CONSTRUCTION OF ADENOVIRUSES AND
RETROVIRUSES OF RECOMBINANT IRON
METABOLISM GENES AND THEIR APPLICATION
IN THE STUDIES ON IRON METABOLISM
GE XIAOHU
THE DEGREE OF DOCTOR OF PHILOSOPHY
THE HONG KONG POLYTECHNIC UNIVERSITY
2010
The Hong Kong Polytechnic University
Department of Applied Biology & Chemical Technology
CONSTRUCTION OF ADENOVIRUSES AND
RETROVIRUSES OF RECOMBINANT IRON
METABOLISM GENES AND THEIR APPLICATION
IN THE STUDIES ON IRON METABOLISM
GE XIAOHU
A THESIS SUBMITTED IN PARTIAL FULFILMENT OF
THE REQUIREMENTS FOR THE DEGREE OF DOCTOR
OF
PHILOSOPHY
June 2009
2 CERTIFICATE OF ORIGINALITY
I hereby declare that this thesis in my own work and that, to the best of my knowledge and belief, it reproduces no material previously published or written nor material which has been accepted for the award of any other degree or diploma, except where due acknowledgement has been made in the text.
…………………………………………. (Signed)
………………………………………….. (Name of Student)
3
Abstract of thesis entitled ‘construction of adenoviruses
and retroviruses of recombinant iron metabolism genes
and their application in the studies on iron metabolism’
Submitted by
Ge Xiaohu
For the degree of Doctor of Philosophy
At The Hong Kong Polytechnic University in June 2009
Abstract
Human iron metabolism is the set of chemical reactions that maintains human homeostasis of iron. Iron is essential for most lives on earth, including human beings. Iron participates in a series of cellular metabolic processes in the brain, for example, as tyrosine hydroxylase, and cofactor for the enzymes. Iron is also essential for the biosynthesis of CNS lipids and cholesterol. In oligodendroglia, it plays an important role in action of metabolic enzymes as a co-factor. But excessive iron is damaging to the brain and may lead to many neurodegenerative diseases. The existence of excessive total brain iron, a common feature of some neurodegenerative diseases, is thought to be a cause of many such diseases. A significant increased concentration of brain iron is found in the neuronal systems
4 or some specific brain regions in some neurodegenerative diseases. In iron metabolism, Divalent metal transporter 1 (DMT1), Transferrin receptors 1
(TfR1), Ferroportin1 (FPN1), Hephaestin (Heph), hepcidin (Hepc) are important iron-related protein and regulative peptide. In order to investigate the effects of these iron-related genes on neurodegenerative diseases, we constructed a series of recombinant adenoviruses and retroviruses, including rAd-DMT1 (+), rAd-DMT1 (-), rAd-FPN1, rAd-Heph, rAd-Hepc, Retro-DMT1, Retro-FPN1,
Retro-Heph, and Retro-Hepc through molecular biological technology. All these recombinant virus products were applied to primary culture neurons or some cell lines. Our results proved that there are high biological expression activities of these recombinant adenoviruses and retroviruses in cells. In this study, we also provided solid evidence for the first time for the association of DMT1-IRE with neurotoxicity induced by L-DOPA. We believe that inhibition of DMT1-IRE expression or neuronal iron uptake might be an effective approach to prevent or delay the development of neurotoxicity induced by L-DOPA in PD patients through the retrovirus gene knockout system. Furthermore, we investigated the regulating effects of hepcidin, an iron regulatory peptide, in neurons through rAd-hepc and retro-hepc. Our results suggested that hepcidin has the ability to regulate the expression of some iron related genes as an upstream regulatory factor, such as FPN1, DMT1 (+), DMT1 (-) etc. This thesis consists of 9 chapters, beginning with a general introduction, followed by the methodology section, and
6 chapters on results, and ends with suggestions on future work.
LIST OF PUBLICATIONS
5
1. Ge Xiaohu, Wang qin, Qian zhongming et al. The iron regulatory hormone
hepcidin reduces ferroportin 1 content band iron release in H9C2
cardiomyocytes, Journal of Nutritional biochemistry, 2008. Article in Press.
(IF 3.5)
2. Wang, Q., Du, F., Qian, Z.M., Ge, X.H., Zhu, L., Yung, W.H., Yang, L., and
Ke, Y. (2008). Lipopolysaccharide induces a significant increase in
expression of iron regulatory hormone hepcidin in the cortex and substantia
nigra in rat brain. Endocrinology 149, 3920-3925 (IF 6.0)
3. Qian, Z.M., Chang, Y.Z., Zhu, L., Yang, L., Du, J.R., Ho, K.P., Wang, Q., Li,
L.Z., Wang, C.Y., Ge, X., et al. Development and iron-dependent expression
of hephaestin in different brain regions of rats. J Cell Biochem (2007)102,
1225-1233.
4. Ke, Y., Ho, K., Du, J., Zhu, L., Xu, Y., Wang, Q., Wang, C.Y., Li, L., Ge, X.,
Chang, Y., et al. Role of soluble ceruloplasmin in iron uptake by midbrain
and hippocampus neurons. J Cell Biochem (2006). 98, 912-919.
5. Chang, Y.Z., Qian, Z.M., Du, J.R., Zhu, L., Xu, Y., Li, L.Z., Wang, C.Y.,
Wang, Q., Ge, X.H., Ho, K.P., et al. Ceruloplasmin expression and its role in
iron transport in C6 cells. Neurochem Int (2007).50, 726-733.
PATENTS
6
1. Inventors:ZM qian, Xiaohu G, The application and construction of anti-HJV retrovirus. Accepted. Application NO.: 200710075360.8 Publication NO. : CN101307085
2. Inventors:ZM qian, Xiaohu G, The application and methodology of FPN recombinant adenovirus, Accepted. Application NO. : 200710125467.9 Publication NO. : CN101210255
3. Inventors:ZM qian,Xiaohu G，The application and methodology of hepcidin recombinant adenovirus, Accepted. Application NO. : 200710075462.X
4. Inventors:ZM qian, Xiaohu G ， The application and construction of anti-hecpcidin retroviru, Accepted. Application NO. : 200810141910.6
5. Inventors: ZM qian, Xiaohu G， The application and construction of anti-DMT1 retrovirus, Accepted. Application NO. : 200810141912.5
6. Inventors:ZM qian, Xiaohu G ， The application and construction of anti-FPN1 retrovirus, Accepted. Application NO. : 200810141911.0
7. Inventors: ZM qian, Xiaohu G， The application and methodology of two
kinds of DMT1 recombinant adenovirus, Accepted. Application NO. :
200810141913.
ACKNOWLEDGEMENTS
7
The investigations described in this thesis were carried out in the Laboratory of
Iron Metabolism in the Department of Applied Biology and Chemical
Technology (ABCT), The Hong Kong Polytechnic University. I am especially indebted to my Chief Supervisor, Prof. Qian Zhong-ming, for his outstanding guidance, sincere encouragement, and helpful advice throughout the course of this work. It would have been impossible for me to complete this thesis without him. I am also grateful to Prof. Wong Kwok-Yin, Prof. Lau Chak-po, Prof. Lo
Chun-lap and Dr. Chow Ming-cheung for their encouragement and valuable suggestions. I am much indebted to the Departmental Research Committee of the
ABCT Department and the Research Committee of The Hong Kong Polytechnic
University for giving me a Research Scholarship and supporting my study in this university.
I would also like to thank Dr. Ke Ya, Dr. Li Lian-zhi, Dr. Wang Cheng-yuan, Dr.
Wang Qin, Ms. Wang Xiao-yun and all other colleagues in our research group for their kind help and strong support. With all my heart, I would like to thank my parents, Ge Chu-xing and Shi Feng-yi, my wife, Liang Yong-hong, my sisters and brothers-in-law, Ge Xiao-hong, Cai Li-ming and Ge Xiao-ni, Zhong
Tao for their unconditional love, endless encouragement and understanding. I am also grateful to all those who encouraged and supported me throughout my life.
Finally, I hope to dedicate this thesis to my darling daughter YoYo.
The List of Content
8 1 CHAPTER 1 INTRODUCTION ...... 28
1.1 INTRODUCTORY STATEMENT ...... 28
1.2 GENERAL DESCRIPTION OF IRON METABOLISM ...... 28
1.2.1 Iron absorption ...... 29
1.2.2 Genetic Insights into Mammalian Iron Absorption ...... 32
1.2.3 Erythropoiesis and Iron Absorption ...... 33
1.2.4 Body iron stores ...... 34
1.2.5 Cells iron uptake from body ...... 35
1.2.5.1 Tf and TfR Dependent Iron Uptake ...... 37
1.2.5.2 Tf and TfR Independent Iron Uptake ...... 38
1.2.6 Iron efflux ...... 42
1.3 BRAIN IRON METABOLISM PROTEINS ...... 43
1.3.1 Transferrin Receptor 1 ...... 43
1.3.1.1 Transferrin Receptor and Transferrin Receptor 2 ...... 44
1.3.1.2 Molecular Characterization and Expression of TfR1 and TfR2 ...... 44
1.3.1.3 Regulation of TfR and TfR2 Gene Expression ...... 46
1.3.1.4 Transferrin Receptor in the Brain ...... 47
1.3.2 Divalent Metal Transporter 1 ...... 49
1.3.2.1 Characteristic of DMT1 Gene and Protein ...... 49
9 1.3.2.2 Expression and Regulation of DMT1 Gene ...... 51
1.3.2.3 Functions of DMT1 ...... 54
1.3.2.4 DMT1 and Brain Iron Metabolism ...... 56
1.3.3 Ferroportin 1 ...... 57
1.3.3.1 Characteristic of Ferroportin1 Gene and Protein ...... 58
1.3.3.2 Expression and Regulation of FPN1 Gene...... 59
1.3.3.3 Functions of Ferroportin1 ...... 60
1.3.3.4 Ferroportin1 and Brain Iron Metabolism ...... 61
1.3.4 Hephaestin ...... 63
1.3.4.1 Hephaestin Gene and Sex-linked Anemia ...... 63
1.3.4.2 Characteristic of Hephaestin ...... 64
1.3.4.3 Function and distribution of Hephaestin ...... 65
1.3.4.4 Regulation of Hephaestin Gene Expression ...... 66
1.3.5 Hepcidin ...... 67
1.3.5.1 Structure of Hepcidin ...... 68
1.3.5.2 Expression and Regulation of Hepcidin ...... 69
1.3.5.2.1 Iron Overload: ...... 69
1.3.5.2.2 Infection and inflammation: ...... 69
1.3.5.2.3 Anemia and hypoxia: ...... 71
10 1.3.5.3 Hepcidin Regulation of Iron Homeostasis ...... 72
1.3.5.4 Hepcidin and Brain Iron Metabolism ...... 76
1.4 CURRENT KNOWLEDGE OF BRAIN IRON METABOLISM ...... 76
1.4.1 Iron Uptake and Transport in the brain ...... 78
1.4.2 Iron Storage in the brain ...... 80
1.4.3 Intracellular Iron Utilization ...... 81
1.4.4 Iron Recycling and Export ...... 81
1.4.5 Mechanisms of Iron Homeostasis ...... 83
1.4.6 Neurodegenerative Disorders Associated with Increased Total Iron Content ...... 83
1.4.6.1 Alzheimer Disease ...... 85
1.4.6.2 Parkinson Disease ...... 86
1.4.7 Iron Deficiency and CNS Dysfunction ...... 87
1.5 BIOLOGICAL ACTIVITY OF RECOMBINANT ADENOVIRUS AND RETROVIRUS ...... 88
1.5.1 Recombinant adenovirus ...... 88
1.5.2 Recombinant retrovirus ...... 92
1.6 APPLICATION OF RECOMBINANT ADENOVIRUS AND RETROVIRUS ON BRAIN IRON
METABOLISM ...... 94
1.7 OBJECTIVE ...... 95
1.7.1 Part 1 ...... 95
11 1.7.2 Part 2 ...... 95
1.7.3 Part 3 ...... 96
1.7.4 Part 4 ...... 96
2 CHAPTER 2 METHODOLOGY ...... 97
2.1 MATERIALS ...... 97
2.1.1 Reagents and Analysis Kits ...... 97
2.1.2 Apparatus ...... 100
2.2 CELL CULTURE ...... 101
2.2.1 Primary rat’s neuron culture...... 101
2.2.1.1 Reagents and solutions ...... 101
2.2.1.2 Poly-D-lysine coated plates ...... 104
2.2.1.3 Culture of hippocampal neurons from embryonic day 18 rat ...... 105
2.2.2 Cell lines culture ...... 111
2.3 METHODS OF MOLECULE BIOLOGY ...... 112
2.3.1 RT-PCR ...... 112
2.3.1.1 RNA Preparation ...... 112
2.3.1.2 cDNA Synthesis ...... 112
2.3.2 Extract animal genome DNA ...... 113
2.3.3 Real-time PCR ...... 116
12 2.3.3.1 Principle: ...... 116
2.3.3.2 Procedure: ...... 117
2.3.3.3 Calculate: ...... 117
2.3.4 Western blot ...... 118
2.3.3.4 Protein Determination (DC Protein Assay kit, Bio-Rad, USA) ...... 118
2.3.3.5 Western Blot ...... 119
2.3.3.5.1 Principle ...... 119
2.3.3.5.2 Procedure: ...... 120
2.3.4 Lipofectine transfection ...... 121
2.3.5 Histochemistry assay ...... 123
2.4 CONSTRUCTION OF RECOMBINANT ADENOVIRUS ...... 125
2.5 CONSTRUCTION OF RECOMBINANT RETROVIRUS ...... 131
2.6 METHODS OF RADIATION ...... 133
2.6.1 Non-transferrin bound iron uptake Assay ...... 133
2.6.2 Transferrin bound iron uptake Assay...... 134
2.6.3 Iron release Assay ...... 136
3 CHAPTER 3 IRON UPTAKE PROTEIN: DMT1 ...... 138
3.1 INTRODUCTION ...... 138
3.2 METHODOLOGY ...... 140
13 3.2.1 Materials ...... 140
3.2.2 Acquisition of the full-length gene of DMT1 ...... 140
3.2.3 Adenovirus construction process ...... 141
3.2.4 Adenovirus infection and detection ...... 142
3.2.5 Design specific sequence for RNAi ...... 142
3.2.6 Annealing oligos ...... 142
3.2.7 Ligation into pSUper-retro-puro ...... 143
3.2.8 Packaging and application of retrovirus ...... 144
3.2.9 Titration of retrovirus ...... 145
3.3 RESULTS ...... 146
3.3.1 Construction of recombinant adenovirus DMT1 (with or without IRE) ...... 146
3.3.1.1 Acquisition of the full length of DMT1+IRE and DMT1-IRE ...... 146
3.3.1.2 Screening of pShuttle-DMT1 (+IRE) and pShuttle-DMT1 (-IRE) ...... 147
3.3.1.3 Bacterial recombinant of viral skeleton of rAd-DMT1 (+) and rAd-DMT1 (-) ...... 148
3.3.1.4 Generation of recombinant adenovirus of DMT1 (+) and DMT1 (-) ...... 150
3.3.2 Construction of recombinant retrovirus DMT1 ...... 152
3.3.2.1 Results of annealing oligos for DMT1 ...... 152
3.3.2.2 Identification of recombinant pSuper-DMT1 ...... 153
3.3.2.3 Screening of the recombinant plasmids pSuper-DMT1...... 154
14 3.3.3 Biological test of rAd-DMT1 (+/- IRE) and Retro- DMT1 (+/- IRE) ...... 155
3.3.3.1 Biological activity of rAd-DMT1 (+/- IRE) in Neurons ...... 155
3.3.3.2 Biological activity of Retro-DMT1 (+/- IRE) in Neurons ...... 157
3.4 DISCUSSION ...... 158
4 CHAPTER 4 IRON UPTAKE PROTEIN: TRANSFERRIN RECEPTOR ...... 161
4.1 INTRODUCTION ...... 161
4.2 METHODOLOGY ...... 162
4.2.1 Materials ...... 162
4.2.2 Methodology ...... 162
4.3 RESULTS ...... 163
4.3.1 Construction of recombinant adenovirus Transferrin Receptor ...... 163
4.3.1.1 Acquisition of the full length of Transferrin Receptor ...... 163
4.3.1.2 Screening of pShuttle- Transferrin Receptor ...... 164
4.3.1.3 Bacterial recombinant of viral skeleton about rAd- Transferrin Receptor ...... 165
4.3.1.4 Generation of recombinant adenovirus of Transferrin Receptor ...... 166
4.3.2 Construction of recombinant retrovirus Transferrin Receptor ...... 166
4.3.2.1 Results of annealing oligos for Transferrin Receptor ...... 166
4.3.2.2 Identification of recombinant pSuper- Transferrin Receptor ...... 166
4.3.2.3 Screening of the recombinant plasmids pSuper-TfR1 ...... 167
15 4.3.3 Biological test of rAd-TfR1 and Retro-TfR1 ...... 168
4.3.3.1 Biological activity of rAd-TfR1 ...... 168
4.3.3.2 Biological activity of retro-TfR1 ...... 170
4.4 DISCUSSION ...... 171
5 CHAPTER 5 IRON RELEASE PROTEIN: FERROPORTIN 1 ...... 175
5.1 INTRODUCTION ...... 175
5.2 METHOD ...... 177
5.3 RESULTS ...... 178
5.3.1 Construction of recombinant adenovirus Ferroportin 1 ...... 178
5.3.1.1 Acquisition of the full length of Ferroportin 1 ...... 178
5.3.1.2 Screening of pShuttle-Ferroportin 1 ...... 179
5.3.1.3 Bacterial recombinant of viral skeleton about rAd-Ferroportin 1 ...... 180
5.3.1.4 Generation of recombinant adenovirus of Ferroportin 1 ...... 181
5.3.2 Construction of recombinant retrovirus Ferroportin 1 ...... 181
5.3.2.1 Results of annealing oligos for Ferroportin 1 ...... 181
5.3.2.2 Identification of recombinant pSuper- Ferroportin 1 ...... 182
5.3.2.3 Screening of the recombinant plasmids pSuper-FPN1 ...... 183
5.3.3 Biological test of recombinant adenovirus Ferroportin 1 ...... 184
5.3.3.1 Biological activity of rAd-FPN1 in Neurons ...... 184
16 5.3.3.2 Biological activity of Retro-FPN1 in Neurons ...... 185
5.4 DISCUSSION ...... 186
6 CHAPTER 6 IRON RELEASE PROTEIN: HEPHAESTIN ...... 190
6.1 INTRODUCTION ...... 190
6.2 METHOD ...... 191
6.3 RESULTS ...... 192
6.3.1 Construction of recombinant adenovirus Hephaestin ...... 192
6.3.1.1 Acquisition of the full length of Hephaestin ...... 192
6.3.1.2 Screening of pShuttle- Hephaestin ...... 193
6.3.1.3 Bacterial recombinant of viral skeleton about rAd-Hephaestin ...... 194
6.3.1.4 Generation of recombinant adenovirus of Hephaestin ...... 195
6.3.2 Construction of recombinant retrovirus Hephaestin ...... 195
6.3.2.1 Results of annealing oligos for Hephaestin ...... 195
6.3.2.2 Identification of recombinant pSuper- Hephaestin ...... 196
6.3.2.3 Screening of the recombinant plasmids pSuper-Heph ...... 197
6.3.3 Biological test of recombinant adenovirus Hephaestin ...... 198
6.3.3.1 Biological activity of rAd-heph ...... 198
6.3.3.2 Biological activity of Retro-heph ...... 200
6.4 DISCUSSION ...... 201
17 7 CHAPTER 7 IRON REGULATORY PEPTIDE: HEPCIDIN ...... 205
7.1 INTRODUCTION ...... 205
7.2 METHODS ...... 206
7.3 RESULTS ...... 207
7.3.1 Construction of recombinant adenovirus hepcidin ...... 207
7.3.1.1 Acquisition of the full length of hepcidin ...... 207
7.3.1.2 Screening of pShuttle-hepcidin ...... 208
7.3.1.3 Bacterial recombinant of viral skeleton of rAd-hepcidin ...... 209
7.3.1.4 Generation of recombinant adenovirus of Hephaestin ...... 209
7.3.2 Construction of recombinant retrovirus hepcidn ...... 210
7.3.2.1 Results of annealing oligos for hepcidin...... 210
7.3.2.2 Identification of recombinant pSuper- hepcidin ...... 211
7.3.2.3 Screening of the recombinant plasmids pSuper-Hepcidin ...... 212
7.4 DISCUSSION ...... 213
8 CHAPTER 8 SYSTEMIC APPLICATION OF RECOMBINANT ADENOVIRUES
AND RETROVIRUSES ...... 216
8.1 PART1 L-DOPA NEUROTOXICITY IS MEDIATED BY UP-REGULATION OF DMT1-IRE
EXPRESSION ...... 216
8.1.1 Introduction ...... 216
18 8.1.2 Materials and methods ...... 219
8.1.2.1 Materials ...... 219
8.1.2.2 Primary cortical neurons ...... 219
8.1.2.3 Preparation of astrocytes culture medium ...... 220
8.1.2.4 Experimental Design ...... 220
8.1.2.5 Morphological observation ...... 221
8.1.2.6 Determination of cell viability ...... 221
8.1.2.7 Immunocytochemistry ...... 222
8.1.2.8 Hoechst 33342 staining ...... 222
8.1.2.9 IRON MEASUREMENT ...... 223
8.1.2.10 WESTERN BLOT ANALYSIS ...... 223
8.1.2.11 CONSTRUCTION OF DMT1-IRE SIRNA EXPRESSION RETROVIRUS ...... 225
8.1.2.12 MEASUREMENT OF NON-TRANSFERRIN BOUND IRON UPTAKE ...... 226
8.1.2.13 STATISTICAL ANALYSIS ...... 226
8.1.3 Results ...... 227
8.1.3.1 Neurotoxicity induced by L-DOPA: morphological evidence and significantly
decreased neuronal viability ...... 227
8.1.3.2 L-DOPA induces a significant increase in iron content in cortical neurons ...... 234
19 8.1.3.3 L-DOPA induces a significant increase in DMT1-IRE expression and ferrous iron
uptake in cortical neurons ...... 237
8.1.3.4 L-DOPA induces a significant increase in ferrous iron uptake by cortical neurons ...... 244
8.1.3.5 ACM diminishes L-DOPA-induced neurotoxicity ...... 246
8.1.3.6 ACM reduces neuron iron content and DMT1-IRE expression ...... 248
8.1.3.7 Decreased expression of DMT1-IRE induced by Retrovirus DMT1-IRE reduces
L-DOPA neurotoxicity ...... 252
8.1.4 Discussion ...... 254
8.2 PART2 THE REGULATING EFFECT OF HEPCIDIN TO RELATED IRON METABOLISM GENES IN
THE NEURONS ...... 261
8.2.1 Introduction ...... 261
8.2.2 Materials and Methods ...... 266
8.2.2.1 Materials ...... 266
8.2.2.2 Optimism Concentration and PH value of Fe55 loading in neurons ...... 266
8.2.2.2.1 Effects of different concentrations of iron in Fe55 uptake ...... 267
8.2.2.2.2 Effects of different PHs in Fe55 uptake ...... 268
8.2.2.3 Preparing neurons with high hepcidin expression ...... 268
8.2.2.4 Real-time PCR and western blot ...... 269
8.2.2.5 Isotope experiments ...... 269
20 8.2.2.5.1 Fe55 uptake experiments ...... 269
8.2.2.5.2 Fe55 release experiments ...... 270
8.2.3 Results ...... 272
8.2.3.1 The optimism Concentration of Fe55 loading ...... 272
8.2.3.2 The optimism PH values of Fe55 loading ...... 273
8.2.3.3 Photos of neurons with high hepcidin expression ...... 274
8.2.3.4 Real-time PCR of hepcidin ...... 275
8.2.3.5 Results of regulation effects of hepcidin to related proteins ...... 277
8.2.3.5.1 Hepcidin regulates FPN expression in cortical neurons ...... 277
8.2.3.5.2 Hepcidin regulates DMT1 without IRE (DMT1-IRE) expression in cortical neurons ...... 285
8.2.3.5.3 Hepcidin regulates DMT1 with IRE (DMT1+IRE) expression in cortical neurons ...... 292
8.2.3.6 Uptake of Fe55 in neurons ...... 299
8.2.3.7 Release of Fe55 in neurons ...... 302
8.2.4 Discussion ...... 305
8.3 PART3 OTHER FUNCTIONAL EXPERIMENTS OF RECOMBINANT ADENOVIRUS AND
RETROVIRUS ...... 311
8.3.1 Introduction ...... 311
8.3.2 Materials and Methods ...... 311
8.3.2.1 Materials ...... 311
21 8.3.2.2 Methods ...... 312
8.3.3 Results ...... 312
8.3.3.1 The effect of rAd-DMT1 (-IRE and +IRE) in iron uptake ...... 312
8.3.3.2 The effect of retro-DMT1 in iron uptake ...... 314
8.3.3.3 The effect of rAd-FPN1 in iron release ...... 315
8.3.3.4 The effect of retro-FPN1 in iron release ...... 316
8.3.3.5 The effect of rAd-TfR1 in iron uptake ...... 317
8.3.3.6 The effect of retro-TfR1 in iron uptake ...... 318
8.3.3.7 The effect of Ad-heph in iron release ...... 319
8.3.3.8 The effect of retro-heph in iron release ...... 320
8.3.4 Discussion ...... 321
9 CHAPTER 9 GENERAL DISCUSSION ...... 323
REFERENCE ...... 330
The List of Figures
22 FIGURE 1-1 ...... 30
FIGURE 1-2 ...... 38
FIGURE 1-3 ...... 41
FIGURE 1-4 ...... 91
FIGURE 1-5 ...... 93
FIGURE 3-1 ...... 139
FIGURE 3-2 ...... 146
FIGURE 3-3 ...... 147
FIGURE 3-4 ...... 148
FIGURE 3-5 ...... 150
FIGURE 3-6 ...... 152
FIGURE 3-7 ...... 153
FIGURE 3-8 ...... 154
FIGURE 3-9 ...... 156
FIGURE 3-10 ...... 157
FIGURE 4-1 ...... 163
FIGURE 4-2 ...... 164
FIGURE 4-3 ...... 165
FIGURE 4-4 ...... 166
23 FIGURE 4-5 ...... 167
FIGURE 4-6 ...... 169
FIGURE 4-7 ...... 170
FIGURE 5-1 ...... 176
FIGURE 5-2 ...... 178
FIGURE 5-3 ...... 179
FIGURE 5-4 ...... 180
FIGURE 5-5 ...... 181
FIGURE 5-6 ...... 182
FIGURE 5-7 ...... 183
FIGURE 5-8 ...... 184
FIGURE 5-9 ...... 185
FIGURE 6-1 ...... 192
FIGURE 6-2 ...... 193
FIGURE 6-3 ...... 194
FIGURE 6-4 ...... 195
FIGURE 6-5 ...... 196
FIGURE 6-6 ...... 197
FIGURE 6-7 ...... 198
24 FIGURE 6-8 ...... 200
FIGURE 7-1 ...... 207
FIGURE 7-2 ...... 208
FIGURE 7-3 ...... 209
FIGURE 7-4 ...... 210
FIGURE 7-5 ...... 211
FIGURE 7-6 ...... 212
FIGURE 8-1 ...... 227
FIGURE 8-2 ...... 228
FIGURE 8-3 ...... 229
FIGURE 8-4 ...... 231
FIGURE 8-5 ...... 232
FIGURE 8-6 ...... 235
FIGURE 8-7 ...... 237
FIGURE 8-8 ...... 239
FIGURE 8-9 ...... 240
FIGURE 8-10 ...... 242
FIGURE 8-11 ...... 245
FIGURE 8-12 ...... 247
25 FIGURE 8-13 ...... 250
FIGURE 8-14 ...... 252
FIGURE 8-15 ...... 272
FIGURE 8-16 ...... 273
FIGURE 8-17 ...... 274
FIGURE 8-18 ...... 275
FIGURE 8-19 ...... 276
FIGURE 8-20 ...... 278
FIGURE 8-21 ...... 279
FIGURE 8-22 ...... 281
FIGURE 8-23 ...... 283
FIGURE 8-24 ...... 285
FIGURE 8-25 ...... 287
FIGURE 8-26 ...... 289
FIGURE 8-27 ...... 290
FIGURE 8-28 ...... 292
FIGURE 8-29 ...... 293
FIGURE 8-30 ...... 295
FIGURE 8-31 ...... 297
26 FIGURE 8-32 ...... 299
FIGURE 8-33 ...... 301
FIGURE 8-34 ...... 302
FIGURE 8-35 ...... 304
FIGURE 8-36 ...... 306
FIGURE 8-37 ...... 310
FIGURE 8-38 ...... 313
FIGURE 8-39 ...... 314
FIGURE 8-40 ...... 315
FIGURE 8-41 ...... 316
FIGURE 8-42 ...... 317
FIGURE 8-43 ...... 318
FIGURE 8-44 ...... 319
FIGURE 8-45 ...... 320
27 1 Chapter 1 Introduction
1.1 Introductory statement
The aim of this chapter is to provide a general introduction to the thesis. It briefly describes the function and hazards of iron in biological systems. Some important iron metabolism proteins such as Hepcidin, Ferroportin 1, DMT1, and transferring receptor 1, Adenovirus, retrovirus and RNA interference are also mentioned. In the study, the above important genes related to iron metabolism were cloned into genome of recombinant adenoviruses and retroviruses. These recombinant viral products were applied to study brain iron metabolism. The recombinant adenoviruses expressed the target genes including hepcidin,
Ferroportin1, DMT1, and Transferring receptor 1 in neurons and preserve their biological activity as same as native. The recombinant retroviruses played a specific role in gene silencing and affected iron metabolism in neurons. In the study, the goal of construction and application of recombinant viral products was to develop a new significant pathway of gene therapy to protect and cure neurodegenerative diseases. To our knowledge, iron metabolism imbalance of neurons may be an important cause of neurodegenerative diseases, although the mechanisms controlling iron homeostasis in neural cells in the central nervous system (CNS) is still not well understood.
1.2 General description of iron metabolism
Human iron metabolism is the set of chemical reactions that maintains human homeostasis of iron. Iron is essential for most lives on earth, including human
28 beings. The control of this necessary but potentially toxic substance is important for human health and in the treatment of many diseases. Many hematologists are especially interested in the system of iron metabolism because iron is essential to red blood cells. Most of the human body's iron is contained in the red blood cells' hemoglobin, and iron deficiency anemia is the most common type of anemia. Understanding this system is also important for understanding diseases of iron overload, like hemochromatosis.
1.2.1 Iron absorption
The duodenum and upper jejunum are major sites of iron absorption (Muir and
Hopfer, 1985) (Figure 1-1). Iron absorption is improved by a feedback mechanism in people who are iron-deficient. In contrast, iron absorption is dampened when iron overload occurs. The physical state of the duodenum has a great influence over its absorption of iron. Ferrous iron (Fe2+) can be rapidly transferred to the insoluble ferric (Fe3+) form by oxidation at physiological pH.
In the proximal duodenum, pH is influenced by gastric acid and a lower pH can enhance the solubility and uptake of ferric iron. When secretion of gastric acid is reduced (for instance by acid pump inhibitors such as the drug Prilosec), iron absorption is affected substantially.
29
Figure 1-1
Iron enters the stomach from the oesophagus. Iron is oxidized to the Fe3+ state regardless of its original form when taken in orally. Gastric acidity prevents the precipitation of the normally insoluble Fe3+. Iron absorption occurs in intestinal mucosal cells of the duodenum and upper jejunum. Transferrin (Tf) binding with
Fe3+ transfer iron to the circulation and then delivers it to the cells of the body.
The mechanism of heme absorption in the duodenum is completely different from inorganic iron absorption. The process is more efficient and less influenced by pH. Consequently meat is an excellent nutrient source of iron because of its abundant heme iron. In fact, heme oxygenase can inhibit heme catabolism in the intestine and induce iron deficiency(Kappas et al., 1993). There are many other dietary factors that affect iron absorption. For instance, ascorbate and citrate as
30 weak metal chelators help absorb iron in the duodenum(Conrad et al., 1993).
Some elements, such as lead, also can critically interfere with iron absorption and metabolism. Lead is a particularly pernicious element to iron metabolism. It blocks iron uptake through competitive inhibition in intestine after absorption from diet. Furthermore, it can interfere with many important iron-dependent metabolic reactions such as heme biosynthesis. Lead not only produces anemia but also impairs cognitive development particularly in children. In newborns, because of the immaturity of the gastrointestinal tract, inefficient iron absorption can exacerbate iron deficiency. Premature infants are even more severe in iron deficiency, which is affected by a variety of reasons. Some studies suggest that several heavy metals compete the absorption pathway with the intestinal iron.
These elements include lead, manganese, cobalt and zinc. When iron absorption is enhanced by iron deficiency, these heavy metals also augment the uptake in the intestine tract.
The mechanism and route of iron entering the mucosal cells in the upper digestive tract are unknown. For the rest of the body, it is believed that iron is transferred into the body via specific transferrin receptors and receptor-mediated endocytosis(Klausner et al., 1983). Because intestinal cells don’t express transferrin genes, the hypothesis that apotransferrin (or an equivalent molecule) secreted by intestinal cells or present in bile (Huebers et al., 1983) is unsubstantiated. In fact, later researches revealed that transferrin found in the intestinal lumen is a part of plasma transferrin(Idzerda et al., 1986). Furthermore,
31 hypoxia, which greatly increases iron absorption, has no effect on the intestinal transferrin levels (Raja et al., 1986).
1.2.2 Genetic Insights into Mammalian Iron Absorption
The rapid development in mouse genetics in recent years has provided more and more evidence on mammalian intestinal iron transport. Mouse breeders readily recognize pale animals, and have developed two mutant strains of intestinal mucosal iron transporter gene deletion, Microcytic (mk) mice and sex-linked anemia (sla) mice. The two kinds of mice have severe iron-deficiency anemia due to the functional impairment of iron uptake and release from the intestinal cell, respectively. Mice with the homozygous autosomal recessive mk mutation have a defect in an apical iron transporter. mk/mk mice absorb iron poorly, and their serum iron levels are very low. The mice’s mucosal cells lack stainable iron.
These findings are consistent with a defect in an apical iron transport molecule.
Intriguingly, mk/mk mice are not rescued by parenteral iron replacement. Anemia develops in normal mice tranplanted with mk bone marrow, indicating that the mk erythroid precursor cells also have a defect in red cell iron uptake. A common component to iron transport may therefore exist in intestinal cells and red cell precursors (Andrews, 2000a, b). In contrast to mk mice, the sla mutation
(sla/sla or sla/y) have abnormal iron deposits within the intestinal mucosal cells, but the serum iron levels are as low as mk mice. This suggests that this X-linked defect impairs intracellular iron trafficking to the plasma. Based on the iron transport defects of the sla animals and mk mice, the treatment of anemia is also different by parenteral iron. The studies of these mutants give us a clue that the
32 basolateral iron transport system is possibly as important as the apical member absorption system in transferring iron from intestinal lumen to plasma. Under physiological conditions, the duodenum only absorbs about 10% of the elemental iron. However, this value increases markedly with iron deficiency (Finch, 1994).
In contrast, iron overload reduces but does not eliminate absorption, reaffirming the fact that absorption is regulated by the body iron stores. In addition, both anemia and hypoxia boost iron absorption. Ferritin of the mucosal cells retains a portion of the iron absorbed. The remaining iron traverses the mucosal cells, to be coupled to transferrin for transport through the circulation.
1.2.3 Erythropoiesis and Iron Absorption
Approximately 80% of iron pool in body takes part in the synthesis of red cell hemoglobin. An average adult produces 2 x 1011 red cells daily, with a red cell renewal rate of 0.8 percent per day. Each red cell contains more than a billion atoms of iron, and one ml of red cells contains 1 mg of iron. Due to the flourishing demand of iron, the body has to develop a series of regulatory mechanisms to meet this daily need. This is the reason why erythropoiesis profoundly influences iron absorption. Plasma iron turnover (PIT) is increased by accelerated erythropoiesis, which is associated with enhanced iron uptake from the gastrointestinal tract. However the mechanism of how PIT influences iron absorption is unknown (Weintraub et al., 1965).
It seems reasonable to assume that iron absorption increased by the erythron-induced effect is in some way related to the increase in erythropoiesis, at least within a given disease state (Finch, 1994). However, for any given
33 increase in plasma iron turnover, different anemic states differ in the magnitude of the absorptive response and its effect on iron balance(Pootrakul et al., 1988).
There must be some components of erythropoiesis, instead of simply its rate, that explain the absorptive response. The common denominator would appear to be the unmet requirement of the erythroid marrow for iron. This imbalance between iron requirements of the erythroid marrow and its iron supply has been referred to as iron-deficient erythropoiesis (Goodnough, 2007; Robach et al., 2007). It occurs in iron deficiency caused by a decreased iron supply, but is also found with a normal or even increased iron supply in the face of increased marrow iron requirement. There are several factors of circulation, including transferrin (Lin et al., 2008) and erythropoietin(de Vasconcelos et al., 2007; Goodnough, 2007), that modulate iron absorption. A deficient iron supply can be detected in the iron-deficient subject by a transferrin saturation of less than 16%, the plasma iron and transferrin saturation needed increases as erythropoietic activity increases
(Beutler et al., 2003).
1.2.4 Body iron stores
Most well-nourished people in the industrialized countries have 3-4 grams of iron in their bodies. Of these, about 2.5 g is contained in the hemoglobin needed to carry oxygen through the blood. Another 400 mg is devoted to cellular proteins that use iron for important cellular processes like storing oxygen
(myoglobin), and performing energy-producing redox reactions (cytochromes).
3-4 mg circulates through the plasma, and is bound to transferrin. Since so much iron is required for hemoglobin, iron deficiency anemia is the first and primary clinical manifestation of iron deficiency. Oxygen transport is so
34 important to human life as severe anemia harms or kills people by depriving their organs of enough oxygen. Iron-deficient people will suffer from or die of organ damage well before their cells run out of the iron needed for intracellular processes like electron transport. Some iron in the body is stored. Physiologically, most stored iron is bound by ferritin molecules; the largest amount of ferritin-bound iron is found in cells of the liver hepatocytes, the bone marrow and the spleen. The liver's stores of ferritin are the primary physiologic source of reserved iron in the body. Macrophages of the reticuloendothelial system store iron as part of the process of breaking down and processing hemoglobin from engulfed red blood cells. Iron is also stored as a pigment called hemosiderin in an apparently pathologic process. This molecule appears to be mainly the result of cell damage. It is often found engulfed by macrophages that are scavenging regions of damage. It can also be found among people with iron overload due to frequent blood cell destruction and transfusions.
1.2.5 Cells iron uptake from body
As discussed above, hemoglobin molecules of the red blood cells reserve most of the iron in the body. When macrophages scavenge senescent red blood cells, the iron-containing hemoglobin is degraded and put the iron onto transferrin molecules. Then macrophages export the transferrin-iron complexes back into circulation. Most of the iron is always used for blood cell reproduction. This is called hemoglobin recycling. Some iron is utilized by other cells from the circulating blood. Since cells have transferrin receptors on the surface of cell membrane and iron is tightly bound to transferrin, cells ingest iron-transferrin complexes from blood and body fluid. When the protein and iron are attached to
35 these receptors, they engulf and internalize the transferrin-iron complex. At the same time, the iron which has entered cells is coupled to ferritin which is a kind of iron storage molecule.
Advanced mechanisms for sensor is essential to cells to sense their own need for iron. Post-transcriptional regulation of mRNA is the best characterized iron-sensor in human cells. The mRNA sequences of transferrin and ferritin contain a sequence of mRNA called iron responsive elements (IREs). These mRNA sequences (IREs) can bind with a protein named iron responsive element binding protein (IRE-BP). The IRE-BP without iron binds to the IREs of ferritin and transferrin receptor mRNA. But when the IRE-BP binds with iron, the shape of IRE-BP is changed and IRE-BPs’ release from the ferritin mRNA results. This result directly stimulates cells to express more ferritin. In other words, when there is high iron in the cell, the iron itself causes the cell to produce more iron storage molecules. Transferrin receptor production depends on a mechanism similar to that of ferritin, but with an opposite trigger, and opposite ultimate effect. In contrast to ferritin, when the IRE-BP without iron binds to IREs of the transferrin receptor, the binding effect not only allows for translation but also stabilizes the mRNA molecule so that it can stay intact for a longer time. This means that IRE-BPs facilitate the cell to keep producing transferrin receptors.
From transferrin-iron complexes of circulation more transferrin receptors bring in more iron for the cells and make it easier to keep the content of the cellular iron in a normal level. But as more and more IRE-BPs bind with iron, their conformation is changed and releases the transferrin receptor mRNA. The transferrin receptor mRNA liberated is rapidly degraded by RNase without the
36 IRE-BP protection. The cell stops producing transferrin receptors. When the cell has obtained more iron than it can bind up with ferritin or heme molecules, more and more iron will bind to the IRE-BPs. This will stop the transferrin receptor production. And iron-IRE-BP binding will also start ferritin production. When the cell is low on iron, less and less iron will bind to IRE-BPs. The IRE-BPs without iron will bind to transferrin receptor mRNA. Transferrin receptor production will increase, and ferritin production will decrease.
1.2.5.1 Tf and TfR Dependent Iron Uptake
Transferrin (Tf) receptor-mediated endocytosis is a major pathway for most cells to obtain iron. Based on the current information, Qian et al. divided this process into seven main steps(Qian, Tang, 1995; Qian, Shen, 2001; Li, Qian, 2002):
A． Binding: Tf-Fe binds to the extracellular portion of TfR on the cellular
membrane, which is a simple physiological process independent of cell
metabolism.
B． Internalization or endocytosis: Fe-Tf-TfR complexes are clustered together
and localized in clathrin-coated pits, which eventually bud off to form
coated vesicles called endosomes or receptorsomes.
C． Acidification: intravesicular pH is lowered to about 5-6 by the activity of H+
ATPase on the membrane of the endosomes.
D． Dissociation and reduction: intravesicular acidification induces the release of
iron (Fe3+) from Tf and its reduction to Fe2+ within the endosomes.
E． Translocation: iron (Fe2+) is transported through the membrane of the
endosomes to the cytoplasm. DMT1 has been recently proposed to be
involved in this process, but the precise mechanism remains unclear.
37 F． Cytosolic transfer of iron into intracellular compounds: after translocation
from endosome to cytoplasm, ATP or AMP transfers iron to the sites where
it is needed for physiological activity, e.g. haem synthesis, electron transport
in mitochondria etc., or to ferritin for storage.
G． Return of Tf-TfR complex to the plasma membrane: endosomes containing
Tf-TfR return to the plasma membrane. The apotransferrin is replaced by
new Tf-Fe molecules from extracellular fluid and the uptake process is
repeated. Apotransferrin released form the receptor returns to the plasma or
surrounding solution.
Figure 1-2 The pathway of cellular iron uptake from Tf via TfR mediated endocytosis.
1.2.5.2 Tf and TfR Independent Iron Uptake
Although it is considered that Tf-dependent iron uptake is probably the major
38 route of iron absorption for cells under normal circumstances, several evidences indicate that there are distinct transport pathways for non-Tf bound iron. First, in some organs, such as the liver and pancreas, a massive iron overload is found in mice and humans lacking Tf objects. (Trenor et al., 2000). Second,
TfR1-deficient mice show normal embryonic organ development before they succumb to severe anemia in mid-gestation, suggesting a second iron uptake mechanism(Levy et al., 1999; Trenor et al., 2000). Third, in some diseases (e.g., hereditary hemochromatosis), plasma iron (Fe2+) is eliminated while the iron binding capacity of Tf is saturated. Morgan and Qian’s results also reveal that reticulocytes can take in Fe2+ through a certain route which is not associated with transferrin receptor (TfR) but dependent on reduction of iron to the ferrous state and then across the membrane by an iron carrier (Qian, Morgan, 1992; Qian,
Tang, 1995; Trinder et al., 1996).
Divalent metal transporter 1 (DMT1) as a trans-membrane iron transporter was the first to be identified in 1997.(Fleming et al., 1997; Gunshin et al., 1997) It is considered as a kind of iron carrier protein on enterocytes membrane and transports ferrous iron through cells without Tf and Tf receptor mediation
(Fleming et al., 1998). In the gastrointestinal tract, dietary iron has to be reduced to the ferrous form from the ferric form before it can be utilized. Duodenal cytochrome B (Dcytb) is a strong candidate for this brush border ferrireductase(McKie et al., 2001). After ferric iron is reduced to ferrous iron by
Dcytb in the brush border, the DMT1 located in membrane enhances the transport of ferrous iron across the brush border membrane. The mechanism of
39 iron through the cell is still unclear, but hephaestin (Heph) and Ferroportin1
(FPN1) may be involved in this process. Basolateral transfer to the body is thought to be mediated by the membrane iron exporter ferroportin 1(FPN1) that is strongly expressed in the duodenum. FPN1 exports the ferric iron (Fe3+) to circulation after Heph oxidizes the ferrous iron (Fe2+) as a ferrous-oxidase. Iron that enters the circulation is loaded onto Tf for transportation to the body tissues.
In this procedure, many molecules have been implicate to influence the regulation of iron absorption, such as the hemochromatosis protein HFE, TfR2 and the antimicrobial peptide hepcidin (Nicolas et al., 2001), which are most strongly expressed in the liver(Kawabata et al., 1999; Frazer et al., 2001; Pigeon et al., 2001).
