, a C-terminally amidated synthetic The synthesis of the peptidyl-resins used as precursors to peptide described herein can be conjugated with a SABA the final peptides may utilize commercially available cross containing a C-terminal Cys residue in Solution by Michael linked polystyrene polymer resins (Novabiochem, San addition of a sulfhydryl group of the C-terminal Cys of the Diego, Calif.) or ChemMatrix PEG polymer resins (PCAS SABA onto a maleimido derivative of the peptide, with the BioMatrix, Quebec City, Canada). Preferred solid supports maleimido group typically at the N-terminus of the peptide, to include, for example: 4-(2',4'-dimethoxyphenyl-Fmoc-ami yield a stable thioether linkage. The same conjugation may be nomethyl)-phenoxyacetyl-p-methyl benzhydrylamine resin achieved by alkylation of the Cys sulfhydryl of the SABA (Rink amide MBHA resin); 9-Fmoc-amino-xanthen-3- with a haloalkyl derivative of the peptide, such as a bromo- or yloxy-Merrifield resin (Sieberamide resin): 4-(9-Fmoc)ami an iodo-methyl group introduced onto the peptide via acyla 10 nomethyl-3,5-dimethoxyphenoxy)Valeryl-aminomethyl Merrifield resin (PAL resin), for C-terminal carboxamides, tion using bromo- or iodo-acetic acid. Those trained in the art and the corresponding ChemMatrix PEG-based resins. Cou will recognize that this type of peptide-protein conjugation pling of first and Subsequent amino acids can be accom may be achievable using several different methods such as, plished using HOBt or 6-C1-HOBt active esters produced for example, bioconjugation procedures like those described 15 from DIC/HOBt, HBTU/HOBt or from DIC/6-C1-HOBt or in G. T. Hermanson, “Bioconjugate Techniques'. Academic HCTU/6-C1-HOBt, respectively. Press, San Diego, Calif., 1996. The syntheses of the peptides and peptide analogs In another embodiment, a neutral linker or spacer is placed described herein can be carried out using an automated pep between the thiol-reactive group on the peptide and the native tide synthesizer, Such as Liberty microwave peptide synthe or modified peptide sequence. The linker or spacer may pro sizer (CEMCorp., Matthews, N.C.). The stepwise solid phase vide reduced steric hindrance and facilitate the binding of the peptide synthesis may be performed using the Fmoc/t-butyl peptide to its cognate receptor or protein partner. Suitable protection strategy described in the Examples. In some linkers include, but are not limited to, those linkers described embodiments, the Fmoc amino acids derivatives shown in in Table 1. Linkers 8-11 are shown with the thiol-reactive FIG. 21 may be used. Maleimido or Iodoacetyl groups and can be coupled to the 25 In the case of Amylin derivatives, the disulfide bond peptide using the corresponding N-Succinimidyl active esters between the Acm-protected Cys residues (e.g., Cys’’ or described in the art. Cys'") may be formed via iodine-mediated oxidation on the The peptides and peptide analogs described herein may be resin (Chan and White, 2000). The peptidyl-resin precursors produced by chemical synthesis using various Solid-phase for their respective peptides may be cleaved and de-protected techniques such as those described in G. Barany and R. B. 30 using any standard procedure (see, for example, D. S. King et Merrifield, “The Peptides: Analysis, Synthesis, Biology': al., Int. J. Peptide Protein Res. 36:255-266 (1990)). In some Volume 2"Special Methods in Peptide Synthesis, Part A’, pp. embodiments, TFA is used in the presence of water, TIS and 3-284, E. Gross and J. Meienhofer, Eds., Academic Press, phenol as Scavengers. Typically, the peptidyl-resin is stirred New York, 1980; or in W. C. Chan and P. D. White, “Fmoc in TFA/water/TIS (94:3:3, v:v:v; 1 mL/100 mg of peptidyl Solid Phase Peptide Synthesis—A Practical Approach'. 35 resin) or TFA/water/phenol (90:5:5; v:v:w) for 2-3 hrs at Oxford University Press., Oxford, UK, 2000. An exemplary room temperature. The spent resin is then filtered off and the strategy for peptide synthesis is based on the Fmoc (9-Fluo TFA solution is concentrated or dried under reduced pressure. renylmethylmethyloxycarbonyl) group for temporary protec The resulting crude peptide may be either precipitated and tion of the C-amino group, in combination with the tert-butyl washed with EtO or re-dissolved directly into DMSO, DMF group for temporary protection of the amino acid side chains 40 or 50% aqueous AcCN for purification by preparative HPLC. (see for example E. Atherton and R. C. Sheppard, “The Fluo Peptides with the desired purity can be obtained by purifi renylmethoxycarbonyl Amino Protecting Group', in “The cation using preparative HPLC, for example, on a Shimadzu Peptides: Analysis, Synthesis, Biology': Volume 9 “Special Model LC-8A liquid chromatograph. For example, the solu Methods in Peptide Synthesis, Part C. pp. 1-38, S. Unden tion of crude peptide may be injected onto a PhenomeneX friend and J. Meienhofer, Eds. Academic Press, San Diego, 45 Luna C18 (5um, 21.2x250 mm) column and eluted with a 1987. linear gradient of MeCN in water, both buffered with 0.1% Peptides can be synthesized in a stepwise manner on an TFA, using a flow rate of 14-20 mL/min with effluent moni insoluble polymer support (also referred to as a “resin) start toring by UV absorbance at 220 nm. The structures of the ing from the Carboxy-terminus of the peptide. A synthesis is purified peptides can be confirmed by electrospray LCMS begun by appending the C-terminal amino acid of the peptide 50 analysis. For example, peptide samples may be analyzed by to the resin through formation of an amide or ester linkage. LC/MS on a Waters ZQ 2000 single quadrupole mass spec This allows the eventual release of the resulting peptide as a trometer (Milford, Mass.) interfaced to a Waters Acquity ultra C-terminal amide or carboxylic acid, respectively. performance liquid chromatograph (HPLC). Chromato The C-terminal amino acid and all other amino acids used graphic separations may be achieved employing a 2.1x50 in the synthesis preferably have their O-amino groups and 55 mm, 1.7 um, 300 A, Acquity BEH300 C18 column (Waters, side chain functionalities (if present) differentially protected Milford, Mass.) with gradient elution at 0.8 mL/min. The Such that the C-amino protecting group may be selectively column temperature may be 50° C. Mobile phase A may be removed during the synthesis. The coupling of an amino acid 98:2 water:acetonitrile with 0.05%TFA and mobile phase B is performed by activation of its carboxyl group as an active may beacetonitrile with 0.04%TFA. A linear gradient may be ester and reaction thereof with the unblocked C-amino group 60 formed from 2% to 80% mobile phase B over 1, 2, or 5 of the N-terminal amino acid appended to the resin. The cycle minutes. A 2 LL injection may be used and ESIMS data may of C.-amino group deprotection and coupling is repeated until be acquired from m/z 500 to m/z 1500 or from m/z. 1000 to the entire peptide sequence is assembled. The peptide is then m/Z 2000. The instrument may be operated at unit resolution. released from the resin with concomitant deprotection of the Deimmunization of Binding Polypeptides side chain functionalities, usually in the presence of appro 65 The amino acid sequences of serum albumin binders and priate Scavengers to limit side reactions. The resulting peptide their fusions may be altered to eliminate one or more B- or may be purified by reverse phase preparative HPLC. T-cell epitopes. A protein, including the SABA fusions US 8,969,289 B2 53 54 described herein, may be deimmunized to render it non throughout the administration of said therapy. The HAMA immunogenic, or less immunogenic, to a given species. response is measured, for example, by detecting antibodies to Deimmunization can be achieved through structural alter the deimmunized protein in serum samples from the Subject ations to the protein. Any deimmunization technique known using a method known to one in the art, including Surface to those skilled in the art can be employed, see e.g., WO plasmon resonance technology (BIAcore) and/or Solid-phase 00/34317, the disclosure of which is incorporated herein in its ELISA analysis. Alternatively, in vitro assays designed to entirety. measure a T-cell activation event are also indicative of immu In one embodiment, the sequences of the serum albumin nogenicity. binders and their fusions can be analyzed for the presence of Additional Modifications MHC class II binding motifs. For example, a comparison may 10 In certain embodiments, the serum albumin binders and be made with databases of MHC-binding motifs such as, for their fusions may further comprise post-translational modifi example by searching the “motifs’ database on the worldwide cations. Exemplary post-translational protein modification web at sitewehilwehi.edu.au. Alternatively, MHC class II include phosphorylation, acetylation, methylation, ADP-ri binding peptides may be identified using computational bosylation, ubiquitination, glycosylation, carbonylation, threading methods such as those devised by Altuvia et al. (J. 15 Sumoylation, biotinylation or addition of a polypeptide side Mol. Biol. 249 244-250 (1995)) whereby consecutive over chain or of a hydrophobic group. As a result, the modified lapping peptides from the polypeptide are testing for their serum albumin binders and their fusions S may contain non binding energies to MHC class II proteins. Computational amino acid elements, such as lipids, poly- or mono-saccha binding prediction algorithms include iTopetM, Tepitope, ride, and phosphates. A preferred form of glycosylation is SYFPEITHI, EpiMatrix (Epi Vax), and MHCpred. In order to sialylation, which conjugates one or more Sialic acid moieties assist the identification of MHC class II-binding peptides, to the polypeptide. Sialic acid moieties improve solubility associated sequence features which relate to Successfully pre and serum half-life while also reducing the possible immu sented peptides such as amphipathicity and Rothbard motifs, nogenicity of the protein. See, e.g., Raju et al. Biochemistry. and cleavage sites for cathepsin B and other processing 2001 Jul.31:40(30):8868-76. Effects of such non-amino acid enzymes can be searched for. 25 elements on the functionality of the serum albuminbinders or Having identified potential (e.g. human) T-cell epitopes, their fusions may be tested for their ability to bind a particular these epitopes are then eliminated by alteration of one or more serum albumin (e.g., HSA or RhSA) and/or the functional amino acids, as required to eliminate the T-cell epitope. Usu role conferred by a specific non-'Fn3 moiety in the context ally, this will involve alteration of one or more amino acids of a fusion (e.g., the effect of FGF21 on glucose uptake). within the T-cell epitope itself. This could involve altering an 30 Vectors & Polynucleotides Embodiments amino acid adjacent the epitope in terms of the primary struc Also included in the present disclosure are nucleic acid ture of the protein or one which is not adjacent in the primary sequences encoding any of the proteins described herein. As structure but is adjacent in the secondary structure of the appreciated by those skilled in the art, because of third base molecule. The usual alteration contemplated will be amino degeneracy, almost every amino acid can be represented by acid substitution, but it is possible that in certain circum 35 more than one triplet codon in a coding nucleotide sequence. stances amino acid addition or deletion will be appropriate. In addition, minor base pair changes may result in a conser All alterations can be accomplished by recombinant DNA Vative Substitution in the amino acid sequence encoded but technology, so that the final molecule may be prepared by are not expected to substantially alter the biological activity expression from a recombinant host, for example by well of the gene product. Therefore, a nucleic acid sequence established methods, but the use of protein chemistry or any 40 encoding a protein described herein may be modified slightly other means of molecular alteration may also be used. in sequence and yet still encode its respective gene product. Once identified T-cell epitopes are removed, the deimmu Certain exemplary nucleic acids encoding the serum albumin nized sequence may be analyzed again to ensure that new binders and their fusions described herein include nucleic T-cell epitopes have not been created and, if they have, the acids having the sequences set forth in Table 3. epitope(s) can be deleted. 