letters to nature and lower east sides of the volcano, and by the rapid transformation 9. Fiske, R. S., Hopson, C. A. & Waters, A. C. Geology of Mount Rainier National Park Washington. US of the collapsed material into a far-travelled lahar. The three large, Geol. Surv. Prof. Pap. 444, 93 (1963). 10. Sisson, T. W. & Lanphere, M. A. Geologic controls on the timing and location of ¯ank alteration at Mt. thick, nonmagnetic bodies that ring the edge of the Osceola Rainier, Washington. Eos 80, F1151±F1152 (1999). palaeocrater (below Russell cliff, east of Sunset amphitheater and 11. Crandell, D. R. Postglacial lahars from Mount Rainier Volcano, Washington. US Geol. Surv. Prof. Pap. near Gibraltar rock) (Fig. 2) are probably remnants of the old 677, 75 (1971). 12. Rystrom, V. L., Finn, Carol A. & Descsz-Pan, Maryla High resolution, low altitude aeromagnetic and altered core of the volcano. The absence of thick altered zones electromagnetic survey of Mt Rainier. US Geological Survey Open-File Report 00-027 [online], hhttp:// beneath the modern summit and the upper east slope suggests not greenwood.cr.usgs.gov/pub/open-®le-reports/ofr-00-0027/Rainierwebpage. htmli (2000). only that the Osceola collapse removed the altered core and upper 13. Deszcz-Pan, M., Fitterman, D. V. & Labson, V. F. Reduction of inversion errors in helicopter EM data eastern portion of the old dyke system (Fig. 1a) to substantial using auxiliary information. Explor. Geophys. 29, 142±146 (1998). 14. Woodward, D. J. & Mumme, T. C. Variation of magnetisation on White Island, New Zealand. N.Z. J. depths, but also that the vertical depth of incision of the Osceola Geol. Geophys. 36, 447±451 (1993). failure might have been limited by the base of highly altered 15. Fiske, R. S., Hopson, C. A. & Waters, A. C. Geologic Map and Section of Mount Rainier National Park rock. Washington (US Geological Survey Miscellaneous Investigations Series I-432, 1964). The absence of a large volume of alteration beneath the modern 16. Finn, C. & Williams, D. L. An aeromagnetic study of Mount St. Helens. J. Geophys. Res. 92, 10194± 110206 (1987). summit and east slope might restrict the collapse of altered material 17. Williams, D. L. & Finn, C. A. Evidence for a shallow pluton beneath the Goat Rocks Wilderness, to the west side of the volcano18, suggesting that a mud¯ow event as Washington, from gravity and magnetic data. J. Geophys. Res. 92, 4867±4880 (1987). large as the Osceola is no longer likely. If collapse retrogresses into 18. Reid, M. E., Christian, S. B., Brien, D. L. & Sisson, T. W. 3-D gravitational stability of stratovolcanoes. the core of the volcano, the relatively coherent core material might Eos 80, F1151 (1999). generate a debris avalanche that would be far less mobile than clay- rich lahars. As alteration is associated primarily with eruptive Acknowledgements periods at Mount Rainier10, the development of future weak, altered We thank D. Fitterman, V. J. S. Grauch and P. Lipman for helpful reviews. This work was supported by the Mineral Resource and Volcano Hazards Programs of the US Geological zones might depend on the frequency and volume of eruptions. The Survey. 25±50 m thickness of alteration at the modern summit has formed since ,2,000±5,000 yr ago. If magmatism and alteration were to Correspondence and requests for materials should be addressed to C.A.F. (e-mail: c®[email protected]). continue at these Holocene rates, it would take at least 20,000 yr to alter an appreciable thickness (.500 m) of the volcano's core. Signi®cant alteration associated with dyke injection also takes 50± 100 kyr10. This ®rst detailed assessment of the internal distribution of ...... altered zones in an active volcano, using geophysical measurements, differs substantially from the distribution extrapolated from Unexpected diversity of small sur®cial exposures alone2±4. Lahars generated by the collapse of structurally incompetent hydrothermally altered rock are most eukaryotes in deep-sea probable on the west side of the volcano18. Strong shaking of the edi®ce during even small eruptive events could dislodge altered rock Antarctic plankton and generate a lahar capable of reaching densely populated areas. Although edi®ce collapse does not require weakened altered rocks, Puri®cacioÂnLoÂpez-GarcõÂa*, Francisco RodrõÂguez-Valera*, the widespread preservation of old (100±200 kyr) lava ¯ows at high Carlos PedroÂs-Alio² & David Moreira* elevations on Mount Rainier10, as well as the scarcity of debris avalanche deposits, as opposed to lahar deposits, suggests that * DivisioÂn de Microbiologia, Universidad Miguel HernaÂndez, unaltered ¯anks collapse infrequently. But Mount Rainier has 03550 San Juan de Alicante, Spain produced numerous far-travelled lahars that contain little or no ² Institut de CieÁnces del Mar, CSIC, 08039 Barcelona, Spain altered material. Some of these alteration-free lahars probably ...... formed as pyroclastic ¯ows or disaggregating active lava ¯ows Phylogenetic information from ribosomal RNA genes directly that swept across and incorporated glacial