Genetic and Evolutionary Characterization of Pakistani Pigeons and Parrots through Mitochondrial D-Loop and Cytb Genes
SEHRISH FIRYAL 2008-VA-454
A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE
OF
DOCTOR OF PHILOSOPHY
IN
MOLECULAR BIOLOGY AND BIOTECHNOLOGY
UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES,
LAHORE
2013
To,
The Controller of Examinations, University of Veterinary & Animal Sciences, Lahore.
We, the Supervisory Committee, certify that the contents and form of the thesis, submitted by Sehrish Firyal, have been found satisfactory and recommend that it be processed for the evaluation by the External Examination(s) for award of the Degree.
Chairman ______
(Dr. Ali Raza Awan)
Member ______
(Prof. Dr. Tahir Yaqub)
Member ______
(Prof. Dr. Aftab Ahmad Anjum)
DEDICATED
To,
The sweet memories of my beloved brother and Sister (Late),
MAZAN and KINZA
(May ALLAH rest them in His eternal peace)
&
To,
MY PARENTS
(A Great source of motivation)
i
ACKNOWLEDGEMENTS
All the extols and recognition for ALMIGHTYALLAH, Who is the entire source of all knowledge and wisdom endowed to mankind. I offer my humblest gratitude from the deep sense of heart to the Holy Prophet, MUHAMMAD (Peace be Upon Him) Who is, forever source of guidance and knowledge for humanity.
There are many people who through their generosity and knowledge have made important contributions to this thesis work. It would be virtually impossible to list everyone who contributed to resolve this research enigma, or to appreciate adequately the extent of the contributions of those who are mentioned.
First and foremost, I would like to express my heartiest gratitude and deep sense of obligation to my worthy supervisor and gracious mentor Dr. Ali Raza Awan, Assistant professor,Institute of
Biochemistry and Biotechnology, for his sagacious guidance and support that he provided all along the course of my PhD degree program. Without his insightful direction, many of the results presented in this thesis manuscript would not have been possible. I am grateful to him also for many thought-provoking suggestions in the realization of final manuscript.
It gives me a momentous pleasure in transcribing my whole hearted thanks to the members of my
Supervisory Committee, Prof. Dr. Tahir Yaqub, Director, Institute of Biochemistry and
Biotechnology, and Prof. Dr. Aftab Ahmad Anjum, Associate Professor, Department of
Microbiology, for their able guidance, keen interest, unstinted help, constructive criticism and ever encouraging attitude throughout the course of research investigations and write-up of thesis manuscript. I am extremely indebted to Dr.M.Wasim, Dr.M.Tayyab, Dr.M. Imran, Dr.M.Asif and Ms. Saeeda Awais for their invaluable help in my research endeavors.
ii
I would remiss if I don‟t recognize the all too important help of my M.Phil research students
(Umair Latif, Muddasar Saeed Khan, Muhammad Wasim, H. M. Farooq and Arslan Nazar) and support staff (in particular Ms. Tayyba) for their cooperation and assistance in the execution of this research endeavor.
With profound emotions of benevolence and gratitude I offer sincerest appreciation to my friends
(Ms. Nadia Mukhtar, Dr.Qamar-un-Nisa and Ms. Saiqa Iqbal), my cousins (Dr. Immad,
Mr.Waleed and Ms Beenish) and my mentors (Prof. Dr. Zia-ur-Rehman; Prof. Dr. Talat Naseer
Pasha, Vice Chancellor, UVAS; Dr. Muhammad Saqib and Dr.Nadem Asi, Assistant professors,
UAF and Dr. Zubair Yousaf), my colleagues (Dr.Wasim Shehzad, Dr.Yasir Zahoor, Dr. Ishtiaq
Ahmad, Dr. Zia Ullah Mughal and Dr. M. Awais) for providing me moral support all along the nerve wrecking and grueling period of my PhD degree course work and research.
It would be unjust and a travesty if I don‟t place my cordial thanks to my father, mother, sisters
(Minaul and late Kinza), and brothers (Shahzaib Chaudhry and Late Chaudhry Mazan Usman) for their inspiration which kept me on track all along my academic career.
Sehrish Firyal 19/12/2013
iii
TABLE OF CONTENTS
Dedication…………………………………….(i)
Acknowledgments……………………………(ii)
Table of Contents…………………………… (iv)
List of Tables………………………………....(v)
List of Figures………………………………...(vi)
CHAPTER NO. TITLE. PAGE NO.
1 INTRODUCTION 01
2 REVIEW OF LITTERATURE 08
3 MATERIALS AND METHODS 36
4 RESULTS 57
5. DISCUSSION 130
6. SUMMARY 142
7. LITERATURE CITED 145
8. APPENDIX 161
iv
LIST OF TABLES
TABLE TITLE PAGE NO. NO. 3.1 List of Primer Sequences 51
3.2 PCR reaction composition 52
3.3 PCR Protocol 53
3.4 PCR Reaction Composition for sequencing products 54
3.5 PCR cycle for sequencing products 54
4.1 SNPs found in the Cytb gene of Sherazi Pigeon 61
4.2 SNPs found in the Cytb gene of Lucky Pigeon 66
4.3 SNPs found in the Cytb gene of Lathay Rock Pigeon 71
4.4 SNPs found in the Cytb gene of Rock Pigeon 76
4.5 SNPs in Cytb gene of various Pakistani Pigeon breeds 78
4.6 SNPs in ND2 gene of various Pakistani pigeons breeds 111
v
LIST OF FIGURES
FIGURE TITLE PAGE NO. NO. 3.1 Pakistan map showing the selected areas for the sampling of 37 Sherazi Pigeon 3.2 Pakistan map showing the selected areas for the sampling of 38 Lucky Pigeon 3.3 Pakistan map showing the selected areas for the sampling of 39 Rock Pigeon 3.4 Pakistan map showing the selected areas for the sampling of 40 Lathay Rock Pigeon 3.5 Pakistan map showing the selected areas for the sampling of 41 Rose-ringed Parakeets (Kathy Parrot) 3.6 Pakistan map showing the selected areas for the sampling of 42 Alexandrine Parakeet (Raw Parrot) 3.7 Sherazi Pigeon 43
3.8 Lucky Pigeon 44
3.9 Rock Pigeon 45
3.10 Lathy Rock Pigeon 46
3.11 Rose-ringed Parakeet 47
3.12 Alexandrine Parakeet 48
3.13 Temperature Profile for Sequencing PCR 55
4.1 PCR amplification of Cytb gene 59
4.2 Nucleotide sequence of Cytb gene of Sherazi along with its 60 deduced amino acid sequences 4.3 Phylogenetic Tree of Cytb gene of Sherazi Pigeon with 52 available Columbiformes members
vi
4.4 PCR amplification of Cytb gene of Pakistani Lucky Pigeon 64
4.5 Nucleotide sequence of Cytb gene of Lucky along with its 65 deduced amino acid sequences 4.6 The phylogeny based on the Cytb gene sequences of 67 Columbiformes indicating the phylogenetic and molecular classification of the Pakistani Lucky pigeon
4.7 PCR amplification of Cytb gene of Lathy Rock 69
4.8 Nucleotide sequence of Cytb gene of Lathy Rock along with 70 its deduced amino acid sequences 4.9 Phylogenetic tree of Cytb gene of Lathay Rock Pigeon 72
4.10 PCR amplification of Cytb gene of Pakistani Rock Pigeon 74
4.11 Nucleotide sequence of Cytb gene of Rock Pigeon along with 75 its deduced amino acid sequences 4.12 Phylogenetic analysis of Pakistani Rock Pigeon 77 4.13 PCR amplification of D-loop gene of Sherazi Pigeon 80
4.14 Nucleotide sequence of D-loop of Sherazi Pigeon 81
4.15 Phylogenic tree of D-loop gene of Sherazi pigeon and putative 82 Columbiformes 4.16 PCR amplification of D-loop gene of Lucky Pigeon 84
4.17 Nucleotide sequence of D-loop gene of Lucky Pigeon 85
4.18 Phylogenic tree of D-loop gene of Pakistani Lucky Pigeon 86
4.19 PCR amplification of D-loop gene of Lathay Rock Pigeon 83
4.20 Nucleotide sequence of D-loop gene of Lathay Rock Pigeon 89
4.21 Phylogenic tree of D-loop gene of Lathay Rock Pigeon 90
4.22 PCR amplification of D-loop gene of Pakistani Rock Pigeon 92
4.23 Nucleotide sequence of D-loop gene of Rock Pigeon 93
4.24 Phylogenic tree of D-loop gene of Pakistani Rock Pigeon 94
4.25 PCR amplification of ND2 gene of Sherazi Pigeon 96
vii
4.26 Nucleotide sequence of ND2 gene of Sherazi Pigeon along 97 with its deduced amino acid sequence 4.27 Phylogenic tree of ND2 gene of Pakistani Sherazi Pigeon 98
4.28 PCR amplification of ND2 gene of Pakistani Lucky Pigeon 100
4.29 Nucleotide sequence of ND2 gene of Lucky Pigeon along with 101 its deduced amino acid sequence 4.30 Phylogenic tree of ND2 gene of Lucky Pigeon 102
4.31 PCR amplification of ND2 gene of Rock Pigeon 104
4.32 Nucleotide sequence of ND2 gene of Rock Pigeon along with 105 its deduced amino acid sequence 4.33 Phylogenic tree of Rock Pigeon based on ND2 gene sequence 106
4.34 PCR amplification of ND2 gene of Lathay Rock pigeon 108
4.35 Nucleotide sequence of ND2 gene of Lathay Rock Pigeon 109 along with its deduced amino acid sequence 4.36 Phylogenic tree of Lathay Rock Pigeon based on ND2 gene 110 sequence 4.37 PCR amplification of Cytb gene of Rose-ringed Parakeets 115
4.38 Nucleotide Sequence of Cytb gene of Rose-ringed Parakeets 116 along with deduced amino acid sequence
4.39 Phylogenetic analysis of Cytb gene of Pakistani Rose-ringed 117 Parakeets 4.40 PCR amplification of Cytb gene of Pakistani Alexandrine 119 Parakeet 4.41 Nucleotide sequence of Cytb gene of Pakistani Alexandrine 120 Parakeet along with deduced amino acid sequence
4.42 Phylogenetic analysis of Cytb gene of Pakistani Alexandrine 121 Parakeet 4.43 PCR amplification of ND2 gene of Pakistani Rose-ringed 123 Parakeets 4.44 Nucleotide sequence of ND2 gene of Pakistani Rose-ringed 124 Parakeets along with deduced amino acid sequence 4.45 Phylogenetic tree of ND2 gene of Pakistani Rose-ringed 125 Parakeets viii
4.46 PCR amplification of ND2 gene of Pakistani Alexandrine 127 Parakeet 4.47 Nucleotide sequence of ND2 gene of Pakistani Alexandrine 128 Parakeet along with deduced amino acid sequence 4.48 Phylogenetic tree of ND2 gene of Pakistani Alexandrine 129 Parakeet
ix
Chapter 1
INTRODUCTION
Birds are egg laying vertebrates that belong to class Aves. They have feathers, wings, and move by means of two limbs. They are highly significant and diverse component of ecosystem worldwide and play an integral role in maintenance of an ecosystem by seed dissemination, by acting as predators, prey, and by pollination of plants. Many birds are of economic importance as they are source of food and are used for hunting, farming and their guano is used as fertilizer. They also benefit human by providing ecosystem services including waste and carcass scavenging (Prakash et al.
2003).
Dynamic geological history, immense latitudinal spread and broad altitudinal range make Pakistan a remarkable ecological region of world. Pakistan is bestowed with a diversified array of avian fauna due to variety of habitats. Climate variations and different biotopes in different territories support diverse ecological zone and provide abode for healthy avian fauna. Among the avifauna of Pakistan, pigeons and parrots are the common usage birds that belong to Columbidae and Psittacidae family, respectively and contribute to overall biodiversity of the country.
Pigeons are monumentally important, oldest domesticated monogamous, stout bodied birds with short neck (Shapiro et al. 2002) and have played many significant roles throughout the human history including symbol of gods, pets, food, companion animal, messengers and even war heroes (Bell, 2007). Pigeon trading is a lucrative business worldwide. They are highly territorial, which lead them to be used as model of animal
------1------INTRODUCTION navigation (Collett et al. 2004) and are benign residents of society. In Pakistan, a long spectrum of pigeon breeds is present. Famous varieties of pigeon in Pakistan include
Baunkay, Rancy, Lucky, Sherazi, Homour, Rock, Daangi, Chhatri, Tukkri and Lotan
(www.opgbb.com/pakistan/, 22/08/2013). Sherazi, Lucky, Rock and Lathy Rock are unique Pakistani fancy pigeon breeds. Their domestication and breeding have been a popular hobby in Indo-Pak since Mughal emperioe‟s period and have ubiquitous association with human beings. These breeds can adapt to nearly all climatic zones including urban, suburban and rural areas. South Asia and Middle East are ancient geographic centers of these breeds (Shapiro et al.2002). Sherazi are medium size pigeon breed, found in different colors and do not fly for long distance. Lucky also known as faintail, are medium size birds with shaking neck and muffs. Rock pigeon breed is native to South Asia, Middle East, North Africa and Europe, and probably well domesticated at several time scale and geographic zones. They have important place in evolutionary ornithology and found to be ancestors of all modern pigeon breeds. They are medium sized, gray colored breed with dense red iris rim (Tanveer, 2001). Lathy Rock is also medium sized domestic breed with yellowish iris rim and dark & light gray colored feathers.
Parrots are among the most striking features of tropical avifauna. Their ability to talk and imitate human voice makes them love-bird and increases their popularity as pets.
There are 372 species of parrots which belong to the family Psittacidae (Iwaniuk et al.
2004). Parrots are frugivorous, have importance as fancy birds, kept as pets and their feathers are used as ornament. In Pakistan, there are four distinct species of parrots that include: Rose-ringed Parakeet (Psittacula krameri) Alexandrine Parakeet (Psittacula
------2------
------INTRODUCTION eupatria), Plum-headed Parakeet (Psittacula cyanocephala) and Slaty-headed Parakeet
(Psittacula himalayana).
P.krameri have four sub-species based on their geographical distribution, these sub-species do not differ much phenotypically (Juniper and Parr 1998; Forshaw, 2010).
These sub-species include P. k. krameri (distributed in Guinea, Senegal, East and West
Uganda, Southern Mauritania and Sudan), P. k. parvirostris (inhabitant in Northwest
Somalia, Sudan, Ethiopia and Somalia), P. k. borealis (found in Eastern Pakistan to
Northern India and Nepal), P. k. manillensis (with the home track in Sri Lanka and
India). On global basis, these subspecies are most widely introduced parrot species
(Lever, 1977). In 1983, British Ornithologists Union accepted them as established exotic
Category C species with 500 birds. In 1986, population increased from 500 to 1000 heads
(Lack, 1986). A latter report by Pithon and Dytham (1999) documented a swelling of these bird numbers to 1508.
Psittacula eupatria have 5 subspecies: P.e. eupatria (East India to South Andhra and Sri Lanka), P.e.avensis (Northeast India), P.e.magnirostris (Andaman Islands),
P.e.nipalensis (Pakistan, Eastern Afghanistan, Central and North India) and P.e.siamensis
(Laos, Vietnam and Cambodia) though they do not differ much phenotypically. These subspecies need to be characterized and documented with reliable approaches in order to comply with International Standards and requirements of WTO Accord.
Wildlife researchers and ornithologists have characterized pigeons and parrots on the basis of phenotypic and anatomical characteristics including body weight, shank length, shank color, skin color, earlobe color, eye color, comb type, naked necks, crests, beards, muffs, polydactility and feathers (Danish et al. 2008). All these approaches are
------3------
------INTRODUCTION crude because these are influenced by environmental factors. There is a dire need to explore the genetic makeup of avian species to characterize them at species and subspecies level and to know more about the evolutionary relationship among local and with the avian fauna of other regions of the world. The Food and Agriculture
Organization (FAO) of the United Nations has also advocated a genetic resources management programme at global level (Bjornstad and Roed 2001). For molecular classification of avifauna, various approaches like protein electrophoresis, protein immunology, DNA hybridization investigations, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), microsatellites, minisatellite studies, nuclear and extra nuclear single nucleotide polymorphism (SNP) analysis are the best options (Tautz, 1989; Hammond et al.1994).
Molecular biology tools are more acceptable for genetic characterization of avian species due to their reliability, reproducibility and accuracy in a short period of time.
Among the molecular tools the mitochondrial genes are principal markers used for molecular classification. They are excellent diagnostic milestones for taxonomic investigations of species, subspecies, families and population. Use of mitochondrial loci has been extended during the last decade to investigate the phylogeny of distantly and closely related texa and unique pattern of gene flow (Wilson et al. 2000; Ketmaier et al.
2003).
Mitochondrial DNA (mtDNA) exhibits some peculiar properties which renders it one of the best markers for phylography, as non-recombination, high copy number, exclusive maternal inheritance, high mutation index. These desirable attributes make the mtDNA an important milestone to define lineages (Quinn, 1997). Thirty seven genes of
------4------
------INTRODUCTION avian mitochondrial DNA are similar to those of mammals with the exception of their order (Rand and Harrison 1986; Quinn and Wilson 1993; Boore, 1999). Out of 37 genes,
22 encode tRNA, 2 encode rRNA and 13 genes encode specialized proteins. There is also a non-coding region known as displacement (D-loop) or control region (CR).
The mtDNA markers like D-loop, Cytochrome b (Cytb) and NADH dehydrogenase subunit 2 (ND2) have successfully been applied for avian species identification as they have potential to distinguish closely related avian species (Girish et al. 2007). Mitochondrial markers are one of the potentially important tools to trace the geographical distribution of avian species. Furthermore, the use of these markers is an ideal approach to resolve the species based forensic issues due to easy amplification, precision and economics with more accuracy (Haunshi et al. 2009).
D-loop is the principal control region for mitochondrial genes expression (Brown et al. 1979). Polymorphisms of D-loop have been widely employed for structural investigation of population, origin archaeological inference, interspecies variability, natural process of domestication, post-natal growth pattern (Troy et al. 2001; Malau-
Aduli et al. 2004; Yoon et al. 2005) and evolutionary pattern of populations and species
(Yoon et al. 2005). Due to high indel frequency, mtDNA has 5-10 folds higher nucleotides substitution rate than that of nuclear DNA. D-loop is considered to be one of the best approaches to elucidate and delineate the avian origin and lineage identification
(Yang, 1996; Lee et al. 2010).
Cytb is another powerful molecular tool to discriminate and identify the various species (Saif et al. 2012). Owning to these desirable attributes, Cytb gene sequence analysis has been widely used to map the phylogenetic relationships among avian fauna
------5------
------INTRODUCTION at order, genus, species and subspecies level (Thomas et al. 2003; Irwin et al. 1991;
Kikkawa et al.1997). ND2 gene polymorphism is yet another reliable tool to infer the phylogeny and molecular classification. ND2 encodes core subunit NADH-ubiquinone oxidoreductase chain 2 of respiratory chain complex I.
Assessment of genetic diversity in avian species is an important parameter to preserve local genetic resources and to define future breeding options. To define rational strategies for avian breeding, it is fundamental to understand their genetic architecture.
This relays on the knowledge of molecular markers like Cytb, D-loop and ND2 genes of mtDNA.
The present study was designed to genetically characterize and investigate the evolutionary relationship of Pakistani pigeon and parrot at breed and species level respectively by exploring the mitochondrial genes. The assays developed by this study can be employed for avian species and breeds identification and verification of mislabeled individuals. In addition, the findings of this study can be used to lay down the foundation of breeding strategies for the conservation of endangered breeds and species of pigeon and parrot. This study can be used to resolve the unambiguous molecular based taxonomic puzzles, phylogenetic relationships and geographical distributions of
Columbiform and Psittaciformes.
Each bird has his or her own specific pattern of genome fingerprints “signature” referred to as their unique DNA profile. The DNA profile is a permanent individual identification tool for the avian species. DNA typing of pigeons and parrots results can pave the way for breeder to maintain the genetic constitution of loft and the unique genetic diversity in progeny. These results can also be used to get a general idea of which
------6------
------INTRODUCTION birds would make good mates. To test hypothesized relationships among breeds of pigeon construction of a molecular phylogeny was done based on mitochondrial D-loop,
Cytb and ND2 regions. For the taxonomic classification of Pakistani parrots species mitochondrial Cytb and ND2 genes were investigated.
This study was envisaged to address the taxonomic and phylogenetic uncertainties in class Aves and to drive the molecular biologists to establish a phylogenetic framework for future comparative tests of hypotheses about the evolution of plumage patterns, genetics, migration, sociality, natural selection and breeding strategies. Moreover, this study may help in quarantine and food security control of the birds.
The following were the specific objectives set forth for the study undertaken:
To genetically characterize the Pakistani pigeons and parrots through
mitochondrial markers
To use the mitochondrial markers for the taxonomic identification of selected
Pakistani pigeon breeds and parrot species
To study the phylogenetic relationship of Pakistani pigeons and parrots
------7------
Chapter 2
REVIEW OF LITERATURE
Being an integral part of the ecosystem, birds are one of the populous and diverse forms of life on the earth. Incredible number of birds species revealed amazing evolutionary pattern and adaptations and by learning different ways of avian species adaptations and adjustments in the world, we can begin to acclimatize our own attitude and behaviors to live in the world, rather than to force the world into the unsustainable and artificial mold. Birds are natural way to control the pests, help in pollinization of plants, provide guano as fertilizer and meat of some birds is used as food. Through environment some birds transport variety of things like seed dissemination, pollen transportation, fish dispersals and microbes spread.
Natural processes of benefiting humans are called as ecosystem services. There are four types of ecosystem services that are provided by the birds. These services are cultural, regulating and provisioning based. This study review the provisioning and supporting services primarily provided by avian species. Ecosystem services provided by birds are subcategorized to two forms, first one is those services that are provided by birds through their behavior such as pest killer in agriculture fields and second are those services that are provided through product of birds such as meat, guano as fertilizer and nests. Being members of the ecosystems birds play several important roles including pollinators, predators, scavengers, seed predators, seed dispersers, and healthy ecosystem engineers. The goal of this review was to estimate the economic value of bird‟s services
------8------REVIEW OF LITERATURE and to determine the directions for future research. Birds are characteristically very special as far as ecosystem services are concerned as they can fly and the species that migrate from one ecosystem to other can link the ecosystem processes and fluxes of distant ecosystems (Whelan et al. 2008).
The importance to maintain molecular diversity in animal and birds is strongly advocated by Food and Agriculture Organization (FAO). Unambiguous identification of avian species is essential to enforce legislation for the identification of bird species.
Conservation of native genetic pool is primarily important to fill the unanticipated pure breeding demands in future.
Pakistan is rich in biodiversity. The country situated at the Western end of South
Asian sub-continent, and its fauna and flora are blend of Indomalayan, Palearctics and
Ethiopian regions. More than two-third of Pakistan is arid or semi-arid. Pakistani avian fauna is diversified but not investigated yet. Among these, pigeon and parrot are the common usage birds belong to Columbidae and Psittacidae families respectively.
Avian species have been traditionally characterized on morphological, anatomical and phenotypic characteristics including the size of bird, color, feathering pattern; body weight, shank length, skin color, shank color, eye color, earlobe color, naked necks, crests, beards, comb types, muffs, polydactility and frizzled. Although these approaches are easy and cheap but are less sensitive, less accurate, reveal less polymorphism and also influenced by environmental factors (Danish et al. 2008). In the past fossils records were also used for the deciphering of evolutionary track of organism. Limitation of this approach is fossil records can provide age estimate on the basis of radioactive dating. In addition to these, biochemical and immunological methods were also used to characterize
------9------
------REVIEW OF LITERATURE the lineage pattern. These methods use antibodies against soluble proteins that are species-specific. Therefore, these methods can only be used for such stain materials that contain extractable proteins. Another drawback for these traditional methods is that only those species can be identified for which antibodies are available. In addition to this blood plasma and serum proteins and blood groups were also used for characterization
(Severin, 2006).