45 Nucleic acids encoding any of the various proteins or Not all T-cell epitopes identified computationally need to polypeptides disclosed herein may be synthesized chemi be removed. A person skilled in the art will appreciate the cally. Codon usage may be selected so as to improve expres significance of the 'strength' or rather potential immunoge sion in a cell. Such codon usage will depend on the cell type nicity of particular epitopes. The various computational selected. Specialized codon usage patterns have been devel methods generate scores for potential epitopes. A person 50 oped for E. coli and other bacteria, as well as mammalian skilled in the art will recognize that only the high scoring cells, plant cells, yeast cells and insect cells. See for example: epitopes may need to be removed. A skilled person will also Mayfield et al., Proc Natl Acad Sci USA. 2003 100(2):438 recognize that there is a balance between removing potential 42: Sinclair et al. Protein Expr Purif. 2002 (1):96-105; Con epitopes and maintaining binding affinity or other biological nell N. D. Curr Opin Biotechnol. 2001 (5):446-9; Makrides et activity of the protein. Therefore, one strategy is to sequen 55 al. Microbiol. Rev. 1996 60(3):512-38; and Sharp et al. Yeast. tially introduce substitutions into the SABA or SABA fusion 1991 7(7):657-78. protein and then test for target binding or other biological General techniques for nucleic acid manipulation are activity and immunogenicity. within the purview of one skilled in the art and are also In one aspect, the deimmunized SABA or SABA fusion described for example in Sambrook et al., Molecular Clon protein is less immunogenic (or rather, elicits a reduced 60 ing: A Laboratory Manual, Vols. 1-3, Cold Spring Harbor HAMA response) than the original protein in a human Sub Laboratory Press, 2 ed., 1989, or F. Ausubel et al., Current ject. Assays to determine immunogenicity are well within the Protocols in Molecular Biology (Green Publishing and knowledge of the skilled person. Art-recognized methods of Wiley-Interscience: New York, 1987) and periodic updates, determining immune response can be performed to monitor a herein incorporated by reference. The DNA encoding a pro HAMA response in a particular Subject or during clinical 65 tein is operably linked to suitable transcriptional or transla trials. Subjects administered deimmunized protein can be tional regulatory elements derived from mammalian, viral, or given an immunogenicity assessment at the beginning and insect genes. Such regulatory elements include a transcrip US 8,969,289 B2 55 56 tional promoter, an optional operator sequence to control tems can also be employed to express recombinant proteins. transcription, a sequence encoding Suitable mRNA ribosomal Baculovirus systems for production of heterologous proteins binding sites, and sequences that control the termination of in insect cells are reviewed by Luckow and Summers, (Bio/ transcription and translation. The ability to replicate in a host, Technology, 6:47, 1988). In some instance it will be desired to usually conferred by an origin of replication, and a selection produce proteins invertebrate cells, such as for glycosylation, gene to facilitate recognition of transformants are addition and the propagation of vertebrate cells in culture (tissue cul ally incorporated. Suitable regulatory elements are well ture) has become a routine procedure. Examples of suitable known in the art. mammalian host cell lines include endothelial cells, COS-7 The proteins and fusion proteins described herein may be monkey kidney cells, CV-1, L cells, C127, 3T3, Chinese produced as a fusion protein with a heterologous polypeptide, 10 hamster ovary (CHO), human embryonic kidney cells, HeLa, which is preferably a signal sequence or other polypeptide 293, 293T, and BHK cell lines. For many applications, the having a specific cleavage site at the N-terminus of the mature small size of the protein multimers described herein would protein or polypeptide. The heterologous signal sequence make E. coli the preferred method for expression. selected preferably is one that is recognized and processed Protein Production (i.e., cleaved by a signal peptidase) by the host cell. For 15 Host cells are transformed with the herein-described prokaryotic host cells that do not recognize and process a expression or cloning vectors for protein production and cul native signal sequence, the signal sequence is substituted by a tured in conventional nutrient media modified as appropriate prokaryotic signal sequence selected, for example, from the for inducing promoters, selecting transformants, or amplify group of the alkaline phosphatase, penicillinase, 1 pp, or ing the genes encoding the desired sequences. heat-stable enterotoxin II leaders. For yeast secretion, the The host cells used to produce the proteins of this invention native signal sequence may be substituted by, e.g., the yeast may be cultured in a variety of media. Commercially avail invertase leader, a factor leader (including Saccharomyces able media such as Ham's F10 (Sigma), Minimal Essential and Kluyveromyces alpha-factor leaders), or acid phos Medium ((MEM), Sigma), RPMI-1640 (Sigma), and Dulbec phatase leader, the C. albicans glucoamylase leader, or the co's Modified Eagle's Medium (DMEM), Sigma) are suit signal described in PCT Publication No. WO 90/13646. In 25 able for culturing the host cells. In addition, any of the media mammalian cell expression, mammalian signal sequences as described in Ham et al., Meth. Enz. 58:44 (1979), Barnes et well as viral Secretory leaders, for example, the herpes sim al., Anal. Biochem. 102:255 (1980), U.S. Pat. Nos. 4,767, plex gld signal, are available. The DNA for such precursor 704; 4,657,866; 4,927,762; 4,560,655; or 5, 122,469: WO regions may be ligated in reading frame to DNA encoding the 90/03430; WO 87/00195; or U.S. Pat. No. Re. 30,985 may be protein. 30 used as culture media for the host cells. Any of these media Expression vectors used in eukaryotic host cells (e.g., may be supplemented as necessary with hormones and/or yeast, fungi, insect, plant, animal, human, or nucleated cells other growth factors (such as insulin, transferrin, or epidermal from other multicellular organisms) will also contain growth factor), salts (such as sodium chloride, calcium, mag sequences necessary for the termination of transcription and nesium, and phosphate), buffers (such as HEPES), nucle for stabilizing the mRNA. Such sequences are commonly 35 otides (such as adenosine and thymidine), antibiotics (such as available from the 5' and, occasionally 3', untranslated GENTAMYCINTM drug), trace elements (defined as inor regions of eukaryotic or viral DNAS or cDNAs. These regions ganic compounds usually present at final concentrations in contain nucleotide segments transcribed as polyadenylated the micromolar range), and glucose or an equivalent energy fragments in the untranslated portion of the mRNA encoding Source. Any other necessary Supplements may also be the multivalent antibody. One useful transcription termina 40 included at appropriate concentrations that would be known tion component is the bovine growth hormone polyadenyla to those skilled in the art. The culture conditions, such as tion region. See PCT Publication No. WO94/11026 and the temperature, pH, and the like, are those previously used with expression vector disclosed therein. the host cell selected for expression, and will be apparent to The recombinant DNA can also include any type of protein the ordinarily skilled artisan. tag sequence that may be useful for purifying the protein. 45 Proteins disclosed herein can also be produced using cell Examples of protein tags include but are not limited to a translation systems. For Such purposes, the nucleic acids histidine tag, a FLAG tag, a myc tag, an HA tag, or a GST tag. encoding the proteins must be modified to allow in vitro Appropriate cloning and expression vectors for use with bac transcription to produce mRNA and to allow cell-free trans terial, fungal, yeast, and mammalian cellular hosts can be lation of the mRNA in the particular cell-free system being found in Cloning Vectors: A Laboratory Manual. (Elsevier, 50 utilized. Exemplary eukaryotic cell-free translation systems New York, 1985), the relevant disclosure of which is hereby include, for example, mammalian or yeast cell-free transla incorporated by reference. tion systems, and exemplary prokaryotic cell-free translation The expression construct is introduced into the host cell systems include, for example, bacterial cell-free translation using a method appropriate to the host cell, as will be apparent systems. to one of skill in the art. A variety of methods for introducing 55 Proteins disclosed hereincan also be produced by chemical nucleic acids into host cells are known in the art, including, synthesis (e.g., by the methods described in Solid Phase Pep but not limited to, electroporation; transfection employing tide Synthesis, 2nd ed., 1984. The Pierce Chemical Co., calcium chloride, rubidium chloride, calcium phosphate, Rockford, Ill.). Modifications to the protein can also be pro DEAE-dextran, or other substances; microprojectile bom duced by chemical synthesis. bardment; lipofection; and infection (where the vector is an 60 The proteins disclosed herein can be purified by isolation/ infectious agent). purification methods for proteins generally known in