Genomic Analysis of the Aromatic Catabolic Pathways from Silicibacter Pomeroyi DSS-3

Annals of Microbiology, 59 (4) 789-800 (2009)

Genomic analysis of the aromatic catabolic pathways from Silicibacter pomeroyi DSS-3

Dazhong YAN1, Jianxiong KANG2, Dong-Qi LIU2*

1School of Biology and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan, 430023; 2Center for Microbiology Engineering, School of Environmental Science and Engineering, Huazhong University of Science and Technology, No. 1037 Luoyue Road, Wuhan 430074, P.R. China

Received 16 June 2009 / Accepted 7 October 2009

Abstract - Genomic analysis of the catabolic potentialities of Silicibacter pomeroyi DSS-3 against a wide range of natural aromatic compounds and sequence comparisons with the entire genome of this microorganism predicted the existence of at least seven main pathways for the conversion of the aromatic compounds to the intermediates which enter into TCA cycle, that is, the catechol (cat I and cat II genes) and protocatechuate (pca genes) branches of the β-ketoadipate pathway, the phenylacetate pathway (paa genes), the gentisate pathway (gtd genes), the homogentisate pathway (hmg/hppD genes), as well as the homoprotocatechuate pathway (hpc genes). Furthermore, the genes encoding those enzymes involved in the peripheral pathways leading to the β-ketoadipate central pathway were also mapped, i.e., 4-hydroxybenzoate (pob), benzoate (ben), quinate (qui), phenylpropenoid compounds (fcs, ech, vdh, cal, van, acd and act), tyrosine (hpp) and n-phenylalkanoic acids (fad). Evidences showed that S. pomeroyi DSS-3 have versatile abili- ties to the catabolism of aromatic compounds either in anaerobic or in aerobic pathway, suggesting such a strain might be a model of heuristic value for the study of the genomic organization, the evolution of genes, as well as the catalytic or transcriptional mechanisms of enzymes for aromatic degradation in marine bacteria. Further, it would provide new insights into the biodegradation of aromatic compounds in marine bacteria and marine environments.

Key words: genomic analysis; aromatic catabolic pathways; Silicibacter pomeroyi DSS-3.

INTRODUCTION catabolism of central aromatic intermediates in this strain, they are the homogentisate pathway (hmg/fah/mai genes), the phe- Aromatic compounds, originating from biosynthesis, natural nylacetate pathway (pha genes), as well as catechol (cat genes) diagenesis, and human activity (Gibson, 1980), are the most and protocatechuate (pca genes) branches of the β-ketoadipate widespread class of organic compounds after carbohydrates pathway (Jimenez et al., 2002). It presents the possibility to and hence a common carbon source for many microorganisms explore the interconnection relationship of the aromatic catabolic (Harwood and Parales, 1996). It also has been aroused great network in this strain. interests in the mechanisms about microbial degradation of aro- As the genome of Silicibacter pomeroyi DSS-3, a Gram- matic compounds over the last several decades. Numerous bac- negative, and marine water isolated bacterium belonging to teria that are able to use aromatic compounds as sole sources of A-Proteobacteria group which was capable of mineralizing carbon and energy have been isolated from enrichment cultures, dimethylsulfoniopropionate (DMSP) and its related sulfur com- and furthermore, the genes involved in some of the degradative pounds (Gonzalez et al., 2003), has been sequenced (Moran et pathways were cloned and characterized in detail, such as sum- al., 2004), we carried out a genomic analysis of the genes or marized in the Biocatalysis/Biodegradation Database (Ellis et al., gene clusters which might be involved in the catabolism of aro- 2006). However, the genomic view on mineralization of aromatic matic compounds in this strain. The present study would further compounds in the versatile aromatic compounds-degrading bac- insights into aromatic ring cleavage in marine bacteria, and also terium which would facilitate the rational genetic manipulation of provide the possibility to develop a new useful model system for the strain for improving the biodegradation or biotransformation studying the catabolism of aromatic compounds. ability is very few for the lack of the genomic data. Previously, genomic analysis of the aromatic catabolism was performed on Pseudomonas putida KT2440, a soil bacterium, in which it MATERIALS AND METHODS revealed that there existed at least four main pathways for the Genome analysis. The nucleotide sequence of the entire * Corresponding Author. Phone: 86-27-87792512; Silicibacter pomeroyi DSS-3 genome was obtained from Genbank Fax: 86-27-87792172; E-mail: [email protected] (4, 109, 442 bp for the chromosome, accession number 790 D. YAN et al.

CP000031; 491, 611 bp for the megaplasmid, accession number the other exists in the magaplasmid (named pcaCII, 125 aa). The NC_006569). amino acid sequence of pcaCI and pcaCII shows 82% and 81% Protein sequence similarities analysis and the protein names sequence identity to the orthologue in Silicibacter sp. TM1040, identification were carried out using the BLAST programs respectively. Previous evidences showed that pcaD and pcaC (Altschul et al., 1997; Krauthammer et al., 2000). locate at different regions of the chromosome in different strains DNA statistics were analyzed by using DNA star (Clewley, (Jimenez et al., 2002), and further, pcaD is either contiguous to 1995). the pcaC gene, or fused to the latter. However, the arrangement Genomic island was predicted by Z curve (Zhang and Zhang, of pcaD and pcaC (I or II) is differing from the known orthologues 2005). described above. As detected in S. pomeroyi DSS-3, the gene encoding β-ketoadipate enolactone hydrolase (encoded by pcaD) is located at the magaplasmid, thus, in S. pomeroyi DSS-3, pcaD RESULTS AND DISCUSSION and pcaCII are presented in different regions of the megaplasmid. However, pcaD and pcaCI are located at the megaplasmid By sequences analysis it can be predicted that there were at and chromosome, respectively. least seven different pathways for the catabolism of aromatic It’s worth noting that analysis showed some ORFs are simi- compounds (Fig. 1, Table 1-6). Growth experiments showed that lar to the known genes which involved in the two downstream S. pomeroyi DSS-3 is able to grow in minimal medium containing pathways for the catabolism of catechol, named as cat I and cat tyrosine, phenylethylamine, coniferyl alcohol, p-coumarate, feru- II (Fig. 1; Table1 ). However, no ORFs share similarities to the late, benzoate, 3-hydroxybenzoate, p-hydroxybenzoate, phe- known muconolactone isomerase which catalyzes muconolactone nylacetate, phenylalanine, phenylethylamine, phenylalkanoate, to form β-ketoadipate enol-lactone, although ORFSPOA0044, salicylate, catechol, caffeate, vanillate and quinate as sole carbon a putative protocatechuate 3,4-dioxygenase β subunit (242 and energy source. Thereby the seven different pathways for the aa), shows 31% amino acid sequence identity to a catechol catabolism of aromatic compounds were functional substanti- 1,2-dioxygenase (278 aa) from Ralstonia solanacearum UW551 ated. (ZP_00946584). Therefore, whether cat I genes which involved in the catechol branch plays a role in the aromatic metabo- The β-ketoadipate central pathway lism of S. pomeroyi DSS-3, and whether the two branches Analysis of the genome of S. pomeroyi DSS-3 revealed that the (protocatechuate branch and catechol branch) will converge at ORFs (open reading frames) encoding the putative enzymes for β-ketoadipate enol-lactone as those in P. putida (Jimenez et al., the two branches of the β-ketoadipate central pathway (ortho- 2002), remain to be demonstrated. cleavage genes), i.e. the protocatechuate branch (pca genes) and the catechol branch (cat genes), showed significant similarity to Peripheral pathways leading to the β-ketoadipate central proteins from Roseobacter sp. MED193, Silicibacter sp. TM1040, pathway two of A-Proteobacteria isolated from seawaters (Table 1). The pathways of aerobic metabolism of benzoate generally fol- Former reports revealed that most of the cat genes of the low a well-established strategy for aerobic aromatic metabolisms catechol branch and the pca genes of the protocatechuate were described in detail (Dagley, 1978; Harwood and Parales, branch from the finished genomic sequence are organized in one 1996; Gescher et al., 2006). The ben genes which involved in or several clusters on the chromosome (Jimenez et al., 2002). the conversion of benzoate into catechol were also identified in However, in S. pomeroyi DSS-3, neither of the genes involved in P. putida and Acinetobacter sp. ADP1 (Collier et al., 1998; Cowles these two branches forms a gene cluster. They distribute either et al., 2000). As observed on the chromosome of S. pomeroyi in the chromosome and /or in the megaplasmid (Table 1). This DSS-3, the ben orthologues locate at positions of 1518-1523 kb, suggested that chromosome-plasmid cooperation is required these genes are not linked to the genes involved in the catechol for the β-ketoadipate central pathway in S. pomeroyi DSS-3. branch, similar to the arrangement of the ben genes in P. putida Similarly, pcaGH and dxnHI (named pcaIJ in other bacteria), KT2440 (Jimenez et al., 2002). Recently, a new pathway (box which encode separate subunits of ptotocatechuate 3, 4-dioxy- cluster) initiated by activation of benzoate to benzoyl-CoA has genase and 3-oxoadipate CoA-succinyl transferase, respectively, been described (Gescher et al., 2005). ORFs showing similarity are co-transcribed as the other bacteria (Harwood and Parales, to box cluster were observed in S. pomeroyi DSS-3 (Table1). 1996). Moreover, these gene products in S. pomeroyi DSS-3 Notably, only one ORF (OrfSPO0235, a putative aldehyde dehy- show significant amino acid sequence similarities to their ortho- drogenase) shows low amino acid sequence identity (29%) to the logues from Silicibacter sp. TM1040, another Silicibacter species, 3,4-dehydroadipyl-CoA aldehyde dehydrogenase (BoxD), which its genomic sequence has been finished recently (Unpublished, catalyzes the ring cleavage product 3,4-dehydroadipyl-CoA semi- accession number: NC_008044). This differs from P. putida aldehyde to form cis-3,4-dehyroadipyl-CoA, and then the com- KT2440, which shows lowest amino acid sequence identity to pound is further metabolized to lead to β-ketoadipate (Gescher those homologous genes products of the other Pseudomonas et al., 2006). However, previous reports revealed that the other strains, and this also indicated that ptotocatechuate 3, 4-dioxy- aldehyde dehydrogenases will fulfill the role of BoxD in the ben- genase and 3-oxoadipate CoA-succinyl transferase genes may be zoate degradation pathway, when orthologue to BoxD is inexist- relatively conservative in Silicibacter species. ent (Gescher et al., 2006). Thus, although no ORF was strongly Most of the known pcaIJF genes form an integrated gene similar to BoxD, ORFSPO0235 and the other aldehyde dehy- cluster (Jimenez et al., 2002), but in S. pomeroyi DSS-3, the drogenases might be the alternatives for the crucial enzymatic dxnGH (corresponding to pcaIJ) is not linked to pcaF, simi- activity in the catabolism of benzoate via benzoyl-CoA pathway lar to the arrangement of pcaF gene and pcaIJ in P. putida, in S. pomeroyi DSS-3. Moreover, two ORFs were observed to be Pseudomonas aeruginosa and Pseudomonas syringae (Jimenez similar to the enzymes responsible for the anaerobic transforma- et al., 2002). Moreover, sequence analysis showed that there are tion of benzyl alcohol/benzaldehyde to benzoate (Table 1). two γ-carboxymuconolactone decarboxylases (encoded by pcaC), On the megaplasmid, two ORFs were suggested to encode one is in chromosome (named pcaCI, 139 aa - amino acids), and 4-hydroxybenzoate 3-hydroxygenase (pobA, catalyzes the con- Ann. Microbiol., 59 (4), 789-800 (2009) 791