Recent trend to use molecular techniques for characterization that detect the genetic variation at DNA level opened the unique dimensions. These include the protein polymorphism assaying by protein electrophoresis and protein immunology, DNA hybridization studies, RAPD, RFLP, repetitive DNA sequences like microsatellites and
DNA sequencing of both nuclear and mitochondrial DNA (Carmela et al. 2000). DNA polymorphisms are more reliable and ethic approach to define the breed and species as they are not affected by environmental fluctuations (Adebambo et al. 2000; Nijman et al.
2003).
Scientists examined about two decades before that mitochondrial DNA is a helpful marker for phylogeography research and surprisingly molecular biologists are continuously isolating different species on the basis of unique mitochondrial loci analysis. In comparison to nuclear data the mitochondrial loci proved to be much sensitive indicators for avian species identification. Mitochondrial genome has captured by molecular biologists for characterization and extensively used as molecular clocks
(Bromham, 2003), even can be used where no fossil records are available. As a molecular clock it has a potential to define the time of divergence between closely related species and finally depict the molecular distance among the species. In the birds 2% per million
------10------
------REVIEW OF LITERATURE year substitution rate in mtDNA was reported by Ho in 2007. This rapid evolutionary rate makes this ideal tool for taxonomic investigations. Almost 2-12 mitochondrial DNA copies are present per mitochondrion and in the diluted sample almost 12000 copies of mtDNA are present per ml (Tobe, 2008). Mitochondria are sites for energy production during aerobic respiration and responsible for metabolic functions (Boldogh and Pon,
2007) found within all eukaryotic cells with their own unique DNA. In various avian species length of mitochondrial DNA ranges from 16.6 to 16.8 kb (Zink, 1991). Pigeon and parrot mtDNA is circular, double stranded distinguished as guanine rich heavy strand
(H) and cytosine rich (L) strand (Lehtonen, 2002) with 37 genes. Out of these 22 are transfer RNA (tRNA) genes involved in translation, 13 protein-coding genes involved in oxidative phosphorination and electron transfer. Due to lack of repair mechanism mtDNA exhibit 5 to ten times faster evolution and highly polymorphic nature as compared to nuclear DNA (Saccone et al. 1990). Two rRNA genes and 13 genes involved in oxidative phosphorination are more prone to genetic variations. To resolve phylogenetic relationship and ancestry tracking at different evolutionary depths the mtDNA of vertebrates has become a common tool due to its peculiar properties. These properties include non-recombination, abundant, easy isolation, high copy number and constant rate of mutation, neutrality and clonal fashion of inheritance etc (Galtier et al. 2009).
Among the vertebrates the avian species carry very little intra species variations. mtDNA loci are important mean to infer these variations and population history. Among the different mitochondrial genes coding and noncoding loci both are extensively used parallel. Hyper mutable D-loop region of mitochondria is also known as control region
(CR); rich in segmental duplications and used routinely in molecular inference. This CR
------11------
------REVIEW OF LITERATURE is noncoding region and serves as principle control site for mitochondrial genes expression due to presence of origin of replication. Evolutionary biologists are utilizing
D-loop based evolutionary dynamics to understand the complexity of avian characterization and geographical distribution. This unique locus has also been employed for captive avian breeding and conservation of endangered species. Randi and Lucchini in 1998 Sequenced the mitochondrial D-loop of seven extant Alectoris partridges species.
They found that substitution rate of D-loop region is lower than that of cytochrome b gene and D-loop region is much conserved [1155 ± 2 base pairs]. Comparative studies suggest that these CRs can be divided into three different domains. In vertebrates out of these three domains peripheral I and III are variable and II is conserved one.
Mitochondrial DNA variations are largely being investigated specially for endangered and threatened species. This study reviews the two different categories of uses of mitochondrial DNA that are conservation and molecular ecology. Phylogenetic studies are extensively used in gene conservation. Gene conservation is important for long term management of populations while molecular ecology that makes use of allele frequency is important for short term planning of populations. Comparative analyses and studies of mitochondrial DNA changes provide useful information about population changes (Moritz, 1987).
Pereira and Baker (2006) performed mitogenome based comprehensive analysis of vertebrates to drive Bayesian timescale of avian evolution. They utilized variable time constraints of phylogenetically scattered fossils and calculated that major lineages of vertebrates instigated in Permian on account of credible intervals of 95% with age of origion of 258 million years ago (MYA) (archosaurs), 365 MYA (amniote-amphibian)
------12------
------REVIEW OF LITERATURE and 278 MYA (archosaur-lizard). Order of modern avian species was 139 MYA with throughout Cretaceous spread. In addition to these timescale revealed that molecular evolution rate vary among taxa and across genes. 5-Myr divergence time expected between 2 genera (Branta and Anser) with mitochondrial clock rate of 0.01 substitutions per site per lineage per Myr in avian species was shown to be underestimated by 9.5 Myr.
Evolutionary rates in avian species varied between 0.0009 to 0.012 s/s/l/Myr, demonstrating that many evolutionary splits among the avian taxa have been miscalculated and need to be critically revised.
Molecular characterization and phylogenetic analysis of Pigeons:
Columbidae family comprises 30 genera, 175 species and 12 sub species of pigeons (Gibbs,2000) found in tropical and sub-tropical zones of world. Pigeon can be used for many purposes like military messengers, homing, domestication and meat purpose. Pigeons are monogamous, cere skinned, gentle small billed, stout bodied birds with short neck (Shapiro et al. 2002). Their weight ranges from 0.2 kilo grams (ground doves Columbina) to 2-4 kilograms (crowned pigeons). Both males and females are able to produce the crop milk for nourishing the young ones (http://EzineArticles.com).
Female normally laid two or occasionally three glossy white eggs at once in flimsy nest.
On an average 19 days are required for hatching followed by 35 days more before they leave the nest (www.arizonaorganic.com).
Hedges (1999) investigated the mitochondrial DNA based bird-crocodile relationship from fossil. Gross morphology of the avian species also created
------13------
------REVIEW OF LITERATURE unambiguous species identification ultimately creates a problem for Wildlife
Conservation legislation.
Johnson and Clayton (2000) studied the molecular systematics of Columbiformes
(pigeons and doves) by making comparison of phylogenies constructed with the sequences of nuclear b-fibrinogen intron 7 and mt cytb genes. Trees constructed on the basis of these two genes shared many common nodes. Homogeneity partition test revealed that these two trees are not substantial incongruence. Rate of the nucleotide substitution of nuclear intron was six times slower than Cytb. They also inspected the rate of transition and transversion substitution in these two genes and found that transversions at third position of Cytb accumulated linearly along with nuclear intron.
Johnson et al. (2001) examined theevolutionary history of Streptopelia and
Columba genus utilizing 3600 bps mitochondrial and nuclear gene sequences. Three mitochondrial genes (Cytb, ND2, COI) and nuclear β fibrinogen gene sequences were utilized for this study. For construction of phylogenetic tree several columbiform taxa including Macropygia, Old and new world Columba, Reinwardtoena and Nesoenas mayeri were used and concluded that Streptopelia is not monophyletic while S. picturata is sister species to Nesoenas mayeri resulting in paraphyletic to Streptopelia. They identified three clades of Streptopelia: (1) S. senegalensis and S. chinensis, (2) Nesoenas mayeri plus S. picturata (3) rest of Streptopelia species. Old World Columba species shared same clade with Streptopelia while species of New World Columba clustered outside that clade. These taxonomic variations suggested merging of Nesoenas with the
Streptopelia. Vocal similarities between N. mayeri and S. picturata are most striking and lead to general diversity of vocalizations in other species.
------14------
------REVIEW OF LITERATURE
Grosso et al. (2006) investigated the woodpigeon distribution from the
Mediterranean to western Asia region. Woodpigeon (C.palumbus) is one of the popular
European game bird and can be discriminate from other Columbidae family members. In this study 1042 bps region of mt Cytb was amplified and sequenced with the help of
L14841 and H4a primers. They found degree of differentiation with 5bp insertion in cytochrome b gene amplicons of C. Palumbus population. Estimated divergence time between Numt and functional homologue was 4.9 to 5.2 MY ago with persistent gene flow. They concluded that C. palumbus is migratory from central Europe, with passive movements to Western Europe, while south population is essentially sedentary.
Avian morphological convergences remain controversial and mostly misled the evolutionary researchers. In 2008 Morganwith his research fellows worked on avian evolution with the hypothesis of Metaves clade distributions within Neoaves on the basis of six new mitochondrial genomes of swift, grebe, humming birds, rail, kagu and flamingo. They reported that 41 bird‟s mt DNA sequences of 13229 base pairs reject the seven Metaves species monophyletic as they do not share the common evolutionary pattern within Neoaves. They found a sister taxa relationship between grebe and flamingo. Novel site stripping technique made this relationship more stable. Diverse humming bird of swift clade positioned as outgroup while rail is not closely related to the kagu.
Specie identification often involves the cytochrome b gene sequence analyses
(Parson et al.2000). The rapid and fast changes that occur in mitochondrial DNA sequence results in differences in those populations that have separated from each other only before a short period of time. Sequence analysis of COI and Cytb genes on the
------15------
------REVIEW OF LITERATURE mitochondrial genome is the familiar DNA based method. D-loop and Cytb regions of mitochondrial DNA serve as a DNA barcode for the identification and differentiation of animal species (Hebert et al.2004). In the mitochondrial DNA of vertebrates Cytb gene is one of the most extensively sequenced genes. In this study almost 2000 sequences of
Cytb gene present in Gene bank database were used and analyzed so as to calculate and compare the genetic distance within and across major vertebrate classes as well as sister species and congeneric species (Johns and Avise 1998).
This study describes the identification of biological specimens from different vertebrate animals. In this study 44 different animal species covering 5 major vertebrate
(i.e. mammals, birds, reptiles, amphibians and fishes) groups were sampled. DNA was extracted from those specimens and amplified using the specific primers for Cytb gene.
After amplification the product was sequenced. Sequences obtained from those specimens were used to find out the biological origin of samples by aligning them with
Cytb gene sequences present in the nucleotide database using Blast program. All sequences including those that were not found in the nucleotide database were submitted to Gene bank. This method is very valuable and applicable for the forensic field where large number of challenging samples such as hair, bone, bristles and feathers etc are analyzed or investigated as limitation case work situation in order to identify the species
(Parson et al., 2000).
Lee et al. 2008 identified the cytochrome b gene based novel approach for bird species identification. 331 amplified sequences revealed intraspecies variation with the
0.059 genetic distances among 40 different species and no similar DNA sequence was shared by samples from two diverse avian species. Estrilda melpoda and Lonchura
------16------
------REVIEW OF LITERATURE punctulata arecloser to each other with molecular distance of 0.059. DNA sequence databank was also established which can further use to solve the forensic disputes like species identification.
Technically easy amplification, clonality nature, across the species highly genome conservation clockwise constant rate of substitutions all these properties render the mitochondrial DNA as one of the most popular biological markers for molecular diversity investigations. Galtier et al. 2009 utilized all these characteristic of mitogenome and concluded that great potential is harbored by mt DNA to address the emerging issues of evolution and functional genomics.
Marreroet al. 2008worked on endangered frugivorous pigeon C. Junoniae (White tailed Pigeon) and C. bollii (Bolle Laurel Pigeon) of Canary Islands. Probably these endemic species evolved in thermophilous and Laurel habitat respectively. Threatened status and elusive behavior of these two Columbidae species makes it challenging to handle and observe individuals. In this study noninvasive (fecal) sampling was done for molecular investigations to know about their ecological (sympatric and congeneric) status. To determine the inter and intra species specific polymorphisms within these two pigeon populations full D-loop was sequenced followed by RFLP analysis. Observed genetic diversity between these two species was 0.16 with P = 0.91 and G1 = 0.010.
Mane et al. 2009 described that species and sub-species identification by using
PCR amplification of mt D-loop sequence is gaining much importance. They reviewed the different molecular approaches like RFLP, RAPD (Rastogi et al. 2007), mitochondrial
12s rRNA and D-loop sequence analysis (Girish et al. 2007; Fajardo et al. 2008) and
------17------
------REVIEW OF LITERATURE concluded that identification of species origin by D-loop marker is comparatively quick, sensitive, precise and economical as compared to other molecular assays.
Tsaie et al. (2009) established the complete mtDNA D-loop region of pigeon.
They utilized 10 pigeon samples and amplified D-loop region of these samples in three fragments. They observed Variable Number Tandem Repeat (VNTR) and short tandem repeats (STR) at 3end of D-loop region. Their findings revealed that D-loop sequence ranged from 1310 to 1327 depending upon indels. This highly polymorphic nature can be used as valuable mean for genetic linkages, maternal identification and forensics procedures.
Gonzalez et al. (2009)utilized two mitochondrial genes (Cytb and ND2) and one nuclear β fibrinogen intron7 gene to address the phylogenetic dispute of Canarian pigeons; Laurel Pigeon (C. junoniae) and Bolle‟s Pigeon (C. bollii). Mitochondrial and nuclear genes sequences based phylogenetic trees were constructed using Bayesian inference, maximum likelihood and maximum parsimony. Congruent topology was observed with clustering of C. bollii with C. palumbus which is frequent in Asia and
Europe,while C. junoniae along with other species of Columba genus occupied deep near base of clade. Laurel Pigeon found to be old lineage that have colonized 20 My ago in the Canary Islands, while Bolle‟s Pigeon arrived much later on archipelago (5 My).
Gibb and Penny in 2010explored the South Pacific radiation into pigeon‟s evolution and association of pigeon species in class Neoaves. For this purpose two aspects of pigeon evolution were studied; (1) Ducula Ptilinopus radiation of eight genera and found that Ducula are comparatively more closer than paraphyletic Ptilinopus taxa,
------18------
------REVIEW OF LITERATURE
(2) phylogenetic relationship of pigeons with other avian species (sandgrouse, parrots, falcons and shorebirds) and reported that pigeon and sandgrouse share same clade in phylogenetic tree and they both are more similar to falcon than parrot and shorebirds.
This within and between the pigeons and other avian species findings paved the way to better understand the taxon.
Unajak et al. (2011) applied sensitive and specific method multiplex nested-
PCR to identify commercial meat species. They used the dried blood as an alternative
DNA source for detection. Mitochondrial cytochrome b and NADH dehydrogenase 5/6 genes were used for this job. Wide range of birds species including pheasant, quail, partridge, pigeon, guinea fowl, song thrush and Eurasian woodcock were investigated by using the universal regions of mitochondria as marker for meat discrimination of different avian species. This approach was a straightforward and fast to detect the game birds meat product mislabeling.
Stringham et al. (2012) studied phenotypically divergent breeds and convergent evolution of breed groups of domestic pigeons. They utilized 361 pigeons including 70 domestic breeds and two free living populations to find out genetic relationship among these species. Their findings illuminated that racing pigeon breeds have made significant contributions to the feral pigeon population and domestic pigeons exhibit more variations than other avian species.
Another study was conducted by Hsieh et al. 2003 to analyze the power of Cytb gene to discriminate the closely related species. They found that intra species genetic diversity ranges from 0.25 to 2.74% and that of inter-species from 5.97 (related species) to 34.83% (distant species).
------19------
------REVIEW OF LITERATURE
Parson and his colleagues 2000 used the Cytb gene sequence to discriminate the
41 diverse biological specimens of 5 vertebrate groups (birds, mammals, fishes, amphibians and reptiles). Sequence analysis was done with the help of online Basic alignment search tool and unique haplotypes were deposited in Gene Bank and are extensively used for vertebrate species identification and thus can be utilize in the field of forensic sciences.
Many avian species are exotic and nearly extinct. In vertebrates Cytb gene has been utilized for little intra-species changes and more inter-species variations (Hsieh,
2001; Christidis, 2006). Boonseub et al. 2009 developed ND2, COI and Cytb based molecular markers for avian species identification utilizing 80 different bird species of 22 orders. They reported that Cytb gene is principle marker for species discrimination followed by ND2 and COI is poorest among these three markers. In addition Cytb gene has ability to separate the wide range avian species followed by ND2 which resolved fewer anomalies as compared to COI.
The avian specie identification is of great debate in recent years. Large number of mitochondrial genes has been used to develop markers as standard specie identification markers. Mitochondrial DNA has largely been explored and now it is the standard method for specie identification in mammals. Avian mitochondrial genome contains conserved and variable regions but less is known about that regions. As some of the avian species that are near to extinction are traded illegally so mitochondrial DNA can be used very effectively to identify species and stop illegal trading, this investigation involves 80 different avian species. Three mitochondrial DNA genes i.e Cytb, COI and the ND2 genes were selected and their sequences were obtained from NCBI and aligned. The
------20------
------REVIEW OF LITERATURE results of alignment showed variable and conserved areas present in the sequences of those genes. The results of this study declares the cytochrome b gene more important for specie identification than the other two genes as from the alignment results it was shown that the cytochrome b gene placed the most number of avian species into their appropriate orders; ND2 was next closest and COI the poorest of the three loci (Tobe et al. 2008).
Mitochondrial genome has also potential to highlight the geographical distribution and taxonomic classification of avian species and subspecies. Such kind of study was conducted by Eberhard and Bermingham in 2001 and presented the phylogenetic relationships among the Amazona ochrocephala. Members of this group are distributed in
South and Middle America. Their findings depicted that subspecies of Middle American are monophyletic reciprocally whereas South America subspecies do not poses much genetic variations. Lower Amazon samples were grouped with western Amazonia parrots and they showed least resemblance with Venezuela and Colombia.
The ancestral gene order and the remnant control region (CR) are two main gene orders that exist in birds that differ by the presence of either one or two copies of CR respectively. The inherited gene order is followed by Oscines that are one of the song birds with the lyrebird and Phylloscopus warblers excluded. This study involves the complete mitochondrial genome sequence analyses of 3 non-Phylloscopus warblers species establishing that two matching copies of the control region are present in the
Sylvia atricapilla (blackcap) and the Acrocephalus scirpaceus (reed warbler), while the remnant CR 2 gene order is followed by Sylvia crassirostris (eastern orphean warbler).
The results of this study negates that Acrocephalus and most sylvioid warblers follow the ancestral gene order as demonstrated in the preceding studies. Polymerase chain reaction
------21------
------REVIEW OF LITERATURE length determination can be used to make prove this negation as a misidentification or wrong identification of gene order. The study thus proposes that evolution of gene order of birds (song birds) should be reinvestigated (Singh et al. 2008).
Goldberg et al. (2011) worked onbiogeography and population structure of
Hemiphaga Pigeons of New Zealand. Avifauna of New Zealand is complex and has not clear historical information of close relatives. In this study Goldberg with his coworkerssequenced D-loop region and Cytb of mitochondrial DNA of genus Hemiphaga. Extensive pigeon sampling was done including sixty seven
Hemiphaga novaeseelandiae novaeseelandiae from mainland, six Hemiphaga chathamensis (sister species) from Chatham Islands and three representations of Newflok island Hemiphaga novaeseelandiae spadicea subspecies). Findings of this study elucidated three main Hemiphaga clades comprising with dense allopatric recognized populations on the oceanic islands. D-loop sequences of 67 individuals showed 23 unique haplotypes of Hemiphaga n. novaeseelandiae, out of these 16 were found to be singletone and one private haplotype was widespread and common. Shallow pattern of population genetic variation was observed between and within population of New
Zealand clearly indicating wide range expansion with great inter population exchange.
Cytb based rooting of the Hemiphaga clade shows exchange between Chatham Islands and mainland before to the Norfolk Island colonization. Low geneticdivergence was observed between Norfolk Island and Chatham Islands populations with deep evolutionary divergence from the neighboring relatives of the Hemiphaga. These findings clearly demonstrated that population reduction occurred during Pleistocene and its subsequent expansion from the forest refugia with hundred kilometers occasional spread.
------22------
------REVIEW OF LITERATURE
Conclusively data strongly suggested that endemicity might epitomize the short term occupancy of this area with recent colonization of descendants. So lineage pruning has potential role in creation of endemicity impression.
Molecular characterization and phylogenetic analysis of Pakistani Parrots:
Psittacidae family consists of 86 genera and 372 species of parrots. Parrots are one of the most intelligent avian species with larger brain (Iwaniuk et al.2004). Typical body features of parrots include a strong, an upright stance, curved bill, strong legs, and zygodactyl feet. Their beaks are strong, short and curved. Mostly the parrots are vividly colored, and some are multi-colored. Mostly parrots exhibit little or no sexual dimorphism. In term of length parrots form the most variably sized avian specie with average weight of 11.5 g. Female parrot normally laid 3 clutches of eggs per year and broods for 17 to 31 days.
On the basis of plumage characteristics and mitochondrial Cytb, ND2 genes sequences, influence of river dynamics, marine transgressions and geotectonic events on neotropical parrots were documented by Ribas et al. 2005. They investigated the phylogenetic relationship of all species of genus Pionopsitta along with five additional short tailed parrot genera and concluded that Pionopsitta genus is not monophyletic and
Central American; Choco and Amazonian species will have to place in Gypopsitta genus.
Species diversification within the genera of Gypopsitta was ranged from 8.7 to 0.6 Ma with main divergence between 3.3 to 6.4 Ma. On taxa comparison similar unique vicariance patterns were observed.
------23------
------REVIEW OF LITERATURE
Birt et al. (1992) studied the Cytb gene based variations among parrots. For this purpose they sequenced 307 base pair fragment of 12 parrot species. Pairwise comparisons showed genetic divergence ranged from 26 to 54 with majority of third base redundancy and most recently divergent lineages harbor higher transition to transversion ratio of 24.3:1. Phylogenetic relationship revealed that African Poicephalus and Psittacus are narrowly related in contrast to Australian genera Melopsittacus, Purpureicephalus and
Nymphicus, which are more divergent. The cockatoos seemed to be an ancient lineage within the parrots.
In 1998 Miyaki, with his colleagues conducted a study on nine genera of parrot including Pyrrhura picta, Guaruba guarouba, Anodorhynchus hyacinthinus, Deroptyus accipitrinus, Amazona aestiva, Aratinga aurea, Pionus menstruus, Cyanopsitta Spixii and
Ara ararauna to determine the mitochondrial DNA based Paleogeographical pattern of these parrots. Total of 1771 base pair region of 16S rDNA, 12S rDNA and cytb genes was amplified and sequenced and compression of private allele of these nine genera with
Melopsittacus undulates (Australian parakeet) were made. Maximum likelihood and maximum parsimony based phylogenetic analysis revealed that Neotropical species constituted two unique monophyletic clades: short and long tailed species. According to them paleo environmental variations might be responsible for this radial variations and long tailed species departed during Cretaceous. They also compared the Cytb sequences with already reported sequences of seven genera of Australasian parrots. Findings of this comparison also supported the independent evolution of Neotropical and Australasian parrots. Addition to this, analysis also supported the opinion that the divergence between
------24------
------REVIEW OF LITERATURE
Neotropical long and short tailed taxa was older in contrast to Oligocene Miocene divergence among long tailed genera.