the field Suitable host cells include prokaryotes, yeast, mammalian of protein chemistry. Non-limiting examples include extrac cells, or bacterial cells. Suitable bacteria include gram nega tion, recrystallization, salting out (e.g., with ammonium Sul tive or gram positive organisms, for example, E. coli or Bacil fate or sodium Sulfate), centrifugation, dialysis, ultrafiltra lus spp. Yeast, preferably from the Saccharomyces species, 65 tion, adsorption chromatography, ion exchange Such as S. cerevisiae, may also be used for production of chromatography, hydrophobic chromatography, normal polypeptides. Various mammalian or insect cell culture sys phase chromatography, reversed-phase chromatography, gel US 8,969,289 B2 57 58 filtration, gel permeation chromatography, affinity chroma ropathy, nephropathy, wound healing, atherosclerosis and its tography, electrophoresis, countercurrent distribution or any sequelae (acute coronary syndrome, myocardial infarction, combinations of these. After purification, proteins may be angina pectoris, peripheral vascular disease, intermittent exchanged into different buffers and/or concentrated by any claudication, myocardial ischemia, stroke, heart failure), of a variety of methods known to the art, including, but not Metabolic Syndrome, hypertension, obesity, dyslipidemia, limited to, filtration and dialysis. hyperlipidemia, hypertriglyceridemia, hypercholester The purified proteins are preferably at least 85% pure, olemia, low HDL, high LDL, vascular restenosis, peripheral more preferably at least 95% pure, and most preferably at arterial disease, lipid disorders, bone disease (including least 98% pure. Regardless of the exact numerical value of the osteoporosis), PCOS, HIV protease associated lipodystro purity, the proteins are sufficiently pure for use as a pharma 10 phy, glaucoma and inflammatory diseases, such as, psoriasis, ceutical product. rheumatoid arthritis and osteoarthritis, and treatment of side Imaging, Diagnostic and Other Applications effects related to diabetes, lipodystrophy and osteoporosis The SABA fusions provided herein may be used to treat a from corticosteroid treatment. In certain embodiments a variety of diseases and disorders, based on the identity of the SABA-FGF21 fusion provided herein may be used for treat heterogenous molecule fused to the SABA. The applications 15 ing or preventing obesity or reducing weight or preventing for the SABA fusions may be determined by the skilled weight gain in a Subject. In an exemplary embodiment, a artisan based on the knowledge in the art and the information SABA-FGF21 fusion may be used for reducing weight or provided herein. Uses for various SABA fusion proteins are preventing weight gain in a subject having a BMI of 25-29.9. described in detail herein. SABA fusions may be adminis In another exemplary embodiment, a SABA-FGF21 fusion tered to any mammalian Subject or patient, including both may be used for reducing weight or preventing weight gain in human and non-human organisms. a subject having a BMI of >30. In another embodiment, a The serum albumin binders and fusion molecules SABA-FGF21 fusion may be used for treating a subject hav described herein can be detectably labeled and used to contact ing a total cholesterol level 200 mg/dL and/or a triglyceride cells expressing, e.g., a protein bound by the fusion molecule level a 150 mg/dL. In other embodiments, a SABA-FGF21 for imaging or diagnostic applications. Any method known in 25 fusion may be used for treating or lowering insulin resistance the art for conjugating a protein to the detectable moiety may and/or increasing glucose uptake in adipose tissue. In other be employed, including those methods described by Hunter, embodiments, a SABA-FGF21 fusion may be used for slow et al., Nature 144:945 (1962); David, et al., Biochemistry ing the progression of diabetes in a prediabetic Subject. In 13:1014 (1974); Pain, et al., J. Immunol. Meth. 40:219 other embodiments, a SABA-FGF21 fusion may be used for (1981); and Nygren, J. Histochem. and Cytochem. 30:407 30 lowering blood glucose levels, lower triglyceride levels, low (1982). ering cholesterol levels, increasing energy expenditure, In certain embodiments, the serum albumin binders and increasing fat utilization and/or increasing lipid excretion in a fusion molecules described herein are further attached to a Subject. label that is able to be detected (e.g., the label can be a As used herein, “preventing a disease or disorder refers to radioisotope, fluorescent compound, enzyme or enzyme co 35 reducing the probability of occurrence of a disease-state in a factor). The label may be a radioactive agent, such as: radio statistical sample relative to an untreated control sample, or active heavy metals such as iron chelates, radioactive chelates delaying the onset or reducing the severity of one or more of gadolinium or manganese, positron emitters of oxygen, symptoms of the disease or disorder relative to the untreated nitrogen, iron, carbon, or gallium, "K, Fe, Co, 'Cu, control sample. Patients may be selected for preventative 7Ga, Ga., I, I, I, II, or Tc. A serum albumin 40 therapy based on factors that are known to increase risk of binder or fusion molecule affixed to such a moiety may be Suffering a clinical disease state compared to the general used as an imaging agent and is administered in an amount population. The term “treating as used herein includes (a) effective for diagnostic use in a mammal Such as a human and inhibiting the disease-state, i.e., arresting its development; the localization and accumulation of the imaging agent is then and/or (b) relieving the disease-state, i.e., causing regression detected. The localization and accumulation of the imaging 45 of the disease state once it has been established. agent may be detected by radioScintigraphy, nuclear magnetic In certain embodiments, the application provides pharma resonance imaging, computed tomography or positron emis ceutical compositions comprising, as an active ingredient, a sion tomography. As will be evident to the skilled artisan, the therapeutically effective amount of a SABA-FGF21 fusion, amount of radioisotope to be administered is dependent upon alone or in combination with a pharmaceutical carrier. the radioisotope. Those having ordinary skill in the art can 50 Optionally, a SABA-FGF21 fusion can be used alone, in readily formulate the amount of the imaging agent to be combination with other fusions described herein, or in com administered based upon the specific activity and energy of a bination with one or more other therapeutic agent(s), e.g., an given radionuclide used as the active moiety. antidiabetic agent or other pharmaceutically active material. Serum albumin binders and fusion molecules also are use In certain embodiments, a SABA-FGF21 fusion can be ful as affinity purification agents. In this process, the proteins 55 administered alone or in combination with one or more addi are immobilized on a suitable Support. Such a Sephadex resin tional therapeutic agents. By “administered in combination' or filter paper, using methods well known in the art. The or “combination therapy” it is meant that the SABA-FGF21 proteins can be employed in any known assay method, Such as fusion and one or more additional therapeutic agents are competitive binding assays, direct and indirect sandwich administered concurrently to the mammal being treated. assays, and immunoprecipitation assays (Zola, Monoclonal 60 When administered in combination, each component may be Antibodies: A Manual of Techniques, pp. 147-158 (CRC administered at the same time or sequentially in any order at Press, Inc., 1987)). different points in time. Thus, each component may be Exemplary Uses of SABA-FGF21 Fusions administered separately but sufficiently closely in time so as The SABA-FGF21 fusions provided herein may be used in to provide the desired therapeutic effect. treating or preventing one or more of the following: diabetes, 65 The SABA-FGF21 fusions provided herein may be hyperglycemia, impaired glucose tolerance, gestational dia employed in combination with anti-diabetic agents, anti-hy betes, insulin resistance, hyperinsulinemia, retinopathy, neu perglycemic agents, anti-hyperinsulinemic agents, anti-ret US 8,969,289 B2 59 60 inopathic agents, anti-neuropathic agents, anti-nephropathic 1 ng/kg to 20 g/kg, 1 ng/kg to 10 ug/kg, 10 ng/kg to 200 agents, anti-atherosclerotic agents, anti-ischemic agents, g/kg, 10 ng/kg to 50 g/kg, 10 ng/kg to 20 g/kg, 10 mg/kg to anti-hypertensive agents, anti-obesity agents, anti-dyslipi 10 g/kg, 100 ng/kg to 200 g/kg, 100 ng/kg to 50 g/kg, 100 demic agents, anti-dyslipidemic agents, anti-hyperlipidemic ng/kg to 20 g/kg, 100 ng/kg to 10 ug/kg, 0.1 to 2001g/kg, 0.1 agents, anti-hypertriglyceridemic agents, anti-hypercholes to 100 ug/kg, 1 to 200 ug/kg, 1 to 100 ug/kg, 0.1 to 50 ug/kg, terolemic agents, anti-restenotic agents, anti-pancreatic 1 to 50 g/kg, or 7 to 50 g/kg, or about 100 pg/kg, 1 ng/kg, agents, lipid lowering agents, anorectic agents, memory 10 ng/kg, 100 ng/kg, or 1, 2, 5, 10, 20, 25, 30, 40, 50, 60, 75, enhancing agents, anti-dementia agents, or cognition promot 100, 125, 150, 200 or 250 g/kg. The SABA-FGF21 fusion ing agents, appetite Suppressants, treatments for heart failure, may be given daily (e.g., once, twice, three times, or four treatments for peripheral arterial disease and anti-inflamma 10 times daily) or less frequently (e.g., once every other day, tory agents. once or twice weekly, or monthly). In exemplary embodi The antidiabetic agents used in combination with the ments, a SABA-FGF21 fusion is administered at a dose of SABA-FGF21 fusion include, but are not limited to, insulin about 0.01 to 20 mg, about 0.01 to 10 mg, about 0.1 to 20 mg. secretagogues or insulin sensitizers, GPR40 receptor modu about 0.1 to 10 mg, about 0.01 to 5 mg, about 0.1 to 5 mg, or lators, or other antidiabetic agents. These agents include, but 15 about 0.7 to 5 mg, or about 1, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10 mg are not limited to, dipeptidyl peptidase IV (DP4) inhibitors on a weekly basis. In exemplary embodiments, a SABA (for example, Sitagliptin, saxagliptin, alogliptin, Vildagliptin FGF21 fusion is administered at a dose of about 0.1 to 200 and the like), biguanides (for example, metformin, phen ug/kg, about 0.1 to 100 g/kg, about 1 to 200 g/kg, about 1 formin and the like), Sulfonyl ureas (for example, gliburide, to 100 g/kg, about 0.1 to 50 ug/kg, about 1 to 50 ug/kg, or glimepiride, glipizide and the like), glucosidase inhibitors about 7 to 50 g/kg, or about 1,2,5, 10, 20, 25, 30, 40, 50, 60, (for example, acarbose, miglitol, and the like), PPARY ago 75, 100, 125, 150, 200 or 250 g/kg on a weekly basis. In nists such as thiazolidinediones (for example, rosiglitaZone, exemplary embodiments, a SABA-FGF21 fusion is adminis pioglitazone, and the like), PPAR C/Y dual agonists (for tered at a dose of about 10 ng to 20 mg, about 10 ng to 