ice. Lahars originating ampli®ed from the environment changed our view of the bio- by this magma±ice interaction threaten all valleys draining the sphere, revealing an extraordinary diversity of previously unde- edi®ce. Nevertheless, the collapse of altered ¯anks, either during or tected prokaryotic lineages. Using ribosomal RNA genes from independently of eruptive activity, is a primary hazard at Mount marine picoplankton, several new groups of bacteria and archaea Rainier and elsewhere, and high-resolution geophysical surveys have been identi®ed, some of which are abundant2±4. Little is interpreted with the bene®t of detailed geological mapping is an known, however, about the diversity of the smallest planktonic effective tool for evaluating, substantiating and quantifying hazards eukaryotes, and available information in general concerns the from collapse-generated debris ¯ows. M phytoplankton of the euphotic region. Here we recover eukaryotes in the size fraction 0.2±5 mm from the aphotic zone (250±3,000 m Received 5 June; accepted 13 November 2000. deep) in the Antarctic polar front. The most diverse and relatively 1. Lopez, D. L. & Williams, S. N. Catastrophic volcanic collapse; relation to hydrothermal processes. abundant were two new groups of alveolate sequences, related to Science 260, 1794±1796 (1993). 2. Frank, D. Sur®cial extent and conceptual model of hydrothermal system at Mount Rainier, dino¯agellates that are found at all studied depths. These may be Washington. J. Volcanol. Geotherm. Res. 65, 51±80 (1995). important components of the microbial community in the deep 3. Zimbelman, D. R. Hydrothermal Alteration and its In¯uence on Volcanic Hazards; Mount Rainier, ocean. Their phylogenetic position suggests a radiation early in Washington, a Case History (Univ. Colorado, Boulder, Colorado, 1996). the evolution of alveolates. 4. Crowley, J. K. & Zimbelman, D. R. Mapping hydrothermally altered rocks on Mount Rainier, Washington, with Airborne Visible/Infrared Imaging Spectrometer (AVIRIS) data. Geology 25, 559± We ampli®ed 18S rRNA genes from samples taken at 250, 500, 562 (1997). 2,000 and 3,000 m deep at the Antarctic polar front limit in a 5. Crandell, D. R. & Waldron, H. H. A Recent volcanic mud¯ow of exceptional dimensions from Mount transect along the Drake passage (598 199 480 S, 558 459 110 W, sea Rainier, Washington. Am. J. Sci. 254, 349±362 (1956). ¯oor at 3,671 m). This sampling site interested us because it is a 6. Vallance, J. W. & Scott, K. M. The Osceola Mud¯ow from Mount Rainier: sedimentology and hazard implications of a huge clay-rich debris ¯ow. Geol. Soc. Am. Bull. 109, 143±163 (1997). region of water-mass mixing from the Atlantic and Southern 7. Scott, K. M., Vallance, J. W. & Pringle, P. T. Sedimentology, behavior, and hazards of debris ¯ows at oceans. It corresponds to cold and oligotrophic waters where Mount Rainier, Washington. US Geol. Surv. Prof. Pap. 1547, 1±56 (1995). microbial biomass, especially at 3,000 m deep, reached minimal 8. Moran, S. C., Zimbelman, D. R. & Malone, S. D. A model for the magmatic hydrothermal system at Mount Rainier, Washington, from seismic and geochemical observations. Bull. Volcanol. 61, 425±436 values in the area as deduced from DNA yields (see Methods). We (2000). constructed 18S rRNA environmental gene libraries from the 0.2±

NATURE | VOL 409 | 1 FEBRUARY 2001 | www.nature.com © 2001 Macmillan Magazines Ltd 603 letters to nature

5 mm planktonic fraction and, for comparison, also from the a microbial fraction .5 mm at 3,000 m deep. After partial sequencing Microsporidia of the 39 region of the gene (700 base pairs, bp, on average), BLAST 5 Diplomonadida searches and phylogenetic reconstruction distance methods pro- Trichomonadida vided us with a ®rst survey of the type of eukaryotic sequences DH148-5-EKD18 Physarum polycephalum present in our samples. Twenty-four representative clones from all 80 DH148-EKB1 100 Diplonema papillatum 96 95 Euglena gracilis depths were subsequently chosen for complete sequencing. The DH145-EKD11 Phreatamoeba balamuthi complete sequences were aligned with 1,443 additional 18S rRNA Entamoeba histolytica gene sequences retrieved from databanks. A subset of 101 complete 50 Myxozoa Dictyostelium discoideum sequences was then selected for phylogenetic analysis, taking special 48 Ammonia beccarii care to include a taxonomically broad sample of eukaryotes (all and Haplosporidia closest relatives to our sequences) to minimize artefacts related to taxonomic sampling. We constructed distance (neighbour-joining, NJ), maximum-parsimony (MP) and maximum-likelihood (ML) 250 m trees, which produced similar congruent results. Figure 1 shows an 500 m 2,000 m Crown eukaryotes ML tree displaying the eukaryotic microbial diversity found. 