Eberhard et al. (2001) reported the rearrangement and duplication of mitochondrial control region of genus Amazona. Mitochondrial gene order is Cytb - tRNAThr - pND6b- tRNAThr- pND6- pGlu- CR1- tRNAPro- NADH dehydrogenase 6- tRNAGlu- CR2- tRNAPhe- 12s rRNA while CR1 and 2 refer to as supplicated control mitochondrial regions and pGlu and pND6 presumed as pseudogenes. They found remarkable conserved sequences in control region including goose hairpin, TASs, the F,
C, and D boxes and CSB1. Control region based phylogenetic relationship among 21 individuals of four Amazona species (A. autumnalis, A. ochrocephala, A. amazonica and
A. farinose) revealed that individual‟s paralogous copies of two control region are closer to one another than orthologous copies of other individuals. Average genetic divergence of paralogous and orthologs was 1.4 % and 4.1 % respectively.
Ribas et al. (2005) demonstrated the power of Cytb and ND2 genes sequence to solve the scientific confusions of Psittacidae lineage. They studied the diversification and historical biogeography of Neotropical parrot to reinvestigate the Cracraft & Prum‟s postulates, 1988 and found that Pionopsitta genus is not actually monophyletic and P. pileata, is distant phylogenetically from rest of the species of this genera. On the basis of molecular systematics they strongly found H. amazonina as the sister clade of Gypopsitta.
Molecular data suggest that within Gypopsitta is 8.7 and 0.6 Ma with the main divergence of 3.3 to 6.4 Ma. Other taxa also showed same vicariance patterns. They finally suggest that Gypopsitta diversification was mainly influenced by marine
------25------
------REVIEW OF LITERATURE transgressions, river dynamics and geotectonic events with the minor effect of forest quaternary glacial in species origination.
Astuti et al. (2006) inferred phylogenetic associations within members of
Psittacidae family on the basis of mitochondrial Cytb gene. They utilized tissue and blood samples of 40 parrots of Indonesia including 27 species of 15 genera and 3 subfamilies. 907 base pairs Cytb region was amplified and phylogeny was constructed usingmaximum parsimony approachesneighbor joining and maximum likelihood methods. This phylogenetic investigation revealed that cackatoos of Cacatuinae subfamily form monophyletic group with other sister groups, genus Cacatua, C. sanguinea and C. goffini make a sister clade including other congeners, subfamily
Psittacinae supposed to be emerged as unique paraphyletic consisting three clades, members of Loriinae subfamily appeared as monophyletic comprising subclades
Trichoglossus+Eos , Chalcopsitta+Pseudeos and Lorius with Charmosyna placentis as basal sister clade.
Tavares et al. (2006) inferred the nuclear and mitochondrial sequence based historical biogeography and phylogenetic relationships of the 29 species of 25 genera of
Neotropical Parrots (Psittaciformes: Psittacidae: Arini). 6388 bps of Cytb, ND2, RAG1,
ATPase 6, 12S rDNA, ATPase 8, 16s rDNA and COIII were sequenced and phylogeny pattern indicated that allies and amazons are sister clade to the macaws. Penalized likelihood and Bayesian methods estimated thatNeotropical parakeets communal a mutual ancestor with the Australian parakeets and these ancestral parrots were pervasively spread in Gondwanaland.
------26------
------REVIEW OF LITERATURE
Melo and Colleen (2007) worked on population genetic based evolutionary dynamics of two different Islands‟ parrots. Their study included 17 samples from
P.erithacus and 13 from P.timmeh. Their findings depicted that these two independent lineages of two different regions diverged almost upto 2.4 million years back. Mode of divergence of heavily harvested Principle Island population is allopatric. To conduct this study they utilized mitochondrial D-loop and Cytb regions. Their study is additional advocation of dynamic potential of mitochondrial loci to address the evolutionary questions and their implication in conservation.
Wright et al. (2008) utilized multilocus molecular phylogeny of the parrots
(psittaciformes) to define the pattern of origin on Gondwanan during cretaceous.
Extensive sampling of 69 extant and 8 outgroup texa was done. 3941 base pair region of two mitochondrial COI and ND2 loci and nuclear tropomyosin α-subunit intron 5, rhodopsin intron 1, transforming growth factor beta-2 was sequenced to generate the phylogenyof Psittaciformes. Bayesian, maximum parsimony and maximum likelihood criteria constructed phylogenetic trees. Trees depict that Nestor (Psittacidae) and New
Zealand taxa Strigops were sister clade to other psittaciforms and cockatoo (Cacatuidae) was sister clade to remaining parrots (Psittacidae). These trees also elucidated that within large clade of Psittacidae, there are some traditionally recognized monophyletic tribes and subfamilies like Loriinae, Arini and Psittacini whereas Psittacinae, Cyclopsittacini,
Psittaculini, Platycercini were polyphyletic. Parrot diversification timing analyses indicated agreement between their diversification, geologic distribution and support the hypothesis of Cretaceous Psittaciformes origin in Gondwana after partitioning of India-
------27------
------REVIEW OF LITERATURE
Madagascar and Africa with successive Psittaciform diversification through both dispersal and vicariance.
Eisermann (2003) studied the endemic of Yellow-headed Amazona oratrix on
Guatemala Atlantic coast (mangrove and palm forest). They highlighted that amazon population continuously decline and extinction is facing by population due to illegal trade and nest robbing. They suggested that in order to conserve Yellow-headed oratrix nest robbing should be control.
Eberhard and Bermingham (2005) evaluated the phylogenetic relationships among the Amazona-ochrocephala species of parrots. This is widely distributed group in
South and Middle America (taxonomic headache). On the basis of mtDNA phylogeny middle American subspecies were reciprocally monophyletic but South American subspecies do not exhibit any genetic variation. Subspecies of complex were found more similar than Amazona species and further three divisions (A. auropalliata, A. oratrix and
A. ochrocephala) are not supported by this study. Divergence date estimated that these species after Panama arrived in Middle America through land bridge and then diversified quickly. During Pleistocene this group spread in the South America.
Schweizer et al. (2010) investigated the local radiations and multiple trans- oceanic dispersal events to define the evolutionary diversification of African taxa. In the modern parrots evolution Vicariance and dispersal have played principle role. Results firmly showed that Madagascar and African Agapornis found sister group of Indo-
Malayasian and Australasian Loriculusof and grouped with Australasian Cyclopsittacini,
Loriinae and Melopsittacus. On the other hand African Psittacus and Poicephalus formed sister group with Coracopsis and Arini.These geographical associations were best
------28------
------REVIEW OF LITERATURE clarified by African independent colonization via trans-oceanic translocation and dispersal from Antarctica and Australasia in early Paleogene and late Cretaceous. In the wide range expansion of parrots in new continents taxon plus model of diversification and trans-oceanic dispersal played vital role.
Urantowka et al. (2013) worked on endangered Rhynchopsitta terrisi (Maroon fronted Parrot) and Rhynchopsitta pahyrchyncha (Thick-billed Parrot) of north eastern
Mexico forests. Morphologically and behavior wise R. terrisi and R. pachyrhyncha were separate species but according to some taxonomists there are conjecture based on conspecific characters. Urantowka with their coworkers tried to resolve this dispute by getting aid of full mitochondrial genome sequencing of R. terrisi followed by mitochondrial ND2 gene based phylogenetic analysis of R. terrisi, R. pahyrchyncha and other tribe Arini species. According to them in contrast to the conventional classification both R. terrisi and R. pachyrhyncha should be considered as subspecies of taxa
Rhynchopsitta.
Eberhard and Bermingham (2005) worked on comparative biogeography and
Phylogeny of Pteroglossus toucansand Pionopsitta parrots. Zonal endemism and distribution of Neotropical bird‟s investigations well explained the species diversity in
Neotropic areas. In this study mitochondrial gene based phylogeny reconstruction at species level was done. Mitochondrial COI, Cytb and ATPase 6, 8 genes of family
Psittacidae and Ramphastidaewere sequenced to determine the absolute lineage timing and geographic divergences. Phylogenies ofPteroglossus and Pionopsitta clearly supported the area relationship hypothesis which stated that divergence of Atlantic Forest region is endemism followed by cis- trans Andean regions divergence and splitting
------29------
------REVIEW OF LITERATURE between Amazon basin. After that diversification proceeds to Guyana and finally taxa diversification in the upper basin of Amazon. In addition to these phylogenies also advocated the high vagility species area relationship proposed by the Prum and agreement on account of relative time Vicariance events. By usingavian mitochondrial clock calibration absolute time of divergence was calculated, showed that diversification of both genera started before the Pleistocene and environmental factors do not alone drive the taxa diversification.
Faria et al. (2007) investigated nuclear and mitochondrial loci based population structure and genetic variation of endangered Macaw (Anodorhynchus hyacinthinus) and their conservation. Estimated Macaw population in Brazil was 6500 specimens accounting for one of the 14 endangered species of Psittacidae family. Minisatellites, microsatellites and 472 base pair mitochondrial control region were utilized to characterize genetic variability levels and gene flow of Pantanal de Miranda, Pantanal do
Abobral and Piauí nesting sites. Results showed that Macaws have comparatively low genetic variations. Miranda and Abobral population are genetically far distant as compared to piauíans individuals due to interbreeding. Analysis of these specimens revealed that Pantanal is actually not site for illegal trade of avian species, but still their exact origin is not cleared. In addition to these environmental factors like nest poaching and natural habitat destruction negatively affect wild populations. The detected genetic structure highlights the prerequisite of protection and conservation of different regional
Hyacinth Macaws to maintain genetic diversity of this species.
Russello et al. (2010) studied themitochondrial control region based population genetic and evolutionary analyses of Bahama parrot. Their findings revealed the unique
------30------
------REVIEW OF LITERATURE distinctiveness of the Inagua, Abaco and Acklins populations based on Bayesian clustering investigations. Demographic genetic signatures were identified on account of
Abaco but not in Inagua. Consistent findings of low genetic based estimated Abaco effective population size with disproportionate impacts of humans on the relative island of Inagua. Overall results suggested that Cuban parrot taxonomy is complex and needs revision to clear the Abaco conservation status and population decline pattern.
Christidis and his coworkers in 2011 tried to resolve the evolutionary associations among the 14 genera and 40 species of Petroicidae by using mitochondrial CO1, ND2 and b-fibrinogen intron 5 genes based phylogeny to elucidate the fashion of ecological diversity and their geographical history. They concluded that Petroicidae (Australasian robins) consist of homogeneous group of Australian originated medium sized insectivorous birds and seven species have colonized in Samoa, New Zealand, Norfolk
Island, Fiji, Vanuatu and New Caledonia. COI, ND2 and b-fibrinogen intron 5 based constructed phylogenetic tree presented the six unique lineages known as Petroicidae subfamilies like (1) Micro-ecinae comprising Microeca, Monachella and Eopsaltria
flaviventris; (2) Pachycephalopsinae comprising Pachycephalopsis; (3) Eopsaltriinae consisting Eopsaltria (excluding E. flaviventris), Tregellasia, Peneothello, Poecilodryas,
Melanodryas and Heteromyias; (4) Drymodinae comprising Drymodes; (5)
Pachycephalopsinae comprising Pachycephalopsis; (6) Petroicinae comprising
Eugerygone and Petroica. Based on branching pattern of phylogenetic tree genera
Poecilodryas, Microeca, Eopsaltria and Peneothello were found paraphyletic. More than one species are found in Eopsaltria australis, Melanodryas cucullata, Tregellasia leucops, Heteromyias albispecularis, Microeca flavigaster and Drymodes supercilious so
------31------
------REVIEW OF LITERATURE this was concluded that Petroicidae display a unique complex bio-geographical history with repeated radiations both across and within New Guinea and Australia.
Masello et al. (2011) worked on genetic structure and gene flow of South
American parrots (Cyanoliseus patagonus) in Argentina and Chile regions. Gene flow is affected by geographical distance and physical barriers. Andes of South American zone faced a barrier to the dispersal. This region also affected by cyclic arid and moist periods.
All these factors subjected as driving force to define phylogeography of vertebrate fauna of this zone. According to their findings Andes parrot species have Chilean origin with single migratory event during Upper and late Pleistocene with extant Argentinean mitochondrial lineages. Findings further revealed that parrot population of Argentinean hybrid zone is more complex as this zone is more stable for thousands years. This zone has also introgression due to expanding haplotypes resulted in intermediate phenotype evolution. Multivariate regressions showedthat climatic variables have close impact on genetic heterogeneity. Conclusively zonal environmental factors presented constrains in colonization of new habitats and drive population divergence and genetic structure.
Kundu et al. (2012) studied the Indian Psittaciformes evolution in term of adaptive radiation, extinction and eustacy. Parrots are most striking and widely distributed tropical avian species. Avifauna of tropical areas like India and its periphery is interesting as harboring high heterogeneity and degree of speciation. Islands of Indian
Ocean found to be stepping stones regarding Old World parrots radiations as fluctuation in sea level is a prime determinant of the current distributions of parrots and speciation.
Multi locus phylogeny demonstrated the monotypic phylogeny of Psittrichas with common ancestor and geographically far distant Coracopsis. Molecular phylogeny based
------32------
------REVIEW OF LITERATURE high level speciation indicated extensively complex radiation pattern including colonization of Asian, Indian Ocean Islands and Africa from the Australasia via multiple migratory route. For this study mitochondrial Cytb gene was selected to resolve the unknown affinities of parrot‟s taxonomy due to following reasons; easy amplification and previous successful attempts to resolve taxonomic conflicts.
Quinteroet al. (2013) described biogeographical and phylogenetic pattern of parrot genus Hapalopsittaca and its deep island sister Pyrilia genus and concluded that
Hapalopsittacagenus cladded within the amazons and their ancestral distribution showed
Pyrilia and Hapalopsittaca was deepland. Museum specimens were also examined to define basal diagnosably discrete taxonomic units. Mitochondrial Cytb and ND2 genes based analysis of 17 individuals, represented the basal taxa with Hapalopsittaca.
Molecular dating estimated that Hapalopsittaca and Pyrilia split occurred between 6.6 and 8.0 Myr showed consistant high and deep land junction advocating the hypothesis of the vicariance due to the Andean uplift. These results proposed that taxonomic unique assembly of montane biotas explained by Earth history rather than by colonization and distance dispersal. This diversification of Hapalopsittaca genus was more recent in time and related to the Pleistocene climatic oscillation that has shown in other montane clades.
Wenner et al. (2012) studied the genetic variation of Neotropical Amazona farinosa parrot cryptic species and its biological conservation. Amazona farinose is found in South and Central America.For this study four mitochondrial and two intronic nuclear genes were utilized to infer association among different species. Two reciprocal mono- phyletic clades were found with strong nodal support. One group comprised of two central American subspecies (virenticeps and guatemalae) and second group including
------33------
------REVIEW OF LITERATURE
South American subspecies (farinosa, inornata and chapmani). Molecular analysis also diagnosed distinct Southern and Central American lineages, with an estimated divergence time of 1.75–2.70 MYS and are separate species. These findings elucidated that Central
American A. farinose are under intense environmental pressure and have need of important conservation implications.
Harrison et al. (2004) studied four avian mitochondrial genomes of avian species for phylogenetic description. They reported four new avian mitochondrial genomes of magpie goose, an owl basal passerine and parrot. According to them magpie goose provides a new calibration point of avian evolution as fossils of Presbyornis are well studied and are positioned on the lineage to geese and ducks. According to RY coding system the root occurs between neognath and paleognath birds. Modern avian species diverged during Cretaceous and passerines found to be an old group in class Neoaves.
Urantowka et al. (2013) sequenced complete mitochondrial genome of South
American parrot specie Aratinga acuticaudata (Blue crowned Parakeet) and ND2 gene based phylography of Conures parrots group. According to their results Aratinga species distributed into three different clades, but did not categorize Blue crowned Parakeet to any of these three clades. Blue crowned Parakeet shared clade with Leptosittaca branickii and Guaruba guarouba species with closest homolog with Diopsittaca nobilis cleared proved the lack of Aratinga genus monophyly.
Aratinga parakeet‟s molecular systematics was studied byRibas and Miyaki
(2004).Parrot species of genus Aratinga can be morphologically separated into three distinct clades. Mitochondrial sequences based phylogenetic analysis of solstitialis group was done with following objectives; (1) species status clarification on the basis of genetic
------34------
------REVIEW OF LITERATURE differences; (2) establishment of phylogenetic positioning of genus Aratinga members followed by monophyly testing; (3) Neotropics geographical and temporal diversification pattern investigations. Results of this study showed that three clades of Aratinga solstitialis were complex and diagnosable phylogenetic species. Genus Nandayus found to be monotypic in solstitialis group and Aratinga were non monophyly. Environmental fluctuations like climate oscillation were responsible to habitat shifting during
Pleistocene and Pliocene leads to speciation.
Russello and George in2004worked on molecular phylography of genus Amazona to define the taxonomy, biogeography and conservation ofNeotropical parrot species.
Amazon parrots are most imperiled and recognizable of all avian species. In this study evolutionary hypothesis of Amazona genus was investigated by using three nuclear
(TROP, RP40 and β-fibint7) and three mitochondrial (12S, 16S and COI) genes. The results showed that species of Amazona genus is not monophyletic and is sister of
Neotropical short tailed parrot. Antillean endemic Amazona species including Central
American A.albifrons constitute monophyletic.
------35------
Chapter 3
MATERIALS AND METHODS
The present study was designed for molecular characterization of Pakistani pigeons and parrots using mitochondrial markers. The work was conducted at Molecular
Biology and Genomics Laboratory, Institute of Biochemistry and Biotechnology,
University of Veterinary and Animal Sciences, Lahore.
Selection of birds:
Four pigeon breeds [Sherazi, Lucky, Rock and Lathy Rock (Fig. 3.7-3.10)] and two parrot species [Raw and Kathy (Fig. 3.11-3.12)] were selected for this study. Twenty five unrelated birds were selected from each pigeon breed and Kathy parrot species whereas 10 birds were selected for Raw parrot. Selection of birds was purely based on phenotypic characteristics. Sampling was done from various cities of Pakistan (Fig. 3.1-
3.6).
Collection of blood samples:
Bird‟s name and code was written on the side & lid of 1.5mL tube containing ethylenediamine tetra acetic acid (EDTA), as an anticoagulant. One quarter of a mL (0.25 mL) blood sample from each bird was collected aseptically from the brachial vein into
1.5mL tube containing 25μL (0.5M) EDTA. After collection tubes were inverted up and down many times for complete mixing of anticoagulant and bloodto prevent blood clotting.
------36------MATERIALS AND METHODS
Storage of blood samples:
After collection of blood, each sample was stored in an ice box and brought to laboratory for molecular investigations. After reaching the laboratory, a list of all samples was prepared. This included bird‟s identity, date and location of sampling. The samples were then stored at -20°C.
Fig. 3.1: Map of Pakistan showing the selected areas for the sampling of Sherazi Pigeon. The figure was modified from http://www.mapsofworld.com (16-12-2013).
------37------
------MATERIALS AND METHODS
Fig. 3.2: Pakistan map showing the selected areas for the sampling of Lucky Pigeon. The figure was modified from http://www.mapsofworld.com (16-12-2013).
------38------
------MATERIALS AND METHODS
Fig. 3.3: Pakistan map showing the selected areas for the sampling of Rock Pigeon. The figure was modified from http://www.mapsofworld.com (16-12-2013).
------39------
------MATERIALS AND METHODS
Fig. 3.4: Pakistan map showing the selected areas for the sampling of Lathay Rock Pigeon. The figure was modified from http://www.mapsofworld.com (16-12-2013).
------40------
------MATERIALS AND METHODS
Fig. 3.5: Pakistan map showing the selected areas for the sampling of Rose-ringed Parakeet (Kathy Parrot). The figure was modified from http://www.mapsofworld.com (16-12- 2013).
------41------
------MATERIALS AND METHODS
Fig. 3.6: Pakistan map showing the selected areas for the sampling of Alexandrine Parakeet (Raw Parrot). The figure was modified from http://www.mapsofworld.com (16-12- 2013).
------42------
------MATERIALS AND METHODS
Fig 3.7: Sherazi Pigeon: Unique characteristic are white head with brown spots, dark shiny dense neck and light brown feathers.
------43------
------MATERIALS AND METHODS
Fig 3.8: Lucky Pigeon: Unique characteristic fantail feathers and muffed feet.
------44------
------MATERIALS AND METHODS
Fig 3.9: Rock Pigeon: Unique characteristic are light and dark gray feathers and radish iris color.
------45------
------MATERIALS AND METHODS
Fig 3.10: Lathy Rock Pigeon: unique characteristic are light and dark gray feathers and yellowish iris color.
------46------
------MATERIALS AND METHODS
Fig 3.11: Rose Ringed Parakeet: Unique characteristic are dark red curved beak and plain green shoulders.
------47------
------MATERIALS AND METHODS
Fig 3.12: Alexandrine Parakeet: Red patched shoulders are unique characteristic.
------48------
------MATERIALS AND METHODS
DNA Extraction:
DNA was extracted by the standard organic method (Sambrook and Russell, 2001).
Before DNA extraction blood samples were frozen at -80 °C for 30 min.
The step wise procedure for extraction of DNA was as follow:
1) About 0.25 mL of blood was taken in 1.5 mL mico- centrifugation tube.
2) One-and-a half ml TE lysis buffer (Tris HCl 10 mM, pH 8.0; EDTA 2 mM) was
added for the pelleting of blood cells.
3) The tube was centrifuged at 3000 rpm for 15 minutes.
4) The supernatant was discarded to get the pellet.
5) The pellet was suspended in 100 µl TNE buffer (Tris HCl 10 mM, pH 8.0; NaCl
400 mM; EDTA 2 mM), 20 µl proteinase K (MBI, Fermentas, Vilnius,
Lithuania) and 60 ul 10 % SDS.
6) The mixture was incubated at 37 oC overnight in shaking incubator.
7) Following overnight incubation, phenol chloroform isoamyle alcohol (PCI)
mixture (25:24:1) was added in equal amount and contents were gently
emulsified by inversion.
8) The mixture was centrifuged at 3000 rpm for 15 minutes.
9) Three layers were formed; lower layer containing phenol & proteins and upper
aqueous layer containing DNA. In between these two layers there was a whitish
layer of proteins. Upper aqueous phase containing DNA was transferred to a
fresh 1.5 mL eppendorf tube.
------49------
------MATERIALS AND METHODS
10) Absolute isopropanol was added in equal amount of supernatant to precipitate
the DNA. Mixture was mixed at room temperature for 1-2 minutes, followed by
centrifugation at 3000 rpm for 2 minutes.
11) Supernatant was removed and DNA pellet was washed with 100 % pre-chilled
ethanol.
12) Mixture was spun down at 5000 rpm for 2 minutes.
13) Ethanol was decanted and let the pellet dry.
14) DNA was dissolved in TE buffer (10 mM Tris, pH 8.0; 0.2 mM EDTA) and
heated at 70°C for 1 hour to inactivate any remaining nucleases.
DNA Quantification:
DNA quantification was done with the help of Nanodrop (Thermoscientific,
Wilmington, USA). All DNA samples were adjusted at same concentration (50
ng/µl).
Primer designing:
For the full length amplification of selected mitochondrial genes following sets of
primers (Table 3.1) were designed using full mitochondrial genomeas reference
sequences for pigeon and parrot, respectively. The web based software Primer3
(http://wwwgenome.wi.mit.edu/cgi-bin/primer/primer3 www.cgi) was utilized for
primer designing.