5 mg. example, muraglitazar, tesaglitazar, aleglitazar, and the like), about 10 ng to 2 mg, about 10 ng to 1 mg, about 10 ng to 500 glucokinase activators (as described in Fyfe, M. C. T. et al., 25 ug, about 10 ng to 200 ug, about 100 ng to 20 mg, about 100 Drugs of the Future, 34(8):641-653 (2009) and incorporated ng to 5 mg, about 100 ng to 2 mg, about 100ng to 1 mg, about herein by reference), GPR119 receptor modulators (MBX 100 ng to 500 ug, about 100ng to 2001g, about 1 lug to 20 mg. 2952, PSN821, APD597 and the like), SGLT2 inhibitors about 1 Lug to 5 mg, about 1 Lig to 2 mg, about 1 Lig to 1 mg. (dapagliflozin, canagliflozin, remagliflozin and the like), about 1 ug to 500 ug, about 1 g to 200 g, about 10 ug to 20 amylin analogs such as pramlintide, and/or insulin. Reviews 30 mg, about 10 ug to 5 mg, about 10 ug to 2 mg, about 10 ug to of current and emerging therapies for the treatment of diabe 1 mg, about 10 ug to 500 g, about 10 ug to 200 ug, or about tes can be found in: Mohler, M. L. et al., Medicinal Research 10 ng, 100 ng, 1 lug. 10 ug. 100 lug. 200 ug. 500 ug, 1 mg, 1.5 Reviews, 29(1):125-195 (2009), and Mizuno, C. S. et al., mg, 2 mg, 2.5 mg, 3 mg, or 5 mgona daily basis. In exemplary Current Medicinal Chemistry, 15:61-74 (2008). embodiments, a SABA-FGF21 fusion is administered at a A SABA-FGF21 fusion may also be optionally employed 35 dose of about 100 pg/kg to 200 ug/kg, about 100 pg/kg to 50 in combination with one or more hypophagic agents such as ug/kg, about 100 pg/kg to 20 ug/kg, about 100 pg/kg to 5 diethylpropion, phendimetrazine, phentermine, orlistat, g/kg, about 100 pg/kg to 2 g/kg, about 1 ng/kg to 200 g/kg. sibutramine, lorcaserin, pramlintide, topiramate, MCHR1 about 1 ng/kg to 50 g/kg, about 1 ng/kg to 20 ug/kg, about 1 receptor antagonists, oxyntomodulin, naltrexone, Amylin ng/kg to 5 Lig/kg, about 1 ng/kg to 2 Lig/kg, about 10 ng/kg to peptide, NPY Y5 receptor modulators, NPY Y2 receptor 40 200 ug/kg, about 10 ng/kg to 50 ug/kg, about 10 ng/kg to 20 modulators, NPYY4 receptor modulators, cetilistat, 5HT2c g/kg, about 10 ng/kg to 5 g/kg, about 10 ng/kg to 2 Lig/kg. receptor modulators, and the like. A SABA-FGF21 fusion about 100 ng/kg to 200 g/kg, about 100 ng/kg to 50 ug/kg, also be employed in combination with an agonist of the glu about 100 ng/kg to 20 ug/kg, about 100 ng/kg to 5 Lig/kg, cagon-like peptide-1 receptor (GLP-1 R). Such as exenatide, about 100 ng/kg to 2 ug/kg, about 1 g/kg to 2001g/kg, about liraglutide, GPR-1(1-36) amide, GLP-1 (7-36) amide, GLP-1 45 1 Lig/kg to 50 g/kg, about 1 Lig/kg to 20 g/kg, about 1 g/kg (7-37) (as disclosed in U.S. Pat. No. 5,614,492 to Habener, to 5 g/kg, about 1 lug/kg to 2 ug/kg, about 10 g/kg to 200 the disclosure of which is incorporated herein by reference), ug/kg, about 10 ug/kg to 50 ug/kg, or about 10 g/kg to 20 which may be administered via injection, intranasal, or by ug/kg, or about 100 pg/kg, 1 ng/kg, 10 ng/kg, 100 ng/kg, 500 transdermal or buccal devices. Reviews of current and emerg ng/kg, 1 Lig/kg, 5 Lig/kg, 10 g/kg, 20 Jug/kg, 50 Lig/kg, 100 ing therapies for the treatment of obesity can be found in: 50 ug/kg or 200 ug/kg on a daily basis. In addition, as is known Melnikova, I. et al., Nature Reviews Drug Discovery, 5:369 in the art, adjustments for age as well as the body weight, 370 (2006); Jones, D., Nature Reviews. Drug Discovery, general health, sex, diet, time of administration, drug inter 8:833-834 (2009): Obici, S., Endocrinology, 150(6):2512 action, and the severity of the disease may be necessary, and 2517 (2009); and Elangbam, C. S., Vet. Pathol., 46(1):10-24 will be ascertainable with routine experimentation by those (2009). 55 skilled in the art. In certain embodiments, a SABA-FGF21 fusion is admin Therapeutic Formulations and Modes of Administration istered at a dose of about 10ng to 20 mg, 10 ng to 5 mg, 10 ng The present application provides methods for administer to 2 mg, 10 ng to 1 mg, 100 ng to 20 mg, 100ng to 5 mg, 100 ing a therapeutic moiety fused to a SABA, wherein the half ng to 2 mg, 100 ng to 1 mg, 1 g to 20 mg, 1 Jug to 5 mg, 1 Jug life of the therapeutic moiety is extended when fused to the to 2 mg, 1 Lig to 1 mg, 10ug to 20 mg, 10ug to 5 mg, 10ug to 60 SABA. Techniques and dosages for administration of the 2 mg, 10 ug to 1 mg, 0.01 to 20 mg 0.01 to 10 mg, 0.1 to 20 fusion constructs will vary depending on the type of thera mg, 0.1 to 10 mg, 0.01 to 5 mg 0.1 to 5 mg. or 0.7 to 5 mg. or peutic moiety fused to the SABA and the specific condition about 10 ng, 100 ng, 1 Jug, 101g, 100 ug, or about 1, 2, 2.5.3, being treated but can be readily determined by the skilled 4, 5, 6, 7, 8, 9, 10 mg. In certain embodiments, a SABA artisan. In general, regulatory agencies require that a protein FGF21 fusion is administered at a dose of about 100 pg/kg to 65 reagent to be used as a therapeutic is formulated so as to have 200 ug/kg, 100 pg/kg to 50 g/kg, 100 pg/kg to 20 ug/kg, 100 acceptably low levels of pyrogens. Accordingly, therapeutic pg/kg to 10 g/kg, 1 ng/kg to 200 g/kg, 1 ng/kg to 50 g/kg, formulations will generally be distinguished from other for US 8,969,289 B2 61 62 mulations in that they are substantially pyrogen free, or at organic acids such as acetic, lactic, pamoic, maleic, citric, least contain no more than acceptable levels of pyrogen as malic, ascorbic, Succinic, benzoic, palmitic, Suberic, Sali determined by the appropriate regulatory agency (e.g., FDA). cylic, tartaric, methanesulfonic, toluenesulfonic, or trifluoro In certain embodiments, pharmaceutical formulations of acetic acids or the like; polymeric acids such as tannic acid, 5 carboxymethyl cellulose, or the like; and inorganic acid Such SABA and their fusion molecules comprise, e.g., 1-20 mM as hydrochloric acid, hydrobromic acid, Sulfuric acid phos succinic acid, 2-10% sorbitol, and 1-10% glycine at pH 4.0- phoric acid, or the like. Metal complexes include Zinc, iron, 7.0. In an exemplary embodiment, pharmaceutical formula and the like. In one example, the polypeptide is formulated in tions of SABA and their fusion molecules comprise, e.g., 10 the presence of Sodium acetate to increase thermal stability. mM succinic acid, 8% sorbitol, and 5% glycine at pH 6.0. Formulations for oral use include tablets containing the In some embodiments, the SABA and fusions thereofare 10 active ingredient(s) in a mixture with non-toxic pharmaceu pharmaceutically acceptable to a mammal, in particular a tically acceptable excipients. These excipients may be, for human. A “pharmaceutically acceptable' polypeptide refers example, inert diluents or fillers (e.g., Sucrose and Sorbitol), to a polypeptide that is administered to an animal without lubricating agents, glidants, and anti-adhesives (e.g., magne significant adverse medical consequences. Examples of phar sium Stearate, Zinc Stearate, Stearic acid, silicas, hydrogenated maceutically acceptable SABA and fusions thereof 15 Vegetable oils, or talc). include 'Fn3 domains that lack the integrin-binding domain Formulations for oral use may also be provided as chew (RGD) and compositions of SABAS or SABA fusions that are able tablets, or as hard gelatin capsules wherein the active essentially endotoxin free or have very low endotoxin levels. ingredient is mixed with an inert Solid diluent, or as soft Therapeutic compositions may be administered with a gelatin capsules wherein the active ingredient is mixed with pharmaceutically acceptable diluent, carrier, or excipient, in water or an oil medium. unit dosage form. Administration may be parenteral (e.g., A therapeutically effective dose refers to a dose that pro intravenous, Subcutaneous), oral, or topical, as non-limiting duces the therapeutic effects for which it is administered. The examples. The composition can be in the form of a pill, tablet, exact dose will depend on the disorder to be treated, and may capsule, liquid, or Sustained release tablet for oral adminis be ascertained by one skilled in the art using known tech tration; a liquid for intravenous, Subcutaneous or parenteral 25 niques. In general, the SABA or SABA fusion is administered administration; or agel, lotion, ointment, cream, or a polymer at about 0.01 ug/kg to about 50 mg/kg per day, preferably 0.01 or other sustained release vehicle for local administration. mg/kg to about 30 mg/kg per day, most preferably 0.1 mg/kg Methods well known in the art for making formulations are to about 20 mg/kg per day. The polypeptide may be given found, for example, in “Remington: The Science and Practice daily (e.g., once, twice, three times, or four times daily) or less of Pharmacy” (20th ed., ed. A. R. Gennaro A. R., 2000, Lip 30 frequently (e.g., once every other day, once or twice weekly, pincott Williams & Wilkins, Philadelphia, Pa.). Formulations or monthly). In addition, as is known in the art, adjustments for parenteral administration may, for example, contain for age as well as the body weight, general health, sex, diet, excipients, Sterile water, Saline, polyalkylene glycols such as time of administration, drug interaction, and the severity of polyethylene glycol, oils of vegetable origin, or hydrogenated the disease may be necessary, and will be ascertainable with napthalenes. Biocompatible, biodegradable lactide polymer, 35 routine experimentation by those skilled in the art. lactide/glycolide copolymer, or polyoxyethylene-polyox ypropylene copolymers may be used to control the release of EXEMPLIFICATION the compounds. Nanoparticulate formulations (e.g., biode gradable nanoparticles, Solid lipid nanoparticles, liposomes) The invention now being generally described will be more may be used to control the biodistribution of the compounds. 40 readily understood by reference to the following examples Other potentially useful parenteral delivery systems include which are included merely for purposes of illustration of ethylene-Vinyl acetate copolymer particles, osmotic pumps, certain aspects and embodiments of the present invention, and implantable infusion systems, and liposomes. The concentra are not intended to limit the invention in any way. tion of the compound in the formulation varies depending Summary of Sequences upon a number of factors, including the dosage of the drug to 45 Many of the sequences referenced in this application are be administered, and the route of administration. summarized in Table 2 below. Unless otherwise specified, all The polypeptide may be optionally administered as a phar N-terminal extensions are indicated with a single underline, maceutically acceptable salt, such as non-toxic acid addition all C-terminal tails/extensions are indicated with a double salts or metal complexes that are commonly used in the phar underline, and linker sequences are boxed. Loop regions BC, maceutical industry. Examples of acid addition salts include DE and FG are shaded for each core SABA sequence. TABLE 2 Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence Exemplary Serum Albumin-Binding Adnectins " (SAA)

