Supplementary Figure Legends
Supplementary Fig. 1. Gonadal NR5A1+ cells are a source of Nestin+ cells in the fetal ovary.
(a-f) Immunofluorescence images of E11.5 (a,b) or E12.5 (c-f) fetal ovaries labeled with
Mitotracker and cultured ex vivo. (a) E11.5 gonad immediately after initial 30-minute incubation with MitoTracker dye, showing labeling limited to coelomic surface epithelial cells.
(b) After 48-hour culture, coelomic epithelial cells labeled by MitoTracker migrated into the gonad. MitoTracker label did not overlap with Nestin. (c) E12.5 gonad immediately after initial
30-minute incubation with MitoTracker dye, showing labeling limited to surface coelomic epithelial cells. (d-f) After 48-hour culture, epithelial cells labeled by MitoTracker migrated into the gonad. MitoTracker label did not overlap with Nestin (e). MitoTracker-labeled epithelial cells that remained on the coelomic surface co-expressed Nestin (f, arrowheads). (g,h)
Immunofluorescence images of E13.5 Nestin-CreER;Rosa-Tomato fetal ovaries exposed to 4- hydroxytamoxifen (4-OHT) at E12.5. Nestin+ cells are NR5A1-positive (g) but WT1-negative
(h). b’, g’, and h’ are higher-magnification images of the boxed regions in b, g, and h. e and f are higher-magnification images of the corresponding boxed regions in d. Dashed lines indicate gonad-mesonephros border. Scale bars: 50 μm.
Supplementary Fig. 2. Initial Tomato labeling in Nestin+ cell lineage tracing marks perivascular cells in fetal and postnatal ovaries.
(a-d) Immunofluorescence images of Nestin-CreER;Rosa-Tomato fetal and postnatal ovaries exposed to 4-OHT at E15.5 (a), E18.5 (b), P2 (c), and P4 (d). Images were taken 24 hours after 4-OHT injection, demonstrating initial Tomato reporter labeling. In E15.5-injected samples (a),
Tomato-labeled cells were perivascular and mutually exclusive of FOXL2 expression. While at all stages the vast majority of Tomato-labeled cells were FOXL2-negative, occasional
Tomato-positive cells co-expressed FOXL2 (b-d, arrowheads). Scale bars: 50 μm.
Supplementary Fig. 3. Perivascular Nestin+ progenitors are multipotent and give rise to multiple ovarian cell types.
(a-x) Long-term lineage-tracing experiments for Nestin+ cells in Nestin-CreER;Rosa-Tomato juvenile (P30) and adult (P60) ovaries, exposed to 4-OHT at E15.5 (a-f), E18.5 (g-l), P2 (m-r), or P4 (s-x). P30 and P60 ovaries were examined for Tomato, steroidogenic cell marker
HSD3B1, smooth-muscle cell marker ACTA2 (also called αSMA), and pericyte marker CSPG4
(also called NG2). HSD3B1 was observed not only in the theca cell layer but also in interstitial cells. ACTA2 was expressed in the theca layer. CSPG4 was expressed in both the theca layer and in pericytes. Arrowheads indicate Tomato+ cells of interest labeled by each antibody. Scale bars: 50 μm.
Supplementary Fig. 4. Pattern and timing of active Notch signaling in fetal and postnatal ovaries.
(a) Images of E15.5, E18.5, P2, and P4 ovaries from CBF:H2B-Venus mice (active Notch signaling reporter). Few ICAM2-labeled endothelial cells (white arrows) and Nestin+ cells adjacent to the vasculature (yellow arrows) were Venus+ at E15.5. At E18.5, the number of
Venus+ cells increased, were down-regulated at P2, and by P4 few Venus+ cells were detected in the ovary. (b-e) qRT-PCR analyses showing fold change in Notch target gene (Hes1 (b),
Hes5 (c), Hey1 (d), Heyl (e)) mRNA levels in ovaries at various developmental stages.
Different letters indicate statistically different values (P<0.05; two-tailed Student’s t-test). qRT-
PCR values in b-e are presented as mean ± SD. (f) Image of P2 CBF:H2B-Venus ovary. Perivascular Venus+ cells did not express FOXL2 (blue arrowhead), while cortical
Venus+ cells co-expressed FOXL2 (white arrowheads). Scale bars: 50 μm.
Supplementary Fig. 5. Active Notch signaling induces expression of Nestin in perivascular cells.
(a) qRT-PCR analyses showing fold change in Cdh5 and Nestin mRNA levels after blockade of Notch signaling via DAPT treatment at E18.5 for 12, 18, or 24 hours. *, P<0.05, **, P<0.01; two-tailed Student’s t-test. qRT-PCR values in A are presented as mean ± SD. (b,c)
Immunofluorescence images of P1 Nestin-CreER; Rosa-Tomato; Rosa-NICD fetal ovaries exposed to 4-OHT at E18.5, showing that perivascular Nestin-derived Tomato+ cells were increased in NICD+ ovaries as compared to controls; however, Tomato+ cells did not co- localize with MKI67 (Ki67) or phospho-histone H3 (pHH3). Scale bars: 50 μm.
Supplementary Fig. 6. In vivo ablation of Nestin+ cells in the postnatal ovary is highly efficient.
(a,b) Immunofluorescence images of P7 (a) and P21 (b) control (Nestin-CreER;Rosa-Tomato) and DTA+ (Nestin-CreER;Rosa-Tomato;Rosa-eGFP-DTA) postnatal ovaries exposed to 4-
OHT at P2 and P4. DTA+ ovaries exhibited a complete ablation of Tomato+ cells. In controls, Tomato+ cells co-expressed the granulosa cell marker FOXL2 in both P7 and P21 ovaries.