There is another pathway, independent of TfR but not Tf, available for iron uptake from Tf in the human melanoma cell or CHO cells lacking TfR but transfected with p97(Kennard et al., 1995; Jefferies et al., 1996). This pathway may involve the transfer of iron from Tf or simple chelators to GPI-p97, and hence to the cell interior by an endocytic route that is less sensitive to the effect of weak bases but more accessible to hydrophilic chelators than the receptor-mediated pathway. The Tf independent iron uptake may be mediated by gelatinase-associated lipocalin (NGAL). Lipocalins are a large group of proteins that are related more in structure than in sequence and which bind small molecules. Lipocalins have been implicated in the transport of small organic molecules such as retinol, prostaglandins, fatty acids and oderants. NGAL binding iron is internalized into endosomes and, like Tf, is recycled. However,
40 the detailed mechanism is not clear(Kaplan, Kushner, 2000). Besides, there maybe other routes which are involved in the Tf and/or TfR independent iron uptake.
Figure 1-3
Pathways of heme and non-heme iron uptake and transport in the intestine. Fe3+ is reduced by Dcytb forming Fe2+, Fe2+ in the intestinal lumen is transported across the apical surface by DMT1. Fe3+ and Fe2+ can also enter absorptive enterocytes via a pathway mediated by paraferritin complex, consisting of
β-integrin, mobilferrin and flavin mono-oxygenase. Heme is processed in the gut lumen and enters the enterocytes as an intact metalloporphyrin (H). The mechanism of heme iron transport is not well defined, but is probably mediated by an endocytic pathway. Once inside the cytoplasm, heme is degraded by heme oxygenase to release inorganic iron. Once inside the cell, iron can either be stored in ferritin or transported across the basolateral membrane by FPN1. The species of iron that is exported by FPN1 is not known, but the need for
41 ferroxidase activity to load iron onto Tf indicates that it is probably Fe2+. FPN1 and Heph may work together in the absorptive enterocyte. In other cell types,
FPN1 may work with CP to load iron onto Tf. Abbrevs: DMT1, divalent netal transporter; CP, ceruloplasmin; Tf, transferrin; FPN1, ferroportin 1; Heph, hephaestin; Dcytb, duodenal cytochrome b.
1.2.6 Iron efflux
Intracellular iron balance is dependent not only upon the amount of iron taken up and sequestered but also upon the amount of iron released from cells. Duodenal enterocytes, macrophages, hepatocytes, placenta syncytiotrophoblasts and cells of the central nervous system (CNS) require mechanisms to release iron in a controlled fashion to ensure that the metal is available where it is needed. The only putative iron exporter identified to date is ferroportin (also known as Ireg1,
MTP)(Abboud, Haile, 2000; Donovan et al., 2000; McKie et al., 2000; McKie et al., 2001). Ferroportin is located at the basolateral membrane of duodenal enterocytes, where it mediates iron export into the bloodstream apparently in concert with hephaestin, a ferroxidase that is homologous to the abundant plasma protein ceruloplasmin(Vulpe et al., 1999).
Iron export from nonintestinal cells requires ceruloplasmin(Cazzola et al., 1985;
Harris et al., 1999). CP converts Fe2+ to Fe3+ that is loaded onto Tf for transport in the plasma. In the brain, the glycosylphosphatidylinositol (GPI)-anchored form of CP physically interacts with ferroportin to export iron from astrocytes(Jeong, David, 2003). Patients and mice with CP deficiency accumulate iron in macrophages, hepatocytes and cells of the CNS, resulting in iron-restricted erythropoiesis and neurodegeneration(Hentze et al., 2004).
42
1.3 Brain iron metabolism proteins
1.3.1 Transferrin Receptor 1
Tf is an 80 kDa glycoprotein capable of binding 2 iron atoms. The polypeptide chain is arranged in two lobes, respectively representing the N-terminal and
C-terminal halves of the molecule (Rao and Anderson, 1987). When devoid of iron, a Tf lobe takes an ‘open-jaw’ conformation with domains separated. Upon binding with iron, the domains undergo a rigid rotation to enclose their iron-binding site (Gerstein et al., 1993), thereby guarding the bound iron from hydrolysis and too-facile release. A distinctive, even defining feature of transferrins is the dependence of iron binding upon concomitant binding of a synergistic anion, normally carbonate. Protonation of the anion, resulting in its expulsion from the harboring protein, is probably a critical event in iron release in vivo as in vitro(el Hage Chahine and Pakdaman, 1995). These two features provide for the tight but reversible binding of iron by transferrins, thus accounting for the 100–200 cycles of iron transport and release displayed by the human protein during its lifetime in the circulation. Tf is synthesized primarily in the liver and secreted into the serum(Morgan, 1983); all nonheme iron in the circulation is bound to Tf. Only about 30% of Tf binding sites are occupied, so most of the protein is free of iron. Tf is relatively abundant in the CSF. It is made in the brain by the choroid plexus and oligodendrocytes. This is supported by the evidence that both have the ability to secrete Tf(Aldred et al., 1987a; Aldred et al., 1987b; Bloch et al., 1987; Dwork et al., 1988). The neurons (Dwork et al.,
1988; Mollgard et al., 1987) and certain types of astrocytes (Qian et al., 2000;
43 Qian et al., 1999) are also expression the Tf. Expression of Tf mRNA in rat oligodendrocytes is iron-independent and changes with increasing age(Moos and
Morgan, 2001).
1.3.1.1 Transferrin Receptor and Transferrin Receptor 2
Transferrin receptors (TfR) provide for a controlled access of Tf to cells.
Transferrin-bond iron (Tf-Fe) uptake or Tf and TfR mediated-endocytosis has been considered to be the main route for cellular iron accumulation(Qian et al.,
2002). Two kinds of receptors have been described. The first and much more studied of these is now known as transferrin receptor 1 (TfR1) but, before the discovery of transferrin receptor 2 (TfR2), it was simply designated the TfR.
TfR2 is a newly described receptor, which is mainly expressed in the liver(Kawabata et al., 1999).
1.3.1.2 Molecular Characterization and Expression of TfR1 and TfR2
The human TfR is encoded by a single gene of about 32 kb and located on chromosome 3, giving rise to a major 5 kb mRNA species. The entire human TfR gene contains 19 exons. The human TfR mRNA has a coding region of 2280 nucleotides and an unusually large 3' untranslated region (UTR) of about 2500 nucleotides. The most important feature of this mRNA lies in a conserved fragment in the 3'UTR that encompasses five stem-loop structures containing the iron responsive elements and the rapid turnover determinant. This regulatory region is critically involved in the iron-dependent regulation of the receptor mRNA degradation(Ponka and Lok, 1999). TfR protein is comprised of two disulfide-bonded identical 90 kDa subunits, each bearing three asparagine-linked
44 and one threonine-linked carbohydrate chains. TfR is expressed by all iron-requiring cells, including the neuronal cells, and is far more abundant than
TfR2. The first 61 amino acids of each subunit form its cytoplasmic domain, and lead to a membrane-anchoring hydrophobic sequence of residues 62–89 that spans the lipid bilayer once. The remainder of the protein, bearing the Tf recognition sites, lies in the exocytic region. Each subunit contains a protease-like domain, a sandwich of two β-sheets combined with a helix along an open edge, and a third helical domain(el Hage Chahine and Pakdaman, 1995). Tf binds to the receptor in 2:2 (Tf:TfR subunit) stoichiometry (Enns and Sussman,
1981). The human TfR2 gene comprises 18 exons, extends 21 kb, and maps to chromosome 7q22(Kawabata et al., 1999). A mouse TfR2 was identified in 2000 and the mouse gene was found to map to chromosome 5 (Fleming et al., 2000). A
2.9 kb mRNA encodes the full length form (TfR2-) of human TfR2, which is predicted to be a type II transmembrane protein with an 80 amino-acid transmembrane domain, and an extracellular domain comprising residues
105-801. The alternatively spliced form (TfR2-β) lacks exons 1, 2 and 3, which likely results in a truncated protein missing the entire transmembrane and cytoplasmic domains. It remains to be seen if TfR2-β is present in the cytoplasm of cells. The extracytoplasmic domain has the greatest identity as well as similarity with TfR (45% and 66%, respectively). TfR2-α has a number of similarities to TfR. These include the presence of the motif YQRV, which may function as a signal for endocytosis, a protease-associated domain (PA domain), and the presence of cell attachment sequences (RGD motifs). It has yet to be determined if the internalization signal is functional and whether the RGD sequences are the binding sites for Tf, as has been shown for TfR(Subramaniam
45 et al., 2002). Unlike TfR, which is ubiquitously expressed, expression of TfR2 is predominantly in the liver and liver-derived cell lines (Fleming et al., 2000), but is also found in human erythroid/myeloid cell lines (Kawabata et al., 1999; Vogt et al.,2003) and platelets(Hannuksela et al., 2003). Using specific peptide antiserum in situ detected the duodenal localization of a class 1 HLA molecule involved in hereditary hemochromatosis (HFE) and TfR2 in humans and mice that was restricted to crypt cells. This finding provides evidence for a novel mechanism for the regulation of iron balance in mammals (Double et al., 2003).
1.3.1.3 Regulation of TfR and TfR2 Gene Expression
Both transcriptional and post-transcriptional regulations play an important role in the control of TfR expression. Transcriptional regulation may play a more significant role in tissue- or stage-specific regulation. Earlier studies of nuclear run-on and reporter gene assays demonstrated that at least a portion of the reciprocal regulation of the TfR mRNA levels by iron is mediated at the transcriptional level. Transcriptional regulation is also involved in serum/mitogenic stimulation of TfR expression, in the TfR induction during T and B lymphocyte activation, in the enhanced TfR expression by SV40 viral infection, in the decrease of TfR during terminal differentiation of myeloid and lymphoid leukemic cell lines, and also in the marked increase of TfR during erythroid differentiation (Ponka and Lok, 1999). A minimal region of about 100 bp upstream from transcriptional start site was shown to drive both basal as well as serum/mitogenic stimulation of the promoter activity (Miskimins et al., 1986;
Owen and Kuhn, 1987; Casey et al., 1988). This region contains putative regulatory elements similar to AP-1 and SP-1. Due to the five similar IRE motifs
46 identified within the 2.7 kb 3'UTR of TfR mRNA, regulation is achieved via iron regulatory proteins (IRPs) and IREs. At low intracellular iron levels, both IRP1 and IRP2 bind to the stem loop IREs and protect the mRNA from degradation.
At high intracellular iron concentrations, IRP1 binds iron, rendering it unable to bind mRNA. IRP2 is oxidized, ubiquitinated and degraded via proteasomes. The
TfR mRNA with no IRP bound to it is rapidly degraded, resulting in low steady state levels of TfR mRNA. Consequently, less TfR is synthesized (Aisen et al.,
2001). The TfR2 transcript lacks IRE(s), so its expression is not sensitive to iron status (Fleming et al., 2000; Kawabata et al., 2000). TfR2 is normally expressed in the iron-overloaded liver of hemochromatosis (Fleming et al., 2000), aceruloplasminemia (Yamamoto et al., 2002) and desferrioxamine (DFO) treated
Chinese hamster ovary (CHO) cells (Tong et al., 2002), so regulation of TfR2 may be via the cell cycle accommodating the needs of proliferating cells
(Kawabata et al., 2000). During post-ischemic rat liver reperfusion, TfR2 mRNA levels were also enhanced (Tacchini et al., 2002).
1.3.1.4 Transferrin Receptor in the Brain
Immunocytochemical methods initially demonstrated the presence of TfR on capillary endothelial cells (Jefferies et al., 1984), and binding studies have shown
Tf mediated transport of iron into these cells (Pardridge et al., 1987). TfR is also present in neurons (Giometto et al., 1990). The distribution of TfR shows a unique distribution with high densities in the cerebral cortex, hippocampus, amygdala, and certain brain-stem nuclei in both rat (Hill et al., 1985; Mash et al.,
1990) and man (Morris et al., 1989). This pattern of distribution appears to reflect the iron requirement of specific neuronal groups (Morris et al., 1990), and
47 may explain why previous studies (Hill et al., 1985; Morris et al., 1989) have shown an inverse relationship between the distribution of iron and TfR densities with, for example, very high iron levels in the globus pallidus, a low TfR density region. The brain obtains iron via a Tf-TfR interaction at the level of the BBB, and both neurons and glia acquire iron via Tf (Fishman et al., 1987; Pardridge et al., 1987; Crowe and Morgan, 1992; Moos and Morgan, 2000). TfR is a key component of the iron regulatory system. In the adult nervous system, TfR has received relatively little attention and even less information exists on the expression and distribution of TfR during development. The density of TfRs on the brain microvasculature is 6-10 folds higher in adult human brains then the brain parenchyma. Autoradiographic studies reveal a heterogeneous distribution of TfRs in the adult brain; areas associated with motor function express a relatively higher density than non-motor areas (Hill et al., 1985; Mash et al.,
1990; Kalaria et al., 1992). In a preliminary analysis of TfR density during development, TfR density was low at birth (15.2 fmol/mg protein) and increased
4 folds (67 fmol/mg protein) by PND 18, with the level of receptor stabilized in adulthood (3 months of age). The low level of TfRs at birth in the presence of high concentration of Tf and iron suggests a negative feedback relationship
(Mash et al., 1990). The cellular distribution of TfR and factors that regulate TfR expression require additional investigation because of changes that occur with age and following injury and the possibility that TfR density may be an indicator of neuronal respiratory activity (Mash et al., 1990). A resent study showed that the developmental regulation is mediated at the post-transcriptional level (Moos and Morgan, 2002).
48 1.3.2 Divalent Metal Transporter 1
Divalent metal transporter 1 (DMT1) is also known as natural resistance-associated macrophage protein 2 (NRAMP2), divalent cation transporter 1 (DCT1) and solute carrier family 11, member 2 (SLC11A2).
Natural resistance associated macrophage protein 2 (Nramp2) was the name assigned to it when it was first found as a DNA sequence with an unknown function, but clearly related by sequence similarity to Nramp1 (Vidal et al.,
1995). It is a mammalian transmembrane proton-coupled metal-iron transporter which has high affinity to iron. In 1997, Gunshin (Gunshin et al., 1997) proposed that divalent cation transporter 1 (DCT1/DMT1) is likely to anticipate the apical, duodenal iron transporter. Almost instantly the apical iron transport role was established when Fleming et al. (Fleming et al., 1998) identified a G185R mutation in the corresponding gene of the microcytic (mk) mouse because it clearly has a defect in the uptake of iron from the lumen of the gut(Edwards and
Hoke, 1972). Soon after, Fleming et al. (Fleming et al., 1998) found the identical mutation accounted for the phenotype of the Belgrade (b) rat extending the function of the gene to exit of Fe2+ from endosomes during the Tf cycle and leaving little doubt about the major role of the transporter in intestinal iron uptake. Many mutation studies of microcytic mouse (mk) and Belgrade rat have shown the important role of DMT1 in iron uptake and endosomal transport in the gastrointestinal tract.
1.3.2.1 Characteristic of DMT1 Gene and Protein
The DMT1 gene is on the 12q13 of human chromosome (Vidal et al., 1995) and mouse chromosome 15 (Andrews and Levy, 1998). The human DMT1 consists
49 of 17 exons spreading over more than 36 kb (Lee et al., 1998). The DMT1 genes of murine and rat have a similar structure. There are at least two different splice forms, encoding alternative carboxy-termini and alternative 3’-UTR (Fleming et al., 1998; Lee et al., 1998). One form contains an IRE in its 3’ untranslated regions (3’-UTR), which is similar to IREs found in the 3’ untranslated region of the TfR mRNA. This suggests that DMT1 protein expression may be controlled post-translationally by intracellular iron concentration. Another form does not contain any recognizable IRE. The DMT1 protein is highly hydrophobic, with 12 predicted transmembrane domains. Both amino- and carboxy-termini are predicted to be within the cytoplasm. There is a substantial extracellular loop with predicted asparagine-linked glycosylation sites between transmembrane domains 7 and 8. Mutations in transmembrane domain 4 have been shown to interfere with DMT1 protein function. Several groups have begun to examine whether the ±IRE species are differentially expressed and whether they localize differently within cells (Canonne-Hergaux et al., 1999; Beaumont, 2000; Roth et al., 2000; Tabuchi et al., 2000). There are four isoforms of rat DMT1. In the
C-terminal there are two isoforms variants: The –IRE’s, associated with the absence of an IRE in the 3’UTR of the mRNA and encodes a 561-amino-acid protein (Gunshin et al 1997), and the +IRE mRNA which is associated with its presence and encodes a 568-amino-acid protein (Gunshin et al., 1997; Fleming et al., 1998; Lee et al., 1998). The initial 543 residues appear to be common for the two forms of the protein although the C-terminal 18 or 25 amino acid residues differ as a result of splicing a different exon at this region. More recently, two
N-terminal variants were identified: One originates with an MV sequence as originally reported (Gunshin et al., 1997; Fleming et al., 1998) and the other
50 starts with 31 amino acid residues proximal to that sequence (Hubert and Hentze,
2002). The longer peptide specie has a potential nuclear localization signal (NLS) motif within it. The N-terminal isoforms are due to an alternative exon to exon 1; investigators have dubbed the new sequence 1A (the old one becoming an untranslated 1B and the next exon remaining as 2) so exon 1A predicts 29 additional residues for human DMT1 and 31 for rat DMT1. Antisera have been raised that recognize a ~90-116 kDa DMT1 protein which can be deglycosylated to a ~50-55 kDa protein (Gruenheid et al., 1999; Tabuchi et al., 2000). The latter mass is closer to the predicted molecular weight based on the amino acid composition of DMT1. However, other groups have generated specific antisera that recognize a ~65-66 kDa species; these antibodies appear to block iron transport activity, suggesting that this antigen is a true transporter protein
(Conrad et al., 2000; Roth et al., 2000; Tandy et al., 2000). It is possible that cell-type specific glycosylation patterns may account for such differences in mass profile.
1.3.2.2 Expression and Regulation of DMT1 Gene
Northern-blot analysis revealed that DMT1 is prominently expressed in proximal intestine, followed by kidney, thymus and brain, and is faintly present in the testis, liver, colon, heart, spleen, skeletal muscle, lung, bone marrow, stomach and all tissues examined. In the kidney and thymus, two strong bands at ~ 3.5 kb and ~4.5 kb were detected, indicating that two isoforms mRNA exist in those tissue (Gunshin et al., 1997). In situ hybridization study showed cellular localization of DMT1 mRNA in the intestine, kidney, testis, thymus and brain. In the small intestine, DMT1 is highly expressed in enterocytes lining the villus,
51 especially in the crypts and lower segments of the villus, but not at the villus tips.
Again, a proximal-to-distal gradient of expression is evident in the small intestine.
In the kidney, DMT1 mRNA labeling is most prominent in S3 proximal tubule segments, suggesting that it is involved in the reabsorption of divalent cations. In the testis, DMT1 mRNA is expressed in the Sertoli cells of seminiferous tubules, and is more abundant in those tubules containing mature spermatocytes. In the thymus, DMT1 labeling is positive in cortical, but not medullary, thymocytes. In the brain, DMT1 mRNA is found in neurons, glial and ependymal cells (Gunshin et al., 1997; Burdo et al., 2001). A qualitative examination of sagittal sections indicates that most neurons express DMT1 mRNA at low levels. More prominent labeling is present in densely packed cell groups, such as the hippocampal pyramidal and granule cells, cerebellar granule cells, the preoptic nucleus and pyramidal cells of the piriform cortex, and in moderate amounts in the substantia nigra (Burdo et al., 2001; Wang et al., 2002). Each DMT1 isoform exhibits differential cell type-specific expression patterns and distinct subcellular localizations. Epithelial cell lines predominantly express DMT1, whereas the blood cell lines express DMT1B. In HEp-2 cells, GFP-tagged DMT1 is localized in late endosomes and lysosomes, whereas GFP-tagged DMT1B is localized in early endosomes. Using site-directed mutagenesis, a Y (555) XLXX sequence in the cytoplasmic tail of DMT1B has been identified as an important signal sequence for the early endosomal-targeting of DMT1B. In polarized MDCK cells,
GFP-tagged DMT1A and DMT1B are localized in the apical plasma membrane and their respective specific endosomes. Disruption of the N-glycosylation sites in each of the DMT1 isoforms affects their polarized distribution into the apical plasma membrane but not their correct endosomal localization. These data
52 indicate that the cell type-specific expression patterns and the distinct subcellular localizations of the two DMT1 isoforms may be involved in the different iron acquisition steps from the subcellular membranes in various cell types (Tabuchi et al., 2002). DMT1 gene expression is regulated in response to iron status. Rats that were made iron deficient had markedly increased DMT1 mRNA in intestinal epithelial cells and cell line while iron sufficient rat had markedly decreased levels (Gunshin et al., 1997; Han et al., 1999; Martini et al., 2002; Frazer et al.,
2003). The basis of this regulation has not yet been fully defined. The putative promoter of the human DMT1 gene contains several potential metal response elements, suggesting that there may be transcriptional regulation in response to metal levels (Lee et al., 1998). It is likely that there is also post-transcriptional regulation (Gunshin et al., 2001; Ke et al., 2003). The IRE sequence found in the
3' untranslated region of one of the two alternative splice forms of DMT1 mRNA binds iron regulatory protein in vitro and appears to respond to cellular iron levels. Under low iron conditions, IRPs bind to the IREs in the 3’UTR of DMT1 mRNA and protect the mRNA from degradation, and lowers mRNA stability when iron is abundant. It has been shown that IRP can bind to a 3’UTR stem-loop in DMT1+IRE mRNA in vitro (Guerrini et al., 1998; Wardrop and
Richardson, 1999). Therefore, DMT1 expression is likely to be modulated by
IRP-IRE at the post-transcriptional level. Other mechanisms may be involved in the regulation of DMT1 gene expression. It has been demonstrated that the 5' regulatory region of human DMT1 contains a single interferon (IFN)-γ regulatory element, three potential SP1 binding sites, two potential Hif-1 binding sites, and five potential metal response elements, all of which may play some role in the regulation of this molecule (Lee et al., 1998). Wardrop and
53 Richardson showed that there was a sevenfold increase in the expression of the
2.3 kb DMT1 mRNA transcript when compared with the control, but little effect on the DMT1 3.1 kb transcript in RAW264.7 macrophage cell line after incubation with LPS/IFN-γ. These results indicate differential regulation of the two transcripts. They suggest that Nramp2 mRNA expression can be influenced by factors other than Fe levels in macrophages (Wardrop et al., 2002). However, the regulation of DMT1 gene expression is still not fully understood.
1.3.2.3 Functions of DMT1
In the microcytic anemia (mk) mice and Belgrade (b) rats there are naturally occurred mutations of DMT1 gene that result in defects in the transport of iron from the gut lumen into the absorptive enterocytes, and from plasma Tf into erythroid precursors (Fleming et al., 1997; Fleming et al., 1998). The indicated results affect iron transport (Su et al., 1998). As a divalent metal transporter,
DMT1 was identified by functional cloning in Xenopus lavis oocytes as an electrogenic metal transporter of broad substrate specificity, transporting Fe2+,
Zn2+ and other ions (Gunshin et al., 1997). In duodenal iron uptake, Fe3+ made soluble by gastric acid is reduced to Fe2+ presumably by Dcytb (McKie et al.,
2001) or a similar reductase on the apical surface and enters the brush border via
DMT1. Because DMT1 may act as a proton symporter, one assumes that Fe2+ uptake is facilitated by the mildly acidic pH expected in the proximal duodenum.
DMT1 is found on the apical surface of the enterocyte (Canonne-Hergaux et al.,
1999; Trinder et al., 2000). This location is consistent with the finding (Knopfel et al., 2000) that divalent cation transport activity is associated with brush-border membrane vesicles. Like this form of TfR-independent iron transport in the brush
54 border, it is possible that the TfR-independent iron transport via DMT1 is present in other tissue. The second role of DMT1 is to mediate iron transport across endosome. Tf-TfR mediated iron uptake is a main route in the cell (Qian and
Wang, 1998). Once Fe is released from Tf, it must cross the endosomal membrane, probably via a membrane-bound transporter that is recruited from the cell surface. A number of recent studies have shown that the transporter is DMT1.
Using erythroid precursor cells of anemic Belgrade rat with mutation in DMT1,
Fleming et al found that these cells could take up iron into an endosomal compartment by receptor-mediated endocytosis of diferric Tf bound to TfR, but they were subsequently unable to export iron from the endosome into the cytoplasm. As a result, endosomal iron was returned to the cell surface and released and very little was retained for hemoglobin synthesis (Fleming et al.,
1998). DMT1 can be expressed on the endosomal membrane and co-localizes with Tf to export iron from the endosome into the cytoplasm of the cell (Su et al.,
1998; Tabuchi et al., 2000). In their study, DMT1 showed clear colocalization with FITC-Tf both at the plasma membrane and in recycling endosomes.
Canonne-Hergaux et al suggest that DMT1 is co-expressed with TfR in erythroid cells. Experiments with isoform-specific anti-DMT1 antiserum strongly suggest that it is the non-iron-response element containing isoform II of DMT1 that is predominantly expressed by the erythroid cells. These results provide further evidence that DMT1 plays a central role in iron acquisition via the transferrin cycle in erythroid cells (Canonne-Hergaux et al., 2001a). The evidence strongly supports the role of DMT1 in transporting Fe2+ into the cytoplasm after acidification of the Tf-positive endosome.
55 1.3.2.4 DMT1 and Brain Iron Metabolism
The cellular localization of DMT1 and its functional characterization suggest that
DMT1 might play a role in the physiological iron transport in the brain. The discovery of DMT1 in neurons, astrocytes and ependymal cells in adult rat brain supports the idea (Burdo et al., 2001). The presence of DMT1 within the endothelial cells lining the blood vessels suggests that iron can be removed from the endosome within the endothelial cell. Whether this iron is for use by the endothelial cell or is then transported into the brain remains to be determined.
The presence of DMT1 on astrocytes also indicates the involvement of this protein in iron transport into the brain. Astrocytes have end-feet that envelop the vasculature (Xu and Ling, 1994) and DMT1 has a polar expression in astrocytes;
DMT1 is found only in the process associated with the BBB and occasionally into the soma of the astrocytes (Burdo and Connor, 2003). To investigate the role of DMT1 in brain iron transport, the Belgrade (b) rat, which has a defect in
DMT1 (Fleming et al., 1998), has been examined. The iron staining is decreased in Belgrade (b) rat brains compared to normal (Burdo et al., 1999) and the decrease in iron status is also detectable with magnetic resonance imaging (MRI)
(Zywicke et al., 2002). 59Fe uptake in Belgrade rat brains is only 10% of that of the normal, while 125Tf uptake is 40% of that of the normal after peripheral injection of 125I-Tf-59Fe (Farcich and Morgan, 1992). DMT1 has recently been found to be moderately expressed in the neurons of the substantia nigra in patients with PD, which correlates to the abnormal iron deposition in the same area of the brain. This suggests that DMT1 may be responsible for the increased iron accumulation in PD and may play a role in the etiology of certain NDs
(Andrews, 1999b). This might be the cause of the increased iron content in the
56 brain regions and might thereby contribute to neuronal death by inducing the production of harmful reactive oxygen species (ROS) (Andrews, 1999b). In the brain, NTBI will be acquired by neuronal cells or other brain cells, probably via
DMT1- or trivalent cation-specific transporter (TCT)-mediated mechanisms
(Qian and Shen, 2001). Therefore, further analysis of the functions of DMT1 within the CNS may be of value in elucidating the mechanisms of neuronal loss in PD and other neurodegenerative disorders where abnormalities in iron metabolism have been demonstrated.
1.3.3 Ferroportin 1
Ferroportin1 is a newly discovered molecule that may play a role in iron export.
In these years, several groups have isolated a putative iron export molecule within several months (Abboud and Haile, 2000; Donovan et al., 2000; McKie et al., 2000). This protein was first named iron-regulated transporter 1 (IREG1) by
McKie et al (McKie et al., 2000). Subsequently, the same molecule was also named ferroportin1 (FPN1) (Donovan et al., 2000), and metal transport protein 1
(MTP1) (Abboud and Haile, 2000). In this thesis, this molecule will be referred to as FPN1. This protein is expressed in the villus cells of the small intestine and on the basolateral surface of polarized epithelial cells. The gene mutation developed a hypochromic anaemia (Donovan et al., 2000), which suggests that
FPN1 is involved in iron export. Therefore, mild mutations resulting in differences in the activity of FPN1 may modify the severity of diseases associated with iron overload, including hemochromatosis, aceruloplasminemia and porphyria cutanea tarda (Roy and Andrews, 2001).
57 1.3.3.1 Characteristic of Ferroportin1 Gene and Protein
The human FPN1 gene consists of 20 kb of DNA, comprises 8 exons and maps to 2q32. This protein of mice, rat and human is up to 90% homology, which is shown FPN1 is extremely well conserved. Human FPN1 shows little homology to the iron importer DMT1, although uncharacterized FPN1-related proteins were found in Arabidopsis and C. elegans. In 2000, McKie (McKie et al., 2000) further analyzed the sequence of FPN1 protein. He found that there exists in
C-terminus a putative NADP/adenine-binding site and basolateral localization signal. An IFVCGP motif is found in the NADP/adenine-binding sequence of
FPN1 that is also a key element of yeast ferric reductase and the neutrophil oxidoreductase gp91-phox have been reported. This suggests that FPN1 is not only a transporter of iron but also may have a reductase activity. Both Fe2+ and
Fe3+ are known to exist in complex equilibrium within cells and the conversion between these redox states may be important in terms of transportation and sequestration (St Pierre et al., 1992; Richardson and Ponka, 1997). Indeed, the export of Fe3+ from cells may involve the conversion of Fe3+ to Fe2+ by the reductase region of FPN1 and this should be investigated further. The last four amino acids (TSVV) of FPN1 comprise a T/S-X-V/L PDZ target motif that is readily recognized by postsynaptic density-9 (PSD-95)/discs large (Dlg)/zona occludens-1 (ZO-1) (PDZ) proteins. PDZ proteins are thought to be involved in the basolateral localization of proteins containing this target motif. Sequence report of FPN1 cDNA shows that IRE is in its 5' untranslated end. The 5' IRE sequence of FPN1 is well conserved in humans, mice and zebrafish. Similar 5'
IREs occur in transcripts encoding ferritin, erythroid-5-aminolevulinate synthase and mitochondrial aconitase (Richardson and Ponka, 1997).
58
1.3.3.2 Expression and Regulation of FPN1 Gene
FPN1 is expressed mainly at the basolateral membrane of villus enterocytes within the duodenum, particularly at the tip of the villus rather than the crypt.
However, while FPN1 is expressed in the duodenum, it is not produced in either the jejunum or ileum. Other important sites of iron metabolism where FPN1 expression occurs are the liver and spleen. These tissues are involved in scavenging iron from senescent erythrocytes. Analysis of immunostaining of the cytoplasm of Kupffer cells, the cell surface of hepatocytes lining sinusoids and splenic macrophages in mice revealed that FPN1 is highly expressed within these tissues. Macrophages and Kupffer cells engulf senescent erythrocytes to release the iron following haemoglobin degradation in liver and spleen but FPN1 is not expressed on plasma membranes of macrophages. However, FPN1 still has a very important role in iron export. For instance, cytoplasmic FPN1 may be involved in the transportation of iron into acidic cellular vesicles that may release iron at the cell surface via exocytosis (Abboud and Haile, 2000; Donovan et al.,
2000). The FPN1 was observed in human and rodent lung cells at both the protein and mRNA levels (Yang et al., 2002). The FPN1 was also detected in the basal surface of placental syncytiotrophoblasts. The expression of FPN1 is the highest during the trimester of pregnancy and is developmentally regulated in placental tissue. This suggests that FPN1 has a possible role to transfer iron from the mother to fetus. Other tissues in which FPN1 is expressed include the large intestine, heart, skeletal muscle and, kidney, testis, megakaryocytes and the decidua of the pregnant uterus (Abboud and Haile, 2000). FPN1 mRNA contains
IRE sequence in the 5’UTR. Unlike the IRE in 3’UTR of DMT1+IRE and TfR
59 genes, when IRE is present in the 5' end of the mRNA, the complex of IRE/IRP will prevent mRNA translation. However, in contrast to the IRP-IRE theory, it was reported that iron-deficiency (induced via a low Fe diet) induces FPN1 expression in duodenal enterocytes, while iron-replete mice (induced by i.m.
Fe-dextran injection) showed lower expression (Abboud and Haile, 2000). These results suggest the presence of an IRE-independent pathway that controls the expression of FPN1 in enterocytes. Another IRE-independent pathway was also observed where placental cells in iron-depleted mice showed no changes in the expression of FPN1 (Gambling et al., 2001). In contrast to enterocytes and placental cells, FPN1 was regulated in accordance to the IRP-IRE theory in
Kupffer cells of the liver (Abboud and Haile, 2000). Other studies showed transient transfection of cells with a FPN1 construct without an IRE motif, demonstrating expression of the molecule at the plasma membrane (McKie et al.,
2000). In addition, these cells were found to contain higher levels of IRE-IRP binding and decreased amounts of ferritin protein, indirectly suggesting that the cells became iron-deplete upon overexpression of FPN1. These results suggest that the complex tissue-specific regulation of FPN1 is linked with various functions of the molecule in different cell types.
1.3.3.3 Functions of Ferroportin1
Functional studies of FPN1 demonstrate that ferroportin1 mediates iron efflux across membranes by a mechanism that requires an auxiliary ferroxidase activity
(Donovan et al., 2000; McKie et al., 2000). Donovan et al demonstrated that the efflux of iron by FPN1 required apotransferrin (apoTf). In contrast, McKie et al showed that iron efflux by FPN1 did not require apoTf, but CP instead. Although
60 contradictory results were obtained from these studies, both authors were able to show that FPN1 may play a role in iron export in the Xenopus expression model.
Collectively, the evidence obtained from FPN1 efflux and expression studies suggests the important role FPN1 plays in iron absorption. However, the expression of FPN1 in the cytoplasm of Kupffer cells and enterocytes suggests the possibility that FPN1 may be involved in the intracellular trafficking of iron between the cytosol and organelles. In 2002, a mutation in FPN1 was associated with the development of autosomal dominant hemochromatosis type 4 (Bomford,
2002). The recent discoveries of FPN1 and Heph have given us an insight into Fe export from duodenal enterocytes. However, the link between these molecules and the mysterious labile Fe pool remains unclear. It can be speculated that the release of Fe from its chaperone may require Heph. Heph may interact with the
Fe chaperone to facilitate Fe transfer to FPN1. Once transported, Fe2+ may then be released into the circulation and oxidized by CP (Le and Richardson, 2002).
1.3.3.4 Ferroportin1 and Brain Iron Metabolism
Through immunohistochemical analysis, FPN1 expression has been found in most brain regions. Its staining in the normal rat is the highest in the hippocampus, cortex, cerebellum, thalamus, and striatum, with lesser staining in the substantia nigra and subcortical white matter. Within the cortex, the cell bodies and apical dendrites of pyramidal neurons are intensely immunoreactive.
In both the striatum and thalamus, FPN1 is most predominant in neurons. Within the hippocampus, granule cells and pyramidal cells are immunopositive for
FPN1. Neurons in the habenular necleus stain strongly for FPN1 but there is no
FPN1 detected in the ependymal cells. In the subcortical white matter,
61 oligodendrocytes are FPN1 positive. There is no pattern of distribution to the immunoreactive oligodendrocytes like that observed for iron and ferritin. In the cerebellum, Purkinje cell bodies and dendrites stain moderately for FPN1. In the hindbrain, several nuclei, including the interposed, cochlear and dentate nuclei stain intensely for FPN1. Neither ependymal cells nor blood vessels throughout the brain react positively for FPN1. In the Belgrade rats, staining for FPN1 is decreased. There is no difference in any cell type staining among any of the groups examined. Immunoblot analysis of FPN1 levels in brain homogenates indicates no differences in FPN1 levels among any of the groups. The FPN1 staining pattern suggests some export of iron from oligodendrocytes. Iron release from oligodendrocytes was previously thought to be mediated by Tf (Espinosa de los Monteros et al., 1990), but recent data indicate that Tf in oligodendrocytes is not secreted (de Arriba Zerpa et al., 2000). Thus, FPN1 may be involved in the mechanism for iron release (Connor et al., 1995; Burdo et al., 1999; Burdo et al.,
2001). Western blot analysis showed the existence of FPN1 in the rat brain, including the cortex, hippocampus, striatum and substantia nigra. The findings also showed that age has a significant effect on the expression of FPN1 protein in the four brain regions. These data imply that FPN1 might play a role in brain iron metabolism. The process of iron transport across the BBB is very similar to that of iron transport across the cells lining the gut. In the BBB, iron first crosses the apical membrane of the capillary endothelium probably by the Tf/TfR pathway, and then iron, possibly also in the form of Fe2+, crosses the basolateral membrane and enters into the interstitial fluid or CSF of the brain. The molecular mechanism underlying Fe2+ transport across the basolateral membrane of the
BBB cells remains a mystery. However, based on the similarity of the two
62 processes and the proposed function of FPN1 in duodenal enterocytes, FPN1 might function as an iron exporter of the BBB cells. As an iron exporter, FPN1 might also play a role in iron release from some brain cell types, keeping an iron balance within the cells. The possibilities need further study (Qian and Shen,
2001; Jiang et al., 2002; Qian et al., 2002).
1.3.4 Hephaestin
1.3.4.1 Hephaestin Gene and Sex-linked Anemia
Sex-linked anemia (sla) is an X-linked disorder of the mouse that is characterized by a microcytic, hypochromic anemia (Bannerman and Cooper, 1966). Early studies indicated that the anemia was due to iron deficiency rather than to a problem with erythroid cell development (Edwards and Bannerman, 1970), and this was supported by the demonstration that the anemia could be completely corrected by the parenteral administration of iron (Bannerman and Cooper, 1966).
In contrast, the anemia was refractory to oral iron treatment. The differential response to parenteral and oral iron suggested that these mice had a defect in intestinal iron absorption, and subsequent studies showed that this was indeed the case (Pinkerton and Bannerman, 1967). Affected animals are able to absorb iron from their diet across the luminal brush border normally, but the subsequent transfer across the basolateral membrane and into the circulation is impaired
(Manis, 1971). As a result, iron accumulates in the intestinal epithelial cells and is subsequently lost from the body when these cells are sloughed at the tip of the villus. Body tissues other than the small intestine are deficient in iron in the sla mouse (Russell, 1979). Early studies indicated that the sla gene lay on the position close to the microsatellites DXMit16 and DXMit96 based on the
63 analysis of intraspecific crosses (Anderson et al., 1998). These mapping data were further refined by ancestral chromosome mapping and by analyzing a mouse strain with a translocation in the candidate region (Vulpe et al., 1999).
The Heph gene was a CP homolog that mapped to a region of the human X chromosome that was syntenous with the sla region in the mouse. Subsequent analysis revealed that this gene was deleted in the sla mouse and that exons 10 and 11 were missing (Vulpe et al., 1999). His deletion segregated perfectly with the sla anemia.
1.3.4.2 Characteristic of Hephaestin
Hephaestin is highly homologous to CP (50% identity, 68% similarity) and, significantly, all the residues involved in copper binding and disulfide bond formation in CP are conserved in Heph (Vulpe et al., 1999). Unlike CP, however,
Heph is an integral membrane protein with a single membrane-spanning domain at its C-terminus. The well-defined domain organization of CP appears to be conserved in Heph and Syed et al. have proposed a structure for the protein based on available crystal structure for CP (Syed et al., 2002). CP has a ferroxidase activity that likely facilitates iron export from the reticuloendothelial system and various parenchymal cells to the plasma (Lee et al., 1968; Harris et al., 1999), and it is very likely that Heph plays a similar role in intestinal enterocytes. The defect in Heph in sla mice is a large in-frame deletion that removes a number of highly conserved residues, including several involved in copper binding and disulfide bond formation (Vulpe etal., 1999). Thus the truncated Heph protein that these mice produce would be expected to exhibit negligible or severely reduced ferroxidase activity. In addition, Heph from both
64 an intestinal cell line and enterocytes is capable of oxidizing paraphenylenediamine (PPD) like CP in plasma. These data, combined with the sla phenotype, suggest that Heph is a multicopper oxidase that plays a central role in whole body iron homeostasis due to its involvement in intestinal iron export at the basolateral membrane of duodenal enterocytes (Chen et al., 2003a).
1.3.4.3 Function and distribution of Hephaestin
The expression pattern of Heph is unique among molecules of iron homeostasis.
It is expressed in a limited number of tissues, but is found at high levels throughout the small intestine and intestine cell line (Thomas and Oates, 2002;
Fleet et al., 2003; Linder et al., 2003), to a lesser extent in the colon, and weakly in a few other tissues such as the brain, spleen, lung and placenta (Vulpe et al.,
1999; Frazer et al., 2001). The high expression of Heph in the duodenum is consistent with its primary role in intestinal iron transport, and this is a feature that it shares with other important intestinal iron transport molecules including
DMT1, FP1 and Dcytb (Gunshin et al.,1997; Abboud and Haile, 2000; Donovan et al., 2000; McKie et al., 2000; Frazer et al., 2001; McKie et al., 2001; Frazer et al., 2003). Within each region of the intestine, Heph expression is restricted to the differentiated cells of the villus and it is not expressed at an appreciable level in the intestinal crypts (Vulpe et al., 1999; Frazer et al., 2001; Stuart et al., 2003).
This again is consistent with its role in intestinal iron transport as this function is restricted to the differentiated enterocytes. The subcellular distribution of Heph is intriguing. Immunohistochemical studies have shown that the protein is located at an intracellular, supranuclear site, rather than on the plasma membrane (Frazer et al., 2001; Simovich et al., 2002). It is possible that there is an intracellular
65 reservoir of Heph from which protein is trafficked to the basolateral in times of high iron demand, such as under iron deficient conditions. Alternatively, Heph may function in the oxidation of iron at an intracellular site. More detailed localization and functional studies are required to resolve these issues. Heph has only a single transmembrane domain, so it is unlikely to be able to transport iron itself. The FP1 is expressed at high levels on the basolateral membranes of intestinal epithelium expected to be involved in iron efflux. But no studies have yet demonstrated a clear interaction between Heph and FP1 in the small intestine
(Anderson et al., 2002a). Other CP homologues may also be involved in the cellular iron export in other tissues. The placenta is an organ that must vectorially transport large amounts of iron to meet the demands of the growing fetus, and although CP has been suggested to play a role in this process, it is not able to stimulate iron release from a placental cell line (Danzeisen et al., 2000).
However, an endogenous CP-like protein with ferroxidase activity could be detected in these cells. Like Heph, this molecule appears to be membrane bound, but its smaller size suggests that it is a novel protein. The other intriguing characteristic that the placental oxidase shares with Heph is its intracellular, perinuclear location, but the precise compartment to which it localizes has yet to be identified (Danzeisen et al., 2000; Danzeisen et al., 2002).
1.3.4.4 Regulation of Hephaestin Gene Expression
Because the Heph mRNA does not possess any IRE structure, the transcription is thought to be important for the regulation of Heph gene expression. Studies in rodents have shown that the expression of Heph mRNA is increased to a small degree under iron deficient conditions and decreased with iron loading (Frazer et
66 al., 2001; Sakakibara and Aoyama, 2002). However, no iron-dependent regulation of the Heph gene expression was observed in hereditary hemochromatosis (HHC) patients (Rolfs et al., 2002). Recent studies showed that
Heph and FP1 expression responds to systemic rather than local signals of iron status (Chen et al., 2003a; Frazer et al., 2003). The change of Heph protein response to iron status is larger than mRNA, so the post-translational modification of Heph may play a significant role (Anderson et al., 2002a). Taken together, however, the current evidence suggests that Heph is not highly regulated in response to iron requirements. The small amount of regulation observed also needs to be considered against the background of a high basal expression of Heph. A further point worth considering is the possible regulation of Heph by intracellular copper levels. Studies in Caco-2 cells have shown an increase of Heph mRNA with copper loading (Han and Wessling-Resnick, 2002) and the placental oxidase is also stimulated by copper (Danzeisen et al., 2002), but the physiological relevance of these observations needs to be clarified. No other factor affecting the Heph expression study was observed.
1.3.5 Hepcidin
During studies of antimicrobial properties of various human body fluids, Park et al. isolated a new peptide from urine (Park et al., 2001) and named it hepcidin based on its site of synthesis (the liver, hep-) and antibacterial properties in vitro
(-cidin). Independently, Krause et al. isolated the same peptide from plasma ultrafiltrate (Krause et al., 2000) and named it LEAP-1 (liver-expressed antimicrobial peptide).
67 1.3.5.1 Structure of Hepcidin
Two forms of human hepcidin of 20- (hepc-20) and 25- (hepc-25) amino acids
(aa) were isolated from urine (Park et al., 2001) and blood ultrafiltrate referred to as LEAP-1 (Krause et al., 2000). These peptides were chemically synthesized and shown to be active in vitro against bacteria and fungi. The major hepcidin form was a cationic peptide with 25 amino acid residues and 4 disulfide bridges.
Surprisingly, and unlike other antimicrobial peptides, hepcidin sequences were remarkably similar among various mammalian species, and searches of expressed sequence tag (EST) databases also identified several clearly related fish hepcidins. In humans, the peptide is derived from the C-terminus of an
84-amino-acid prepropeptide, encoded by a 0.4 kb mRNA generated from three exons of a 2.5 kb gene on chromosome 19. As judged by mass spectrometry, electrophoretic migration in acid-urea PAGE, retention on C18 reverse-phase
HPLC columns and reactivity with anti-hepcidin antibody, the natural and synthetic forms were identical. Hunter et al. analyzed the synthetic forms by nuclear magnetic resonance spectrometry (Hunter et al., 2002) and established their connectivity and solution structure. The molecule is a simple hairpin whose two arms are linked by disulfide bridges in a ladder-like configuration. One highly unusual feature of the molecule is the presence of disulfide linkage between two adjacent cysteines near the turn of the hairpin. Compared to most disulfide bonds, those formed between adjacent cysteines are stressed and could have a greater chemical reactivity. Like other antimicrobial peptides, hepcidin displays spatial separation of its positively charged hydrophilic side chains from the hydrophobic ones, a characteristic of peptides that disrupt bacterial membranes.
