DOCSLIB.ORG

Maternal Lineages of the Cultivated Strawberry, Fragaria ×Ananassa

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Maternal Lineages of the Cultivated Strawberry, Fragaria ×Ananassa HORTSCIENCE 44(6):1562–1565. 2009. Table 1. Country of origin and the detected chloroplast DNA haplotype of 75 accessions of Fragaria ·ananassa and seven accessions Maternal Lineages of the Cultivated of its wild relatives. Accessions Country Haplotype Strawberry, Fragaria ·ananassa, F. ·ananassa cultivars in North America Allstar USA V Arking USA V Revealed by Chloroplast Blakemore USA V Cardinal USA V DNA Variation Chandler USA V Columbia USA C 1 Masanori Honjo , Sono Kataoka, Susumu Yui, and Masami Morishita Donner USA V National Agricultural Research Center for Tohoku Region, Nabeyashiki, 92 Douglas USA V Excelsior USA V Shimokuriyagawa, Morioka, Iwate 020-0123, Japan Fairfax USA V Fresno USA V Miyuki Kunihisa Geneva USA V National Institute of Vegetable and Tea Science, 3-1-1 Kannondai, Tsukuba, Hecker USA V Ibaraki 305-8666, Japan Holiday USA V Honeoye USA V Takayoshi Yano, Megumi Hamano, and Hiromichi Yamazaki Huxley USA V Lassen USA V National Agricultural Research Center for Tohoku Region, Nabeyashiki, 92 Linn USA V Shimokuriyagawa, Morioka, Iwate 020-0123, Japan Marshall USA V Missionary USA V Additional index words. Fragaria virginiana, Fragaria chiloensis, haplotype, maternal Pajaro USA V inheritance, maternal origin Premier (Howard 17) USA V Raritan USA V Abstract. We analyzed sequence variation in chloroplast DNA (cpDNA) to investigate the Selva USA V origin of the cultivated strawberry, Fragaria ·ananassa. From analysis of two noncoding Sequoia USA V regions, trnL–trnF and trnR–rrn5, we found three haplotypes (V, C, and X) in F. Tioga USA V ·ananassa. Haplotype V corresponded to the haplotype of F. virginiana and was Tyee Canada V possessed by cultivars bred over a wide geographic range, including North America, Vibrant Canada V Europe, and Japan. Almost all the North American cultivars analyzed in this study Wiltguard USA V possessed haplotype V, suggesting a founder effect. Haplotype C corresponded to the F. ·ananassa cultivars in Europe Cambridge Favourite UK X haplotype of F. chiloensis and was detected mainly in Japanese cultivars. Haplotype X Cambridge Prizewinner UK V was found in only two English cultivars. This haplotype was positioned as intermediate Deutch Evern Germany V between haplotypes V and C in a median-joining network and was considered to be Merton Princess UK X representative of the process of differentiation between F. virginiana and F. chiloensis. Oranda Netherlands V Results of controlled crosses indicate that cpDNA haplotypes of F. ·ananassa are Redgauntlet UK V maternally inherited. These results verify that F. ·ananassa is an interspecific hybrid Senga Sengana Germany V between F. virginiana and F. chiloensis and indicate that traditional cultivars of F. F. ·ananassa cultivars in Japan ·ananassa have been derived from at least three maternal lineages. We demonstrate that Aiberry Japan V the cpDNA variation detected in this study can be used to verify parentage and for Akihime Japan V Asuka Wave Japan C extending hypotheses about June yellows, a leaf variegation disorder in strawberry. Bellerouge Japan V Benihoppe Japan V Decorouge Japan V Enrai Japan V Determining the historical pedigree of in that first hybridization was claimed to have Everberry Japan V cultivars is an important step in understand- been only five plants, which were introduced Fukuba Japan C ing the evolution of crop species (Matsuoka, from Chile to Europe in 1714 (Darrow, 1966). Harunoka Japan V 2005). It can also help to avoid inbreeding Systematic breeding began in England in the Haruyoi Japan V depression and to identify the origin of early 1800s and in North America in the mid- Hatsukuni Japan C agronomically important traits. 