FIG. 1 - Predicted pathways for the catabolism of aromatic compounds in Silicibacter pomeroyi DSS-3. The enzymes involved are listed in Tables 1-6 and in the text. ? means that such biochemical step is lack of evidences from the genomic analysis. – means that such protein is unnamed. A: 2-Hydroxy-cis, cis-muconate semialdehyde; B: cis-2-Hydroxy-penta-2,4-dienoate; C: 4-Hydroxy-2-oxovalerate; D: trans,cis-5-Carboxymethyl-2-hydroxymuconate semialdehyde; E: trans,cis-5-Carboxy-methyl-2-hydroxymuconate; F: cis-5-Carboxymethyl-2-oxohex-3-ene-1,6-dioate; G: 2-Hydroxyhepta-trans,trans-2,4-diene-1,7-dioate; H: cis-2-Oxohept-3-ene-1,7-dioate; I: 2, 4-Dihydroxy-hept-trans-2-ene-1,7-dioate. ķ: HpaD (homoprotocatechuate 2,3-dioxygenase or 3,4-dihydroxyphenylacetate 2,3-dioxygenase); ĸ: HpcB (homoprotocatechuate 2,3-dioxygenase or 3,4-dihydroxyphenylacetate 2,3-dioxygenase); Ĺ: HpcC (5-carboxy-2-hydroxymuconate semialdehyde dehydrogenase); ĺ: SPOA0025 (5-carboxymethyl-2-hydroxymuconate delta-isomerase); Ļ: HpcD (5-carboxymethyl-2-hydroxymuconate delta-isomerase); ļ: SPO2435 (bifunctional isomerase/decarboxylase, C-terminal subunit); Ľ: SPOA0116 (bifunctional isomerase/decarboxylase, N-terminal subunit); ľ: SPOA0024 (2-oxo-hepta-3-ene-1,7-dioic acid hydratase); Ŀ: SPO3686 (2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase). 792 D. YAN et al.

TABLE 1 - The genes and their products involved in the β-ketoadipate central pathway from Silicibacter pomeroyi DSS-3 Gene Gene Related gene products a (orf No.) product Name Function Organism Identity Accession b (aa) (%) / aa No. SPO3696 568 Fcs Feruloyl-CoA synthetase Roseobacter sp. MED193 52/605 ZP_01055680 SPOA0046 389 PobA 4-Hydroxybenzoate 3-monooxygenase Roseobacter sp. MED193 69/389 YP_612556 SPOA0043 206 PcaG Protocatechuate 3,4-dioxygenase, A Roseobacter sp. MED193 78/206 ZP_01058065 subunit SPOA0044 242 PcaH Protocatechuate 3,4-dioxygenase, β Roseobacter sp. MED193 80/246 ZP_01054657 subunit SPOA0432 445 PcaB 3-Carboxy-cis,cis-muconate cyclois- Roseobacter sp. MED193 64/445 ZP_01054577 omerase SPO2768 139 PcaC1 4-Carboxymuconolactone decarboxy- Silicibacter sp. TM1040 82/127 YP_612750 lase SPOA0045 125 PcaC2 4-Carboxymuconolactone decarboxy- Silicibacter sp. TM1040 81/134 YP_612554 lase SPO1450 158 BenA Benzoate 1,2-dioxygenase, β subunit Jannaschia sp. CCS1 82/159 YP_509286 SPO1451 441 BenB Benzoate 1,2-dioxygenase, A subunit Jannaschia sp. CCS1 79/436 YP_509285 SPO1452 308 BenC Ferredoxin Jannaschia sp. CCS1 59/322 YP_509284 SPO1447 240 - 2,3-Dihydro-2,3-dihydroxybenzoate Brucella suis 1330 34/258 NP_699220 dehydrogenase SPO3688 326 - Catechol 2,3-dioxygenase Silicibacter sp. TM1040 84/326 ZP_00623447 SPO3667 376 CatB Muconate cycloisomerase I Jannaschia sp. CCS1 70/371 YP_509350 SPOA0434 262 CatD 3-Oxoadipate enol-lactone hydrolase Roseobacter sp. MED193 77/263 ZP_01054579 SPO3082 234 DxnG β-Ketoadipate:succinyl CoA trans- Loktanella vestfoldensis SKA53 87/234 ZP_01003986 ferase (3-oxoadipate CoA-succinyl transferase), A subunit SPO3083 208 DxnH 3-Oxoadipate CoA-succinyl trans- Loktanella vestfoldensis SKA53 92/212 ZP_01003987 ferase, β subunit SPO0758 400 PcaF β-Ketoadipyl CoA thiolase Roseobacter sp. MED193 88/400 ZP_01057509 SPOA0027 502 - 2-Hydroxymuconate semialdehyde Jannaschia sp. CCS1 84/515 YP_511445 hydrolase SPOA0024 266 - 2-Oxopent-4-enoate hydroatase Novosphingobium aromaticivorans 78/266 YP_511441 SPO3686 256 - 4-Hydroxy-2-oxovalerate aldolase Roseobacter denitrificans OCh 114 57/256 YP_680714 SPO3703 372 BoxA Benzoyl-CoA oxygenase, A subunit Rhodobacterales bacterium 71/397 ZP_01012910 HTCC2654 SPO3701 483 BoxB Benzoyl-CoA oxygenase, B subunit Rhodobacterales bacterium 87/483 ZP_01012912 HTCC2654 SPO3700 553 BoxC Benzoyl-CoA-dihydrodiol lyase (BoxC) Burkholderia xenovorans LB400 58/556 YP_559584 SPO0235 504 - 3,4-Dehydroadipyl-CoA aldehyde Azoarcus evansii 29/515 AAN39373 dehydrogenase (BoxD) SPO0097 483 - Benzaldehyde dehydrogenase Pseudomonas putida KT2440 43/492 NP_744100 SPO3850 370 - Benzyl alcohol dehydrogenase Azoarcus sp. EbN1 34/362 YP_158805 SPO1508 606 - Quinate-shikimate dehydrogenase Ralstonia eutropha H16 61/580 CAJ95838 (QuiA) SPO1426 366 - Dehydroshikimate dehydratase Pseudomonas putida KT2440 32/635 NP_744699 (3-dehydroshikimate dehydratase) SPO1973 150 - Type Ċ dehydroquinate dehydratase Sulfitobacter sp. EE-36 79/145 ZP_00954892 (QutE) a Open reading frame number in the chromosome and egaplasmid. b aa, number of amino acids.