3,000 m As was expected of cold, highly oxygenated waters, the majority of 3,000 m (> 5 µm) sequences af®liate with the eukaryotic ``crown'', the densely branched apical part of the eukaryotic tree6. However, we found three phylotypes belonging to the early branching part of the 18S b rRNA tree (Fig. 1a). DH148-5-EKD18 represents a new lineage Blepharisma americanum Stylonychia pustulata emerging in the region of the Archezoa. The large length of its Tetrahymena pyriformis DH148-5-EKD6 branch suggests that it could correspond to a parasite whose rRNA 100 Anophyroides haemophila Ciliates DH147-EKD23 has evolved rapidly. It would thus be `attracted' to the base of the 50 Pseudoplatyophrya nana 100 Colpoda inflata tree by a long-branch attraction artefact, as indeed occurs with Apicomplexa Alveolates 7 Microsporidia . This may be supported by the occurrence of several DH147-EKD19 12 84 DH145-EKD20 speci®c deletions in this sequence (data not shown), as fast-evolving DH147-EKD20 DH148-EKD27 8 42 Marine alveolate eukaryotic sequences are often characterized by length variation . 89 DH148-EKD14 39 DH147-EKD3 Group II DH145-EKD11 also corresponds to a new eukaryotic lineage of 38 DH147-EKD16 100 DH147-EKD6 uncertain phylogenetic ascription, although it emerges in a region DH144-EKD3 DH148-EKD22 70 Marine alveolate 69 DH147-EKD18 of the tree occupied by amoeboid organisms (Phreatamoeba, 48 DH145-EKD10 Group I Perkinsus marinus Entamoeba or Myxozoa) (Fig. 1a). We could retrieve very few Crypthecodinium cohnii Pyrocystis noctiluca sequences with the primer set EK-1F + EK-1520R, which was Noctiluca scintillans DH147-EKD21 Dinoflagellates used only with the 3,000-m sample, but all of them (here repre- 99 Gymnodinium mikimotoi Symbiodinium microadriaticum sented by DH148-EKB1) were related to Diplonema spp., which are DH147-EKD17 100 Acanthometra sp.- AF063240 Acantharea euglenozoan heterotrophs frequently found in marine benthic 100 Chaunacanthid sp.-218 9 Chlorarachniophyta sites . Heteromita globosa Euglypha rotunda The diversity of crown eukaryotes is much larger (Fig. 1b). The Blastocystis hominis Cafeteria roenbergensis most frequently retrieved groups were the alveolates, followed by Ulkenia profunda Labyrinthuloides haliotidis heterokonts. We also found sequences belonging to fungi, and to the DH147-EKD10 Labyrinthuloides minuta Labyrinthulids 29 & amoeboid phagotrophic acantharean radiolaria. Fungi reaf®rm 100 Schizochytrium minutum Thraustochytrids Thraustochytrium multirudimentale themselves as one of the most ecologically successful eukaryotic DH148-5-EKD53 Developayella elegans lineages; they have even been isolated from the bottom of the 57 DH144-EKD10 19 Lagenidium giganteum 10 43 Mariana trench (10,897 m) . Within the heterokonts, we detected Hyphochytrium catenoides Heterokonts sequences related to the labyrinthulids (DH147-EKD10). These are Dictyochophyceae relatively common in the sea and play a role in decomposition Bolidophyceae 11 Centric diatoms processes colonizing faecal pellets also under deep-sea conditions . Fragilaria striatula DH148-5-EKD54 Pennate diatoms Two other sequences, DH148-5-EKD53 and DH144-EKD10, do not 100 Pseudo-nitzschia pungens Pelagomonas calceolata clearly af®liate with any known species, and may represent new Giraudyopsis stellifera Chrysophyceae lineages of heterokonts. We also retrieved a pennate diatom Vacuolaria virescens Nannochloropsis salina sequence (DH148-5-EKD54) at 3,000 m that could correspond to Fucus gardneri a sinking cell. However, as it is very similar to Pseudo-nitzschia spp. Haptophyceae sequences, common dino¯agellate endosymbionts, this sequence Green plants could instead derive from a dino¯agellate endosymbiont. Cryptophyta Cyanophora paradoxa Alveolate sequences were by far the most diverse in our samples. Acanthamoebidae Within the commonly predatory ciliates, we obtained new oligo- Red algae Hydra littoralis Metazoa hymenophorean (DH148-5-EKD6) and colpodean (DH147- Saccharomyces cerevisiae EKD23) sequences. We also recovered typical dino¯agellate DH148-5-EKD21 Fungi 100 Eupenicillium javanicum sequences from all depths and both planktonic fractions (Figs 1b and 2). These sequences are related to Gymnodiniales (often lacking Figure 1 Maximum-likelihood tree of eukaryotic phylotypes in deep Antarctic waters a theca cell wall) and Prorocentrales (theca with two plates), which constructed using 101 eukaryotic 18S rRNA sequences. The tree has been split in two are usually small12. Interestingly, the vast majority of sequences parts representing the basal part (a) and the crown (b) of the eukaryotic rRNA-based obtained grouped in two major clades between dino¯agellates and phylogeny. The outgroup branch (archaea) is not shown. Thin triangles correspond to two apicomplexans (we have termed these marine alveolate groups I and representative species of a given taxon, three in the case of Apicomplexa. Bootstrap II). These sequences were mainly retrieved from the smallest values are given only below nodes concerning the new eukaryotic sequences. The colour planktonic fraction at all depths (Figs 1b and 2). In terms of genetic code indicates sea depths at which sequences were obtained. Scale bars correspond to divergence, the diversity found within these groups is equivalent to 15 substitutions per 100 positions for a unit branch length.