1800s using a small number of native and Himiko Japan C The cultivated strawberry, Fragaria cultivated clones (Darrow, 1966). Most mod- Hokowase Japan V ·ananassa Duch., is one of the most eco- ern strawberry cultivars are the progeny of this Kitanokagayaki Japan V nomically important fruit crops in the world. relatively narrow range of germplasm, al- Kogyoku Japan V Kurume 34 Japan C It first arose from accidental hybridization though attempts have been made recently to Kurume 103 Japan V between two American octoploid species, F. increase genetic diversity by using wild ge- Miyazaki Japan V virginiana and F. chiloensis, in a European netic resources (Hancock et al., 2001; Luby Mo-ikko Japan V garden during the early to mid-1700s (Darrow, et al., 2008). On the basis of pedigree data, Morioka 16 Japan V 1966). The number of F. chiloensis involved Dale and Sjulin (1990) reported that the Morioka 26 Japan V majority of modern North American cultivars Morioka 30 Japan V came from only 17 cytoplasmic sources. Morioka 32 Japan V However, further tracing was impossible ow- Morioka 33 Japan V Received for publication 19 June 2009. Accepted ing to incomplete records. Morioka 34 Japan V for publication 12 Aug. 2009. Natsuakari Japan V Because chloroplast DNA (cpDNA) is Nyoho Japan V We thank Naoe Suzuki for technical assistance; unaffected by changes in ploidy, which can Rikiya Kimura, Setsuko Oki, Yukari Sakurai, and Ohishi Shikinari Japan V Keiko Iwabuchi for help in cultivation of plant complicate phylogenetic analysis, the ge- Reiko Japan V materials; and anonymous reviewers for their valu- nome is particularly useful for the phyloge- Sachinoka Japan C able comments. netic analysis of Fragaria. Potter et al. (2000) Sagahonoka Japan C 1To whom reprint requests should be addressed; examined the sequence variation in cpDNA e-mail [email protected]. among 14 species of Fragaria with various (Continued on next page) 1562 HORTSCIENCE VOL. 44(6) OCTOBER 2009 Table 1. (Continued) Country of origin and the Table 2. Chloroplast DNA primers used in the analysis of Fragaria ·ananassa, annealing temperature, and detected chloroplast DNA haplotype of 75 references. accessions of Fragaria ·ananassa and seven Annealing accessions of its wild relatives. Primer Sequence 5#-3# temp (°C) References Accessions Country Haplotype trnL (UAA) GGTTCAAGTCCCTCTATCCC 50 Taberlet et al. (1991) Summer Candy Japan C trnF (GAA) ATTTGAACTGGTGACACGAG Taberlet et al. (1991) Summer Princess Japan V trnR (ACG) CGACACCGTGGTTCGTAGC 50 Yoshimura et al. (unpublished data) Summerberry Japan V rrn5 TGGTGTCCCAGGCGTAGAG Yoshimura et al. (unpublished data) Tochihitomi Japan C Tochiotome Japan C Toyonoka Japan C MgCl2, 0.9 units Taq polymerase, 0.2 mMof Table 3. Chloroplast DNA haplotype of seedlings Yachiyo Japan V each primer, and 10 ng template DNA in obtained from controlled cross-pollination of Wild relatives a total volume of 30 mL. Thermocycling cultivars of Fragaria ·ananassa. F. virginianaz V y conditions were as follows: 3 min at 94 °C; Parentage (female · male) Haplotype F. virginiana V2 30 cycles of 30 s at 94 °C, 45 s at 50 °C, and F. chiloensis C Haplotype C · haplotype V ‘PI551445’ 45 s at 72 °C; and a final extension step at Sagahonoka · Natsuakari, No.1 C F. vesca EMC Vesca 72 °C for 5 min. The PCR was carried out in Sagahonoka · Natsuakari, No.2 C F. vesca UC1 Vesca a GeneAmp PCR System Model 9700 (Ap- Sagahonoka · Natsuakari, No.3 C F. vesca UC5 Vesca plied Biosystems, Foster City, CA) or a PCR Sagahonoka · Natsuakari, No.4 C F. nilgerrensisz Nil Thermal Cycler Dice (Takara, Tokyo, Japan). Sagahonoka · Natsuakari, No.5 C z Sagahonoka · Selva, No.1 C Germplasm conserved in the National The PCR products were purified with a QIA- Sagahonoka · Selva, No.2 C Agricultural Research Center for Tohoku region, quick PCR purification Kit (Qiagen GmbH, Haplotype V · haplotype C Morioka, Japan. Hilden, Germany). The DNA obtained was y Natsuakari · Sagahonoka, No.1 V Seeds were purchased from the B&T World sequenced with an ABI PRISM 310 Genetic Natsuakari · Sagahonoka, No.2 V Seeds, Paguignan, France, in 2002. Analyzer (Applied Biosystems) using a Big- Natsuakari · Sagahonoka, No.3 V Dye Terminator Cycle Sequencing Ready Selva · Sagahonoka V Reaction Kit (Applied Biosystems). Se- Haplotype V · haplotype X ploidy levels. Distinctive sequences for each quencing data were aligned manually with (Morioka 32 · Sagahonoka) species, including F. virginiana and F. chi- CLUSTAL W (Thompson et al., 1994). In- · Cambridge Favourite V loensis, were found in the trnL–trnF region, Haplotype X · haplotype V sertions/deletions (indels) were generally and F. ·ananassa showed the same sequence Cambridge Favourite · Aiberry X placed so as to increase the number of as F. virginiana. Although this analysis Cambridge Favourite · X matching nucleotides in a sequence position. examined only one sample of F. ·ananassa Kitanokagayaki We determined cpDNA haplotypes from and therefore did not provide further infor- Cambridge Favourite x Morioka 32 X nucleotide substitutions and indels. To show Haplotype X · haplotype C mation about the involvement of other wild the relatedness of haplotypes, we constructed Cambridge Favourite · Sachinoka X species in the establishment of F. ·ananassa, a median-joining network (Bandelt et al., sequence variation in cpDNA may allow us 1999) with epsilon value set to zero using to infer the origin of each strawberry cultivar. the software Network 4.5.0.0 (http://www. Japanese cultivars and the American cultivar In this study, we investigated the mode fluxus-engineering.com). Columbia. We detected haplotype X in only of inheritance of cpDNA and then identified To confirm the mode of inheritance of two English cultivars, Cambridge Favourite the maternal origin of F. ·ananassa. We dis- cpDNA in F. ·ananassa, we performed and Merton Princess. cuss the accuracy of the reported pedigree of controlled cross-pollination between culti- All seedlings obtained from controlled cultivars and the relationship between vars possessing different haplotypes (Table cross-pollination possessed the same haplo- cpDNA haplotype and June yellows, a leaf 3). We examined the haplotype for one to five types as their maternal parents (Table 3). variegation disorder in strawberry. seedlings per cross. Discussion Materials and Methods Results The results of the controlled crosses We collected fresh leaves from 75 acces- We found two haplotypes (V and V2) in (Table 3) indicate that the cpDNA of F.
Load more

Recommended publications
  • 2011 August Rosbreed Newsletter
    Dedicated to the genetic improvement of U.S. rosaceous crops August 31, 2011 Volume 2 Issue 3 Another major milestone accomplished for peach and cherry genetics 2010 was a breakthrough year for peach genetics with the re- lease of the peach genome sequence. However, this DNA se- quence was from just one variety. Therefore, RosBREED‘s task was to use this sequence information to identify the DNA differ- ences that contribute to the wide diversity of peaches used in modern breeding programs. RosBREED scientists and their inter- national partners did just that. They identified a set of 8144 ge- netic differences, called single nucleotide polymorphisms (SNP) spanning the eight peach chromosomes. Working with a com- mercial company, Illumina Inc., using state-of-the-art markers similar to those pioneered for human genetics, a ―SNP chip‖ was developed that can examine 8144 SNP data points from an indi- vidual variety. A similar strategy was used in cherry, except 5696 SNP data points are on the cherry ―SNP chip‖. RosBREED purchased enough peach and cherry chips to geno- type the full complement of plant material carefully selected for Left: Dan Zarka, Michigan State University. Right: an genetic analysis by the peach, sweet cherry, and tart cherry crop Illumina Infinium® SNP chip. teams. This summer, with the help of the DNA genotyping lab headed by RosBREED Co-PD Dr. Dechun Wang, and with the technical expertise of Dr. Dan Zarka, the processing of the RosBREED peach and cherry chips was completed resulting in data files of more than 3.5 million data points for peach and 2 million data points for cherry.