GCNA (TRA98) labels germ cells. Scale bars: 50 μm.
Supplementary Table 1. Primary antibodies used for immunofluorescence.
Primary Antibody Dilution Source/Reference
Rabbit anti-ACTA2 (αSMA) 1:500 Abcam #ab5694
Rabbit anti-CSPG4 (NG2) 1:500 Millipore-Sigma #AB5320
Rabbit anti-FOXL2 1:500 D. Wilhelm (Polanco, et al., 2010)
Rat anti-GCNA (TRA98) 1:1,000 Abcam #ab82527
Rabbit anti-HSD3B1 1:500 Cosmo Bio #KAL-KO607
Rat anti-ICAM2 (CD102) 1:1,000 Bio-Rad #MCA2295
Rabbit anti-MKI67 (Ki67) 1:500 GeneTex #GTX16667
Rabbit anti-Nestin 1:1,000 BioLegend #PRB-315C
Rat anti-NR5A1 1:200 Cosmo Bio #KAL-KO610
Rat anti-PECAM1 1:250 BD Pharmingen #553370
Rabbit anti-phospho-
histone H3 (Ser10) 1:500 Millipore-Sigma #06-570
Mouse anti-WT1 (F-6) 1:100 Santa Cruz #sc-7385
Supplementary Table 2. Sequences of primers used for qRT-PCR analyses.
Gene name Sequence (5’ to 3’)
Cdh5 forward TCCTCTGCATCCTCACTATCACA
Cdh5 reverse GTAAGTGACCAACTGCTCGTGAAT
Nestin forward GCTGGAACAGAGATTGGAAGG
Nestin reverse CCAGGATCTGAGCGATCTGAC
Hes1 forward ATAGCTCCCGGCATTCCAAG
Hes1 reverse GCGCGGTATTTCCCCAACA
Hes5 forward AGTCCCAAGGAGAAAAACCGA
Hes5 reverse GCTGTGTTTCAGGTAGCTGAC
Hey1 forward GCGCGGACGAGAATGGAAA
Hey1 reverse TCAGGTGATCCACAGTCATCTG
Heyl forward CAGCCCTTCGCAGATGCAA
Heyl reverse CCAATCGTCGCAATTCAGAAAG
Foxl2 forward GCTACCCCGAGCCCGAAGAC
Foxl2 reverse GTGTTGTCCCGCCTCCCTTG
Gapdh forward AGGTCGGTGTGAACGGATTTG
Gapdh reverse TGTAGACCATGTAGTTGAGGTCA
References
Polanco, J.C., Wilhelm, D., Davidson, T.L., Knight, D., and Koopman, P. (2010). Sox10 gain- of-function causes XX sex reversal in mice: implications for human 22q-linked disorders of sex development. Hum Mol Genet 19, 506-16. E11.5 a E11.5 b b’
0 hr 48 hrs Nestin MitoTracker Nuclei E11.5 E11.5
0 hr 48 hrs MitoTracker c E12.5 d E12.5 e f F E
0 hr 48 hrs Nestin MitoTracker Nuclei
0 hr 48 hrs MitoTracker g E13.5 g’
NR5A1 Tomato Nuclei Tomato NR5A1 h E13.5 h’
WT1 Tomato Nuclei Tomato WT1
Supplemental Fig. 1 4-OHT @ E15.5 a
E16.5 4-OHT @ E18.5 b
P1 4-OHT@ P2 c
P3 4-OHT @ P4 d
P5
FOXL2 Tomato ICAM2 Nuclei Tomato FOXL2
Supplemental Fig. 2 4-OHT
E15.5 E18.5 P2 P4 a g m s
P30 P30 P30 P30 b h n t
P60 P60 P60 P60 HSD3B1 Tomato Nuclei c i o u
P30 P30 P30 P30 d j p v
P60 P60 P60 P60 ACTA2 Tomato Nuclei e k q w
P30 P30 P30 P30 f l r x
P60 P60 P60 P60 CSPG4 Tomato Nuclei
Supplemental Fig. 3 a E15.5 E18.5
P2 P4
CBF:H2B-Venus Nestin ICAM2 Nuclei
5 b 80 c a a ab
ab 4 mRNA 60 mRNA 3
b Hes1 40 Hes5 ab 2
20 c 1 b c c c d
0 levels relative to E12.5relativeto levels
0 E12.5relativeto levels
Fold change in Foldchange Fold change in Foldchange d 6 e 300
a a
mRNA mRNA 4 200 bc b
b Heyl c Hey1 c cd 2 100 cd cd d
d levels relative to E12.5relativeto levels
0 E12.5relativeto levels 0
Fold change in Foldchange Fold change in Foldchange
f
P2 CBF:H2B-Venus Venus FOXL2 Nuclei FOXL2 ICAM2
Supplemental Fig. 4 a 2 12 hrs 18 hrs 24 hrs
1
0.50.5
relative controls relative to 0.250.25 Cdh5 Nestin
Fold change in mRNA levels in mRNAlevels change Fold * ** ** 0.1250.125
b c
Control NICD+
MKI67 Tomato Tomato pHH3 Tomato Tomato ICAM2 Nuclei ICAM2 Nuclei
Supplemental Fig. 5 a b Control Control
P7 P21 DTA+ DTA+
P7 Tomato P21 Tomato FOXL2 Tomato GCNA Nuclei FOXL2 Tomato GCNA Nuclei
Supplemental Fig. 6