604 © 2001 Macmillan Magazines Ltd NATURE | VOL 409 | 1 FEBRUARY 2001 | www.nature.com letters to nature that displayed by all dino¯agellates known to date. Taking into ports the idea of an early radiation in the evolutionary history of account that these sequences come from the aphotic region of a alveolates. Indeed, internal bootstrap values within alveolates are single (low biomass) sampling site, this diversity is astonishing. On quite small in our analysis, with the exception of ciliates (76%) and the other hand, many microbial groups seem to be ubiquitous in marine alveolates group I (70%) (Fig. 1b). This trend may be the ocean, probably as a result of current mixing13, and this could diagnostic for radiation processes where the order of branch also be true of the newly discovered alveolate lineages. In fact, emergence is dif®cult to assess15. Guillou et al.14 retrieved a picoplanktonic sequence (OLI2001) from We do not observe a clear pattern of diversity fractionation with 100 m deep in the equatorial Paci®c that emerged at the base of the depth in the range studied (250±3,000 m), especially for marine (only three) dino¯agellate sequences they used. When we included alveolates group I and II (Fig. 2). This is consistent with the it in our larger alignment, OLI2001 branches within the marine homogeneity of the physico-chemical conditions in this part of alveolate group I (Fig. 2). This con®rms the observation of this the aphotic water column (poor nutrient concentration, absence of group at upper parts of the water column, and suggests the ubiquity light, average temperature around 2 8C). These novel groups of this lineage in the sea. The discovery of these two new clusters of accounted for most of the diversity found, and corresponded to sequences branching amid apicomplexans and dino¯agellates sup- 65 to 76% of the sequences retrieved from the smallest planktonic

Apicomplexa

Perkinsus marinus DH145-EKD20 DH145-EKD3 DH148-EKD27 51 DH147-EKD7 97 90 53 DH145-EKD13 DH147-EKD20 18 DH145-EKD9 DH147-EKD6 81 15 93 DH145-EKD16 87 98 DH144-EKD14 Marine alveolate 8 DH147-EKD24 22 DH148-EKD14 Group II 99 DH148-EKD2 DH147-EKD3 47 73 DH147-EKD9 DH145-EKD18 8 DH147-EKD11 7 43 DH147-EKD1 6 DH147-EKD16 79 DH144-EKD13 DH148-EKD6 45 DH144-EKD3 93 Unc. Dinophyceae-OLI02001 DH145-EKD10 87 DH148-EKD22 Marine alveolate 9 DH147-EKD19 Group I 58 23 DH148-5-D39 12 89 DH148-EKD18 DH145-EKD12 72 DH144-EKD7 DH147-EKD2 82 DH147-EKD18 18 9 DH148-5-EKD37 69 DH145-EKD4 Noctiluca scintillans Ceratocorys horrida Amphidinium belauense Gonyaulax spinifera Crypthecodinium cohnii Ceratium tenue Alexandrium minutum 98 Alexandrium tamarense 79 Pyrocystis noctiluca Gymnodinium beii 96 Symbiodinium microadriaticum 83 Symbiodinium sp.-U10893 Gloeodinium viscum Dinoflagellates Prorocentrum micans Prorocentrum concavum DH148-5-EKD17 78 DH148-5-EKD46 21 DH144-EKD15 Gymnodinium fuscum 66 DH145-EKD8 60 DH148-5-EKD33 Gymnodinium catenatum Gymnodinium mikimotoi Pfiesteria piscicida Cachonina hallii 10 DH147-EKD21 Figure 2 Maximum-likelihood tree showing the diversity of new dino¯agellates and those above 80% are given below the respective nodes. The scale bar corresponds to 5 marine alveolate groups I and II. The tree was constructed using partial 39 end 18S rRNA substitutions per 100 positions for a unit branch length. The colour code is as in Fig. 1. sequences. Bootstrap values corresponding to the new eukaryotic sequences and also

NATURE | VOL 409 | 1 FEBRUARY 2001 | www.nature.com © 2001 Macmillan Magazines Ltd 605 letters to nature fraction at different depths, suggesting that they are also relatively 377 apparatus (Perkin Elmer Applied Biosystems) using the ABI Prism dRhodamine abundant. By contrast, we could detect a signi®cant difference terminator cycle sequencing ready reaction kit with either primer EK-1F or EK-82F. After preliminary phylogenetic analysis, 13 dino¯agellate-related marine alveolate clones, and between the eukaryotic diversity observed in the fractions 0.2± 11 eukaryotic clones of different phylogenetic af®liation were chosen for complete 5 mm and .5 mm at 3,000 m deep. Sequences recovered from the sequencing. Inserts were sequenced twice using both ¯anking vector primers and speci®c larger fraction were more diverse, and marine alveolate groups I and eukaryotic primers. Speci®c internal primers DIN-1F (GTTGTTGCGGTTAAAAAGC), II accounted