    [Show full text]
  • Genetic Mapping and Phenotyping Plant Characteristics, Fruit Quality and Disease Resistance Traits in Octoploid Strawberry (Fragaria × Ananassa)
    UNIVERSITY OF READING Genetic mapping and phenotyping plant characteristics, fruit quality and disease resistance traits in octoploid strawberry (Fragaria × ananassa) Thesis submitted for the degree of Doctor of Philosophy School of Biological Sciences Laima Antanaviciute February, 2016 Declaration I confirm that this is my own work and the use of all material from other sources has been properly and fully acknowledged. ……………………………………………………… Abstract The cultivated strawberry (Fragaria × ananassa Duch.) is the third most economically important fruit crop. In recent years the withdrawal of many fungicides and soil fumigants have made the sustainability and profitability of this crop more challenging. To overcome these challenges, plant breeders aim to improve upon existing cultivars and to release new ones with higher yield, better fruit quality and more disease resistance. Through Quantitative Trait Mapping, markers linked to genetic variants associated with traits of economic and agronomic importance can be identified through and molecular markers such as simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs), can be used to improve plant breeding efficiency at the molecular level, which significantly reduces the breeding time and cost of phenotyping. In this thesis the following work is described: a correlation analysis of plant characteristics and fruit quality traits; the saturation of an existing SSR-based linkage map; the development of a high density consensus SNP-based octoploid strawberry linkage map, and the identification of quantitative trait loci (QTL) linked to two key plant attributes, fruit quality and powdery mildew resistance. In addition, the most closely linked SSR markers were identified and validated in a wider strawberry germplasm using firmness as an example study.
    [Show full text]
  • In Vitro Pathogenesis Caused by Phytophthora Cactorum and DNA Analysis of the Strawberry-Resistant Microplants with ISSR Markers
    agronomy Article In Vitro Pathogenesis Caused by Phytophthora cactorum and DNA Analysis of the Strawberry-Resistant Microplants with ISSR Markers Wojciech Marecki * and Jadwiga Zebrowska˙ Department of Genetics and Horticultural Plant Breeding, Institute of Plant Genetics, Breeding and Biotechnology, Faculty of Agrobioengineering, University of Life Sciences in Lublin, Akademicka 15 Street, 20-950 Lublin, Poland; [email protected] * Correspondence: [email protected] Abstract: The soil pathogenic fungus Phytophthora cactorum causes the most dangerous diseases occurring in strawberry plantations—strawberry crown rot and leather rot. Modern biotechnology methods, e.g., in vitro culture selection and molecular diagnostics can be utilized in the selection of cultivars that are less susceptible or resistant to Phytophthora diseases. In this study, in vitro selection of four strawberry microclones: ‘Elsanta’, ‘Feltar’, ‘Teresa’ and ‘Plena SVdT’ against Phytophthora cactorum (Lebert and Cohn) J. Schröt was carried out. Molecular analysis with inter simple sequence repeat (ISSR) markers was also used to evaluate genetic similarity of the selected resistant plants. None of the analyzed microclones showed complete resistance to the selection factor, but there were plants in all tested microclones that survived the pressure of the pathogen. Results showed that susceptibility to this pathogenic fungus was significantly differentiated and depended on the microclone. The ‘Feltar’ microclone had the significantly lowest susceptibility to Phytophthora disease, followed by the microclones ‘Elsanta’ and ‘Teresa’ with significantly higher susceptibility. The ‘Plena SVdT’ microclone showed the highest susceptibility to Phytophthora disease. This differentiation was linked to the genetic similarity observed at deoxyribonucleic acid (DNA) level between the Citation: Marecki, W.; Zebrowska,˙ J.