version of 4-hydroxybenzoate to protocatechuate) and the pca showing 75% amino acid identity to 2-hydroxychromene-2-car- operon transcriptional activator (pcaQ), respectively. They are boxylate isomerase from Silicibacter sp. TM1040 (YP_614068), linked to each other, and forming a gene cluster with the other was detected. But no other ORFs show strong identity to the genes involved in the pca branch (Table 1). This suggested that rest of the known nah genes which are involved in the naphtha- the pobA gene may be co-transcribed with pca genes. pcaQ lene and phenanthrene pathways (Eaton and Chapman, 1992; belongs to the LysR family, unlikely to the transcriptional activa- Kiyohara et al., 1994). tors from Acinetobacter sp. ADP1 (IcIR family), and Pseudomonas Quinate can be converted into protocatechuate with a set of strains (XylS/ArcC family) (Jimenez et al., 2002). enzymes encoded by the Qui genes which have been reported in ORFSPO2510 encoding a protein of 388 aa that is homol- Acinetobacter sp. ADP1 (Elsemore and Ornston, 1995). It con- ogous to salicylate 1-monooxygenase, a well-characterized tains a quinate-shikimate dehydrogenase (QuiA) which catalyze naphthalene-degrading enzyme in bacteria which transforms quinate and shikimate to yield 3-dehydroquinate and dehydro- salicylate into catechol (Fig. 1). Moreover, NahD (OrfSPO3158), shikimate, respectively, a dehydroshikimate dehydratase which Ann. Microbiol., 59 (4), 789-800 (2009) 793

TABLE 2 - The genes and their products involved in the catabolism of phenylpropeniod compounds in Silicibacter pomeroyi DSS-3 Gene Gene Related gene products a (orf No.) product Name Function Organism Identity Accession No. b (aa) (%) / aa SPO3696 568 Fcs Feruloyl-CoA synthetase Roseobacter sp. MED193 52/605 ZP_01055680 SPO2706 273 Ech p-Hydroxycinnamoyl CoA hydratase Xanthomonas oryzae pv. oryzae 33/275 YP_452549 MAFF 311018 SPOA0275 486 Vdh Vanillin dehydrogenase Pseudomonas putida KT2440 39/482 NP_745497 SPO0142 391 Aat β-Ketothiolase Roseobacter sp. MED193 86/391 ZP_01057994 SPO0575 385 AcdA-1 Acyl-CoA dehydrogenase Roseobacter sp. MED193 61/380 ZP_01057792 SPO0582 385 AcdA-2 Acyl-CoA dehydrogenase Oceanicola batsensis HTCC2597 76/385 ZP_01000117 SPOA0288 386 AcdA-3 Acyl-CoA dehydrogenase Roseovarius sp. 217 89/386 ZP_01035185 SP O3681 380 VanA Vanillate O-demethylase Acinetobacter sp. ADP1 32/351 YP_045216 oxygenase subunit SPOA0133 314 VanB Vanillate O-demethylase Bradyrhizobium sp. BTAi1 54/316 ZP_00863504 oxidoreductase SPO2427 240 CalA Alcohol dehydrogenase Geobacillus thermoleovorans 35/249 BAA94092 SPO3328 503 CalB1 Coniferyl aldehyde Pseudomonas putida KT2440 32/476 NP_747221 dehydrogenase SP O3368 777 CalB2 Coniferyl aldehyde dehydrogenase Acinetobacter sp. ADP1 33/482 CAG67430 SPO0097 483 CalB3 Coniferyl aldehyde dehydrogenase Burkholderia thailandensis E264 32/472 YP_440750 a Open reading frame number in the chromosome and megaplasmid. b aa, number of amino acids.

TABLE 3 - The genes and their products involved in the phenylcetate pathway from Silicibacter pomeroyi DSS-3 Gene Gene Related gene products a (orf No.) product Name Function Organism Identity Accession No. b (aa) (%) / aa SPO3597 449 - Putative amine oxidase (flavin-con- Synechocystis sp. PCC 6803 39/458 BAD01863 taining) (MaoA) SPOA0112 504 FeaB Phenylacetaldehyde dehydrogenase Pseudomonas fluorescens Pf-5 58/495 AAY92486 SPO0742 436 PaaF Phenylacetate-CoA ligase Roseobacter sp. MED193 93/436 ZP_01054484 SPO0753 357 PaaK Component of a predicted Roseobacter sp. MED193 80/357 ZP_01057515 Phenylacetate-CoA oxygenase, oxidoreductase unit SPO0754 153 PaaJ Component of a predicted Roseobacter sp. MED193 74/157 ZP_01057514 Phenylacetate-CoA oxygenase SPO0755 253 PaaI Component of a predicted Roseobacter sp. MED193 79/257 ZP_01057513 Phenylacetate-CoA oxygenase SPO0756 94 PaaH Component of a predicted Roseobacter sp. MED193 95/94 ZP_01057512 Phenylacetate-CoA oxygenase SPO0757 330 PaaG Component of a predicted Silicibacter sp. TM1040 78/330 YP_611953 Phenylacetate-CoA oxygenase SPO0752 252 PaaG’ Component of a predicted Roseobacter sp. MED193 73/253 ZP_01057516 Phenylacetate-CoA oxygenase SPO0739 681 PaaC 3-Hydroxyacyl-CoA dehydrogenase Roseovarius nubinhibens ISM 51/653 ZP_00958986 SPO0740 261 PaaB Enoyl-CoA hydratase/isomerase Roseobacter sp. MED193 84/261 ZP_01054482 SPO0735 673 PaaZ Ring-opening enzyme Roseobacter sp. MED193 81/676 ZP_01054481 SPO0741 142 PaaD Predicted thioesterase Roseobacter sp. MED193 80/143 ZP_01054483 SPO1810 594 PhaJ Phenylacetic acid transporter Pseudomonas putida KT2440 30/520 AE016519 SPO0734 266 PaaX PaaX domain protein Roseobacter sp. MED193 58/263 ZP_01054480 SPO0758 400 PaaE β-Ketoadipyl CoA thiolase Roseobacter sp. MED193 88/400 ZP_01057509 SPO0762 216 PaaY Transcriptional regulator, GntR family Roseobacter sp. MED193 73/216 ZP_01057504 SPO2697 697 FadD Putative acyl-CoA synthetase Pseudomonas aeruginosa 42/696 ZP_00141450 UCBPP-PA14 SPO0773 391 FadA1 Acetyl-CoA C-acyltransferase Caulobacter sp. K31 74/395 ZP_01417869 (FadA, 3-ketoacyl-CoA thiolase) SPO2918 403 FadA2 Acetyl-CoA C-acyltransferase Roseobacter sp. MED193 92/403 ZP_01055957 SPO0772 698 FadB Enoyl-CoA hydratase/isomerase/ Roseobacter sp. MED193 75/697 ZP_01058826 3-hydroxyacyl-CoA dehydrogenase a Open reading frame number in the chromosome and megaplasmid. b aa, number of amino acids. 794 D. YAN et al.