only for 31% of the clones. This trend was compen- for dino¯agellate-related clones, and EK-555F (AGTCTGGTGCCAGCAGCCGC) and EK- 1269R (AAGAACGGCCATGCACCAC), for eukaryotes, were designed to complete and sated by a larger proportion of heterokonts, and other groups such overlap central insert sequences. as fungi or even animalsÐa relatively large number of copepod sequences was ampli®ed (data not shown). We did not identify Phylogenetic analyses foraminifera in our samples, although some of the basal diverging 1,443 eukaryotic 18S rRNA sequences were retrieved from GenBank and the rRNA lineages could belong to these organisms. Sequences from plank- Database at the University of Antwerp (http://rrna.uia.ac.be/). They were aligned together tonic foraminifera are scarce in databanks, and they are very with the Antarctic clone sequences using CLUSTAL W22, and the resulting multiple divergent, often containing large insertions16. alignment was manually edited using the program ED from the MUST package23. Partial The diversity of small eukaryotes found at high ocean depth NJ trees were constructed for the different eukaryotic taxa to choose a representative subset of 101 sequences, avoiding partial and fast-evolving ones, for further phylogenetic (250±3,000 m) in the Antarctic appears to be at least as important as analyses (Fig. 1). Fifteen archaeal sequences were included as the outgroup. Gaps and that of prokaryotes, including both archaea and bacteria (unpub- ambiguously aligned positions were excluded from our analyses, resulting in an alignment lished results). They may reach the deeper parts of the water column of 1,275 positions. An additional alignment including 39 partial, new Antarctic alveolate by sinking from the upper region, where primary production, sequences (580 unambiguous positions) was constructed to analyse the phylogeny of the diversity and nutrient concentration are higher17. However, we two new alveolate groups (Fig. 2). MP and ML trees were constructed, respectively, with the programs PAUP 3.1 (ref. 24) and NUCML from the MOLPHY 2.3 package25 using a did not ®nd sequences corresponding to several phototrophic heuristic quick-add OTUs search and default values. Bootstrap proportions were esti- groups that are common in surface waters (such as haptophytes mated using 1,000 replicates for NJ and MP trees, and using the RELL method26 on the and diverse diatoms); this suggests that the new lineages may be 1,000 top-ranking trees for ML trees. The alpha parameter value of the gamma thriving in the deep ocean. A small planktonic size would also be in distribution accounting for among-site rate variation was computed using PUZZLE27. Alignments, trees and list of species used are available on request. agreement with life in cold and oligotrophic waters17. Our ®ndings may be of interest for at least three disciplines. First, Received 1 August; accepted 6 November 2000. for ecology and biogeochemistry, as until now most measurements 1. Pace, N. R. A molecular view of microbial diversity and the biosphere. Science 276, 734±740 (1997). of prokaryotic carbon cycling in the sea have been based on size- 2. Giovannoni, S. J., Britschgi, T. B., Moyer, C. L. & Field, K. G. Genetic diversity in Sargasso Sea exclusion techniques that cannot discriminate between prokaryotes bacterioplankton. Nature 356, 148±149 (1992). 17 3. Fuhrman, J. A., McCallum, K. & Davis, A. A. Novel major archaebacterial group from marine and very small eukaryotes . Second, for phylogeny and evolution. plankton. Nature 356, 148±149 (1992). The two new alveolate groups support an early radiation within this 4. DeLong, E. F. Archaea in coastal marine environments. Proc. Natl Acad. Sci. USA 89, 5685±5689 phylum and could represent intermediate taxa between dino¯agel- (1992). lates and apicomplexans. These could be used to test some of the 5. Altschul, S. F. & Koonin, E. V. Iterated pro®le searches with PSI-BLASTÐa tool for discovery in protein databases. Trends Biochem. Sci. 23, 444±447 (1998). evolutionary scenarios proposed (see ref. 18 for example). For 6. Knoll, A. H. The early evolution of eukaryotes: a geological perspective. Science 256, 622±627 (1992). general eukaryotic phylogeny, the new lineages in the basal region 7. Embley, T. M. & Hirt, R. P. Early branching eukaryotes? Curr. Opin. Genet. Dev. 8, 624±629 (1998). of the tree may help to break long branches, stabilizing this 8. Stiller, J. & Hall, B. Long-branch attraction and the rDNA model of early eukaryotic evolution. Mol. problematic region15. Furthermore, our present knowledge of Biol. Evol. 16, 1270±1279 (1999). 