    [Show full text]
  • Our Strawberries Les Fraisiers De Chez Nous
    Agriculture and Agriculture et Agri-Food Canada Agroalimentaire Canada Shahrokh Khanizadeh Jennifer DeEll OurOur StrawberriesStrawberries LesLes FraisiersFraisiers dede chezchez nousnous A description of over 170 strawberry cultivars including photographs of the plants, fruits, flowers, pollen and leaves. Description de plus de 170 cultivars de fraisiers avec les photos des plants, fruits, fleurs, pollen et feuilles. Canadian Cataloguing in Publication Data National Library of Canada cataloguing in publication data Main entry under title : Our strawberries = Les fraisiers de chez nous Text in English and French. "A description of over 170 strawberry cultivars including photographs of the plants, fruits, flowers, pollen and leaves." Issued also in CD-ROM format. ISBN 0-660-62338-2 Cat. no. A22-307/2005 1. Strawberries – Varieties – Canada, Eastern. 2. Strawberries – Canada, Eastern – Identification. 3. Strawberries – Pictorial works. I. Khanizadeh, Shahrokh, 1953- II. Canada. Agriculture and Agri-Food Canada. Research Station. St-Jean-sur-Richelieu (Quebec) III. Title : Les fraisiers de chez nous. SB385.K42 2005 634.75’09713 C2003-980161-6E Données de catalogage avant publication (Canada) Vedette principale au titre : Our strawberries = Les fraisiers de chez nous Texte en anglais et en français. "Description de plus de 170 cultivars de fraisiers avec des photos des plantes, fruits, fleurs, pollen et feuilles. " Publ. aussi en format CD-ROM. ISBN 0-660-62338-2 No de cat. A22-307/2005 1. Fraisiers – Variétés – Canada (Est) 2. Fraisiers – Canada (Est) – Identification. 3. Fraisiers – Ouvrages illustrés. I. Khanizadeh, Shahrokh, 1953- . II. Canada. Agriculture et Agro-alimentaire Canada. Station de Recherches St-Jean-sur-Richelieu (Québec). III. Titre : Les fraisiers de chez nous.
    [Show full text]
  • Introduction to Species Strawberry Species
    1 STRAWBERRY SPECIES INTRODUCTION TO SPECIES Numerous species of strawberries are found in the temperate zones of the world. Only a few have contributed directly to the ancestry of the cultivated types, but all are an important component of our natural environment. The strawberry belongs to the family Rosaceae in the genus Fragaria. Its closest rela- tives are Duchesnea Smith and Potentilla L. Species are found at six ploidy levels in Fragaria (Table 1.1; Fig. 1.1). The most widely distributed native species, Fragaria vesca, has 14 chromosomes and is considered to be a diploid. The most commonly cultivated strawberry, Fragaria × ananassa, is an octoploid with 56 chromosomes. Interploid crosses are often quite difficult, but species with the same ploidy level can often be suc- cessfully crossed. In fact, F. × ananassa is a hybrid of two New World species, Fragaria chiloensis (L.) Duch. and Fragaria virginiana Duch. (see below). There are 13 diploid and 12 polyploid species of Fragaria now recog- nized (Table 1.1). Although a large number of the strawberry species are perfect flowered, several have separate genders. Some are dioecious and are composed of pistillate plants that produce no viable pollen and func- tion only as females, and some are staminate male plants that produce no fruit and serve only as a source of pollen (Fig. 1.2). The perfect-flowered types vary in their out-crossing rates from self-incompatible to compat- ible (Table 1.1). Isozyme inheritance data have indicated that California F. vesca is predominantly a selfing species (Arulsekar and Bringhurst, 1981), although occasional females are found in European populations (Staudt, 1989; Irkaeva et al., 1993; Irkaeva and Ankudinova, 1994).