68
1.3.5.2 Expression and Regulation of Hepcidin
Current literature suggests that hepcidin signals the body’s iron requirements to the intestine, and its predominantly hepatic expression and apparent regulation by liver-iron concentration has prompted suggestions that hepcidin is the mediator of iron absorption (Fleming and Sly, 2001a; Nicolas et al., 2001).
However, several studies have now shown that hepcidin expression can be altered by anemia, hypoxia, inflammation (Nicolas et al., 2002) and Tf saturation
(Frazer et al., 2002).
1.3.5.2.1 Iron Overload:
The connection between hepcidin and iron metabolism was first made by Pigeon et al. (Pigeon et al., 2001) during studies of the hepatic responses to iron overload. The hepcidin mRNA was induced not only by dietary or parenteral iron overload but also by treatment of the mice with lipopolysaccharide. Moreover,
β2-microglobulin knockout mice, a murine model of hemochromatosis, showed increased levels of hepcidin mRNA on normal diet but not a low iron diet. These results clearly indicated that hepcidin was regulated by iron as well as immune stimuli.
1.3.5.2.2 Infection and inflammation:
In the meantime, the connection between hepcidin and infection/inflammation was also becoming clearer. Shike et al. showed that in white bass liver, infection
69 with the fish pathogen Streptococcus iniae increased hepcidin mRNA expression
4500-fold (Shike et al., 2002). In another study by Nicolas et al., injections of turpentine, a standard inflammatory stimulus, into mice induced hepcidin mRNA
4-fold and led to a 2-fold decrease in serum iron (Nicolas et al., 2002). The hypoferremic response to turpentine-induced inflammation was absent in the
USF2/hepcidin-deficient mice, indicating that this response is fully dependent on hepcidin. Nemeth et al. assayed urinary hepcidin peptide in patients with anemia due to chronic infections or severe inflammatory diseases, and observed as much as 100-fold increases in hepcidin excretion (adjusted for urinary creatinine), with smaller increases in patients with less severe inflammatory disorders (Nemeth et al., 2003). Urinary hepcidin also increased about 100-fold in patients with iron overload from transfusions for sickle cell anemia or myelodysplasia. Hepcidin excretion correlated well with serum ferritin that is also increased by both iron loading and inflammation. Studies of the effect of iron or cytokines on isolated primary human hepatocytes (Nemeth et al., 2003) revealed that hepcidin mRNA was induced by lipopolysaccharide and strongly induced by monokines from monocytes exposed to lipopolysaccharide. Among the cytokines, IL-6, but not
IL-1α or TNF-α, strongly induced hepcidin mRNA. Surprisingly, exposure of hepatocytes to iron-saturated Tf or to ferric ammonium citrate not only failed to induce hepcidin mRNA but suppressed it. These findings indicated that hepcidin production by hepatocytes is indirectly regulated by both infection and iron.
Infections, in particular by pathogen-specific macromolecules like lipopolysaccharide, probably act on macrophages, including hepatic Kupffer cells, to induce the production of IL-6, and the cytokine in turn induces the production of hepcidin mRNA in hepatocytes (Nemeth et al., 2003). In aggregate,
70 the increase of hepcidin production due to inflammation and the ability of transgenic or tumor-derived hepcidin to suppress erythropoiesis by iron starvation strongly suggest that hepcidin is the key mediator of anemia of inflammation. However, it remains to be shown that hepcidin peptide administration to mice or humans will cause iron sequestration and iron-limited erythropoiesis.
1.3.5.2.3 Anemia and hypoxia:
In addition to iron stores and inflammation, anemia and hypoxia also affect iron metabolism. These stimuli would be expected to decrease hepcidin production and remove the inhibitory effect on iron absorption and iron release from macrophages so that more iron is available for compensatory erythropoiesis.
Several investigators (Weinstein et al., 2002) (Nicolas et al., 2002) confirmed that these effects indeed take place. Anemia induced by mouse mutations that restrict the uptake of iron in the small intestine (sla and mk mice) showed markedly decreased hepatic hepcidin mRNA. Anemia induced by phlebotomy, or by hemolysis from phenylhydrazine, also suppressed hepatic hepcidin mRNA.
Importantly, the suppressive effect of hemolytic anemia was seen even in iron-overloaded mice, suggesting that the suppression of hepcidin by anemia has a stronger effect than the stimulation of hepcidin by iron overload. This hierarchy of effects could explain why iron overload commonly develops with certain hemolytic disorders. However, these observations do not explain why iron overload occurs much more commonly in intramedullary hemolysis than in peripheral hemolysis or nonhemolytic anemias.
71
1.3.5.3 Hepcidin Regulation of Iron Homeostasis
The Tf saturation of serum is a key signal to the hepcidin reflecting. Townsend and Drakesmith proposed the mechanism for the detection of Tf saturation by
HFE and TfR2 (Townsend and Drakesmith, 2002). Some research showed that the HFE (Frazer et al., 2001), TfR2 (Kawabata et al., 1999), and hepcidin
(Pigeon et al., 2001) are highly expressed in the liver. Tf exists in the serum in three forms: diferric Tf, monoferric Tf, and apotransferrin (Leibman and Aisen,
1979). The distribution of iron between diferric Tf and monoferric Tf is dependent on Tf saturation so that a lowering of Tf saturation shifts the ratio of the two forms in favor of monoferric Tf (Huebers et al., 1984). For example, the ratio of diferric Tf to monoferric Tf is 1:2 at a Tf saturation of 30% but 1:5 at
15% saturation. All three forms of Tf can bind to TfR1 at the cell surface, although diferric Tf has a 4-fold greater affinity than monoferric Tf and a 24-fold greater affinity than apotransferrin (Young et al., 1984). This, along with the increased iron content of the diferric form, results in a more efficient iron delivery from diferric Tf than from monoferric Tf under normal conditions
(Huebers et al., 1985). However, the proportion of iron delivered from monoferric Tf increases as Tf saturation decreases (Huebers et al., 1985). Under normal conditions there is sufficient iron-bearing Tf in the circulation to totally saturate the entire cell surface TfR1 in the body (Cazzola et al., 1985). Therefore, in this state, the Tf saturation determines the ratio of diferric to monoferric Tf that is bound to its receptor at any one time.
The hemochromatosis protein HFE has also been shown to bind to TfR1 in vivo
72 (Parkkila et al., 1997; Waheed et al., 1999). In addition, the binding site for HFE on TfR1 overlaps with that of Tf (West et al., 2001). This means that there would be competition between Tf from the circulation and HFE on the cell surface for binding to TfR1. The intrinsically higher affinity of Tf for TfR1 (West et al.,
2001) makes it reasonable to assume that diferric Tf can outcompete HFE for
TfR1, binding more efficiently than monoferric Tf, although it has proved difficult to measure the relative affinities experimentally (West et al., 2001).
Based on this assumption, Frazer proposed a model for the regulation of hepcidin expression (Frazer and Anderson, 2003). The free HFE on the cell surface (i.e.,
HFE not bound to TfR1) transmits a signal to the nucleus to stimulate the production of hepcidin. However, when HFE binds to TfR1, the signal is abrogated. The competition between HFE and diferric Tf for binding to TfR1 will determine the amount of free HFE on the cell surface and consequently the level of hepcidin produced. In a normal individual, approximately 30% of the iron binding sites on Tf are occupied (Huebers and Finch, 1987), and at this level of saturation the majority of the receptor-bound Tf will be in the diferric form
(Huebers et al., 1985). Thus the competition between HFE and Tf for TfR1 binding would favor Tf. This would leave a proportion of HFE molecules free on the hepatocyte surface to stimulate hepcidin production.
As body iron stores decrease, several events occur that shift the competition in favor of HFE binding to TfR1: (1) Tf saturation decreases; (2) the ratio of diferric Tf to monoferric Tf shifts in favor of monoferric Tf; (3) cell surface
TfR1 expression increases; and (4) Tf levels increase. Thus more HFE is able to bind to TfR1 and the signal to synthesize hepcidin is reduced, leading to a
73 decrease in circulating hepcidin levels and an increase in intestinal absorption.
The opposite would occur during iron overload when Tf saturation is high and the cell surface expression of TfR1 is low. The competition would greatly favor the binding of diferric Tf and result in increased free HFE at the cell surface. In addition, the reported stimulation of HFE expression in iron-loaded cells (Han et al., 1999; Byrnes et al., 2000) would increase the amount of free HFE at the cell surface and, subsequently, the expression of hepcidin. In hemochromatosis, aberrant HFE function would prevent the induction of hepcidin expression despite TfR1 being saturated with diferric Tf. This would reduce hepcidin expression and lead to the inappropriately increased iron absorption seen under this condition. The binding of diferric Tf to TfR2 produces a signal to increase the expression of hepcidin in a similar manner to unbound HFE. Since TfR2 does not appear to bind to HFE (West et al., 2001), it is unlikely to signal through this molecule. In this case, as the level of diferric Tf falls, TfR1 would outcompete
TfR2 for diferric Tf binding, as TfR1 has a 25-fold greater affinity for diferric Tf than its homolog (West et al., 2000). This would reduce the signal for hepcidin synthesis and, as a result, stimulate absorption. When iron levels increase, the resultant lowering of TfR1 expression would shift the competition in favor of
TfR2, causing an increase in hepcidin production and a decrease in absorption. A recent study has also shown that diferric Tf raises TfR2 expression and causes a redistribution of TfR2 to the cell surface (Deaglio et al., 2002), further increasing hepcidin production when iron levels are high. This model places the regulation of hepcidin expression under the dual control of HFE/TfR1 and TfR2. A mutation in either gene would reduce the signal to express hepcidin and result in the inappropriately increased iron absorption that is seen in hemochromatosis.
74 The remaining functional molecule would continue to regulate absorption, although basal absorption would occur at a higher rate.
However, many questions need to be explained. Direct exposure of murine
(Pigeon et al., 2001) or human (Nemeth et al., 2003) hepatocytes to ferric iron, with or without serum, or of human hepatocytes to iron saturated Tf (Nemeth et al., 2003) did not induce hepcidin mRNA, and at higher concentrations of iron suppressed it. This suggests that iron-sensing may take place in other cell types.
How the free HFE or saturation of TfR2 transmits a signal to the nucleus to stimulate the production of hepcidin is unclear although Ganz has proposed that it causes the release of IL-6 and possibly other signals that act on hepatocytes to induce the synthesis and secretion of hepcidin (Ganz, 2003).
The molecules that mediate the transport of non-heme iron in enterocytes have been elucidated in this thesis’ introduction. Nicolas et al. (Nicolas et al., 2001) proposed that hepcidin interacts with receptors on the crypt cells of the duodenum and dictates the amount of iron absorbed by these cells once they have matured and migrated to the villus. However, in all situations studied thus far, hepcidin expression shows a close inverse correlation with iron absorption. This is equally true in the case of a rapid stimulus (e.g., the acute phase response) or a delayed stimulus (e.g., enhanced erythropoiesis) for iron absorption (Nicolas et al., 2002). The close temporal relationship between variations in hepcidin levels and intestinal transporter expression strongly suggests a direct effect of hepcidin on mature enterocytes. Fazer et al (Frazer and Anderson, 2003) demonstrated that expression of iron transport molecules is altered simultaneously in all mature
75 enterocytes, and not progressively as newly differentiated cells emerge from the crypts, which strongly supports this proposal.
1.3.5.4 Hepcidin and Brain Iron Metabolism
Because the brain resides behind BBB and has multiple regions with differing metabolic requirements, a variety of cell types with specialized functions and hence specialized iron requirements, it is possible that there is a system of regulating brain iron homeostasis. However, the mechanism by which the brain acquires iron or how the mechanism is regulated is poorly understood. The mechanism for iron uptake and transport across the endothelial cells lining the blood vessels, the regulation of iron uptake of specific brain region and where the brain iron is released must be considered. The role of hepcidin in body iron metabolism implies that specific factor(s) like hepcidin may also be involved in the iron homeostasis in the brain.
1.4 Current knowledge of brain iron metabolism
Elemental iron (Fe) is essential for nearly all living organisms since it participates in a variety of critical metabolic processes including oxygen transport, electron transport, DNA synthesis, and redodnon-redox reactions and other cell functions (Eisenstein, 2000; Lieu et al., 2001). Cellular iron concentrations must be tightly controlled due to low iron solubility and the ability of Fe to form toxic reactive oxygen intermediates (free radicals) in most biological systems(Eisenstein, 2000). In the central nervous system (CNS), iron is necessary for many critical metabolic functions. One role of iron in the CNS is
76 the biosynthesis of the neurotransmitters dopamine (Rouault, 2001b) and serotonin(D'Sa et al., 1996). Iron is also important in the formation of myelin by oligodendrocytes(Connor and Menzies, 1996). In mammals, brain iron accumulation increases after birth with selective uptake in regions undergoing myelination(Connor et al., 1995). In the CNS, iron is also an essential component of enzymes of oxidative metabolism, such as those catalyzed by the cytochromes and iron-sulfur enzymes. Brain energy requirements are high, with particular demand for ATP as the principal energy source for stable cellular ionic gradients, synaptic transmission and distant axoplasmic transport. Thus, it is not surprising that Fe-related mitochondria1 dysfunction has been associated with neurodegeneration. During CNS oxidative metabolism, free radicals are normally produced and metabolized, but an excess of free Fe results in rapid formation of toxic reactive oxygen intermediates that may be one mechanism of CNS cell death in neurodegeneration
Abnormally high levels of iron in the brain have been proved in many neurodegenerative disorders (Aisen et al., 1999; Jellinger, 1999; Sadrzadeh and
Saffari, 2004), such as Hallerorden–Spatz syndrome (HSS)(Hartig et al., 2006;
Swaiman, 1991),Parkinson’s disease (PD) (Berg, 2006; Berg et al., 2006; Fasano et al., 2006a, b) and Alzheimer’s disease (AD) (Ong and Farooqui, 2005;
Quintana et al., 2006). Excessive brain iron can result in oxidative stress and induce neuronal death in these disorders. Deficiencies of antioxidant defense are also associated with this damage. (Qian et al., 1997a; Qian and Wang, 1998;
Sayre et al., 1999; Andrews, 1999, 2000; Ke and Qian, 2003; Aracena et al.,
2006; Berg and Hochstrasser, 2006; Shamoto-Nagai1 et al., 2006). However, two
77 questions about brain iron need to be answered. First, what is the mechanism of abnormal iron increase in the brain? Second, is excessive iron mass in the brain an initial event or a result of the disease (Ke and Qian, 2003; Lee et al., 2006)?
During the past years, many studies of brain iron metabolism for iron-associated neurodegenerative diseases have provided evidences about homeostatic and pathological mechanism. These data show that misregulation of brain iron is one of the initial causes for some neurodegenerative diseases (Ke and Qian, 2003;
Thomas and Jankovic, 2004; Kaur and Andersen, 2004; Casadesus et al., 2004).
Although the mechanisms are not very clear, the causes of imbalance of brain iron metabolism can be divided into genetic and nongenetic in these disorders.
The procedures of iron metabolism are complicated, including iron uptake and release, storage, intracellular metabolism and modulation. Each of these is disturbed that causes an imbalance of iron metabolism in the brain (Ke and Qian,
2003). It is the increased brain iron that triggers a cascade of harmful events, leading to neuronal death in these diseases.
1.4.1 Iron Uptake and Transport in the brain
Iron uptake in the brain is limited by the blood-brain barrier and blood-cerebrospinal fluid (CSF) barrier(Bradbury, 1997) maintained by tight junctions between microvascular endothelial cells and choroid plexus epithelium.
Thus, CNS-regulated expression of transport proteins is required for uptake of iron (Connor et al., 2001). Iron uptake into the brain is mediated in part by transferrin receptor expression in the endothelial cells and choroid plexus cells(Moos, 1996) or lactoferrin receptor expression on neurons and microvessels(Kawamata et al., 1993; Leveugle et al., 1994). The endothelial cells
78 release Fe from the Fe-lactoferrin or Fe-transferrin complex after this Fe-receptor complex endocytosis (Leveugle et al., 1994). Movement of iron from the cytosol to the extracellular spaces of the CNS involves brain specific proteins. In the
CNS, ceruloplasmin(CP) is expressed highly as a membrane anchored protein(Patel et al., 2000) and the data of in situ hybridization of CNS tissue
(specific in glial cells around vessel in the brain) reveals that ceruloplasmin gene expression is associated closely with neurons in the substantia nigra (Klomp and Gitlin, 1996). Thus, ceruloplasmin may play a role in iron export from endothelial cells into the extracellular spaces or from iron loaded cells such as dopaminergic neurons in the substantia nigra. The subsequent transport of Fe to other areas of the brain is likely to be mediated by transferrin and nontransferrin-bound mechanisms(Moos and Morgan, 2000). Serum transferrin is not found within the CNS unless there is a breakdown of the blood-brain barrier (Crowe and Morgan, 1992). Thus, the transferrin of brain must be synthesized by itself, and the synthesis is regulated by a nervous system-specific promoter (Bowman et al., 1995; Rouault, 2001b). Cellular iron uptake may be stimulated by ceruloplasmin ferroxidase activity by means of a recently reported trivalent cationspecific transport mechanism (Attieh et al., 1999). The divalent metal transporter 1 (DMTI, Nramp2) has been implicated in the transport of iron from endosomes and is localized in neurons and oligodendrocytes (Glial cells that produce and support the myelin sheath, in the CNS), which show a significantly decreased iron content in the Belgrade rat with a mutation in
DMTl/Nramp2 (Burdo et al., 1999). Alternatively, evidence suggests that Fe may be transported by glial cell processes, from astrocyte foot processes that surround the microvasculature, through the astrocyte cell extensions to remote regions
79 (Qian et al., 2000). Ferritin binding, presumably due to specific receptors, has been identified in the human brain(Hulet et al., 1999). Ferritin-binding sites are distributed in iron-rich areas of the brain in contrast to the transferrin receptor distribution which is located primarily in the grey matter (Hulet et al., 1999).
Ferritin receptor binding was considered to have a more important role in iron uptake, because the localization of ferritin-binding sites is better correlated with brain iron accumulation than the transferrin receptor.
1.4.2 Iron Storage in the brain
Ferritin, a cytosolic protein, binds and stores intracellular iron in most cells of the
CNS and prevents it from forming reactive oxygen intermediates (Lieu et al.,
2001). In the Central Neuron System, the neurons produce ferritin protein and transport holoferritin by axoplasmic flow to axons where ferritin may be degraded distally within lysosomes (Abboud and Haile, 2000; Donovan et al.,
2000; LaVaute et al., 2001). Very early in mammalian CNS development, iron first appears in microglia (Connor et al., 1995) and then, as brain development continues, ferritin and stored iron appear in oligodendroglia in both temporal and regional correlation with myelination of axons (Connor and Menzies, 1996). The expression of ferritin is induced by the presence of excess iron(Lieu et al., 2001).
Intact human ceruloplasmin appears to be required for the incorporation and loading of iron into ferritin (Van Eden and Aust, 2000). The quantity of ferritin binding iron in the brain may be elevated in some neurodegenerative diseases, for example, Alzheimer disease. Neuromelanin (Double et al., 2000) is another major iron storage mechanism in the CNS such as the substantia nigra.
Intraneuronal membrane-bound neuromelanin has a strong chelating ability for
80 iron and may be another mechanism of intracellular iron sequestration.
1.4.3 Intracellular Iron Utilization
Iron participates in a series of cellular metabolic processes in the brain, for example, as tyrosine hydroxylase, cofactor for the enzymes (Connor et al., 2001).
Also, iron is essential for the biosynthesis of CNS lipids and cholesterol; in oligodendroglia, iron plays an important role of action of metabolic enzymes as a co-factor. In the brain, the mitochondrion is a particularly critical organelle of intracellular iron utilization. In order to keep mitochondrial function, vital non-heme proteins, cytochromes a, b and c, and cytochrome oxidase in the organelle require iron to be assembled in the energy generation process (Connor et al., 2001). Mitochondrial iron sequestration has been demonstrated in dopamine-challenged astrocytes, providing a possible alternative pathogenetic mechanism for iron accumulation, mitochondrial damage and oxidative injury in neurodegeneration (Schipper et al., 1999). However, frataxin, a kind of protein located to the mitochondrion in the CNS, was believed to be involved in iron metabolism. (Campuzano et al., 1997; Koutnikova et al., 1997; Priller et al.,
1997). The function of frataxin is not entirely clear, but it seems to be involved in the assembly of iron-sulfur clusters. Its structural suggested that frataxin may serve an iron storage function similar to that of ferrtin in the brain (Roy and
Andrews, 2001).
1.4.4 Iron Recycling and Export
Most of the iron taken up by the human body is extensively recycled and reused and there is no exception in the CNS, although little is known about how or if
81 iron exits the CNS. Macrophages play a key role in iron recycling of the peripheral tissues and organs through phagocytosis of senescent erythrocytes but red cells are not normally present inside the CNS blood-brain barrier except in brain injuries (Sastry and Arendash, 1995). Transferrin-bound Fe in the interstitial fluid could exit the CNS through the arachnoid villi that normally participate in the exit of CSF into the venous system (Rouault, 2001b).
Alternatively, vascular endothelial cells could export transferrin-bound iron back into the circulation. In addition, heme oxygenase (HO) is present in the brain in two forms (HO-1 and HO-2) that appear to have functions other than heme recycling (Maines, 2000). Recent studies of HO distribution demonstrate high levels of HO-2 in the brain (Maines, 2000) with the highest levels localized in the substantia nigra (Calabrese et al., 2002). HO-1 appears to be involved in mitochondrial iron trapping via the mitochondrial transition pore which mediates the transfer of non-transferrin iron into mitochondria (Poss and Tonegawa, 1997;
Schipper et al., 1999). HO is upregulated in stroke, stress and proinflammatory cytokine release which might contribute to brain iron accumulation in neurodegeneration (Mehindate et al., 2001; Poss and Tonegawa, 1997) but one experimental brain ischemic injury model suggested that increased HO activity does not contribute to iron accumulation (Bidmon et al., 2001). Consistent with this hypothesis, Ferris et al. (Ferris et al., 1999) showed that cells from mice with a targeted deletion of the HO-1 gene demonstrated reduced iron efflux in
HO-1-deficient fibroblasts, suggesting a possible mechanism for intracellular iron accumulation and cell death.
82 1.4.5 Mechanisms of Iron Homeostasis
Some fundamentals of CNS iron homeostasis remain unclear, but some animal models of iron metabolism disorders produced by targeted genetic knockout could provide some clues to these basic mechanisms. For example, iron regulatory protein-2 (IRP2) gene disruption in mice results in iron accumulation in distinctive brain regions and is associated with iron overload in degenerated neurons and in oligodendrocytes with ubiquitin positive inclusions (LaVaute et al., 2001). This finding leads to a neurodegenerative disease in IRP2-/- mice
(LaVaute et al., 2001) suggesting possible contributions to the pathogenesis of comparable human neurological disorders. HFE is a kind of the hemochromatosis gene whose function is unclear in the brain, but HFE protein is highly expressed in vascular endothelial cells of the cerebellum and cortex. The location is considered that is associated with iron metabolism regulation (Bastin et al., 1998; Moos and Morgan, 2000). However, some systemic iron overload disorders are not found excessive brain iron level or neurodegenerative disease, for example, hereditary hemochromatosis. Consistent with the above notion,
Moos et al. (Moos and Morgan, 2000) examined whether high circulatory levels of iron could cause brain iron accumulation and they clearly showed that there is exclusion of excess plasma iron from transfer into the brain.
1.4.6 Neurodegenerative Disorders Associated with Increased Total Iron
Content
A common feature of some neurodegenerative diseases is the existence of excessive total brain iron which is thought to be a cause of the generation of many of these diseases. A significant increased concentration of brain iron was
83 found in the neuronal systems or some specific brain regions in some neurodegenerative diseases (Rouault, 2001a, b; Roy and Andrews, 2001).
Similarly, in certain neurodegenerative basal ganglia disorders including
Parkinson disease, Huntington disease, and hereditary aceruloplasminemia, accumulation of iron in the basal ganglia was found (Rouault, 2001b; Roy and
Andrews, 2001). The question of increased cellular brain iron is still not exactly answered. But there are several possible mechanisms in the pathological procedures of the neurodegenerative diseases. The most often cited potential mechanism is the ability of iron to promote oxidative damage (Chiueh, 2001;
Rouault, 2001b; Roy and Andrews, 2001). It has been proposed that some brain regions or specific neuronal groups, i.e., dopaminergic neurons, with a high rate of free oxygen radical production would be vulnerable to excessive iron-mediated free radicals via the Fenton reaction (Hirsch and Faucheux, 1998).
Iron and oxidative stress might result in the damage and aggregation of proteins.
In fact, in vitro iron has been shown to promote aggregation of a-synuclein, reminiscent of Lewy bodies or amyloid (Hashimoto et al., 1999). Hydroxyl radicals and other oxygen-free radicals are produced during normal brain metabolism (Hirsch and Faucheux, 1998) and significantly higher plasma levels of hydroxyl radicals have been demonstrated in Parkinson disease (Ihara et al.,
1999), together with increased lipid peroxidation products in the CSF and brain
(Miyajima et al., 1998; Yoshida et al., 2000), suggesting a role in neurodegeneration. Subsequently, the ubiquitin-proteasome system, which is essential for non-lysosomal catabolism, could fail to adequately clear damaged or aggregated proteins in the CNS cells.
84 1.4.6.1 Alzheimer Disease
Excessive iron accumulation and oxidative damage have been associated with
Alzheimer disease and may contribute to the pathogenesis or disease progression
(Connor et al., 2001). In this disease, iron has been associated with senile plaques, deposition of P-amyloid peptide fragments and abnormal processing of amyloid precursor protein (Connor et al., 1992; Rogers et al., 1999). Analysis detecting the iron concentration of some regions of selective vulnerability of Alzheimer disease brains, such as the hippocampus and cerebral cortex, indicates iron accumulation in these brain regions. Iron accumulation in Alzheimer disease has been suggested as an important source of redox-generated free radicals and a contributor to oxidative damage in this disease (Smith et al., 1997). Other iron-binding proteins that have been associated with Alzheimer neurodegeneration include transferrin, ferritin and IRPZ. Specifically, transferrin is indicated to locate to glial cells in brain tissue from Alzheimer subjects
(Jefferies et al., 1996). And some reports about senile plaques of Alzheimer brains also demonstrated ferritin containing microglia, ferritin cores and nanoscale iron oxides in these researches (Dobson, 2001). These investigations of ferritin suggested a possible role for ferritin in the disruption of Alzheimer brain iron homeostasis. In mice with deletion of IRP2 genes, iron overload and degeneration of neurons with associated ubiquitin-positive inclusions appear in the CNS. It is clear that IRP2 also has an important role in neurodegeneration.
Melanotransferrin (p97) is considered as a biochemical marker for Alzheimer disease (Kim et al., 2001). The reason is that expression of melanotransferrin
(p97) increases in Alzheimer disease but not in other neurodegenerative diseases
(Kim et al., 2001; Ujiie et al., 2002). And melanotransferrin may be
85 over-expressed in senile plaque-associated reactive microglia (Kim et al., 2001;
Ujiie et al., 2002).
1.4.6.2 Parkinson Disease
Parkinson disease and other basal ganglia disorders (Hirsch and Faucheux, 1998) are also related with impaired iron homeostasis. The origin of the increased iron content in Parkinson disease is presently unknown. Specifically in Parkinson disease, there is increased iron loading of intracellular femtin (Hirsch and
Faucheux, 1998) and iron deposits are found within degenerating neurons of the substantia nigra undergoing apoptosis and in Lewy bodies (Bartzokis et al.,
1999a). In the brain, catecholaminergic neurons can produce neuromelanin (NM), which is a dark polymer pigment associated with iron. In Parkinson disease, neuromelanin significantly accumulates within the substantia nigra (Bartzokis et al., 1999b). This suggested that the mechanism of neuromelanin binding ferritin with iron (III) may play an important role in the neurodegeneration disorder of
Parkinson disease(Good et al., 1992). Lewy bodies, a kind of major biomarker of
Parkinson diseases, are abnormally protein aggregation in neurons. In the substantia nigra of Parkinson patients, the Lewy bodies are enhanced by HO immunoreactivity (Dewachter et al., 2000). MPTP
(1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) can kill certain neurons in the substantia nigra and cause permanent symptoms of Parkinson disease. As a neurotoxin, MPTP selectively induces HO expression in striatal astrocytes
(Fernandez-Gonzalez et al., 2000), thus suggesting a possible role of HO in the pathogenesis of Parkinson disease. The structure of lactoferrin is similar to that of transferrin, but their function including lactoferrin and lactoferrin receptor is
86 not clear in the CNS. Postmortem Parkinson brain tissue revealed that expression of lactoferrin receptors increased on neurons and microvessels in the neuronal degeneration regions of the mesencephalon. This suggests the increased expression of lactoferrin receptor may be induced by iron overload in the affected brain regions (Lee et al., 2002). IRP2 gene knockout mice show misregulation of brain iron metabolism and a neurodegenerative disorder with significant brain iron overload (LaVaute et al., 2001), and the human brain distribution of IRP2 colocalizes with redox-active iron and the brain lesions of
Alzheimer disease(Smith et al., 1998). We have proposed that affinity between the IRP and the binding site on the mRNA is increased by the dysfunction in the
IRP system in Alzheimer’s disease (Pinero et al., 2000). This increased affinity between the IRP and the mRNA binding site results in and an increase in cellular iron uptake and an increased vulnerability to oxidative stress, both of which occur in Alzheimer’s disease. An increase in affinity of IRPs to the iron-responsive binding site on mRNAs may also directly influence amyloid precursor protein processing(Rogers et al., 1999).
1.4.7 Iron Deficiency and CNS Dysfunction
Iron excess can result in neuron degeneration, and iron deficiency is associated with central nerve system dysfunction. There have been many studies that reported the issue of iron deficiency and CNS dysfunction. The effects of iron deficiency on the nervous system have been reviewed in the past (Dallman et al.,
1978; Pollitt and Leibel, 1976). These researches focused on developmental and intellectual retardation in experimental animals and humans as a result of iron deficiency. Neurological symptoms in iron-deficient patients include headaches,
87 papilledema resolving with iron therapy (Shukla et al., 1989), and parasthesias.
The relationship between intellectual subnormality and iron deficiency has been controversial due to the complexity of interacting factors. Oski and Honig (Oski and Honig, 1978) used iron supplementation to cure iron deficient infants; they found improvement within 1 week after iron supplementation treatment. The study suggests that developmental retardation may be associated with elemental
Fe deficiency and not anemia. This could be the result of a lack of functionally critical iron-containing proteins such as iron-sulfur proteins, metalloflavoproteins
(Silaghi-Dumitrescu et al., 2005) and cytochromes(Nazifi et al., 2009). Studies of iron deficiency in animals during development have demonstrated that ignoring iron treatment after infants weaning would induce low brain iron concentrations and neurobehavioral abnormalities. It suggested that sufficient brain iron concentration is important to normal development(Beard, 2008) and behavior(Rosales and Zeisel, 2008; Simka and Rybak, 2008). Studies of perinatal medical research also found that iron deficiency can decrease cytochrome c oxidase activity in hippocampus of the neonatal rat brain. It uncovered that perinatal iron deficiency may reduce brain cellular metabolic activity, especially in the part of brain that deals with memory(Beard, 2008).
1.5 Biological activity of recombinant adenovirus and retrovirus
1.5.1 Recombinant adenovirus
Recombinant adenoviruses are used for tpurposes include in vitro gene transfer, in vivo vaccination, and gene therapy(Berkner, 1988; Miller, 1992; Morgan and
Anderson, 1993). Several features of adenovirus biology have made such viruses
88 the vectors of choice for certain of these applications. For example, a broad spectrum of infective cell types and gene transfer is not dependent on active cell division. Moreover, high titers of viruses and high levels of transgenic expression generally can be obtained.
The viral life cycle and the functions of the majority of viral proteins have been elucidated through decades of detailed study of adenovirus biology. The human adenovirus (serotype 5), which is the most commonly used adenovirus, consists of a linear, 36-kb, double-stranded DNA genome. Adenovirus transcription units are divided into early phase (E1, E2, E3, and E4) and late phase, the latter defined as beginning with the onset of viral DNA replication. It is difficult to operate recombinant manipulation of adenovirus because of its high density and complexity of the viral transcription units. To simplify the recombinant manipulation, it is usually restricted to specific regions, particularly E1, E2A, E3, and E4. In most recombinant vectors, E1 or E3 is deleted by transgenes technology. In the package process, E1 or E3 will be supplied from exogenous packaging cells (e.g. HEK293). The E1 deletion renders the viruses defective for replication and incapable of producing infectious viral particles in target cells; the E3 region encodes proteins involved in evading host immunity and is dispensable for viral production per se.
There are two approaches traditionally used to generate recombinant adenoviruses. The first involves direct ligation of DNA fragments of the adenoviral genome to restrict endonuclease fragments containing a transgene(Ballay et al., 1985; Rosenfeld et al., 1991). The second and more
89 widely used method is defective adenoviruses generation in mammalian cells through homologous recombination (Mittal et al., 1993; Stratford-Perricaudet et al., 1992). Packaging cell line (e.g., 293 or 911 cells) supplies the defective genes
(e.g., E1) to generate a defective adenovirus which cannot be replicated fully in other cells. (Graham et al., 1977). The desired recombinants are identified by screening individual plaques generated in a lawn of packaging cells (Becker et al.,
1994). This approach requires a long time to complete the viral production process. This has undoubtedly hampered a more widespread use of this adenoviral vector technology.
In this thesis, Ad-easy system was selected as viral vector of gene delivering. In our system, the backbone vector containing most of the adenoviral genome was used in a supercoiled form, thus obviating the need to enzymatically manipulate it. The homology recombination was performed in Escherichia coli rather than mammalian cells. And there were no ligation steps involved in generating the adenoviral recombinants, as the process took advantage of the highly efficient homologous recombination machinery present in bacteria. The capacity of the vectors was enough to allow the inclusion of up to 10 kb of transgene sequences and allow multiple transgenes to be produced from the same virus. In addition, the adenovirus vectors contained a green fluorescent protein (GFP) gene incorporated into the adenoviral backbone as a report gene. The green fluorescence could be directly observed under fluorescent microscope to determine the efficiency of transfection and infection, processes that had been difficult to follow with adenoviruses in the past. Adenoviral vector system includes two vectors, one is a Shuttle vector that delivers interested genes into
90 the system, and the other is a pAdeasy-1 plasmid that is an adenovirus genome.
Constructing a recombinant adenoviral vector using the AdEasy system is a two-step process in which the desired expression cassette is first subcloned into a shuttle vector, and then transferred into the adenoviral genome by homologous recombination in E. coli.
Figure 1-4
The pAdEasy-1 vector contains most of the human adenovirus serotype 5 (Ad5) genome and is deleted for the genes E1 and E3. The expression cassette from the shuttle vector is inserted into the original E1 region of the adenovirus genome by
91 homologous recombination. The pAdEasy-1 vector carries the ampicillin resistance gene, which is lost after recombination with a shuttle vector.
1.5.2 Recombinant retrovirus
The retrovirus vector has numerous features that make it suitable for gene delivery. Their life cycle includes an integrated state in the DNA of the host chromosome. The promoter of retrovirus can direct high level expression of genes encoded within the confines of its genome. This regulation depends upon local chromatin context(s) often influenced by cell type-specific promoter events.
As evidenced by the discovery of oncogenes within certain strains of leukemia and sarcoma-inducing murine retroviruses, the retroviral genome can accommodate changes to its configuration. For these and other reasons retroviruses offer gene transfer specialists and gene therapy researchers probably the best utility for delivering genes to target cells at high efficiency in a manner that allows for a long-term, stable expression of the introduced genetic elements
The retroviral life cycle begins in the nucleus of an infected cell. At this stage of the life cycle the retroviral genome is a DNA element integrated into and covalently attached to the DNA of the host cell. The genome of the virus is of approximately 8-12 kilobases of DNA (depending upon the retroviral species).
Full-length genomic mRNA is made initiating at the beginning of the R (repeat) at the 5' LTR (Long Terminal Repeat).The free particle can infect new cells by binding to a cell surface receptor. The specificity of the virus-cell interaction is determined largely by the envelope protein(s) of the retrovirus. Infection leads to
92 injection of the virus nucleoprotein core (consisting mostly of gag-derived proteins, full-length genomic RNA, and the reverse transcriptase protein). Once inside the cell, the nucleoprotein complex accesses intracellular DNA nucleotide triphosphate pools, upon which the reverse transcriptase protein initiates the creation of a double-stranded DNA copy of the genome of the virus in preparation for integration into the host cell chromosome. Upon completion of the reverse transcription, the viral enzyme integrase searches the DNA for an appropriate "home", upon which the integrase clips the host DNA and sews the double-stranded DNA into the host DNA (see below). The virus is now prepared to initiate a new round of replication.
The pSUPER RNAi System allows researchers to perform long-term experiments to study the effect of blocking the production of specific proteins within cells and whole organisms, and may lead to the development of RNAi as a major new therapeutic weapon against many diseases including HIV, cancer and other genetic disorders.
Figure 1-5
The pSuper-retro-puro is a member of the pSuper RNAi family. It has a
93 distinctive character which is pSuper-retro-puro can integrate into a specific cell
(ex. Phi-NX cell) genome and can produce an endless stream of new generation of retrovirus.
1.6 Application of recombinant adenovirus and retrovirus on brain iron
metabolism
Recombinant adenovirus and retrovirus are wildly used in gene therapy as gene delivering vehicle. But studies and application are relatively rare in brain iron metabolism. In 1995, Muldoon used MION (paramagnetic monocrystalline iron oxide nanoparticles) to assess the infective effect of adenovirus and HSV in rat brain(Muldoon et al., 1995). Their data revealed that differential cell type infective of the two virus types was found in rat brain. They also found toxicity for the viral vector after administration by either direct inoculation or BBB disruption. But the toxicity of recombinant adenovirus is lee than that of HSV.
The recombinant adenovirus is applied expressly in iron metabolism is published by Zhu et al in 2004(Zhu et al., 2004). They constructed transferrin-receptor recombinant adenovirus to treat Caco-2 cells. Their data suggested the potential clinical benefit conditions where drug delivery is a challenge, such as within the airway epithelium, at the bladder lumen urothelial cell interface, and across the blood-brain barrier for clinical treatment of lung, urogenital, and brain disorders, respectively by adenoviral transcytosis of transgene delivery. In 2008, Hung et al
(Hung et al., 2008)published a paper about the role of HO-1 over-expression in neuroprotection. In their research, they utilized recombinant HO-1 adenovirus to treat neurons, and their results indicated that HO-1 induction exerts
94 neuroprotection both in vitro and in vivo. Compared with adenovirus, report of application of retrovirus is rare in iron metabolism. Only in 2006 did Benchoua et al report that complex II defects in HD may be instrumental in striatal cell death using a lentivirus vector.
Our research is the first one to apply various viral vectors including induction expression adenoviruses and repression expression retroviruses associated with iron related genes. In this thesis, we will describe the construction and application of DMT1, TfR1, FPN1, Hepcidin and Hephaestin recombinant adenovirus and retrovirus in brain iron metabolism in detailed.
1.7 Objective
This thesis will investigate some important aspects of brain iron homeostasis and brain iron transport proteins.
1.7.1 Part 1
This study aims to:
Construction and biological activity test of iron related genes recombinant adenovirus and retrovirus.
1.7.2 Part 2
This study aims to:
Investigate the application of retro-DMT1 in neurons and the role of protection to neurons.
95 1.7.3 Part 3
This study aims to:
The study is to investigate the regulation effect of hepcidin through Ad-hepc and
Retro-hepc treatment.
1.7.4 Part 4
This study aims to:
Observe the function of Ad-FPN1, Retro-FPN1, Ad-DMT1 (+), Ad-DMT1 (-),
Retro-DMT1 in iron metabolism in vitro.
96 2 Chapter 2 Methodology
2.1 Materials
2.1.1 Reagents and Analysis Kits
Acrylamide/bis-acrylamide 30% Bio-Rad Technology Ltd.,USA solution, electrophoresis grade
Agarose standard low-Mr Bio-Rad Technology Ltd., USA
Ammonium persulphate Bio-Rad Technology Ltd., USA
Ammonium sulfate Sigma Chemical Co. USA
Apo-transferrin (Rat) Sigma Chemical Co. USA
Aprotinin Sigma Chemical Co. USA
Bathophenanthroline disulfonic (BP) Sigma Chemical Co., USA
Bromophenol blue Bio-Rad Technology Ltd., USA
Chloroform Sigma Chemical Co. USA
DC protein assay kit Bio-Rad Technology Ltd.,USA
Diethyl ether Lab-Scan Ltd., Ireland
Dimethyl sulfoxide Sigma Chemical Co., USA
DMEM medium Invitrogen, CA, USA
ECL Western blotting analysis system Amersham Pharmacia biotech, USA
(RPN2132)
EDTA Sigma Chemical Co., USA
Ethidum bromide Bio-Rad Technology Ltd.,USA
Ethanol (100 %, 96 %) Lab-Scan Ltd., Ireland
97 FeCl3 Sigma Chemical Co., USA
FeSO4 Sigma Chemical Co., USA
55FeCl3 PerkinElmer Inc., USA
Fetal bovine serum Invitrogen (Carlsbad, CA), USA
Glycerol Bio-Rad Technology Ltd., USA
Glycine Bio-Rad Technology Ltd., USA
HEPES Sigma Chemical Co., USA iQ SYBR Green Surmix Bio-Rad Technology Ltd., USA
Iron and total iron binding capacity ki Stanbio laboratory Co., USA
Isopropanol Sigma Chemical Co., USA
Lead nitrate Sigma Chemical Co., USA
Leupeptin Sigma Chemical Co., USA
Lipopolysaccaride Sigma Chemical Co., USA
MgSO4 Sigma Chemical Co., USA
2-mercaptoethanol Bio-Rad Technology Ltd., USA
Methanol Lab-Scan Ltd., Ireland
Hydrochloride acid Lab-Scan Ltd., Ireland
Nitrilotriacetic acid (NTA) Sigma Chemical Co., USA
Nonidet P-40 Sigma Chemical Co., USA
Paraformaldehyde Sigma Chemical Co., USA
Penicillin-streptomycin Invitrogen (Carlsbad, CA), USA
Pipes Sigma Chemical Co., USA
PMSF Sigma Chemical Co., USA
Prestained protein marker Bio-Rad Laboratories, CA, USA
98 RPMI 1640 medium Invitrogen, CA, USA
RT-for-PCR Kit, Cat# A3500 Promega corporation., USA
Scintillation cocktail Beckman Coulter, Inc., USA
Sodium Acetate Sigma Chemical Co., USA
Sodium barbital Sigma Chemical Co., USA
Sodium β-glycerophosphate Sigma Chemical Co., USA
Sodium chloride Sigma Chemical Co., USA
Sodium deoxycholate Sigma Chemical Co., USA
SDS Bio-Rad Technology Ltd., USA
Sodium orthovanadate Sigma Chemical Co., USA
Sucrose Sigma Chemical Co., USA
TEMED Bio-Rad Technology Ltd., USA
Tris Bio-Rad Technology Ltd., USA
Trizol® Reagent Invitrogen (Carlsbad, CA), USA
Trypsin Invitrogen (Carlsbad, CA), USA
Tween 20 Sigma Chemical Co., USA
Mouse anti-Mouse Ceruloplasmin BD Transduction Laboratories., USA purified antibody
Mouse anti-rat CD71 monoclon BD Bioscience, USA antibody
Rabbit anti-Mouse Hephaestin Alpha Diagnostic International, antibody Inc., USA
Rabbit anti-Rat DMT1+IRE antibody Alpha Diagnostic International,
Inc., USA
99 Rabbit anti-Rat DMT1-IRE antibody Alpha Diagnostic International, Inc., USA
Rabbit anti-mouse FP1 antibody Alpha Diagnostic International, Inc., USA
Mouse anti-rat β-actin monoclon Sigma Chemical Co., USA antibody
2.1.2 Apparatus
Autoclave (model HA-30) Hirayama manufacturing, Japan
Boiling water bath Grand Instruments, USA
Jouan Centrifuge DJB labcare Ltd., England
Dri-bath Barnstead/Thermolyne Ltd.,USA
GeneAmp PCR System 9700 PE Applied Biosystems, USA
Incubator (model TC2323) Shel LAB, USA
Leica microscope (Model DRIMB) Leica Germany
LS 5600 scintillation counter Beckman Coulter, Inc., USA
Lumi-imager Roche Molecular Biochemicals Ltd
USA
Luminar flow cabinet (model Nu-425-400E) Perkinelmer Inc., USA
MBA spectrometer Eppendorf, Germany
Microcentrifuge Hawksley, Australia
Micro-hematocrit centrifuge and reader Bio-Rad Technology Ltd.,USA
Minigel apparatus Bio-Rad Laboratories Inc.,USA
Mini-protein II Electrophoresis Cell KOFA Enterprise Limited.,HK
Orbital incubater SI50 Orion research, USA pH meter (Model 701 digital) Bio-Rad Technology Ltd., USA
100 Power supply Precision Scientific Ltd., Indian
Reciprocal shaking bath IKA-Labortechnik., Germany
Rotor–stator homogenizer Cepheid Corporate., USA
Smart cycler Branson Inc., USA
Sonicator, Branson Sonifier 250
2.2 Cell Culture
2.2.1 Primary rat’s neuron culture
2.2.1.1 Reagents and solutions
Chopping solution (0.01% DNase I in CMF-HBSS/HEPES with antibiotics):
0.01 g DNase I
100 ml dissection solution (see recipe)
Adjust pH to 7.2 with 0.1 M NaOH
Filter sterilize through 0.2-μm filter
Divide into 10-ml aliquots
Store up to 6 months at −20°C.