------50------
------MATERIALS AND METHODS
Table 3.1: List of Primer sequences
Sr. No Primer Name 5’-3’ Sequence Anealing Temperature (oC) Primers used for the amplification of Cytb gene of pigeon
1. ACyt-1F CTCTATCCATTCTCATCAT 56
2. ACyt-1R CGAGCGGCAAACTCTAAGAAG
Primers used for the amplification of D-loop gene of pigeon
3. ADL-1F GGCGGGCACATTGGTTTATA 59
4. ADL-1R TGGCGTCTTCAGTGCCATGC
Primers used for the amplification of ND2 gene of pigeon
5. AND-1F AAAGCTATCGGGCCCATACC 55
6. AND-1R GCTGCTGAGGAGATAGCCAT
7. AND-2F ATGGCTATCTCCTCAGCAGC 54
8. AND-2R TCTTAAAGGGTTGTGAGAA
Primers used for the amplification of Cytb gene of parrot
9. PCyt-1F TCCTCCGCACTATCAATCCT 53.5
10. PCyt-1R ATGCAAATAGGAAATACCATTC
Primers used for the amplification of ND2 gene of parrot
11. ND2-1F CATACCCCGAAAATGATGGT 55
12. ND2-1R GTTGGGAGGGAGTGTGATTG
------51------
------MATERIALS AND METHODS
Optimization of PCR conditions:
For the amplification of mitochondrial genes PCR conditions were optimized by varying concentration of divalent ion Mg2+ DNA, primers and Taq polymerase in PCR reactions for different temperature profiles. The PCR products were analyzed by agarose gel.
Briefly, the PCR product concentrated with gel loading dye (bromophenol blue) was resolved on TAE-dissolved 1-3% DNA grade agarose mixed with ethidium bromide along with molecular weight marker on 120 volts electric supply in gel electrophoresis equipment. The products were illuminated on UV-transilluminator or in gel documentation system to evaluate the primer optimization.Mitochondrial genes amplification was performed in a 25 µL reaction with the composition as shown in Table.
Table 3.2: PCR Reaction Composition
Reagents Volume (µl)
DNA 50 ng/µl 1.0
PCR Buffer (10X) 2.5 dNTPs (25 mM) 2.5
MgCl2 (20 mM) 2.5
Primers (10 ρmol) Forward Reverse
0.75 0.75
Taq polymerase 5 U/µl 0.3 ( MBI, Fermentas, Vilnius, Lithuania) Distilled water 14.70
Total Volume 25
------52------
------MATERIALS AND METHODS
Table 3.3: PCR protocols
Step Temperature Time
Initial Denaturation 95oC 5 min
1. Denaturation 94oC 45 sec
2. Annealing 60oC 45 sec
3. Extension 72oC 1 min Repeat step1 to 3 for 35 cycles Final extension 72oC 10 min
Precipitation of amplicons for sequencing:
Amplicons were run on 1.2% agarose gel followed by precipitation.
Following protocol was used for precipitation;
1) Full volume of amplicon and 100 µl 80% ethanol were poured in 1.5 mL tube.
2) Mixture was placed in dark for 1 hr.
3) Dark placed incubated mixture was subjected to centrifugation at 5000 rpm for 15
minutes.
4) Supernatant was discarded and let the pellet dry.
5) Dried pellet was dissolved in nuclease free water.
------53------
------MATERIALS AND METHODS
Sequencing of the PCR products:
Precipitated PCR products were subjected to sequencing using dye-labeled dideoxy terminator cycle sequencing using ABI prism 3130 XL Genetic Analyzer (Applied
Biosystems, Inc., Foster City, CA) following standard protocol.
The following reagents were used
Table 3.4: PCR Reaction Composition for sequencing products
Reagents Volume Diluted DNA 6 µl
Big dye sequencing mix 2 µl
Primer 1 µl
5x buffer 1 µl
Total 10 µl
Table 3.5: PCR cycle for sequencing products
Step Temperature Time Initial denaturation 95 0C 1 min
1. Denaturation 96 0C 30 sec
2. Annealing 50 0C 15 sec
3. Extension 60 0C 4 min
Repeat step 1 to 3 for 35 cycles
Final extension 60 0C 5 min
------54------
------MATERIALS AND METHODS
Figure 3.13: Temperature profile for sequencing PCR
Precipitation of sequencing products:
PCR products after sequencing reactions were precipitated with ethanol. 40 µL of 75% ethanol was added to each 10 µL reaction, to a final concentration of 60%. The reactions were vortex mixed using vortex and left for precipitation at room temperature for 20 minutes. These were then centrifuged at 14,000 rpm for 20 minutes at 4 0C. The supernatant was discarded by inverting the tube. The pellets were washed with 100 µL of
70% ethanol and after discarding the ethanol, the pellets were dried. Pellets were then dissolved in 15 µL of deionized formamide, denatured at 95 0C for 5 minutes and quick chilled by placing in ice for 5 minutes before loading on the ABI PRISM 3130 Genetic
Analyzer according to the manufacturer‟s instructions given in the technical manuals.
After each run, the samples were analyzed using the ABI PRISM sequencing analysis software version 3.7
------55------
------MATERIALS AND METHODS
Bioinformatics Analysis:
Sequences were analyzed manually using Chromas software version (V1.45) and comparative analysis was done using Chromas software version 2.2.10. Clustal W software (http://www.genome.jp/tools/clustalw/) was used for homology analysis and pairwise alignments. FASTA (Pearson) Format was used to generate the sequence input file. To get the graphical description of sequence alignment Java; Version 7 was used.
The Basic Local Alignment Search Tool (BLASTn) was also used for similarity analysis. Megablast was optimized with nucleotide collection “nr/nt” database.
Aligned nucleotide sequences were imported to Expasy Bioinformatics Resource
Portal (http://web.expasy.org.translate) for nucleotide translation. Vertebrate‟s mitochondrial genetic codes were employed for nucleotide translation.
Molecular Evolutionary Genetics Analysis (MEGA, V 5.0, Tamura et al. 2011) was used to estimate the evolutionary distances between sequences by computing the of nucleotide differences between each pair of sequences. To construct the phylogenetic trees NCBI distance tree matrix was employed. The cluster analysis was carried out using PoPgene software (version 1.31, Yeh et al. 1998) based on Nei‟s Unweighted
Paired Group of Arithmetic Means Average (UPGMA). Similarity matrix was determined by using BioEdit (V.7.0). The gene sequences were submitted to GenBank using Sequin Submission Portal.
------56------
------RESULTS
Chapter 4
RESULTS
Genetic and Evolutionary Characterization of Pakistani Pigeon breeds
using Cytb, D-loop and ND2 genes
Cytb (1.267 kb), D-loop (0.95 kb) and ND2 (1.040 kb) genes of Sherazi, Lucky, Rock and Lathy Rock pigeons were amplified. These three genes showed conserved private alleles in all Pakistani pigeon breeds which can be employed for Pakistani pigeon breed identification. Cytb gene analysis demonstrated that positions T174A, C232T, G261A has unique polymorphisms was declared as private alleles. Cytb gene based inter breed differentiation can be done on the basis of 582, 703 and 815 positions. D-loop analysis showed that addition of T at positions 1132, 1243, 1255, 1288, 1309 and 1343 is conserved in all Pakistani pigeon breeds. In ND2 gene sequences nucleotide positions
C202G and C722A were found private alleles for Pakistani pigeon breeds; in addition to these, nucleotide positions 219, 724 and 818 were found important for inter breed discrimination.
Cytb, D-loop and ND2 genes based phylogenetic analysis showed that all Pakistani pigeon breeds shared the same clade with Columba rupestris and C. livia.
C. livia was found to be immediate ancestor of Pakistani domestic pigeons and C. rupestris was found deep ancestor of both C. livia and Pakistani domestic pigeon breeds.
------57------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Sherazi
Pigeon Breed using Cytb Gene
------58------
------RESULTS
PCR Amplification of Cytb Gene of Sherazi Pigeon
1.267kb
1.267kb
Fig.4.1: PCR Amplification of Cytb Gene Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of Cytb Gene isolated from Pakistani Sherazi Pigeons
------59------
------RESULTS
Cytb Gene Sequence Analysis of Sherazi Pigeon
Atggcccccgatctacgaaaataccaccctctactaaaaataatcaataactccctaatc 60 M A P D L R K Y H P L L K M I N N S L I Gacctaccaaccccctcaaacatctccgcctgatggaactttgggtccctactaggcatt 120 D L P T P S N I S A W W N F G S L L G I Tgcttgctaactcaaatcctaaccggcttactactcgccgcacattacactgcagacacc 180 C L L T Q I L T G L L L A A H Y T A D T Accctagccttttcatccgttgcacacacatgccgaaacgtacagtacggctggctaatc 240 T L A F S S V A H T C R N V Q Y G W L I Cgaaacctccatgcaaacggagcctcatttttcttcatctgtatttacctacacatcgga 300 R N L H A N G A S F F F I C I Y L H I G Cgaggactctactacggatcctacctctacaaagagacttgaaacacaggagtcgtcctc 360 R G L Y Y G S Y L Y K E T W N T G V V L Ctactaacccttatagccactgcattcgtaggatatgtcctaccctgaggacaaatatca 420 L L T L M A T A F V G Y V L P W G Q M S Ttctgaggagctacagtcattaccaatctattctcagctgtcccctacattggccaaacc 480 F W G A T V I T N L F S A V P Y I G Q T Ctcgttgaatgagcctgaggcggattttccgtagataaccctacattaacacgattcttc 540 L V E W A W G G F S V D N P T L T R F F Acccttcacttcctcctcccctttataatcgcaggcctcactatcatccacctcaccttc 600 T L H F L L P F M I A G L T I I H L T F Ctgcacgaatcaggctcaaacaacccactaggcatcacctccaactgcgataaaatccca 660 L H E S G S N N P L G I T S N C D K I P Ttccacccctacttctccctaaaagacatcctcggcttcatgataatactcctcccccta 720 F H P Y F S L K D I L G F M M M L L P L Atgaccctagccctattctcccccaaccttctaggagacccagaaaacttcacgcctgca 780 M T L A L F S P N L L G D P E N F T P A Aaccctctagttacacctccccatatcaaaccagagtgatacttcctattcgcatacgcc 840 N P L V T P P H I K P E W Y F L F A Y A Atcctacgctccatccccaataaactaggcggagtactagccttagccgcctcagtacta 900 I L R S I P N K L G G V L A L A A S V L Attctattcctcacccccctactccacaagtccaaacaacgcacaataatcttccgccca 960 I L F L T P L L H K S K Q R T M I F R P Ctctctcaactcctattctgaatcctagtcaccaacctccttatcctaacatgagttgga 1020 L S Q L L F W I L V T N L L I L T W V G Agccaacctgtagaacaccccttcatcattatcggccaactagcctccctcacctacttc 1080 S Q P V E H P F I I I G Q L A S L T Y F Accatcctccttgtcctcttccctgctaccgcagccctagaaaacaaactacttaactac 1140 T I L L V L F P A T A A L E N K L L N Y Taa 1143 -
Fig.4.2: Nucleotide sequence of Cytb Gene of Sherazi along with its deduced amino acid sequences
------60------
------RESULTS
Phylogenetic Analysis of Sherazi Pigeon
Homology analysis of Sherazi with already reported C. livia sequence
(GQ240309.1) divulged 5 novel single nucleotide polymorphic sites in Cytb gene of the
Pakistani Sherazi pigeon (Table 4.1). The Cytb gene sequences of the Sherazi pigeon were submitted to NCBI GenBank under the accession no. JX968124-JX968148.
Table 4.1: SNPs found in the Cytb Gene of Sherazi Pigeon
No. Allele Base position Rock Pigeon Pakistani Sherazi Pigeon 1 T/A 174 T A 2 C/T 232 C T 3 G/A 261 G A 4 C/T 582 C T 5 G/A 703 G A
------61------
------RESULTS
Fig. 4.3: Phylogenetic Tree of Cytb Gene of Sherazi Pigeon with available Columbiformes showing the molecular classification of the Sherazi Pigeon
------62------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Lucky
Pigeon Breed using Cytb Gene
------63------
------RESULTS
PCR Amplification of Cytb Gene of Lucky Pigeon
1.267kb
1.267kb
Fig. 4.4: PCR Amplification of Cytb gene of Lucky Pigeon Lane M: Marker 1kb SM0313 (Fermentas)
Lane 1-25: Amplified fragments of Cytb gene isolated from Pakistani Lucky pigeons
------64------
------RESULTS
Cytb Gene Sequence Analysis of Lucky Pigeon
Atggcccccgatctacgaaaataccaccctctactaaaaataatcaataactccctaatc 60 M A P D L R K Y H P L L K M I N N S L I Gacctaccaaccccctcaaacatctccgcctgatggaactttgggtccctactaggcatt 120 D L P T P S N I S A W W N F G S L L G I Tgcttgctaactcaaatcctaaccggcttactactcgccgcacattacactgcagacacc 180 C L L T Q I L T G L L L A A H Y T A D T Accctagccttttcatccgttgcacacacatgccgaaacgtacagtacggctggctaatc 240 T L A F S S V A H T C R N V Q Y G W L I Cgaaacctccatgcaaacggagcctcatttttcttcatctgtatttacctacacatcgga 300 R N L H A N G A S F F F I C I Y L H I G Cgaggactctactacggatcctacctctacaaagagacttgaaacacaggagtcgtcctc 360 R G L Y Y G S Y L Y K E T W N T G V V L Ctactaacccttatagccactgcattcgtaggatatgtcctaccctgaggacaaatatca 420 L L T L M A T A F V G Y V L P W G Q M S Ttctgaggagctacagtcattaccaatctattctcagctgtcccctacattggccaaacc 480 F W G A T V I T N L F S A V P Y I G Q T Ctcgttgaatgagcctgaggcggattttccgtagataaccctacattaacacgattcttc 540 L V E W A W G G F S V D N P T L T R F F Acccttcacttcctcctcccctttataatcgcaggcctcactatcatccacctcaccttc 600 T L H F L L P F M I A G L T I I H L T F Ctgcacgaatcaggctcaaacaacccactaggcatcacctccaactgcgataaaatccca 660 L H E S G S N N P L G I T S N C D K I P Ttccacccctacttctccctaaaagacatcctcggcttcatgataatactcctcccccta 720 F H P Y F S L K D I L G F M V M L L P L Atgaccctagccctattctcccccaaccttctaggagacccagaaaacttcacgcctgca 780 M T L A L F S P N L L G D P E N F T P A Aaccctctagttacacctccccatatcaaaccagaatgatacttcctattcgcatacgcc 840 N P L V T P P H I K P E W Y F L F A Y A Atcctacgctccatccccaataaactaggcggagtactagccttagccgcctcagtacta 900 I L R S I P N K L G G V L A L A A S V L Attctattcctcacccccctactccacaagtccaaacaacgcacaataatcttccgccca 960 I L F L T P L L H K S K Q R T M I F R P Ctctctcaactcctattctgaatcctagtcaccaacctccttatcctaacatgagttgga 1020 L S Q L L F W I L V T N L L I L T W V G Agccaacctgtagaacaccccttcatcattatcggccaactagcctccctcacctacttc 1080 S Q P V E H P F I I I G Q L A S L T Y F Accatcctccttgtcctcttccctgctaccgcagccctagaaaacaaactacttaactac 1140 T I L L V L F P A T A A L E N K L L N Y Taa 1143 -
Fig 4.5: Nucleotide sequence of Cytb Gene of Lucky Pigeon along with its deduced amino acid sequences
------65------
------RESULTS
Phylogenetic Analysis of Lucky Pigeon
The nucleotide sequences were utilized for homology comparison and phylogenetic tree construction. Homology analysis of Lucky pigeon with already reported C. livia sequence (GQ240309.1) divulged 6 novel single nucleotide polymorphic sites in Cytb gene of the Pakistani Lucky pigeon (Table 4.2). The Cytb gene sequences of the Lucky pigeons were submitted to NCBI GenBank under the accession no.
KC675192- KC675212
Table 4.2: SNPs found in the Cytb Gene of Lucky Pigeon
Sr.No. Allele Base position Rock Pigeon Pakistani Lucky Pigeon
1 T/A 174 T A
2 C/T 232 C T
3 G/A 261 G A
4 C/T 582 C T
5 G/A 703 G A
6 G/A 815 G A
------66------
------RESULTS
Fig 4.6: The phylogeny based on the Cytb Gene sequences of Columbiformes indicating the phylogeny of the Lucky Pigeon
------67------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Lathy Rock
Pigeon Breed using Cytb Gene
------68------
------RESULTS
PCR Amplification of Cytb Gene of Lathy Rock
1.267kb
1.267kb
Fig. 4.7: PCR Amplification of Cytb Gene of Lathy Rock Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of Cytb Gene isolated from Pakistani Lathy Rock Pigeons
------69------
------RESULTS
Cytb Gene Sequence Analysis of Lathy Rock
Atggcccccgatctacgaaaataccaccctctactaaaaataatcaataactccctaatc 60 M A P D L R K Y H P L L K M I N N S L I Gacctaccaaccccctcaaacatctccgcctgatggaactttgggtccctactaggcatt 120 D L P T P S N I S A W W N F G S L L G I Tgcttgctaactcaaatcctaaccggcttactactcgccgcacattacactgcagacacc 180 C L L T Q I L T G L L L A A H Y T A D T Accctagccttttcatccgttgcacacacatgccgaaacgtacagtacggctggctaatc 240 T L A F S S V A H T C R N V Q Y G W L I Cgaaacctccatgcaaacggagcctcatttttcttcatctgtatttacctacacatcgga 300 R N L H A N G A S F F F I C I Y L H I G Cgaggactctactacggatcctacctctacaaagagacttgaaacacaggagtcgtcctc 360 R G L Y Y G S Y L Y K E T W N T G V V L Ctactaacccttatagccactgcattcgtaggatatgtcctaccctgaggacaaatatca 420 L L T L M A T A F V G Y V L P W G Q M S Ttctgaggagctacagtcattaccaatctattctcagctgtcccctacattggccaaacc 480 F W G A T V I T N L F S A V P Y I G Q T Ctcgttgaatgagcctgaggcggattttccgtagataaccctacattaacacgattcttc 540 L V E W A W G G F S V D N P T L T R F F Acccttcacttcctcctcccctttataatcgcaggcctcaccatcatccacctcaccttc 600 T L H F L L P F M I A G L T I I H L T F Ctgcacgaatcaggctcaaacaacccactaggcatcacctccaactgcgataaaatccca 660 L H E S G S N N P L G I T S N C D K I P Ttccacccctacttctccctaaaagacatcctcggcttcatgataatactcctcccccta 720 F H P Y F S L K D I L G F M M M L L P L Atgaccctagccctattctcccccaaccttctaggagacccagaaaacttcacgcctgca 780 M T L A L F S P N L L G D P E N F T P A Aaccctctagttacacctccccatatcaaaccagaatgatacttcctattcgcatacgcc 840 N P L V T P P H I K P E W Y F L F A Y A Atcctacgctccatccccaataaactaggcggagtactagccttagccgcctcagtacta 900 I L R S I P N K L G G V L A L A A S V L Attctattcctcacccccctactccacaagtccaaacaacgcacaataatcttccgccca 960 I L F L T P L L H K S K Q R T M I F R P Ctctctcaactcctattctgaatcctagtcaccaacctccttatcctaacatgagttgga 1020 L S Q L L F W I L V T N L L I L T W V G Agccaacctgtagaacaccccttcatcattatcggccaactagcctccctcacctacttc 1080 S Q P V E H P F I I I G Q L A S L T Y F Accatcctccttgtcctcttccctgctaccgcagccctagaaaacaaactacttaactac 1140 T I L L V L F P A T A A L E N K L L N Y Taa 1143 -
Fig 4.8: Nucleotide sequence of Cytb Gene of Lathy Rock along with its deduced amino acid sequences
------70------
------RESULTS
Phylogenetic Analysis Cytb gene of Lathy Rock
Sequence homology and phylogenetic analysis was done with the help of NCBI
BLAST and MEGA 4.2 respectively. Homology analysis revealed 5 novel polymorphic
sites in Cytb gene of the Pakistani Lathy Rock pigeon (Table 4.3). Furthermore
phylogenetic tree revealed the clustering of Lathy Rock with the Rock Pigeon and Hill
Pigeon (Fig 4.8) C. rupestris occupied position at node and found to be common ancestor
of clade members ( Lathy Rock and C. livia) and C.livia is most recent ancestor of
Pakistani Lathy Rock pigeon.
Table 4.3: SNPs found in the Cytb gene of Lathy Rock pigeon
Sr. No. Allele Base position Rock Pigeon Pakistani lathy Rock
1 T/A 174 T A
2 C/T 232 C T
3 G/A 261 G A
5 G/A 703 G A
6 G/A 815 G A
------71------
------RESULTS
Fig. 4.9: Phylogenetic tree of Cytb Gene of Lathy Rock Pigeon with available Columbiformes revealed the molecular classification of Pakistani Lathy Rock Pigeons
------72------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Rock
Pigeon Breed using Cytb Gene
------73------
------RESULTS
PCR Amplification of Cytb Gene of Rock Pigeon
1.267kb
N
1.267kb
Fig. 4.10: PCR Amplification of Cytb Gene of Rock Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of Cytb Gene isolated from Pakistani Rock Pigeons Lane 26: Negative control
------74------
------RESULTS
Cytb Gene Sequence Analysis of Rock Pigeon
Atggcccccgatctacgaaaataccaccctctactaaaaataatcaataactccctaatc 60 M A P D L R K Y H P L L K M I N N S L I Gacctaccaaccccctcaaacatctccgcctgatggaactttgggtccctactaggcatt 120 D L P T P S N I S A W W N F G S L L G I Tgcttgctaactcaaatcctaaccggcttactactcgccgcacattacactgcagacacc 180 C L L T Q I L T G L L L A A H Y T A D T Accctagccttttcatccgttgcacacacatgccgaaacgtacagtacggctggctaatc 240 T L A F S S V A H T C R N V Q Y G W L I Cgaaacctccatgcaaacggagcctcatttttcttcatctgtatttacctacacatcgga 300 R N L H A N G A S F F F I C I Y L H I G Cgaggactctactacggatcctacctctacaaagagacttgaaacacaggagtcgtcctc 360 R G L Y Y G S Y L Y K E T W N T G V V L Ctactaacccttatagccactgcattcgtaggatatgtcctaccctgaggacaaatatca 420 L L T L M A T A F V G Y V L P W G Q M S Ttctgaggagctacagtcattaccaatctattctcagctgtcccctacattggccaaacc 480 F W G A T V I T N L F S A V P Y I G Q T Ctcgttgaatgagcctgaggcggattttccgtagataaccctacattaacacgattcttc 540 L V E W A W G G F S V D N P T L T R F F Acccttcacttcctcctcccctttataatcgcaggcctcactatcatccacctcaccttc 600 T L H F L L P F M I A G L T I I H L T F Ctgcacgaatcaggctcaaacaacccactaggcatcacctccaactgcgataaaatccca 660 L H E S G S N N P L G I T S N C D K I P Ttccacccctacttctccctaaaagacatcctcggcttcatggtaatactcctcccccta 720 F H P Y F S L K D I L G F M M M L L P L Atgaccctagccctattctcccccaaccttctaggagacccagaaaacttcacgcctgca 780 M T L A L F S P N L L G D P E N F T P A Aaccctctagttacacctccccatatcaaaccagagtgatacttcctattcgcatacgcc 840 N P L V T P P H I K P E W Y F L F A Y A Atcctacgctccatccccaataaactaggcggagtactagccttagccgcctcagtacta 900 I L R S I P N K L G G V L A L A A S V L Attctattcctcacccccctactccacaagtccaaacaacgcacaataatcttccgccca 960 I L F L T P L L H K S K Q R T M I F R P Ctctctcaactcctattctgaatcctagtcaccaacctccttatcctaacatgagttgga 1020 L S Q L L F W I L V T N L L I L T W V G Agccaacctgtagaacaccccttcatcattatcggccaactagcctccctcacctacttc 1080 S Q P V E H P F I I I G Q L A S L T Y F Accatcctccttgtcctcttccctgctaccgcagccctagaaaacaaactacttaactac 1140 T I L L V L F P A T A A L E N K L L N Y Taa 1143 -
Fig. 4.11: Nucleotide sequence of Cytb Gene of Rock Pigeon along with its deduced amino acid sequences
------75------
------RESULTS
Phylogenetic Analysis Cytb gene of Rock
Sr.No. Allele Base position Rock Pigeon Pakistani Rock Pigeon
1 T/A 174 T A
2 C/T 282 C T
3 G/A 261 G A
5 C/T 582 C T
Table 4.4: SNPs found in the Cytb Gene of Rock Pigeon
------76------
------RESULTS
Phylogenetic Analysis of Cytb Gene of Rock Pigeon
Fig. 4.12: Phylogenetic Analysis of Pakistani Rock Pigeon indicating the evolutionary relation of Pakistani Rock Pigeon with available Columbeformes
------77------
------RESULTS
SNPs in Cytb gene of various Pakistani Pigeon Breeds
Sr.No. Position Reference Sherazi Lucky Rock Lathy Rock
01 113 T A A A A
02 171 C T T T T
03 200 G A A A A
04 251 C T T T C
05 642 G A A G A
06 802 G G A G A
Table 4.5: SNPs in Cytb Gene of various Pakistani Pigeon Breeds
------78------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Sherazi
Pigeon Breed using
D-loop Gene
------79------
------RESULTS
PCR Amplification of D-loop Gene of Sherazi Pigeon
.