1 Fn3WT WT human 'Fn3 WSDWPRDLEWWAATPTSLLISWDAPAWT

domain VRYYRITYGETGGNSPVOEFTVPGSKST

ATISGLKPGWDYTITWYAWTGRGDSPAS

SKPISINYRT US 8,969,289 B2 63 64 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence Finav6 Generic 'Fn3 having EVVAAT (X) SLLI (X) YYRITYGE (X), 6 variable loops QEFTV (X). ATI (X).DYTITVYAV (X), ISINYRT Generic 'Fn3 having EVVAATPTSLLI(X) YYRITYGETGGN 3 variable loops SPVQEFTV (X), ATISGLKPGVDYTITV YAV (X) ISINYRT SABA1 Core 1. Adnectin " EVVAATPTSLLISWHSYYEQNSYYRITY

GETGGNSPVOEFTVPYSOETATISGLKP

GVDYTITVYAVYSKYYYPISINYRT

SABA1BC Core 1 BC Loop HSYYEONS

SABA1DE Core 1 DE Loop YSOT

SABA1FG Core 1 FG Loop YGSKYYY

SABA2 Core 2 Adnectin " EWWAATPTSLLISWEEEEEEEYYRITY

GETGGNSPVOEFTVPTROTTATISGLKP

GWDYTITWYAVSKEEEEEEEEERPISINY

SABA2BC Core 2 BC Loop

10 SABA2DE Core 2 DE Loop TROT

11 SABA2FG Core 2 FG Loop SKDDYYPHEHR

12 SABA3 Core 3 Adnectin " EWWAATPTSLLISWSIESEGESYYRITY

GETGGNSPVOEFTVPSSETATISGLKP

GWDYTITWYAWSSEASASPISINY

13 SABA3BC Core 3 BC Loop SNDGPGIS

14 SABA3DE Core 3 DE Loop SSOT

15 SABA3FG Core 3 FG Loop SYYTKKAYSAG

16 SABA4 Core 4 Adnectin "; EMWAATPTSLLISWEEESSSRYYRITY

contains a scaffold GETGGNSPVOEFTVPSDIYTATISGLKP

mutation (bolded) ; GVDYTITVYAVTEEEEEEEEEPISINY

scaffold-perfect RT version is SABA5 17 SABA4BC Core 4 BC Loop EDDSYYSR

18 SABA4DE Core 4 DE Loop SDLY

19 SABA4FG Core 4 FG Loop YDWTDLIMHE

SABA5 Core 5 Adnectin "; EWWAATPTSLLISWEEESSRYYRITY

see description for GETGGNSPVOEFTVPSDIYTATISGLKP US 8,969,289 B2 65 66 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

SABA4; corrected GVDYTITVYAVTEEEEEEEEPISINY

residue is bolded RT

21 SABA5BC Core 5 BC Loop EDDSYYSR

22 SABA5DE Core 5 DE Loop SDLY

23 SABA5FG Core 5 FG Loop YDWTDLIMHE

24 SABA6 Core 6 Adnectin " EWWAA PTSLLISWEEYERYYR TY

GETGGNSPVOEFTVPNSYNTATISGLKP

TVYAVTREANNYSEPIS NY

25 SABAf Core 7 Adnectin " EWWAA PTSLLISWEEEEEEEARYYR TY

GETGGNSPVOEFTVPEYETTATISGLKP

TVYAVTITMEKYPTOSPIS NY

26 SABA8 Core 8 Adnectin " EWWAA PTSLLISWERRSEYYR TY

GETGGNSPVOEFTWEESSYTATISGLKP

TWYAVSKEYEEEEERPIS NY

27 SABA9 Core 9 Adnectin " EWWAA PTSLLISWEASESERRYYR TY

GETGGNSPVOEFTVPRY HEITATISGLKP

TVYAVTOAQEHYQRPISINYRT

28 SABA10 Core 10 Adnectin " EWWAA PTSLLISSESSEYYR TY

GETGGNSPVOEFTVPYPETATISGLKP

TWYAVSSAESSPISINYR

29 SABA11 Core 11 Adnectin " EWWAA PTSLLISWSKYSKEYYR TY

GETGGNSPVOEFTVPSGNATATISGLKP

TWYAVEEEEEEEEEEERPIS NY

3 O SABA12 Core 12 Adnectin " EWWAA CPTSLLISWHGEPETRYYR TY

GETGGNSPVOEFTVP2YRRTATISGLKP

TVYAVTSGYTGHYQPISINYRT

31 SABA13 Core 13 Adnectin " EWWAA PTSLLISWSKYSKEGYYRITY

GETGGNSPVOEFTWEESSYTATISGLKP

TWYAVSEEEEEEEEERPISINY

RT US 8,969,289 B2 67 68 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

32 SABA14 Core 14 Adnectin " EWWAATPTSLLISWEEEEEEYYRITY

GETGGNSPVOEFTWPGY GTATISGLKP

GVDYTITVYAVYGYYQYTPISINYRT

33 SABA15 Core 15 Adnectin " EWWAATPTSLLISWSKYSKEYYRITY

GETGGNSPVOEFTVPSGNATATISGLKP

GVDYTITVYAVSEINKYYHCHRPISINY

34 SABA16 Core 16 Adnectin " EWWAATPTSLLISWESRRSGIYYRITY

GETGGNSPVOEFTVESSYTATISGLKP

GWDYTITWYAVSKEEEEEEEEERPISINY

35 SABA17 Core 17 Adnectin " EWWAATPTSLLISWSKYSKEYYRITY

GETGGNSPVOEFTVPSGNATATISGLKP

GVDYTITVYAVEEEEEEEEEERPISINY

36 SABA18 Core 18 Adnectin " EWWAATPTSLLISWSEESASSEYYYRITY

GETGGNSPVOEFTVPSYSTATISGLKP

GVDYTITVYAVSEG YESEPISINYRT

37 SABA19 Core 19 Adnectin " EVVAATPTSLLISWQSYYAHSEYYRITY

GETGGNSPVOEFTVPYPPOTATISGLKP

GVDYTITVYAVAGSSYYPISINYRT

38 SABA2O Core 20 Adnectin " EWWAATPTSLLISWESRRSGIYYRITY

GETGGNSPVOEFTVOESSYTATISGLKP

GWDYTITWYAVSEESSEEEEEERPISINY

39 SABA21 Core 21 Adnectin " EVWAATPTSLLISWEEEEEE|YYYRITY

GETGGNSPVOEFTVPAYYGTATISGLKP

GVDYTITVYAVYGYYEYSPISINYRT

4 O SABA22 Core 22 Adnectin " EVVAATPTSLLISWYRYEKTHYYRITY

GETGGNSPVOEFTVPRESSTATISGLKP

GVDYTITVYAVSEA.SY.EYEEEEEERPISINY

41 SABA23 Core 23 Adnectin " EWWAATPTSLLISWikiSEERYYRITY

GETGGNSPVOEFTVPYYSEITATISGLKP US 8,969,289 B2 69 70 TABL 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

TWYAVEEASAFSSPISIN

42 SABA24 Core 24 Adnectin T EWWAATPTSLLISWEESESSYYR TY

GETGGNSPVOEFTWGETTATISGLKP

GVDYTITVYAVSYYYSEQPISINYR

43 SABA25 Core 25 Adnectin T EWWAATPTSLLISWSEEGESYYR TY

GETGGNSPVOEFTVPSSCITATISGLKP

GWDYTITWYAVSEEKASPIS NY

44 SABA26 Core 26 Adnectin T EWWAATPTSLLISWEESYSREYYR TY

GETGGNSPVOEFTVPREYETATISGLKP

GVDYTITVYAVESYSSYSPISINYR Exemplary Adnectin " N-Terminal Extension Sequences

45 AcN Exemp airy eader MGWSDWPRDL

46 AcN Exemp airy eader GWSDWPRDL

47 AcN Exemp airy eader WSDWPRDL

48 AcN Exemp airy eader SDWPRDL

49 AcN Exemp airy eader DWPRDL

SO AcN Exemp airy eader WPRDL

51 AcN Exemp airy eader PRDL

52 AcN Exemp airy eader RD L

53 Exemp airy eader DL Exemplary Adnectin " C-Terminal Extension Sequences

54 AcC 1. Exemp airy tai E KPSQ

55 AcC 2 Exemp airy tai E KPS

56 AcC 3. Exemp airy tai KPC

st AcC 4. Exemp airy tai KP

58 AcC s Exemp airy tai

59 AcC 6 Exemp airy tai

60 AcC 7 Exemp airy tai KPSQ

61 AcC 8 Exemp airy tai KPSQLE

62 AcC 9 Exemp airy tai DEDEDEDED

63 AcC 1 O Exemp airy tai KPSOEDEDEDEDED

64 AcC 11 Exemp airy tai EGSGS

215 AcC 12 Exemp airy tai E

65 Ll G (GS) GGSGS 66 L2 G (GS) GGSGSGSGS US 8,969,289 B2 71 72 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

67 3 G (GS) GGSGSGSGSGSGS 68 4. G (GS) 7 GGSGSGSGSGSGSGS 69 5 G (GS),G GGSGSGSGSGSGSGSG

70 6 GSGS GSGS

71. f (GS) GSGSGSGS 72 f (GS) 7 GSGSGSGSGSGSGS 73 9 GS (A) GS GSAAAAAAAAAGS 74 (GSE) s GSEGSEGSEGSEGSE (PAS) s PASPASPASPASPAS 76 (GSP) s GSPGSPGSPGSPGSP 77 GS (TVAAPS) GSTWAAPSTWAAPS 78 (GGSE) , GGSEGGSE 79 (ST) G STSTSTG (GGGGS) 7 GGGGSGGGGSGGGGSGGGGSGGGGSGGG

GSGGGGS

81 (GGGGS) 5 GGGGSGGGGSGGGGSGGGGSGGGGS 82 (GGGGS) G GGGGSGGGGSGGGGSG 83 (GP) G GPGPGPG 84 (GP) sq GPGPGPGPGPG 85 21 P (ST) PSTSTST 86 22 (PA) PAPAPA 87 23 (PA) PAPAPAPAPAPA

88 24 (PA)g PAPAPAPAPAPAPAPAPA

216 25 (GGGGS) GGGGSGGGGSGGGGS 217 26 (ED) is EDEDEDEDED 218 27 (ED) EDEDED 219 28 (ED) EDEDEDED 22O 29 (ED) EDEDEDEDEDED 221 3 O (GSP) GS GSPGSPGSPGSPGS 397 31 (ED) G EDEDEDEDEDG Exemplary Extensions to Adnectin " Core Sequences