TABLE 4 - The genes and their products involved in the gentisate pathway from Silicibacter pomeroyi DSS-3 Gene Gene Related gene products a (orf No.) product Name Function Organism Identity Accession No. b (aa) (%) / aa SPO3690 344 GtdA-1 Gentisate 1,2-dioxygenase Rhodobacterales bacterium HTCC2654 75/344 ZP_01013505 SPOA0115 374 GtdA-2 Gentisate 1,2-dioxygenase Bradyrhizobium japonicum USDA 110 66/368 NP_770052 SPO3691 232 - Fumarylacetoacetate hydrolase Roseobacter sp. MED193 70/232 EAQ46506 family protein SPO3692 395 - 3-Hydroxybenzoate 6-hydroxylase Pseudomonas alcaligenes 54/394 AAG39455.1| SPO0679 213 - Maleylpyruvate isomerase Ralstonia solanacearum UW551 44/216 ZP_00946277 a Open reading frame number in the chromosome and megaplasmid. b aa, number of amino acids.

TABLE 5 - The genes and their products involved in the homogentisate pathway from Silicibacter pomeroyi DSS-3 Gene Gene Related gene products a (orf No.) product Name Function Organism Identity Accession No. b (aa) (%) / aa SPO3720 394 TyrB Aromatic amino acid aminotransferase Silicibacter sp. TM1040 77/394 ZP_00623416 SPO1426 366 HppD 4-Hydroxyphenylpyruvate dioxygenase Silicibacter sp. TM1040 85/366 ZP_00620300 SPO0686 451 HmgA Homogentisate 1,2-dioxygenase Silicibacter sp. TM1040 91/451 ZP_00623402 SPO0679 213 HmgC Maleylacetoacetate isomerase Roseobacter sp. MED193 76/213 ZP_01058643 SPO0685 417 HmgB Fumarylacetoacetase Roseobacter sp. MED193 87/424 ZP_01058638 a Open reading frame number in the chromosome and megaplasmid. b aa, number of amino acids.

TABLE 6 - The genes and their products involved in the homoprotocatechuate pathway from Silicibacter pomeroyi DSS-3 Gene Gene Related gene products a (orf No.) product Name Function Organism Identity Accession No. b (aa) (%) / aa SPO2711 166 - 4-Hydroxyphenylacetate Xanthobacter autotrophicus Py2 33/169 ZP_01197346 3-monooxygenase small chain SPO3688 326 HpaD Homoprotocatechuate Silicibacter sp. TM1040 84/326 YP_611701 2,3-Dioxygenase (3,4-dihydroxyphenylacetate 2,3-dioxygenase) SPOA0026 283 HpcB 3,4-Dihydroxyphenylacetate Roseobacter sp. MED193 88/283 ZP_01056611 2,3-dioxygenase SPOA0027 502 HpcC 5-Carboxy-2-hydroxymuconate Jannaschia sp. CCS1 84/515 YP_511445 semialdehyde dehydrogenase SPOA0025 283 - 5-Carboxymethyl-2- Silicibacter sp. TM1040 72/285 YP_611699 hydroxymuconate delta-isomerase SPOA0320 125 HpcD 5-Carboxymethyl-2- Roseobacter sp. MED193 72/134 ZP_01056609 hydroxymuconate delta isomerase SPO2435 281 - Bifunctional isomerase/decarboxy- Burkholderia pseudomallei 38/254 YP_337415 lase, C-terminal subunit 1710b SPOA0116 305 - Bifunctional isomerase/decarboxy- Burkholderia pseudomallei 30/229 YP_337414 lase, N-terminal subunit 1710b SPOA0024 266 - 2-oxo-hepta-3-ene-1,7-dioic acid Jannaschia sp. CCS1 78/266 YP_511441 hydratase SPO3686 256 - 2,4-Dihydroxyhept-2-ene-1, 7-dioic Roseobacter sp. MED193 61/352 ZP_01056614 acid aldolase SPOA0023 218 - Transcriptional regulator, TetR family Sulfitobacter sp. EE-36 48/211 ZP_00956035 a Open reading frame number in the chromosome and megaplasmid. b aa, number of amino acids.

transforms 3-dehydroshikimate into protocatechuate, as well Phenylpropenoid compounds such as ferulate, coumarate, as a type II dehydroquinate dehydratase (QutE) which converts and cinnamate, etc., formed from the natural turnover of lignin 3-dehydroquinate into 3-dehydroshikimate. In S. pomeroyi DSS- and suberin, are the carbon sources for some soil microorgan- 3, ORFs expected to be the Qui gene orthologues which might isms (Jimenez et al., 2002). Previous reports revealed that the be involved in quinate metabolism were listed (see Table 1). All metabolism of ferulate follows a CoA-dependent non-β-oxidative these data showed that quinate catabolism in S. pomeroyi DSS-3 pathway which contains feruloyl-CoA synthetase (Fcs) and enoyl- would be similar to those in Acinetobacter sp. ADP1. CoA hydratase/aldolase (EcH), yielding vanillin (Overhage et al., Ann. Microbiol., 59 (4), 789-800 (2009) 795