0.951kb
0.951kb
Fig 4.13: PCR Amplification of D-loop Gene of Sherazi Pigeon Lane M: Marker 1kb (Fermentas) Lane 1-25: Amplified fragments of D-loop Gene isolated from Pakistani Sherazi Pigeons Lane N: Negative control
------80------
------RESULTS
D-loop Gene Sequence Analysis of Sherazi Pigeon
GGCGGGCACATTGGTTTATATTCTGCACCTAAATTATGCGTTACCAACTA 50 ATCTCGACCTCAGGTACTACTGGCGTTACGGCTTAAAGATAACCGGTATC 100 ACCTTGACACTGATGCACTTTGTCTTCCATAACTCGGCTGGATGTAATGG 150 ATTAAGGACATACAGAGCTTCGCCCGCGAGATGCACCCTTTCGAGCATCT 200 GGTTATGGTGTGTCCGCAAGTACCTACAAATGCTGCATATTAGTGAATGC 250 TCGCAGGACATAAATTTCCACCATTTTACCCTATTTACTTCCTCTAACTT 300 TCTAAGCAACACGGCTAACTTTCAACTAAACACTCAAAATACCGACCCAA 350 AATCTTGTAAATTTCACTTTCTTTTTCTTTTTTTTTTCCTATGATTACCA 400 CTGGAGTTCCATTAATAATTCATCATACGATTCATACGTACGTATGTTAA 450 TCCTCTGACAAACCATTAATAACTCATCAAATTTTTCCATTATTTGTTTG 500 TTGATTTTTTCATCATTCACCCATCTAATATTAACCGAATTTTAGCCACA 550 CTTTTCCCATTTTTCACTCATCAATTGTCCAAAACATTAGACCAATTTAA 600 GCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGTCCAAAACATTA 650 GACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGT 700 CCAAAACATTAGACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCA 750 CCAACTCTTGTCCAAAACATTAGACCAATTTAAGCCGTACAAGTAACCGC 800 CGAAAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAA 850 ACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAAC 900 AAACAAACAAACAAACAC 918
Fig 4.14: Nucleotide sequence of D-loop of Pakistani Sherazi Pigeon. Red highlighted poits are addition of T
------81------
------RESULTS
Phylogenetic Analysis of D-loop Gene of Sherazi Pigeon
Fig. 4.15: Phylogenic tree of D-loop Gene of Sherazi Pigeon indicating the molecular classification of Sherazi Pigeons
------82------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Lucky
Pigeon Breed using
D-loop Gene
------83------
------RESULTS
PCR Amplification of D-loop Gene of Lucky Pigeon
0.951kb
0.951kb
Fig. 4.16: PCR Amplification of D-loop Gene of Lucky Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of D-loop gene isolated from Pakistani Lucky Pigeons Lane 26: Negative control
------84------
------RESULTS
D-loopgene Sequence Analysis of Lucky Pigeon
GGCGGGCACATTGGTTTATATTCTGCACCTAAATTATGCGTTACCAACTA 50 ATCTCGACCTCAGGTACTACTGGCGTTACGGCTTAAAGATAACCGGTATC 100 ACCTTGACACTGATGCACTTTGTCTTCCATAACTCGGCTGGATGTAATGG 150 ATTAAGGACATACAGAGCTTCGCCCGCGAGATGCACCCTTTCGAGCATCT 200 GGTTATGGTGTGTCCGCAAGTACCTACAAATGCTGCATATTAGTGAATGC 250 TCGCAGGACATAAATTTCCACCATTTTACCCTATTTACTTCCTCTAACTT 300 TCTAAGCAACACGGCTAACTTTCAACTAAACACTCAAAATACCGACCCAA 350 AATCTTGTAAATTTCACTTTCTTTTTCTTTTTTTTTTCCTATGATTACCA 400 CTGGAGTTCCATTAATAATTCATCATACGATTCATACGTACGTATGTTAA 450 TCCTCTGACAAACCATTAATAACTCATCAAATTTTTCCATTATTTGTTTG 500 TTGATTTTTTCATCATTCACCCATCTAATATTAACCGAATTTTAGCCACA 550 CTTTTCCCATTTTTCACTCATCAATTGTCCAAAACATTAGACCAATTTAA 600 GCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGTCCAAAACATTA 650 GACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGT 700 CCAAAACATTAGACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCA 750 CCAACTCTTGTCCAAAACATTAAACCAATTTAAGCCGTACAAGTAACCGC 800 CGAAAAAAAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAA 850 ACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAAC 900 AAACAAACAAACAAACAC 918
Fig 4.17: Nucleotide sequence of D-loop Gene of Lucky Pigeon. Red highlighted poits are addition of T
------85------
------RESULTS
Phylogenetic Analysisof D-loop Gene of Lucky Pigeon
Figure 4.18: Phylogenetic tree of D-loop Gene of Pakistani Lucky Pigeon demonstrating the phylogenetic relationship of Lucky Pigeon with available Columbiformes
------86------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Lathy Rock
Pigeon Breed using D-loop Gene
------87------
------RESULTS
PCR Amplification of D-loop Gene of Lathy Rock Pigeon
0.951kb
0.951kb
Fig. 4.19: PCR Amplification of D-loop Gene of Lathy Rock Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of D-loop gene isolated from Pakistani Lathy Rock Pigeons Lane 26: Negative control
------88------
------RESULTS
D-loop Gene Sequence Analysis of Lathy Rock Pigeon
GGCGGGCACATTGGTTTATATTCTGCACCTAAATTATGCGTTACCAACTA 50 ATCTCGACCTCAGGTACTACTGGCGTTACGGCTTAAAGATAACCGGTATC 100 ACCTTGACACTGATGCACTTTGTCTTCCATAACTCGGCTGGATGTAATGG 150 ATTAAGGACATACAGAGCTTCGCCCGCGAGATGCACCCTTTCGAGCATCT 200 GGTTATGGTGTGTCCGCAAGTACCTACAAATGCTGCATATTAGTGAATGC 250 TCGCAGGACATAAATTTCCACCATTTTACCCTATTTACTTCCTCTAACTT 300 TCTAAGCAACACGGCTAACTTTCAACTAAACACTCAAAATACCGACCCAA 350 AATCTTGTAAATTTCACTTTCTTTTTCTTTTTTTTTTCCTATGATTACCA 400 CTGGAGTTCCATTAATAATTCATCATACGATTCATACGTACGTATGTTAA 450 TCCTCTGACAAACCATTAATAACTCATCAAATTTTTCCATTATTTGTTTG 500 TTGATTTTTTCATCATTCACCCATCTAATATTAACCGAATTTTAGCCACA 550 CTTTTCCCATTTTTCACTCATCAATTGTCCAAAACATTAGACCAATTTAA 600 GCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGTCCAAAACATTA 650 GACCAATTTTAAGCCACTCTCCTCATCACCGGCTCACTCACCACTCTTGT 700 CCAAAACATTAGACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCA 750 CCAACTCTTGTCCAAAACATTAGACCAATTTAAGCCACTCTCCTCATCAC 800 CGAAAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAA 850 ACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAAC 900 AAACAAACAAACAAACAC 918
Fig 4.20: Nucleotide sequence of D-loop Gene of Lathy Rock Pigeon. Red highlighted poits are addition of T
------89------
------RESULTS
Phylogenetic Analysis of D-loop Gene of Lathy Rock Pigeon
Fig. 4.21: Phylogenetic tree of D-loop Gene of Lathy Rock Pigeons indicating the molecular classification of Lathy Rock Pigeons
------90------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Rock
Pigeon Breed using D-loop Gene
------91------
------RESULTS
PCR Amplification of D-loop Gene of Rock Pigeon
0.951kb
0.951kb
Fig. 4.22: PCR Amplification of D-loop Gene of Rock Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of D-loop Gene isolated from Pakistani Rock Pigeons Lane 26: Negative control
------92------
------RESULTS
D-loop Gene Sequence Analysis of Rock Pigeon
GGCGGGCACATTGGTTTATATTCTGCACCTAAATTATGCGTTACCAACTA 50 ATCTCGACCTCAGGTACTACTGGCGTTACGGCTTAAAGATAACCGGTATC 100 ACCTTGACACTGATGCACTTTGTCTTCCATAACTCGGCTGGATGTAATGG 150 ATTAAGGACATACAGAGCTTCGCCCGCGAGATGCACCCTTTCGAGCATCT 200 GGTTATGGTGTGTCCGCAAGTACCTACAAATGCTGCATATTAGTGAATGC 250 TCGCAGGACATAAATTTCCACCATTTTACCCTATTTACTTCCTCTAACTT 300 TCTAAGCAACACGGCTAACTTTCAACTAAACACTCAAAATACCGACCCAA 350 AATCTTGTAAATTTCACTTTCTTTTTCTTTTTTTTTTCCTATGATTACCA 400 CTGGAGTTCCATTAATAATTCATCATACGATTCATACGTACGTATGTTAA 450 TCCTCTGACAAACCATTAATAACTCATCAAATTTTTCCATTATTTGTTTG 500 TTGATTTTTTCATCATTCACCCATCTAATATTAACCAAATTTTAGCCACA 550 CTTTTCCCATTTTTCACTCATCAATTGTCCAAAACATTAGACCAAATTTA 600 GCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGTCCAAAACATTA 650 GACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCACCAACTCTTGT 700 CCAAAACATTAGACCAATTTAAGCCACTCTCCTCATCACCCGCTCACTCA 750 CCAACTCTTGTCCAAAACATTAGACCAATTTAAGCCGTACAAGTAACCGC 800 CGAAAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAA 850 ACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAAC 900 AAACAAACAAACAAACAC 918
Fig 4.23: Nucleotide sequence of D-loop of Rock Pigeon. Red highlighted poits are addition of T
------93------
------RESULTS
Phylogenetic Analysis of D-loop Gene of Rock Pigeon
Fig. 4.24: Phylogenetic tree of D-loop of Rock Pigeon indicating the evolutionary relationship of Pakistani Rock Pigeons with available Columbiformes
------94------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Sherazi
Pigeon Breed using ND2 Gene
------95------
------RESULTS
PCR Amplification of ND2 Gene of Sherazi Pigeon
0.541kb
A
0.541kb
0.574kb B
0.574kb
Fig 4.25: PCR Amplification of ND2 Gene of Sherazi Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of ND2 Gene isolated from Pakistani Sherazi Pigeons Lane 26: Negative control
------96------
------RESULTS
ND2 Gene Sequence Analysis of Sherazi Pigeon
Atgaacccacacgccatattagtttcaaccctaagcctactcttaggaacaaccatcacc 60 M N P H A M L V S T L S L L L G T T I T Atttcaagcaaccactgggtcatagcttgaaccggactagaaattaacactcttgcaatc 120 I S S N H W V M A W T G L E I N T L A I Atcccatttatctccgaacctcaccacccacgagctattgaagccacagtcaaatacttc 180 I P F I S E P H H P R A I E A T V K Y F Ctagtacaagcaacagcatcagccctactcttattctcaagtatgtccaatgcctgagcc 240 L V Q A T A S A L L L F S S M S N A W A Actggacaatgagatattacccaactcacccacccaacatcatgcattctacttacaatt 300 T G Q W D I T Q L T H P T S C I L L T I Gcaatctccataaagctaggactagtaccattccacttttgattcccagaagtacttcaa 360 A I S M K L G L V P F H F W F P E V L Q Ggttcatccataaccacagcactactactatccacagccctaaaacttcccccaattacc 420 G S S M T T A L L L S T A L K L P P I T Atcctcctcataacatcccactcactaaacccaactctactgaccattatggctatctcc 480 I L L M T S H S L N P T L L T I M A I S Tcagcagccctgggaggctgaataggactcaatcaaactcaaatccgaaaaatcttagcc 540 S A A L G G W M G L N Q T Q I R K I L A Ttctcctccatctcccacataggatgaatagtggtcatcatcatttacaacccaaacctc 600 F S S I S H M G W M V V I I I Y N P N L Acccttctaaccttctacctctatacccttataaccaccactgtattcctcactcttagc 660 T L L T F Y L Y T L M T T T V F L T L S Accactaaaacactaaaactaacaacaatgataacctcgtgaacaaaaacccccatacta 720 T T K T L K L T T M M T S W T K T P M L Aacacaacattaataataaccctactctcactagcgggccttccaccactaacaggcttc 780 N T T L M M T L L S L A G L P P L T G F Ttacctaaatgactcatcattcaagagcttaccaagcaagaaataaccttaacagccaca 840 L P K W L I I Q E L T K Q E M T L T A T Atcatggctatgctttctctacttgggctattcttctacctccgccttgcatactactcg 900 I M A M L S L L G L F F Y L R L A Y Y S Acaatcactctgccccccaacactacaaaccacataaaacagtggcacaccaacaaaacc 960 T I T L P P N T T N H M K Q W H T N K T Acaagcaccccagttgccatcctaacctcattagccaccctgctcctgccactctccccc 1020 T S T P V A I L T S L A T L L L P L S P Ataattctcacaacccttta 1040 M I L T T L
Fig 4.26: Nucleotide sequence of ND2 Gene of Sherazi Pigeon along with its deduced amino acid sequences
------97------
------RESULTS
Phylogenetic Analysisof ND2 Gene of Sherazi Pigeon
Fig. 4.27: Phylogenetic tree of ND2 Gene of Pakistani Sherazi Pigeon showing the phylogenetic relationship of Sherazi Pigeons and other Columbiformes
------98------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Lucky
Pigeon Breed using ND2 Gene
------99------
------RESULTS
PCR Amplification of ND2 Gene of Lucky Pigeon
0.541kb A
0.541kb
0.574kb B
0.574kb
Fig. 4.28: PCR Amplification of ND2 Gene of Lucky Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of ND2 Gene isolated from Pakistani Lucky pigeons Lane 26: Negative control
------100------
------RESULTS
ND2 Gene Sequence Analysis of Lucky Pigeon
Atgaacccacacgccatattagtttcaaccctaagcctactcttaggaacaaccatcacc 60 M N P H A M L V S T L S L L L G T T I T Atttcaagcaaccactgggtcatagcttgaaccggactagaaattaacactcttgcaatc 120 I S S N H W V M A W T G L E I N T L A I Atcccatttatctccgaacctcaccacccacgagctattgaagccacagtcaaatacttc 180 I P F I S E P H H P R A I E A T V K Y F Ctagtacaagcaacagcatcagccctactcttattctcaagtatgtccaatgcctgagcc 240 L V Q A T A S A L L L F S S M S N A W A Actggacaatgagatattacccaactcacccacccaacatcatgcattctacttacaatt 300 T G Q W D I T Q L T H P T S C I L L T I Gcaatctccataaagctaggactagtaccattccacttttgattcccagaagtacttcaa 360 A I S M K L G L V P F H F W F P E V L Q Ggttcatccataaccacagcactactactatccacagccctaaaacttcccccaattacc 420 G S S M T T A L L L S T A L K L P P I T Atcctcctcataacatcccactcactaaacccaactctactgaccattatggctatctcc 480 I L L M T S H S L N P T L L T I M A I S Tcagcagccctgggaggctgaataggactcaatcaaactcaaatccgaaaaatcttagcc 540 S A A L G G W M G L N Q T Q I R K I L A Ttctcctccatctcccacataggatgaatagtggtcatcatcatttacaacccaaacctc 600 F S S I S H M G W M V V I I I Y N P N L Acccttctaaccttctacctctatacccttataaccaccactgtattcctcactcttagc 660 T L L T F Y L Y T L M T T T V F L T L S Accactaaaacactaaaactaacaacaatgataacctcgtgaacaaaaacccccatacta 720 T T K T L K L T T M M T S W T K T P M L Aacgcaacattaataataaccctactctcactagcgggccttccaccactaacaggcttc 780 N A T L M M T L L S L A G L P P L T G F Ttacctaaatgactcatcattcaagagcttaccaagcaagaaataaccttaacagccaca 840 L P K W L I I Q E L T K Q E M T L T A T Atcatggctatgctttctctacttgggctattcttctacctccgccttgcatactactcg 900 I M A M L S L L G L F F Y L R L A Y Y S Acaatcactctgccccccaacactacaaaccacataaaacagtggcacaccaacaaaacc 960 T I T L P P N T T N H M K Q W H T N K T Acaagcaccccagttgccatcctaacctcattagccaccctgctcctgccactctccccc 1020 T S T P V A I L T S L A T L L L P L S P Ataattctcacaacccttta 1040 M I L T T L
Fig 4.29: Nucleotide sequence of ND2 Gene of Pakistani Lucky Pigeon along with its deduced amino acid sequences
------101------
------RESULTS
Phylogenetic Analysis of ND2 Gene of Lucky Pigeon
Fig 4.30: Phylogenetic tree of ND2 Gene of Lucky Pigeon demonstrating the molecular classification of Lucky Pigeons
------102------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Rock
Pigeon Breed using ND2 Gene
------103------
------RESULTS
PCR Amplification of ND2 Gene of Rock Pigeon
0.541kb
A
0.541kb
0.574kb
B
0.574kb
Fig. 4.31: PCR Amplification of ND2 gene of Rock Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of ND2 gene isolated from Pakistani Rock Pigeons Lane 26: Negative control
------104------
------RESULTS
ND2 Gene Sequence Analysis of Rock Pigeon
Atgaacccacacgccatattagtttcaaccctaagcctactcttaggaacaaccatcacc 60 M N P H A M L V S T L S L L L G T T I T Atttcaagcaaccactgggtcatagcttgaaccggactagaaattaacactcttgcaatc 120 I S S N H W V M A W T G L E I N T L A I Atcccatttatctccgaacctcaccacccacgagctattgaagccacagtcaaatacttc 180 I P F I S E P H H P R A I E A T V K Y F Ctagtacaagcaacagcatcagccctactcttattctcaagtatgtccaatgcctgagcc 240 L V Q A T A S A L L L F S S M S N A W A Actggacaatgagatattacccaactcacccacccaacatcatgcattctacttacaatt 300 T G Q W D I T Q L T H P T S C I L L T I Gcaatctccataaagctaggactagtaccattccacttttgattcccagaagtacttcaa 360 A I S M K L G L V P F H F W F P E V L Q Ggttcatccataaccacagcactactactatccacagccctaaaacttcccccaattacc 420 G S S M T T A L L L S T A L K L P P I T Atcctcctcataacatcccactcactaaacccaactctactgaccattatggctatctcc 480 I L L M T S H S L N P T L L T I M A I S Tcagcagccctgggaggctgaataggactcaatcaaactcaaatccgaaaaatcttagcc 540 S A A L G G W M G L N Q T Q I R K I L A Ttctcctccatctcccacataggatgaatagtggtcatcatcatttacaacccaaacctc 600 F S S I S H M G W M V V I I I Y N P N L Acccttctaaccttctacctctatacccttataaccaccactgtattcctcactcttagc 660 T L L T F Y L Y T L M T T T V F L T L S Accactaaaacactaaaactaacaacaatgataacctcgtgaacaaaaacccccatacta 720 T T K T L K L T T M M T S W T K T P M L Aacgcaacattaataataaccctactctcactagcgggccttccaccactaacaggcttc 780 N A T L M M T L L S L A G L P P L T G F Ttacctaaatgactcatcattcaagagcttaccaagcgagaaataaccttaacagccaca 840 L P K W L I I Q E L T K R E M T L T A T Atcatggctatgctttctctacttgggctattcttctacctccgccttgcatactactcg 900 I M A M L S L L G L F F Y L R L A Y Y S Acaatcactctgccccccaacactacaaaccacataaaacagtggcacaccaacaaaacc 960 T I T L P P N T T N H M K Q W H T N K T Acaagcaccccagttgccatcctaacctcattagccaccctgctcctgccactctccccc 1020 T S T P V A I L T S L A T L L L P L S P Ataattctcacaacccttta 1040 M I L T T L
Fig. 4.32: Nucleotide sequence of ND2 Gene of Rock Pigeon along with its deduced amino acid sequences
------105------
------RESULTS
Phylogenetic Analysis of ND2 Gene of Rock Pigeon
Fig4.33: Phylogenetic tree of Pakistani Rock Pigeon based on ND2 Gene sequences demonstrating the molecular classification of Rock Pigeons
------106------
------RESULTS
Genetic and Evolutionary Characterization
of Pakistani Lathy Rock Pigeon Breed
using ND2 Gene
------107------
------RESULTS
PCR Amplification of ND2 Gene of Lathy Rock Pigeon
0.541kb A
0.541kb
0.574kb
B
0.574kb
Fig. 4.34: PCR Amplification of ND2 Gene of Lathy Rock Pigeon Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of ND2 gene isolated from Pakistani Lathy Rock Pigeons Lane 26: Negative control
------108------
------RESULTS
ND2 gene sequence analysis of Lathy Rock Pigeon
Atgaacccacacgccatattagtttcaaccctaagcctactcttaggaacaaccatcacc 60 M N P H A M L V S T L S L L L G T T I T Atttcaagcaaccactgggtcatagcttgaaccggactagaaattaacactcttgcaatc 120 I S S N H W V M A W T G L E I N T L A I Atcccatttatctccgaacctcaccacccacgagctattgaagccacagtcaaatacttc 180 I P F I S E P H H P R A I E A T V K Y F Ctagtacaagcaacagcatcagccctactcttattctcgagtatgtccaatgcctgagcc 240 L V Q A T A S A L L L F S S M S N A W A Actggacaatgagatattacccaactcacccacccaacatcatgcattctacttacaatt 300 T G Q W D I T Q L T H P T S C I L L T I Gcaatctccataaagctaggactagtaccattccacttttgattcccagaagtacttcaa 360 A I S M K L G L V P F H F W F P E V L Q Ggttcatccataaccacagcactactactatccacagccctaaaacttcccccaattacc 420 G S S M T T A L L L S T A L K L P P I T Atcctcctcataacatcccactcactaaacccaactctactgaccattatggctatctcc 480 I L L M T S H S L N P T L L T I M A I S Tcagcagccctgggaggctgaataggactcaatcaaactcaaatccgaaaaatcttagcc 540 S A A L G G W M G L N Q T Q I R K I L A Ttctcctccatctcccacataggatgaatagtggtcatcatcatttacaacccaaacctc 600 F S S I S H M G W M V V I I I Y N P N L Acccttctaaccttctacctctatacccttataaccaccactgtattcctcactcttagc 660 T L L T F Y L Y T L M T T T V F L T L S Accactaaaacactaaaactaacaacaatgataacctcgtgaacaaaaacccccatacta 720 T T K T L K L T T M M T S W T K T P M L Aacgcaacattaataataaccctactctcactagcgggccttccaccactaacaggcttc 780 N A T L M M T L L S L A G L P P L T G F Ttacctaaatgactcatcattcaagagcttaccaagcaagaaataaccttaacagccaca 840 L P K W L I I Q E L T K Q E M T L T A T Atcatggctatgctttctctacttgggctattcttctacctccgccttgcatactactcg 900 I M A M L S L L G L F F Y L R L A Y Y S Acaatcactctgccccccaacactacaaaccacataaaacagtggcacaccaacaaaacc 960 T I T L P P N T T N H M K Q W H T N K T Acaagcaccccagttgccatcctaacctcattagccaccctgctcctgccactctccccc 1020 T S T P V A I L T S L A T L L L P L S P Ataattctcacaacccttta 1040 M I L T T L
Fig 4.35: Nucleotide sequence of ND2 Gene of Lathy Rock Pigeon along with its deduced amino acid sequences
------109------
------RESULTS
Phylogenetic Analysis of ND2 Gene of Lathy Rock Pigeon
Fig 4.36: Phylogenetic tree of Lathy Rock Pigeon based on ND2 gene sequences
------110------
------RESULTS
SNPs in ND2 Gene of Various Pakistani Pigeon Breeds
Sr. No. Position Reference Sherazi Lucky Rock Lathy Rock
01 202 C G G G G
02 219 A A A A G
03 722 C A A A A
04 724 G A G G G
05 818 G A A G A
Table 4.6: SNPs in ND2 Gene of various Pakistani Pigeon breeds
------111------
------RESULTS
Genetic and Evolutionary Characterization of Pakistani Parrot species
using Cytb and ND2 genes
Cytb (0.799 kb) and ND2 (1.041 kb) genes of Rose-ringed Parakeet (Psittacula
krameri) and Alexandrine parakeet (Psittaculaeupatria) were amplified. These two
genes showed species specific conserved polymorphic sites which can be employed
for the identification of Pakistani parakeets. Four novel single nucleotide
polymorphic sites; G270A, T273C, A276T and C663T were identified in Cytb gene
of Pakistani Rose-ringed Parakeet. Cytb gene sequences of Rose-ringed Parakeet
were submitted to NCBI under the accession no. KC876642 to KC876665. Cytb gene
analysis of Alexandrine parakeet demonstrated three nucleotide polymorphic sites;
A660G, C663T and C672T.