9. Larsen, J. & Patterson, J. L. Some ¯agellates (Protista) from tropical marine sediments. J. Nat. Hist. 24, eukaryotic diversity is based on phenotypical traits and species 801±937 (1990). isolation but, for very small eukaryotes, tiny sizes may have 10. Takami, H., Inoue, A., Fuji, F. & Horikoshi, K. Microbial ¯ora in the deepest sea mud of the Mariana precluded their recognition as such by direct observation1. Molecu- Trench. FEMS Microbiol. Lett. 152, 279±285 (1997). 11. Raghukumar, S. & Raghukumar, C. Thraustochytrid fungoid protists in faecal pellets of the tunicate lar ecology techniques based on rRNA ampli®cation could thus Pegea confoederata, their tolerance to deep-sea conditions and implication in degradation processes. stimulate changes in protistology like those that occurred in Mar. Ecol. Prog. Ser. 190, 133±140 (1999). prokaryotic microbiology. Finally, the existence of a wide variety 12. Lenaers, G., Scholin, C., Bhaud, Y., Saint-Hilaire, D. & Herzog, M. A molecular phylogeny of of small eukaryotes should be considered for general micropalaeon- dino¯agellate protists (pyrrhophyta) inferred from the sequence of 24S rRNA divergent domains D1 and D8. J. Mol. Evol. 32, 53±63 (1991). tological studies. Easily fossilizable forms (like some dino¯agellates), 13. Darling, K. F. et al. Molecular evidence for genetic mixing of Arctic and Antarctic subpolar may have led to the misinterpretation of some microfossils as populations of planktonic foraminifers. Nature 405, 43±47 (2000). prokaryotes. This could partly explain problems such as the gap 14. Guillou, L., Moon-Van Der Staay, S. Y., Claustre, H., Partensky, F. & Vaulot, D. Diversity and existing between the earliest unequivocal occurrence of dino¯agel- abundance of Bolidophyceae (Heterokonta) in two oceanic regions. Appl. Environ. Microbiol. 65, 4528±4536 (1999). lates (,240 million years ago) and that of dino¯agellate biomarkers, 15. Philippe, H. et al. Early-branching or fast-evolving eukaryotes? An answer based on slowly evolving dinosteranes (,520 million years ago)19, as well as the decline in the positions. Proc. R. Soc. Lond. B 267, 1213±1221 (2000). dino¯agellate fossil record observed during the Tertiary period20. M 16. Pawlowski, J. et al. Extreme differences in rates of molecular evolution of foraminifera revealed by comparison of ribosomal DNA sequences and the fossil record. Mol. Biol. Evol. 14, 498±505 (1997). 17. Fenchel, T., King, G. M. & Blackburn, T. H. Bacterial Biogeochemistry: The Ecophysiology of Mineral Cycling (Academic, London, 1998). Methods 18. Cavalier-Smith, T. Kingdom protozoa and its 18 phyla. Microbiol. Rev. 57, 953±994 (1993). Experimental methods 19. Moldowan, J. M. & Talyzina, N. M. Biogeochemical evidence for dino¯agellate ancestors in the early cambrian. Science 281, 1168±1170 (1998). Samples were collected in Niskin bottles on December 1998, during the Spanish 20. McRae, R. A., Fensome, R. A. & Williams, G. L. Fossil dino¯agellate diversity, origins and extinctions oceanographic campaign DHARMA 98 (He052; http://www.ugbo.csic.es). For the sam- and their evolutionary signi®cance. Can. J. Bot. 74, 1987±1994 (1996). ples used in this work, volumes from 20 to 341 of sea water from 250, 500, 2,000 and 21. Massana, R., Murray, A. E., Preston, C. M. & DeLong, E. F. Vertical distribution and phylogenetic 3,000 m deep were pre®ltered through a nylon mesh, ®ltered through a 5-mm pore-size characterization of marine planktonic Archaea in the Santa Barbara Channel. Appl. Environ. ®lter, and the remaining plankton collected in 0.2-mm Sterivex ®lters (0.2±5 mm fraction). Microbiol. 63, 50±56 (1997). 21 After a proteinase K±SDS lysis step, nucleic acids were extracted as previously described 22. Thompson, J. D., Higgins, D. G. & Gibson, T. J. CLUSTALW: improving the sensitivity of progressive with a yield of 0.327, 0.146, 0.169, and 0.068 mg DNA per litre of sea water, respectively. 