89 SABA1.1 Adnectin " core 1 MGWSDWPRDLEWWAATPTSLLISWHSYY

sequence having EONSYYRITYGETGGNSPVOEFTVPYSO

AdNT1 and AdCT1 TTATISGLKPGVDYTITWYAWYGSKYYY

terminal sequences PISINYRTEIDKPSQHHHHHH with His 6 tag 90 SABA1.2 Adnectin " core 1 MGWSDWPRDLEWWAATPTSLLISWHSYY

sequence having EONSYYRITYGETGGNSPVOEFTVPYSO US 8,969,289 B2 73 74 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequen ce

AcNT1 and AcCT8 TTATIS

terminal sequences PISINY RTEIEDEDEDEDED

91 SABA13 Adnectin core 1. MGWSDW PRDLEWWAATPTSLLISWHSYY

sequence having EONSYY RITYGETGGNSPVOEFTVPYSO

AcNT1 and AcCT9 TTATIS GLKPGVDYTITWYAVYGSKYYY

terminal sequences PISINY RTEIEDEDEDEDEDHHHHHH with His 6 tag 222 SABA1 .. 4 Adnectin " core 1 GWSDWPRDLEWWAATPTSLLISWHSYYE

sequence having ONSYYRITYGETGGNSPVOEFTVPYSOT

AdNT2 and AdCT12 TATISG

terminal sequences ISINYR TE

223 SABA15 Adnectin core 1. MGWSDW PRDLEWWAATPTSLLISW

sequence having EONSYY RITYGETGGNSPVOEFTV PYSO

AcNT1 and AcCTf TTATIS KYYY

terminal sequences PISINY RTE

224 SABA1 .. 6 Adnectin core 1. MGWSDW EWWAATPTSLLISW HSYY

sequence having EONSYY RITYGETGGNSPVOEFTV PYSO

AdNT1 and AdCT12 TTATIS KYYY

terminal sequences PISINY RTEIEKPSQ

225 SABA17 Adnectin core 1. MGWSDW PRDLEWWAATPTSLLISW HSYY

sequence having EONSYY RITYGETGGNSPVOEFTV PYSO

AcNT1 and AcCT6 TTATIS GLKPGVDYTITWYAVYGS KYYY

terminal sequences PISINY RTEI

92 SABA2.1 Adnectin " core 2 MGWSDW PRDLEWWAATPTSLLISW PKYD

sequence having RITYGETGGNSPVOEFTV PTRO

AdNT1 and AdCT1 TTATIS GLKPGVDYTITWYAVSKD DYYP

terminal sequences HEHRPI SINYRTEIDKPSQHHHHH with His 6 tag 93 SABA31 Adnectin " core 3 PRDLEWWAATPTSLLISWSNDG

sequence having PGLSYY RITYGETGGNSPVOEFTV PSSQ

AdNT1 and AdCT1 TTATIS GLKPGWDYT

terminal sequences YSAGPI SINYRTEIDKPSQHHHHH with His 6 tag 94 SABA4.1 Adnectin " core 4 PRDLEMWAATPTSLLISWEDDS

sequence having YYSRYY RITYGETGGNSPVOEFTV PSDL

AdNT1 and AdCT1 YTATIS GLKPGWDYT TWYAWTYDWTDL

terminal sequences IMHEPI SINYRTEIDKPSQHHHHH with His 6 tag 95 SABA51 Adnectin " core 5 PRDLEWWAATPTSLLISWEDDS

sequence having YYSRYY RITYGETGGNSPVOEFTV PSDL

AdNT1 and AdCT1 YTATIS TWYAWTYDWTDL US 8,969,289 B2 75 76 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence terminal sequences IMHEPIS NYRTEIDKPSQHHHHHH with His 6 tag 96 SABA6.1. Adnectin " core 6 MGWSDWPRD EWWAA PTSLLISWYMDE

sequence having TYGETGGNSPVOEFTVPNYYH

AdNT1 and AdCT1 NTATISGLK PGVDYT TWYAVTRIKANN

terminal sequences YMYGPS NYRTEIDKPSQHHHHHH with His 6 tag 97 SABAf.1 Adnectin " core 7 MGWSDWPRD EWWAA PTSLLISWNHLE

sequence having HWARYYR TYGETGGNSPVOEFTVPEYPH

AdNT1 and AdCT1 TTATISGLK. TWYAVTITMLKY

terminal sequences PTOSPIS NYRTEIDKPSQHHHHHH with His 6 tag 98 SABA81 Adnectin " core 8 MGWSDWPRD EWWAA PTSLLISWGHYR

sequence having RSGHYYR TYGETGGNSPVOEFTWDPSS

AdNT1 and AdCT1 YTATISGLK. TWYAVSKDDYYP

terminal sequences HEHRPIS NYRTEIDKPSQHHHHHH with His 6 tag 99 SABA9.1 Adnectin " core 9 MGWSDWPRD EWWAA PTSLLISWDASH

sequence having YERRYYR TYGETGGNSPVOEFTVPRYH

AdNT1 and AdCT1 HTATISGLK. TVYAVTOAOEHY terminal sequences QPPISINYRTEIDKPSQHHHHHH with His 6 tag SABA1 O. 1 Adnectin " core 10 MGWSDWPRD EWWAA PTSLLISWNSYY

sequence having HSADYYR TYGETGGNSPVOEFTVPYPP

AdNT1 and AdCT1 TTATISGLK. TWYAVYSAKSYY

terminal sequences PISINYRTEIDKPSQHHHHHH with His 6 tag SABA11.1 Adnectin " core 11 MGWSDWPRD EWWAA PTSLLISWSKYS

sequence having TYGETGGNSPVOEFTWPSGN

AdNT1 and AdCT1 ATATISGLK PGVDYT TWYAVEDTNDYP

terminal sequences HTHRPIS NYRTEIDKPSQHHHHHH with His 6 tag SABA12.1 Adnectin " core 12 MGWSDWPRD EWWAA PTSLLISWHGEP

sequence having DOTRYYR TYGETGGNSPVOEFTVPPYR

AdNT1 and AdCT1 RTATISGLK.

terminal sequences YQPISINYRTEIDKPSOHHHHHH with His 6 tag 103 SABA13.1 Adnectin " core 13 MGWSDWPRD EWWAA PTSLLISWSKYS

sequence having KHGHYYRITYGETGGNSPVOEFTWDPSS

AdNT1 and AdCT1 YTATISGLK. TWYAVSKDDYYP

terminal sequences HEHRPISINYRTEIDKPSQHHHHHH with His 6 tag 104 SABA14. 1 Adnectin " core 14 MGWSDWPRD EWWAA PTSLLISWYEPY

sequence having TPIHYYRITYGETGGNSPVOEFTVPGYY

AdNT1 and AdCT1 GTATISGLK.

terminal sequences PISINYRTEIDKPSQHHHHHH with His 6 tag US 8,969,289 B2 77 78 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

105 SABA15.1 Adnectin " core 15 MGWSDWPRDLEWWAATPTSLLISWSKYS

sequence having KHGHYYR TYGETGGNSPVOEFTWPSGN

AdNT1 and AdCT1 ATATISGLK TWYAVSDDNKYY

terminal sequences HOHRPIS NYRTEIDKPSOHHHHHH with His 6 tag 106 SABA16 .1 Adnectin " core 16 MGWSDWPRDLEWWAATPTSLLISWGHYR

sequence having RSGHYYR TYGETGGNSPVOEFTWDPSS

AdNT1 and AdCT1 YTATISGLK. PGVDYT TWYAVSKDDYYP

terminal sequences HEHRPIS NYRTEIDKPSQHHHHHH with His 6 tag 1. Of SABA171. Adnectin " core 17 MGWSDWPRDLEWWAATPTSLLISWSKYS

sequence having TYGETGGNSPVOEFTWPSGN

AdNT1 and AdCT1 ATATISGLK PGVDYT TWYAVEDTNDYP

terminal sequences HTHRPIS NYRTEIDKPSQHHHHHH with His 6 tag 108 SABA18.1 Adnectin " core 18 MGWSDWPRDLEWWAATPTSLLISWYEPG

sequence having TYGETGGNSPVOEFTVPSYY

AdNT1 and AdCT1 HTATISGLK. PGVDYT TWYAWYGYYEYE

terminal sequences PISINY DKPSQHHHHHH with His 6 tag 109 SABA19.1 Adnectin " core 19 MGWSDWPRD LEVVAATPTSLLISWOSYY

sequence having AHSDYYR TYGETGGNSPVOEFTVPYPP

AdNT1 and AdCT1 QTATISGLK PGVDYT TWYAVYAGSSYY

terminal sequences PISINYRTEIDKPSQHHHHHH with His 6 tag 110 SABA2 O. 1 Adnectin " core 20 MGWSDWPRDLEWWAATPTSLLISWGHYR

sequence having RSGHYYR TYGETGGNSPVOEFTWDPSS

AdNT1 and AdCT1 YTATISGLK. TWYAVSKDDYYP

terminal sequences HEHRPIS NYRTEIDKPSQHHHHHH with His 6 tag 111 SABA21.1 Adnectin " core 21 MGWSDWPRD EWWAA PTSLLISWPEPG

sequence having TYGETGGNSPVOEFTVPAYY

AdNT1 and AdCT1 GTATISGLK.

terminal sequences PSINYR IDKPSQHHHHHH with His 6 tag 112 SABA22.1 Adnectin " core 22 MGWSDWPRD EWWAA PTSLLISWYRYE

sequence having KTOHYYR TYGETGGNSPVOEFTVPPES

AdNT1 and AdCT1 GTATISGLK. TWYAVYAGYEYP

terminal sequences HTHRPIS NYRTEIDKPSQHHHHHH with His 6 tag 113 SABA23. 1 Adnectin " core 23 MGWSDWPRD EWWAA PTSLLISWWKSE

sequence having TYGETGGNSPVOEFTVPYYV

AdNT1 and AdCT1 HTATISGLK. TWYAVTEYYYAG

terminal sequences AVVSVPISINYRTEIDKPSQHHHHHH with His 6 tag US 8,969,289 B2 79 80 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