Comparative analysis of ND2 gene sequence of Pakistani Rose-ringed Parakeet
with its closest homologue indicated 25 variations in nucleotide sequence; C274T,
A315G, C397T, A475G, C486T, A504G, C528A, C543T, T555C, G564A, A570G,
N578T, N579T, A597G, C607T, A609G, T617C, C626T, T630C, T666C, T711C,
C716T, T777C, G816A and G829A. While ND2 gene sequence of Alexandrine
parakeet contained 41 base substitutions;T19C, C23T, C30G, G48A, C73A, T111C,
T123C, T141C, T156C, A162G, T195C, C201A, G225A, C285T, G348A, T371C,
C397A, T445C, C465T, G475A, A492G, T498C, A504G, G507A, C528A, C535T,
C540T, C543T, T555C, G564A, A570G, C572T, C575T, N577T, N578C, C589A,
C626T, T630C, G673A, C654T and A658G. ND2 gene sequences of Pakistani Rose
------112------
------RESULTS
Ringed Parakeets were submitted to NCBI under the accession numbers; KC823233-
KC823255.
Cytb and ND2 genes based phylogenetic analysis showed that Pakistani P. krameri shared the clade with P. k. manillensis. Further phylogenetic analysis highlighted that
Pakistani Alexindrine parakeet shared the clade with P. eupatria. P. e. magnirostriswas found recent ancestor of Pakistani Alaxindrine.
------113------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani Rose-
ringed Parakeets using Cytb Gene
------114------
------RESULTS
PCR Amplification of Cytb Gene of Rose-ringed Parakeet
0.799kb
0.799kb
Fig. 4.37: PCR Amplification of Cytb Gene of Rose-ringed Parakeet Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of Cytb gene isolated from Rose-ringed Parakeet Lane 26: Negative control
------115------
------RESULTS
CytbGene Sequence Analysis of Rose-ringed Parakeets
Gcccactacaccgcagacacctccctagccttctcatccgtagccaacacatgccgaaac 60 A H Y T A D T S L A F S S V A N T C R N Gtgcaatacgggtggctaatccgcaacctacatgcaaacggagcttcattattctttatc 120 V Q Y G W L I R N L H A N G A S L F F I Tgcatctacctccacatcgcccgaggcttttactatggctcatacctatacaaagaaacc 180 C I Y L H I A R G F Y Y G S Y L Y K E T Tgaaacacaggaatcatcctcctacttaccctcatagcaaccgctttcgttggctatgtc 240 W N T G I I L L L T L M A T A F V G Y V Ctaccatgaggccaaatatcattctgaggagccactgtcatcacaaacctattctccgcc 300 L P W G Q M S F W G A T V I T N L F S A Atcccgtacatcggacaagcattagtcgaatgagcctgaggcggattctccgtagacaac 360 I P Y I G Q A L V E W A W G G F S V D N Cccaccttaacacgattcttcgccctacacttcctcctaccattcataatcaccagccta 420 P T L T R F F A L H F L L P F M I T S L Gttatcatccacctaacctttctccacgaatcaggatcaaacaaccccctaggcatccca 480 V I I H L T F L H E S G S N N P L G I P Tcaaactgcgacaaaatcccattccacccatacttctccctaaaagacctactagggttt 540 S N C D K I P F H P Y F S L K D L L G F Gctatcatactcctctccctcaccacccttgccctattctcacccaacttactgggggac 600 A I M L L S L T T L A L F S P N L L G D Cccgaaaacttcaccccagcaaaccccctaacaactcccccacatatcaaacctgaatgg 660 P E N F T P A N P L T T P P H I K P E W Tatttcctattcgcgtacgcaattctacgatcaatccccaacaaactgggcggagtcctg 720 Y F L F A Y A I L R S I P N K L G G V L Gccctagctgcctccgtactgatcctattcctaagccccctcctccataaatccaaacaa 780 A L A A S V L I L F L S P L L H K S K Q Cgtaccatagccttccggc 799 R T M A F R
Fig 4.38: Nucleotide sequence of Cytb Gene of Rose-ringed Parakeet along with its deduced amino acid sequences
------116------
------RESULTS
Phylogenetic Analysis of Rose-ringed Parakeets
Fig 4.39: Phylogenetic Analysis of Pakistani Rose-ringed parakeet demonstrating the molecular classification of Pakistani Rose-ringed parakeet
------117------
------RESULTS
Genetic and Evolutionary
Characterization of Pakistani
Alexandrine Parakeets using Cytb Gene
------118------
------RESULTS
PCR Amplification of Cytb Gene of Alexandrine Parakeets
0.799kb
Fig. 4.40: PCR Amplification of Cytb Gene of Alexandrine Parakeets Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-10: Amplified fragments of Cytb Gene of Alexandrine Parakeet Lane 11: Negative control
------119------
------RESULTS
Cytb Gene Sequence Analysis of Alexandrine Parakeets
Gcccactacaccgcagacacctccctagccttctcatccgtagccaacacatgtcgaaac 60 A H Y T A D T S L A F S S V A N T C R N Gtacaatacgggtgactaatccgcaacttacatgcaaacggagcctcgctcttcttcatc 120 V Q Y G W L I R N L H A N G A S L F F I Tgcatctacctccacatcgctcgaggcttttactacggctcatacctgtataaggaaacc 180 C I Y L H I A R G F Y Y G S Y L Y K E T Tgaaacacaggaattatcctcctactcaccctcatagcaaccgctttcgttggctatgtc 240 W N T G I I L L L T L M A T A F V G Y V Ttaccatgaggccaaatatcattctgaggggctacagtcatcacaaacctattctccgcc 300 L P W G Q M S F W G A T V I T N L F S A Atcccatacattggacaaacactagttgaatgggcctgaggcggattctccgtagacaac 360 I P Y I G Q T L V E W A W G G F S V D N Cccaccctaacacgattcttcgccctgcacttcctcctaccattcataatcaccagccta 420 P T L T R F F A L H F L L P F M I T S L Gttatcatccacctaaccttcctccacgaatctggatcaaacaaccccctaggcatccca 480 V I I H L T F L H E S G S N N P L G I P Tcaaactgtgacaaaatcccattccacccgtacttctccctaaaagacctactaggattc 540 S N C D K I P F H P Y F S L K D L L G F Gccattatactcctcgcactcaccaccctcgccctgttctcacccaatctactaggagac 600 A I M L L A L T T L A L F S P N L L G D Cctgaaaactttaccccagcaaaccccctaacaacccccccacacatcaaacccgaatgg 660 P E N F T P A N P L T T P P H I K P E W Tatttcctatttgcatacgcaatcctacgatcaatccccaataaactaggcggagtccta 720 Y F L F A Y A I L R S I P N K L G G V L Gccctagctgcctccgtactgatcctattcctaagccccctcctccacaaatccaaacaa 780 A L A A S V L I L F L S P L L H K S K Q Cgaaccatagccttccgac 799 R T M A F R
Fig 4.41: Nucleotide sequence of Cytb Gene of Alexandrine Parakeet along with its deduced amino acid sequences
------120------
------RESULTS
Phylogenetic Analysis of Cytb Gene ofAlexandrine Parakeets
Fig 4.42: Phylogenetic analysis of Cytb Gene of Alexandrine parakeets showing the molecular taxonomy of Alexandrine parakeets
------121------
------RESULTS
Genetic and Evolutionary Characterization
of Pakistani Rose-ringed Parakeets using
ND2 Gene
------122------
------RESULTS
PCR Amplification of ND2 Gene of Rose-ringed Parakeets
1.041kb
1.041kb
Fig. 4.43: PCR Amplification of ND2 Gene of Rose-ringed Parakeets Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-25: Amplified fragments of ND2 Gene isolated from Pakistani Rose-ringed parakeet Lane N: Negative control
------123------
------RESULTS
ND2 Gene Sequence Analysis of Rose-ringed Parakeets
Atgagccccatcacaaaatttacatcaaccacaagcctactcctagggacaacaatcaca 60 M S P I T K F T S T T S L L L G T T I T Accacaagcaaccactgaataatagcatgaacagggctagaaatcaacactctagctatt 120 T T S N H W M M A W T G L E I N T L A I Attcccctaatctcaaaatctcaccacccacgagctatcgaagcaacaaccaaatacttc 180 I P L I S K S H H P R A I E A T T K Y F Ctagtacaagcagctgcctccgcactagtactcctctcaagcatgaccaacgcctgatcc 240 L V Q A A A S A L V L L S S M T N A W S Actggacaatgagacatcactcaactcacccactccccatcatgcaacctactaaccact 300 T G Q W D I T Q L T H S P S C N L L T T Gcaatcgccatcaagctaggcctagcccccttccacttttgattccccgaagtcctccaa 360 A I A I K L G L A P F H F W F P E V L Q Ggatcatcccttaccacagccctactcctatcaacattaataaaactcccaccaatctcc 420 G S S L T T A L L L S T L M K L P P I S Atcctcctactcacatcacactcattaaaccccacactactaaccgccctatcagtcaca 480 I L L L T S H S L N P T L L T A L S V T Tccattgccctaggtggttgaatggggctcaaccaaacacaaacccgaaaaatcctagcc 540 S I A L G G W M G L N Q T Q T R K I L A ttttcatccatctcccacataggatgaatagccatcattatcatctatcacccaaagcta 600 F S S I S H M G W M A I I I I Y H P K L Accctattgaccttctacatctacaccctcataacagcctccatcttcctaaccataaac 660 T L L T F Y I Y T L M T A S I F L T M N Acaaccaacaccctaaaactaccaacactaataacctcatgaactaaagcccccatacta 720 T T N T L K L P T L M T S W T K A P M L Aacacaaccctaatactaacgctcctatcactagcaggcctacccccactaacaggcttc 780 N T T L M L T L L S L A G L P P L T G F Ctacccaaatgatccatcatccaagagctcatcaaacaggacataaccacagcagccaca 840 L P K W S I I Q E L I K Q D M T T A A T Acaatctccatactctcactcttaagcctcttcttctacctacgcctggcatactgctca 900 T I S M L S L L S L F F Y L R L A Y C S Acaatcacactccctcccaacccatcaaacaaaataaaactatgatccactaaaaaacca 960 T I T L P P N P S N K M K L W S T K K P Actaacatcctgacccccacactcacatcattatcgatctcactcctaccactctcccct 1020 T N I L T P T L T S L S I S L L P L S P Ataatcctcttcaccatctaa 1041 M I L F T I -
Fig 4.44: Nucleotide sequence of ND2 Gene of Rose-ringed Parakeet along with its deduced amino acid sequences
------124------
------RESULTS
Phylogenetic Analysisof ND2 Gene of Rose-ringed Parakeets
Fig 4.45: Phylogenetic tree of ND2 Gene of Pakistani Rose-ringed Parakeets
------125------
------RESULTS
Genetic and Evolutionary Characterization
of Pakistani Alexandrine Parakeets using
ND2 Gene
------126------
------RESULTS
PCR Amplification of ND2 Gene of Alexandrine Parakeet
1.041kb
Fig. 4.46: PCR Amplification of ND2 Gene of Alexandrine Parakeet Lane M: Marker 1kb SM0313 (Fermentas) Lane 1-10: Amplified fragments of ND2 Gene isolated from Alexandrine Parakeet
------127------
------RESULTS
ND2 Gene Sequence Analysis of Alexandrine Parakeet
Atgagccccatcacaaaacttatatcaacgacaagcctactcctaggaacaacaatcaca 60 M S P I T K L M S T T S L L L G T T I T Accacaagcaacaactgaataatagcatgaacagggctagaaatcaacaccctagctatt 120 T T S N N W M M A W T G L E I N T L A I Atccccctaatctcaaaatcccaccacccacgagccatcgaggcaacaaccaaatacttc 180 I P L I S K S H H P R A I E A T T K Y F Ctagtacaagcagccgcctcagcactagtactcctctcaagcataaccaacgcctgatcc 240 L V Q A A A S A L V L L S S M T N A W S Actggacaatgagacatcactcaactcacccaccccccatcatgtaacctactaaccact 300 T G Q W D I T Q L T H P P S C N L L T T Gcaatcgccatcaaactaggcctagcccccttccacttttgattcccagaagtcctccaa 360 A I A I K L G L A P F H F W F P E V L Q Ggatcatcccctaccacagccctactcctatcaacaataataaaactcccaccaatctcc 420 G S S P T T A L L L S T M M K L P P I S Atcctcctactcacatcacactcactaaaccccacactactaactaccctatcaatcaca 480 I L L L T S H S L N P T L L T T L S I T Tccatcgccctgggtggctgaatgggactcaaccaaacacaaacccgaaaaatcttagct 540 S I A L G G W M G L N Q T Q T R K I L A Ttttcatccatctcccacataggatgaatgactattatcatcatctataacccaaaacta 600 F S S I S H M G W M T I I I I Y N P K L Accctactaaccttctatatctacatcctcataacaacctccatcttcctaactatagac 660 T L L T F Y I Y I L M T T S I F L T M D Acaactaacaccctaaaactaccaacactaataacctcatgaactaaagctcccacacta 720 T T N T L K L P T L M T S W T K A P T L Aacacaaccctaatactaacgctcctatcactagcaggcctacccccactaacaggtttc 780 N T T L M L T L L S L A G L P P L T G F Ctacccaaatgatccatcatccaagagctcatcaagcaggacataaccgcagcagccaca 840 L P K W S I I Q E L I K Q D M T A A A T Acaatctccatactctcactcttaagcctcttcttctacctacgcctggcatactgctca 900 T I S M L S L L S L F F Y L R L A Y C S Acaatcacactccctcccaacccatcaaacaaaataaaactatgatccactaaaaaacca 960 T I T L P P N P S N K M K L W S T K K P Actaacatcctgacccccacactcacatcattatcgatctcactcctaccactctcccct 1020 T N I L T P T L T S L S I S L L P L S P Ataatcctcttcaccatctaa 1041 M I L F T I -
Fig 4.47: Nucleotide sequence of ND2 Gene of Alexandrine Parakeets
------128------
------RESULTS
Phylogenetic Analysisof ND2 Gene of Alexandrine Parakeet
Fig. 4.48: Phylogenetic Tree of ND2 Gene of Alexandrine Parakeets indicating the molecular taxonomy of Alexandrine Parakeets
------129------
------DISCUSSION
Chapter 5
DISCUSSION
Avian species are valuable global assets as they are symbols of freedom, beauty, spirituality and wisdom. Importance of conservation of avian fauna is being advocated by
American organization “BirdLife International” which is extensively involved to elucidate the Global Threats which are faced by birds. Quantitative genetic characterization of avian species is perquisite of their conservation (Fortin et al. 2005).
For avian characterization, different morphological, anatomical, biochemical and molecular tools are being used. Among these, use of molecular markers is a reliable approach. Mitochondrial markers are considered as an important tool for the genetic and evolutionary studies. Maternal inheritance, high copy number, lack of recombination and high nucleotide substitution rate are the peculiar properties that make the mitochondrial
DNA a preferred tool for forensic, zoological, taxonomic, evolutionary and molecular analysis of avian species (Lee et al. 1994; Mindell et al. 1997; Hedges et al. 1995).
Mutations have strong influence on mitochondrial DNA diversity patterns in birds. There is a strong relationship between mitochondrial mutation rate and species maximal longevity which is in agreement with mitochondrial aging theory (Galtier et al. 2009).
The mitochondrial gene sequences along with multiple nuclear genes have been used to distinguish the speciation arising from high regional selective sweeps (Baker et al. 2009).
------130------
------DISCUSSION
Pakistan is potential habitat for a wide range of avian species (Awan et al. 2013).
Among them pigeons and parrots are more striking features of avifauna belong toColumbidae andPsittacoidea respectively. There are wide varieties of pigeons in
Pakistan including; Fancy, Feral, Band tailed, racing and homing pigeons. Fancy pigeons are also known as domestic pigeons. They are mostly bred by fancier for varieties of traits like colour, shape, size and behaviours. Sherazi, Lucky, Rock and Lathy Rock are most commonly found domestic pigeon breeds in Pakistan. They have unique phenotypic characteristics but have not been systematically studied to uncover their taxonomic status.
Along with pigeons, parrots are also commonly usage birds in Pakistan. Their ability to provide excellent companionship to humans makes them lovely to keep as pets. Rose- ringed parakeets and Alexandrine parakeets are most commonly found parrot species in
Pakistan. They have unique morphological characteristics but genetically have not been studied yet at species and sub-species level. Keeping in view these research gaps, the current study was conducted to genetically characterize the Pakistani pigeon breeds and parrot species, and to know about their taxonomic and phylogenetic scenario.
The present study is the first contribution toward molecular characterization of
Pakistani pigeon breeds and parrot species on the basis of mitochondrial Cytb, D-loop and ND2 genes. This study aimed to validate mitochondrial markers which can be capable of discriminating the closely associated avian species. These mitochondrial genes assume to be evolved according to the neutral model of evolution (Slatkin, 1985) and have been widely employed in systematic studies to resolve uncertainties at taxonomic levels. Among these, Cytb gene has been considered potential tool to define evolutionary relationships involving ancient divergences (Zardoya and Meyer, 1996; Abouheif et al.
------131------
------DISCUSSION
1998; Zardoya et al. 1998) due to rapid and slow mutation rate. Therefore, Cytbgene is useful for systematic deep phylogeny to recent divergence (Kirchman et al. 2000). D-loop region is rapidly evolving sequences in mitochondrial genome and exhibit more polymorphisms. They are under low selective pressure with 2.5 to 5.0 times base substitutions. In vertebrates, the phylogenetic effectiveness of D-loop region has been investigated at taxonomic levels. It is a best indicator to explore genetic variations within and between closely related individuals (Xiaodong, 2010). ND2 gene is another mitochondrial marker which has potential to solve topological and evolutionary ambiguities at taxonomic level (Russo et al. 1996).
In the first phase of study, the analysis of Cytb gene sequences of Pakistani pigeon breeds (Sherazi, Lucky, Rock and Lathy Rock) indicated the presence of three unique polymorphic sites at 174, 232 and 261 positions (Table 4.4) in all the studied breeds. These three sites were conserved and identified as unique private alleles that can be employed for identification of Pakistani pigeons. Additional polymorphic sites were also found at positions 582, 703 and 815for inter breed identification. Table 4.4 clearly demonstrates these unique breed-specific changes.
Phylogenetic analysis based on Cytb gene polymorphisms explored the continuum of shallower to deeper genetic divergences. This continuum evolution determines the biological relationships of individuals. Phylogenetic analysis of the Pakistani pigeon breeds, using Cytb gene haplotypes with all available Cytb gene sequences of the
Columbiformes, significantly revealed that rock pigeon (C. livia) is the ancestor of the
Pakistani domestic pigeons.Rock Pigeon and Pakistani domestic pigeons diverged from
Hill pigeon (C. rupestris); likely to be allopatric. Branch lengths separating them are very
------132------
------DISCUSSION short and believe to be a recent radiation. No empirical data is available about this radiation because little work has been undertaken to address this issue.These findings are unswerving even with the whole genomic studies (Shapiro et al. 2013). Based on morphological characteristics domestic pigeon breeds are much distinct and taxonomist might be tempted to categorize them as entirely different genera, yet all breeds are simply variants within single species, the rock pigeon C. livia(Stringham et al. 2012). The phylogenetic analysis of present study found C. junoniae (Laurel Pigeon)as an old lineage bird as compared to C. bollii (Bolles Pigeon) and C. palumbus (Culver Pigeon) which are the recently evolved species. These results are congruent with the reported data of Gonzalez and his co-workers (2009). The results avowed that both Bolles and Culver pigeon species were evolved at the same time and share many physical characteristics.
The presence or absence of white patches on the either side of neck, the dark bands on the grey tail and pinkish breast are the unique characteristics that make these pigeons distinguished from Laurel pigeon. Both Laurel and Bolles pigeon species belong to same ecological habitat whereas these are genetically away from each other on the basis of phylogenetic analysis (Fig. 4.3, 4.6, 4.9 and 4.12). Bolles and Culver, both were found very close to each other phylogenetically but their habitual distribution in the world is quite different. Bolles pigeon is confined within Spain whereas Culver pigeon is distributed to Asia, Europe and England.This is due to rapid cladogenetic events. The arboreal and frugivorous radiations are potential determinants for the successful gene flow which leads to dispersion of pigeons. Gibb and Penny (2010) worked on South pacific radiation to determine the relationship of pigeons within Neoaves. These radiations swamp local populations and lead to evolutionary events.
------133------
------DISCUSSION
Mitochondrial D-loop region also known as control region, is hyper variable region in mitochondrial DNA of all species and has a very important and prominent role in phylogenetic and lineage studies of different species (Lee et al. 2010). Basic organization of mammalian and avian mitochondrial D-loop region is almost same except few minor changes (Randi and Lucchini 1998). The control region (D-loop) is also heavily used for genetic exploration in avian species as this region is hyper variable part of mtDNAs, due to short insertions/deletions nucleotide substitutions, and dynamics of variable-number tandem repeats. D-loop region analysis for the characterization of four
Pakistani pigeon breeds indicated the presence of 6 additions of T in all the breeds that separate them from Rock pigeons and can be utilized for the identification of domestic pigeon breeds. D-loop sequences of 4 pigeon breeds have some unique transitions and trans-verions in their sequences that might be utilized to discriminate the breeds. Lu and coworkers worked on Coregonus clupeaformis and found 7 variable sites in D-loop, and used these polymorphic sites to identify the Atlantic and Acadian lineage (Lu et al. 2001).