18S multiple sequence alignment through sequence weighting, position-speci®c gap penalties and weight rRNA genes presented in this work were ampli®ed by polymerase chain reaction (PCR) matrix choice. Nucleic Acids Res. 22, 4673±4680 (1994). using the speci®c primers EK-1F (CTGGTTGATCCTGCCAG), EK-82F (GAAACTGCG 23. Philippe, H. MUST, a computer package of Management Utilities for Sequences and Trees. Nucleic AATGGCTC) and EK-1520R (CYGCAGGTTCACCTAC) under previously described Acids Res. 21, 5264±5272 (1993). 4 conditions . Four additional speci®c eukaryotic primer sets tested gave similar results to 24. Swofford, D. L. PAUP: phylogenetic analysis using parsimony, version 3.1.1 (Illinois Natural History the combination EK-82F/EK-1520R. rDNA clone libraries were constructed using the Survey, Champaign, 1993). Topo TA Cloning system (Invitrogen). After plating, 24 to 104 positive transformants per 25. Adachi, J. & Hasegawa, M. MOLPHY version 2.3: programs for molecular phylogenetics based on library were screened by PCR ampli®cation of inserts using ¯anking vector primers. maximum likelihood. Comput. Sci. Monogr. 28, 1±150 (1996). Expected-size amplicons were subsequently cleaned using the QIAquick PCR puri®cation 26. Kishino, H., Miyata, T. & Hasegawa, M. Maximum likelihood inference of protein phylogeny, and the system (Qiagen). Cleaned PCR products were directly partially sequenced in an ABI Prism origin of chloroplasts. J. Mol. Evol. 31, 151±160 (1990).

606 © 2001 Macmillan Magazines Ltd NATURE | VOL 409 | 1 FEBRUARY 2001 | www.nature.com letters to nature

27. Strimmer, K. & von Heseler, A. Quartet puzzling: a quartet maximum likelihood method for groups, using more 18S rDNA sequences available (data not reconstructing tree topologies. Mol. Biol. Evol. 13, 964±969 (1996). shown). The presence of sequences from lineages that are known to harbour picoplanktonic representatives, such as the prasino- Acknowledgements phytes or the pelagophytes (Fig. 1), and the converse absence of We thank A. Roger for critical reading of the manuscript, A. LoÂpez-LoÂpez for DNA sequences from larger cells such as diatoms despite their ubiquity in extraction and M. L. Campos for sequencing help. This work was supported by the 13 European MIDAS project. The HeÂsperides campaign DHARMA98 was ®nanced by the Paci®c waters , con®rms that the approach taken speci®cally Spanish Research Council (CSIC). P.L.G. was ®nanced by a postdoctoral contract of the targeted picoplankton. Spanish Ministerio de EducacioÂn y Cultura. Sequences have been deposited in GenBank Most of the work on oceanic eukaryotic picoplankton has focused under accession numbers AF290036 to AF290085. on its photosynthetic component because chlorophyll ¯uorescence 1 Correspondence and requests for materials should be addressed to D.M. makes it easy to detect by ¯ow cytometry and pigment signatures (e-mail: [email protected]). permit inferences to be made about its taxonomic composition. Among autotrophs, haptophytes constitute one of the major picoplanktonic lineages, as suggested by the dominance of the diagnostic carotenoid 199-hexanoyloxyfucoxanthin in most oceanic ...... waters14. Indeed, four haptophyte clones (OLI11056, OLI11019, OLI11072 and OLI11007) were observed in the Paci®c sample. Oceanic 18S rDNA sequences from Separate phylogenetic analyses of these environmental clones, adding more haptophyte sequences, suggest that clones OLI11072 picoplankton reveal unsuspected and OLI11019 are more speci®cally related to Chrysochromulina leadbeateri. Clone OLI11007 belongs to a recently revealed environ- eukaryotic diversity mental lineage that is related either to coccolithophorids or to Phaeocystis14. Clone OLI11056 forms a somewhat independent clade Seung Yeo Moon-van der Staay*², Rupert De Wachter³ & Daniel Vaulot*³ as a sister to the Chrysochromulina clade and that uniting the Prymnesium, Imantonia and part of the Chrysochromulina species * Station Biologique, UPR 9042 Centre National de la Recherche Scienti®que et (data not shown). Universite Pierre et Marie Curie, BP 74, 29682 Roscoff Cedex, France Another key group in the picoplanktonic autotrophs is the ³ Departement Biochemie, Universiteit Antwerpen (UIA), Universiteitsplein 1, prasinophytes, primitive green algae that have been repeatedly B-2610 Antwerpen, Belgium isolated from marine waters6. Indeed, three clones (OLI11059, ...... OLI11305 and OLI11345) were assigned to this class (Fig. 1). PicoplanktonÐcells with a diameter of less than 3 mmÐare the Phylogenetic analyses strongly support the af®nity between dominant contributors to both primary production and