    [Show full text]
  • Strawberry Crop Vulnerability Statement
    USDA Fragaria Crop Vulnerability Statement 2017 Summary In 2014, about 8.1 million tonnes of strawberries, Fragaria L., were produced worldwide (FAOSTAT 2017). Strawberries are an economically important crop in the US. At 2.8 billion dollars, the US 2014 strawberry crop was valued second only to grapes among noncitrus fruits (USDA-NASS 2015). After China, the US is the second largest producer with approximately 17% of the world’s crop. California leads the nation in strawberry production with 91% of US strawberries produced on 68% of US strawberry production area, followed by Florida, the leading producer from December through February, with 7% of the crop from 18% of the US strawberry fields (USDA-NASS 2015). However, strawberries are grown widely throughout the US for a couple of reasons. They are highly perishable (Mitcham 2002) so that locally-grown strawberries are particularly valued by some consumers. They also are a valuable crop for growers at a national average of $46,737 gross per acre, ranging from $7,200 per acre in Pennsylvania to $59,850 in California (USDA-NASS 2015). The high value of strawberries is due in part because of their popularity. Strawberries rank as the fifth most popular fresh-market fruit in the United States (USDA-ERS 2012), with annual per capita consumption increasing steadily to 3.62 kg from 2002 to 2013 (USDA-ERS 2016). Strawberry species have a complex background including natural diploid, tetraploid, pentaploid, hexaploid, octoploid, enneaploid, and decaploid genomes. Centers for strawberry species diversity include Eurasia and North and South America. The primary cultivated gene pool is octoploid, and the hybrid berry that dominates the commercial market has only been developed within the last 260 years.
    [Show full text]
  • 2015 North American Strawberry Symposium & North American Strawberry Growers Association Annual Meeting
    2015 North American Strawberry Symposium & North American Strawberry Growers Association Annual Meeting Crowne Plaza Ventura Beach Ventura, California www.nasga.org An Invitation to the 2015 North American Strawberry Symposium fter a very successful symposium in Tampa, A multidisciplinary poster session will span the three days Florida in 2011 we are heading back to Ventura, of the conference, open to all attendees. A California, for the 8th North American Straw- The tour on February 6th will be a highlight of the confer- berry Symposium (NASS), hosted by the North American ence. It features visits to nearby University of California Strawberry Growers Association. It will have been eight research facilities; commercial farms with conventional, years since our last visit to Ventura County, and the berry organic, and tunneled substrate production of berry crops; industry has evolved significantly. The symposium is being and an insectary that raises beneficial insects. The tour held jointly with the 39th Annual Meeting of the North ends with a reception on the beach at our hotel. American Strawberry Growers Association (NASGA), and therefore should attract many growers and industry mem- On the behalf of Program Committee we eagerly invite bers who are the beneficiaries of research and are often growers, researchers, and students to come to California partners in research programs. in February to share your experiences and research, inter- act with scientists and growers from other parts of North The 8th NASS will provide an opportunity to discuss recent America and the world, and see the impressive strawberry progress in research and production and to explore the industry in southern California.
    [Show full text]
  • Chapter 2 Fragaria
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Department of Agriculture: Agricultural Publications from USDA-ARS / UNL Faculty Research Service, Lincoln, Nebraska 2011 Chapter 2 Fragaria K. E. Hummer USDA Agriculture Research Service, [email protected] Nahla Bassil USDA Agriculture Research Service Wambui Njuguna USDA Agriculture Research Service Follow this and additional works at: https://digitalcommons.unl.edu/usdaarsfacpub Hummer, K. E.; Bassil, Nahla; and Njuguna, Wambui, "Chapter 2 Fragaria" (2011). Publications from USDA- ARS / UNL Faculty. 1258. https://digitalcommons.unl.edu/usdaarsfacpub/1258 This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Publications from USDA-ARS / UNL Faculty by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Chapter 2 Fragaria Kim E. Hummer, Nahla Bassil, and Wambui Njuguna 2.1 Botany (Hedrick 1919;Staudt1962). Duchesne maintained the strawberry collection at the Royal Botanical Garden, 2.1.1 Taxonomy and Agricultural Status having living collections documented from various regions and countries of Europe and the Americas. He distributed samples to Linnaeus in Sweden. Strawberry, genus Fragaria L., is a member of the The present Fragaria taxonomy includes 20 named family Rosaceae, subfamily Rosoideae (Potter et al. wild species, three described naturally occurring 2007), and has the genus Potentilla as a close relative. hybrid species, and two cultivated hybrid species Strawberry fruits are sufficiently economically impor- important to commerce (Table 2.1). The wild species tant throughout the world such that the species is are distributed in the north temperate and holarctic included in The International Treaty on Plant Genetic zones (Staudt 1989, 1999a, b; Rousseau-Gueutin et al.