Phylogenetic analysis using the D-loop gene of all Pakistani pigeon breeds indicated the close homology of local breeds with C. livia. Same strategy was adopted by Gonzalez and his colleagues for the identification of C. livia and reported the same results that C. rupestris is the ancestor of C. livia (Gonzalez et al. 2009).
To elaborate the results of Cytb and D-loop genes, another mitochondrial gene
ND2 was amplified, sequenced and phylogenetically analyzed. The presence of 2 unique polymorphic sites in ND2 gene of Pakistani pigeons, make them unique, from rest of the
World. In addition to this, private haplotype of 4 pigeon species, ND2 genes have unique
------134------
------DISCUSSION
Single Nucleotide Polymorphisms (SNPs) (Table 4.5), these SNPs are breed specific and can also be utilized for inter-breed identification.
ND2 gene based phylogenetic analysis revealed the eloquent monophyletic monotomy of Pakistani pigeon breeds, C. livia and C. rupestris. These findings were also in concordance with the analysis of Cytb and D-loop gene polymorphisms of present study; explicit that C. livia is ancestor of Pakistani pigeon and C. rupestris is deep ancestor of both Pakistani pigeon and C. livia. Molecular classification at breed level should be done to define their taxonomic status, especially in spectrum of genetic, phylogenetic and genomic polymorphisms.These findings probably explain the random migrations of pigeons due to spatial radiation. This same type of pattern was reported by
Jetz et al. (2012) in avian species to highlight the global avian diversity in term of macro- evolutionary and macro-ecological perspectives. They found the adaptive radiations pattern in molecular tree, hemispheric diversification and avian species assemblage in
South America, North America and Asia. Rapid adaptive radiations in lineages contribute significantly in spatial distributions and temporal dynamics of species diversification in terms of taxonomic and geographical perspectives. Johnson and Dale (2000) evaluated combined mitochondrial (Cytb and ND2) and nuclear (fibrinogen 7 intron) analysis to uncover the phylogeny of genus Zenaida and Columba. According to their study mitochondrial markers are best options to resolve phylogeny disputes.
Gene flow due to migration plays an important role in avian diversity of Pakistan.
Due to favorable climatic zone, Pakistan has large and diversified number of guest birds every year from Central Asia, Russia, Siberia, India and Europe. Due to extensive utilization, some migratory routes have been categorized worldwide. By far there are
------135------
------DISCUSSION seven flyways; Northern Europe to Scandinavian countries, Indus Flyway (Green Route) from Siberia to Pakistan, Central Europe to Mediterranean Sea, Ganga Flyway from Eastern Siberia to India, Western Siberia to Red Sea, Chakotaka to California and
Manchuria to Korea. Green Route is one of the busiest migratory routes in the World.
Mostly Siberian birds adopt this rout for movement toward Pakistan. These random migrations promote avian adaptive diversification and intermediate level of dispersal.
Results of present study illustrated the lineage dispersal of Rock pigeon in Pakistan. The four Pakistani domestic pigeon breeds have diverged from common ancestor (C.livia) and in this divergence random migrations play an important role. Through Indus Flyway exclusive migration resulted in avian gene flow and paved the way toward the avian diversification.
Parakeets occupy a special place in evolutionary biology because convergent morphologies of many species and sub-species demonstrate repeatability in evolution even as they obscure phylogenetic relationships. Parrots are named as “Introduced species” in the world and their number is exponentially increasing day by day. To date
Pakistani parrot species have not been characterized at molecular level. In the second phase of the study systematic investigations were done within disjunct populations of the
P.krameri and P. eupatria to genetically characterize them for their molecular classification.
In this study, two Pakistani parrot species were genetically characterized on the basis of Cytb and ND2 gens. Four novel single nucleotide polymorphic sites; G270A,
T273C, A276T and C663T were identified in Pakistani Rose-ringed Parakeet, when the
Cytb gene sequence was compared with P. columboides, P. alexandri, P. krameri, P.
------136------
------DISCUSSION eupatria, P. k. borealis, P. k. parvirostris and P. k. manillensis. Interestingly, all the nucleotide substitutions were found at third base of codon. These results were supported by the experimental findings of Tavares et al. (2006). These deviations in the Cytb gene sequence of Pakistani Rose-ringed Parakeets indicates independent evolution of this species as an ecocline in Pakistan. The geographical heterogeneity exerts evolutionary pressure to a specie to adopt the status of an ecocline to that extent which evolves it into sub-species (Groombridge et al. 2004). For example mandible size in the African Rose- ringed parakeets increases westwards across its geographical range in Africa and mandible color of Asian Rose-ringed parakeets changes from red (P. k. borealis) to black
(P. k. manillensis) in longitudinal coordinates of South-Asia (Forshaw, 2006; Juniper and
Parr, 1998). The same pattern of adaptive radiation was observed in Pakistani Rose- ringed parakeet which has been evolved independently in the indigenous environment.
P. krameri (Rose-ringed Parakeets) is sub divided in 4 sub-species consisting of
P. krameri krameri, P. k. parvirostris, P. k. manillensis and P. k. borealis. According to their geographical pattern P. k. krameri, P. k. parvirostri, P. k. manillensis and P. k. borealis were reported in Ugenda; Sudan; Srilanka & India; and North India & Pakistan respectively. But this study, first time, reported that Pakistani P. krameri shared the same clade with P. k. manillensis and was more distinct from the Athopian P. k. parvirostris
(98.37%), Indo-Pak P. krameriborealis (98.2%), Mauritiusal P.echo (96.37%) and
African P. k. krameri; P. k. parvirostris and P. echo were found polyphyletic with respect to other sub-species of P. krameri whereas Kundu et al. (2012) reported the monophyletic existence of various P. krameri subspecies. Geogical dynamics, zonal biota and eco dynamism are important determinants of evolution; Kundu described the complex pattern
------137------
------DISCUSSION of evolution of P. krameri subspecies. Sharing of Pakistani P. krameri with Indian P. k. manillensis is due to adaptive radiation of parrots (Kundu et al. 2012). Sub-species of P. krameri have been forcibly and deliberately distributed in locations from where they are not native, due to this they are named as “introduced species”. Molecular biologists have paid extensive consideration on introduced species phenomena as this play a pivotal role in gene flow, genetic variation, species radiation and population translocation (Butler,
2003). Similar comprehensive study was done by Fletcher and Nick (2007) on ecology and future distribution of parakeets in different areas of England and found that Rose ringed Parakeets are undergoing a rapid population growth in England with negative effect on native species.
On the basis of sequence homology of Cytb gene, the Pakistani Rose-ringed parakeet can be classified as sub-species of P. k. manillensis but the deviation in Cytb gene sequence of Pakistani Rose-ringed Parakeets is pointing towards independent evolution of this species as an ecocline in Pakistan. The geographical heterogeneity exerts evolutionary pressure to a specie to adopt the status of an ecocline to that extent which evolves it into sub-species (Groombridge et al., 2004). Schweizer and his co- workers explained the phenomena of Vicariance in the evolution of parakeets. According to them trans-oceanic translocation and dispersal play significant role in wide range of expansion of parakeets. In the present study vicariance evolution was found in Pakistani
P. krameri and Indian P. k. manillensis.
Analysis of Cytb gene from Pakistani Alexandrine parakeet (P. eupatria) identified the presence of 3 transitions in the Cytb gene sequence as compared to reported gene sequence from P. eupatria. These results are in agreement to previously reported
------138------
------DISCUSSION results (Yoder et al. 2006; Groombridge et al. 2004). Further phylogenetic analysis highlighted that Pakistani Alexindrine parakeet shared the clade with P. eupatria, with P. e. magnirostris as recent ancestor. Subspecies of highly radiating clade mate (P. eupatria) of Paksitani Alexindrine parakeet not defined yet in broader context, there is need of mass scale sub-species characterization at global level. Gene flow due to geological events stimulates the diversity in Psittacula genus (Ruddima and Kutzbach,
1991; Kutzbach et al. 1993). Physical barriers and the Asian monsoon cycles also influenced the Psittacula distribution (Zhisheng, et al. 2001). All these migratory factors are expected to play an important role in distribution and neutralization of Alexindrine from Andaman Islands in Pakistan. These findings are in favors of Pleistocene Refugia hypothesis; stated that spatial changes are driving forces in diversification of resident biota of the specific region (Haffer, 1993, 1997).
Genetic surveys of populations augment our understanding of different ways in which demographic and ecological parameters influence the partitioning of the genetic diversity. In addition to this; molecular based surveys are magnetically useful in the wide range of evolutionary inquiries, including conservation biology, biogeography and microevolutionary processes (Winker et al.2000). Migration and mobility of birds are other relevant factors of higher level of gene flow and accentuate the population dispersal and evolution (Barrowclough 1983). In this study Mitochondrial ND2 gene was also utilized for the characterization of Pakistani Rose ringed and Alexandrine parakeet.
Previously, ND2 gene was utilized for the characterization of various avian species like
Otus and Mimizuku (Gonzalez et al. 2009; Zink et al. 2001; Bradman et al. 2011).
Comparative analysis explored that the use of ND2 gene was found to be a better
------139------
------DISCUSSION approach rather than Cytb gene for the identification of various avian species of
Phasianidae, Anatidae, Gruidae, Scolopacidae, Accipitridae, Falconidae, Struthionidae and Psittacidae families (Boonseub et al. 2009).
Quantification of the transitions/transversions is primarily important for coding genes based characterization and phylogenetic analysis. Transitions are mostly down- weighted as compared to the nucleotide transversion in phylogenetic investigations.
Reconstruction of accurate phylogenetic relationship is fairly homoplasmy of data dependent, because it play integral role in numerous genetic indices (Broughton et al.
2000). Previous studies of Fitch (1967) and Li et al. (1984) also were in favor of high transitional frequency in nuclear and mitochondrial genomes, this elevated rate of nucleotide transition showed the multiple vibrational events in specific nucleotide sites and increase the frequency of homoplasmy (Simon et al., 1994; Meyer 1994).
Furthermore the nucleotide transitional accumulation exhibits the “plateau” effect. That means beyond a specific level, increase in nucleotide transitions become neutral even with the increase of overall divergence (Irwin et al. 1991). In the present study, ND2 gene based homology analysis showed 25 variations in nucleotide sequences, but not a single indel. It was observed that most of these nucleotide variations were at third base of codon, so the coded amino acids were found same-sense. Ribas et al. (2005) worked on diversification and historical geography of Neotropical parrot with the help of ND2 and
Cytb genes. According to them, marine transgressions, river dynamics and geotectonic events play an important role in diversification of Neotropical parrot. Sequence statistics of present study showed the transition and transversion ratio, high frequency of cytosine
------140------
------DISCUSSION and adenine at third base of codon and more divergence hits in ND2 gene as compared to
Cytb that is in agreement with the Ribas study (ND2= 12% and Cytb = 8%).
mtDNA variations are pivotal tools in evolutionary, molecular ecology and population genetics. They paved the way for modeling the population history of individuals. Coalescent events in mitochondrial genome (Schierup and Hein 2000), including ways of population expansion and divergence time (Kuhner et al. 1998; Beerli and Felsenstein, 1999) greatly impact on biogeographical distributions of individuals.
This study is first molecular investigation to genetically characterize the Pakistani domestic pigeon breeds (Sherazi, Lucky, Rock and Lathy Rock) and parrot species
(Rose-ringed parakeets and Alexindrine parakeets) to know about their taxonomic and phylogenetic status. Mitochondrial genes based markers can assist the avian fanciers to authentically identify the pigeon breeds and parrot species. SNP based marker developed in this study can help wildlife forensics in term of blood and meet identification. In addition to these, the findings can help ornithologist and ecologists for breed and species conservation. It would help the Pet lovers to keep the authentic pigeons and parrots.
Furthermore, it would also the local people to rare true- true breeds of pigeons for support and competition purposes. This study illustrated the taxonomy and phylogeny of
Pakistani domestic pigeon breeds and parrot species. This study has paved the way for molecular ornithologists in Pakistan.Present study also highlighted the taxonomic ambiguities at sub-species of parakeets and proposed the taxonomic revisions at global level.
------141------
------SUMMARY
Chapter 6
SUMMARY
Pakistan is bestowed with a diversified array of avian fauna due to variety of habitats. Among the avifauna of Pakistan pigeons and parrots are the common usage birds, belong to
Columbidaeand Psittacidae family respectively contribute to overall biodiversity of the country.
In the present study, the four Pakistani pigeon breeds (Sherazi, Lucky, Rock and Lathy Rock) and two parrot species (Rose ringed parakeet, Alexandrine parakeet) were genetically investigated on the basis of mitochondrial D-loop, Cytb and ND2 genes to know about their evolutionary trends. The attempt was made to develop mitochondrial based molecular markers which might be capable of distinguishing the closely related pigeon and parrot breeds.
Mitochondrial genes based study was conducted due to its maternal inheritance, high copy number, lack of recombination and high nucleotide substitution rate. This makes the mitochondrial DNA a preferred tool for forensic, zoological, taxonomic and molecular analysis of avian species.
A total of 100 unrelated pigeon birds were selected (25 from each breed) on the basis of unique phenotypic characteristics for molecular studies. Twenty five Rose ringed parakeets and 10
Alexandrine parakeet s were also selected for present study. The DNA was extracted from the blood of selected birds and was utilized for the PCR amplification of D-loop, Cytb and ND2 genes, followed by DNA sequencing and bioinformatics analysis.
The analysis of Cytb gene sequences from the selected Pakistani pigeon species indicated the presence of 3 unique Single Nucleotide Polymorphisms (SNPs) for all the selected breeds.
------142------
------SUMMARY
These 3 sites were conserved and declared as unique private alleles that can be employed for
Pakistani pigeon breeds identification. Some additional sites were also identified at various positions in the sequence that could be used for inter-breed identification. D-loop region analysis for the characterization of 4 Pakistani pigeon breeds indicated the presence of 6 additions of T in all the breeds that separate them from rest of the world and have some unique transitions and transverions polymorphic sites in their sequences that might be utilized to discriminate the breeds. ND2 gene of Pakistani pigeons were also contain some unique sites for inter and intra breed identification. Phylogenetic analysis based on Cytb, D-loop and ND2 genes indicatedColumba liviaas ancestor of Pakistani domestic pigeons.
Cytb gene based 4 and 3 novel single nucleotide polymorphic sites were identified inPakistani Rose-ringed Parakeet and Alexandrine parakeet3 nucleotide polymorphic sites. The
ND2 gene found to be comparatively more polymorphic with 25 variations in nucleotide sequence in Pakistani Rose-ringed Parakeet and 41 in Alexandrine parakeet. On the basis of sequence homology of Cytb gene, the Pakistani Rose-ringed parakeet can be classified as sub- species of P. k. manillensis but the deviation in Cytb gene sequence of Pakistani Rose-ringed
Parakeets is pointing towards independent evolution of this species as an ecocline in Pakistan.
The geographical heterogeneity exerts evolutionary pressure to a specie to adopt the status of an ecocline to that extent which evolves it into sub-speciesPakistani Alexindrine parakeet shared homology with various members of Psittacidae family and cladded with P. eupatria, with P. e. magnirostris as recent ancestor. Clade mates of Pakistani Alexindrine parakeet not clear and there is need of mass scale subspecies characterization at global level.
This is the first report of molecular classification of Pakistani domestic pigeon breeds
(Sherazi, Lucky, Rock and Lathy Rock) and parrot species (Rose-ringed parakeets and
------143------
------SUMMARY
Alexindrine parakeet s) using Cytb, D-loop and ND2 genes. SNP based identified markers can assist the avian fanciers to authentically identify the pigeons and parrots. This would also solve the forensics issues regarding blood and meet identification.This study will contribute scientific community to understand the phylogenetic lineage of the Pakistani pigeons and parrots. Present study also highlighted the taxonomic ambiguities at sub-species of parakeets and proposed for taxonomic revisions at global level.
------144------
------LITERATURE CITED
Chapter 7
LITERATURE CITED
Abouheif E, R Zardoya and A Meyer, 1998. Limitations of Metazoan 18S rRNA Sequence Data:
Implications for Reconstructing a Phylogeny of the Animal Kingdom and Inferring the
Reality of the Cambrian Explosion. Journal of Molecular Evolution, 47: 394-405.
Adebambo O, Williams JL, Blott S and Urquhart B. 2000 Genetic relationships between native
sheep breeds in Nigeria based on microsatellite DNA polymorphisms. Nigerian Journal
of Animal Production. 27: 1-8.
Astuti D, Azuma N, Suzuki H and Higashi S. 2006. Phylogenetic Relationships Within Parrots
(Psittacidae) Inferred from Mitochondrial Cytochrome-b Gene Sequences. Zoological
Science. 23(2): 191-198.
Awan AR, Umar E, Zia ul Haq M and Firyal S. 2013. Molecular classification of Pakistani
collared dove through DNA barcoding. Mol Biol Rep. 40:6329–6331.
Baker AJ, Tavares ES, RF E and 2009. Countering criticisms of single mitochondrial DNA gene
barcoding in birds. Molecular Ecology Resources. (9): 257–268.
Barrowclough GF. 1983. Biochemical studies of microevolutionary processes. In: Brush, A. H.
and Clark, Jr., G. A. (eds). Perspectives in Ornithology. University of Cambridge Press,
Cambridge. 223–261.
Beerli P and Felsenstein J. 1999. Maximum-likelihood estimation of migration rates and
effective population numbers in two populations using a coalescent approach. Genetics.
152(2): 763-773.
Bell S. 2007. "Fitting tribute to animal heroes". BBC News.
------145------
------LITERATURE CITED
Birt TP, Friesen VL, Green JM, Montevecchi WA and Davidson WS. 1992. Cytochrome-b
sequence variation among parrots. Hereditas. 117(1): 67-72.
Bjornstad G and Røed K. 2001. Breed demarcation and potential for breed allocation of horses
assessed by microsatellite markers. Animal genetics. 32(2): 59-65.
Boldogh IR and Pon LA. 2007. Mitochondria on the move. Trends in cell biology. 17(10): 502-
510.
Boonseub S, S. Tobe, AMT Linacre. 2009. The use of mitochondrial DNA genes to identify
closely related avian species. Forensic Science international: Genetic Supplement
Science. 27:275-277.
Boore JL. 1999. Animal mitochondrial genomes. Nucleic acids research. 27(8): 1767-1780.
Bradman H, Grewe P and Appleton B. 2011. Direct comparison of mitochondrial markers for the
analysis of swordfish population structure. Fisheries Research. 109(1): 95-99.
Broughton RE, Stanley SE and Durrett RT. 2000. Quantification of homoplasy for nucleotide
transitions and transversions and a reexamination of assumptions in weighted
phylogenetic analysis. Systematic Biology. 49(4): 617-627.
Brown WM, George M and Wilson AC. 1979. Rapid evolution of animal mitochondrial DNA.
Proceedings of the National Academy of Sciences. 76(4): 1967-1971.
Bromham L. 2003. Molecular Clocks and Explosive Radiations. Journal of Molecular Evolution.
57(1): S13-S20.
Butler CJ, 2003. Population biology of the introduced rose-ringed parakeet Psittacula krameri in
the UK. University of Oxford
------146------
------LITERATURE CITED
Christidis L, M Irestedt, D Rowe, WE Boles and JA Norman, 2011. Mitochondrial and nuclear
DNA phylogenies reveal a complex evolutionary history in the Australasian robins
(Passeriformes: Petroicidae). Molecular Phylogenetics and Evolution, 61: 726-738.
Christidis L, Norman JA, Johnson RN and Lindsay MS. 2006. Forensic identification of aviation
bird strikes in Australia. Australian Transport Safety Bureau, Canberra, Australia.
Collett TS and Graham P. 2004. Animal navigation: path integration, visual landmarks and
cognitive maps. Current Biology. 14(12): R475-R477.
Carmela G, Reyes A, Pesole G and C. S. 2000. Lineage-specific evolutionary rate in mammalian
mtdna. Mol Biol Evol. 17: 1022- 1031.
Danish M, Geerlings E, Solkner J, Thea S, Thieme O and Wurzinger M. 2008. Characterization
of indigenous chicken production system in Cambodia. Food and Agricultural
Organization of United Nation, Rome.
Eberhard JR and Bermingham E. 2005. Phylogeny and comparative biogeography of
Pionopsitta,parrots and Pteroglossus toucans. Molecular Phylogenetics and Evolution.
36(2): 288-304.
Eberhard JR, Wright TF and Bermingham E. 2001. Duplication and concerted evolution of the
mitochondrial control region in the parrot genus Amazona. Molecular Biology and
Evolution. 18(7): 1330-1342.
Eisermann K. 2003. Status and conservation of Yellow-headed Parrot Amazona
oratrix“guatemalensis” on the Atlantic coast of Guatemala. Bird Conservation
International. 13(4): 361-366.
------147------
------LITERATURE CITED
Faria PJ, Guedes NM, Yamashita C, Martuscelli P and Miyaki CY. 2007. Genetic variation and
population structure of the endangered Hyacinth Macaw (Anodorhynchus hyacinthinus):
implications for conservation. Biodiversity and Conservation. 17(4): 765-779.
Fajardo V, Gonzalez I, Lopezcalleja I, Martin I, Rojas M, Garcia T, Hernandez P and R. M.
2008. PCR identification of meats from chamois (Rupicapra rupicapra), pyrenean ibex
(Capra pyrenaica), and mouflon (Ovis ammon) targeting specific sequences from the
mitochondrial D-loop region. Meat Science. 76: 644-652.
Fitch WM. 1967. Evidence suggesting a non-random character to nucleotide replacements in
naturally occurring mutations. Journal of molecular biology. 26(3): 499-507.
Fletcher M and N Askew, 2007. Review of the Status, Ecology and Likely Future Spread of
Parakeets in England. York: CSL.
Forshaw JM 2006. Parrots of the World: An Identification Guide, Princeton University Press.
Forshaw JM 2010. Parrots of the World, Princeton University Press.
Fortin MJ, TH Keitt, BA Maurer, ML Taper, DM Kaufman and TM Blackburn, 2005. Species‟
geographic ranges and distributional limits: pattern analysis and statistical issues. Oikos,
108: 7-17.
Galtier N, Nabholz B, Glémin S and Hurst G. 2009. Mitochondrial DNA as a marker of
molecular diversity: a reappraisal. Molecular ecology. 18(22): 4541-4550.
Gibbs, Barnes , Cox. Pigeons and Doves (Pica Press 2000)
Gibb GC and Penny D. 2010. Two aspects along the continuum of pigeon evolution: A South-
Pacific radiation and the relationship of pigeons within Neoaves. Molecular
Phylogenetics and Evolution. 56(2): 698-706.
------148------
------LITERATURE CITED
Girish P, Anjaneyulu A, Viswas K, Santhosh F, Bhilegaonkar K, Agarwal R, Kondaiah N and
Nagappa K. 2007. Polymerase chain reaction–restriction fragment length polymorphism
of mitochondrial 12S rRNA gene: a simple method for identification of poultry meat
species. Veterinary research communications. 31(4): 447-455.
Goldberg J, Trewick SA and Powlesland RG. 2011. Population structure and biogeography of
Hemiphaga pigeons (Aves: Columbidae) on islands in the New Zealand region. Journal
of Biogeography. 38(2): 285-298.