1999; Jimenez et al., 2002). Vanillin is further transformed into to the known genes involved in this pathway were listed (see protocatechuate by the catalysis of an aldehyde dehydrogenase Table 3). (encoded by vdh gene) and a vanillate-O-demethylase (encoded Previous work described that the degradation of n-phenyla- by vanAB genes) (Priefer et al., 1997; Segura et al., 1999; lkanoic acids can be transformed to phenylacetate-CoA with the Jimenez et al., 2002) (Fig. 1). In S. pomeroyi DSS-3, gene ortho- catalysis of FadD (acyl-CoA synthetase), FadF (acyl-CoA dehy- logues (fcs/ech/vdh genes and van genes) involved in the metab- drogenase), as well as the complex of FadAB (fused 3-hydroxy- olism of phenylpropenoid compounds were observed (Table 2), butyryl-CoA epimerase/delta (3)-cis-delta (2)-trans-enoyl-CoA but neither of them forming a gene cluster or clusters, as those isomerase/enoyl-CoA hydratase/3-hydroxyacyl-CoA) (Olivera et in the other strains describes in the previous reports (Venturi et al., 2001). The orthologues to FadD, FadF and FadAB were also al., 1998; Overhage et al., 1999; Jimenez et al., 2002), nor they detected in S. pomeroyi DSS-3 (Table 3). are linked to each other. CoA-dependent β-oxidative pathway of ferulate catabolism has been demonstrated (Priefert et al., The gentisate pathway 2001). Orthologues of β-ketothiolase (AaT) and acyl-CoA dehy- A set of genes might encode catabolic pathway for aerobic drogenase (Acd), the two enzymes responsible for this pathway metabolism of 3-hydroxybenzoate (3-HBA) is predicted in were also detected in S. pomeroyi DSS-3 (Table 2). Catabolism strain S. pomeroyi DSS-3 based on the previous works (Jones of p-coumarate and caffeate via p-hydroxybenzoate and pro- and Cooper, 1990; Zhou et al., 2001; Gao et al., 2005; Shen et tocatechuate pathway, respectively, with the catalysis of Fcs, al., 2005) (Table 4). It’s been known that there are three down- Ech and Vdh have been described (Venturi et al., 1998; Mitra stream routes for the further catalysis of maleylpyruvate, the et al., 1999), and the degradation of these two compounds in product from gentisate 1, 2-dioxygenase, namely, maleylpyru- S. pomeroyi DSS-3 was suggested to agree well with these two vate is either cleaved directly to form pyruvate and maleate by pathways. Alcohol dehydrogenase (CalA) and aldehyde dehydro- the enzyme maleylpyruvate hydrolase (Bayly et al., 1980) or genase (CalB) catalyze the conversion of coniferyl alcohol into converted to fumarylpyruvate with maleylpyruvate isomerase ferulate (Overhage et al., 1999). In S. pomeroyi DSS-3, some glutathione-independent (Crawford and Frick, 1977; Hagedorn ORFs share similarities to the known CalA or CalB (Table 2), but and Chapman, 1985; Hagedorn et al., 1985; Shen et al., for the low sequence identity, it’s remaining to verify the function 2005) or glutathione-dependent (Lack, 1959, 1961; Crawford of these two gene products. and Frick, 1977; Ishiyama, 2004). The fumarylpyruvate is then cleaved to fumarate and pyruvate by fumarylpyruvate The phenylacetyl-CoA pathway hydrolase (Bayly et al., 1980; Poh and Bayly, 1980; Jonesand Aerobic catabolism of phenylacetate in microbe is a hybrid path- Cooper, 1990; Robson et al., 1996; Zhuang et al., 2004). way for the first step in which the conversion of phenylacetate In strain DSS-3, orfSPO3692 and gtdA-1 were predicted to into phenylacetyl-CoA is catalyzed by phenylacetate-CoA ligase, encode 3-HBA-6-hydroxygenase and gentisate 1,2-dioxygen- and then phenylacetyl-CoA is further decomposed following ase, respectively. orfSPO3691, forming a gene cluster with orf- the conventional routes of aromatic compounds biodegradation SPO3692 and gtdA-1, shows 53% amino acid sequence identity (Jimenez et al., 2002). The genes (paa genes) involved in the to a fumarylpyruvate hydrolase from Polaromonas naphtha- phenylacetate degradation were observed in the chromosome of lenivorans CJ2, suggesting that it might catalyze the product S. pomeroyi DSS-3 (Table 3). Beside the orfSPO0739 (encoding from the predicted maleylpyruvate isomerase (OrfSPO0679, an enoyl-CoA hydratase/isomerase/3-hydroxyacyl-CoA dehy- shows 44% to the maleylpyruvate isomerase from Ralstonia drogenase), the rest of the paa genes form a cluster which can solanacearum UW551) to form fumarate and pyruvate. Thus, be divided into six putative functional units: paaBCDE and paaF these four genes were expected to encode the enzymes are responsible to β-oxidation and activation of phenylacetate, responsible for the conversion of 3-HBA into metabolites that respectively; orfSPO1810 and paaZ are phenylacetate trans- enter into TCA cycles. porter and aromatic ring-opening enzyme; paaX and paaY are the regulator of the paa cluster. Interestingly, analysis showed The homogentisate central pathway and the catabolism that there are two ORFs show strong similarity to the known of tyrosine PaaG, component of a predicted phenylacetate-CoA oxygenase Previous work has been elucidated that the homogentisate path- (see Table 3), it’s a unique feature comparing with the formerly way is a central catabolic pathway involved in the degradation reports (Fig. 2). Although the genes encoding phenylacetate- of L-phenylalanine, L-tyrosine, and 3-hydroxyphenylacetate in P. CoA and phenylacetate oxygenase are ubiquitously in bacteria, putida (Arias-Barrau et al., 2004). Firstly, phenylalanine is con- the porin and transporter for phenylacetate uptake are absent verted into tyrosine by the catalysis of pterin-dependent pheny- in most of the phenylacetate-utilizing bacteria (Jimenez et al., lalanine hydroxylase (PhhA), in the presence of the phenylalanine 2002). In S. pomeroyi DSS-3, it’s observed that OrfSPO1810 hydroxylase-stimulating protein/ pterin-4alpha-carbinolamine (594 aa) might encode the transporter for phenylacetic acid, but dehydratase (Song and Jensen, 1996), and then tyrosine ami- the orthologue of the porin could not be identified. Furthermore, notransferase (TyrB) catalyzes the conversion of tyrosine into paaX (encoding a putative phenylacetic acid degradation operon 4-hydroxyphenylpyruvate, homogentisate (Hpd) is subsequently negative regulatory protein) and paaY (a transcriptional regulator formed by the catalysis of 4-hydroxyphenylpyruvate dioxgenase of the GntR family) locate at 3’ and 5’ of the paa cluster, respec- (HppD). Homogentisate is then catabolized by a central catabolic tively. The arrangement of these two genes is also observed in pathway that involves three enzymes, homogentisate dioxy- Azoarcus evansii and Bacillus halodurans (Fig. 2). genase (HmgA), fumarylacetoacetate hydrolase (HmgB), and Phenylethylamine can be transformed into phenylacetal- maleylacetoacetate isomerase (HmgC), finally yielding fumarate dehyde by an amine oxidase (MaoA), and subsequently, a and acetoacetate (Sparnins and Chapman, 1976). Interestingly, phenylacetaldehyde dehydrogenase (PadA or FeaB) oxidizes OrfSPO3733, showing 81% to pterin-4alpha-carbinolamine dehy- the latter to phenylacetate (Parrot et al., 1987). Phenylacetate dratase from Roseobacter denitrificans OCh 114 (YP_681298), is then metabolized further via phenylacetate-CoA pathway as was observed on the chromosome. However, the homologous described above. ORFs from S. pomeroyi DSS-3 homogenous to pterin-dependent phenylalanine hydroxylase, could not be 796 D. YAN et al.

FIG. 2 - Gene organization of the paa cluster of Silicibacter pomeroyi DSS-3 and the equivalent clusters from other bacteria (Jimenez et al., 2002, revised). Genes (listed in Table 3) are represented by arrows: black (regulatory genes), stippled (transport genes), vertically striped (genes involved in the presumed dearomatization step), horizontally striped (genes encoding the multicomponent phenylacetyl-CoA oxygenase), hatched (genes encoding the β-oxidation-like functional unit), cross-hatched (genes encoding the phenylacetyl-CoA ligase). Arrowheads indicate the REP element. Two vertical lines mean that the genes are not adjacent in the genome. Note the existence of two different nomenclatures (pha and paa clusters): phaE corresponds to paaK and paaF, phaFOGHI correspond to paaABCDE and paaKJIHG(or G’), phaL corresponds to paaZ, and phaMN correspond to paaYX respectively. paaZ′, phaL′, and phaC ′ indicate a 3′ end truncated gene. The references of the sequences are as follows: Sinorhizobium meliloti strain 1021 (accession no. AL603647) (Galibert et al., 2001); A. evansii strain KB740 (accession no. AF176259, AJ278756) (Mohamed et al., 2002); E. coli W (accession no. X97452) (Ferrández et al., 1998); B. halodurans strain C-125 (accession no. AP001507) (Takami et al., 2000); B. pseudomallei (accession no. NC_007434); P. putida strain KT2440 (accession no. NC_002947) (Jimenez et al., 2002). detected neither on the chromosome, nor on the magaplasmid. the second pathway (Adachi et al., 1964; Blakley et al., 1967; Analysis indicated that ORFs involved in putative homogentisate Dagley et al., 1968), 4-hydroxyphenylacetate was subsequently pathway from S. pomeroyi DSS-3 showed significant identities hydroxylased and formed 3, 4-dihydroxyphenylacetate (homo- to the known homogentisate pathway genes, but not all of the protocatechuate). The genes encoding the homoprotocatechuate homologous genes coding these catabolic enzymes are clustered pathway from Escherichia coli C (hpc cluster) and E. coli W (hpa together (Table 5), this is unlike to the homogentisate pathway cluster) have been cloned and sequenced (Jenkinsand Cooper, genes from P. putida KT2440, P. aeruginosa, Pseudomonas 1988; Roper et al., 1993; Prieto et al., 1996). In S. pomeroyi fluorescens, as well as Sinorhizobium meliloti (Milcamps and de DSS-3, ORFs showing strong identities to the known enzymes Bruijn, 1999; Jimenez et al., 2002). were observed (Table 5). Moreover, two ORFs were similar to the C-terminal subunit and N-terminal subunit of the bifunctional The homoprotocatechuate pathway isomerase/decarboxylase, but the sequence identity is very Two metabolic pathways were described for the aerobic deg- low (30-38%), maybe for the scarceness of the related protein radation of 4-hydroxyphenylacetate by microorganisms, one sequences available in GenBank (only two of these two subunits of which is initiated by hydroxylation, leading to the forma- from Burkholderia thailandensis E264 and Burkholderia pseu- tion of homogentisate (Kunita, 1955; Blakley, 1972), and then domallei 1710b available). Moreover, although ORFSPO2711 being converted into fumarate and acetoacetate (Chapman showing 35% to the small subunit of 4-hydroxyphenylacetate and Dagley, 1962). The genes involved in the homogentisate 3-monooxygenase was observed, ORFs homologous to the large pathway in S. pomeroyi DSS-3 were described above. As to subunit could not be detected. Ann. Microbiol., 59 (4), 789-800 (2009) 797

FIG. 3 - The cumulative GC profile for the Silicibacter pomeroyi DSS-3 genome (Unit: kb). The dashed means the genomic island.