114 SABA24.1 Adnectin " core 24 MGWSDWPRDLEWWAATPTSLLISWYDPY

sequence having TYGSYYR TYGETGGNSPVOEFTVGPYT

AdNT1 and AdCT1 TTATISGLKPGVDYT TVYAVSYYYSTQ

terminal sequences PISINYR DKPSQHHHHHH with His 6 tag 115 SABA251 Adnectin " core 25 MGWSDWPRDLEWWAATPTSLLISWSNDG

sequence having PGLSYYR TYGETGGNSPVOEFTWPSSO

AdNT1 and AdCT1 TTATISGLKPGVDYT

terminal sequences YSAGPIS NYRTEIDKPSOHHHHHH with His 6 tag 116 SABA26.1 Adnectin " core 26 MGWSDWPRDLEWWAATPTSLLISWPDPY

sequence having TYGETGGNSPVOEFTVPRDY

AdNT1 and AdCT1 TTATISGLKPGVDYT

terminal sequences PSINYR CEIDKPSQHHHHHH with His 6 tag Exemplary FGF21 Sequences

117 FGF21 WT full-length MDSDETGFEHSGLWWSWLAGLLGACQAH

FGF21 PI PDSSPLLOFGGOVRORYLYTDDAQOT

EA HLEIREDGTWGGAADQSPESLLOLKA

K PGVIOILGVKTSRFL CORPDGALYGS

H FDPEACSFREL LLEDGYNWYOSEAHG

P LHLPGNKSPHR DPAPRGPARFLPLPG

PALPEPPGILA POPPDVGSSDPLSMV

GPSQGRSPSYAS

118 FGF21 core FGF21 core sequence PL LOFGGOVRORY LYTDDAQOTEAHLEI

RE PESLLOLKALKPGVI

RPDGALYGSLHFDPE

ACSFRELLLEDGYNWYOSEAHGLPLHLP

KSPHRDPAPRG PARFLPLPGLPPALP

EP PGILAPOPPDWGSSDPLSMWGPSQGR

SPSYA Exemplary FGF21 N-terminal Sequences

119 FNT1 Exemplary leader MDSDETGFEHSGLWWSWLAGLLGACQAH

PIPDSS

12O FNT2 Exemplary leader HP IPDSS

121 FNT3 Exemplary leader PIPDSS

122 FNT4 Exemplary leader DSS

123 FNTS Exemplary leader IPDSS

124 FNT6 Exemplary leader PDSS

US 8,969,289 B2 83 84 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

FGF21 variant 6 MHHHHHHIPDSSPLLOFGGOVRORYLYT

DDAQOTEAHLEIREDGTWGGAADOSPES

LLOLKALKPGVIQILGWKTSRFLCORPD

GALYGSLHFDPEACSFRELLLEDGYNWY

OSEAHGLPLHLPGNKSPHRDPAPRGPAR

LPGLPPALPEPPGILAPOPPDWGSS DPLSMVGPSQGRSPSYAs. FGF21 variant 7 HHHHPLLOFGGOVRORYLYTDDAQQ

HLEIREDGTWGGAADQSPESLLOLK

PGVIOILGVKTSRFLCORPDGALYG

DPEACSFRELLLEDGYNVYOSEAH

HLPGNKSPHRDPAPRGPARFLPLP

PALPEPPGILAPOPPDWGSSDPLSM VGPSQGRSPSYAs. Exemplary Fusions : X-SABA-X-X-X-FGF21

132 SABA1 SABA1-FGF21 MGWSDWPRDLEWWAATPTSLLISWHSYY

variant 1: EONSYYRITYGETGGNSPVOEFTVPYSO

SABA core 1. TTATISGLKPGVDYTITWYAWYGSKYYY

sequence having an PIS INYRTEIEKPSCGSGSGSGSGSGS AdNT1 leader SPIPDSSPLLQFGGQVRQRYLYTDDAQQ sequence and AdCT7 TEAHLEIREDGTWGGAADQSPESLLOLK

tail sequence followed ALKPGVIOILGWKTSRFLCQRPDGALYG

by a (GS) 7 linker SLHFDPEACSFRELLLEDGYNVYOSEAH

which joins an FGF21 GLPLHLPGNKSPHRDPAPRGPARFLPLP

core sequence having GLPPALPEPPGILAPQPPDWGSSDPLSM an. FGF21 leader VGPSQGRSPSYAS sequence FNT3 and a C-terminal S 133 SABA1 SABA1-FGF21 MGWSDWPRDLEWWAATPTSLLISWHSYY

variant 2; see similar EONSYYRITYGETGGNSPVOEFTVPYSO

description for variant TTATISGLKPGVDYTITWYAWYGSKYYY

1. PIS INYRTEIDKPSQHHHHHHGSGSGSG

SGSGSGSHPIPDSSPLLQFGGQWRQRYL

YTDDAQOTEAHLEIREDGTWGGAADQSP

ESLLOLKALKPGVIQILGWKTSRFLCOR

PDGALYGSLHFDPEACSFRELILLEDGYN

WYOSEAHGLPLHLPGNKSPHRDPAPRGP

US 8,969,289 B2 109 110 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

VGPSQGRSPSYASIGGSGSGSGSGSGSGS GVSDWPRDLEVVAATPTSLLISWHSYYE ONSYYRITYGETGGNSPVOEFTVPYSOT

TATISGLKPGWDYTITWYAWYGSKYYYP

ISINYRTEIDKPSQ Exemplary Trimer Fusion : X-FGF21-X-X-SABA-X-X-X-FGF21 174 An exemplary trimer MHHHHHHIPDSSPLLOFGGOVRORYLYT

SABA1 fusion in which a DDAQOTEAHLEIREDGTWGGAADOSPES

sequence comprising LLOLKALKPGVIQILGWKTSRFLCORPD

SABA core 1 is GALYGSLHFDPEACSFRELLLEDGYNWY

flanked by FGF21 OSEAHGLPLHLPGNKSPHRDPAPRGPAR core sequence, each FLPLPGLPPALPEPPGILAPOPPDWGSS comprising unique N DPLSMVGPSQGRSPSYASGSGSGSGSGS and C- extension GSGSWSDWPRDLEVVAATPTSLLISWHS sequences YYEONSYYRITYGETGGNSPVOEFTVPY SOTTATISGLKPGVDYTITVYAVYGSKY

YYPISINYRTEIDKP

SGSPDSSPLLOFGGOVRORYLYTDDAQQ TEAHLEIREDGTWGGAADQSPESLLOLK

ALKPGVIOILGWKTSRFLCQRPDGALYG

SLHFDPEACSFRELLLEDGYNVYOSEAH

GLPLHLPGNKSPHRDPAPRGPARFLPLP

GLPPALPEPPGILAPQPPDWGSSDPLSM VGPSQGRSPSYAs. Exemplary GLP-1 and Exendin Sequences and Fusions

226 GLP-1 variant 1: HAEGTFTSDWSSYLEGOAAKEFIAWLVK

GLP-1 (7-36), GR optionally may contain a C-terminal C.-amide group 227 GLP-1 variant 2: HAEGTFTSDWSSYLEGOAAKEFIAWLVK

GLP-1 (7-37) GRG

228 Exendin-4 Exendin-4, optionally HGEGTFTSDLSKOMEEEAVRLFIEWLKN

may contain a C GGPSSGAPPPS

terminal C.-amide group 229 GLP-1- GLP-1-SABA1 MHAEGTFTSDVSSYLEGOAAKEFIAWLV

SABA1W1 variant 1: GLP-1 (7- KG WSDWPRDL

37) with an N EWVAATPTSLLISWHSYYEONSYYRITY

terminal Met, fused to GETGGNSPVOEFTVPYSOTTATISGLKP US 8,969,289 B2 111 112 TABLE 2- Continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence a (GGGGS) is linker, GWDYTI TVYAVYGSKYYYPISINYRTE fused to SABA1 .. 4 23 O GLP-1- GLP-1-SABA1 MHAEGT FTSDWSSYLEGOAAKEFIAWLV

SABA1W2 variant 2: GLP-1 (7- KGRGEDEDEDEDEDGWSDWPRDLEWWAA

37) with an N TPTSLL ISWHSYYEONSYYRITYGETGG terminal Met, fused to NSPVOE FTVPYSOTTATISGLKPGVDYT an (ED) is linker, fused ITVYAVYGSKYYYPISINYRTE to SABA1 .. 4 231 SABA1 SABA1 - GLP-1 MGWSDWPRDLEWWAATPTSLLISWHSYY

variant 1: SABA1.5 EONSYYRITYGETGGNSPVOEFTVPYSO fused to a (GGGGS) TTATIS linker, fused to GLP PISINYRTEGGGGSGGGGSGGGGSHAEG 1 (7-37) TFTSDWSSYLEGOAAKEFIAWLVKGRG

232 SABA1 SABA1 - GLP-1 MGWSDWPRDLEWWAATPTSLLISWHSYY

variant 2: SABA1.5 EONSYYRITYGETGGNSPVOEFTVPYSO fused to an (ED) is TTATIS linker, fused to GLP PISINYRTEEDEDEDEDEDHAEGTFTSD 1 (7-37) WSSYLE GOAAKEFIAWLWKGRG

233 Exendin-4- Exendin- 4 - SABA1 MHGEGT FTSDLSKOMEEEAVRLFIEWLK

SABA1W1 variant 1: Exendin-4 NGGPSS GAPPPSGGGGSGGGGSGGGGS

With an N-terminil VSDVPRDLEVWAATPTSLLISWHSYYEO

Met, fused to a NSYYRI TYGETGGNSPVOEFTVPYSOTT (GGGGS) linker, ATISGL

fused to SABA1 .. 4 SINYRT E

234 Exendin-4- Exendin- 4 - SABA1 MHAEGT FTSDWSSYLEGOAAKEFIAWLV

SABA1W2 variant 1: Exendin-4 KGR WSDWPRDLEWWAA

with N-terminal Met, TPTSLL ISWHSYYEONSYYRITYGETGG fused to an (ED) is NSPVOE FTVPYSOTTATISGLKPGVDYT linker, fused to ITVYAVYGSKYYYPISINYRTE SABA1 .. 4 235 SABA1 SABA1-Exendin-4 MGWSDWPRDLEWWAATPTSLLISWHSYY

Exendin variant 1: SABA1.5 EONSYYRITYGETGGNSPVOEFTVPYSO

fused to a (GGGGS) TTATIS linker, fused to PISINYRTEGGGGSGGGGSGGGGSHGEG Exendin-4 TETSDL SKOMEEEAVRLFIEWLKNGGPS

SGAPPP S 236 SABA1 SABA1-Exendin-4 MGWSDWPRDLEWWAATPTSLLISWHSYY

Exendin variant 2: SABA1.5 EONSYYRITYGETGGNSPVOEFTVPYSO

fused to an (ED) is TTATIS linker, fused to PISINYRTEEDEDEDEDEDHGEGTFTSD US 8,969,289 B2 113 114 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