Dissection solution (CMF HBSS/HEPES with antibiotics)
100 ml 10× CMF-HBSS (e.g., Life Technologies)
800 ml H2O
3.9 g HEPES (15 mM final)
0.84 g NaHCO3 (10 mM final; cell culture tested, Sigma)
10 ml 100× penicillin/streptomycin (e.g., Life Technologies; 100 U/ml
101 penicillin/100 μg/ml streptomycin final)
Adjust pH to 7.2 with 1 N HCl
Add H2O to 1 liter
Filter sterilize through 0.2-μm sterile filter
Store up to 1 month at 4°C.
DMEM/F-12/N2, supplemented
900 ml DMEM/F-12 (APPENDIX 2A; with L-glutamine and antibiotics)
3.9 g HEPES
3.7 g NaHCO3 (cell culture tested, Sigma)
0.11 g sodium pyruvate
N2 supplements (purchase from Invitrogen)
Adjust pH to 7.2 or 7.3 with 1 N HCl
Adjust volume to 1 liter with DMEM/F-12
Filter sterilize through 0.2-μm filter
Store protected from light for up to 1 month at 4°C.
DMEM/F-12/N2/10% FBS, supplemented
Add 50 ml heat-inactivated (30 min at 56°C) FBS (Sigma) to 450 ml supplemented DMEM/F-12/N2. Store protected from light for up to 1 month at 4°C.
Fibronectin, 1 μg/ml
Resuspend 1 mg sterile, lyophilized bovine fibronectin in 1 ml sterile deionized, distilled water according to the manufacturer’s instructions.
102 Store up to 3 to 4 weeks at 4°C. On day of use, dilute 1:1000 to 1 μg/ml with sterile water.
Phosphate-buffered saline (PBS) with antibiotics, 10× :
Dilute 10× PBS (APPENDIX 2A) to 990 ml with water. Add 10 ml of 100× penicillin/streptomycin (Invitrogen; 100 U/ml penicillin/100 μg/ml streptomycin final) and adjust pH to 7.4 with 1 N NaOH. Filter sterilize through a 0.2-μm filter and store up to 1 month at 4°C.
Polyornithine, 15 μg/ml
100× stock (1.5 mg/ml):
0.150 g polyornithine hydrobromide (MW 55,000; Sigma),
100 ml H2O.
Divide into aliquots and store (stable at least 6 months) at −20°C. Working solution (15 μg/ml):
When needed, dilute 1:100 with H2O.
Filter sterilize through 0.2-μm filter.
Store up to 1 month at 4°C.
Trituration solution (1% DNase I in CMF-HBSS)
0.1 g DNase I (from bovine pancreas; 1700 to 3300 U/mg dry weight;
Worthington) add to 10 ml 1× CMF-HBSS.
Adjust pH to 7.2 with 0.1 N NaOH.
Filter sterilize through 0.2-μm filter
103 Divide into 1.5-ml aliquots.
Store up to 6 months at −20°C.
Trypsinization solution (0.1% trypsin/0.4% DNase I in CMF-HBSS)
0.025 g trypsin (from bovine pancreas; 200 to 300 U/mg protein; Worthington)
0.1 g DNase I (from bovine pancreas; 1700 to 3300 U/mg dry weight;
Worthington).
25 ml dissection solution .
Adjust pH to 7.2 with 0.1 N NaOH.
Filter sterilize through 0.2-μm filter.
Divide into 2.5-ml aliquots.
Store up to 6 months at −20°C.
2.2.1.2 Poly-D-lysine coated plates
Materials:
Poly-D-lysine (Sigma, 5mg)
Method:
1. Add 50 ml of sterile tissue culture grade water to 5 mg of poly-D-lysine.
2. Aseptically coat culture surface with 0.5-1.0 ml of solution per 25 cm2. Rock gently to ensure even coating of the culture surface.
3. After 5 minutes, remove solution by aspiration and thoroughly rinse surface
104 with sterile tissue culture grade water.
4. Allow to dry at least two hours before introducing cells and medium.
2.2.1.3 Culture of hippocampal neurons from embryonic day 18 rat
Materials:
Pregnant rat (e.g., Sprague-Dawley, Taconic), 18 days pregnant
CO2, metophane, or ether to anesthetize animal
70% ethanol,
Dissection solution,
Ice cold (keep in ice bucket)
Chopping solution,
Trypsinization solution,
Supplemented DMEM/F-12/N2/10% FBS,
Trituration solution,
0.2% to 0.4% trypan blue
PBS with antibiotics,
Supplemented DMEM/N2/10% FBS,
N2 supplements,
1 mM cytosine β-D-arabinofuranoside (Ara-C; Sigma)
Surgical instruments:
Scissors
Microdissecting scissors
105 Curved forceps (medium and small sizes)
Dumont no. 5 titanium forceps
Microdissecting scissors with angled blades (Castroviejo style)
Dissecting microscope and optic fiber lights
Neubauer hemacytometer
Inverted microscope
12-mm-diameter polyornithine/fibronectin-coated circular coverslips for 24-well microtiter plate wells,
Additional reagents and equipment for tissue culture and for cell counting using a hemacytometer and trypan blue
Isolate embryos
1. Anesthetize pregnant rat or mouse with CO2, metophane, or ether. Sacrifice animal by cervical dislocation.
2. Wipe off abdomen with 70% ethanol.
3. Open abdomen by grabbing skin with curved forceps and cutting skin and muscle along the midline with scissors. Make two cuts to the sides and pull out both horns of the uterus. Place uterus in a 10-cm dish containing dissection solution.
4. Open uterus using small scissors. The tip of the scissors should be pointed upwards to avoid damaging the embryos.
106 5. Remove embryos (a pregnant rat has E18 embryos on average), decapitate the embryos, and place the heads in a fresh dish of dissection solution. If they continue to bleed, move them to a new dish of fresh dissection solution.
Dissect brain and isolate hippocampus
6. Place one head in a 6-cm dish containing dissection solution. Remove skin and skull using two pairs of Dumont forceps. Hold the head firmly with one pair of forceps, carefully remove the skin and skull with the other. Begin on the dorsal side over lambda and continue forward to bregma.
Separate the ventral side of the brain from the rest of the head.
8. Pick the brain up with curved small forceps and place it into a new 6-cm dish of fresh dissection solution.
9. Use Dumont forceps to remove the caudal parts of the central nervous system
(CNS), such as the cerebellum, pons and cervical spinal cord
10. With the ventral aspect of the brain facing up, separate both hemispheres by moving the forceps through the midline.
11. Work on one hemisphere, carefully remove the septum, thalamus, and hypothalamus from the cortex (see Fig. 3.2.1C); the hippocampus will be visible as a slightly thicker portion lining the curved medial edge of the cortex.
12. Make a cut to separate the cortex from the striatum and olfactory bulbs. Then
107 cut longitudinally through the boundaries between the hippocampus and cortex.
13. Remove the meninges and choroid plexus, both of which are highly vascularized.
14. Use a Pasteur pipet to move the hippocampus to a fresh 6-cm dish containing dissection solution.
15. Repeat steps 11 to 15 on the other hemisphere and then steps 6 to 15 on the remaining heads. Collect the hippocampi in a single 6-cm dish. When all the hippocampi are collected, start working in a laminar-flow hood. Mince hippocampus tissue and trypsinize
16. Put the tissue in a 35-mm dish containing the chopping solution. Mince the tissue into small pieces using angled scissors. It usually takes 8 to 10 min to chop the tissue into small pieces. It is important to mince thoroughly in order to get a good yield of cells.
17. Pipet the minced tissue into a 15-ml tube. Rinse the dish well with more chopping solution and collect the remaining tissue. Centrifuge 5 min at 200 × g,
4°C, and remove the supernatant.
18. Add 2 to 4 ml trypsinization solution to the 15-ml tube containing the minced tissue. Pipet into a 50-ml tube. Swirl in a 37°C water bath for 5 to 7 min (or up to
10 min if hippocampi are from older embryos, i.e., E-19 or E-20 rat embryos).
108 Swirling in a 50-ml tube will help prevent clumping. Trypsinization should be kept as short as possible within the recommended 5 to 7 min to minimize the deleterious effects of trypsin on the cells.
Quench trypsin and triturate tissue
19. Quench trypsin activity by adding 10 ml DMEM/F-12/N2/10% FBS as quickly as possible. Pipet into a 15-ml tube. Centrifuge 5 min at 200 × g, 4°C. If some clumping has occurred, pipet the tissue up and down two to four times before centrifugation.
20. Remove the supernatant and add 1.5 ml trituration solution to the tissue pellet.
Triturate the tissue by pipetting it five to eight times through a 1000-μl pipet tip.
Pipet slowly to avoid formation of bubbles. If some clumps are very difficult to disperse, it is better to remove them than to triturate many times, which will damage the cells.
21. Add 5 ml dissection solution and centrifuge 5 min at 200 × g, 4°C.
22. Remove the supernatant and add 500 to 1000 μl dissection solution, depending on the size of the pellet. Resuspend the pellet by tapping the tube and pipetting through a 1000 μl pipet tip. Pipet slowly to avoid formation of bubbles.
Assess percentage of viable cells
23. Dilute 15 μl of cell suspension in 15 μl of 0.2% to 0.4% trypan blue (or 10 μl of cell suspension in 20 μl of trypan blue), and count both viable cells (those that
109 exclude dye) and nonviable cells (those that take up the dye and become blue) using a hemacytometer. The proportion of viable cells should ideally be 90%.
Plate cells
24. Prepare cell suspension of desired density of viable cells by diluting the cell suspension in DMEM/F-12/N2/10% FBS. Plan to plate 2–2.5 × 105 cells/cm2.
25. Just before plating the cells, aspirate fibronectin from the wells of 24-well microtiter plates containing polyornithine/fibronectin-coated circular coverslips.
Wash once with PBS, if desired.
26. Add 1 ml cell suspension to each well. Place the multi-well plate into a humidified 37°C, 5% CO2 incubator.
27. Four to five days after plating, change 300 μl of the medium (per well) as follows:
Place DMEM/N2/10% FBS in the incubator for 30 min to allow it to equilibrate to 37°C and 5% CO2. Add 6 to 8 μM Ara-C. Then remove 300 μl medium from each well and replace it with 300 μl of the freshly prepared medium, using a micropipettor and 1000-μl pipet tip.
28. Continue to incubate plates for up to 3 to 4 weeks, changing 250 to 300 μl of the medium every 7 to 10 days. Fresh medium should always be
DMEM/N2/10% FBS. Use gentle technique when changing medium, particularly when the cultures are older than 2 weeks.
110
2.2.2 Cell lines culture
C6 cell line, HEK293, Phi-NX cell line were obtained from the American Type
Culture Collection (ATCC). The cells were grown in Dulbecco's modified
Eagle's medium (DMEM/Glutamax; Life Technologies), supplemented with 10%
(vol/vol) heat-inactivated fetal bovine serum and 100U/ml of sodium penicillin G and 100 µg/ml of streptomycin sulfate. The medium was changed every 3 days.
The subculture was prepared by removing the medium, adding 1-3 ml of fresh
0.25% trypsin or 2mM EDTA solution (for protein extraction) for several minutes, and removing the trypsin solution. The culture was allowed to stand at room temperature for 10 to 15 minutes. Fresh medium was added, aspirated and dispensed until the cells were detached. Then the cells were transferred to a 15 ml centrifuge tube containing 3-5 ml of fresh medium and centrifuged at 1000 rpm for 5 minutes at 4℃ . The supernatant was discarded and the pellet triturated in 2 ml fresh medium. The cell number was determined by trypan blue exclusion under the microscope, and the required number of cells were placed into the flasks (for maintenance), and in 6-well plates or 96-well plates. All the apparatus and mediums used for cell culture were sterilized before use. For certain immunocytochemistry experiments, the iron transport assay, the cells were replanted in serum-free DMEM or HBSS solution.
111 2.3 Methods of Molecule Biology
2.3.1 RT-PCR
2.3.1.1 RNA Preparation
Total RNA was isolated from brain tissue or other tissues using Trizol® Reagent for real-time RT-PCR according to the manufacturer’s instructions. Genomic
DNA potentially present in RNA processing was removed by incubating the
RNA with RNase free DNase I. The relative purity of isolated RNA was assessed spectrophotometrically and the ratio of A260 nm to A280 nm exceeded 1.8 for all preparations or 28S RNA bands = twice the amounts of the 18S RNA.
2.3.1.2 cDNA Synthesis
1. Quickly thaw each tube in the RT-for-PCR Kit and place on ice. Carry out all
dilutions and additions on ice.
2. Spin each tube briefly in a tabletop microcentrifuge and return to ice.
3. Place 1µg total RNA in a sterile 0.5-ml microcentrifuge tube and incubate at
70°C for 10 minutes. Spin briefly in a microcentrifuge, then place on ice.
4. Prepare 20µl reaction by adding the following reagents in the order listed:
Component Amount
MgCl2, 25mM* 4µl
Reverse Transcription 10X Buffer 2µl dNTP Mixture, 10mM 2µl
Recombinant RNasin® Ribonuclease Inhibitor 0.5µl
112 AMV Reverse Transcriptase (High Conc.) 15ul
Oligo(dT)15 Primer 0.5µg total RNA 1µg
Nuclease-Free Water to a final volume of 20µl**
*The suggested magnesium concentration may be optimized for any given sequence to achieve better yields.
**Final concentration of reaction components: 5mM MgCl2, 1X Reverse
Transcription Buffer (10mM Tris-HCl [pH 9.0 at 25°C], 50mM KCl, 0.1%
Triton® X-100), 1mM each dNTP, 1u/µl Recombinant RNasin® Ribonuclease
Inhibitor, 15u/µg AMV Reverse Transcriptase (High Conc.), 0.5µg Oligo(dT)15
Primer per microgram RNA, 50ng/µl total RNA.
5. Mix the contents of the tube by pipeting up and down.
6. Incubate the reaction at 42°C for 60 minutes.
7. Heat the sample at 95°C for 5 minutes, then incubate at 0–5°C for 5 minutes.
This will inactivate the AMV Reverse Transcriptase and prevent it from
binding to the cDNA. Then spin down the contents of the tube.
8. PCR or store the first-strand cDNA at -20°C until use.
2.3.2 Extract animal genome DNA
Reagents:
Chloroform
113 EDTA, 0.5 M
Ethanol, 100%
Ethanol, 70%
Isoamyl Alcohol
Phenol
Phosphate Buffered Saline (PBS), 10X and 1X
Proteinase K
Sodium acetate, 3 M, pH 5.2
Sodium dodecyl sulfate (SDS), 10%
Tris-HCl, 1 M, pH 8.0
TAE buffer (Tris acetate/disodium EDTA), 1X
Trypsin
Distilled Water
Preparation
DNA buffer
1M Tris-HCl, 1 M, pH 8.0 100 ml
0.5 M EDTA 100 ml dH2O water 300 ml
Chloroform/Isoamyl alcohol 24:1
Chloroform 24 ml
Isoamyl alcohol 1 ml
Procedure
1. Use trypsin or a cell scraper to remove cells from a tissue culture flask (T-75).
114 Centrifuge cultured cells for 10 min at 10°C (1200 rpm). Remove supernatant and re-suspend cell pellet in 1X PBS and wash twice with 10 ml 1X PBS, centrifuge between washes.
2. Resuspend pellet in 10 ml DNA buffer. Centrifuge cells for 10 min at 10 °C
(1200rpm). Remove supernatant.
3. Add 3 ml DNA-buffer, re-suspend the pellet, add 125 ml Proteinase K (10 mg/ml) and 400 ml 10% SDS; shake gently and incubate overnight at 45°C.
4. Add 3.6 ml of phenol, shake by hand for 10 minutes (RT); centrifuge for 10 min at 10°C (3000 rpm).
5. Transfer the supernatant into a new tube (15 ml); measure the volume. Add 1.8 ml phenol and 1.8 ml chloroform/isoamylalcohol (24:1) or a total amount equal to the volume of the supernatant. Shake by hand for 10 min (RT); centrifuge for
10 min at 10°C (3000 rpm).
6. Transfer the supernatant into a new tube (15 ml); measure the volume. Add 3.6 ml chloroform/isoamylalcohol (24:1) or an amount equal to the volume of the supernatant. Shake by hand for10 min (RT); centrifuge for 10 min at 10°C
(3000rpm).
7. Transfer the supernatant into a new tube, measure the volume. Add 1/10 volume 3 M sodium acetate (pH 5.2) and 3 x the volume 100% isopropanol
115 (2-propanol); shake gently until the DNA is precipitated.
8. Use a sterile glass pipette to transfer the precipitated DNA into a tube with 30 ml of 70% ethanol tube. Place on an inverting rack and invert for 2 hr for a thoroughly rinse. Transfer DNA into a sterile eppendorf tube.
9. Centrifuge for 20 min at 14,000 rpm. Dry pellet in a SpeedVac for 5 min.
Dissolve the DNA in 300-500 μl sterile water and place in an eppendorf thermomixer shaker overnight at 37°C.
10. Measure the DNA concentration and run 1-5 μl (approximately 200 ng) for gel electrophoresis on agarose gel (1%) in 1X TAE buffer.
2.3.3 Real-time PCR
2.3.3.1 Principle:
There are currently four competing techniques available that detect amplified product with about the same sensitivity. They use fluorescent dyes and combine the processes of amplification and detection of an RNA target to permit the monitoring of PCR reactions in real-time during the PCR; their high sensitivity eliminates the need for a second-round amplification, and decreases chances of false-positive results. The simplest method uses fluorescent dyes that bind specifically to double-stranded-DNA. The other three rely on the hybridisation of fluorescence-labelled probes to the correct amplicon. SYBRGreen I is a
DNA-binding dye that incorporates into dsDNA. It has an undetectable fluorescence when it is in its free form, but once bound to the dsDNA it starts to
116 emit fluorescence. When monitored in real time, this results in an increase in the fluorescence signal that can be observed during the polymerization step, and that falls off when the DNA is denatured. Consequently, fluorescence measurements at the end of the elongation step of every PCR cycle are performed to monitor the increased amount of amplified DNA. Additional specificity and RT-PCR product verification can be temperature to generate a melting curve of the amplicon. This is done by slowly increasing the temperature above the Tm of the amplicon and measuring the fluorescence. As the Tm of the amplicon depends markedly on its nucleotide composition, it is possible to identify the signal obtained from the correct product. A characteristic melting peak at the melting temperature (Tm) of the amplicon will distinguish it from amplification artefacts that melt at lower temperatures in broader peaks.
2.3.3.2 Procedure:
A. Quickly thaw the iQ SYBR Green Supermix and primers and place on ice.
Carry out all dilutions and additions on ice.
B. Spin each tube briefly in a tabletop microcentrifuge and return to ice.
C. Prepare 25µl reaction according to the manufacturer’s protocol.
D. The initial denaturation (95°C for 5 min) is followed by 40 cycles. Each cycle
consists of 95°C for 15 seconds, 59°C for 15 seconds, and 72°C for 30
seconds.
2.3.3.3 Calculate:
Absolute quantification should be performed in situations where it is necessary to determine the absolute transcript copy number. In some situations, it may be
117 unnecessary to determine the absolute transcript copy number and reporting the relative change in gene expression will suffice. In this thesis, the comparative
CT method is used for relative quantification.
In this method arithmetic formulas are used to calculate relative expression levels compared with a calibrator, which can be for instance a control (non-treated) sample. The amount of target, normalized to an endogenous housekeeping gene(β-actin) and relative to the calibrator, is then given by △△CT, where
△△CT =△CT(sample) - △CT(calibrator), and △CT is the CT of the target gene subtracted from the CT of the housekeeping gene. For the untreated control
0 sample, △△CT equals zero and 2 equals one, so that the fold change in gene expression relative to the untreated control equals one by definition. For the treated samples, evaluation of △△CT indicates the fold change in gene expression relative to the untreated control.
2.3.4 Western blot
2.3.3.4 Protein Determination (DC Protein Assay kit, Bio-Rad, USA)
(A)Preparation of working reagent
Add 20 µl of reagent S to each ml of reagent A that will be needed for the run.
(This working reagent A' is stable for one week even though a precipitate will
form after one day. If precipitate forms, warm the solution and vortex.)
(B)Five dilutions (0.2, 0.4, 0.6, 0.8, 1µg/µl) of a protein standard were prepared
which are representative of the protein solution to be tested.
A standard curve should be prepared each time the assay is performed. For the
118 best results, the standards should always be prepared in the same buffer as the
sample.
(C) Pipet 100 µl of standards and samples into clean, dry test tubes.
(D) Add 500 µl of reagent A' or A (see note from step 1) into each test tube and
vortex.
(F) Add 4.0 ml reagent B into each test tube and vortex immediately.
(G) After 15 minutes, absorbance can be read at 750 nm. The absorbance will be
stable for at least 1 hour.
The protein concentration was adjusted to 2-4mg/ml and the fractions (containing
30 µg protein) in aliquots stored at –70°C.
2.3.3.5 Western Blot
2.3.3.5.1 Principle
Western- or immunoblotting is a commonly employed technique for the detection of protein antigens in complex mixtures. It is highly sensitive and can detect as little as picograms of protein with antibodies of known specificity.
Samples are first separated by SDS-polyacrylamide gel electrophoresis. The separated proteins are then transferred to a membrane. The membrane is incubated with an antibody specific for the protein of interest that binds to the protein band immobilized on the membrane. The antibody is then visualized with
119 a detection system that is usually based on a secondary protein binding to Ig chains, which are linked to chemiluminescent substrate reaction.
2.3.3.5.2 Procedure: a) Polyacrylamide gel electrophoresis
Thirty micrograms total protein were diluted in 2× sample buffer (50 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 0.1% bromophenol blue, and 5%
β-mercaptoethanol) and heated for 5 min at 95°C before SDS-PAGE on 10% gel for FP1, DMT1+IRE, DMT1-IRE, TfR and 7.5% gel for CP, Heph.
Electrophoresis was conducted by running the stacking gel at 100V for about
15-20 min and running the separating gel at 200V for about 40-50 min.
b) Transferring gel
√ The gel was disassembled from the plates carefully, the stacking gel was removed and the position marked by notching one corner.
√ The gel was washed in the transfer buffer for 15 min.
√ The PVDF membrane and the filter papers were cut to fit the dimension of gel size.
√ The filter paper and fiber pads were soaked in transfer buffer for at least
15min.
√ The cassette was assembled as follows: white (+), fiber pads, filter paper, membrane, gel, filter paper, fiber pads, gray (-). Avoid the bubble by rolling a glass rod.
√ The pre-chilled transfer buffer and frozen Bio-Ice cooling Unit were placed in the electrophoresis tank.
120 √ The transfer unit was allowed to stand at 4°C overnight with 30 voltages and gentle agitation.
√ After transferring, the blot was put on a clean filter paper, and stained with commassie blue to check the quality of transfer.
√ The blots were used immediately or stored.
c) Immunoblotting (ECL western blotting analysis system, RPN 2132)
The membrane was blocked with 5% blocking milk (Bio-Rad, USA) in TBS containing 0.1% Tween 20 for 2h at RT or overnight at 4°C. The membrane was rinsed in three changes of TBS-T, incubated once for 15 min and twice for 5 min in fresh washing buffer, and then incubated with primary antibody for 2h at RT or overnight at 4°C, the concentration of primary antibodies was maintained according to the instruction of products. After three washes in washing buffer, the membrane was incubated for 2 hours in horseradish peroxidase-conjugated anti-rabbit or anti-mouse second antibody (1:5000, Amersham Biosciences,
England) and developed using enhanced chemiluminescence (ECL Western blotting analysis system kit, Amersham Biosciences, England). The blot was detected by Lumi-imager F1 workstation (Roche Molecular Biochemical). The intensity of the specific bands was determined by densitometry with the use of
LumiAnalyst 3.1 software (Roche Molecular Biochemical).
2.3.4 Lipofectine transfection
Materials:
Lipofectamine (Invitrogen)
121 IMDM containing 10% fetal bovine serum, 1% glutamine, 1% aa
IMDM containing 1% glutamine
IMDM containing 20% fetal bovine serum, 1% glutamine, 1% aa
Procedure:
1. In a six-well or 35 mm tissue culture plate, seed ~2x 105 cells per well in
2 ml IMDM containing 10% FBS and nonessential amino acids.
2. Incubate the cells at 37°C in a CO2 incubator until the cells are 70-80%
confluent. This usually takes 18-24 h.
3. Prepare the following solutions in 12 x 75 mm sterile tubes:
Solution A: For each transfection, dilute 2 μg DNA (plasmid) in 375 μl
serum-free IMDM (containing nonessential amino acids).
Solution B: For each transfection, dilute 12 μl LIPOFECTAMINE
Reagent in 375 μl serum-free IMDM.
4. Combine the two solutions, mix gently, and incubate at room temperature
for 15-45 min. The solution may appear cloudy, however, this will not
impede the transfection. Wash the cells once with 2 ml serum-free
IMDM.
5. For each transfection, add 750 μl serum-free IMDM to each tube
containing the lipid-DNA complexes. Do not add antibacterial agents to
media during transfection. Mix gently and overlay the diluted complex
solution onto the washed cells.
6. Incubate the cells for 5 h at 37°C in a CO2 incubator.
122 7. Add 1.5 ml IMDM with 20% FBS without removing the transfection
mixture. If toxicity is a problem, remove the transfection mixture and
replace with normal growth medium. Replace medium at 18-24 h after
the start of transfection.
8. Assay cell extracts for gene activity 24-72 h after the start of transfection,
depending on the cell type and promoter activity.
2.3.5 Histochemistry assay
Solutions:
PHEM buffer:
25 mM HEPES
10 mM EGTA
60 mM PIPES
2 mM MgCl2
pH = 6.9
(Added in this order.)
Antifade: 1 ml
1 mg p-phenylene diamine hydrochloride
Dissolve in 0.1 ml 10x PBS (20 min at RT)
Add 0.9 ml 100% glycerol
Keep covered at all times and no vortexing.
If it turns brown, it is no good.
Aliquot and store at -70°C.
123 Procedure:
A. Plating:
1. To sterilize glass coverslips, dip in ethanol and flame.
We use 22x22x1 mm3 coverslips and put them in 6-well plates.
2. Seed 100,000 cells per well overnight and fix the next day.
B. Fixation:
1. Remove the media and rinse once with PBS.
2. Remove the PBS and immediately add -20°C methanol. (Do not allow the
cells to dry.)
3. Put the plate in a -20°C freezer for 5 min.
4. Remove the methanol and add PHEM buffer. Fixed cells are kept at 4°C
in PHEM.
C. Antibody incubation:
1. Block with appropriate sera (2.5 to 5%) in PHEM buffer for 1 hr with
gentle rocking.
2. Add primary antibody to the blocking buffer and incubate for 1 hr with
gentle rocking.
3. Remove and wash 4 x 10 min with PHEM buffer.
4. Add secondary antibody in PHEM buffer with sera and incubate for 30
min with gentle rocking.
5. Remove and wash 4 x 10 min with PHEM buffer.
D. Mounting:
124 1. Pick up coverslip with forceps and drain away excess buffer (can gently
aspirate if desired).
2. Put ~20 µl "antifade" on slide and gently lay coverslip on top.
3. After removing excess antifade either by blotting with Kimwipe or
aspirating, seal with Sally Hansen clear nail polish. (This brand
supposedly works better than others.)
4. Keep in the dark at all times.
5. Store in a -20°C freezer.
2.4 Construction of recombinant adenovirus
REAGENTS
.GOI (Gene of interest)
.LB medium
.Kanamycin
.Ampicillin
.Restriction endonucleases
.Shuttle vector DNA
.7.5 M ammonium acetate
..20 mg ml/L glycogen (Roche Molecular or equivalent suppliers)
.25:24:1 (vol/vol/vol) phenol/chloroform/isoamyl alcohol
.70 and 100% ethanol
.pAdEasy-1 supercoiled adenoviral backbone vector (CsCl purified)
.LB/kanamycin plates
.0.8% (wt/vol) agarose gel
.Electrocompetent DH10B cells or other cells not prone to recombination
125 .HEK-293 cells (E1-transformed HEK cells)
.Lipofectamine reagent (Invitrogen) or similar transfection reagents
.DMEM (Invitrogen)
.Complete DMEM: DMEM with 10% FBS, 1% penicillin/streptomycin
.HBSS or sterile PBS (Invitrogen)
.Cesium chloride (CsCl)
.Chlorine bleach
.Phenol red
Equipment
.12-ml polyallomer tubes for SW 41 Ti rotor (Beckman)
.DNA gel apparatus and power supplies
.37 ℃ orbital shaker
.Gene pulser electroporator (Bio-Rad) or similar apparatus
.37 ℃ bacteria incubator
.37 ℃ , 5% CO2 incubator
.15- and 50-ml conical tubes
.1- and 2-mm cuvettes, ice-cold
.25- and 75-cm2 tissue culture flasks
.Cell scrapers (rubber policeman)
.Dry-ice/methanol bath
.Ultracentrifuge (Beckman) or equivalent with SW 41 Ti rotor
.Centrifuge tube (thick-wall polycarbonate tube with cap)
.Ring stand and clamp, 3-ml syringes and 18-G needles
126 Procedure
Cloning GOI into a shuttle vector
1. Design the primer, PCR amplify GOI fragment. If the GOI and the shuttle vector do not have correctly positioned restriction sites, it may be necessary to blunt-end one or both restriction sites with T4 DNA polymerase. In some cases, it may be more convenient to introduce new restriction sites at one or both ends by linker ligation or by PCR amplification. Introduction of restriction sites by
PCR is quick and efficient, but the sequence of the amplified segments must be verified by DNA sequencing. Digest GOI and shuttle vector both with restriction enzymes. Gels purify digested PCR and vector products. Ligate GOI and shuttle vector subsequently with T4 ligase. Analyze for correct and complete ligation by transformation E.coil cells.
2. Grow shuttle plasmid clones containing the GOI in 2 ml LB/kanamycin in a
15-ml conical tube, shake overnight in a 37 ℃ orbital shaker. Purify plasmid
DNA.
3. Linearize the confirmed shuttle vector with PmeI restriction endonuclease. To ensure complete digestion, use a 100-ml reaction with 0.1–0.5 mg DNA and
30–100 U of enzyme. Ensure that the digestion is complete by electrophoresis in an agarose gel. One-tenth to one-fifth of each miniprep (approximately 0.1–0.5 mg DNA) is sufficient for one transformation.
4. To the 100 μl DNA restriction solution, add 100μl ddH2O, 100μl 7.5 M ammonium acetate. Extract with 300μl 25:24:1 phenol-chloroform-isoamyl
127 alcohol, pH 8.0.
5. Transfer the top layer of DNA solution to a clean tube and precipitate with 600 ml 100% ethanol by centrifuging for 5 min at 16,000g at room temperature.
Wash the pellet three times with 70% ethanol to eliminate residual salt.
Re-suspend DNA in 8 ml ddH2O.
6. To 20μl electrocompetent cells, add the 8.0μl ethanol-precipitated linearized shuttle vector and Adeasy plasmid. Limit the final volume to less than 30μl.
Place it on ice for 30min, and 42℃ heat-shock immediately after ice-bath.
7. Re-suspend transformation mix in 500μl LB medium. Plate the transformation mix in two to five LB/kanamycin plates. Grow overnight (16–20 h) in a 37 ℃ incubator. Some investigators incubate the transformation mix for 20–30 min at
37 ℃ before plating; this is optional.
8. Pick 10–20 of the smallest colonies and grow each in 2 ml LB medium containing 25 μg/ml kanamycin for 10–15 h in a 37 ℃ orbital shaker.
9. Perform minipreps. Check the size of supercoiled plasmids by running one-fifth of each miniprep on a 0.8% agarose gel.
10.Further restriction analysis of the clones should be performed to confirm their structure. Finally, purify plasmids with any commercial purification kit or by
CsCl gradients in preparation for transfection of HEK-293 cells.
128
6 11. Plate HEK-293 cells in one or two 25-cm2 tissue culture flask(s) at 2 x 10 cells per flask 6–15 h before transfection.
12. Digest recombinant adenoviral plasmid with PacI (usually 3 mg DNA is needed to transfect one 25-cm2 tissue culture flask).
13. Perform a standard transfection with LipofectAMINE according to manufacturer’s instructions.
14. Add DNA/LipofectAMINE mix dropwise to the 25-cm2 tissue culture flasks, and return them to a 37 ℃，5% CO2 humidified incubator. Remove the medium containing DNA/LipofectAMINE mix 4–6 h later and add 7–10 ml fresh complete DMEM.
15. If pAdTrack-based vectors are used, monitor transfection efficiency and virus production by GFP expression, which is visible under fluorescence microscopy.
Maintain the transfected cells in the 37 ℃，5% CO2 incubator for 14–20 d.
16. To prepare viral lysates, scrape cells off flasks with a cell scraper or rubber policeman (do not use trypsin) and transfer them to 15-ml conical tubes.
17. Perform four freeze–thaw–vortex cycles to release adenoviruses from cells as follows: freeze cells in a dry-ice/methanol bath, thaw in a 37 ℃ water bath.
Repeat the freezing–thawing–vortexing for three more cycles.
129
18. For the final round of large-scale amplification, plate HEK-293 cells in
75-cm2 tissue culture flasks (approximately 1x107 cells per flask) so that they are
90–100% confluent at the time of infection 6–15 h later. Usually, 80-100 75-cm2 flasks are sufficient to make a high-titer stock. Larger cell culture flasks or
100-mm cell culture dishes can also be used for this purpose.
19. Combine cell pellets and re-suspend the pellet in 10.0 ml sterile PBS.
Perform four freeze–thaw–vortex cycles to release viruses from cells. Transfer
10.0 ml virus supernatant into a 50-ml conical tube and add 3.4 g ultrapure CsCl.
Mix well by vortexing.
20. Transfer the CsCl solution to a 12-ml polyallomer tube suitable for a
Beckman SW 41 Ti rotor. Overlay with approximately 2 ml CsCl (1.2g/ml) to fill the tube. Prepare a balance tube if necessary. Centrifuge in a Beckman ultracentrifuge with an SW 41 Ti rotor for 18–24 h at 176,000g (SW 41 Ti rotor at 32,000 r.p.m.) at 10 ℃ .
21. Remove tubes from ultracentrifuge and clamp onto a ring stand above a beaker of chlorine bleach. Collect virus fraction with a 3 ml syringe and a
18-gauge needle to extract it into the syringe. Mix virus fraction with an equal volume of PBS at -80 ℃ .
22. Determine viral titer by GFP expression, plaque assays or immunohistochemical staining using antibodies that detect the product of GOI.
130 2.5 Construction of recombinant retrovirus
1．Use oligoengine RNAi design tool to design N-19 target sequences for any gene of interest.
2. Dissolve the oligos in sterile, nuclease-free H2O to a concentration of 3 mg/ml.
If you need assistance to determine how much H2O (or buffer, etc.) to add to your product on hand, see the Lab Tips section in this manual following the procedure.
3. Assemble the annealing reaction by mixing 1 μl of each oligo (forward + reverse) with 48 μl annealing buffer.
4. Incubate the mixture at 90°C for 4 min, and then at 70°C for 10 minutes.
Slowly cool the annealed oligos to 10°C . The annealed oligo inserts can be used immediately in a ligation reaction, or cooled further to 4°C. For longer storage, keep at -20°C until needed.
5. Linearize 1 μl of the pSUPER.retro vector with BglII and HindIII restriction enzymes. It is recommended to perform sequential reaction steps rather than simultaneous digestion as follows: Digest with HindIII OR XhoI for 60 minutes, add BglII and continue reaction for 2 hours, then heat inactivate the reaction
(raise the temperature to 65 or 80°C for 20 minutes).
6. Assemble the cloning reaction by adding 2 μl of the annealed oligos to 1 μl of
T4 DNA ligase buffer. Add 1 μl pSUPER.retro vector, 5 μl nuclease-free H2O,
131 and 1 μl T4 DNA ligase.
7. Incubate overnight at room temperature. A negative control cloning reaction should be performed with the linearized vector alone and no insert.
8. After cloning and prior to transformation, plasmids should be treated with
BglII to reduce the level of background in your transformation.
9. Recombinant pSUPER.retro vector should be transformed into competent cells of an appropriate host strain (e.g., DH5α). In order to monitor the efficiency of the transformation steps, as a negative control, cells should also be transformed either with a vector that has been ligated with a scrambled-base hairpin oligo, or with a circular vector containing no oligo insert.
10. Grow bacteria in amp-agarose plates overnight (16-24 hrs), then pick and grow colonies in an ampicilin broth for an additional cycle. Pick and miniprep several colonies (it may take many to locate a positive clone)
11. Check for the presence of positive clones by digesting with EcoRI and
HindIII.
12. The pSUPER.retro plasmid can be transfected directly into your target cells, or you may wish to utilize a packaging cell line to produce retroviral supernatants
132 13. Culture cells in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with10% fetal calf serum. Transfect Phoenix packaging cells by calcium-phosphate precipitation to produce ecotropic retroviral supernatants. 48 hours posttransfection, filter the tissue culture medium through a 0.45 μm filter, and use the viral supernatant for infection of cells after addition of 4 μg/ml polybrene. Infect cells for at least 6 hr and allow them to recover for 24 hr with fresh medium. Select infected cells with puromycin (1–3 μg/ml for 48 hr).
2.6 Methods of Radiation
2.6.1 Non-transferrin bound iron uptake Assay
(1) Preparation of buffer
(A) 0.27M Sucrose solution：9.242g sucrose + 100ml ddH2O, buffered to pH 6.5
by 4mM Pipes.
(B) Cell lysis buffer： 1g SDS + 100ml ddH2O
(C) Phosphate-Buffered Saline (PBS) (10×)：
80g NaCl + 33.6g Na2HPO4·12H2O+ 2g KCl + 2g KH2PO4+ 1000ml ddH2O
55 (D) Radioactive solution: FeCl3(Perkinelmer) dissolved with FeSO4, the molar
ratio is 1:10, then add 50 times beta-mercaptoethanol and 0.27M sucrose
solution.
(2) Procedure
(A) Remove the incubation medium and wash the cells three times by cold PBS.
(B) Add 0.27 M sucrose solution 1ml and 32ul radioactive solution to each well.
o (C) Incubate the cells at 37 C, 5% CO2 for 30minutes.
133 (D) Stop the reaction by placing the plates on ice and washing the cells by
ice-cold PBS for 5minutes, three times.
(E) After washing, lysize the cells by the lysis buffer 500ul and shake for 10min
with the maximum shaking rate.
(F) Detach the cells by the scraper and transfer them into EP tubes and vortex
them.
(G) Use 50ul aliquot to detect the protein concentration.
(H) The cytosol is separated from the stromal-mitochondrial membrane
(membranes) fraction by centrifugation at10,000 g for 20 minutes at 4oC
using a Jouan centrifuge (DJB labcare Ltd., England ).
(I) The cytosol is subsequently separated from the membranes, and the pellet is
dissolved with 450 1% SDS. Both fractions are added into 3ml scintillation
solution to count the cpm.
(J) The blank group is added 450ul 1% SDS into 3ml scintillation solution.
2.6.2 Transferrin bound iron uptake Assay
(1) Preparation of buffer
(A) Dialysis buffer：0.15 M NaCl.
(B) NaHCO3 buffer：10mM NaHCO3, 250mM Tris-HCl.
(C) Saturation NaHCO3 solution
(D) 3.2mM NTA
(E) Acid solution：0.2N acetate，0.5M NaCl，1mM FeCl3
(2) Preparation of the 55Fe-Tf
134 55 (A) Take FeCl3 solution into 200ul NTA(3.2mM)solution. The molar ratio is
55FeCl3 :NTA=1:10
(B) Keep the solution in room temperature for 2 hours.
(C) Add saturation NaHCO3 solution to neutralize the reaction.
(D) Dissolve 2.6mg apo-transferrin of rats in the 2ml 10mM NaHCO3 buffer. The
55 molar ratio is FeCl3:Tf=2:1
(E) React at room temperature for 3 hours.
(F) Dialysis and remove the unbound-55Fe. 4oC stirred in 250ml dialysis buffer
for 7 times, and each time during 3 hours.
(G) Detect the Tf protein concentration (A280nm) and count radioactivity,
calculate the ratio.
(3) Procedure
(A) Remove the incubation medium and wash the cells three times with cold
PBS.
(B) Add 1ml culture medium without FBS (but with 0.1% BSA) and incubate at
o 37 C, 5%CO2 for 1 hour.
(C) Wash cells with warm PBS for one time.
(D) Add 1ml culture medium without FBS (but with 0.1% BSA) to each well.
(E) Add the 55Fe-Tf into each well to the final concentration to 10ug/ml, and
incubate for 60 minutes at 37oC.
(F)Cool the plates on ice and discard the medium.
(G)Add 1ml ice-cold PBS to terminate the uptake of iron by cells. Wash the cells
by cold PBS for two times.
(H)Wash the cells with 1ml acid washing buffer to remove the nonspecific
135 attachment of the 55Fe-Tf.
(I)Discard the buffer and wash the cells three times by cold PBS.
(J)Add 500ul cell lysis buffer and keep on ice for 10 minutes.
(K)Detach the cells by the scraper and transfer them into EP tubes and vortex
them.
(L) Use 50ul aliquot to detect the protein concentration.
(M) The cytosol is separated from the stromal-mitochondrial membrane
(membranes) fraction by centrifugation at10,000 g for 20 minutes at 4oC
using a Jouan centrifuge (DJB labcare Ltd., England ).
(N) The cytosol is subsequently separated from the membranes, and the pellet is
dissolved with 450μl 1% SDS. Both fractions are added into 3ml scintillation
solution to count the CMP.
2.6.3 Iron release Assay
(1) Preparation of buffer
(A) 0.27M Sucrose solution：9.242g sucrose + 100ml ddH2O, buffered to pH 6.5
by 4mM Pipes.
(B) Cell lysis buffer： 1g SDS + 100ml ddH2O
(C) Phosphate-Buffered Saline (PBS) (10×)：
80g NaCl + 33.6g Na2HPO4·12H2O+ 2g KCl + 2g KH2PO4+ 1000ml ddH2O
55 (D) Radioactive solution: FeCl3(Perkinelmer) dissolve with FeSO4, the molar
ratio is 1:10, then add 50 times beta-mercaptoethanol and 0.27M sucrose
solution.
136 (2) Procedure
(A)Remove the incubation medium and wash the cells three times by cold PBS.
(B)Add the 0.27 M sucrose solution 1ml and 32ul radioactive solution to each
o well. Incubate them at 37 C, 5% CO2 for 30 minutes.
(C)After this incubation, the cell culture plates are placed on a tray of ice, the
medium aspirated, and the cell monolayer is washed three times with ice-cold
PBS.
(D)The cells are then incubated at 37oC for different times with or without
hepcidin.
(E) After this incubation, the overlying supernatant (efflux medium) is
transferred to counting tubes.
(F)The cells are removed from the wells after adding 500ul of cell lysis buffer
and by using a plastic spatula to detach them.
(G) Vortex them and use a 50ul aliquot to detect the protein concentration.
(H) The cytosol is separated from the stromal-mitochondrial membrane
(membranes) fraction by centrifugation at10,000 g for 20 minutes at 4oC
using a Jouan centrifuge (DJB labcare Ltd., England ).
(H) The cytosol is subsequently separated from the membranes, and the pellet is
dissolved with 450 1% SDS. Both fractions are added into 3ml scintillation
solution to count the cpm.
(I) Iron activity in the supernatant or cell fractions is expressed as the
percentage of the total iron present in the system.
137 3 Chapter 3 Iron uptake protein: DMT1
3.1 Introduction
DMT1 has four names. It transports as many as eight metals, may have four or more isoforms and carries out its transport for multiple purposes.
Table Error! Reference source not found.-1 Multiple names for one transporter.
Nramp2 Natural Resistance Associated Macrophage Protein 2
DCT1 Divalent Cation Transporter 1
DMT1 Divalent Metal Transporter 1
SLC11A2 Solute Carrier Family 11, member 2
The organization of the human DMT1 gene was initially described by Lee et al(Lee et al., 1998). They demonstrated that the gene contained 17 exons, spanned more than 36 kb, and contained alternative 3' exons. In detailed studies,
Tchernitchko et al(Tchernitchko et al., 2002) identified DMT1 mRNA isoforms containing the alternative 3' exons. One isoform contained an iron responsive element (IRE) in the 3' untranslated region (IRE+), while the other isoform lacked the IRE (IRE-) and the C-terminal 18 amino acids were replaced by a novel 25 amino acid segment. The IRE- isoform was produced by the alternative splicing at a site within exon 16. The signal for this alternative splicing is unknown, however, the duodenum, liver and testes express primarily the IRE+ isoform, while other tissues such as the spleen, kidney, brain and thymus express both isoforms. More recently, it has been recognized that there are also
138 alternative 5' exons designated 1A and 1B(Hubert and Hentze, 2002). These characteristics result from different promoters and transcriptional start sites with mutually exclusive splicing of the alternative first exons to exon 2. The newly described exon 1A isoform inserts additional 29-31 amino acids onto the
N-terminus of the protein (Fig 3.1). Exon 1A is utilized in both the kidney and the intestine, but not to any great extent in other tissues. No metal response element or Hif-1 consensus binding sequences are found upstream of exon 1A.
However, Lee et al. reported that there are 5 possible metal response elements, a gamma interferon response element and 2 Hif-1-like motifs in the 596 bp region
5' at the start of transcription of the 1B isoform. Alternative splicing of DMT1 mRNA in hematopoietic cells using cryptic splice sites in exon 3 or intron 3 and resulting in early stop codons has been identified. However, the function of this splicing is not yet clear.