biomass OLI11059 and the unidenti®ed coccoid prasinophyte CCMP in open oceanic regions1,2. However, compared with the 1205, whereas the other two sequences seem to form a new clade, prokaryotes3, the eukaryotic component of picoplankton is still not yet represented in culture. The exact branching order of the poorly known. Recent discoveries of new eukaryotic algal taxa lineage leading to these clones and CCMP 1205 in other early based on picoplankton cultures4,5 suggest the existence of many diverging prasinophyte lineages is still not clear (bootstrap value undiscovered taxa. Conventional approaches based on phenotypic ,50%). criteria have limitations in depicting picoplankton composition Stramenopiles or heterokonta contain key oceanic algal classes, in due to their tiny size and lack of distinctive taxonomic characters6. particular the ubiquitous diatoms, but also heterotrophic groups Here we analyse, using an approach that has been very successful such as the bicosoecids. Clone OLI11030 shows 99.6% sequence for prokaryotes7 but has so far seldom been applied to identity with P. calceolata a widespread species, whose discovery in eukaryotes8, 35 full sequences of the small-subunit (18S) riboso- 1993 led to the creation of the class Pelagophyceae4. Clone OLI11025 mal RNA gene derived from a picoplanktonic assemblage col- is related to the dictyochophytes, which contain phototrophic, lected at a depth of 75 m in the equatorial Paci®c Ocean, and show phagotrophic and mixotrophic species. Five other clones are that there is a high diversity of picoeukaryotes. Most of the af®liated to two highly diverging heterotrophic stramenopile sequences were previously unknown but could still be assigned lineages. One group (OLI11026 and OLI11008) clusters with the to important marine phyla including prasinophytes, haptophytes, oomycetes (Lagenidium, Phytopthora and Achlya), whereas the dino¯agellates, stramenopiles, choano¯agellates and acanthar- other group (OLI11066, OLI11150 and OLI11006) apparently ians. We also found a novel lineage, closely related to dino¯agel- represents an early heterotrophic divergence. Clone OLI11066 lates and not previously described. clusters with clone OLI11150, whereas the af®nity of clone A sequence search with the EMBL gene databank showed that OLI11006 with the two former clones is not strongly supported only 2 of the 35 18S rDNA sequences (OLI11030 and OLI11015) by bootstrapping (54%). The relative branching order between early from the Paci®c Ocean had signi®cant identity (more than 99%) diverging heterotrophic stramenopiles, for example bicosoecids to known sequences: the ubiquitous picoplanktonic species (Syluania, Cafeteria), labyrinthulids (Labyrinthuloides minuta) Pelagomonas calceolata and a recently sequenced acantharian9, and thraustochytrids (Thraustochytrium kinnei), is still obscure, as respectively. The maximum sequence identities of the other envir- shown in previous studies based on 18S rRNA15,16. onmental sequences to known eukaryote 18S rDNAs ranged from Dino¯agellates, like the stramenopiles, contain both autotrophic 82% to 97%. The global phylogenetic tree (Fig. 1) obtained with and heterotrophic taxa. Three clones (OLI11255, OLI11027 and both environmental clones and available sequences is largely con- OLI11005) can be included in various dino¯agellate clades, gruent with those found previously10±12, although many evolution- although their exact phylogenetic positions are not clear (bootstrap ary relationships between the eukaryotic crown taxa are not clear, values ,50%). Seven clones (OLI11115, OLI11261, OLI11055, and the bootstrap values at the nodes are low, as indicated in earlier OLI11023, OLI11010, OLI11009 and OLI11012) form a monophy- studies. The phylogenetic positions of the environmental clones are letic lineage (Fig. 1) that includes the parasitic syndiniophycean also supported by detailed, separate phylogenetic analyses of sub- Amoebophrya sp.17. Additional sequences of syndiniophyceans are probably needed for a more detailed characterization of these clones. The most intriguing discovery from this work is that of an ² Present address: Department of Evolutionary Microbiology, University of Nijmegen, NL-6525ED, The Netherlands. environmental lineage consisting of six clones (OLI11038,

NATURE | VOL 409 | 1 FEBRUARY 2001 | www.nature.com © 2001 Macmillan Magazines Ltd 607