    [Show full text]
  • Breeding Better Fruits and Nuts, Station Bulletin, No.448
    University of New Hampshire University of New Hampshire Scholars' Repository NHAES Bulletin New Hampshire Agricultural Experiment Station 5-1-1958 Breeding better fruits and nuts, Station Bulletin, no.448 Yeager, A. F. Meader, E. M. New Hampshire Agricultural Experiment Station Follow this and additional works at: https://scholars.unh.edu/agbulletin Recommended Citation Yeager, A. F.; Meader, E. M.; and New Hampshire Agricultural Experiment Station, "Breeding better fruits and nuts, Station Bulletin, no.448" (1958). NHAES Bulletin. 410. https://scholars.unh.edu/agbulletin/410 This Text is brought to you for free and open access by the New Hampshire Agricultural Experiment Station at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in NHAES Bulletin by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. Mxhr^rp xxi Igrtcnlhir^^ MpCEcttugrlojgg Xlxbcral Hris BREEDING BETTER FRUITS AND NUTS By A. F. YEAGER and E. M. MEADER New Hampshire raspberry, a large, high-quality suminer bearing variety that grows well in the north. Station Bulletin 448 Agricultural Experiment Station University of New Hampshire Durham, New Hampshire May 1958 Breeding Better Fruits and Nuts By A. F. Yeaeer and E. M. Meader* bulletin covers the work with fruits and nuts of the Horti- THIS breeding cultural Department from 1950. when Station Bulletin 383 was issued, until 1957. The cooperation of many persons has made possible the develop- ment of the new improved varieties. Breeding of strawberries was done by L. P. Latimer previous to 1950. The varieties. Blaze. Strafford, and Jamberee tfiat resulted and which have been named since 1950.
    [Show full text]
  • Iowa State Journal of Research 58.4
    8 \ l o0.t C- oufiiil of Research ISSN0092-6345 May, 1984 1984 24 1984 anuary-March, 1983 'Polyploid Breeding" '· · ·, .. , ...... "'!TV from the.Editors.-.... ~v ·............................... 369 BRINGHURST, R. S. and V. VOTH. Breeding octoploid straw- berries . 3 71 DEWEY, D. R. Wide-hybridization and induced-polyploid breed- ing strategies for perennial grasses of the Triticeae tribe . 3 83 EINSPAHR, D. W. Production and utilization of triploid hybrid aspen................................................ 401 HERMSEN, J. G. Th. Nature, evolution, and breeding of poly- ploids . 411 HERMSEN, J. G. Th. Mechanisms and genetic implications of 2n-gamete formation.. 421 HERMSEN, J. G. Th. The potential of meiotic polyploidization in breeding allogamous crops.... 435 HERMSEN, J. G. Th. Haploids as a tool in breeding polyploids . 449 HERMSEN, J. G. Th. Some fundamental considerations on inter- specific hybridization . 461 Book Review. 4 7 5 Contents, Iowa State Journal of Research, Vol. 58 (August, 1983-May, 1984)........................... ... 477 IOWA STATE JOURNAL OF RESEARCH Published under the auspices of the Graduate College of Iowa State University EDITOR .......... ...................... DUANE ISEL Y (On Leave) ACTING EDITOR ........................... KENNETH G. MADISON BUSINESS MANAGER. ...................... .. MERRITT E. BAILEY ASSOCIATE EDITOR ... ..... ....................... PAUL N. HINZ ASSOCIATE EDITOR ........................... BRUCE W. MENZEL COMPOSITOR-ASSISTANT EDITOR ..........CHRISTINE V. McDANIEL Administrative Board N. L. Jacobson, Chairman M. E. Bailey, I.S.U. Press J. E. Galejs, l.S. U. Library Duane lsely, Editor W. H. Kelly, College of Sciences and Humanities W. R. Madden, Office of Business and Finance J. P. Mahlstede, Agriculture and Home Economics Experiment Station W. M. Schmitt, Information Service G. K. Serovy, College of Engineering Editorial Board G.