Exendin-4 LSKOMEEEAVRLFIEWLKNGGPSSGAPP

PS Exemplary Plectasin Sequences and Fusions

237 Plec Plectasin (Plec) MGFGCNGPWDEDDMOCHNHCKSIKGYKG

GYCAKGGFWCKCY

238 SABA1- SABA1 core with MGWSDWPRDLEWWAATPTSLLISWHSYY

Plec AdNT1 extension, EONSYYRITYGETGGNSPVOEFTVPYSO fused to an (ED) s TTATISGLKPGVDYTITWYAWYGSKYYY linker, fused to PISINYRTEDEDEDEDEDMGFGCNGPWD

Plectasin EDDMOCHNHCKSIKGYKGGYCAKGGFVC

KCY

239 Plec- Plectasin, fused to a MGFGCNGPWDEDDMOCHNHCKSIKGYKG

SABA1 SABA1 core with GYCAKGGFWCKCYWSDWPRDLEWWAATP

AdNT3 and L26 TSLLISWHSYYEONSYYRITYGETGGNS

extensions PVOEFTVPYSOTTATISGLKPGVDYTIT

WYAWYGSKYYYPISINYRTEDEDEDEDE D Exemplary Progranulin and At stirrin Sequences and Fusions

24 O PRGNW1 Progranulin (PRGN) MWTLVSWVALTAGLVAGTRCPDGOFCPW variant 1, the signal ACCLDPGGASYSCCRPLLDKWPTTLSRH sequence is LGGPCOVDAHCSAGHSCIFTVSGTSSCC

underlined and the PFPEAWACGDGHHCCPRGFHCSADGRSC

elements used in FORSGNNSWGAIOCPDSOFECPDFSTCC

At stirrin are in VMVDGSWGCCPMpgasggedry.hgsphg

indicated in lower afedlyhtigitpgthplakilpagit case/italics/dotted navalsssVMCPDARSRCPDGSTCCEL underline PSGKYGCCPMPNATCCSDHLHCCPODTV CDLIQSKCL skenattdlitklpahtvg

FTOAVCCEDHIHCCPAGFTCDTOKGTce ggphqvpwmekapahisipdpqalkirdv

EIVAGLEKMPARRASLSHPRDIGCDOHT

SCPWGOTCCPSLGGSWACCOLPHAVCCE

DROHCCPAGYTCNVKARSCEKEVVSAOP

ATFLARSPHVGVKDVECGEGHFCHDNOT

US 8,969,289 B2 123 124 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

YYRITYGETGGNSPVOEFTVPYSOTTAT

ISGLKPGVDYTITWYAVYGSKYYYPISI NYRTE

249 SABA1 SABA1-ATST variant MGWSDWPRDLEWWAATPTSLLISWHSYY

ATSTV1 1: SABA1.5 fused to EONSYYRITYGETGGNSPVOEFTVPYSO a (GGGGS) is linker, TTATISGLKPGVDYTITWYAWYGSKYYY

fused to Atstrrin PISINY POAS

CCEDRVHCCPHGAFCDLVHTRCITPTGT

HPLAKKLPAORTNRAVALSSSSKEDATT

DLLTKLPA. HTVGDWKCDMEWSCPDGYTC

CRLOSGAWCEQGPHOWPWMEKAPAHLSL

PDPOALKR DVPCDNVSSCPSSDTCCOLT

SGEWGCCPIP

250 SABA1 SABA1-ATST variant MGWSDWPR DLEWWAATPTSLLISWHSYY

ATSTV2 2: SABA1.5 fused to EONSYYRITYGETGGNSPVOEFTVPYSO

an (ED) is linker, fused TTATISGL to At stirrin PISINYRTEEDEDEDEDEDPQASCCEDR

WHCCPHGA FCDLWHTRCITPTGTHPLAK

KLPAORTN RAWALSSSSKEDATTDLLTK

LPAHTVGDWKCDMEVSCPDGYTCCRLOS

GAWCEOGP HOVPWMEKAPAHLSLPDPOA

LKRDVPCDNVSSCPSSDTCCOLTSGEWG

CCPIP Exemplary IFN Sequences and Fusions

251 IFNV1 IFN lamda1 variant 1 GPWPTSKPTTTGKGCHIGRFKSLSPOEL

ASFKKARDALEESLKLKNWSCSSPWFPG

NWDLRLLOVRERPVALEAELALTLKVLE

AAAGPALEDVLDOPLHTLHHILSQLOAC

ESAGCLEASWTFNLFRLLTRDLKYWADG

NLCLRTSTHPEST

252 IFNV2 IFN lamda1 variant TTTGKGCHIGRFKSLSPOEL

2: IFN lamda1 with ASFKKARDALEESLKLKNWSCSSPWFPG

C171S substitution NWDLRLLOVRERPVALEAELALTLKVLE

AAAGPALEDVLDOPLHTLHHILSQLOAC

PRPRGRLHHWLHRLOEAPKK

US 8,969,289 B2 143 144 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

WTFNLFRLLTRDLKYWAEGNLSLRTSTH

PEST

285 SABA1 SABA1-IFN variant MGWSDWPRDLEWWAATPTSLLISWHSYY

IFNV14 14: SABA1.5 fused EONSYYRITYGETGGNSPVOEFTVPYSO to an (ED) s linker, TTATISGLKPGVDYTITWYAWYGSKYYY fused to IFNV7 PISINYRTEEDEDEDEDEDGPVPTSKPT TTGKGCHIGRFKSLSPOELASFKKARDA

LEESLKLKNWSCSSPWFPGNWDLRLLOW

RERPWALEAELALTLKWLEAAAGPALED

WLDOPLHTLHHILSQLOACIQPQPTAGP

RPRGRLHHWLHRLQEAPKKESAGCLEAS

WTFNLFRLLTRDLKYWADANLSLRTSTH

PEST Exemplary IL-21 Sequences and Fusions

286 IL21W1 IL-21 variant 1: MDSSPGNMERIWICLMWIFLGTLWHKSS

human IL-21 with the SQGQDRHMIRMRQLIDIVDQLKNYVNDL native leader sequence WPEFLPAPEDVETNCEWSAFSCFOKAOL

underlined KSANTGNNERIINWSIKKLKRKPPSTNA

GRROKHRLTCPSCDSYEKKPPKEFLER

KSLLOKMIHOHLSSRTHGSEDS

287 IL21W2 IL-21 variant 2: MOGODRHMIRMROLIDIVDOLKNYWNDL

human IL-21 without WPEFLPAPEDVETNCEWSAFSCFOKAOL

a leader sequence KSANTGNNERIINWSIKKLKRKPPSTNA

GRROKHRLTCPSCDSYEKKPPKEFLER

KSLLOKMIHOHLSSRTHGSEDS

288 IL121 na1 IL21 nucleic acid ATGGATTCCAGTCCTGGCAACATGGAGA

sequence variant 1: GGATTGTCATCTGTCTGATGGTCATCTT

nucleotide sequence CTTGGGGACACTGGTCCACAAATCAAGC encoding the human TCCCAAGGTCAAGATCGCCACATGATTA IL-21 sequence with GAATGCGTCAACTTATAGATATTGTTGA

the native leader, the TCAGCTGAAAAATTATGTGAATGACTTG

portion of the GTCCCTGAATTTCTGCCAGCTCCAGAAG

sequence encoding the ATGTAGAGACAAACTGTGAGTGGTCAGC

leader is underlined; TTTTTCCTGTTTTCAGAAGGCCCAACTA

for expression in AAGTCAGCAAATACAGGAAACAATGAAA

mammalian cells GGATAATCAATGTATCAATTAAAAAGCT

GAAGAGGAAACCACCTTCCACAAATGCA US 8,969,289 B2 145 146 TABLE 2 - continued Summary of exemplary sequences

SEQ ID Sequence NO: Name Description Sequence

GGGAGAAGACAGAAACACAGACTAACAT

GCCCTTCATGTGATTCTTATGAGAAAAA

ACCACCCAAAGAATTCCTAGAAAGATTC

AAATCACTTCTCCAAAAGATGATTCATC

AGCATCTGTCCTCTAGAACACACGGAAG

TGAAGATTCCTGA

289 IL121 na2 IL21 nucleic acid ATGCAAGGTCAAGATCGCCACATGATTA

sequence variant 2: GAATGCGTCAACTTATAGATATTGTTGA

nucleotide sequence TCAGCTGAAAAATTATGTGAATGACCTG

encoding the human GTTCCGGAATTCCTGCCGGCTCCGGAAG

IL-21 sequence ATGTTGAGACCAACTGTGAGTGGTCCGC

Without the leader TTTCTCCTGTTTCCAGAAAGCCCAGCTG

sequence; sequence AAATCCGCAAACACCGGTAACAACGAAC

has been partially GTATCATCAACGTTTCCATTAAAAAACT

codon optimized for GAAACGTAAACCGCCGTCCACCAACGCA

expression in E. coli GGTCGTCGTCAGAAACACCGTCTGACCT

GCCCGTCCTGTGATTCTTATGAGAAAAA

ACCGCCGAAAGAATTCCTGGAACGTTTC

AAATCCCTGCTGCAGAAAATGATTCACC

AGCACCTGTCCTCTCGTACCCACGGTTC

CGAAGATTCCTGA

290 IL21 IL21-SABA1 variant MDSSPGNMERIWICLMWIFLGTLWHKSS

1: IL21 with native SQGQDRHMIRMRQLIDIVDQLKNYVNDL

leader fused to a WPEFLPAPEDVETNCEWSAFSCFOKAOL

(GGGGS) linker, KSANTGNNERIINWSIKKLKRKPPSTNA

fused to SABA1 .. 4 GRROKHRLTCPSCDSYEKKPPKEFLERF

KSLLOKMIHOHLSSRTHGSEDSGGGGS

GGGSGGGGSGWSDWPRDLEWWAATPTSL

LISWHSYYEONSYYRITYGETGGNSPVO

EFTVPYSQTTATISGLKPGVDYTITVYA VYGSKYYYPISINYRTE 291. IL21 IL21-SABA1 variant MOGODRHMIRMROLIDIVDOLKNYWNDL

2: IL21. Without a WPEFLPAPEDVETNCEWSAFSCFOKAOL

leader fused to a KSANTGNNERIINWSIKKLKRKPPSTNA

(GGGGS) linker, GRROKHRLTCPSCDSYEKKPPKEFLERF

fused to SABA1 .. 4 KSLLOKMIHOHLSSRTHGSEDSGGGGS