Evolutionary analysis and general conclusions aromatic catabolic clusters from P. putida strains (Houghton It’s was observed that the G+C content of the clusters involved et al., 1995; Aranda-Olmedo et al., 2002; Jimenez et al., in the catabolism of aromatic compounds in S. pomeroyi DSS-3, 2002). REP sequences were screened base on the genomic i.e., cat I, paa, hmg, as well as gtd, averaged as 63.60, 65.29, sequence of S. pomeroyi DSS-3 (Table 7). It’s found that 64.08 and 65.85, respectively. These G+C contents were closely REP1 and REP2 linked to the genes involved in aromatic to the mean content of G+C of the S. pomeroyi DSS-3 (63.5). compounds degradation, i.e., REP1 presents at 5’ side of the The cat II, pca, and hpc pathway were excluded for the genes gene encoding β-ketoadipyl CoA thiolase, and REP2 exists at involved in the corresponding pathway were discretely distrib- 3’ end of a gene encoding maleylacetoacetate isomerase, at uted on chromosome and megaplasmid. Previous work indicated 5’ end of a gene encoding enoyl-CoA hydratase/isomerase, that genomic island contains cluster of horizontally transferred respectively. genes (Zhang and Zhang, 2005). In present study, five genomic Aromatic transporter, which might facilitate assimilation islands were detected in the genome of S. pomeroyi DSS-3 (Fig. of related aromatic compounds in bacterium, was observed 3), but further analysis showed that all of the genes predicted to in the aromatic catabolic clusters (Nichols and Harwood, be involved in the catabolism of aromatic compounds as above 1997; Jimenez et al., 2002), e.g., PcaK has been proved to were beyond these islands. Thus, combining with the evidences be bifunctional permease, namely, it act either as a permease of G+C content and genomic islands, it can be suggested that the for transporting aromatic compounds into bacterium cell, or cat I, paa, hmg, as well as gtd genes have been harbored in this as a chemotactic factor for mediating the cells moving to the strain over a long time of evolutional process. related aromatic compounds presenting in the environments Genes encoding enzymes for the catabolism of aromatic com- (Nichols and Harwood, 1997) . Interestingly, only two ORFs pounds in S. pomeroyi DSS-3 show low amino sequence identity with strong homology to known aromatic transporters were to those from the extensively used strain, e.g., Pseudomonas observed (benzoate transporter, OrfSPO3378); phenylacetate sp. (data not shown), this would arouse interesting discussions transporter, OrfSPO1810), suggesting that the organism concerning the catalytic mechanism of these enzymes compared assimilates the other aromatic compounds might be just by with those from the previous reports. Moreover, in S. pomeroyi passive diffusion, or by some novel permeases. Moreover, DSS-3, all the genes involved in aromatic catabolism are dis- previous work has been shown that no ORFs with significant tributed along 70-400kb of the chromosome (about 8% of the identity to the known chemotaxis proteins or methyl- chromosome), and further, it revealed that no catabolic island accepting chemotaxis transducers, although S. pomeroyi formed with these genes which show low level of linkage between DSS-3 is motile and is potentially able to position itself in each other (Tables 1-6), similar to the distribution of those favourable microniches, suggesting that the organism is homologous genes in Pseudomonas putida KT2440 (Jimenez et motile but not chemotactic or that chemotaxis occurs by an al., 2002). unknown mechanism (Moran et al., 2004). Repetitive extragenic palindromic (REP) sequence, which Redundancy in peripheral metabolic pathways was suggested might be involved in the function in RNA and DNA physiology to be an important theme in the large-genome environmen- (Tobes and Ramos, 2005), was previously detected in some tal isolates, and it would be provide a selective advantage for

TABLE 7 - REP sequences in Silicibacter pomeroyi DSS-3 ID REP sequence Copy number in megaplasmid Copy number in chromosome Total copies REP1 AGAAAATTCGTCGAATTTTCT 0 11 11 REP2 CGTTTTCCGTGCCGGAAAACG 0 12 12 REP3 AGATTTTTCGTCGAAAAATCT 1 22 23 798 D. YAN et al.

the catabolism of the related compounds (Denef et al., 2006). REFERENCES It’s been shown that the presence of multiple pathways in Rhodococcus sp. strain RHA1 (pathways for the catabolism of Adachi K., Takeda Y., Senoh S., Kita H. (1964). Metabolism of phthalate, terephthalate, and ethybenzene; ~9.7 Mbp of the p-hydroxyphenylacetic acid in Pseudomonas ovalis. Biochim. genome) (Kitagawa et al., 2001; Patrauchan et al., 2005); in Biophys. Acta, 93: 483-493. Ralstonia eutropha JMP134 (pathways for the degradation of Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., chloroaromatic compounds; ~7.3 Mbp of the genome) (Laemmli Miller W., Lipman D.J. (1997). Gapped BLAST and PSI-BLAST: et al., 2004); in Burkholderia xenovorans LB400 (pathways for a new generation of protein database search programs. the mineralization of benzoate, ~9.7Mbp of the genome) (Denef Nucleic Acids Res., 25: 3389-3402. et al., 2006). However, in S. pomeroyi DSS-3, although with the Aranda-Olmedo I., Tobes R., Manzanera M., Ramos J.L., Marqués smaller genome (~4.6 Mbp), it’s also showing the redundancy S. (2002). Species-specific repetitive extragenic palindromic metabolic pathways of benzoate (one for ben-cat and one for (REP) sequences in Pseudomonas putida. Nucleic Acids Res., box) and 4-hydroxyphenylacetate (via homogentisate path- 30: 1826-1833. way and homoprotocatechuate pathway, respectively) (Fig. 1). Moreover, redundant genes involved in aromatic catabolism were Arias-Barrau E., Olivera E.R., Luengo J.M., Fernandez C., Galan also detected, e.g., pcaC I and pcaC II (both encoding 4-carboxy- B., Garcia J.L., Diaz E., Minambres B. (2004). The homoge- muconolactone decarboxylase) (table 1), acdA-1, acdA-2, as well ntisate pathway: a central catabolic pathway involved in the as acdA-3 (all of them encoding acyl-CoA dehydrogenase), paaG degradation of L-phenylalanine, L-tyrosine, and 3-hydroxy- and paaG’ (both encoding component of a predicted phenylac- phenylacetate in Pseudomonas putida. J. Bacteriol., 186: etate-CoA oxygenase), gtdA-1 and gtdA-2 (both encoding gen- 5062-5077. tisate 1,2-dioxygenase), ORFSPOA0025 and hpcD (both encod- Bayly R.C., Chapman P.J., Dagley S., Di Berardino D. (1980). ing 5-carboxymethyl-2-hydroxymuconate delta-isomerase), as Purification and some properties of maleylpyruvate hydrolase well as hpaD and hpcB (both encoding homoprotocatechuate and fumarylpyruvate hydrolase from Pseudomonas alcali- 2,3-dioxygenase), etc. whether these redundancies confer genes. J. Bacteriol., 143: 70-77. advantages for the growth of S. pomeroyi DSS-3 in nutrient-poor Blakley E.R. (1972). Microbial conversion of p-hydroxypheny- ocean, remains to be substantiated with the genetic and genomic lacetic acid to homogentisic acid. Can. J. Microbiol., 18: view. 1247-1255. Genomic analysis show that the following predicted tran- Blakley E.R., Kurz W., Halvorson H., Simpson F.J. (1967). The scriptional regulators may control the expression of the genes metabolism of phenylacetic acid by a Pseudomonas. Can. J. involved in the catabolism of the aromatic compounds, i.e., Microbiol., 13: 147-157. transcriptional activators from the MarR family (regulator for benzoate 1,2-dioxygenase gene, hmg genes, and HpcH/HpaI Buchan A., Collier L.S., Neidle E.L., Moran M.A. (2000). Key aldolase genes), LysR family (regulator for pca operon and cat aromatic-ring-cleaving enzyme, protocatechuate 3,4-dioxy- II), MerR family (PhhR) and TetR family (hpc genes), as well genase, in the ecologically important marine Roseobacter as transcriptional repressors from the GntR family (PhaN) (see lineage. Appl. Environ. Microbiol., 66: 4662-4672. above). A further study will then be necessary to clarify whether Chapman P.J., Dagley S. (1962). Oxidation of homogentistic acid by these regulatory systems cross-talk between each other as the cell-free extracts of a vibrio. J. Gen. Microbiol., 28: 251-256. previous reports (Cowles et al., 2000). Clewley J.P. (1995). Macintosh sequence analysis software. Belonging to the marine Rosebacter lineage in the DNAStar's LaserGene. Mol. Biotechnol., 3: 221-224. α-protobacteria which are abundant in coastal environments Collier L.S., Gaines G.L.I., Neidle E.L. (1998). Regulation of (Buchan et al., 2000), and also one of the few dominant benzoate degradation in Acinetobacter sp. strain ADP1 by marine clades that amenable to culturing (Giovannoni and BenM, a LysR-type transcriptional activator. J. Bacteriol., 180: Rappé, 2000), S. pomeroyi DSS-3 shows its versatile ability 2493-2501. to the catabolism of aromatic compounds either in anaerobic and /or in aerobic pathway (see above), suggesting such a Cowles C.E., Nichols N.N., Harwood C.S. (2000). BenR, a XylS strain might be a model of heuristic value for the study of homologue, regulates three different pathways of aromatic the genomic organization, the evolution of genes for aro- acid degradation in Pseudomonas putida. J. Bacteriol., 182: matic degradation, as well as the catalytic or transcriptional 6339-6346. mechanisms of related enzymes. Further, the ongoing works Crawford R.L, Frick T.D. (1977). Rapid spectrophotometric dif- of functional identification of the genes which were predicted ferentiation between glutathione-dependent and glutathione- to be involved in the catabolism of aromatic compounds would independent gentisate and homogentisate pathways. Appl. provide new insights into the biodegradation of aromatic com- Environ. Microbiol., 34: 170-174. pounds in marine bacteria and marine environments, and also Denef V.J., Klappenbach J.A., Patrauchan M.A., Florizone C., pave the way for developing more efficient bioremediation Rodrigues J.L., Tsoi T.V., Verstraete W., Eltis L.D., Tiedje technologies. J.M. (2006). Genetic and genomic insights into the role of benzoate-catabolic pathway redundancy in Burkholderia xen- Acknowledgments ovorans LB400. Appl. Environ. Microbiol., 72: 585-595. This work was financially supported by the foundation of Youth Dagley S. (1978). Pathways for the utilization of organic sub- Science and Technology Chen-Guang Project of Wuhan, China strates. In: Sokatch J.R., Ornston L.N., Eds, The Bacteria, (No. 200950431172), the Foundation of the Talent Introduction Academic Press, New York, pp. 305-388. of Huazhong University of Science and Technology (No. 0124261003) and the Postdoctoral Science Foundation of China Dagley S., Geary P.J., Wood J.M. (1968). The metabolism of (Grant No. 2005038032). We also thank Mr. Liwu Zeng for his protocatechuate by Pseudomonas testosteroni. Biochem. J., technical assistance during this work. 109: 559-568. Ann. Microbiol., 59 (4), 789-800 (2009) 799