Figure 3-1
DMT1 gene structure and effect of recently identified human DMT1 mutation on splicing of mRNA. The upper portion of the figure shows the structure of the
139 DMT1 gene with alternative 5' and 3' exons. The lower portion shows the effect of the G-C substitution on splicing of DMT1 mRNA. In control reticuloctyes,
90% of PCR products are the fully expected products, while 10% demonstrate exon 12 skipping. This baseline exon 12 skipping is exaggerated in reticulocytes from the patient bearing the G-C mutation such that 90% of the PCR products demonstrate exon 12 skipping, while only 10% contain exon 12. Four isomers of
DMT1 have been reported, but our study only concerned two of them. One splice form, called DMT1 (IRE) mRNA, contains an iron-responsive element (IRE) in the 3’-UTR. The other splice form designated DMT1 (non-IRE) mRNA does not contain any classical IRE.
3.2 Methodology
3.2.1 Materials
Unless otherwise stated, all chemicals were obtained from Sigma chemical company, St. Louis, MO, USA. Trizol Regent, T4 ligases and Pfx polymerases were purchased from Invitrogen Company, USA. Agarose, Tris, ethidium bromide and prestained protein marker were purchased from Bio-Rad
Laboratories, Hercules, CA, USA. ECL Western blotting analysis system was from Amersham Biosciences, England. Plamids minipreps kit and RT-PCR kit were from Promega, USA. Antibody against DMT1, FPN1, Hephasetin were obtained from Alpha Diagnostics Company, San Antonio, USA.
3.2.2 Acquisition of the full-length gene of DMT1
SD rat liver tissues were put into liquid nitrogen to freeze, and then rapidly grinded. 1ml Trizol reagent was added per 10mg tissues. mRNA was extracted
140 from the tissues in accordance with the standard procedure. mRNA and oligo(dT) were heated in 65 degrees Celsius for 10 minutes before the first strand synthesis.
1ul reverse transcriptase and 10 x buffer were added into the reaction solution which was then incubated in 42 Celsius for 1hour, and 75 Celsius for 15 minutes.
After the reaction completed, the samples were labeled and frozen at -20 Celsius.
DMT1 has two isomers (DMT1 with IRE/DMT1 without IRE), for which we designed a variety of primer to build respectively. Search “Rat DMT1 with IRE” sequence of cDNA in Pubmed website. Its locus in Pubmed is AF008439.
DMT1 with IRE：
Upstream primer:
5’- GGCAGATCTATGGTGTTGGATCCT -3’
Downstream primer:
5’- GCCGTCGACTTACTTAGTATTGCC -3’
Search “Rat DMT1 without IRE” sequence of cDNA in Pubmed website. Its locus in Pubmed is AF029757.
DMT1 without IRE：
Upstream primer:
5’- GGCAGATCTATGGTGTTGGATCCT -3’
Downstream primer:
5’- GCGGTCGACTCATCTAGA TACCAG -3’
3.2.3 Adenovirus construction process
The processes and methods have been elaborated in Chapter 2, please refer to methodology.
141
3.2.4 Adenovirus infection and detection
Take out virus stocks from a low-temperature refrigerator, slowly thaw on ice.
Add the virus in cell culture medium in the volume ratio of 1000:1, gently swaying, and leave it for at least six hours at 37 degree. During the experiment, the samples were divided into two groups: the control group, and the experimental group. After 6 to 24 hours of virus treatments, according to the needs of experiments, cells were extracted from protein and mRNA. Analyze expression of the target genes with western blot and real-time PCR.
3.2.5 Design specific sequence for RNAi
According to the principles of RNA interference, a specific oligo nucleotides sequence as siRNA transcription template must be designed first. There are many tools to complete this task, which analyze the sequence submitted by us, and then choose the most specific fragments. Of course, they may provide dozens, even hundreds of results. We need to choose the best one from among them. In general, we tend to choose 3-5 fragments as our goals. In this research, 3 fragments were chosen for each gene in order to confirm the best target sequence.
DMT 1:
1st target sequence: 5’- CATGTACTTTGTCGTGGTC -3’
2nd target sequence: 5’- AATGGTCGCGCTTTGCCCG -3’
3rd target sequence: 5’- GCAATCATTGGTTCTGATA -3’
3.2.6 Annealing oligos
A simple and effective method for nucleotide annealing was adopted as follows:
142 Dissolve the oligos in sterile, nuclease-free H2O to a concentration of 3 mg/ml.
Assemble the annealing reaction by mixing 1 μl of each oligo (forward + reverse) with 48 μl annealing buffer. Incubate the mixture in boiled water for 2 min, and turn off the electric heater. Let the water temperature gradually drop to room temperature. In this process, do not to remove the tube but let it remain inside boiled water. The whole annealing process takes 4-5 hours. The annealed oligo inserts can be used immediately in a ligation reaction, or further cooled to 4°C.
For longer storage, keep at -20°C until needed.
3.2.7 Ligation into pSUper-retro-puro
Prepare the cloning reaction by adding 2 μl of the annealed oligos to 1 μl of T4
DNA ligase buffer. Add 1 μl pSUPER vector, 5μl nuclease-free H2O, and 1 μl T4
DNA ligase. Incubate overnight at room temperature. A negative control cloning reaction should be performed with the linearized vector alone and no insert. After cloning and prior to transformation, plasmids should be treated with BglII to reduce the level of background after transformation.
To perform this reaction:
1. Add 1.0 μg of BglII to plasmid
2. Incubate for 30 minutes at 37°
Before ligating, we need to dilute the annealed oligos solution 50 to 100 folds, because the high concentration of oligos will greatly reduce the efficiency of ligation reaction, and increase the quantity of negative clones. This is very important to the success of the experiment.
143 For other conventional steps, including the transformation of E.coil and positive clone checking, please refer to Chapter 2 Methodology.
3.2.8 Packaging and application of retrovirus
For the general processes of packaging, please refer to Chapter 2 Section 2.6.The virus had to be concentrated first in order to obtain a high titer. At first, puromycin (3µg/ml) was used to select stable transfected cells. The continuous screening processes took about 10 to 14 days. Then, the cell clones were transferred to cell culture dishes with fresh culture medium. When there were a sufficiently large number of cells, they could be plated to at least twenty 9cm culture dishes. The supernatant was collected when the stable transfection cells were of 100% confluence. 250 to 500 ml of the supernatant was needed as raw materials of the next step. The supernatant was spinned at 10000rpm for 10min at
4℃ and filtered with 0.45uM to completely remove cell debris. 45% PEG6000 was added to a final concentration of 8.5% and slowly shaken for 30min at 4℃ .
The mixture was then spinned at 8000g for 10min at 4℃ . At last, the pellets were dissolved in 5ml PBS.
For titer determination, please see the next section “titration of retrovirus”.
It is well established with retroviruses that cells are most efficiently infected immediately after they are trypsinized. Trypsinization does two things. First, it apparently exposes the receptor to which the virus binds. Second, it stimulates
DNA synthesis and cell division, two processes that are essential for the establishment of retroviral infection.
144
Infection with retroviruses is greatly facilitated by polybrene. This small, positively charged molecule binds to cell surfaces and neutralizes surface charge.
This apparently allows the viral glycoproteins to bind more efficiently to their receptors, because repulsion between sialic acid containing molecules is reduced.
To use polybrene optimally, the cells to be infected should be pre-treated with polybrene and the virus adsorption should be done in the presence of polybrene.
The amount of polybrene that cells tolerate differs, but 1 to 10 µg per ml is usual.
In this research, 10 µg per ml was used to treat C6 cell lines, but this concentration was not tolerated by the primary culture neurons. 5 µg per ml was the optimum concentration. After infection with retrovirus for 2-4 days, mRNA and protein were extracted for analysis.
3.2.9 Titration of retrovirus
1x106 HIN-3T3s were seeded in 6-well plates on the day before infection.
NIH-3T3s were used because they gave nice discreet colonies after selection. It was hoped that the cells would be 20-80% confluent on the day of infection. On the infection day, 200ul viral solution was kept for titration. Six Eppendorf tubes labeled 1-6 each of which containing 800ml of DMEM were set up for each titration. 6ml of [DMEM + 9mg/ml polybrene] was prepared in general. For example, 18ml should be prepared for 3 titrations. 200ml of supernatant was added to Eppendorf no.1 and mixed by inverting several times. 200ml mixture of no.1 was transferred from Eppendorf 1 to Eppendorf 2 and then mixed by inverting. This process was applied to all 6 tubes. The HIN-3T3s were reseeded with 1 ml per well of [DMEM + 9mg/ml polybrene]. 0.5ml mixture from each
145 Eppendorf was added to each of the wells 1-6. The cells were left for infection until the next day, and then selection was started with 5ug/ml puromycin. Count colonies down the microscope around 15 days.
3.3 Results
3.3.1 Construction of recombinant adenovirus DMT1 (with or without
IRE)
3.3.1.1 Acquisition of the full length of DMT1+IRE and DMT1-IRE
M: 1kb DNA ladder marker
1: DMT1 with IRE
2: DMT1 without IRE
Figure 3-2
Electrophoresis photos of RT-PCR results. DMT1 without IRE is around 1710 bp,
DMT1 with IRE is around 1870 bp.
146
3.3.1.2 Screening of pShuttle-DMT1 (+IRE) and pShuttle-DMT1 (-IRE)
A
B
Figure3-3
Bgl II and Sal I were used to digest the pShuttle-DMT1 with IRE and pShuttle-DMT1 without IRE for 1 hour in a 37 ℃ water bath. The production of digestion was detected through running 1.5% agrose electrophoresis. In A, #7
147 and #8 clones released a gene fragment around 1870bp, while the rest were negative clones. In B, #6 and #8 clones were positive clones, because they showed a gene fragment about 1710bp after restriction enzyme treatment. Submit it to sequencing.
3.3.1.3 Bacterial recombinant of viral skeleton of rAd-DMT1 (+) and rAd-DMT1
(-)
Figure 3-4
Pac-I was used to identify the successful recombinant adenovirus genome after transformation to E.coil. The positive clone will release a specific fragment around 4.5 kb by running 1% agrose gel electrophoresis. After collecting many clones from bacterial, these plasmids were digested with Pac-I in a 370C water
148 bath for 1 hour. The clones that released this specific fragment (arrow point,
4.5kb) were the positive recombinant adenovirus genome. In Fig 3-4, #1 and #2,
#5 were rAd-DMT1(+IRE) while #8,9,10 were rAd-DMT1(-IRE). Their bacterial liquids were reversed with 10% DMSO at -80 0C. The plasmids were reversed at
-20 0C.
149 3.3.1.4 Generation of recombinant adenovirus of DMT1 (+) and DMT1 (-)
Figure 3-5
Recombinant adenoviruses had highly efficient infective ability. A, B and C showed the procedure of adenoviruses packaging in HEK293. A was an image of
150 the first day after gene transfection. Only weak fluorescence expressed by GFP of adenovirus in HEK 293 could be seen. B was an image of the expression of
GFP at the sixth day. Its fluorescence was stronger than that of the first day. C was an image of the ninth day. The Fluorescence of HEK293 was very strong and almost all of the cells were infected by recombinant adenoviruses. This means the packaging of recombinant adenoviruses had reached the development peak.
These HEK293 could be collected to extract the recombinant adenoviruses.
After the recombinant adenoviruses were purified, they could be used to infect other cells. The range of infection was wide, almost including all kinds of cells in animal. I, II and III were records of neurons infected. In this experiment, about
0.5 X 109 granules of adenoviruses were used to infect neurons around 1 X 106. I was the image of the first day, II the image of the second day and III the image of the third day. The recombinant adenoviruses infected the neurons in a short time and appeared to have highly efficient infection ability.
151 3.3.2 Construction of recombinant retrovirus DMT1
3.3.2.1 Results of annealing oligos for DMT1
Figure 3-6
DMT1 andTR1 RNAi oligos were dissolved in sterile H2O to the final concentration of 3 mg/ml. 1 μl of each oligo (forward + reverse) with 48 μl annealing buffer were mixed to assemble the annealing reaction. Incubate the mixture in boiled water for 2 min, and turn off the electric heater. These samples were detected by PAGE electrophoresis and silver staining. The successful annealing productions were double-stranded DNA and were size of 60bp around.
The result was image of TfR1 and DMT1 oligos annealing reaction. The all of
TfR1 and DMT1 oligos (TfR1 #1 ,#2 and #3, DMT1 #1, #2 and #3) all formed double-stranded DNA.
152 3.3.2.2 Identification of recombinant pSuper-DMT1
Figure 3-7
The three kinds of pSuper-DMT1 (#1, #2 and #3) and the blank plasmids as the control group were cut by EcoR I and Hind III at 37 0C, 1 hour. The band of the blank plasmids on the gel corresponded to the expected molecular weight
(227bp), and the bands of the pSuper-DMT1 (#1, #2 and #3) plasmids were around 310bp in size. Collect and submit them to sequence.
153 3.3.2.3 Screening of the recombinant plasmids pSuper-DMT1
Figure 3-8 mRNA extraction and Real-time PCR methods were performed as described in
Material and Method. Transfection of 10g plasmids DNA into H9C2 (cell counting 5 x 106) was performed by liposome. After 48 hours, total mRNA of these cells was transcribed to cDNA. The real-time results showed that #2 pSuper-DMT1 can effectively decrease the gene expression of hepcidin in H9C2.
This clone was selected as the retrovirus packaging material. The recombinant retrovirus were named Retro-DMT1.
154 3.3.3 Biological test of rAd-DMT1 (+/- IRE) and Retro- DMT1 (+/- IRE)
3.3.3.1 Biological activity of rAd-DMT1 (+/- IRE) in Neurons
155
Figure 3-9
1.5x109 CPU (0.5μl) purified recombinant adenovirus-hepcidin (rAd-DMT1) were used to treat neurons (cells counting around 1.5x106) for 24 hours. The method of Western-blot was used to measure the expression of DMT1 with IRE and DMT1 without IRE. The concentration gradients from 0μl to 2.0 μl were applied in this experiment. The results showed that recombinant adenovirus-DMT1 with or without IRE( rAd-D-/rAd-D+) can significantly
156 increase the expression of protein.
3.3.3.2 Biological activity of Retro-DMT1 (+/- IRE) in Neurons
Figure 3-10
The expected molecular weight of DMT1 was ~57 kDa and β-actin ~ 45 kDa bands appeared on each gel. Expression values for β-actin were normalized and expressed as a control. Figure 3-10 showed that retro-DMT1 has the ability to
157 inhibit the expression of DMT1. The data were presented as means ± SEM of 3 separate experiments. T-test was used in the data analysis, *P<0.05 (n=3), versus the control group.
3.4 Discussion
In this chapter, rAd-DMT1 with IRE and rAd-DMT1 without IRE were constructed by molecular biological technology. In the process of target genes acquisition, gene mutation was avoided by utilizing high-fidelity polymerases and optimized PCR conditions. The results proved the fidelity of the genes. The recombinant virus in our experiments also showed high infectiousness. Through fluorescence detection, we also found the virus express protein in around six hours. It reached the peak after 24 hours and its effect lasted for 15 days. In the process of virus production, the most important and complicated step is the purification of virus. The primary solution of virus can be use in some in vitro experiments. However, there are many other ingredients in the primary solution, for example, amino acids, trace elements and some protein factors secreted by cells. These factors are likely to affect our results, especially in animal experiments where the animals’ immune responses may be triggered. Therefore, the purification of the virus is essential to the success of experiments. In our experiment, we collected a large quantity of virus primary solutions. As a small number of virus particles will lead to concentration failure, we had to collect at least 1 x 109 HEK293 cells. About 1 ml high concentration virus solution was generated through gradient centrifugation.
158 In the enrichment process, cesium chloride was used and there was a large number of cesium in the fluid. We would like to remove cesium through dialysis in the final step. Through 48 hours of continuous dialysis, we were able to get virus of high purity. After spectrophotometric determination, there were more than 1x 1010 viral granules per 1ul concentrated solution. Concentrated viral solutions have very high infection efficiency. From our results we can see that neurons were completely infected after 24 hours. We used real-time PCR and
Western blot to detect the target genes expression in protein and mRNA levels.
Our results indicated that mRNA of target genes increased 10 folds than control group. This showed that the recombinant adenoviruses had launched our target gene expression in the neurons. Western blot results also showed that the levels of protein expression increased significantly too. This implied that the mRNA had normal translation structure, and that the cDNA cloned into plasmid was of the correct reading frame; there was no mismatch, deletion.
We can conclude from the above discussion that first, the recombinant adenovirus has high infection efficiency and is sensitive to neurons. Second, the recombinant adenovirus can enhance the target proteins expression. Third, adenovirus can sustain protein expression. We will investigate the functions of the above recombinant adenoviruses later.
In this Chapter, we have described the methods and processes of the construction of RNA interference retrovirus in detail. The result reveals that the plasmid screened out by us has satisfactory silencing effect. In the course of construction, rigorous screening out is essential. Successful construction needs three essential
159 steps. The first is selecting the better sequences that may be effective from a large number of target sequences. This step requires the computer and internet support. We will discuss the detailed content below. The second is the screening of recombinant plasmids. As the inserts were very small, they might have many kinds of reorganization ways in the ligation system. In EcoR I and Xho I digestion, a 310bp fragment is cut off from the positive recombinants and the negative clones will release a 250bp band in electrophoresis gel. The third and most important is the selection of the most effective interference plasmids. In this research, three different target sequences were designed for each gene respectively in order to have the best one chosen from them. All constructed plasmids were transferred into C6 cells. The expression of mRNA was then measured with Real-time PCR. The aim of the experiment was to reduce over 70 percent of the target genes expression. It was found that the actual results were different from the results that the computer analyzes. The real-time PCR results showed that only one oligos nucleotides sequence could meet the requirement of the RNA interference experiments in every three sequences have been designed.
160 4 Chapter 4 Iron uptake protein: Transferrin Receptor
4.1 Introduction
There are two iron transport mechanisms involving Tf-TfR dependent iron transport and Tf-TfR independent iron transport. Most cells obtain iron from transferrin (Tf) by receptor-mediated endocytosis. Tf-Fe uptake or Tf and transferrin receptor (TfR) mediated-endocytosis is considered to be the main route for cellular iron accumulation. The above information has been discussed in detail in Section 1.2.1 of Chapter 1. In this section, only a simple description of the role of TfR and DMT1 will be presented.
TfR1 is a type II transmembrane glycoprotein found primarily as a homodimer
(180 kDa) consisting of identical monomers joined by two disulfide bonds. Each monomer (760 amino acids, molecular weight 90—95 kDa) contains a large extracellular C-terminal domain (671 amino acids) known as the ectodomain that contains a Tf-binding site, a single-pass transmembrane domain (28 amino acids) and a short intracellular N-terminal domain (61 amino acids). The ectodomain contains 3 N-linked glycosylation sites and one O-linked glycosylation site.
Glycosylation at these sites is required for adequate functioning of the receptor.
Phosphorylation of TfR on serine 24 in the intracellular domain has been previously demonstrated but is not required for the internalization or recycling of the receptor. In this chapter, rAd-TfR1 and Retro-TfR1 would be constructed for the investigation of the role of TfR1 in iron metabolism.
161 4.2 Methodology
4.2.1 Materials
Unless otherwise stated, all chemicals were obtained from Sigma chemical company, St. Louis, MO, USA. Trizol Regent, T4 ligases and Pfx polymerases were purchased from Invitrogen Company, USA. Agarose, Tris, ethidium bromide and prestained protein marker were purchased from Bio-Rad
Laboratories, Hercules, CA, USA. ECL Western blotting analysis system was from Amersham Biosciences, England. Plamids minipreps kit and RT-PCR kit were from Promega, USA.
4.2.2 Methods
The methodology of construction of rAd-TfR1 and Rero-TfR1 is similar as
Chapter 3 described. For details please refer to Section 3.2 in Chapter 3. In this part, the PCR primers design and RNAi oligos design are mentioned briefly.
Search “Rat Transferrin receptor” sequence of cDNA in Pubmed website. Its locus in Pubmed is XM_001072774.
TfR1 clone primers:
Upstream primer:
5’-CGCTCAGATCTGTGCTTCAGAGTGCTCCCTTGTA-3’
Downstream primer:
5’-TCAATGTCGACGTCTTTGGCTTCTGGTCTCATCC-3’
RNAi oligos of Transferrin receptor 1:
1st target sequence: 5’- CTGGTCAGCTCATTATTAA -3’
162 2nd target sequence: 5’- GGAAATCAATGATCGTATT -3’
3rd target sequence: 5’- GTAAACTGGTCCATGCTAA -3’
4.3 Results
4.3.1 Construction of recombinant adenovirus Transferrin Receptor
4.3.1.1 Acquisition of the full length of Transferrin Receptor
Figure 4-1
The Figure4-1 demonstrates Transferrin receptor 1 cDNAs. It is around 2900bp.
163 4.3.1.2 Screening of pShuttle- Transferrin Receptor
Figure 4-2
Bgl II and Sal I were used to digest the pShuttle-TfR1 for 1 hour in a 37 ℃ water bath. Detect the production of digestion through running 1.5% agrose electrophoresis. The results (Fig 3-10) showed that TfR1 genes were released from recombinant plasmids #1 and #3. The positive clones were #1 and #3 recombinant plasmids, named pShuttle-HJV. Submit to sequencing. The size of
TfR was around 2900bp.
164 4.3.1.3 Bacterial recombinant of viral skeleton about rAd- Transferrin
Receptor
Figure 4-3
Please refer to the statement of Fig 3-4. In this photo, #1 and #2 were all positive clones. They were named rAd-TfR1.
165 4.3.1.4 Generation of recombinant adenovirus of Transferrin Receptor
The procedure of infection and expression is similar to rAd-DMT1. Please refer to Figure 3-5.
4.3.2 Construction of recombinant retrovirus Transferrin Receptor
4.3.2.1 Results of annealing oligos for Transferrin Receptor
Please refer to Figure 3-8.
4.3.2.2 Identification of recombinant pSuper- Transferrin Receptor
Figure 4-4
The three kinds of pSuper-TfR1 (#1, #2 and #3) and blank plasmids as control
166 group were cut with EcoR I and Hind III at 37 0C, 1 hour. The band of blank plasmids on the gel corresponded the expected molecular weight (227bp), and the bands of pSuper-TfR1 (#1, #2 and #3) plasmids were around 310bp size.
Collect them and submit to sequence.
4.3.2.3 Screening of the recombinant plasmids pSuper-TfR1
Figure 4-5 mRNA extraction and Real-time PCR methods were performed as described in
Material and Method. Transfection of 10μg plasmids DNA into H9C2 (cell counting 5 x 106) was performed by liposome. After 48 hours, transcribe total mRNA of these cells to cDNA. The real-time results showed that #2 pSuper-TfR1 could effectively decrease the gene expression of Transferrin receptor 1 in H9C2. This clone was selected as retrovirus packaging material.
The recombinant retrovirus was named Retro-TfR1.
167
4.3.3 Biological test of rAd-TfR1 and Retro-TfR1
4.3.3.1 Biological activity of rAd-TfR1
168
Figure 4-6
1.5x109 CPU (0.5μl) purified recombinant adenovirus-Transferrin receptor1
(rAd-TfR1) were used to treat C6 (cells counting around 1.5x106) for 24 hours.
The method of Western-blot was used to measure the expression of TfR1. The results showed rAd-TfR1 can increase the expression of transferrin receptor 1 significantly. The data were presented as means ± SEM of 2 separate experiment groups and the experiments were repeated 3 times. T-test was used in the data analysis, *P<0.05, versus the control group.
169 4.3.3.2 Biological activity of retro-TfR1
Figure 4-7
170 The expected molecular weight of TfR1 was ~97 kDa and β-actin ~ 45 kDa bands appearing on each gel. Expression values were normalized for β-actin and expressed as a fraction. The figure showed that retro-TfR1 has the ability to inhibit the expression of TfR1. The data were presented as means ± SEM of 2 separate experiment groups and was repeated 3 times T-test was used in the data analysis, *P<0.05, versus the control group.
4.4 Discussion
The original characterization and naming of transferring (Tf) as the serum protein with two specific Fe3+-binding sites (Holmberg & Laurell, 1947; Laurell
& Ingelman, 1947) led to the demonstration that Tf serves as iron source for hemoglobin synthesis (Jandl, Inman, Simmons, & Allen, 1959). The latter was accompanied by the recognition that cellular uptake of Tf-borne iron requires interaction of the protein with a specific Tf receptor now known as TfR1 (Jandl et al., 1959). (A recently described second Tf receptor, TfR2 (Kawabata et al.,
1999), with as yet poorly understood function, will not be discussed in this discussion.) A presumption that the receptor–Tf complex on the cell surface is the site of iron release from Tf was subsequently challenged by the radioautographic display of 125I-labeled Tf internalized by the iron-requiring reticulocyte (Morgan & Appleton, 1969). Subsequent demonstrations that Tf
171 remains bound to receptor within a proton-pumping endosome in which the pH falls to near 5.6, depending on cell type (Klausner, Ashwell, VanRenswoude,
Harford, & Bridges, 1983), and that the receptor–Tf complex remains stable at this pH when iron has been freed from Tf, provided a model for the Tf-to-cell cycle in iron metabolism (Dautry-Varsat, Ciechanover, & Lodish, 1983). At the pH of the cell surface, 7.4, TfR1 binds only iron-bearing Tf, either monoferric or diferric; apoTf is ignored, thereby avoiding wasteful competition between the iron-free protein (that predominates in the circulation in normal and iron-deficient states) and the iron-carrying protein. The Tf/TfR1 assembly is internalized into a clathrin-coated pit that, assisted by an adaptor protein complex designated AP-2 (Conner & Schmid, 2003), rapidly matures and internalizes to a proton-pumping, pH-lowering endosome. At the lowered pH, near 5.6 depending on cell type, iron is freed from Tf to cross the endosomal membrane as Fe2+ via the divalent metal transporter DMT1 (Fleming et al.,1998). Iron-depleted Tf is then returned to the cell surface where, again encountering a pH of 7.4, the protein is released for another cycle of iron transport. The entire cycle is completed within a few minutes, and 100–200 such cycles are experienced by Tf during its lifetime in the circulation (Katz, 1961). The salient feature of the Tf cycle is the persistence of the Tf/TfR1 complex throughout the journey of Tf in
172 the cell (Lamb, Ray, Ward, Kushner, & Kaplan, 1983). TfR1 plays a critical role in iron homeostasis by serving as a gatekeeper regulating iron uptake from Tf.
Cells expressing large amounts of TfR1 are correspondingly competent in securing iron from Tf, while low receptor numbers are paralleled by reduced capacity to acquire Tf-borne iron. Rapidly proliferating cells, as in malignancy, generally express TfR1 abundantly (Trowbridge & Omary, 1981).
Due to importance of transferring receptor 1 in Fe3+ uptake as discussed at above, the function research for TfR1 is essential to iron metabolism in our research, especially in the brain. As mentioned in Chapter 1, TfR1 play a critical role in Fe3+ uptake peripheral tissues or organs which have been reported many times since TfR1 was found. But in the brain, transferring receptor 1 is still not clear in many aspects, including its location, mechanism, regulation and expression et al. In this study, we hope regulate the level of TfR1 gene expression through viral vectors, consequently recombinant transferring receptor
1 adenoviruses and recombinant transferring receptor 1 retroviruses were constructed to meet our requirement. rAd-TfR1 contain the full-length gene of
TfR1 which was got from SD rat and retro-TfR1 is make up of pSUPERION and
19nt oligo silencing sequence.
173 In this chapter, recombinant adenovirus and retrovirus of transferrin receptor
1(TfR1) gene are constructed and applied in C6 cell lines to identify their biological activities. In the figure 4-6, the data showed that the expression of
TfR1 is responded to the infection of rAd-TfR1, which suggest these viruses can efficiently influence the expression of TfR1. Subsequent biological activity experiments of the chapter 8 also prove the rAd-TfR1 can enhance Fe3+ uptake of C6 cells. Contrary to rAd-TfR1, retro-TfR1 can reduce the expression of TfR1 protein and inhibit the iron uptake. In the brain, the function and regulation of
TfR1 is unclear. We hope to use rAd-TfR1 and retro-TfR1 to modulate the level of expression of TfR1 in vitro artificially so that the relationship of TfR1 and brain iron uptake will be clarified in the future. In some other data of our lab, we found the expression of TfR1 was inhibited when hepcidn was highly expressed by rAd-hepcidin infection in brain cells (The data don’t show here). These preliminary results suggested expression of TfR1 may be regulated by hepcidn in the brain, but the direct evidences between TfR1 and hepcidin are lacking. In our plan, the joint use of various viral products (example, rAd-TfR1 coupling with retro-hepc) will direct the future study.
174 5 Chapter 5 Iron release protein: Ferroportin 1
5.1 Introduction
As we have described in Section 1.3.3 Chapter 1[Fig 5.1], ferroportin1, a newly discovered molecule, may play a role in iron export. The following six observations provide evidence that suggests ferroportin in the efflux of non-heme iron.
[1] Over-expression of ferroportin resulted in a cellular iron deficient phenotype, indicating that ferroportin caused iron efflux from cells(Abboud and
Haile, 2000).
[2] Ferroportin expression in Xenopus oocytes along with DMT1 resulted in iron efflux(Donovan et al., 2000; McKie et al., 2001).
[3] Over-expression of ferroportinin cells exposed to hepcidin-25 resulted in an internalization of ferroportin and its targeting to lysosomes for degradation and was linked with increased cellular iron stores. Hepcidin-20 had no similar effect as hepcidin 25 (Nemeth et al., 2004a).
[4] Mutations to ferroportin resulted in a hemochromatosis phenotype, suggesting that iron release from the stores was impaired or that ferroportin was unresponsive to hepcidin-25(De Domenico et al., 2006; De Domenico et al.,
2005).
[5] Over-expression of ferroportin in macrophages during erythrophagocytosis increased the release of non-heme iron after its release from heme (Knutson et al., 2005).
[6] Ferroportin-/- mice resulted in non-heme iron accumulation within enterocytes(De Domenico et al., 2005).
175
Figure 5-1
Topology of Fpn showing the potential transmembrane domain containing the phosphorylation (Y302 and Y303) and ubiquitination (K253) sites.
These data support the hypothesis that ferroportin is a receptor for hepcidin and is involved in non-heme iron release, and that hepcidin is a major regulator of iron absorption and body iron turnover. In this chapter, rAd-FPN1 and
Retro-FPN1 would be constructed for this research.
176 5.2 Methods
The methods of construction for rAd-FPN1 and Rero-FPN1 is similar as Chapter
3 described. For details please refer to Section 3.2 in Chapter 3. In this part, the
PCR primers design and RNAi oligos design are mentioned briefly.
Search “Rat Ferroportin 1” sequence of cDNA in Pubmed website. Its locus in
Pubmed is NM_133315.
Ferroportin 1:
Upstream primer:
5’- CGCTCAGATCTCTATTCTAAGAGCACAGATCC -3’
Downstream primer:
5’- CTATAGTCGACCAAAGACAGACAGACAGGCT -3’
RNAi oligos of Ferroportin 1:
1st target sequence: 5’- TGTGAACAAGAACCCACCT-3’
2nd target sequence: 5’- TCTCCGTCAGCCTGCTGTT -3’
3rd target sequence: 5’- CTCTGGAAGGTTTACCAGA -3’
177 5.3 Results
5.3.1 Construction of recombinant adenovirus Ferroportin 1
5.3.1.1 Acquisition of the full length of Ferroportin 1
Figure 5-2
Figure 5-2 demonstrates Ferroportin 1 cDNAs. It is around 2900bp.
178 5.3.1.2 Screening of pShuttle-Ferroportin 1
Figure 5-3
Bgl II and Sal I were used to digest the pShuttle-FPN for 1 hour in a 37 ℃ water bath. Detect the production of digestion through running 1.5% agrose electrophoresis. The results (Fig 5-3) showed that FPN1 genes were released from recombinant plasmids #1,3,4. The positive clone was #1,3,4 recombinant plasmids, named pShuttle-FPN1. Submit to sequencing. The size of FPN1 was around 1200bp.
179
5.3.1.3 Bacterial recombinant of viral skeleton about rAd-Ferroportin 1
Figure 5-4
Pac-I was used to identify the successful recombinant adenovirus genome after transformation to E.coil. The positive clone would release a specific fragment around 4.5 kb by 1% agrose gel electrophoresis. After collecting many clones from bacteria, these plasmids were digested with Pac-I in a 370C water bath for 1 hour. The clones that released this specific fragment (arrow point, 4.5kb) were the positive recombinant adenovirus genome. In this photo, #2 and #5 were all
180 positive clones. They were named rAd-FPN1.
5.3.1.4 Generation of recombinant adenovirus of Ferroportin 1
The procedure of infection and expression is similar to rAd-DMT1. Please refer to Figure 3-5.
5.3.2 Construction of recombinant retrovirus Ferroportin 1
5.3.2.1 Results of annealing oligos for Ferroportin 1
Figure 5-5
Dissolve the three kinds of Ferroportin1 oligos (FPN1 #1, #2 and #3) in sterile, nuclease-free H2O to a concentration of 3 mg/ml. Assemble the annealing reaction by mixing 1 μl of each oligo (forward + reverse) with 48 μl annealing buffer. Incubate the mixture in boiling water for 2 min, and turn off the electric heater. Running PAGE detected the annealing products, and silver staining for
181 color development. The successful annealing productions were double-stranded
DNA and had a size of around 60bp. The control groups were single-stranded
DNA. They run faster than double-stranded DNA in PAGE. Figure 5-5 is the image of FPN1 oligos annealing reaction. The three FPN1 RNAi oligos (FPN1
#1 ,#2 and #3) all formed double-stranded DNA.
5.3.2.2 Identification of recombinant pSuper- Ferroportin 1
Figure 5-6
The three kinds of pSuper-FPN1 (#1, #2 and #3) and blank plasmids as control group were cut with EcoR I and Hind III at 37 0C, 1 hour. The band of blank plasmids on the gel corresponded the expected molecular weight (227bp), and the bands of pSuper-FPN1 (#1, #2 and #3) plasmids were around 310bp in size.
Collect them and submit to sequence.
182 5.3.2.3 Screening of the recombinant plasmids pSuper-FPN1
Figure 5-7 mRNA extraction and Real-time PCR methods were performed as described in
Material and Method. Transfection of 10 g plasmids DNA into H9C2 (cell counting 5 x 106) was performed by liposome. After 48 hours, transcribe total mRNA of these cells to cDNA. The real-time results showed that #2 pSuper-FPN1 can effectively decrease the gene expression of hepcidin in H9C2.
This clone was selected as the retrovirus packaging material. The recombinant retrovirus was named Retro-FPN1.
183 5.3.3 Biological test of recombinant adenovirus Ferroportin 1
5.3.3.1 Biological activity of rAd-FPN1 in Neurons
Figure 5-8
1.5x109 CPU (0.5ml) purified recombinant adenovirus-hepcidin (rAd-Hepc) were used to treat Neurons (cells counting around 1.5x106) for 24 hours. The method of Western-blot was used to measure the expression of DMT1 with IRE and DMT1 without IRE. The concentration gradients from 0 ml to 2.0 ml were applied in this experiment. The results showed that recombinant adenovirus-FPN can increase the expression of the protein significantly.
184 5.3.3.2 Biological activity of Retro-FPN1 in Neurons
Figure 5-9
The expected molecular weight of FPN1 was ~60 kDa and β-actin ~ 45 kDa bands appeared on each gel. Expression values were normalized for β-actin and expressed as a fraction. The data were presented as means ± SEM of 3 separate experiments. T-test was used in the data analysis, *P<0.05 (n=3), versus the control group. After retro-FPN1 treatment 48 hours, expression values of FPN1 decreased significantly compared with control group.
185 5.4 Discussion
In the chapter, recombinant Ferroportin 1 adenovirus (rAd-FPN) and retrovirus knockout system (retro-FPN) are constructed successfully. The system application of these viruses will be discussed in the Chapter 8. From Figure 5-9 and 5-10, the results suggest that rAd-FPN and retro-FPN have ability to regulate expression of Ferroportin protein in the neurons. In our research, the one of research hot points is the function of Ferroportin protein in brain iron release.
Most of us believe the Ferroportin has an important role of iron exporting from cells, and it is the only iron exporting transporter of cell membrane has been known. But the mechanism of Ferroportin of brain is still unclear. The work of
Donovan et al. has significantly advanced our understanding of ferroportin’s function. Their earlier studies in zebrafish indicated that the complete loss of ferroportin expression is embryonic lethal, unless the embryos are rescued by iron injections (Donovan et al., 2000). The surviving zebrafish had severe iron deficiency anemia and were not able to absorb iron from their diet. In the current study, total deficiency of ferroportin in mammals is also embryonic lethal, almost certainly because the developing embryo cannot import iron across the maternal-fetal interface (extraembryonic visceral endoderm, placenta). If this early defect is selectively circumvented by conditionally deleting ferroportin in
186 all tissues except the maternal-fetal interface, the embryo survives to birth but the newborn mouse rapidly develops severe iron deficiency as it begins to depend on intestinal absorption of iron. The mice also display defects in the release of iron from hepatic storage and in the recovery of iron from recycled red cells. As indicated by abundant trapped iron in intestinal enterocytes, macrophages, and hepatocytes, all these cells are unable to export cytoplasmic iron to plasma in the absence of ferroportin. In our research, we also found the state of C6 cells was beginning to be abnormal after retro-FPN1 treated for 72 hours. But the phenomenon required continuing in-depth observation.
The importance of ferroportin for intestinal iron absorption was specifically addressed by an intestine-specific ablation of ferroportin expression. Like the mice with total postnatal ablation of ferroportin, these mice also developed severe systemic iron deficiency despite iron-loaded enterocytes. Here, however, macrophages and hepatocytes lacked iron, since these cell types still had ferroportin, and exported iron as is appropriate in systemic iron deficiency. Most discussions of diseases of iron overload make the point that physiological excretion of iron is very limited and cannot be increased. However, Donovan et
187 al. (Donovan et al., 2005) propose that intestinal epithelium can take up significant amounts of iron from plasma by transferrin receptor-mediated endocytosis through the basolateral membrane. If circulating hepcidin concentrations are high, basolateral ferroportin is degraded and the iron trapped.
At the end of their 1–2 day life span, the iron-loaded intestinal epithelial cells would be shed into the fecal stream. It is therefore conceivable (but remains to be shown and quantified) that iron excretion in stool could be homeostatically increased during iron overload. This important and definitive study confirms that the iron-exporting tissues and cells have no significant alternative to the ferroportin iron efflux pathway and provides further support for the fundamental role of the hepcidin-ferroportin interaction in systemic iron homeostasis. This interaction is also the key to understanding the pathogenesis of hereditary hemochromatosis. The excessive intestinal iron absorption characteristic of this group of diseases results from inappropriately high ferroportin activity either because of hepcidin deficiency or, less commonly, because of the insensitivity of mutated ferroportin to hepcidin. At the other end of the spectrum of iron disorders, anemia of inflammation develops when the cytokine-induced hepcidin internalizes and degrades ferroportin on iron-exporting cells, most notably macrophages. Recycled iron is trapped, decreasing the plasma concentration of
188 iron and limiting hemoglobin production in developing erythrocytes in the bone marrow. The role of ferroportin and the exporting pathway of brain iron are still indistinct. The relation of hepcidin and ferroportin is also a most important focus concerned by us. In the research, we want to clarify the role of Ferroportin in brain through recombinant adenovirus and retrovirus. In the Chapter 8, we investigate the function and biological activity of rAd-FPN1 and Retro-FPN1, whose data suggest us that the level of expression of FPN1 can influence the change of iron release. And the data about Ferroportin regulated by hepcidin maybe help us to clear the effect of Ferroportin in iron release of brain.
According to our data and some relevant literature, it may safely be assumed that
Ferroportin is the sole cellular efflux channel for iron and is regulated by the iron regulatory hormone hepcidin, which binds ferroportin and induces its internalization and degradation. More information and discussions about recombinant adenovirus and retrovirus system have been discussed in the
Chapter 3, please refer to 3.4.
189 6 Chapter 6 Iron release protein: Hephaestin
6.1 Introduction
The characteristics and function of hephaestin have been described in Chapter 1.
The presence of hephaestin on the basolateral surface of enterocytes is essential for effective iron export. Hephaestin is thought to oxidize ferrous iron exported through the basolateral membrane by Ireg1. Iron oxidation is required for its ultimate extracellular binding to transferrin. Supranuclear localization of hephaestin may also suggest the involvement of hephaestin in intracellular oxidation of iron. Such a function could, for instance, facilitate iron storage in ferritin or intracellular transferrin. We know that hephaestin is highly homologous to CP (50% sameness, 68% similarity) and significantly all the residues involved in copper binding and disulfide bond formation in CP are conserved in Heph. However, in this study, we are more interested in the interaction between hephaestin and ferroportin1 in the brain. In this chapter, rAd-heph and retro-heph were constructed to further clarify the relationship between heph and FPN1 in brain iron metabolism.
190 6.2 Methods
The method of construction of rAd-FPN1 and Rero-FPN1 is similar to the one described in Chapter 3. For details please refer to Section 3.2 Chapter 3. In this part, the PCR primers design and RNAi oligos design are mentioned briefly.
Search “Rat Hephaestin” sequence of cDNA in Pubmed website. Its locus in
Pubmed is NM_133304.
Hephaestin:
Upstream primer:
5’- CGCTCAGATCT TCTCAAAGTACTGTGGGCCATGAAGGCAGG -3’
Downstream primer:
5’- TCAATGTCGAC AGATGTGTTCTGAAGATATTTTCAGGCTTC -3’
RNAi oligos of Hephaestin:
1st target sequence: 5’- GCCCACGCCAACACTACCA -3’
2nd target sequence: 5’- CACTACCAAGCGTCAAGAG -3’
3rd target sequence: 5’- GGATGCAGGCAATTTATAA -3’
191 6.3 Results
6.3.1 Construction of recombinant adenovirus Hephaestin
6.3.1.1 Acquisition of the full length of Hephaestin
Figure 6-1
Figure 6-1 demonstrates Hephaestin cDNAs. It is around 3400bp. The expressions of Heph in different tissues of rat were detected in this study. Figure
6-1 revealed that the liver, brain, intestine and lung all were able to express hephaestin, although liver and brain are weaker than intestine and lung.
192 6.3.1.2 Screening of pShuttle- Hephaestin
Figure 6-2
Bgl II and Sal I were used to digest the pShuttle-Heph for 1 hour in a 37 ℃ water bath. Detect the production of digestion through running 1.5% agrose electrophoresis. The results (Fig 6-2) showed that Heph genes were released from recombinant plasmids #1,2. The positive clone was #1,2 recombinant plasmids, named pShuttle-Heph. Submit to sequencing. The size of Heph was around 3400bp.
193 6.3.1.3 Bacterial recombinant of viral skeleton about rAd-Hephaestin
Figure 6-3
Pac-I was used to identify the successful recombinant adenovirus genome after transformation to E.coil. The positive clone would release a specific fragment around 4.5 kb by 1% agrose gel electrophoresis. After collecting many clones from bacteria, these plasmids were digested with Pac-I in a 370C water bath for 1 hour. The clones that released this specific fragment (arrow point, 4.5kb) were the positive recombinant adenovirus genome. In this figure, #1, #3 and #4 were all positive clones. They were named rAd-heph.
194 6.3.1.4 Generation of recombinant adenovirus of Hephaestin
The procedure of infection and expression was similar to that of rAd-heph.
Please refer to Figure 3-5.
6.3.2 Construction of recombinant retrovirus Hephaestin
6.3.2.1 Results of annealing oligos for Hephaestin
Figure 6-4
Dissolve the three kinds of Ferroportin1 oligos (Heph #1, #2 and #3) in sterile, nuclease-free H2O to a concentration of 3 mg/ml. Assemble the annealing reaction by mixing 1 μl of each oligo (forward + reverse) with 48 μl annealing buffer. And then incubate the mixture in boiling water for 2 min, and turn off the electric heater. The successful annealing productions were double-stranded DNA and were of a size of around 60bp. The control groups were single-stranded DNA.
195 They run faster than double-stranded DNA in PAGE. Figure 6-4 is the image of
Heph oligos annealing reaction. The three Heph RNAi oligos (Heph #1, #2 and
#3) all formed double-stranded DNA.
6.3.2.2 Identification of recombinant pSuper- Hephaestin
Figure 6-5
The three kinds of pSuper-Heph (#1, #2 and #3) and blank plasmids as control group were cut by EcoR I and Hind III at 37 0C, 1 hour. The bands of pSuper-heph (#1, #2 and #3) plasmids were shown to be around 310bp in size.
Collect them and submit to sequence.
196 6.3.2.3 Screening of the recombinant plasmids pSuper-Heph
Figure 6-6 mRNA extraction and RT-PCR methods were performed as described in Material and Method. Transfection of 10μg plasmids DNA into H9C2 (cell counting 5 x
106) was performed by liposome. After 48 hours, transcribe total mRNA of these cells to cDNA. The results showed that #3 pSuper-Heph can effectively decrease the gene expression of hepcidin in H9C2. This clone was selected as retrovirus packaging material. The recombinant retrovirus was named Retro-Heph.
197 6.3.3 Biological test of recombinant adenovirus Hephaestin
6.3.3.1 Biological activity of rAd-heph
Figure 6-7
1.5x109 CPU (0.5μl) purified recombinant adenovirus-hephaestin (rAd-heph)
198 were used to treat C6 (cells counting around 1.5x106) for 24 hours. The method of Western-blot was used to measure the expression of hephaestin. The results showed that rAd-heph can increase the expression of hephaestin significantly.