    [Show full text]
  • In North America Fletcher University of California at Los Angeles
    THE STRAWBERRY" IN NORTH AMERICA FLETCHER UNIVERSITY OF CALIFORNIA AT LOS ANGELES THE STRAWBERRY IN NORTH AMERICA THE MACMILLAN COMPANY HEW YORK BOSTON CHICAGO - DALLAS ATLANTA SAN FRANCISCO MACMILLAN & CO., Lmrrro LONDON BOMBAY CALCUTTA THE MACMILLAN CO. OF CANADA, LTD. THE STRAWBERRY IN NORTH AMERICA HISTORY, ORIGIN, BOTANY, AND BREEDING BY S. W. FLETCHER PROFESSOR OF HOSTICtfLTtRE AT "THE PENNSYLVANIA Wefo THE MACMILLAN COMPANY 1917 Att righto reserved COFTKIOHT, 1917, BY THE MACM1J.LAN COMPANY. ' Set up and elecuo'-jyvei*. ?luJ>d <Jurte, .9-7- J. 8. Gushing Co. Berwick A Smith Co. Norwood, Mass., U.S.A. ass 1 <ft PREFACE 6^ <\J THIS book completes a survey of the strawberry as ^3 grown in North America. Modern cultural methods are presented in a companion volume, "Strawberry- O Growing," and all of the more than 1800 North Ameri- can varieties are described in Technical Bulletin 11, & Virginia Agricultural Experiment Station, Blacksburg, en Virginia, "North American Varieties of the Strawberry." u-j The present volume deals mainly with the origin and his- ^ tory of the North American type one of the most ^ interesting chapters in our pomology. The assistance of many pomologists and cultivators is gratefully acknowledged, more especially of Matthew C Crawford, Cuyahoga Falls, Ohio. A number of the illus- *} trations are borrowed, for which acknowledgment is M made in the List of Illustrations. Ai S. W. FLETCHER. V STATE COLLEGE, PENNSYLVANIA, *J May 3, 1917. 253079 CONTENTS CHAPTER I PAOES EARLY HISTORY 1-34 Strawberries in colonial days ..... 1-6 Wild strawberries of Virginia .... 12 Wild strawberries of New England .
    [Show full text]
  • The Development of the Modern Strawberry (Fragaria X Ananassa): Physiology, Biochemistry and Morphology of Progenitor Species (F
    THE DEVELOPMENT OF THE MODERN STRAWBERRY (FRAGARIA X ANANASSA): PHYSIOLOGY, BIOCHEMISTRY AND MORPHOLOGY OF PROGENITOR SPECIES (F. VIRGINIANA AND F. CHILOENSIS) AND RESULTING CULTIVARS A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Rebecca M Harbut August 2009 © 2009 Rebecca M Harbut THE DEVELOPMENT OF THE MODERN STRAWBERRY (FRAGARIA X ANANASSA): PHYSIOLOGY, BIOCHEMISTRY AND MORPHOLOGY OF PROGENITOR SPECIES (F. VIRGINIANA AND F. CHILOENSIS) AND RESULTING CULTIVARS. Rebecca M Harbut, Ph. D. Cornell University 2009 The cultivated strawberry (Fragaria x ananassa) in the northeastern United States has seen limited improvement in yield over the past century. Narrow germplasm diversity has been suggested to be a possible limitation and has resulted in evaluation of the progenitor species: F. chiloensis and F. virginiana for desirable characteristics. One of the possible avenues explored to improve the productivity of the cultivated strawberry is to increase the photosynthetic capacity through the use of F. chiloensis which has a high photosynthetic capacity. Previous research has relied exclusively on gas exchange data to quantify photosynthetic capacity; however, due to the complexity of regulatory processes that influence gas exchange it is difficult to identify the basis of the different gas exchange rates observed. Evaluation of the strawberry cultivar ‘Jewel’ and the two progenitor species was conducted to determine the basis of the observed differences in photosynthetic capacity. Results of this research suggest that the high photosynthetic capacity of F. chiloensis may be a based on higher light use efficiency, determined by chlorophyll fluorescence, and increased activity of key enzymes of the Calvin Cycle.
    [Show full text]