Eaton R.W., Chapman P.J. (1992). Bacterial metabolism of naph- Harwood C.S., Parales R.E. (1996). The β-ketoadipate pathway thalene: construction and use of recombinant bacteria to and the biology of self-identity. Annu. Rev. Microbiol., 50: study ring cleavage of 1, 2-dihydroxynaphthalene and sub- 553-590. sequent reactions. J. Bacteriol., 174: 7542-7554. Houghton J.E., Brown T.M., Appel A.J., Hughes E.J., Ornston L.N. Ellis L.B.M., Roe D., Wackett L.P. (2006). “The University of (1995). Discontinuities in the evolution of Pseudomonas Minnesota Biocatalysis/Biodegradation Database: The First putida cat genes. J. Bacteriol., 177: 401-412. Decade,” Nucleic Acids Res., 34: 517-521. Jenkins J.R., Cooper R.A. (1988). Molecular cloning, expression, Elsemore D.A., Ornston L.N. (1995). Unusual ancestry of dehy- and analysis of the genes of the homoprotocatechuate catabolic dratases associated with quinate catabolism in Acinetobacter pathway of Escherichia coli C. J. Bacteriol., 170: 5317-5324. calcoaceticus. J. Bacteriol., 177: 5971-5978. Jimenez J.I., Minambres B., Garcia J.L., Diaz E. (2002). Genomic Ferrández A., Miñambres B., García B., Olivera E.R., Luengo J.M., analysis of the aromatic catabolic pathways from Pseudomonas García J.L., Díaz E. (1998). Catabolism of phenylacetic acid putida KT2440. Environ. Microbiol., 4: 824-841. in Escherichia coli. Characterization of a new aerobic hybrid Jones D.C., Cooper R.A. (1990). Catabolism of 3-hydroxyben- pathway. J. Biol. Chem., 273: 25974-25986. zoate by the gentisate pathway in Klebsiella pneumoniae Galibert F., Finan T.M., Long S.R., Puhler A., Abola P., Ampe F., M5a1. Arch. Microbiol., 154: 489-495. Barloy-Hubler F., Barnett M.J., Becker A., Boistard P., Bothe Kitagawa W., Suzuki A., Hoaki T., Masai E., Fukuda M. (2001). G., Boutry M., Bowser L., Buhrmester J., Cadieu E., Capela Multiplicity of aromatic ring hydroxylation dioxygenase genes D., Chain P., Cowie A., Davis R.W., Dreano S., Federspiel N.A., in a strong PCB degrader, Rhodococcus sp. strain RHA1 dem- Fisher R.F., Gloux S., Godrie T., Goffeau A., Golding B., Gouzy onstrated by denaturing gradient gel electrophoresis. Biosci. J., Gurjal M., Hernandez-Lucas I., Hong A., Huizar L., Hyman Biotechnol. Biochem., 65: 1907-1911. R.W., Jones T., Kahn D., Kahn M.L., Kalman S., Keating D.H., Kiyohara H., Torigoe S., Kaida N., Asaki T., Iida T., Hayashi Kiss E., Komp C., Lelaure V., Masuy D., Palm C., Peck M.C., H., Takizawa N. (1994). Cloning and characterization of a Pohl T.M., Portetelle D., Purnelle B., Ramsperger U., Surzycki chromosomal gene cluster, pah, that encodes the upper R., Thebault P., Vandenbol M., Vorholter F.J., Weidner S., pathway for phenanthrene and naphthalene utilization by Wells D.H., Wong K., Yeh K.C., Batut J. (2001). The compos- Pseudomonas putida OUS82. J. Bacteriol., 176: 2439-2443. ite genome of the legume symbiont Sinorhizobium meliloti. Science, 293: 668-672. Krauthammer M., Rzhetsky A., Morozov P., Friedman C. (2000). Using BLAST for identifying gene and protein names in jour- Gao X., Tan C.L., Yeo C.C., Poh C.L. (2005). Molecular and bio- nal articles. Gene ., 259: 245-252. chemical characterization of the xlnD-encoded 3-hydroxybenzoate 6-hydroxylase involved in the degradation of Kunita N. (1955). Bacterial oxidation of phenylacetic acid. II. The 2,5-xylenol via the gentisate pathway in Pseudomonas alcali- pathway through homogentisic acid. Med. J. Osaka Univ., 6: genes NCIMB 9867. J. Bacteriol., 187: 7696-7702. 703-708. Gescher J., Eisenreich W., Worth J., Bacher A., Fuchs G. (2005). Lack L. (1959). The enzymic oxidation of gentisic acid. Biochim. Aerobic benzoyl-CoA catabolic pathway in Azoarcus evansii: Biophys. Acta, 34: 117-123. studies on the non-oxygenolytic ring cleavage enzyme. Mol. Lack L. (1961). Enzymic cis-trans isomerization of maleylpyruvic Microbiol., 56:1586-1600. acid. J. Biol. Chem., 236: 2835-2840. Gescher J., Ismail W., Olgeschlager E., Eisenreich W., Worth J., Laemmli C., Werlen C., van der Meer J.R. (2004). Mutation Fuchs G. (2006). Aerobic benzoyl-coenzyme A (CoA) catabol- analysis of the different tfd genes for degradation of chlo- ic pathway in Azoarcus evansii: conversion of ring cleavage roaromatic compounds in Ralstonia eutropha JMP134. Arch. product by 3,4-dehydroadipyl-CoA semialdehyde dehydroge- Microbiol., 181: 112-121. nase. J. Bacteriol., 188: 2919-2927. Milcamps A., de Bruijn F.J. (1999). Identification of a novel Gibson D.T. (1980). Microbial Metabolism. In: Hutzinger O., Ed., nutrient-deprivation-induced Sinorhizobium meliloti gene The Handbook of Environmental Chemistry 2 Part A - Reactions (hmgA) involved in the degradation of tyrosine. Microbiology and Processes. Springer Verlag, Berlin, pp. 161-192. ., 145: 935-947. Giovannoni S.J., Rappé M.S. (2000). Evolution, diversity and Mitra A., Kitamura Y., Gasson M.J., Narbad A., Parr molecular ecology of marine prokaryotes. In: Kirchman D.L., A.J., Payne J., Rhodes M.J., Sewter C., Walton N.J. Ed., Microbial Ecology of the Oceans. John Wiley & Sons, Inc., (1999). 4-Hydroxycinnamoyl-CoA hydratase/lyase (HCHL) New York, pp. 47-84. – an enzyme of phenylpropanoid chain cleavage from Gonzalez J.M., Covert J.S., Whitman W.B., Henriksen J.R., Mayer Pseudomonas. Arch. Biochem. Biophys., 365: 10-16. F., Scharf B., Schmitt R., Buchan A., Fuhrman J.A., Kiene Mohamed M.E., Ismail W., Heider J., Fuchs G. (2002). Aerobic R.P., Moran M.A. (2003). Silicibacter pomeroyi sp. nov. and metabolism of phenylacetic acids in Azoarcus evansii. Arch. Roseovarius nubinhibens sp. nov., dimethylsulfoniopropion- Microbiol., 178: 180-192. ate-demethylating bacteria from marine environments. Int. Moran M.A., Buchan A., Gonzalez J.M., Heidelberg J.F., Whitman J. Syst. Evol. Microbiol., 53: 1261-1269. W.B., Kiene R.P., Henriksen J.R., King G.M., Belas R., Fuqua Hagedorn S.R., Chapman P.J. (1985). Glutathione-independent C., Brinkac L., Lewis M., Johri S., Weaver B., Pai G., Eisen maleylacetoacetate isomerase in Gram-positive bacteria. J. J.A., Rahe E., Sheldon W.M., Ye W., Miller T.R., Carlton J., Bacteriol., 163: 803-805. Rasko D.A., Paulsen I.T., Ren Q., Daugherty S.C., Deboy R.T., Hagedorn S.R., Bradley G., Chapman P.J. (1985). Glutathione- Dodson R.J., Durkin A.S., Madupu R., Nelson W.C., Sullivan independent isomerization of maleylpyruvate by Bacillus S.A., Rosovitz M.J., Haft D.H., Selengut J., Ward N. (2004). megaterium and other Gram-positive bacteria. J. Bacteriol., Genome sequence of Silicibacter pomeroyi reveals adapta- 63: 640-647. tions to the marine environment. Nature ., 432: 910-913. 800 D. YAN et al.