The data were presented as means ± SEM of 2 separate experiment groups and the experiment was repeated 3 times. T-test was used in the data analysis,
**P<0.01, versus the control group.
199 6.3.3.2 Biological activity of Retro-heph
Figure 6-8
The expected molecular weight of heph was ~155 kDa and β-actin ~ 45 kDa bands appeared on each gel. Expression values were normalized for β-actin and expressed as a fraction. The figure showed that retro-heph has the ability to
200 inhibit the expression of hephaestin. The data were presented as means ± SEM of
2 separate experiment groups and the experiment was repeated 3 times. T-test was used in the data analysis, *P<0.05, versus the control group.
6.4 Discussion
Intracellular iron balance is dependent not only upon the amount of iron uptake by but also the amount of iron released from cells. The excessive accumulation of iron in the brain found in some neurodegenerative diseases may result from an increased uptake by as well as a decreased release from cells [Qian and Wang,
1998]. Little is known about the molecules involved in the iron efflux from brain cells under physiological conditions. Although ceruloplasmin is widely believed to have a role in the iron release from the cells [Harris et al.,1999], the expression of ceruloplasmin in the brain is only observed in those astrocytes predominantly surrounding the microvasculature, but not in all glial cells and other brain cells
[Klomp et al., 1996]. Also, the GPIanchored ceruloplasmin expressed by astrocytes is the predominant form of this protein in the brain [Patel and David,
1997; Patel et al., 2000]. The unique location and expression form of this protein in the brain suggest that after Fe2t crosses the abluminal membrane of the BBB endothelial cells probably via ferroportin 1 [Jeong and David, 2003], ceruloplasmin might be necessary for Fe2t to be oxidized to Fe3t to enable the
201 latter to bind to the transport carriers [Patel et al., 2000, 2002; Qian and Ke, 2001;
Qian and Shen, 2001]. Also, these characteristics of ceruloplasmin, together with some recent studies in vitro on the effect of ceruloplasmin on iron transport in the brain glomia cells [Qian et al., 2001; Xie et al., 2002] and other types of cells
[Mukhopadhyay et al., 1998; Attieh et al., 1999], imply the impossibility for ceruloplasmin to play any function in the iron efflux from other brain cells except for the BBB. cells and astrocytes. Therefore, there is probably other molecule(s) that has a ceruloplasminlikerole in the brain, playing a role in the iron release from the relevant brain cells.
Hephaestin, as a potential iron release protein, is a new direction of brain iron metabolism. Its functions and characters have been mentioned in the Chapter 1.
In general opinion, hephaestin is highly expressed in the small intestines and expressed weakly in the brain. But our lab has proved four differ regions of the brain can express hephaestin protein and expression of that is related with iron contents and aging. In this part, our results also revealed that the brain can express the hephaestin although the expression is weaker than that of the lung and intestine. We believe that hephaestin might be one of the molecules that have a ceruloplasmin-like role, playing a role in the iron export from the relevant cells
202 in the brain. We think Iron (Fe2+) might first be transported across the membrane of these cells by Ferroportin 1. Heph, acting as a ferroxidase [Griffiths et al.,
2005; Petrak and Vyoral 2005], might oxidize Fe2+ to Fe3+ and subsequently load iron (Fe3t) onto transferrin or other iron carriers in the brain. In order to verify the hypothesis, we construct the recombinant hephaestin adenovirus and retrovirus knockout system in my research. The semi-qPCR results showed that pSUPER-heph transfection was able to effectively reduce the expression of hephastin in H9C2 cell lines. Through packaging and concentrating of retrovirus, the retro-heph was used to treat C6 cells. Western blot results showed the retro-heph is efficient to gene suppression of hephaestin. Recombinant adenovirus of hephaestin also demonstrated high biological activity in the experiments. In radiation experiments, Ad-heph can increase the iron release and retro-heph can decrease the iron release. These results maybe reveal the relationship of hephaestin and ferroportin. As we have said, hephaestin, as a potential iron release protein of brain, the function and mechanism are unclear. In our study, we have proved expression of hephaestin can influence the iron (Fe3+) release of brain in vitro. The data is of importance in support of discussion of the existence and mechanism of hephaestin in the brain that we predicted at above.
In this part, we verified hephaestin is able to act on the brain cells. This means
203 hephaestin is a part of brain iron metabolism and transport. In the intestine, hephaestin facilitated the exporting of iron from cytoplasm associating with ferroportin. We concluded that ferroportin-hephaestin interaction model of brain maybe is the same as the model of intestine although this point needs to observe in further. The relation of hephaestin and ferroportin is one of the most important problems about brain iron metabolism. In the future, rAd-FPN1 and rAd-heph would be used in animal models to investigate brain iron metabolism.
204 7 Chapter 7 Iron regulatory peptide: hepcidin
7.1 Introduction
As discussed in Chapter 1, hepcidin is a key regulator of iron metabolism. It is widely distributed in the liver, kidney, heart, brain and other organs. Current scientific evidence suggests that hepcidin is a central regulatory hormone whose main action is to regulate systemic iron homeostasis. However, because of its very low molecular weight and easily degradable characteristics, researchers have to solve the problem of how to obtain hepcidin of high purity and biological activity.
Hepcidin synthesized by chemical methods is used to treat cells and animals in most researches. There are two drawbacks: their expensiveness and their inability to confirm the biological activity of hepcidin. The use of synthesized hepcidin is thus restricted. A new way to express hepcidin protein efficiently and rapidly especially in in vivo experiments is needed. As described in Chapter 1, adenovirus can increase the expression level of those exogenous genes which have been inserted into the genome of adenoviruses. We amplified the full-length hepcidin gene and constructed a recombinant adenovirus. We named it
“rAd-hepc”. rAd-hepc can infect primary cultured neurons at high efficiency and express the target protein spontaneously in neurons. In addition, retro-hepcidin was constructed to silence the expression of hepcidin .
Hepcidin have three predominant forms: 20- (hepc-20), 22- (hepc-22) and 25-
(hepc-25) amino acids. They are derived from a precursor peptide of 84 amino
205 acids. In humans, the cDNA sequence of hepcidin exhibits an open reading frame encoding an 84-residue precursor protein which contains the isolated peptide at the COOH-terminus. An NH2-terminal signal sequence (residues 124) characteristic for secretory proteins has been identified. rAd-hepc includes not only the open reading frame, but also its signal peptide structure. We have strengthened a series of hepcidin expression processes that include transcription, translation and cutting in organisms . Hepcidin, a kind of protein with various functions, is involved in all aspects of iron metabolism including iron uptake and release. In this chapter, the application of recombinant hepcidin adenovirus and retrovirus in brain iron metabolism will be explored.
7.2 Methods
The method of the construction of rAd-Hepc and Rero-Hepc is similar to the one described in Chapter 3. For details please refer to Section 3.2 Chapter 3. In this part, the PCR primers design and RNAi oligos design are briefly described.
Search “Rat hepcidin” sequence of cDNA in Pubmed website. Its locus in
Pubmed is NM_053469.
Hepcidin：
Upstream primer:
5’-GGCAGATCTATGGCACTAAGCACTC-3’
Downstream primer:
5’-GCGGTCGACCTATGTTATGCAACAGA-3’
206 RNAi oligos of Hepcidin:
1st target sequence: 5’- GCGAAGGAAGCGAGACACC -3’
2nd target sequence: 5’- AGCAAGACTGATGACAGTG -3’
3rd target sequence: 5’- GTCTCTGTTGCATAACATA -3’
7.3 Results
7.3.1 Construction of recombinant adenovirus hepcidin
7.3.1.1 Acquisition of the full length of hepcidin
Figure 7-1
Demonstrate hepcidin cDNAs. It is around 420bp.
207 7.3.1.2 Screening of pShuttle-hepcidin
Figure 7-2
Bgl II and Sal I were used to digest the pShuttle-hepcidin for 1 hour in a 37 ℃ water bath. Detect the production of digestion through running 1.5% agrose electrophoresis. The results (Fig 7-2) showed that hepcidin genes were released from recombinant plasmids. The size of hepcidin was around 470bp. Submit to sequencing.
208 7.3.1.3 Bacterial recombinant of viral skeleton of rAd-hepcidin
Figure 7-3
Pac-I was used to identify the successful recombinant adenovirus genome after its transformation to E.coil. The positive clone would release a specific fragment around 4.5 kb by 1% agrose gel electrophoresis. After collecting many clones from bacteria, these plasmids were digested with Pac-I in a 370C water bath for 1 hour. The clones that released this specific fragment (arrow point, 4.5kb) were the positive recombinant adenovirus genome. In Fig 7-3, #1 and #2 clones were positive clones. Their bacterial liquids were reversed with 10% DMSO in -80 0C.
The plasmids were reversed in -20 0C.
7.3.1.4 Generation of recombinant adenovirus of Hephaestin
The procedure of infection and expression is similar to that of rAd-DMT1. Please refer to Figure 3-5.
209 7.3.2 Construction of recombinant retrovirus hepcidn
7.3.2.1 Results of annealing oligos for hepcidin
Figure 7-4
Dissolve the three kinds of hepcidin oligos (Hepc #1, #2 and #3) in sterile, nuclease-free H2O to a concentration of 3 mg/ml. Assemble the annealing reaction by mixing 1 μl of each oligo (forward + reverse) with 48 μl annealing buffer. Incubate the mixture in boiling water for 2 min, and turn off the electric heater. PAGE detected the annealing products, and silver staining for color development. The successful annealing productions were double-stranded DNA and were of a size of around 60bp. The control groups were single-stranded DNA, they were running faster than the double-stranded DNA in PAGE. In Fig 7-5, the oligos of Hepc #2 and #3 formed double-stranded DNA after the annealing reaction, but Hepc #1 was failed in this experiment. Repeat hepc #1 annealing reaction and show its result in Fig 5-5.
210 7.3.2.2 Identification of recombinant pSuper- hepcidin
Figure 7-5
After transformation, grow bacteria in amp-agarose plates overnight (16-24 hrs), then pick and grow colonies in an ampicilin broth for an additional cycle. Pick and miniprep several colonies (it can take many to locate a positive clone) according to the supplier’s instructions (Promega mini pre kit). Check for the presence of positive clones (i.e., containing vector with an oligo insert) by EcoRI and HindIII digested. After digestion, determine your results as follows: the vector with the insert would release a fragment of around 310bp and the vector with no insert would release a fragment of around 227bp. In Fig 4-5, the three kinds of recombinant Hepcidin plasmids were positive clones. Collect them and submit to sequence.
211 7.3.2.3 Screening of the recombinant plasmids pSuper-Hepcidin
Figure 7-6 mRNA extraction and Real-time PCR methods were performed as described in
Material and Method. Transfection of 10mg plasmids DNA into H9C2 (cell counting 5 x 106) was performed by liposome. After 48 hours, transcribe total mRNA of these cells to cDNA. The real-time results showed that #3 pSuper-hepc can effectively decrease the gene expression of hepcidin in H9C2. This clone was selected as retrovirus packaging material. The recombinant retrovirus was named
Retro-Hepc.
212 7.4 Discussion
Hepcidin is a key regulator of systemic iron homeostasis. The first link between hepcidin and iron homeostasis was established by the finding that murine hepcidin mRNA levels increase in mice subjected to secondary iron overload
(Pigeon et al., 2001). Subsequent studies in a strain of Usf2-/-(upstream stimulatory factor 2) mice, which inadvertently also lacked hepcidin expression, demonstrated hepatic iron overload associated with decreased iron in tissue macrophages (Nicolas et al., 2001). Mice overexpressing hepcidin die several hours after birth, and only mosaic transgenic mice survive and present with severe iron-deficiency anaemia (Nicolas et al., 2002b). Consistent with this, injection of hepcidin peptide into mice induces a rapid drop in serum iron levels
(Rivera et al., 2005). Taken together these findings suggest that hepcidin attenuates intestinal iron absorption and macrophage iron release. In our study, rAd-hepc and retro-hepc also have been found the similar effect to expression of
Ferroportin1 and iron transport in brain. The results will be showed in Chapter 8
(8.2). rAd-hepc reduced the expression of FPN1 coupled with cellular iron release down-regulated . Contrary to recombinant adenoviruses, retro-hepc can induce the expression of FPN1 and enhance the exporting of iron in neurons.
These results provided us some evidences to elucidate the regulation effect of
213 hepcidin in brain. The role of hepcidin in brain is a key emphasis in our works.
We constructed recombinant adenoviruses of hepcidin (rAd-hepc) and retroviruses of hepcidin (retro-hepc) to investigate the regulation mechanism of hepcidin in brain iron metabolism. Up to now, it is not still research reports about injection of rAd-hepc in vivo except hepcidin peptide injection. Comparing with injection of peptide, the biggest advantage of recombinant hepcidin adenovirus is able to preserve the active ingredient of hepcidin and aid in application. In this chapter, the primary objective is construction of recombinant adenovirus of hepcidin and retrovirus of hepcidin. These research tools applied in neurons research and intraventricular injection of SD rats. In the Chapter 8, the results of biological activities of rAd-hepc and retro-hepc revealed that hepcidin is associated with FPN1 and DMT1 in brain iron metabolism. The application of hepcidin relevant viral products will be discussed in detail. So, in this chapter, we only showed general procedures of recombinant adenovirus and retrovirus packaging.
Deregulation of hepcidin is central to the most frequent diseases of iron metabolism, hereditary hemochromatosis and anaemia of inflammation. Future research will tackle the challenging questions how hepcidin expression is regulated in response to changing systemic iron levels and brain iron levels. It is
214 expected that this will lead to the discovery of novel cellular pathways involving
HFE, TfR2 and HJV. Detailed understanding of these processes may reveal novel therapeutic approaches that may be beneficial in treating iron disorder diseases.
In our future work, the application of rAd-hepc will be expanded to gene therapy of Alzheimer's disease and other iron metabolism disorder diseases when the function of hepcidin is clarified in animal models.
215 8 Chapter 8 Systemic application of recombinant
adenoviruses and retroviruses
8.1 PART1 L-dopa neurotoxicity is mediated by up-regulation of
DMT1-IRE expression
8.1.1 Introduction
Parkinson’s disease (PD) is a progressive neurodegenerative disorder that affects approximately 1% of people over the age of 60 (Jankovic and Stacy, 2007). This disorder is mainly characterized by the degeneration of dopamine-containing neurons in the substrantia nigra. This brain section is therefore deprived of adequate amounts of the neurotransmitter dopamine (Foley, 2000; LeWitt and
Nyholm, 2004). Because dopamine is unable to access the brain directly,
L-3,4-dihydroxyphenylalanine (L-DOPA), its natural precursor, is used in clinical treatment of patients with PD. Until now, L-DOPA remains the most effective drug for the symptomatic control of PD (Dunnett and Bjorklund, 1999).
However, accumulated evidence shows that the therapeutic efficacy of L-DOPA is gradually lost over time, and abnormal involuntary movements, dyskinesias, gradually emerge as a prominent side effect of the previously beneficial doses of the drug (Carta et al., 2007; Cenci, 2007; Fabbrini et al., 2007).
216
The precise molecular mechanisms underlying the side effect or the neurotoxicity caused by L-DOPA are not yet completely known. Available data suggest that
L-DOPA might have the ability to significantly affect iron distribution in the brain. The changes in brain iron distribution induced by L-DOPA might be one of the causes of the side effect or neurotoxicity of L-DOPA. A clinical study
(Boll et al., 1999) demonstrated that L-DOPA could significantly affect brain ceruloplasmin (CP), a major factor in the regulation of regional brain iron, and that L-DOPA-treated PD patients had a significantly higher CP than those who were not given L-DOPA. A pathological study of postmortem brain tissue showed that the levels of iron storage protein ferritin were significantly lower in several brain regions of PD patients treated with L-DOPA than those in the age-matched control patients (Dexter et al., 1990). In a recent study, we demonstrated that L-DOPA induces a significant increase in the expression of
DMT1-IRE (DMT1 without iron-responsive element), but not DMT1+IRE
(DMT1 with ironresponsive element), TfR1 or Fpn1, and a remarkable increase in ferrous uptake in cells (Chang et al., 2006). Based on these findings, plus the potential role of DMT1-IRE in neuronal iron uptake and the implication of iron as a major generator of reactive oxygen species, we speculated that the
217 upregulation of DMT1-IRE might play a critical role in the development of
L-DOPA neurotoxicity. L-DOPA might have a role to increase DMT1-IRE expression, which in turn leads to a remarkable increase in DMT1-IRE-mediated ferrous iron uptake by neurons. Consequently, the increased ferrous iron in neurons generates highly reactive hydroxyl radicals via the Fenton reaction or
Haber-Weiss reaction. In turn, these free radicals can damage the biological molecules of neurons, leading to the development of L-DOPA neurotoxicity. To test this hypothesis, we investigated the effects of astrocyte-conditioned medium
(ACM) and Retrovirus DMT1-IRE on L-DOPA neurotoxicity by observing the changes in morphology and Hoechst 33342 staining, measuring neuronal viability, neuronal iron content, expression of DMT1-IRE, DMT1+IRE, TfR1 and Fpn1 proteins and ferrous iron uptake in cortical neurons in the present study.
Our results provide solid evidence that the upregulation of DMT1-IRE plays a key role in the development of L-DOPA neurotoxicity in vitro. The findings imply that inhibition of DMT1-IRE expression or neuronal iron uptake might be an effective approach to prevent or delay the development of L-DOPA neurotoxicity in PD patients.
218 8.1.2 Materials and methods
8.1.2.1 Materials
Unless otherwise stated, all chemicals were obtained from Sigma Chemical
Company, St. Louis, MO, USA. The scintillation cocktail and tubes were purchased from beckman Coulter Company, Fullerton, CA, USA and 55FeCl3 from Perkinelmer Company, Wellesley, MA, USA. The antibodies against
DMT1+IRE, DMT1-IRE and Fpn1 were purchased from Alpha Diagnostic
International Company, San Antonio, TX, USA and mouse anti-rat TfR1 monoclonal antibody was obtained from BD Transduction Laboratories, BD
Biosciences Pharmingen, USA. The specific antibodies against neuron microtubule-associated protein 2 (MAP2) and astrocyte glial fibrillary acadic protein (GFAP) were purchased from Chemicon International Ltd, UK and
Hoechst 33342 from Polysciences Inc., Warrington, PA, USA.
8.1.2.2 Primary cortical neurons
Primary cortical neurons were prepared from embryonic Day 18 (E18) rats as previously described (Ho et al., 2003) with minor modifications. The purity of these cultures was assessed by staining for the neuron specific antibodies against
MAP2 and the astrocyte marker GFAP.
219 8.1.2.3 Preparation of astrocytes culture medium
Primary astrocytes were prepared as previously described (Qian et al., 2000;
Qian et al., 1999). The purity of astrocyte cultures was determined using anti-GFAP antibody. More than 95% cells were GFAP immunoreactive in the culture. The medium was changed to DMEM/F12 supplemented with 2% newborn calf serum (NCS), collected 48 hours later (astrocyte conditioned medium, ACM), centrifuged at 3000 r/min for 15 min to remove cellular debris and then stored at -80 °C.
8.1.2.4 Experimental Design
To investigate the effects of L-DOPA on cortical neurons, the cells were treated with different concentrations of L-DOPA (0, 1, 5, 10, 100, 200 μM) in
DMEM+5%FBS for 16 hours and then morphological changes, neuronal viability, cell iron content, the expression of DMT1-IRE, DMT1+IRE, TfR1 and
Fpn1 proteins and NTBI (non-transferrin bound iron) uptake were determined.
To detect the effects of ACM on the neurotoxicity induced by L-DOPA, neurons were incubated with or without L-DOPA in DMEM+5%FBS or ACM for 16 hours and the relevant measurements were then conducted. To further confirm whether the increased expression of DMT1-IRE was involved in the
220 neurotoxicity induced by L-DOPA, neurons were pre-incubated with rDMT1-IRE-Adenovirus for 24 hours before treatment with different concentrations of L-DOPA for 16 hours and then the relevant measurements were performed.
8.1.2.5 Morphological observation
Morphological changes of the neurons were observed under phase contrast microscopy or fluorescence microscopy.
8.1.2.6 Determination of cell viability
The cell viability was determined using an MTT assay as described previously
(Li et al., 2008b). Briefly, a total of 5 mg/ml MTT was added to each well in the final concentration of 1 mg/ml and another 4 hours of incubation at 37ºC was conducted. The assay was stopped by the addition of a 100 l lysine buffer
(20% SDS in 50% N‟N-dimethylformamide, pH 4.7). Optical density (OD) was measured at 570 nm by the use of the ELX-800 microplate assay reader (Bio-tek,
USA).
221 8.1.2.7 Immunocytochemistry
Immunocytochemical experiments were performed using neuron specific mouse anti-MAP2, astrocyte specific anti-GFAP, rabbit anti-rat DMT1-IRE,
DMT1+IRE, TfR1 and rabbit anti-mouse Fpn1 antibodies respectively (Li et al.,
2008a). Cortical neurons in slides were incubated with one of the above antibodies: anti-MAP2 (1:200), anti-GFAP (1:200), anti-rat DMT1-IRE (1:500),
DMT1+IRE (1:500), TfR (1:200) and anti-mouse Fpn1 (1:500) for 24 hours, followed by FITC-labeled goat antimouse IgG (1:200), or Rhodamine-labeled goat anti-rabbit IgG (1:200) (Invitrogen, USA) as the secondary antibody.
Fluorescent images were captured by using a Nikon Eclipse TE2000-U microscope (Nikon, UK) equipped with T-FL Epi-FI attachment and a SPOT cooled CCD camera (Diagnostic Instruments, INC, US). SPOT software version
4.6 was used for image acquisition (Diagnostic Instruments, INC, US).
8.1.2.8 Hoechst 33342 staining
Hoechst 33342 staining was used to detect morphological features of apoptotic cell death. Cortical neurons pre-treated with or without different concentrations of L-DOPA were stained with Hoechst 33342. The cells were then examined under a fluorescent microscope. Undamaged cell nuclei were large and diffusely
222 stained whereas apoptotic nuclei showed chromatin that was condensed and fragmented.
8.1.2.9 Iron measurement
The slides were fixed with 4% paraformalin for 10 min. After three washes with
PBS, slides were incubated in Perl’s solution containing 4% potassiumferrocanide and an equal volume of 1.2 mmol/L hydrochloride acid solutions for 16 hours at 4°C and then washed with deionized water 3 times, followed by dehydration through 95% alcohol and mounting with xylene. Iron staining was observed under a Nikon Eclipse TE2000-U microscope (Nikon,
UK). The total iron in the neurons was also determined using a graphite furnace atomic absorption spectrophotometer (GFAAS, Perkin Elmer, Analyst 100) as previously described (Chang et al., 2005; Ke et al., 2005).
8.1.2.10 Western blot analysis
Neurons that received different treatments were washed with ice-cold PBS, homogenized with lysis buffer and then subjected to sonication using Soniprep
150 (MSE Scientific Instruments, London, UK). After centrifugation at 10,000g for 15 min at 4°C, the supernatant was collected, and protein content was
223 determined using the Bradford assay kit (Bio-Rad). Aliquots of the cell extract containing 30 μg of protein were diluted in 2 μl sample buffer (50 mM Tris, pH
6.8, 2% SDS, 10% glycerol, 0.1% bromphenol blue, and 5% β-mercaptoethanol) and heated for 5 min at 95°C before SDS-PAGE on 10% gel and subsequently transferred to a pure nitrocellulose membrane. After the transfer, the membrane was blocked with 5% blocking reagent in Tris-buffered saline containing 0.1%
Tween-20 overnight at 4°C. The membrane was rinsed in three changes of
Tris-buffered saline/Tween-20, incubated in fresh washing buffer once for 15 min and twice for 5 min, and then incubated overnight at 4°C with primary antibodies: rabbit anti-rat DMT1+IRE, DMT1-IRE polyclonal antibodies, rabbit anti-mouse
Fpn1 polyclonal antibody (1:5000); mouse anti-rat TfR1 monoclonal antibody
(1:1000). After three washes, the blots were incubated with goat anti-rabbit or anti-mouse IRDye 800 CW secondary antibody (1:5000, Li-Cor) for 1 hour at room temperature. The intensity of the specific bands was detected and analyzed by Odyssey infrared imagine system (Li-Cor). To ensure even loading of the samples, the same membrane was probed with rabbit anti-rat β-actin polyclonal antibody at a 1:2000 dilution.
224 8.1.2.11 Construction of DMT1-IRE siRNA expression retrovirus pSUPER.retro vector (OligoEngine, USA) is used for expression of siRNA targeting on hepcidin. The target sites for siRNA are designed by using an oligoEngine tool. The selected sequences are submitted to a BLAST search to avoid targeting to the other human genome. Two 19-nucleotide sequences corresponding to nucleotides 148–166 and 190-208 of hepcidin are selected to generate the pSUPER-hepcidin vectors. A control vector (pSUPER-Control) is constructed using a 19-nucleotide sequence (gcgcgctttgtaggattcg) with no significant homology to any mammalian gene sequence and therefore serves as a non-silencing control (OligoEngine, USA). These sequences are inserted into the pSUPER.retro vector after digestion with BglII and HindIII and are transformed into BL21-A1 One ShotTM supercompetent cells (Invitrogen, USA). Several clones are obtained, and the vectors are amplified. Retroviruses expressing hepcidin siRNA are produced by transfecting pSUPER-hepcidin vectors into amphotropic Phoenix packaging cell line according to the manufacturer's instructions. The obtained retrovirus is used to in vitro infection of cells or in vivo injection of cerebroventricules.
225 8.1.2.12 Measurement of non-transferrin bound iron uptake
The radio-labelled 55Fe(II) (NTBI) solution was prepared and the Fe(II) uptake was measured as described previously (Qian and Morgan, 1992). The incubation medium was 0.27 M sucrose with 4 mM pipes, pH 6.5. Following pre-treatment with different concentrations of L-DOPA, the cells were washed with cold PBS and then incubated with or without 55Fe(II) for various periods of time. After being lysed, the cells were scraped off and transferred into Eppendorf tubes. A
50 l aliquot was subjected to the detection of protein concentration. The cytosol was separated from the stromal fraction (outer cell membrane plus intracellular organells such as endosomes and mitochondria) by centrifugation at 10,000 g for
20 min at 4oC using a Jouan centrifuge (DJB labcare Ltd., England). Scintillation solution (3 ml) was added to count the cpm. The total iron uptake was the sum of the cytosol and stromal fractions.
8.1.2.13 Statistical analysis
Statistical analyses were performed using SPSS software for Windows (version
10.0). Data were presented as mean ± SEM. The difference between the means was determined by One-Way ANOVA followed by a Student-Newman-Keuls test for multiple comparisons. A probability value of P < 0.05 was taken to be
226 statistically significant.
8.1.3 Results
8.1.3.1 Neurotoxicity induced by L-DOPA: morphological evidence and
significantly decreased neuronal viability
Figure 8-1
The purity of cultured cortical neurons.
A. Bright view of cultured cells.
B. Immunocytochemical staining of cortical neurons for anti-MAP2 antibody.
The percentage of cortical neurons in cultures reached 99.6%. Arrows indicate that MAP2-positive immunostained neurons but no GFAP-positive immunostained cells were found. .
227 Figure 8-1 showed typical morphological features of cortical neurons immunostained with MAP2 but no GFAP-positive immunostained cells. The percentage of cortical neurons in the population reached 99.6%.
Figure 8-2
L–DOPA induced morphological changes in cortical neurons.
228 Neurons were treated with L-DOPA (0, 1, 5, 10, 100, 200 μM) in
DMEM+5%FBS (A) or astrocyte-conditioned medium (ACM) (B) for 16 hours and then morphological changes were observed as described in Materials and
Methods.
(MAP2)
Figure 8-3
Immunocytochemistry of MAP2 in cortical neurons treated with or without
L-DOPA. Neurons were exposed to L-DOPA (0, 1, 5, 10, 100, 200 μM) in
DMEM+5%FBS for 16 hours and then immunostained for MAP-2 antibody as described in Materials and Methods.
229 Figure 8-2 A presented the morphological observations in neurons treated with
L-DOPA (0, 1, 5, 10, 100 or 200 μM) in DMEM+5%FBS for 16 hours. As compared to the controls (Figure 8-2B), neurons pre-treated with L-DOPA displayed a dose-dependent morphological change. It was characterized by a progressive increase in the number o f irregular cell bodies with disrupted and shrunken neuronal processes with the increase of concentrations of L-DOPA in the medium. Pretreatment with 200 μM of L-DOPA induced a significant reduction in or disappearance of the neuronal number or processes. The observations under phase contrast microscopy corresponded to the findings of immunostaining of cortical neurons for MAP2 (Figure 8-3).
230
Figure 8-4
Hoechst 33342 staining in cortical neurons treated with or without L-DOPA.
Neurons were exposed to 0, 1, 5, 10, 100 or 200 μM of L-DOPA in
DMEM+5%FBS (A) or 0 or 200 μM of LDOPA in astrocyte-conditioned medium (ACM) (B) for 16 hours and then Hoechst 33342 staining was
231 performed. The nuclei with fluorescing intensely, shrunken in size and irregular in shape are indicated as arrow.
Hoechst 33342 staining (Figure 8-4A) displayed a gradual increase in the number of condensed or fragment nuclei (apoptosis)in cortical cells with the increase of concentrations of L-DOPA. The number of condense nuclei was the highest in the neurons pretreated with 200 μM of L-DOPA.
Figure 8-5
Effects of L-DOPA on neuronal viability. Neurons were treated with 0, 1, 5, 10,
100 or 200 μM of L-DOPA in DMEM+5%FBS for 16 hours. The neuronal viability was then determined using an MTT assay. Data are the mean±SEM
232 (percentage of control) of three independent experiments performed in triplicate.
*P<0.01, **P<0.001 vs. the control (0 μM).
The neuronal viability was determined using an MTT assay. As shown in Figure
8-5, treatment of neurons with L-DOPA in DMEM+5%FBS for 16 hours led to a progressive decrease in the cell viability with the increase of concentrations of
L-DOPA. A significantly decrease in viability was found in the neurons treated with 10, 100 or 200 μM of L-DOPA. They were only 63%, 52% and 44% of the controls (P < 0.05 or 0.01) respectively.
233 8.1.3.2 L-DOPA induces a significant increase in iron content in cortical
neurons
Perl’s iron staining and GFAAS measurement
234
Figure 8-6
Effects of L-DOPA on neuronal iron. Neurons were exposed to L-DOPA (0, 1, 5,
10, 100, 200 μM) in DMEM+5%FBS (A) or astrocyte-conditioned medium
(ACM) (B) for 16 hours and then iron staining was conducted. Total iron was also measured using a GFAAS method in the neurons treated with or without different oncentrations of L-DOPA in the presence or absence of ACM (C). Data are the mean±SEM (percentage of control) of three independent experiments performed in triplicate. *P<0.05, **P<0.01 vs. the control (0 μM); # < 0.01 vs.
200 M of L-DOPA.
235 Figure 8-6A presented the data on iron stain in neurons that were treated with different concentrations of L-DOPA in DMEM+5%FBS for 16 hours. The control neurons had large cell bodies and more elaborate processes with a tiny amount of iron located primarily in the cell bodies. No changes in iron distribution and morphology were found in neurons pre-treated with 1 μM of
L-DOPA. In the neurons treated with 5 μM of L-DOPA, iron content in the cell body appeared to have increased but the body shape and body size remained the same. A significant increase in iron density and positive iron staining in the processes was observed in the neurons treated with 10, 100 or 200 μM of
L-DOPA. The iron accumulation was most pronounced in neurons pre-treated with 200 μM of L-DOPA, which appeared dystrophic with large and irregularly-shaped cell bodies attaching to densely beaded processes and the iron filling the cell body and processes completely. The measurement of total iron provided quantitative evidence for the ability of L-DOPA to induce a significant increase in neuronal iron contents. The total iron was significantly higher in neurons pretreated with 5, 10, 100 or 200 μM of L-DOPA than in the controls
(Figure 8-6C)
236 8.1.3.3 L-DOPA induces a significant increase in DMT1-IRE expression and
ferrous iron uptake in cortical neurons
Figure 8-7
237 Effects of L-DOPA on the expression of DMT1-IRE and DMT1+IRE proteins in cortical neurons. Neurons were treated with L-DOPA (0, 1, 5, 10, 100, 200 μM) in DMEM+5%FBS for 16 hours and the expression of proteins was determined using Western blot analysis. A, representative Western blots of DMT1-IRE and
-actin. B, the relative values of DMT1-IRE protein expression. C, representative
Western blots of DMT1+IRE and β-actin. D, the relative values of DMT1+IRE protein expression. Data are means±SEM (percentage of control) of four independent experiments. There are no significant differences in the levels of
DMT1+IRE protein between neurons treated with or and without L-DOPA. * P <
0.05, ** P < 0.01 vs. the control.
238
Figure 8-8
Immmocytochemistry of DMT1-IRE and DMT1+IRE proteins in cortical neurons. Cells were treated with L-DOPA (0, 1, 5, 10, 100, 200 μM) in
DMEM+5%FBS for 16 hours and then immunostained for DMT1-IRE (A) or
DMT1+IRE (B) antibodies. No significant changes were observed in the
239 expression of DMT1+IRE.
Figure 8-9
Effects of L-DOPA on the expression of Fpn1 and TfR1 proteins in cortical
240 neurons. Nneurons were treated with L-DOPA (0, 1, 5, 10, 100, 200 μM) in
DMEM+5%FBS for 16 hours and Western blot analysis was then conducted. A, representative Western blots of Fpn1 and -actin. B, the relative values of Fpn1 protein expression. C, representative Western blots of TfR1 and β-actin. D, the relative values of TfR1 protein expression. Data are means±SEM (percentage of control) of four independent experiments. L-DOPA treatment induced a dose-dependent decrease in TfR. There are no significant differences in the levels of Fpn1 protein between neurons treated with and without L-DOPA. * P < 0.05,
** P < 0.01 vs. the control.
241
Figure 8-10
Immmocytochemistry of Fpn1 and TfR1 in cortical cells. Neurons were treated with L-DOPA (0, 1, 5, 10, 100, 200 μM) in DMEM+5%FBS for 16 hours and
242 then immunostained for Fpn1 (A) or TfR1 (B) antibodies. L-DOPA treatment induced a dose-dependent decrease in TfR1 expression, but no significant changes were observed in the expression of Fpn1 protein.
Treatment of cortical neurons with L-DOPA did not induce any changes in the expression of DMT1+IRE (Figures 8-7C, D and Figure 8-8B) and Fpn1 (Figures
8-9A,B and Figure 8-10A). This implies that the increased iron contents in the neurons pre-treated with L-DOPA is associated neither with DMT1+IRE nor the decreased Fpn1-mediated iron release from the cells. Western blot analysis also demonstrated that treatment with L-DOPA induces a dose-dependent decrease in
TfR (Figures 8-9C,D and Figure 8-10B), rather than an increase as we expected.
This shows that TfR1 is not involved in the increased neuronal iron contents induced by L-DOPA. However, L-DOPA treatment induced a significant and dose-dependent increase in the expression of DMT1-IRE (Figure 8-7A,B). The levels of DMT1-IRE in the neurons pre-treated with 5, 10, 100 or 200 μM of
L-DOPA were significantly higher than those in the controls (P < 0.05 or 0.01).
The results from immunostaining of DMT1 also indicated that L-DOPA has a significant ability to increase the expression of DMT1-IRE rather than
DMT1+IRE in cortical neurons (Figure 8-8A). As shown in Figure 8-8A,
243 DMT1-IRE was dominantly distributed in the cell membrane and processes, while DMT1+IRE was located in the whole cell body and process in the control neurons (Figure 8-8B). However, the distribution of DMT1-IRE spread from the cell membrane to the cell body in neurons upon the exposure to 100 and 200 μM of L-DOPA (Figure8-8A). The strongest fluorescent intensity was found in the whole cell body of the cortical neurons pre-treated with 200 μM of L-DOPA.
8.1.3.4 L-DOPA induces a significant increase in ferrous iron uptake by
cortical neurons
Based on the above findings, we hypothesized that the increased DMT1-IRE expression might induce an increase in DMT1-IRE-mediated ferrous iron uptake by neurons. This might be one of the reasons for the L-DOPA-induced increase in neuronal iron contents. Therefore, we then examined effects of L-DOPA on ferrous iron uptake in neurons.
244
Figure 8-11
Effects of L-DOPA on 55Fe(II) uptake by cortical cells. Neurons were treated with L-DOPA (0, 1, 5, 10, 100, 200 μM) in DMEM+5%FBS for 16 hours and then incubated with 2 M of 55Fe(II) in 0.27M sucrose (pH 6.5) at 37oC for 30 min. The 55Fe(II) taken into neurons was then measured. Data were presented as mean±SEM of 6 independent experiments performed in triplicate. *P <0.05, **P
<0.01 vs. the control.
As shown in Figure 8-11, treatment with L-DOPA induced a significant and dose-dependent increase in the 55Fe uptake by neurons. The 55Fe uptake was significantly higher in the neurons pre-treated with 5, 10, 100 or 200 μM of
245 L-DOPA than those in the controls (P < 0.05 or 0.01). Correlation analysis of the relationship between the expression of DMT1-IRE protein and the 55Fe uptake in the neurons was conducted by plotting the values for these two indicators against one another. A highly significant correlation was found in the cells pre-treated with different concentrations of L-DOPA (Y=0.924x + 11.603,
R2 = 0.974, P < 0.001). The relationship between the expression of DMT1-IRE protein and neuronal viability was also determined by the same analysis. A highly significant correlation was also found in the cells pre-treated with different concentrations of L-DOPA (Y= -0.7165x + 178.28, R2 = 0.853, P <
0.01).
8.1.3.5 ACM diminishes L-DOPA-induced neurotoxicity
Treatment with L-DOPA did not induce any significant changes in neuronal morphology when the incubation medium DMEM+5%FBS was replaced by
ACM. No significant differences in cell morphology were found among the neurons treated with or without different concentrations of L-DOPA
(Figure8-2B). Consistent with this observation, Hoechst 33342 staining demonstrated that cell nuclei remained unchanged in neurons that were incubated with 200 μM of L-DOPA in ACM (Figure 8-4B).
246
Figure 8-12
Effects of ACM on L-DOPA-induced neurotoxicity. Neurons were incubated with 0, 10, 100 or 200 μM of L-DOPA in DMEM +5%FBS medium (ACM 0) or astrocyte-conditioned medium (ACM 1) or 1/2, 1/5 or 1/10 of ACM in
DMEM+5%FBS medium for 16 hours. The neuronal viability was then determined using an MTT assay. Data are the mean±SEM (percentage of control) of three independent experiments performed in triplicate. *P<0.01, **P<0.001,
***P<0.0001 vs. the corresponding controls.
247 No significant differences in Hoechst 33342 staining were found between the neurons treated with or without 200 μM of L-DOPA in ACM. Furthermore, cell viabilities in the neurons that were incubated with 10, 100 or 200 μM of L-DOPA in ACM were significantly higher than those in the neurons incubated with same concentrations of L-DOPA in DMEM+5%FBS medium (Figure 8-12). The changes in percentage of ACM in the mixed medium (DMEM+5%FBS and
ACM) showed a significant effect on neuronal viability, the higher the percentage of ACM in the medium, the higher the neuronal viability (Figure
8-12). These findings demonstrated that ACM plays a significant role in protecting cortical neurons from L-DOPA toxicity.
8.1.3.6 ACM reduces neuron iron content and DMT1-IRE expression
As we expected, no significant changes in neuron iron contents were observed when neurons were incubated in ACM with L-DOPA (0, 1, 5, 10, 100 or 200 μM) for 16 hours (Figures 8-6B,C). Also, there were no significant differences in expression of DMT1-IRE (Figures 8-13A,B) and other iron transport proteins including DMT1+IRE (Figures 8-13C,D), Fpn1 (Figures 8-13E,F) and TfR1
(Figures 8-13G,H) among the neurons treated with 0, 100 or 200 μM of L-DOPA in ACM. The data imply that ACM has a role to inhibit the increased expression
248 of DMT1-IRE induced by L-DOPA in cortical neurons. The significant role of
ACM in protecting cortical neurons from L-DOPA toxicity is “DMT1-IRE and iron”-mediated.
249
Figure 8-13
Effects of astrocyte-conditioned medium on the expression of DMT1-IRE,
DMT1+IRE, Fpn1 and TfR1 proteins in cortical neurons treated with L-DOPA.
250 Neurons were treated with L-DOPA (0, 100 or 200 μM) in ACM for 16 hours and Western blot analysis was then conducted. A,representative Western blots of
DMT1-IRE and β-actin. B, the relative values of DMT1-IRE protein expression.
C, representative Western blots of DMT1+IRE and β-actin. D, the relative values of DMT1+IRE protein expression. E, representative Western blots of Fpn1 and
-actin. F, the relative values of Fpn1 protein expression. G, representative
Western blots of TfR1 and β-actin. H, the relative values of TfR1 protein expression. Data are means±SEM (percentage of control) of four independent experiments. There are no significant differences in the levels of all four proteins we investigated between the neurons treated with or without L-DOPA.
251 8.1.3.7 Decreased expression of DMT1-IRE induced by Retrovirus
DMT1-IRE reduces L-DOPA neurotoxicity
Figure 8-14
Effects of Retrovirus DMT1-IRE on DMT1-IRE expression and
L-DOPA-induced neurontoxicity in cortical neurons. A and B: Neurons were pre-incubated with
252 Retrovirus DMT1-IRE for 24 hours and Western blots analysis were then performed (A: representative Western blots of DMT1-IRE and β-actin, and B: the relative values of DMT1-IRE protein in neurons infected with or without
Retrovirus DMT1-IRE). Data are means±SEM (percentage of control) of four independent experiments performed in triplicate. **P < 0.01 vs. the control. C:
Neurons were pre-incubated with Retrovirus DMT1-IRE for 24 hours and then treated with different concentrations of L-DOPA (0, 1, 5, 10, 100, 200 μM) in
DMEM+5%FBS medium fro 16 hours. The neuronal viability was then determined using an MTT assay. Data are the mean±SEM (percentage of control) of four independent experiments performed in triplicate. *P<0.05, ***P<0.001 vs. the corresponding controls.
We then investigated the effects of Retrovirus DMT1-IRE on DMT1-IRE expression and L-DOPA-induced neurontoxicity in cortical neurons. Incubation of neurons with Retrovirus DMT1IRE for 24 hours induced a significant decrease in the expression of DMT1-IRE protein level in the infected neurons
(Figure 8-14A and B). When neurons were pre-incubated with Retrovirus
DMT1-IRE for 24 hours and then treated with different concentrations of
L-DOPA for 16 hours, it was found that the viabilities of the neurons infected
253 with Retrovirus DMT1-IRE were significantly higher than those of the control neurons at 10, 100 and 200 μg of L-DOPA (p < 0.05, 0.01 or 0.01) (Figure 8-14
C). The findings demonstrated that the decreased expression of DMT1-IRE induced by Retrovirus DMT1-IRE can reduce L-DOPA neurotoxicity.
8.1.4 Discussion
The exact etiology of the side effect or the neurotoxicity induced by L-DOPA is unknown although there is evidence that abnormal pulsatile stimulation of dopamine receptors may be contributory (Olanow et al., 2006; Zesiewicz et al.,
2007). Based on our recent findings (Chang et al., 2006), together with the potential role of DMT1-IRE in neuronal iron uptake (Chang et al., 2006; Touret et al., 2003) and the well-known function of iron in the generation of reactive oxygen species, we hypothesized that the upregulation of DMT1-IRE might play a critical role in the development of L-DOPA neurotoxicity. In the present study, efforts were devoted to test this hypothesis. Based on several lines of solid evidence obtained from this study, we concluded that the L-DOPA-induced neurotoxicity is mediated by the upregulation of DMT1-IRE expression in cortical neurons. The first evidence comes from the investigation on the effects of L-DOPA on cortical neurons. Our data clearly demonstrated that treatment of
254 neurons with different concentrations of L-DOPA induces not only a significant change in morphology or Hoechst-33342 staining but also a dose-dependent decrease in neuronal viability, confirming that L-DOPA can induce neurotoxicity in our experimental conditions. Meanwhile, the treatment also resulted in a significant dose-dependent increase in iron content, ferrous iron uptake and
DMT1-IRE protein expression in cortical neurons. Furthermore, correlation analysis showed that the expression of DMT1-IRE protein is significantly correlated with 55Fe uptake (positively) and neuronal viability (negatively) in cortical neurons treated with different concentrations of L-DOPA; respectively.
These findings support a role of L-DOPA in the increased DMT1-IRE expression as well as in the connection of the increased DMT1-IRE with the increased neuron iron content. In addition, both western blot and immunocytochemistry analysis showed that L-DOPA didn't induce any changes in the expression of
DMT1+IRE and Fpn1. A significant decrease in TfR1 expression, rather than an increase, was found in the neurons treated with L-DOPA. These results showed that the increase in neuronal iron content induced by L-DOPA is due to neither the decrease in Fpn1-mediated iron efflux nor the increase in DMT1+IRE or
TfR1mediated iron uptake. On the other hand, these results also provided further support that L-DOPA has a role to increase DMT1-IRE expression and that the
255 increased iron content in neurons induced by L-DOPA results from the increased
DMT1-IRE-mediated iron uptake.