Grosso AR, Bastos-Silveira C, Coelho MM and Dias D. 2006. Columba palumbus Cyt b-like
Numt sequence: comparison with functional homologue and the use of universal primers.
Folia Zoologica-Praha-. 55(2): 131.
Groombridge JJ, Jones CG, Nichols RA and Carlton M, Bruford, M.W.,2004. Molecular
phylogeny and morphological change in the Psittacula parakeets. Molecular
Phylogenetics and Evolution. (31): 96–108.
Gonzalez J, Castro GD, Garcia-del-Rey E, Berger C and Wink M. 2009. Use of mitochondrial
and nuclear genes to infer the origin of two endemic pigeons from the Canary Islands. J
Ornitho. (150): 357–367.
Haffer J, 1993. Time„s cycle and time„s arrow in the history of Amazonia. Biogeographica, 69:
15-45.
Haffer J, 1997. Alternative models of vertebrate speciation in Amazonia: an overview.
Biodiversity & Conservation, 6: 451-476.
Hammond HA, Jin L, Zhong Y, Caskey CT and Chakraborty R. 1994. Evaluation of 13 short
tandem repeat loci for use in personal identification applications. American journal of
human genetics. 55(1): 175.
------149------
------LITERATURE CITED
Harrison GL, McLenachan PA, Phillips MJ, Slack KE, Cooper A and D. P. 2004. Four new
avian mitochondrial genomes help get to basic evolutionary questions in the late
cretaceous. Mol Biol Evol. 21(6): 974-983.
Haunshi S, Basumatary R, Girish P, Doley S, Bardoloi R and Kumar A. 2009. Identification of
chicken, duck, pigeon and pig meat by species-specific markers of mitochondrial origin.
Meat science. 83(3): 454-459.
Hebert PD, Stoeckle MY, Zemlak TS and Francis CM. 2004. Identification of birds through
DNA barcodes. PLoS biology. 2(10): 312.
Hedges SB, Simmons MD, van Dijk M, Caspers G-J, de Jong WW and Sibley CG. 1995.
Phylogenetic relationships of the hoatzin, an enigmatic South American bird. Proceedings
of the National Academy of Sciences. 92(25): 11662-11665.
Hedges SB and Poling LL. 1999. A molecular phylogeny of reptiles. Science. 283(5404): 998-
1001.
Hsieh H-M, Chiang H-L, Tsai L-C, Lai S-Y, Huang N-E, Linacre A and Lee JC-I. 2003.
Cytochrome b gene for species identification of the conservation animals. Forensic
science international. 122(1): 7-18.
Ho SY, Shapiro B, Phillips MJ, Cooper A, Drummond AJ. 2007. Evidence for time dependency
of molecular rate estimates. Systematic Biology. 56:515–522.
Irwin DM, Kocher TD and Wilson AC. 1991. Evolution of the cytochromeb gene of mammals.
Journal of Molecular Evolution. 32(2): 128-144.
Irwin DM and Wilson AC (1991). Limitations of molecular methods for establishing the
phylogeny of mammals, with special reference to the position of elephants. In American
Museum of Natural History Symposium on Mammilian Phylogeny (ed. Press, U.).
------150------
------LITERATURE CITED
Iwaniuk AN, Dean KM and Nelson JE. 2004. Interspecific allometry of the brain and brain
regions in parrots (Psittaciformes): comparisons with other birds and primates. Brain,
behavior and evolution. 65(1): 40-59.
Jetz W TG, Joy JB, Hartmann K and M AO., 2012. The global diversity of birds in space and
time. Nature, 491: 444-448.
Johns GC and Avise JC. 1998. A comparative summary of genetic distances in the vertebrates
from the mitochondrial cytochrome b gene. Molecular Biology and Evolution. 15(11):
1481-1490.
Johnson KP and Clayton DH. 2000. Nuclear and mitochondrial genes contain similar
phylogenetic signal for pigeons and doves (Aves: Columbiformes). Molecular
Phylogenetics and Evolution. 14(1): 141-151.
Johnson KP, de Kort S, Dinwoodey K, Mateman A, ten Cate C, Lessells C, Clayton DH and
Sheldon F. 2001. A molecular phylogeny of the dove genera Streptopelia and Columba.
The Auk. 118(4): 874-887.
Juniper T and Parr M. 1998. Parrots.A Guide to the Parrots of the World. Pica Press, Sussex,
UK.
Ketmaier V, Argano R and Caccone A. 2003. Phylogeography and molecular rates
ofsubterranean aquatic Stenasellid Isopods with a peri-Tyrrhenian distribution. Mol. Ecol.
12: 547–555.
Kikkawa Y, Yonekawa H, Suzuki H and Amano T. 1997. Analysis of genetic diversity of
domestic water buffaloes and anoas based on variations in the mitochondrial gene for
cytochrome b. Animal genetics. 28(3): 195-201.
------151------
------LITERATURE CITED
Kirchman JJ, LA Whittingham and FH Sheldon, 2000. Relationships among Cave Swallow
Populations (Petrochelidon fulva) Determined by Comparisons of Microsatellite and
Cytochrome b Data. Molecular Phylogenetics and Evolution, 14: 107-121.
Kuhner MK, Yamato J and Felsenstein J. 1998. Maximum likelihood estimation of population
growth rates based on the coalescent. Genetics. 149(1): 429-434.
Kundu S, Jones C, Prys-Jones R and Groombridge J. 2012. The evolution of the Indian Ocean
parrots (Psittaciformes): Extinction, adaptive radiation and eustacy. Molecular
Phylogenetics and Evolution. 62(1): 296-305.
Kutzbach JE, Prell WL and Ruddiman WF. 1993. Sensitivity of Eurasian climate to surface
uplift of the Tibetan plateau. J. Geol. 101(177-190).
Kutzbach JE, PJ Guetter, P Behling and R Selin, 1993. Simulated climatic changes: results of the
COHMAP climate-model experiments. Global climates since the last glacial maximum:
24-93.
Lack P. 1986. The atlas of wintering birds in Britain and Ireland. T. & A.D. Poyser, Calton,
Staffordshire.
Lee JC-I and Chang J-G. 1994. Random amplified polymorphic DNA polymerase chain reaction
(RAPD PCR) fingerprints in forensic species identification. Forensic science
international. 67(2): 103-107.
Lee JCI, Tsai LC, Huang MT, Jhuang JA, Yao CT, Chin SC, Wang LC, Linacre A and Hsieh
HM. 2008. A novel strategy for avian species identification by cytochrome b gene.
Electrophoresis. 29(11): 2413-2418.
Lee JC-I, Tsai L-C, Liao S-P, Linacre A and Hsieh H-M. 2010. Evaluation of the polymorphic
D-loop of Columba livia in forensic applications. Ectrophoresis. 31(23-24): 3889-3894.
------152------
------LITERATURE CITED
Lehtonen M. 2002. Mitochondrial DNA sequence variation in patients with sensorineural heating
impairment and in the Finnish population. Biocenter Oulu, Oulun yliopisto.
Lever C and Peter S 1977. The naturalized animals of the British Isles, Hutchinson London.
Li WH, Wu C-I and Luo C-C. 1984. Nonrandomness of point mutation as re•ected in nucleotide
substitutions in pseudogenes and its evolutionary implications. J.Mol. Evol. 21: 58–71.
Lu G, Basley DJ and Bernatchez L. 2001. Contrasting patterns of mitochondrial DNA and
microsatellite introgressive hybridization between lineages of lake whitefish (Coregonus
clupeaformis); relevance for speciation. Molecular Ecology. 10(4): 965-985.
Malau-Aduli A, Nishimura-Abe A, Niibayashi T, Yasuda Y, Kojima T, Abe S, Oshima K,
Hasegawa K and Komatsu M (2004). Mitochondrial DNA polymorphism, maternal
lineage and correlations with postnatal growth of Japanese Black beef cattle to yearling
age. Asian Austral J Anim 17 (11): 1484-1490
Mane B, Mendiratta S and Tiwari A. 2009. Polymerase chain reaction assay for identification of
chicken in meat and meat products. Food Chemistry. 116(3): 806-810.
Marrero P, Cabrera VM, Padilla DP and Nogales M. 2008. Molecular identification of two
threatened pigeon species (Columbidae) using faecal samples. Ibis. 150(4): 820-823.
Masello JF, Quillfeldt P, Munimanda GK, Klauke N, Segelbacher G, Schaefer HM, Failla M,
Cortés M and Moodley Y. 2011. The high Andes, gene flow and a stable hybrid zone
shape the genetic structure of a wide-ranging South American parrot. Frontiers in
zoology. 8(1): 16.
Melo M and Colleen OR. 2007. Genetic differentiation between Príncipe Island and mainland
populations of the grey parrot (Psittacus erithacus), and implications for conservation.
Molecular ecology. 16(8): 1673-1685.
------153------
------LITERATURE CITED
Meyer A. 1994. Shortcomings of the cytochrome b gene as a molecular marker. Trends Ecol.
Evol. 9: 278–280.
Mindell DP, Sorenson MD, Huddleston CJ, Miranda HC and Knight A. 1997. Phylogenetic
relationships among and within select avian orders based on mitochondrial DNA. Avian
molecular evolution and systematics. 214–247.
Miyaki CY, Matioli SR, Burke T and Wajntal A. 1998. Parrots evolution and paleogeographycal
events: mitochondrial DNA evidence Mol Biol Evol. 15: 544–551.
Morgan-Richards M, SA Trewick, A Bartosch-Härlid, O Kardailsky, MJ Phillips, PA
McLenachan and D Penny, 2008. Bird evolution: testing the Metaves clade with six new
mitochondrial genomes. BMC Evolutionary Biology, 8: 20.
Moritz C, Dowling T and Brown W. 1987. Evolution of animal mitochondrial DNA: relevance
for population biology and systematics. Annual review of ecology and systematics. 18:
269-292.
Nijman IJ, Otsen M, Verkaar EL, de Ruijter C and Hanekamp E. 2003. Hybridization of banteng
(Bos javanicus) and zebu (Bos indicus) revealed by mitochondrial DNA, satellite DNA,
AFLP and microsate lites. Heredity. 90: 10–16.
Parson W, Pegoraro K, Niederstatter H, Foger M and Steinlechner M. 2000. Species
identification by means of the cytochrome b gene. International Journal of Legal
Medicine. 114(1-2): 23-28.
Parsons K, Balcomb III K, Ford J and Durban J. 2009. The social dynamics of southern resident
killer whales and conservation implications for this endangered population. Animal
Behaviour. 77(4): 963-971.
------154------
------LITERATURE CITED
Pereira SL and Baker AJ. 2006. A mitogenomic timescale for birds detects variable phylogenetic
rates of molecular evolution and refutes the standard molecular clock. Molecular Biology
and Evolution. 23(9): 1731-1740.
Prakash V, Pain D, Cunningham A, Donald P, Prakash N, Verma A, Gargi R, Sivakumar S and
Rahmani A. 2003. Catastrophic collapse of Indian white-backed Gyps bengalensis and
long-billed Gyps indicus vulture populations. Biological conservation. 109(3): 381-390.
Pithon JA and Dytham C. 1999. Census of the British population of Ring-necked Parakeets
Psittacula krameri by simultaneous roost counts. Bird Study. 46: 112–115
Quinn TW and Wilson AC. 1993. Sequence evolution in and around the mitochondrial control
region in birds. Journal of Molecular Evolution. 37(4): 417-425.
Quinn TW 1997. Molecular evolution of the mitochondrial genome. Avian molecular evolution
and systematics, Academic Press, London. 3–28.
Quintero E, Ribas CC and Cracraft J. 2013. The Andean Hapalopsittaca parrots (Psittacidae,
Aves): an example of montane‐tropical lowland vicariance. Zoologica Scripta. 42(1): 28-
43.
Rand DM and Harrison RG. 1986. Mitochondrial DNA transmission genetics in crickets.
Genetics. 114(3): 955-970.
Randi E and Lucchini V. 1998. Organization and evolution of the mitochondrial DNA control
region in the avian genus Alectoris. Journal of Molecular Evolution. 47(4): 449-462.
Rastogi G, Dharne MS, Walujkar S, Kumar A, Patole MS and Shouche YS. 2007. Species
identification and authentication of tissues of animal origin using mitochondrial and
nuclear markers. Meat science. 76(4): 666-674.
------155------
------LITERATURE CITED
Ribas CC, Gaban‐Lima R, Miyaki CY and Cracraft J. 2005. Historical biogeography and
diversification within the Neotropical parrot genus Pionopsitta (Aves: Psittacidae).
Journal of Biogeography. 32(8): 1409-1427.
Ribas CC and Miyaki CY. 2004. Molecular systematics in Aratingaparakeets: species limits and
historical biogeography in the solstitialisgroup, and the systematic position of Nandayus
nenday. Molecular phylogenetics and evolution. 30(3): 663-675.
Ruddiman WF and Kutzbach JE. 1991. Plateau uplift and climatic change. Sci. Am. (264): 66.
Russello M, Stahala C, Lalonde D, Schmidt K and Amato G. 2010. Cryptic diversity and
conservation units in the Bahama parrot. Conservation Genetics. 11(5): 1809-1821.
Russello MA and Amato G. 2004. A molecular phylogeny of Amazona: implications for
Neotropical parrot biogeography, taxonomy, and conservation. Molecular Phylogenetics
and Evolution. 30(2): 421-437.
Russo CM, Takezaki N and Nei M, 1996. Efficiencies of different gene and different tree-
building methods in recovering a known vertebrate phylogeny. Mol. Biol. Evol., 13: 525–
536.
Saccone C, Lanave C, Pesole G and Preparata G. 1990. Influence of base composition on
quantitative estimates of gene evolution. Methods in enzymology. 183: 570-584.
Saif R, Babar ME, Awan AR, Nadeem A, Hashmi A-S and Hussain T. 2012. DNA fingerprinting
of Pakistani buffalo breeds (Nili-Ravi, Kundi) using microsatellite and cytochrome b
gene markers. Molecular biology reports. 39(2): 851-856.
Schierup MH and Hein J. 2000. Consequences of recombination on traditional phylogenetic
analysis. Genetics. 156(2): 879-891.
------156------
------LITERATURE CITED
Severin K, Mašek T, Janicki Z, Konjević D, Slavica A and Hrupački aT. 2006. Copunisation of
pheasants at different age.Veterinarski Arhiv. (76): 211-219
Sambrook J and Russell DW. 2001. Molecular cloning: a laboratory manual (3-volume set).
Schweizer M, Seehausen O, Güntert M and Hertwig ST. 2010. The evolutionary diversification
of parrots supports a taxon pulse model with multiple trans-oceanic dispersal events and
local radiations. Molecular Phylogenetics and Evolution. 54(3): 984-994.
Shapiro B, Sibthorpe D, Rambaut A, Austin J, Wragg GM, Bininda-Emonds OR, Lee PL and
Cooper A. 2002. Flight of the dodo. Science. 295(5560): 1683-1683.
Shapiro MD, Kronenberg Z, Li C, Domyan ET, Pan H, Campbell M, Tan H, Huff CD, Hu H and
Vickrey AI. 2013. Genomic Diversity and Evolution of the Head Crest in the Rock
Pigeon. Science. 339(6123): 1063-1067.
Simons C, Frati F, Beckenbach A, Crespi B, Liu H and Floors P. 1994. Evolution, weighting,
and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved
polymerase chain reaction primers. Annals of the entomological Society of America.
87(6): 651-701.
Singh TR, Shneor O and Huchon D. 2008. Bird mitochondrial gene order: insight from 3 warbler
mitochondrial genomes. Molecular Biology and Evolution. 25(3): 475-477.
Slatkin M, 1985. Gene flow in natural populations. Annu. Rev. Ecol. Syst., 16: 393-430.
Stringham SA, Mulroy EE, Xing J, Record D, Guernsey MW, Aldenhoven JT, Osborne EJ and
Shapiro MD. 2012. Divergence, convergence, and the ancestry of feral populations in the
domestic rock pigeon. Current Biology. 22(4): 302-308.
------157------
------LITERATURE CITED
Tamura K, Peterson D, Peterson N, Stecher G, Nei M and Kumar S. 2011. MEGA5: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Molecular Biology and Evolution. 28(10): 2731-2739.
Tanveer A, Shahzad M. and Chaudhry A.A. 2001. Avian fauna of Punjab University, Lahore. J.
Zool. 17(35-51).
Tautz D. 1989. Hypervariabflity of simple sequences as a general source for polymorphic DNA
markers. Nucleic acids research. 17(16): 6463-6471.
Tavares ES, Baker AJ, Pereira SL and Miyaki CY. 2006. Phylogenetic relationships and
historical biogeography of neotropical parrots (Psittaciformes: Psittacidae: Arini) inferred
from mitochondrial and nuclear DNA sequences. Systematic Biology. 55(3): 454-470.
Thomas J, Touchman J, Blakesley R, Bouffard G, Beckstrom-Sternberg S, Margulies E,
Blanchette M, Siepel A, Thomas P and McDowell J. 2003. Comparative analyses of
multi-species sequences from targeted genomic regions. Nature. 424(6950): 788-793.
Tobe SS and Linacre AMT. 2008. A multiplex assay to identify 18 European mammal species
from mixtures using the mitochondrial cytochrome b gene. Electrophoresis. 29(2): 340-
347.
Troy CS, MacHugh DE, Bailey JF, Magee DA, Loftus RT, Cunningham P, Chamberlain AT,
Skyes BC and Bardley DG. 2001. Genetic evidence for Near-Estern origion of European
cattle. Nature. 410: 1088-1091.
Tsai LC, Lee JCI, Liao SP, Weng LH, Linacre A and Hsieh HM. 2009. Establishing the
mitochondrial DNA D‐loop structure of Columba livia. Electrophoresis. 30(17): 3058-
3062.
------158------
------LITERATURE CITED
Unajak S, Meesawat P, Anyamaneeratch K, Anuwareepong D, Srikulnath K and
Choowongkomon K. 2011. Identification of species (meat and blood samples) using
nested-PCR analysis of mitochondrial DNA. African Journal of Biotechnology. 10(29):
5670-5676.
Urantowka AD, Grabowski KA and Strzala T. 2013. Complete mitochondrial genome of Blue-
crowned Parakeet (Aratinga acuticaudata)-phylogenetic position of the species among
parrots group called Conures. Mitochondrial DNA.
Wenner TJ, Russello MA and Wright TF. 2012. Cryptic species in a Neotropical parrot: genetic
variation within the Amazona farinosa species complex and its conservation implications.
Conservation Genetics. 13(5): 1427-1432.
Whelan CJ, Wenny DG and Marquis RJ. 2008. Ecosystem services provided by birds. Annals of
the New York Academy of Sciences. 1134(1): 25-60.
Wilson K, Cahill V, Ballment E and J. B. 2000. . The complete sequence of the mitochondrial
genome of the crustacean Penaeus monodon: are malacostracan crustaceans more closely
related to insects than to branchiopods. Mol Biol Evol. 17: 863–874.
Winker K, Graves GR and Braun MJ. 2000. Genetic differentiation among populations of a
migratory songbird: Limnothlypis swainsonii. J. Avian Biol. 31: 319–328
Wright TF, Schirtzinger EE, Matsumoto T, Eberhard JR, Graves GR, Sanchez JJ, Capelli S,
Müller H, Scharpegge J and Chambers GK. 2008. A multilocus molecular phylogeny of
the parrots (Psittaciformes): support for a Gondwanan origin during the Cretaceous.
Molecular Biology and Evolution. 25(10): 2141-2156.
Yang Z. 1996. Among-site rate variation and its impact on phylogenetic analyses. Trends in
Ecology & Evolution. 11(9): 367-372.
------159------
------LITERATURE CITED
Yeh F, Rong-Cai C and Boyle T. 1998. POPGENE V. 1.31: Microsoft-based freeware for
population genetic analysis. University of Alberta, Edmonton, Canada.
Yoder AD and Nowak MD. 2006. Has vicariance or dispersal been the predominant
biogeographic force in Madagascar? Only time will tell. Annual Review of Ecology
Evolution and Systematics. (37): 405–431.
Zardoya R, Y Cao, M Hasegawa and A Meyer, 1998. Searching for the closest living relative(s)
of tetrapods through evolutionary analyses of mitochondrial and nuclear data. Molecular
Biology and Evolution, 15: 506-517.
Zardoya R and A Meyer, 1996. Evolutionary relationships of the coelacanth, lungfishes, and
tetrapods based on the 28S ribosomal RNA gene. Proceedings of the National Academy
of Sciences, 93: 5449-5454.
Zhisheng A, Kutzbach JE, Prell WL and Porter SC. 2001. Evolution of Asian monsoons and
phased uplift of the Himalaya Tibetan plateau since Late Miocene times. Nature. (411):
62–66.
Zink RM. 2001. The geography of mitochondrial DNA variation in two sympatric sparrows.
Evolution. 329-339.
------160------
------APPENDIX
APPENDIX
FORMULATIONS:
All recipes marked with „A‟ strongly recommend autoclaving of the reagent prepared.
50x TAE (1L) A: Trizma base 242g Glacial AceticAcid 57.1mL 0.5 M EDTA 100mL Water VST 1L
1x TAE (1L) A: 50x TAE 20mL Water VST 1L
0.5 M EDTA (pH=8.0, 1L) A: EDTA 186.1g NaOH Few pellets to dissolve EDTA Water VST 1L
1M Tris-HCl (pH= 8.0, 1L) A: Trizma base crystals 121.1g Deionized water 220mL Concentrated HCl VST raise the pH to 7.4 Deionized water VST 1000mL
------161------
------APPENDIX
Sodium Chloride (6M, 1L) A: Sodium chloride crystals 351.0g De ionized water VST 1000mL
Tris-EDTA (10mM Tris and 1mM EDTA, pH=8.0, 1L) A: 1M Tris-HCl soln. 10mL 0.5M EDTA soln. 4mL De-ionized water VST 1000mL
10N Sodium Hydroxide (100mL): NaOH pellets 40g De-ionized water VST 100mL
10%SDS: Sodium Dodecyl Sulfate (Sodium Lauryl Sulfate) 10gm De-ionized water 100mL Stored at room temperature.
Ethidium Bromide: Ethidium bromide 500mg De-ionized water 10mL Stored in Aluminum foiled tube
Ethanol (95%): Absolute Ethanol 95mL De-ionized water 5mL Store chilled at –20°C.
------162------
------APPENDIX
Ethanol (70%): Absolute Ethanol 70mL De-ionized water 30mL Stored chilled at –20°C.
Self-digested Proteinase K (20mg/ml): Protein K pack 100mg Tris-EDTA-SDS (100mM Tris, pH 8.0, 40m MEDTA, 0.05%SDS) 5ml incubated at 37°C for 30 minutes. Made 50μL aliquots and store at –20°C.
Loading solution (6X): Glycerol 50mL Bromophenol blue 100mg EDTA (0.5M, pH 8.0) 20mL De-ionized water VST 100mL
------163------
------APPENDIX
ABBREVIATIONS
DNA Deoxyribonucleic acid Nm Nano meter
µg (Mue) micro gram Min Minutes
µL (Mue) micro litre mL Millie Liters
bp Base pair NaCl sodium Chloride
Di De-ionized ng Nano gram
EDTA Ethylene Diamide Tetra-Acetic acid PCR Polymerase chain reaction
G/gm Gram rpm Revolution Per Minute
Kb Kilo bases S Second (s)
L Litre S# Serial number
M Molar S.E. Standard Error
mg Mili Gram SDS Sodium Dodecyl sulfate
Tris Trizma base Soln. Solution
TE Tris EDTA(buffer) SNP Single Nucleotide Polymorphism
APS Ammonium per sulphate SSC Sodium chloride sodium citrate
na Observed number of alleles Taq Thermusaquaticus
------164------