Nichols N.N., Harwood C.S. (1997). PcaK, a high-affinity per- direction of transcription and control of expression. Mol. Gen. mease for the aromatic compounds 4-hydroxybenzoate and Genet., 237: 241-250. protocatechuate from Pseudomonas putida. J. Bacteriol., Segura A., Bünz P.V., D’Argenio D.A., Ornston L.N. (1999). 179: 5056-5061. Genetic analysis of a chromosomal region containing vanA Olivera E.R., Carnicero D., Garcia B., Minambres B., Moreno M.A., and vanB, genes required for conversion of either ferulate or Canedo L., Dirusso C.C., Luengo J.M. (2001). Two different vanillate to protocatechuate in Acinetobacter. J. Bacteriol., pathways are involved in the β-oxidation of n-alkanoic and 181: 3494-3504. nphenylalkanoic acids in Pseudomonas putida U: genetic Shen X.H., Jiang C.Y., Huang Y., Liu Z.P., Liu S.J. (2005). studies and biotechnological applications. Mol. Microbiol., 39: Functional identification of novel genes involved 863-874. in the glutathione-independent gentisate pathway in Overhage J., Priefert H., Steinbüchel A. (1999). Biochemical and Corynebacterium glutamicum. Appl. Environ. Microbiol., genetic analyses of ferulic acid catabolism in Pseudomonas 71: 3442-3452. sp. strain HR199. Appl. Environ. Microbiol., 65: 4837-4847. Song J., Jensen R.A. (1996). PhhR, a divergently transcribed Patrauchan M.A., Florizone C., Dosanjh M., Mohn W.W., Davies activator of the phenylalanine hydroxylase gene cluster of J., Eltis L.D. (2005). Catabolism of benzoate and phthalate Pseudomonas aeruginosa. Mol. Microbiol., 22: 497-507. in Rhodococcus sp. strain RHA1: redundancies and conver- Sparnins V.L., Chapman P.J. (1976). Catabolism of L-tyrosine by gence. J. Bacteriol., 187: 4050-4063. the homoprotocatechuate pathway in Gram-positive bacteria. Parrot S., Jones S., Cooper R.A. (1987). 2-Phenylethylamine J. Bacteriol., 127: 362-366. catabolism by Escherichia coli K12. J. Gen. Microbiol., 133: Takami H., Nakasone K., Takaki Y., Maeno G., Sasaki R., 347-351. Masui N., Fuji F., Hirama C., Nakamura Y., Ogasawara Poh C.L., Bayly R.C. (1980). Evidence for isofunctional enzymes N., Kuhara S., Horikoshi K. (2000). Complete genome used in m-cresol and 2,5-xylenol degradation via the gen- sequence of the alkaliphilic bacterium Bacillus halodurans tisate pathway in Pseudomonas alcaligenes. J. Bacteriol., and genomic sequence comparison with Bacillus subtilis. 143: 59-69. Nucleic Acids Res., 28: 4317-4331. Priefert H., Rabenhorst J., Steinbüchel A. (1997). Molecular Tobes R., Ramos J.L. (2005). REP code: defining bacterial identity characterization of genes of Pseudomonas sp. strain HR199 in extragenic space. Environ. Microbiol., 7: 225-228. involved in bioconversion of vanillin to protocatechuate. J. Venturi V., Zennaro F., Degrassi G., Okeke B.C., Bruschi C.V. Bacteriol., 179: 2595-2607. (1998). Genetics of ferulic acid bioconversion to protocate- Priefert H., Rabenhorst J., Steinbüchel A. (2001). Biotechnological chuic acid in plant-growth-promoting Pseudomonas putida production of vanillin. Appl. Microbiol. Biotechnol., 56: 296- WCS358. Microbiology, 144: 965-973. 314. Zhou N.Y., Fuenmayor S.L., Williams P.A. (2001). nag genes of Prieto M.A., Díaz E., García J.L. (1996). Molecular characteriza- Ralstonia (formerly Pseudomonas) sp. strain U2 encoding tion of the 4-hydroxyphenylacetate catabolic pathway of enzymes for gentisate catabolism. J. Bacteriol., 183: 700- Escherichia coli W: engineering a mobile aromatic degrada- 708. tive cluster. J. Bacteriol., 178: 111-120. Zhang R., Zhang C.T. (2005). Genomic islands in the Robson N.D., Parrott S., Cooper R.A. (1996). In vitro formation of Corynebacterium efficiens genome. Appl. Environ. Microbiol., a catabolic plasmid carrying Klebsiella pneumoniae DNA that 71: 3126-3130. allows growth of Escherichia coli K-12 on 3-hydroxybenzoate. Zhuang Z., Song F., Takami H., Dunaway-Mariano D. (2004). Microbiology, 142: 2115-2120. The BH1999 protein of Bacillus halodurans C-125 is Roper D.I., Fawcett T., Cooper R.A. (1993). The Escherichia coli gentisyl-coenzyme A thioesterase. J. Bacteriol., 186: 393- C homoprotocatechuate degradative operon: hpc gene order, 399.