The second evidence is obtained from the study on the effects of ACM on
L-DOPA-induced neurotoxicity. It has been reported that astrocytes have a role in the reduction of neuronal cell death following a variety of cellular stresses, such as excitotoxicity and oxidative stress (Dhandapani et al., 2003; Dringen et al., 2000; Tanaka et al., 1999). Also, it has been demonstrated that glia conditioned medium (GCM) protects fetal rat midbrain neurones in culture from
L-DOPA toxicity (Mena et al., 1996). We speculated that the neuroprotective role of GCM or ACM might be mediated by its ability to inhibit DMT1-IRE expression as well as iron accumulation in neurons. Therefore, we investigated the effects of ACM on morphology, Hoechst 33342 staining, viability, neuron iron content and DMT1-IRE expression in the neurons treated with L-DOPA by incubating neurons in ACM with or without different concentrations of L-DOPA for 16 hours. The results obtained on the morphology, Hoechst 33342 staining and neuronal viability clearly demonstrated that ACM significantly diminishes
L-DOPA-induced neurotoxicity. No significant differences were found in morphology, Hoechst-33342 staining and viability between the neurons
256 incubated in ACM in the presence and those incubated in ACM in the absence of the same concentrations of L-DOPA. At the same time, Western blot analysis and iron staining showed that ACM significantly reduces DMT1-IRE expression as well as neuron iron content. The similar tendencies of the effects of ACM on
L-DOPA-induced neurotoxicity, DMT1-IRE expression and neuron iron content implied that ACM protects neurons from L-DOPA by its ability to inhibit
DMT1-IRE expression and ferrous iron uptake.
The final piece of evidence is provided by the data on the effects of Retrovirus
DMT1-IRE on L-DOPA neurotoxicity. According to the findings on DMT1-IRE,
L-DOPA neurotoxicity and the role of ACM, we expected that a decrease in
DMT1-IRE expression should also be able to lead to a decrease in L-DOPA neurotoxicity. Therefore, we infected the cortical neurons with Retrovirus
DMT1-IRE to decrease DMT1-IRE expression to see whether L-DOPA neurotoxicity was hence changed in these neurons. As we expected, western blot analysis revealed a significant decrease in expression of DMT1-IRE protein as well as iron content in the neurons infected with Retrovirus DMT1-IRE. The
MTT assay demonstrated that the viabilities were significantly higher in the neurons infected with Retrovirus DMT1-IRE than those in control neurons at all
257 concentration points of L-DOPA we examined. The findings showed that decreased expression of DMT1-IRE induced by Retrovirus DMT1-IRE can decrease neuronal iron accumulation and also L-DOPA neurotoxicity. These further confirmed that DMT1-IRE upregulation and the increased DMT1-IRE mediated iron influx play a key role in the development of L-DOPA neurotoxicity in primary neurons. DMT1 (DCT1 or NRAMP2), a widely expressed membrane protein (Gunshin et al., 1997; Kuehl et al., 2001), is responsible for the uptake of a broad range of divalent metal ions (Gunshin et al.,
1997; Tandy et al., 2000). There are four DMT1 isoforms that differ in their
N-and C-termini arise from mRNA transcripts that vary both at their 5'-ends
(starting in exon 1A or exon 1B) and at their 3'-ends giving rise to mRNAs containing (+) or lacking (-) the 3'IRE [30]. The existence of DMT1 in the brain has been well determined. The functions of DMT1+IRE and DMT1-IRE have not been completely understood. However, available data support the notion that
DMT1-IRE, rather than DMT1+IRE, is the entity responsible for the transmembrane transport of the iron released from transferrin to the early endosomal lumen. Recent studies also inferred that DMT1-IRE is predominantly found in three compartments: the plasma membrane, early/recycling endosomes, and the endoplasmic reticulum. In the present study, we found that treatment of
258 neurons with different concentrations of L-DOPA also resulted in a significantly dose-dependent increase in iron content, ferrous iron uptake and the expression of DMT1-IRE protein in cortical neurons. It was also found that there is a significant correlational relationship between the expression of DMT1-IRE protein and 55Fe uptake (positively) in cortical neurons treated with different concentrations of L-DOPA. These findings provide further support to the notion that DMT1-IRE, rather than DMT1+IRE, is the entity responsible for iron transmembrane transport as well as the role of DMT1-IRE upregulation in
L-DOPA neurotoxicity.
In summary, in the present study we provided solid evidence for the first time for the association of DMT1-IRE with neurotoxicity induced by L-DOPA. We concluded that upregulation of DMT1-IRE and then the increased DMT1-IRE mediated iron influx play a critical role in L-DOPA neurotoxicity in primary cortical neurons. We also demonstrated for the first time that ACM's protection of cortical neurons from L-DOPA is at least partly due to its ability to inhibit
DMT1-IRE expression and ferrous iron uptake. The neurotoxicity induced by
L-DOPA, once established, is difficult to treat and therefore efforts should be made to prevent it. Based on our findings, we therefore propose that inhibition of
259 DMT1-IRE expression or neuronal iron uptake might be an effective approach to prevent or delay the development of neurotoxicity induced by L-DOPA in PD patients.
260 8.2 PART2 The regulating effect of hepcidin to related iron metabolism
genes in the neurons
8.2.1 Introduction
Nicolas et al.(Nicolas et al., 2001) proposed that hepcidin interacts with receptors on the crypt cells of the duodenum and dictates the amount of iron absorbed by these cells once they have matured and migrated to the villus. However, in all situations studied thus far, hepcidin expression shows a close inverse correlation with iron absorption. This is equally true in the case of a rapid stimulus (e.g., the acute phase response) or a delayed stimulus (e.g., enhanced erythropoiesis) for iron absorption (Nicolas et al., 2002b).
Hepcidin presumably acts by inhibiting the expression or activity of one or more of iron transporters on cell membrane. An inverse correlation was found between hepcidin expression and the expression of duodenal iron transporters and iron absorption in rats (Frazer et al., 2002). During the switch from high to low iron diet in rats, iron absorption increased, accompanied by a rise in duodenal expression of ferric reductase (Dcytb) and duodenal iron transporters, DMT1 and
FPN1. These changes correlated with decreases in hepatic hepcidin expression
261 and transferrin saturation. At no time was a 2 to 3-day lag period evident between the decreased hepcidin expression and the increased expression of iron transporters, suggesting that hepcidin acts directly on mature villus enterocytes instead of crypt cells, which may take 2–3 days to mature and migrate to the villus. Frazer et al (Frazer et al., 2004) investigated the delay in the iron absorptive response following stimulated erythropoiesis by using phenylhydrazine induced haemolysis. They found that this delayed increase in iron absorption following stimulated erythropoiesis was attributable to a lag in the hepcidin response rather than the crypt programming. This was consistent with a direct effect of the hepcidin pathway on the mature villus enterocytes expression of iron transport molecules which is altered simultaneously in all mature enterocytes, and not progressively as newly differentiated cells emerge from the crypts.
A recent study has indicated that hepcidin inhibits cellular iron export through binding directly to the iron exporter ferroportin and inducing its internalization and degradation in HEK-293 cells (Nemeth et al., 2004b). Serial deletion of the
N-terminal amino acids of intact hepcidin causes a progressive loss of bioactivity of the peptide with almost complete loss when all five N-residues are deleted
262 (Nemeth E, 2006). Human urine contains two predominant hepcidin forms, comprised of 20 and 25 amino acids each, which differ only by N-terminal truncation (Hunter et al., 2002). The N-terminal peptides alone do not internalize ferroportin, nor modified hepcidin molecules when the C-terminus is deleted or the disulphide pattern is altered by replacing pairs of cysteines with alanines(Nemeth et al., 2006). These data indicate that the N-terminus within the intact molecules is responsible for the hepcidin activity of the peptide with respect to ferroportin internalization and degradation.
This hepcidin-ferroportin mechanism is sufficient to explain the regulation of iron absorption, because absorptive enterocytes only perform their function for 2 days before being shed from the tips of the villi into the intestinal lumen.
Therefore, the transport of iron by ferroportin across the basolateral membrane determines whether the iron is delivered to plasma transferring or removed from the body with the shed enterocytes. When iron stores are adequate or high, the liver produces hepcidin, which circulates to the small intestine. There, hepcidin causes ferroportin to be internalized, blocking the sole pathway for the transfer of iron from enterocytes to plasma. When iron stores are low, hepcidin production is suppressed, ferroportin molecules are displayed on basolateral membranes of
263 enterocytes, and there they transport iron from the enterocyte cytoplasm to plasma transferrin. Similarly, the hepcidin-ferroportin interaction also explains how macrophage recycling of iron is regulated and accounts for the characteristic finding of iron-containing macrophages in inflammatory states characterized by a high production of hepcidin. In the presence of hepcidin, ferroportin is internalized, iron export is blocked, and iron is trapped within macrophages.
A pharmacodynamic study of the effects of radio-labelled hepcidin injection in mice showed that a single 50 μg dose resulted in an 80% drop in serum iron within 1 h which did not return to normal until 96 h (Rivera et al., 2005b). This time course is consistent with the blockage of recycled iron from macrophages and previous reports of the rapid hepcidin response to IL-6 administration
(Nemeth et al., 2004a). The rapid disappearance of plasma iron was followed by a delayed recovery, possibly due to the slow resynthesis of membrane FPN.
Tissue concentrations revealed that hepcidin preferentially accumulates in the proximal duodenum and spleen, reflecting the high expression of FPN in these areas.
Laftah et al reported that direct injection of synthetic hepcidin peptide into mice
264 inhibited iron uptake in isolated duodenal segments (Laftah et al., 2004). In contrast to the conclusions of other investigators, these authors suggested that hepcidin predominantly acted to diminish iron transport across the apical membrane, with little or no effect on basolateral iron transfer. New data presented demonstrate that hepcidin specifically decreases iron uptake across the
apical surface of the CaCO2 epithelial layer, which is consistent with previous findings(Laftah et al., 2004). At the molecular level these changes in iron transport are explained by a reduction in DMT1(McKie et al.) transporter expression following hepcidin treatment.
This part focuses on two aspects: iron uptake of neurons and iron release of neurons. As discussed in Chapter 1, iron is essential for normal neurological functioning because of its role in oxidative metabolism and its being a cofactor in the synthesis of neurotransmitters and myelin. However, there is not yet any in-depth study on iron metabolism in the nervous system. We hope to clear several questions, the first is whether hepcidin can affect the neuron in iron metabolism; the second is what function FPN has in neuron iron metabolism; the third is What is the relation between DMT1 and hepcidin. In this study, three parts of the experiment were used to explore these questions. The cells used were
265 from the whole-brain neurons of SD rat. The first part measured the changes of proteins of FPN and DMT1 with (without) IRE after rAd-hepcidin and retro-hepcidin. The second part was Fe55 uptake experiments. The final one was
Fe55 release experiments. The same cell batches were used in this three-part test to ensure the reliability of the experimental data.
8.2.2 Materials and Methods
8.2.2.1 Materials
Unless otherwise stated, all chemicals were obtained from Sigma Chemical
Company, St. Louis, MO, USA. The scintillation cocktail and tubes were purchased from beckman Coulter Company, Fullerton, CA, USA and 55FeCl3 from Perkinelmer Company, Wellesley, MA, USA. The antibodies against
DMT1+IRE, DMT1-IRE and FPN were purchased from Alpha Diagnostic
International Company, San Antonio, TX, USA.
8.2.2.2 Optimism Concentration and PH value of Fe55 loading in neurons
Isotope experiment is a precise and rigorous experiment. In order to get the best results, experimental conditions including the two main aspects, the optical PH and the optical concentration of iron, have to be optimized.
266 8.2.2.2.1 Effects of different concentrations of iron in Fe55 uptake
1×106 H9C2 cells each well were planted into a 6-well plate one day before isotope experiment. The purpose was to ensure a higher activity of cells during the experiment. Exuberant vitality of cells was more conducive to our experiment.
On the experiment day, a series of concentration gradient of Fe55 isotope solutions, including 0.1μM/ml, 0.5μM/ml, 1μM/ml, 2.5μM/ml, 5μM/ml and
10μM/ml, were established. For Isotope solution preparation, please refer to
Chapter 2. The six groups’ samples were placed in a shaker and shaken very gently for 30 min at 37 ℃。They were then taken from the shaker and immediately placed on ice to terminate the reaction. Electric motors were used as soon as possible to remove supernatant and then 3ml ice-cooling PBS was added into each well. After standing 3 minutes, PBS was removed, and the step was repeated 5 times. The purpose was to clean the isotope as much as possible in order to reduce the experiment background. 200μl lysis buffer was added into each well to crack cells. The lysis solution of cells was spinned at 10000g 4℃ .
10μl was kept to measure the concentration of protein, and the rest of the supernatant was collected into a tube and then 3ml scintillation liquid was added.
These collection tubes were shaken violently for 15 minutes at room temperature, and then put them into Beckman coulter. The CPM value of each sample was
267 measured.
The computing formula was as follows:
Uptake value=CPM/protein Con. *volume (CPM/μg)
8.2.2.2.2 Effects of different PHs in Fe55 uptake
The preparation of cells was the same as in the preceding section. A series of PH gradient of Fe55 isotope solution from 1 to 10 was set up. They were labeled the first to the tenth groups, each with six samples. All of the experimental operations and processes have been described in detail in the “effects of different concentrations in Fe 55 uptake” section.
8.2.2.3 Preparing neurons with high hepcidin expression
Plant around 1×106 primary culture neurons per well in 6-well plates 3 days before experiment. For the methods of primary culture please refer to Chapter 2.
On the day of experiment, observe the status of neurons, choose the neurons in good condition and throw away cells that do not meet requirements. The selection criteria involve several aspects, namely neuron adhesion, purity and
268 quantity. Remove old medium and cover cells layer in 0.5 ml fresh medium. Add
Ad-hepcidin into wells according to the experimental design. Put them into an
incubator at 37 Celsius degrades, 5% CO2. Change into fresh medium 6 hours later and keep the temperature at 37 Celsius degrade for another 6 hours. This step is to allow sufficient time for hepcidin expression. As this time, the neurons can be used for experiments.
8.2.2.4 Real-time PCR and western blot
Please refer to Chapter 2.
8.2.2.5 Isotope experiments
8.2.2.5.1 Fe55 uptake experiments
Cell treatment and groupings are discribed in Section 5.1.2. The samples were taken out and the medium removed at different time points. The cell layer was washed once with ice-cooling PBS. 1ml isotope solution was added into each well. The samples were then put into a shaker at 37 ℃ for 30min. They were then taken out from the shaker, and immediately placed on ice to terminate the reaction. Electric motors were used as soon as possible to remove supernatant and then 3ml ice-cooling PBS was added into each well. After cold-PBS washing
269 3 times, 200μl lysis buffer was added into each well to crack cells. The lysis solution of cells was spinned at 10000g 4℃. 10μl lysis solution was kept to measure the concentration of protein, and the rest of the supernatant was collected into a tube and then added 10-fold volume of scintillation liquid. Shake these tubes violently for 15 minutes at room temperature, and then put them into
Beckman coulter. For protein concentration measurement, please refer to Chapter
2 “Methodology”; for the computing formula of uptake value, please see Section
5.1.1.1. The statistics method is t-test.
8.2.2.5.2 Fe55 release experiments
First, loading iron experiment had to be carried out. High hepcidin expression neurons were taken out, Fe55 isotope solution was added to the medium to the final concentration of 5uM and shaken very gently for 30 min at 37 ℃ . The samples were then taken out from the shaker, and immediately placed on ice to terminate the reaction. Electric motors were used as soon as possible to remove medium and then 3ml ice-cooling PBS was added into each well to wash cells, repeat this step for 5 times. The purpose is to clean the isotope as much as possible in order to reduce interference of the experiment background.
270 The neurons were put into an incubator at 37 ℃ for 6 hours in 1ml fresh medium.
All medium were carefully pipetted into isotope measuring tubes. The neuron layer was washed with cold PBS 3 times. The neurons were lyzed with 100ul lysis buffer, and then the lysis solution of neurons was spinned for 10min at
10000g 4℃. The supernatant was carefully transferred into isotope measuring tubes. The precipitant was re-suspended with 100ul lysis buffer, transferred into isotope measuring tubes and then added with 10-fold volume of scintillation liquid. It was then shaken violently for 15 minutes at room temperature, and then put into Beckman coulter. Preservation procedure was carried out and the CPM value of each sample was measured.
The computing formula:
Total Loading iron= CPM of medium+ CPM supernatant +CPM precipitant
Release value=CPM of medium/ Total Loading iron
271 8.2.3 Results
8.2.3.1 The optimism Concentration of Fe55 loading
Figure 8-15
The optimal Fe55 concentration of iron loading
6 concentration points, 0.1uM, 0.5 uM, 1uM, 2.5uM, 5uM, 10uM, were set.
From 0.1uM to 5uM is the rising period of the curve. From 5uM to 10uM is the platform period of the curve. In this research, the concentration of 5μM was set as the optimum concentration of iron loading experiments in neurons.
272 8.2.3.2 The optimism PH values of Fe55 loading
Figure 8-16
The optimal PH of iron loading in neurons
We set a series of PH values for iron loading experiments in neurons. We have established 12 different pH values altogether, consider optimum PH most likely to fall on the middle region, and we has increased the alternate density between 5 and 8. The concentration gradients involve 2, 3, 4, 5, 5.5, 6, 6.5, 7, 7.5, 8, 9 and
10. The result is a wave curve; the peak appears in at PH6.5. In this study, the value of PH6.5 was set as the optimum PH of Fe55 uptake in neurons.
273 8.2.3.3 Photos of neurons with high hepcidin expression
Figure 8-17
The photos of neurons with high hepcidin expression
The photos were taken 6 hours and 12 hours after Ad-hepcidin treatment respectively. A is at 6 hours and B is at 12 hours. As mentioned above, the neurons which infected by Ad-hepcidin for 12 hours were chosen as experimental cells to allow sufficient time for hepcidin expression. From the pictures we can see that the 6 hours of fluorescent relatively bleak, 12 hours of fluorescent noticeably strengthened. This also means that hepcidin expressions are synchronized.
274 8.2.3.4 Real-time PCR of hepcidin
Figure 8-18
Real-time PCR of hepcidin expression in neurons after rAd-hepc
Hepcidin mRNA of different virus volumes (0μl, 0.1μl, 0.5μl, 1μl, 1.5μl, 2μl) was measured at the 12-hour time point. Hepcidin rose continuously. The quantity of 12 hours increases by 8 times than the quantity of control group. This meant the adenovirus worked well, and the expression amount of hepcidin could meet demands of experiments. Expression values were normalized for β-actin and the data were presented as mean ± SEM (n =3).*P<0.05, **P<0.01 versus the control Group (0μl).
275
Figure 8-19
Real-time PCR of hepcidin expression in neurons after Retro-hepc
Figure 8-19 reveals that effect of retro-hepc on expression of hepcidin in neurons.
The neurons were treated by recombinant hepcidin retrovirus (retro-hepc) in 48 hours. After treatment of retro-hepc, the mRNA was extracted from these neurons and detected the expression of hepcidin by real-time PCR. The result suggests that retro-hepc reduce the expression of hepcidin effectively. Expression values were normalized for β-actin and the data were presented as mean ± SEM
(n =3).*P<0.05, versus the control Group (0 μl).
276 8.2.3.5 Results of regulation effects of hepcidin to related proteins
As an iron metabolism hormone, some important iron related genes are regulated by expression of hepcidin in peripheral tissues, for example, intestine, live and so on. In this part, our results reveal that hepcidin also influence the expression of some iron related genes, such as FPN1, and DMT1, which suggest the effect of hepcidin in brain is similar as peripheral tissues.
8.2.3.5.1 Hepcidin regulates FPN expression in cortical neurons
8.2.3.5.1.1 Western-blot results of FPN after rAd-hepc treatment
A
277
B
Figure 8-20
Western-blot results of FPN at 6 hours
The results were FPN expression level of 6 hours after Ad-hepcidin treatment.
The experiments were repeated at least 3 times. A is an electrophoresis graph, and B is an analysis chart of optical density. In A, 6 concentration gradients of ad-hepcidin were used to treat neurons. The picture above is the lanes of FPN around 60kD; the one below is β-actin around 45kD. In B, the X-axis is the virus volume, and the Y-axis is the rate of FPN versus β-actin. Student t-test analysis showed no significant change in FPN. P value was greater than 0.05 (n=6).
Therefore, we believe that hepcidin can not enough affect FPN expression at 6 hours.
278
A
B
Figure 8-21
Western-blot results of FPN at 12 hours
The results were FPN expression at 12 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis
279 graph, and B is an analysis chart of optical density. The same as the 6-hour treatment group, 6 concentration gradients of ad-hepcidin was used to treat neurons with high hepcidin expression. The picture above is the lanes of FPN around 60kD; the one below is β-actin around 45kD.
The FPN changes in B were obvious. It was very obvious that 0.5 μl virus could reduce the expression of FPN. More importantly, this effect was correlated with the virus quantity. From this, we believe the down regulation of FPN expression has contacts with expression of hepcidin. T-test was used in the data analysis,
*P<0.05, **P<0.01 versus the control group (0 μl virus).
280
A
B
Figure 8-22
Western-blot results of FPN at 24hours
The results were FPN expression at 24 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis
281 graph, and B is an analysis chart of optical density. Like in the 6-hour treatment, we use 6 concentration gradients of ad-hepcidin to treat neurons with high hepcidin expression. The picture above is the lanes of FPN around 60kD; the one below picture is β-actin around 45kD.
FPN change after treatment of 24 hours was more obvious than that of 12 hours.
The values also showed the trend was more obvious than 12 hours treatment.
Certainly, the relationship between FPN changes and ad-hepcidin volumes was even close. This further verified our supposition. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0μl virus).
282 8.2.3.5.1.2 Western-blot results of FPN after retro-hepc treatment
Figure 8-23
The expected molecular weight of FPN1 was ~60 kDa and β-actin ~ 45 kDa bands appearing on each gel. Expression values were normalized for β-actin and and expressed as a fraction. The data were presented as means ± SEM of 3 separate experiments. T-test was used in the data analysis, *P<0.05 (n=3), versus
283 the control group. The effect of hepcidin has been discussed in section 8.2.1 in detail. High expression hepcidin in neurons can decrease expression of FPN1 and
DMT1 with or without IRE. The data please refer to Figure 8-12. Retro-hepc effectively silenced expression of hepcidin through degradation of mRNA of hepcidin. FPN1 and DMT1 were thrown off this restraint of hepcidin regulation, so the expression amount accelerated. Their mechanism was the most important part of future works.
284 8.2.3.5.2 Hepcidin regulates DMT1 without IRE (DMT1-IRE) expression
in cortical neurons
8.2.3.5.2.1 Western-blot results of DMT1-IRE protein after rAd-hepc
treatment
A
B
Figure 8-24
Western-blot results of DMT1 -IRE at 6 hours
285 The results were DMT1-IRE expression at 6 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis graph, and B is an analysis chart of optical density. Also 6 concentration gradients ad-hepcidin were used to treat neurons. The picture above is the lanes of DMT1-IRE around 57kD; the one below is β-actin around 45kD. From B we can see that unlike FPN, DMT1 already declined prominently within 6 hours.
T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group
(0 μl virus).
286
A
B
Figure 8-25
Western-blot results of DMT1 -IRE at 12 hours
The results were DMT1-IRE expression level after Ad-hepcidin treatment 12 hours.The experiments were repeated at least 3 times. A is an electrophoresis
287 graph, and B is an analysis chart of optical density. Like in the 6-hour treatment, we use 6 concentration gradients of ad-hepcidin to treat neurons with high hepcidin expression. The picture above is the lanes of DMT1-IRE around 57kD; the one below is β-actin around 45kD.
There are obvious dosage dependences in DMT1-IRE down regulation with ad-hepcidin. The downward trends were obviously stronger than that of 6 hours too. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0 μl virus).
288
A
B
Figure 8-26
Western-blot results of DMT1 -IRE at 24 hours
The results were DMT1-IRE expression at 24 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis graph, and B is an analysis chart of optical density. Like that of the 6-hour treatment, we used 6 concentration gradients of ad-hepcidin to treat neurons with
289 high hepcidin expression. The picture above is the lanes of DMT1-IRE around
57kD; the one below is β-actin around 45kD. There are obvious dosage dependences in DMT1-IRE down regulation with ad-hepcidin. The downward trends are obviously stronger than 12 hours too. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0 μl virus).
Figure 8-27
Western-blot results of DMT1-IRE protein after retro-hepc treatment
The expected molecular weight of DMT1 (-IRE) was ~57 kDa and β-actin ~ 45
290 kDa bands appearing on each gel. Expression values were normalized for β-actin and and expressed as a fraction. The data were presented as means ± SEM of 3 separate experiments. T-test was used in the data analysis, *P<0.05 (n=3), versus the control group.
291 8.2.3.5.3 Hepcidin regulates DMT1 with IRE (DMT1+IRE) expression in
cortical neurons
8.2.3.5.3.1 Western-blot results of DMT1+IRE protein after rAd-hepc
treatment
A
B
Figure 8-28
Western-blot results of DMT1 +IRE at 6 hours
The results were DMT1-IRE expression at 6 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis
292 graph, and B is an analysis chart of optical density. We used 6 concentration gradients of ad-hepcidin to treat neurons with high hepcidin expression. The picture above is the lanes of DMT1-IRE around 57kD; the one below is β-actin around 45kD. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0 μl virus).
A
B
Figure 8-29
Western-blot results of DMT1 +IRE at 12 hours
293 The results were DMT1-IRE expression at 12 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis graph, and B is an analysis chart of optical density. We used 6 concentration gradients of ad-hepcidin to treat neurons with high hepcidin expression. The picture above is the lanes of DMT1-IRE around 57kD; the one below is β-actin around 45kD. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0 μl virus).
294
A
B
Figure 8-30
Western-blot results of DMT1 +IRE at 24hours
The results were DMT1-IRE expression at 24 hours time point after Ad-hepcidin treatment. The experiments were repeated at least 3 times. A is an electrophoresis graph, and B is an analysis chart of optical density. We used 6 concentration
295 gradients of ad-hepcidin to treat neurons with high hepcidin expression. The picture above is the lanes of DMT1-IRE around 57kD; the one below is β-actin around 45kD. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0 μl virus).
From figure 8-28 to figure 8-30 show DMT1+IRE changes within 24 hours. We find the expression of DMT1+IRE was weaker than that of DMT1-IRE in this experiment. Even so, changes in the whole course of DMT1+IRE could be measured. DMT1+IRE began to reduce at the 12th hour, and more prominent after 24 hours. This may be correlated with its localization and function in cells.
This question will be discussed in detail.
296 8.2.3.5.3.2 Western-blot results of DMT1+IRE protein after retro-hepc
treatment
Figure 8-31
The expected molecular weight of DMT1 (+IRE) was ~57 kDa and β-actin ~ 45 kDa bands appearing on each gel. Expression values were normalized for β-actin
297 and and expressed as a fraction. The data were presented as means ± SEM of 3 separate experiments. T-test was used in the data analysis, *P<0.05 (n=3), versus the control group.
298 8.2.3.6 Uptake of Fe55 in neurons
A
B
Figure 8-32
Effect of rAd-hepc in Fe55 uptake in neurons
299 We measured the condition that the iron absorbs at 3 different time points separately with 6 different ad-hepcidin concentrations. Two different charts were made to facilitate comparison and discussion. A shows change in Fe55 uptake at the same time at different Ad-hepcidin concentrations. This experiment’s purpose is to observe time correlation. B shows changes in Fe55 uptake at different time points at the same Ad-hepcidin concentration. This experiment’s purpose is to observe their dosage correlation.
In Figure 8-32 A, this curve for 6 hours is a gently curve. Statistical analysis shows that there were no obvious differences at different concentration in 6-hour treatment. The inhibitory activity of iron uptake appeared after 12 hours, and was more obvious in 24 hours. In our experiment, the minimum effective concentration was 0.5 μl, which were 1.5×109 virus particles. T-test was used in the data analysis, *P<0.05, **P<0.01 versus the control group (0μl virus).
300
Figure 8-33
Effect of retro-hepc in Fe55 uptake in neurons
0 The neurons were treated 48-hour by retro-hepcidin in 37 C, 5% CO2, and then the quantity of Fe55 uptake was measured through general methodology has been mentioned in Chapter 2. The results showed that retro-hepcidin increase ability of Fe55 uptake comparing to Control group. In this experiment, 200 μl recombinant retrovirus solutions (1×108CFU/ml) per 1×106 neuron cells were added in 1ml medium with 4μg polyberen. T-test was used in the data analysis,
*P<0.05, **P<0.01 n=5 versus the control group (0μl virus).
301 8.2.3.7 Release of Fe55 in neurons
A
B
Figure 8-34
302 Fe55 release in neurons after rAd-hepc treatment
We measure the condition that the irons release at 3 different time points separately at 6 different rAd-hepcidin concentrations. Two different charts were made to facilitate comparison and discussion. In figure 8-33 A, shows changes in
Fe55 release at the same time point at different Ad-hepcidin concentrations.
Figure 8-33 B shows changes in Fe55 release at different time points at the same concentration of Ad-hepcidin.
From the results of figure 8-33 B, we can see the watershed of the iron release is appeared at 12 hours. In A, we only observed the correlation between inhibition effects and Ad-hepcidin concentration on the curve of 24 hours. In other time curves, the change is not obvious. T-test was used in the data analysis, *P<0.05, versus the control group (0μl virus).
303
Figure 8-35
Fe55 release in neurons after retro-hepc treatment
0 The neurons were treated 48-hour by retro-hepcidin in 37 C, 5% CO2, and then the quantity of Fe55 release was measured through general methodology has been mentioned in Chapter 2. Compare to the Control group, the iron release of retro-hepc group is more obvious after 48 hours treatment. In this experiment,
200 μl recombinant retrovirus solutions (1×108CFU/ml) per 1×106 neuron cells were added in 1ml medium with 4μg polyberen. T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
304 8.2.4 Discussion
In the Chapters, we carried out experiments on the optimum pH and optimum concentration of isotope. Though the cell types were different, the optimum condition of iron uptake was basically identical. Under the condition of PH6.5 and 5μM iron, their uptake reached the peak. This phenomenon could be explained by the characteristic of DMT1. Gunshin (Gunshin et al., 1997), who observed that DMT1 also transported protons with a stoichiometry of one proton per divalent cation, postulated that the proton gradient associated with the mildly acidic pH of proximal duodenum was the driving force for metal uptake.
Similarly, Fleming (Fleming et al., 1998) pointed out that a proton gradient could provide a driving force for iron exit from endosomes. Therefore, DMT1 also needs protons to provide the driving force in the intake of NTBI. Some other related researches suggest that DMT1 is a proton symporter active only in specific low-pH environment (Andrews, 2002, 2005; Hentze et al., 2004;
Richardson, 2005). This range is between pH 6.0 and pH6.5. In our experiments,
PH 6.5 was used.
Our results suggest that hepcidin has an important role in iron related genes regulation. From the results we can see that the iron release and iron uptake are
305 all reduced when hepcidin expression is elevated by rAd-hepc in neurons. On the contrary, iron release and uptake are increased when hepcidin is silenced after retro-hepc treatment. Hepcidin as an iron metabolism regulating hormones may be have multi-interaction models. Hepcidin is responsible for the precise control of iron intake and output and for reaching a dynamic balance. In fact, are much literatures and experimental evidences to prove that hepcidin can play a role in two-way. We might as well call it “the balance mode”. (Figure 8-36)
Figure 8-36
The iron balance mode
There are many researches about hepcidin and FPN. It is basically believed that
FPN is an iron efflux transporter and a receptor of hepcidin (Abboud and Haile,
2000; Donovan et al., 2005; McKie et al., 2000). FPN is the only known iron
306 exporter in vertebrate. For details about FPN, please refer to Chapter 1. The latest research results reveal that there are 3 steps in the interaction between hepcidin and FPN (De Domenico et al., 2007). First, hepcidin binds with FPN. Second, there is the endocytosis of complex of hepcidin and FPN. Third, there are the ubiquitination of FPN and degradation. Phosphorylation is the most crucial among these steps. De Domenico found that mutant human FPN that is not internalized or internalized slowly shows either an absent or impaired phosphorylation(De Domenico et al., 2007). Our results also reveal some relationship between FPN and hepcidin. The response of FPN content to the treatment with rAd-hepc and retro-hepc were parallel to that of the amount of iron release from the cells. This suggested that the decreased iron release is a result of the decreased content of FPN induced by hepcidin. Also, when expression of hepcidin is inhibited, the iron release increase in neurons. Based on current knowledge on the mechanisms involved in the hepcidin-mediated inhibition on Fpn1 and iron release, it is possible that the inhibiting role of hepcidin on iron release in the neurons might also be initiated by a direct binding of this peptide with FPN. After binding with hepcidin, FPN is then internalized and degraded, leading to a decreased iron export from the neurons as found in macrophages.
307
Our data show that hepcidin not only regulates the release of iron, but also the absorption the iron at the same time. To our knowledge, Hepcidin can directly control iron release through interacting with FPN. Our results also support the conclusion in neurons. But it is unknown that the relationship between hepcidin and DMT1 and the interaction model of hepcidin on iron uptake in neurons. In our experiment, the regulation effect of hepcidin to DMT1 is observed through
Fe55 isotope research and western blot results. The beginning of iron uptake reducing is observed at 12 hours of incubating of the neurons with rAd-hepc, and the expression of DMT1 -IRE began to be changed at the 6-hour time point. This means DMT1 expression is take place before the change of iron metabolism. In other words, our results suggest DMT1 expression lead to iron metabolism change directly. Laftah and Yamaji (Laftah et al., 2004; Yamaji et al., 2004) pointed out that in polarized Caco-2 cells and mice, hepcidin firstly decreased expression of DMT1, which in turn decreased iron uptake and therefore the overall iron absorption. Activation of hepcidin expression reduced plasma iron levels within 6 hours in a transgenic mouse model (Viatte et al., 2006). There was a quicker response time after parenteral administration of recombinant hepcidin-25 to mice (Rivera et al., 2005). We think the different response time
308 presents the time required to activate transcription, translation and post-translational modifications of the peptide and its secretion before an effect is produced. This important information prompts us to speculate that changes of
DMT1 are not a secondary effect of iron uptake inhibition. It also means that the decline of DMT1 leads to an iron uptake decrease. The relation of DMT1 and iron uptake is also proved in retro-hepc experiments. After treatment of retro-hepc, DMT1 expression of the neurons is elevated within 48 hours and lead to Fe55 uptake increase.
According to our data and analysis, we propose a tentative idea for mechanism of interaction between hepcidin and DMT1. Hepcidin maybe first activate some certain intracellular protein factors to degrade DMT1 peptide through a signal pathway. These factors should be some protein kinases or phosphatases. This is a kind of rapid responses that rapidly reduce DMT1 expression. Second, hepcidin can transmit inhibitory signal into nucleus through a signal transmitting pathway and further inhibit the expression of DMT1. This response is a kind of slow response which continues to regulate DMT1 expression until the removal of the inhibitory factors (Figure 8-37).
309
Figure 8-37
The interaction of hepcidin and DMT1
The white arrows are the rapidly regulating pathway. Hepcidin activates some protein factors and degrades DMT1 in cytoplasm and cell membrane. Iron levels decrease subsequently. The pink arrows are the slowly regulating pathway.
Hepcidin transfers the inhibition signs into nucleus and inhibits the transcription of DMT1 mRNA. The effects lead to a decline of the quantity of DMT1 protein.
310 8.3 PART3 Other functional experiments of recombinant adenovirus and
retrovirus
8.3.1 Introduction
In this research, we have constructed several recombinant adenoviruses and retroviruses, including rAd-FPN, rAd-DMT1 (-), rAd-DMT1 (+), rAd-TfR, rAd-heph, rAd-Hepc, retro-FPN, retro-DMT1, retro-TfR, retro-heph and retro-hepc. The retrovirus of DMT1 has been applied for L-dopa research in section 8.2, and the function of rAd-hepc and retro-hepc have been investigated in neurons about their regulation effects in section 8.3. In this part, the rest of virus products will be applied in H9C2, and C6 cell lines to identify their functions.
8.3.2 Materials and Methods
8.3.2.1 Materials
Unless otherwise stated, all chemicals were obtained from Sigma Chemical
Company, St. Louis, MO, USA. The scintillation cocktail and tubes were purchased from beckman Coulter Company, Fullerton, CA, USA and 55FeCl3 from Perkinelmer Company, Wellesley, MA, USA.
311 8.3.2.2 Methods
The methodologies of isotope experiment have been described in the section
8.2.2. The other methods please refer to the chapter 2.
8.3.3 Results
8.3.3.1 The effect of rAd-DMT1 (-IRE and +IRE) in iron uptake
A
312
B
Figure 8-38
2μl purified recombinant adenoviruses treated experiment group (H9C2, 1×106), and PBS treated control group (H9C2, 1×106) for 24 hours, 37 0C. A was results of Fe55 uptake of H9C2 after Ad-DMT1 (-IRE) treatment. DMT1 (-IRE) expressed highly in cells and promoted absorption of iron. After 24 hours treatment, the experiment group compared with control group, the CPM values increased significantly. In B, Ad-DMT1 (+IRE) also enhanced the iron uptake in
H9C2 after 24 hours treatment. T-test was used in the data analysis, *P<0.05
(n=3), versus the control group.
313 8.3.3.2 The effect of retro-DMT1 in iron uptake
Figure 8-39
0 The H9C2 were treated 48-hour by retro-DMT1 in 37 C, 5% CO2, and then the quantity of Fe55 uptake was measured through general methodology has been mentioned in Chapter 2. The figure 8-39 showed that iron uptake is declined obviously. In this experiment, 200μl recombinant retrovirus solutions
(1x108CFU/ml) per 1×106 cells were added in 1ml medium with 4μg polyberen.
T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
314 8.3.3.3 The effect of rAd-FPN1 in iron release
Figure 8-40
FPN1 was the only has been known protein that can export iron from cells.
Ad-FPN1 can increase expression of FPN1 in cells. In this experiment, 2μl purified recombinant adenoviruses-FPN1 treated experiment group (H9C2,
1×106), and PBS treated control group (H9C2, 1×106) for 24 hours, 37 0C. The procedure of Fe55 release experiment please refers to 2.6.3 section. The results revealed that experiment group could release more iron than control group. T-test was used in the data analysis, *P<0.05 (n=3), versus the control group.
315 8.3.3.4 The effect of retro-FPN1 in iron release
Figure 8-41
0 The H9C2 were treated 48-hour by retro-FPN in 37 C, 5% CO2, and then the quantity of Fe55 release was measured through general methodology has been mentioned in Chapter 2. The figure 8-41 showed that the retro-FPN group inhibits the release of iron at the 48-hour time point. In this experiment, 200 μl recombinant retrovirus solutions (1x108CFU/ml) per 1x106 cells were added in
1ml medium with 4μg polyberen. T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
316 8.3.3.5 The effect of rAd-TfR1 in iron uptake
The method of iron uptake of TfR1 is different from bivalence iron. TfR1 dependent pathway is the most important route of iron absorption. Before
TfR-mediated endocytosis, iron need to be oxidized to Fe3+ form and bind to transferrin at first. So, the necessary step of TfR1 uptake experiment is radioactive iron solution of preparation. The compounding and steps have been mentioned in Chapter 2 (Please refer to 2.6.2).
Figure 8-42
5×106 C6 cells were prepared for iron TfR1-mediated uptake before the day of experiment. 5μl rAd-TfR1 was added in 1 ml cell culture medium to infect these
317 0 55 cells in 37 C, 5% CO2 for 24 hours. We measured the CPM values of Fe according to general iron uptake methodology which has been described in
Chapter 2. The data reveal that rAd-TfR1 group intake more transferrin binding iron compared with control group. T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
8.3.3.6 The effect of retro-TfR1 in iron uptake
Figure 8-43
5×106 C6 cells were prepared for iron TfR1-mediated uptake before the day of experiment. 200μl retro-TfR1 was added in 1 ml cell culture medium with 4μg
0 polyberen to infect these cells in 37 C, 5% CO2 for 48 hours. We measured the
318 CPM values of Fe55 according to general iron uptake methodology which has been described in Chapter 2. The data reveal that iron uptake is depressed after
TfR1 gene expression inhibited. T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
8.3.3.7 The effect of Ad-heph in iron release
Figure 8-44
2×106 C6 cells were prepared before the day of experiment. 50μl rAd-heph recombinant solution was added in 1 ml cell culture medium to infect these cells
0 55 in 37 C, 5% CO2 for 24 hours. We measured the CPM values of Fe according
319 to general iron release methodology which has been described in Chapter 2. The data reveal that iron release is increased after hephaestin gene expression enhanced by rAd-heph. T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
8.3.3.8 The effect of retro-heph in iron release
Figure 8-45
5×106 C6 cells were prepared for iron release experiment before the day of experiment. 200μl retro-heph (1×109 CFU/ml) was added in 1 ml cell culture
0 medium with 4μg polyberen to infect these cells in 37 C, 5% CO2 for 48 hours.
We measured the CPM values of Fe55 according to general iron release
320 methodology which has been described in Chapter 2. The data reveal that iron release is in respond to hephaestin expression depressed. T-test was used in the data analysis, *P<0.05, n=5 versus the control group (0μl virus).
8.3.4 Discussion
In this part, we use some cell lines to indentify the function of several virus products. Our results show that these virus products can regulate the iron uptake or release as expected. FPN1, DMT1, TfR1 and Heph are all important iron related genes in brain iron metabolism. In my research, the focus is development of recombinant virus tools and identification of their functions. Because of time limited, the further functional research doesn’t continue to finish off. But from these preliminary data, some clues suggest us to discover the related function of above virus products in brain iron metabolism. Most of us would accept that the views of the important role about FPN1, DMT1 and TfR1 in brain iron metabolism as similar as the role of peripheral tissues. But opinions vary as to function and expression of hephaestin in brain. In 2007, our lab published a paper about “hephaestin in brain”(Qian et al., 2007). In this paper, we demonstrated for the first time that all the four regions of rat brain we examined, the cortex, hippocampus, striatum, and substantia nigra, have the ability to
321 express Heph mRNA and protein. Our findings also showed that both the development and iron status have a significant effect on Heph expression and that the trends in development and iron status-induced changes were similar between Heph mRNA and protein expression in all four regions, suggesting the existence of a development and iron status-dependent transcriptional regulation in these regions. In figure 8-42 and 43, we also found hephaestin can regulate the iron uptake and release in C6 cell lines. Although these data would not finally prove the effect of hephaestin in brain iron metabolism in vivo, the important suggestion can lead to the development of hephaestin research in brain in the future.
322 9 Chapter 9 General Discussion
Human iron metabolism is the set of chemical reactions maintaining human homeostasis of iron. Iron is an essential for most life on Earth, including human beings. Iron participate a series of cellular metabolic processes in the brain, for example, as tyrosine hydroxylase, cofactor for the enzymes. Also, iron is essential for the biosynthesis of CNS lipids and cholesterol, in oligodendroglia, iron plays an important role of action of metabolic enzymes as a co-factor. But excessive iron is damage to brain and lead to many of Neurodegenerative
Diseases. A common feature of some neurodegenerative diseases is excessive total brain iron existence and is thought that it is a cause of the generation of many of these diseases. Neuronal systems or some specific brain regions were found a significantly increased concentration of brain iron in some several neurodegenerative diseases. In iron metabolism, Divalent metal transporter 1
(DMT1), Transferrin receptors 1 (TfR1), Ferroportin1 (FPN1), Hephaestin
(Heph), hepcidin (Hepc) are important iron related protein and regulation peptide.
The goal of the research is to investigate the mechanism of brain iron metabolism and develop a new significant pathway of gene therapy to protect and cure neurodegeneration diseases in the future. The objectives of the thesis mainly embody in four aspects: the first is Construction and bioactivity test of iron
323 related genes recombinant adenovirus and retrovirus. The second is Application of retro-DMT1 in neurons and investigate the role of protection to neurons. The third is to investigate the regulation effect of hepcidin through Ad-hepc and
Retro-hepc treatment. The fourth is to Observe the function of Ad-FPN1,
Retro-FPN1, Ad-DMT1 (+), Ad-DMT1 (-), Retro-DMT1 in iron metabolism in vitro.
In order to detect the effects of these iron related genes in Neurodegenerative
Diseases, we constructed a series of recombinant adenoviruses and retroviruses, including rAd-DMT1 (+), rAd-DMT1 (-), rAd-FPN1, rAd-Heph, rAd-Hepc,
Retro-DMT1, Retro-FPN1, Retro-Heph, and Retro-Hepc through molecular biological technology. These recombinant virus products are all applied in primary culture neurons or some relevant cell lines. Our results proved that there are high biological expression activities of these recombinant adenoviruses and retroviruses in cells. In the procedures of recombinant adenoviruses and retroviruses construction, we summed up experiences to improve the quality and purity of viral products. From the Chapter 3 to Chapter 7, we described the methods of construction of all of related genes viral products which were mentioned in this thesis. Their biological activities and functional experiments
324 were performed and the data were showed in the Chapter 8. From our results we can see that neurons were completely infected after 24 hours by recombinant adenoviruses. Results of real-time PCR and Western blotting proved the target genes expression in neurons at protein and mRNA levels. Our results indicated mRNA of target genes increased 10 to 50 folds than control group after adenoviruses infection. This showed that the recombinant adenoviruses had launched our target gene expression in the neurons. Western blot results showed that the levels of protein expression increased significantly too. RNA interference is an important constitutes of my research and the tools of delivering
RNAi genes are recombinant retroviruses. Our result revealed that our retroviruses system had satisfactory gene silencing effects. To clarify the mechanism of brain iron metabolism, the retrovirus technique was to regulate the expression of iron related genes artificially combined with recombinant adenovirus at the same time.
Furthermore, we investigated the regulating effects of hepcidin, an iron regulatory peptide, in the neurons through rAd-hepc and retro-hepc. Our results suggested that hepcidin have the ability to regulate the expression of some iron related genes as an upstream regulatory factor, such as FPN1, DMT1 (+), DMT1
325 (-) etc. Our results suggest that hepcidin has an important role in iron related genes regulation. From the results we can see that the iron release and iron uptake are all reduced when hepcidin expression is elevated by rAd-hepc in neurons. On the contrary, iron release and uptake are increased when hepcidin is silenced after retro-hepc treatment. Hepcidin as an iron metabolism regulating hormones may be have multi-interaction models. Hepcidin is responsible for the precise control of iron intake and output and for reaching a dynamic balance.
And our data show that hepcidin not only regulates the release of iron, but also the absorption the iron at the same time. To our knowledge, Hepcidin can directly control iron release through interacting with FPN. Our results also support the conclusion in neurons. But it is unknown that the relationship between hepcidin and DMT1 and the interaction model of hepcidin on iron uptake in neurons. In this research, we thought that the mode of interaction of DMT1 and hepcidin is not only a direct degradation as relation of FPN1 and hepcidin but also a indirect complex signal pathway. But this conclusion needs to verify through further study.
In this study, we also provided solid evidence for the first time for the association of DMT1-IRE with neurotoxicity induced by L-DOPA. Because dopamine is
326 unable to access the brain directly, L-3, 4-dihydroxyphenylalanine (L-DOPA), its natural precursor, is used in clinical treatment of patients with PD. Until now,
L-DOPA remains the most effective drug for the symptomatic control of PD. In a recent study, we demonstrated that L-DOPA induces a significant increase in the expression of DMT1-IRE (DMT1 without iron-responsive element), but not
DMT1+IRE (DMT1 with ironresponsive element), TfR1 or Fpn1, and a remarkable increase in ferrous uptake in cells. Based on these findings, plus the potential role of DMT1-IRE in neuronal iron uptake and the implication of iron as a major generator of reactive oxygen species, we speculated that the upregulation of DMT1-IRE might play a critical role in the development of
L-DOPA neurotoxicity. We believe that inhibition of DMT1-IRE expression or neuronal iron uptake might be an effective approach to prevent or delay the development of neurotoxicity induced by L-DOPA in PD patients through retrovirus gene knockout system. We had three evidences to conclude the conclusion. The first evidence comes from the investigation on the effects of
L-DOPA on cortical neurons. The data clearly demonstrated that treatment of neurons with different concentrations of L-¬DOPA induces not only a significant change in morphology or Hoechst-33342 staining but also a dose-dependent decrease in neuronal viability, confirming that L-DOPA can induce neurotoxicity
327 in our experimental conditions. The second evidence is obtained from the study on the effects of ACM on L-DOPA-induced neurotoxicity. Through our data, we speculated that the neuroprotective role of GCM or ACM might be mediated by its ability to inhibit DMT1-IRE expression as well as iron accumulation in neurons. The effects of ACM on L-DOPA-induced neurotoxicity, DMT1-IRE expression and neuron iron content implied that ACM protects neurons from
L-DOPA by its ability to inhibit DMT1-IRE expression and ferrous iron uptake.
The final piece of evidence is provided by the data on the effects of Retrovirus
DMT1-IRE on L-DOPA neurotoxicity. We infected the cortical neurons with
Retrovirus DMT1-IRE to decrease DMT1-IRE expression to see whether
L-DOPA neurotoxicity was hence changed in these neurons. As we expected, western blot analysis revealed a significant decrease in expression of DMT1-IRE protein as well as iron content in the neurons infected with Retrovirus
DMT1-IRE. The MTT assay demonstrated that the viabilities were significantly higher in the neurons infected with Retrovirus DMT1-IRE than those in control neurons at all concentration points of L-DOPA we examined. These findings provide further supports to the notion that DMT1-IRE, rather than DMT1+IRE, is the entity responsible for iron transmembrane transport as well as the role of
DMT1-IRE upregulation in L-DOPA neurotoxicity.
328 In the future, we shall continue to deepen the related research works about all of virus products in vitro and in vivo. The first is the research of application of rAd-FPN, rAd-DMT1 (+/-), rAd-TfR1, rAd-Heph, rAd-HJV and a series of corresponding retrovirus in neurons from primary culture. After these in vitro experiments are finished off, we shall apply these purified virus solutions for animal experiments, including intraventricular injection and intravenous injection, in order to investigate the different effects about iron metabolism in Central
Neuron System and peripheral tissues. We believe effects of peripheral maybe influence the changes of content of brain iron. These works will be completed in the future. Another focus is improvement and purification of retrovirus knockout system. In this research, our retrovirus system can effectively silence the target genes expression, but there are still some aspects need to be improved in the future, for example, the infection efficiency and purification of retrovirus solution. Till now, the retrovirus concentrated solutions don’t meet the biological application standard. In the future, we will develop the technology of purification and improve the infective ability. Our recombinant adenovirus system is a kind of successful and mature technique, which will be an important research tool to discover the mechanism of iron metabolism combined with proteomics studies.
329 Reference
Abboud, S., and Haile, D.J. (2000). A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 275, 19906-19912.
Aisen, P., Wessling-Resnick, M., and Leibold, E.A. (1999). Iron metabolism.
Curr Opin Chem Biol 3, 200-206.
Aldred, A.R., Dickson, P.W., Marley, P.D., and Schreiber, G. (1987a).
Distribution of transferrin synthesis in brain and other tissues in the rat. J Biol
Chem 262, 5293-5297.
Aldred, A.R., Grimes, A., Schreiber, G., and Mercer, J.F. (1987b). Rat ceruloplasmin. Molecular cloning and gene expression in liver, choroid plexus, yolk sac, placenta, and testis. J Biol Chem 262, 2875-2878.
Andrews, N.C. (2000a). Iron homeostasis: insights from genetics and animal models. Nat Rev Genet 1, 208-217.
Andrews, N.C. (2000b). Iron metabolism: iron deficiency and iron overload.
Annu Rev Genomics Hum Genet 1, 75-98.
Andrews, N.C. (2002). Metal transporters and disease. Curr Opin Chem Biol 6,
181-186.
Andrews, N.C. (2005). Molecular control of iron metabolism. Best Pract Res
Clin Haematol 18, 159-169.
330 Attieh, Z.K., Mukhopadhyay, C.K., Seshadri, V., Tripoulas, N.A., and Fox, P.L.
(1999). Ceruloplasmin ferroxidase activity stimulates cellular iron uptake by a trivalent cation-specific transport mechanism. J Biol Chem 274, 1116-1123.
Ballay, A., Levrero, M., Buendia, M.A., Tiollais, P., and Perricaudet, M. (1985).
In vitro and in vivo synthesis of the hepatitis B virus surface antigen and of the receptor for polymerized human serum albumin from recombinant human adenoviruses. Embo J 4, 3861-3865.
Bartzokis, G., Cummings, J., Perlman, S., Hance, D.B., and Mintz, J. (1999a).
Increased basal ganglia iron levels in Huntington disease. Arch Neurol 56,
569-574.
Bartzokis, G., Cummings, J.L., Markham, C.H., Marmarelis, P.Z., Treciokas, L.J.,
Tishler, T.A., Marder, S.R., and Mintz, J. (1999b). MRI evaluation of brain iron in earlier- and later-onset Parkinson's disease and normal subjects. Magn Reson
Imaging 17, 213-222.
Bastin, J.M., Jones, M., O'Callaghan, C.A., Schimanski, L., Mason, D.Y., and
Townsend, A.R. (1998). Kupffer cell staining by an HFE-specific monoclonal antibody: implications for hereditary haemochromatosis. Br J Haematol 103,
931-941.
Beard, J.L. (2008). Why iron deficiency is important in infant development. J
331 Nutr 138, 2534-2536.
Becker, T.C., Noel, R.J., Coats, W.S., Gomez-Foix, A.M., Alam, T., Gerard, R.D., and Newgard, C.B. (1994). Use of recombinant adenovirus for metabolic engineering of mammalian cells. Methods Cell Biol 43 Pt A, 161-189.
Berg, D. (2006). In vivo detection of iron and neuromelanin by transcranial sonography - a new approach for early detection of substantia nigra damage. J
Neural Transm.
Berg, D., Hochstrasser, H., Schweitzer, K.J., and Riess, O. (2006). Disturbance of iron metabolism in Parkinson's disease -- ultrasonography as a biomarker.
Neurotox Res 9, 1-13.
Berkner, K.L. (1988). Development of adenovirus vectors for the expression of heterologous genes. Biotechniques 6, 616-629.
Beutler, E., Hoffbrand, A.V., and Cook, J.D. (2003). Iron deficiency and overload.
Hematology Am Soc Hematol Educ Program, 40-61.
Bidmon, H.J., Emde, B., Oermann, E., Kubitz, R., Witte, O.W., and Zilles, K.
(2001). Heme oxygenase-1 (HSP-32) and heme oxygenase-2 induction in neurons and glial cells of cerebral regions and its relation to iron accumulation after focal cortical photothrombosis. Exp Neurol 168, 1-22.
Bloch, B., Popovici, T., Chouham, S., Levin, M.J., Tuil, D., and Kahn, A. (1987).
332 Transferrin gene expression in choroid plexus of the adult rat brain. Brain Res
Bull 18, 573-576.
Boll, M.C., Sotelo, J., Otero, E., Alcaraz-Zubeldia, M., and Rios, C. (1999).
Reduced ferroxidase activity in the cerebrospinal fluid from patients with
Parkinson's disease. Neurosci Lett 265, 155-158.
Bowman, B.H., Jansen, L., Yang, F., Adrian, G.S., Zhao, M., Atherton, S.S.,
Buchanan, J.M., Greene, R., Walter, C., Herbert, D.C., et al. (1995). Discovery of a brain promoter from the human transferrin gene and its utilization for development of transgenic mice that express human apolipoprotein E alleles.
Proc Natl Acad Sci U S A 92, 12115-12119.
Bradbury, M.W. (1997). Transport of iron in the blood-brain-cerebrospinal fluid system. J Neurochem 69, 443-454.
Burdo, J.R., Martin, J., Menzies, S.L., Dolan, K.G., Romano, M.A., Fletcher, R.J.,
Garrick, M.D., Garrick, L.M., and Connor, J.R. (1999). Cellular distribution of iron in the brain of the Belgrade rat. Neuroscience 93, 1189-1196.
Calabrese, V., Scapagnini, G., Ravagna, A., Fariello, R.G., Giuffrida Stella, A.M., and Abraham, N.G. (2002). Regional distribution of heme oxygenase, HSP70, and glutathione in brain: relevance for endogenous oxidant/antioxidant balance and stress tolerance. J Neurosci Res 68, 65-75.
333 Campuzano, V., Montermini, L., Lutz, Y., Cova, L., Hindelang, C., Jiralerspong,
S., Trottier, Y., Kish, S.J., Faucheux, B., Trouillas, P., et al. (1997). Frataxin is reduced in Friedreich ataxia patients and is associated with mitochondrial membranes. Hum Mol Genet 6, 1771-1780.
Carta, M., Carlsson, T., Kirik, D., and Bjorklund, A. (2007). Dopamine released from 5-HT terminals is the cause of L-DOPA-induced dyskinesia in parkinsonian rats. Brain 130, 1819-1833.
Cenci, M.A. (2007). Dopamine dysregulation of movement control in
L-DOPA-induced dyskinesia. Trends Neurosci 30, 236-243.
Chang, Y.Z., Ke, Y., Du, J.R., Halpern, G.M., Ho, K.P., Zhu, L., Gu, X.S., Xu,
Y.J., Wang, Q., Li, L.Z., et al. (2006). Increased divalent metal transporter 1 expression might be associated with the neurotoxicity of L-DOPA. Mol
Pharmacol 69, 968-974.
Chang, Y.Z., Qian, Z.M., Wang, K., Zhu, L., Yang, X.D., Du, J.R., Jiang, L., Ho,
K.P., Wang, Q., and Ke, Y. (2005). Effects of development and iron status on ceruloplasmin expression in rat brain. J Cell Physiol 204, 623-631.
Chiueh, C.C. (2001). Iron overload, oxidative stress, and axonal dystrophy in brain disorders. Pediatr Neurol 25, 138-147.
Connor, J.R., and Menzies, S.L. (1996). Relationship of iron to oligodendrocytes
334 and myelination. Glia 17, 83-93.
Connor, J.R., Menzies, S.L., Burdo, J.R., and Boyer, P.J. (2001). Iron and iron management proteins in neurobiology. Pediatr Neurol 25, 118-129.
Connor, J.R., Pavlick, G., Karli, D., Menzies, S.L., and Palmer, C. (1995). A histochemical study of iron-positive cells in the developing rat brain. J Comp
Neurol 355, 111-123.
Connor, J.R., Snyder, B.S., Beard, J.L., Fine, R.E., and Mufson, E.J. (1992).
Regional distribution of iron and iron-regulatory proteins in the brain in aging and Alzheimer's disease. J Neurosci Res 31, 327-335.
Conrad, M.E., Umbreit, J.N., and Moore, E.G. (1993). Regulation of iron absorption: proteins involved in duodenal mucosal uptake and transport. J Am
Coll Nutr 12, 720-728.
Crowe, A., and Morgan, E.H. (1992). Iron and transferrin uptake by brain and cerebrospinal fluid in the rat. Brain Res 592, 8-16.
D'Sa, C.M., Arthur, R.E., Jr., States, J.C., and Kuhn, D.M. (1996). Tryptophan hydroxylase: cloning and expression of the rat brain enzyme in mammalian cells.
J Neurochem 67, 900-906.
Dallman, P.R., Beutler, E., and Finch, C.A. (1978). Effects of iron deficiency exclusive of anaemia. Br J Haematol 40, 179-184.
335 De Domenico, I., Ward, D.M., Langelier, C., Vaughn, M.B., Nemeth, E.,
Sundquist, W.I., Ganz, T., Musci, G., and Kaplan, J. (2007). The molecular mechanism of hepcidin-mediated ferroportin down-regulation. Mol Biol Cell 18,
2569-2578.
De Domenico, I., Ward, D.M., Musci, G., and Kaplan, J. (2006). Iron overload due to mutations in ferroportin. Haematologica 91, 92-95.
De Domenico, I., Ward, D.M., Nemeth, E., Vaughn, M.B., Musci, G., Ganz, T., and Kaplan, J. (2005). The molecular basis of ferroportin-linked hemochromatosis. Proc Natl Acad Sci U S A 102, 8955-8960. de Vasconcelos, P.A.I.F., Krebs, V.L., Gualandro, S.F., Silveira, P.A., and Vaz,
F.A. (2007). [Effects of recombinant human erythropoietin in preterm newborns with infectious diseases]. Rev Assoc Med Bras 53, 90-94.
Dewachter, I., van Dorpe, J., Spittaels, K., Tesseur, I., Van Den Haute, C.,
Moechars, D., and Van Leuven, F. (2000). Modeling Alzheimer's disease in transgenic mice: effect of age and of presenilin1 on amyloid biochemistry and pathology in APP/London mice. Exp Gerontol 35, 831-841.
Dexter, D.T., Carayon, A., Vidailhet, M., Ruberg, M., Agid, F., Agid, Y., Lees,
A.J., Wells, F.R., Jenner, P., and Marsden, C.D. (1990). Decreased ferritin levels in brain in Parkinson's disease. J Neurochem 55, 16-20.
336 Dhandapani, K.M., Hadman, M., De Sevilla, L., Wade, M.F., Mahesh, V.B., and
Brann, D.W. (2003). Astrocyte protection of neurons: role of transforming growth factor-beta signaling via a c-Jun-AP-1 protective pathway. J Biol Chem
278, 43329-43339.
Dobson, J. (2001). On the structural form of iron in ferritin cores associated with progressive supranuclear palsy and Alzheimer's disease. Cell Mol Biol
(Noisy-le-grand) 47 Online Pub, OL49-50.
Donovan, A., Brownlie, A., Zhou, Y., Shepard, J., Pratt, S.J., Moynihan, J., Paw,
B.H., Drejer, A., Barut, B., Zapata, A., et al. (2000). Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 403,
776-781.
Donovan, A., Lima, C.A., Pinkus, J.L., Pinkus, G.S., Zon, L.I., Robine, S., and
Andrews, N.C. (2005). The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis. Cell Metab 1, 191-200.
Double, K.L., Halliday, G.M., Henderson, J., Griffiths, F.M., Heinemann, T.,
Riederer, P., and Gerlach, M. (2003). The dopamine receptor agonist lisuride attenuates iron-mediated dopaminergic neurodegeneration. Exp Neurol 184,
530-535.
Double, K.L., Zecca, L., Costi, P., Mauer, M., Griesinger, C., Ito, S.,
337 Ben-Shachar, D., Bringmann, G., Fariello, R.G., Riederer, P., et al. (2000).
Structural characteristics of human substantia nigra neuromelanin and synthetic dopamine melanins. J Neurochem 75, 2583-2589.
Dringen, R., Gutterer, J.M., and Hirrlinger, J. (2000). Glutathione metabolism in brain metabolic interaction between astrocytes and neurons in the defense against reactive oxygen species. Eur J Biochem 267, 4912-4916.
Dunnett, S.B., and Bjorklund, A. (1999). Prospects for new restorative and neuroprotective treatments in Parkinson's disease. Nature 399, A32-39.
Dwork, A.J., Schon, E.A., and Herbert, J. (1988). Nonidentical distribution of transferrin and ferric iron in human brain. Neuroscience 27, 333-345.
Edwards, J.A., and Hoke, J.E. (1972). Defect of intestinal mucosal iron uptake in mice with hereditary microcytic anemia. Proc Soc Exp Biol Med 141, 81-84.
Eisenstein, R.S. (2000). Iron regulatory proteins and the molecular control of mammalian iron metabolism. Annu Rev Nutr 20, 627-662. el Hage Chahine, J.M., and Pakdaman, R. (1995). Transferrin, a mechanism for iron release. Eur J Biochem 230, 1102-1110.
Enns, C.A., and Sussman, H.H. (1981). Physical characterization of the transferrin receptor in human placentae. J Biol Chem 256, 9820-9823.
Fabbrini, G., Brotchie, J.M., Grandas, F., Nomoto, M., and Goetz, C.G. (2007).
338 Levodopa-induced dyskinesias. Mov Disord 22, 1379-1389; quiz 1523.
Fasano, M., Bergamasco, B., and Lopiano, L. (2006a). Is neuromelanin changed in Parkinson's disease? Investigations by magnetic spectroscopies. J Neural
Transm 113, 769-774.
Fasano, M., Bergamasco, B., and Lopiano, L. (2006b). Modifications of the iron-neuromelanin system in Parkinson's disease. J Neurochem 96, 909-916.
Fernandez-Gonzalez, A., Perez-Otano, I., and Morgan, J.I. (2000). MPTP selectively induces haem oxygenase-1 expression in striatal astrocytes. Eur J
Neurosci 12, 1573-1583.
Ferris, C.D., Jaffrey, S.R., Sawa, A., Takahashi, M., Brady, S.D., Barrow, R.K.,
Tysoe, S.A., Wolosker, H., Baranano, D.E., Dore, S., et al. (1999). Haem oxygenase-1 prevents cell death by regulating cellular iron. Nat Cell Biol 1,
152-157.
Finch, C. (1994). Regulators of iron balance in humans. Blood 84, 1697-1702.
Fleming, M.D., Romano, M.A., Su, M.A., Garrick, L.M., Garrick, M.D., and
Andrews, N.C. (1998). Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci U
S A 95, 1148-1153.
Fleming, R.E., Migas, M.C., Holden, C.C., Waheed, A., Britton, R.S., Tomatsu,
339 S., Bacon, B.R., and Sly, W.S. (2000). Transferrin receptor 2: continued expression in mouse liver in the face of iron overload and in hereditary hemochromatosis. Proc Natl Acad Sci U S A 97, 2214-2219.
Foley, P. (2000). The L-DOPA story revisited. Further surprises to be expected? J
Neural Transm Suppl, 1-20.
Frazer, D.M., Inglis, H.R., Wilkins, S.J., Millard, K.N., Steele, T.M., McLaren,
G.D., McKie, A.T., Vulpe, C.D., and Anderson, G.J. (2004). Delayed hepcidin response explains the lag period in iron absorption following a stimulus to increase erythropoiesis. Gut 53, 1509-1515.
Frazer, D.M., Wilkins, S.J., Becker, E.M., Vulpe, C.D., McKie, A.T., Trinder, D., and Anderson, G.J. (2002). Hepcidin expression inversely correlates with the expression of duodenal iron transporters and iron absorption in rats.
Gastroenterology 123, 835-844.
Gerstein, M., Anderson, B.F., Norris, G.E., Baker, E.N., Lesk, A.M., and Chothia,
C. (1993). Domain closure in lactoferrin. Two hinges produce a see-saw motion between alternative close-packed interfaces. J Mol Biol 234, 357-372.
Good, P.F., Olanow, C.W., and Perl, D.P. (1992). Neuromelanin-containing neurons of the substantia nigra accumulate iron and aluminum in Parkinson's disease: a LAMMA study. Brain Res 593, 343-346.
340 Goodnough, L.T. (2007). Erythropoietin and iron-restricted erythropoiesis. Exp
Hematol 35, 167-172.
Graham, F.L., Smiley, J., Russell, W.C., and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen
Virol 36, 59-74.
Gunshin, H., Mackenzie, B., Berger, U.V., Gunshin, Y., Romero, M.F., Boron,
W.F., Nussberger, S., Gollan, J.L., and Hediger, M.A. (1997). Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature
388, 482-488.
Hannuksela, J., Parkkila, S., Waheed, A., Britton, R.S., Fleming, R.E., Bacon,
B.R., and Sly, W.S. (2003). Human platelets express hemochromatosis protein
(HFE) and transferrin receptor 2. Eur J Haematol 70, 201-206.
Hartig, M.B., Hortnagel, K., Garavaglia, B., Zorzi, G., Kmiec, T., Klopstock, T.,
Rostasy, K., Svetel, M., Kostic, V.S., Schuelke, M., et al. (2006). Genotypic and phenotypic spectrum of PANK2 mutations in patients with neurodegeneration with brain iron accumulation. Ann Neurol 59, 248-256.
Hashimoto, M., Hsu, L.J., Xia, Y., Takeda, A., Sisk, A., Sundsmo, M., and
Masliah, E. (1999). Oxidative stress induces amyloid-like aggregate formation of
NACP/alpha-synuclein in vitro. Neuroreport 10, 717-721.
341 Hentze, M.W., Muckenthaler, M.U., and Andrews, N.C. (2004). Balancing acts: molecular control of mammalian iron metabolism. Cell 117, 285-297.
Hirsch, E.C., and Faucheux, B.A. (1998). Iron metabolism and Parkinson's disease. Mov Disord 13 Suppl 1, 39-45.
Ho, K.P., Li, L., Zhao, L., and Qian, Z.M. (2003). Genistein protects primary cortical neurons from iron-induced lipid peroxidation. Mol Cell Biochem 247,
219-222.
Hubert, N., and Hentze, M.W. (2002). Previously uncharacterized isoforms of divalent metal transporter (DMT)-1: implications for regulation and cellular function. Proc Natl Acad Sci U S A 99, 12345-12350.
Hulet, S.W., Powers, S., and Connor, J.R. (1999). Distribution of transferrin and ferritin binding in normal and multiple sclerotic human brains. J Neurol Sci 165,
48-55.
Hung, S.Y., Liou, H.C., Kang, K.H., Wu, R.M., Wen, C.C., and Fu, W.M. (2008).
Overexpression of heme oxygenase-1 protects dopaminergic neurons against
1-methyl-4-phenylpyridinium-induced neurotoxicity. Mol Pharmacol 74,
1564-1575.
Hunter, H.N., Fulton, D.B., Ganz, T., and Vogel, H.J. (2002). The solution structure of human hepcidin, a peptide hormone with antimicrobial activity that
342 is involved in iron uptake and hereditary hemochromatosis. J Biol Chem 277,
37597-37603.
Idzerda, R.L., Huebers, H., Finch, C.A., and McKnight, G.S. (1986). Rat transferrin gene expression: tissue-specific regulation by iron deficiency. Proc
Natl Acad Sci U S A 83, 3723-3727.
Ihara, Y., Chuda, M., Kuroda, S., and Hayabara, T. (1999). Hydroxyl radical and superoxide dismutase in blood of patients with Parkinson's disease: relationship to clinical data. J Neurol Sci 170, 90-95.
Jankovic, J., and Stacy, M. (2007). Medical management of levodopa-associated motor complications in patients with Parkinson's disease. CNS Drugs 21,
677-692.
Jefferies, W.A., Food, M.R., Gabathuler, R., Rothenberger, S., Yamada, T.,
Yasuhara, O., and McGeer, P.L. (1996). Reactive microglia specifically associated with amyloid plaques in Alzheimer's disease brain tissue express melanotransferrin. Brain Res 712, 122-126.
Jellinger, K.A. (1999). The role of iron in neurodegeneration: prospects for pharmacotherapy of Parkinson's disease. Drugs Aging 14, 115-140.
Kappas, A., Drummond, G.S., and Galbraith, R.A. (1993). Prolonged clinical use of a heme oxygenase inhibitor: hematological evidence for an inducible but
343 reversible iron-deficiency state. Pediatrics 91, 537-539.
Kawabata, H., Yang, R., Hirama, T., Vuong, P.T., Kawano, S., Gombart, A.F., and
Koeffler, H.P. (1999). Molecular cloning of transferrin receptor 2. A new member of the transferrin receptor-like family. J Biol Chem 274, 20826-20832.
Kawamata, T., Tooyama, I., Yamada, T., Walker, D.G., and McGeer, P.L. (1993).
Lactotransferrin immunocytochemistry in Alzheimer and normal human brain.
Am J Pathol 142, 1574-1585.
Ke, Y., Chang, Y.Z., Duan, X.L., Du, J.R., Zhu, L., Wang, K., Yang, X.D., Ho,
K.P., and Qian, Z.M. (2005). Age-dependent and iron-independent expression of two mRNA isoforms of divalent metal transporter 1 in rat brain. Neurobiol Aging
26, 739-748.
Kim, D.K., Seo, M.Y., Lim, S.W., Kim, S., Kim, J.W., Carroll, B.J., Kwon, D.Y.,
Kwon, T., and Kang, S.S. (2001). Serum melanotransferrin, p97 as a biochemical marker of Alzheimer's disease. Neuropsychopharmacology 25, 84-90.
Klausner, R.D., Kempf, C., Weinstein, J.N., Blumenthal, R., and Van Renswoude,
J. (1983). The folding of ovalbumin. Renaturation in vitro versus biosynthesis in vitro. Biochem J 212, 801-810.
Klomp, L.W., and Gitlin, J.D. (1996). Expression of the ceruloplasmin gene in the human retina and brain: implications for a pathogenic model in
344 aceruloplasminemia. Hum Mol Genet 5, 1989-1996.
Knutson, M.D., Oukka, M., Koss, L.M., Aydemir, F., and Wessling-Resnick, M.
(2005). Iron release from macrophages after erythrophagocytosis is up-regulated by ferroportin 1 overexpression and down-regulated by hepcidin. Proc Natl Acad
Sci U S A 102, 1324-1328.
Koutnikova, H., Campuzano, V., Foury, F., Dolle, P., Cazzalini, O., and Koenig,
M. (1997). Studies of human, mouse and yeast homologues indicate a mitochondrial function for frataxin. Nat Genet 16, 345-351.
Kuehl, P., Zhang, J., Lin, Y., Lamba, J., Assem, M., Schuetz, J., Watkins, P.B.,
Daly, A., Wrighton, S.A., Hall, S.D., et al. (2001). Sequence diversity in CYP3A promoters and characterization of the genetic basis of polymorphic CYP3A5 expression. Nat Genet 27, 383-391.
Laftah, A.H., Ramesh, B., Simpson, R.J., Solanky, N., Bahram, S., Schumann, K.,
Debnam, E.S., and Srai, S.K. (2004). Effect of hepcidin on intestinal iron absorption in mice. Blood 103, 3940-3944.
LaVaute, T., Smith, S., Cooperman, S., Iwai, K., Land, W., Meyron-Holtz, E.,
Drake, S.K., Miller, G., Abu-Asab, M., Tsokos, M., et al. (2001). Targeted deletion of the gene encoding iron regulatory protein-2 causes misregulation of iron metabolism and neurodegenerative disease in mice. Nat Genet 27, 209-214.
345 Lee, P.L., Gelbart, T., West, C., Halloran, C., and Beutler, E. (1998). The human
Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 24, 199-215.
Lee, P.L., Gelbart, T., West, C., Halloran, C., Sipe, J.C., and Beutler, E. (2002).
Polymorphisms in iron-responsive binding protein 2 and lack of association with sporadic Parkinson's disease. Mov Disord 17, 1302-1304.
Leveugle, B., Spik, G., Perl, D.P., Bouras, C., Fillit, H.M., and Hof, P.R. (1994).
The iron-binding protein lactotransferrin is present in pathologic lesions in a variety of neurodegenerative disorders: a comparative immunohistochemical analysis. Brain Res 650, 20-31.
LeWitt, P.A., and Nyholm, D. (2004). New developments in levodopa therapy.
Neurology 62, S9-16.
Li, Z., Lai, Z., Ya, K., Fang, D., Ho, Y.W., Lei, Y., and Ming, Q.Z. (2008a).
Correlation between the expression of divalent metal transporter 1 and the content of hypoxia-inducible factor-1 in hypoxic HepG2 cells. J Cell Mol Med
12, 569-579.
Li, Z., Ya, K., Xiao-Mei, W., Lei, Y., Yang, L., and Ming, Q.Z. (2008b).
Ginkgolides protect PC12 cells against hypoxia-induced injury by p42/p44
MAPK pathway-dependent upregulation of HIF-1alpha expression and
346 HIF-1DNA-binding activity. J Cell Biochem 103, 564-575.
Lieu, P.T., Heiskala, M., Peterson, P.A., and Yang, Y. (2001). The roles of iron in health and disease. Mol Aspects Med 22, 1-87.
Lin, X.M., Tian, W., Ma, L., Long, Z., Zhang, J., Shen, X.Y., and Zhang, X.P.
(2008). The responses of serum transferrin receptors to iron supplements in subjects with iron-deficiency erythropoiesis and iron-deficiency anaemia. Br J
Nutr 99, 416-420.
Maines, M.D. (2000). The heme oxygenase system and its functions in the brain.
Cell Mol Biol (Noisy-le-grand) 46, 573-585.
McKie, A.T., Barrow, D., Latunde-Dada, G.O., Rolfs, A., Sager, G., Mudaly, E.,
Mudaly, M., Richardson, C., Barlow, D., Bomford, A., et al. (2001). An iron-regulated ferric reductase associated with the absorption of dietary iron.
Science 291, 1755-1759.
McKie, A.T., Marciani, P., Rolfs, A., Brennan, K., Wehr, K., Barrow, D., Miret,
S., Bomford, A., Peters, T.J., Farzaneh, F., et al. (2000). A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 5, 299-309.
Mehindate, K., Sahlas, D.J., Frankel, D., Mawal, Y., Liberman, A., Corcos, J.,
Dion, S., and Schipper, H.M. (2001). Proinflammatory cytokines promote glial
347 heme oxygenase-1 expression and mitochondrial iron deposition: implications for multiple sclerosis. J Neurochem 77, 1386-1395.
Mena, M.A., Casarejos, M.J., Carazo, A., Paino, C.L., and Garcia de Yebenes, J.
(1996). Glia conditioned medium protects fetal rat midbrain neurones in culture from L-DOPA toxicity. Neuroreport 7, 441-445.
Miller, A.D. (1992). Human gene therapy comes of age. Nature 357, 455-460.
Mittal, S.K., McDermott, M.R., Johnson, D.C., Prevec, L., and Graham, F.L.
(1993). Monitoring foreign gene expression by a human adenovirus-based vector using the firefly luciferase gene as a reporter. Virus Res 28, 67-90.
Miyajima, H., Fujimoto, M., Kohno, S., Kaneko, E., and Gitlin, J.D. (1998). CSF abnormalities in patients with aceruloplasminemia. Neurology 51, 1188-1190.
Mollgard, K., Stagaard, M., and Saunders, N.R. (1987). Cellular distribution of transferrin immunoreactivity in the developing rat brain. Neurosci Lett 78, 35-40.
Moos, T. (1996). Immunohistochemical localization of intraneuronal transferrin receptor immunoreactivity in the adult mouse central nervous system. J Comp
Neurol 375, 675-692.
Moos, T., and Morgan, E.H. (2000). Transferrin and transferrin receptor function in brain barrier systems. Cell Mol Neurobiol 20, 77-95.
Moos, T., and Morgan, E.H. (2001). Restricted transport of anti-transferrin
348 receptor antibody (OX26) through the blood-brain barrier in the rat. J Neurochem
79, 119-129.
Morgan, E.H. (1983). Chelator-mediated iron efflux from reticulocytes. Biochim
Biophys Acta 733, 39-50.
Morgan, R.A., and Anderson, W.F. (1993). Human gene therapy. Annu Rev
Biochem 62, 191-217.
Muldoon, L.L., Nilaver, G., Kroll, R.A., Pagel, M.A., Breakefield, X.O., Chiocca,
E.A., Davidson, B.L., Weissleder, R., and Neuwelt, E.A. (1995). Comparison of intracerebral inoculation and osmotic blood-brain barrier disruption for delivery of adenovirus, herpesvirus, and iron oxide particles to normal rat brain. Am J
Pathol 147, 1840-1851.
Nazifi, S., Mansourian, M., Nikahval, B., and Razavi, S.M. (2009). The relationship between serum level of thyroid hormones, trace elements and antioxidant enzymes in dromedary camel (Camelus dromedarius). Trop Anim
Health Prod 41, 129-134.
Nemeth E, P.G., Jung CL, Kaplan J, Waring AJ, Ganz T. (2006). The N-terminus of hepcidin is essential for its interaction with ferroportin: structure-function study. 107 1, 328-333.
Nemeth, E., Preza, G.C., Jung, C.L., Kaplan, J., Waring, A.J., and Ganz, T. (2006).
349 The N-terminus of hepcidin is essential for its interaction with ferroportin: structure-function study. Blood 107, 328-333.
Nemeth, E., Rivera, S., Gabayan, V., Keller, C., Taudorf, S., Pedersen, B.K., and
Ganz, T. (2004a). IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone hepcidin. J Clin Invest 113, 1271-1276.
Nemeth, E., Tuttle, M.S., Powelson, J., Vaughn, M.B., Donovan, A., Ward, D.M.,
Ganz, T., and Kaplan, J. (2004b). Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 306, 2090-2093.
Nicolas, G., Bennoun, M., Devaux, I., Beaumont, C., Grandchamp, B., Kahn, A., and Vaulont, S. (2001). Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad
Sci U S A 98, 8780-8785.
Nicolas, G., Viatte, L., Bennoun, M., Beaumont, C., Kahn, A., and Vaulont, S.
(2002b). Hepcidin, a new iron regulatory peptide. Blood Cells Mol Dis 29,
327-335.
Olanow, C.W., Obeso, J.A., and Stocchi, F. (2006). Drug insight: Continuous dopaminergic stimulation in the treatment of Parkinson's disease. Nat Clin Pract
Neurol 2, 382-392.
Ong, W.Y., and Farooqui, A.A. (2005). Iron, neuroinflammation, and Alzheimer's
350 disease. J Alzheimers Dis 8, 183-200; discussion 209-115.
Oski, F.A., and Honig, A.S. (1978). The effects of therapy on the developmental scores of iron-deficient infants. J Pediatr 92, 21-25.
Patel, B.N., Dunn, R.J., and David, S. (2000). Alternative RNA splicing generates a glycosylphosphatidylinositol-anchored form of ceruloplasmin in mammalian brain. J Biol Chem 275, 4305-4310.
Pinero, D.J., Hu, J., and Connor, J.R. (2000). Alterations in the interaction between iron regulatory proteins and their iron responsive element in normal and
Alzheimer's diseased brains. Cell Mol Biol (Noisy-le-grand) 46, 761-776.
Pollitt, E., and Leibel, R.L. (1976). Iron deficiency and behavior. J Pediatr 88,
372-381.
Ponka, P., and Lok, C.N. (1999). The transferrin receptor: role in health and disease. Int J Biochem Cell Biol 31, 1111-1137.
Pootrakul, P., Kitcharoen, K., Yansukon, P., Wasi, P., Fucharoen, S., Charoenlarp,
P., Brittenham, G., Pippard, M.J., and Finch, C.A. (1988). The effect of erythroid hyperplasia on iron balance. Blood 71, 1124-1129.
Poss, K.D., and Tonegawa, S. (1997). Heme oxygenase 1 is required for mammalian iron reutilization. Proc Natl Acad Sci U S A 94, 10919-10924.
Priller, J., Scherzer, C.R., Faber, P.W., MacDonald, M.E., and Young, A.B.
351 (1997). Frataxin gene of Friedreich's ataxia is targeted to mitochondria. Ann
Neurol 42, 265-269.
Qian, Z.M., Chang, Y.Z., Zhu, L., Yang, L., Du, J.R., Ho, K.P., Wang, Q., Li, L.Z.,
Wang, C.Y., Ge, X., et al. (2007). Development and iron-dependent expression of hephaestin in different brain regions of rats. J Cell Biochem 102, 1225-1233.
Qian, Z.M., Li, H., Sun, H., and Ho, K. (2002). Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway. Pharmacol Rev 54, 561-587.
Qian, Z.M., Liao, Q.K., To, Y., Ke, Y., Tsoi, Y.K., Wang, G.F., and Ho, K.P.
(2000). Transferrin-bound and transferrin free iron uptake by cultured rat astrocytes. Cell Mol Biol (Noisy-le-grand) 46, 541-548.
Qian, Z.M., and Morgan, E.H. (1992). Changes in the uptake of transferrin-free and transferrin-bound iron during reticulocyte maturation in vivo and in vitro.
Biochim Biophys Acta 1135, 35-43.
Qian, Z.M., To, Y., Tang, P.L., and Feng, Y.M. (1999). Transferrin receptors on the plasma membrane of cultured rat astrocytes. Exp Brain Res 129, 473-476.
Quintana, C., Bellefqih, S., Laval, J.Y., Guerquin-Kern, J.L., Wu, T.D., Avila, J.,
Ferrer, I., Arranz, R., and Patino, C. (2006). Study of the localization of iron, ferritin, and hemosiderin in Alzheimer's disease hippocampus by analytical microscopy at the subcellular level. J Struct Biol 153, 42-54.
352 Raja, K.B., Pippard, M.J., Simpson, R.J., and Peters, T.J. (1986). Relationship between erythropoiesis and the enhanced intestinal uptake of ferric iron in hypoxia in the mouse. Br J Haematol 64, 587-593.
Rao, K.V., and Anderson, W.R. (1987). Mechanism of liver cell injury from iron overload in renal transplant recipients. Transplant Proc 19, 2225-2226.
Richardson, D.R. (2005). Molecular mechanisms of iron uptake by cells and the use of iron chelators for the treatment of cancer. Curr Med Chem 12, 2711-2729.
Rivera, S., Nemeth, E., Gabayan, V., Lopez, M.A., Farshidi, D., and Ganz, T.
(2005). Synthetic hepcidin causes rapid dose-dependent hypoferremia and is concentrated in ferroportin-containing organs. Blood 106, 2196-2199.
Robach, P., Cairo, G., Gelfi, C., Bernuzzi, F., Pilegaard, H., Vigano, A.,
Santambrogio, P., Cerretelli, P., Calbet, J.A., Moutereau, S., et al. (2007). Strong iron demand during hypoxia-induced erythropoiesis is associated with down-regulation of iron-related proteins and myoglobin in human skeletal muscle. Blood 109, 4724-4731.
Rogers, J.T., Leiter, L.M., McPhee, J., Cahill, C.M., Zhan, S.S., Potter, H., and
Nilsson, L.N. (1999). Translation of the alzheimer amyloid precursor protein mRNA is up-regulated by interleukin-1 through 5'-untranslated region sequences.
J Biol Chem 274, 6421-6431.
353 Rosales, F.J., and Zeisel, S.H. (2008). Perspectives from the symposium: The
Role of Nutrition in Infant and Toddler Brain and Behavioral Development. Nutr
Neurosci 11, 135-143.
Rosenfeld, M.A., Siegfried, W., Yoshimura, K., Yoneyama, K., Fukayama, M.,
Stier, L.E., Paakko, P.K., Gilardi, P., Stratford-Perricaudet, L.D., Perricaudet, M., et al. (1991). Adenovirus-mediated transfer of a recombinant alpha 1-antitrypsin gene to the lung epithelium in vivo. Science 252, 431-434.
Rouault, T.A. (2001a). Iron on the brain. Nat Genet 28, 299-300.
Rouault, T.A. (2001b). Systemic iron metabolism: a review and implications for brain iron metabolism. Pediatr Neurol 25, 130-137.
Roy, C.N., and Andrews, N.C. (2001). Recent advances in disorders of iron metabolism: mutations, mechanisms and modifiers. Hum Mol Genet 10,
2181-2186.
Sadrzadeh, S.M., and Saffari, Y. (2004). Iron and brain disorders. Am J Clin
Pathol 121 Suppl, S64-70.
Sastry, S., and Arendash, G.W. (1995). Time-dependent changes in iron levels and associated neuronal loss within the substantia nigra following lesions within the neostriatum/globus pallidus complex. Neuroscience 67, 649-666.
Schipper, H.M., Bernier, L., Mehindate, K., and Frankel, D. (1999).
354 Mitochondrial iron sequestration in dopamine-challenged astroglia: role of heme oxygenase-1 and the permeability transition pore. J Neurochem 72, 1802-1811.
Shukla, A., Agarwal, K.N., Chansuria, J.P., and Taneja, V. (1989). Effect of latent iron deficiency on 5-hydroxytryptamine metabolism in rat brain. J Neurochem 52,
730-735.
Silaghi-Dumitrescu, R., Kurtz, D.M., Jr., Ljungdahl, L.G., and Lanzilotta, W.N.
(2005). X-ray crystal structures of Moorella thermoacetica FprA. Novel diiron site structure and mechanistic insights into a scavenging nitric oxide reductase.
Biochemistry 44, 6492-6501.
Simka, M., and Rybak, Z. (2008). Hypothetical molecular mechanisms by which local iron overload facilitates the development of venous leg ulcers and multiple sclerosis lesions. Med Hypotheses 71, 293-297.
Smith, M.A., Harris, P.L., Sayre, L.M., and Perry, G. (1997). Iron accumulation in Alzheimer disease is a source of redox-generated free radicals. Proc Natl Acad
Sci U S A 94, 9866-9868.
Smith, M.A., Wehr, K., Harris, P.L., Siedlak, S.L., Connor, J.R., and Perry, G.
(1998). Abnormal localization of iron regulatory protein in Alzheimer's disease.
Brain Res 788, 232-236.
Stratford-Perricaudet, L.D., Makeh, I., Perricaudet, M., and Briand, P. (1992).
355 Widespread long-term gene transfer to mouse skeletal muscles and heart. J Clin
Invest 90, 626-630.
Subramaniam, V.N., Summerville, L., and Wallace, D.F. (2002). Molecular and cellular characterization of transferrin receptor 2. Cell Biochem Biophys 36,
235-239.
Swaiman, K.F. (1991). Hallervorden-Spatz syndrome and brain iron metabolism.
Arch Neurol 48, 1285-1293.
Tanaka, J., Toku, K., Zhang, B., Ishihara, K., Sakanaka, M., and Maeda, N.
(1999). Astrocytes prevent neuronal death induced by reactive oxygen and nitrogen species. Glia 28, 85-96.
Tandy, S., Williams, M., Leggett, A., Lopez-Jimenez, M., Dedes, M., Ramesh, B.,
Srai, S.K., and Sharp, P. (2000). Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal
Caco-2 cells. J Biol Chem 275, 1023-1029.
Tchernitchko, D., Bourgeois, M., Martin, M.E., and Beaumont, C. (2002).
Expression of the two mRNA isoforms of the iron transporter Nramp2/DMTI in mice and function of the iron responsive element. Biochem J 363, 449-455.
Touret, N., Furuya, W., Forbes, J., Gros, P., and Grinstein, S. (2003). Dynamic traffic through the recycling compartment couples the metal transporter Nramp2
356 (DMT1) with the transferrin receptor. J Biol Chem 278, 25548-25557.
Ujiie, M., Dickstein, D.L., and Jefferies, W.A. (2002). p97 as a biomarker for
Alzheimer disease. Front Biosci 7, e42-47.
Van Eden, M.E., and Aust, S.D. (2000). Intact human ceruloplasmin is required for the incorporation of iron into human ferritin. Arch Biochem Biophys 381,
119-126.
Viatte, L., Nicolas, G., Lou, D.Q., Bennoun, M., Lesbordes-Brion, J.C.,
Canonne-Hergaux, F., Schonig, K., Bujard, H., Kahn, A., Andrews, N.C., et al.
(2006). Chronic hepcidin induction causes hyposideremia and alters the pattern of cellular iron accumulation in hemochromatotic mice. Blood 107, 2952-2958.
Weintraub, L.R., Conrad, M.E., and Crosby, W.H. (1965). Absorption of hemoglobin iron by the rat. Proc Soc Exp Biol Med 120, 840-843.
Yamaji, S., Sharp, P., Ramesh, B., and Srai, S.K. (2004). Inhibition of iron transport across human intestinal epithelial cells by hepcidin. Blood 104,
2178-2180.
Yoshida, K., Kaneko, K., Miyajima, H., Tokuda, T., Nakamura, A., Kato, M., and
Ikeda, S. (2000). Increased lipid peroxidation in the brains of aceruloplasminemia patients. J Neurol Sci 175, 91-95.
Zesiewicz, T.A., Sullivan, K.L., and Hauser, R.A. (2007). Levodopa-induced
357 dyskinesia in Parkinson's disease: epidemiology, etiology, and treatment. Curr
Neurol Neurosci Rep 7, 302-310.
Zhu, Z.B., Makhija, S.K., Lu, B., Wang, M., Rivera, A.A., Preuss, M., Zhou, F.,
Siegal, G.P., Alvarez, R.D., and Curiel, D.T. (2004). Transport across a polarized monolayer of Caco-2 cells by transferrin receptor-mediated adenovirus transcytosis. Virology 325, 116-128.
358