The Healthy Human Retina

Total Page:16

File Type:pdf, Size:1020Kb

The Healthy Human Retina Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2011 Identification and treatment of splice defects in ciliary genes RPGRand BBS1 causing Retinitis pigmentosa Schmid, Fabian Abstract: Retinitis pigmentosa (RP) ist eine genetisch und klinisch heterogene Krankheit, die zur De- generation von Photorezeptoren führt und vollständige Blindheit verursachen kann. Zirka eine von 3000 bis 4000 Personen erkrankt an RP und weltweit sind mind. 1.5 Millionen Menschen betroffen. RP kann auch Teil einer syndromalen Krankheit, wie zum Beispiel dem Bardet-Biedl Syndrom (BBS) sein. Wir haben Mutationen in den Genen RPGR und BBS1 gefunden, welche für das Funktionieren des Verbinden- den Ziliums (connecting cilium) im Photorezeptor wichtig sind. Die Mutationen führen zu Defekten im Spleissen der pre-mRNA. Mutationen in BBS1 sind normalerweise mit BBS assoziiert, wohingegen die meisten RPGR Mutationen nicht syndromale RP verursachen. Unsere Patienten zeigen aber Symptome, die dem zu erwartenden Krankheitsbild widersprechen. In der Familie des einen Patienten mit Spleissde- fekten in RPGR, sind heterozygote Trägerinnen der Mutation ebenfalls betroffen. Im anderen Fall leidet der Patient zusätzlich zu RP an einer milden Höhrschwäche. Die zwei Patienten mit der Splice Donor Mutation in BBS1 zeigen RP, aber keine weiteren Symptome von BBS. Unsere Beobachtungen deuten an, dass Spleissdefekte das Krankheitsbild und den Krankheitsverlauf modifizieren können. Die zwei RPGR Mutationen verändern die exprimierte Menge von neu entdeckten, alternativen RPGR Transkrip- tisoformen. Wir haben gefunden, dass deren Menge in gesunden Menschen gewebespezifisch reguliert ist. Dies impliziert, dass eine Misregulation dieser Isoformen Schäden in den entsprechenden Geweben verursachen oder den Schweregrad der Krankheit erhöhen könnte. Im Gegensatz dazu, führt die BBS1 Mutation zu RP, höchstwahrscheinlich durch eine Reduktion der Menge an funktionellem BBS1 Protein. Die reduzierte Menge an BBS1 scheint auf die anderen Gewebe aber keinen Einfluss zu haben. In unserer Gruppe wurde ein gentherapeutischer Ansatz entwickelt, um die pathogenen Effekte von Spleissendefek- ten zu mildern. Der Ansatz basiert auf der Expression einer modifizierten Form des U1 small nuclear Ribonukleoproteins (U1). U1 ist ein Spleissfaktor der direkt am Pozess des Transkriptspleissens beteiligt ist. Höchstwahrscheinlich stört die Mutation in BBS1 die Interaktion von U1 mit dem Transkript, was dadurch den Spleissdefekt verursacht. Um die Interaktion von U1 mit dem Transkript und damit die Erkennung des von der Mutation betroffenen Exons zu verbessern, wurde U1 an die Mutation angepasst. Die Behandlung von Patientenzellen mit dem angepassten U1 verhindert das Überspringen von Exon 5 und erhöht die Menge an korrekt gespleisstem BBS1 Transkript. Diese Resultate, werden möglicherweise dazu beitragen, eine Behandlungsmethode für solche Mutationen in betroffenen Patienten zu etablieren. Summary Retinitis pigmentosa (RP) is a genetically and clinically heterogeneous disease leading to the degeneration of photoreceptors and can cause complete blindness. The prevalence of the disease is about 1 in 3000 to 4000 people with more than 1.5 million affected worldwide. RP can be a part of several syndromic disorders, as for example the Bardet-Biedl syndrome (BBS). We have identified mutations in the genes RPGR and BBS1 which are important for the functioning of the photoreceptor’s connecting cilium. The mutations lead to defects in pre-mRNA splicing. Mutations in BBS1 are generally associated with BBS, whereas most of the mutations in RPGR cause non-syndromic RP. However, our patients show different phenotypes. In the family of one of the two male RP patients who show RPGR splice defects, heterozygous female carriers are affected. The other patient suffers from mild hearing impairments in addition to RP. Furthermore, the two patients with a splice site mutation in BBS1 show RP without any further signs of BBS. Our findings implicate that defects in mRNA splicing might modify progression and expression of the disease. The two mutations found in RPGR change the amount of novel, alternative transcript isoforms. We have found that the novel RPGR isoforms were expressed in a tissue-dependent manner in healthy individuals which suggests that misregulation of these variants could affect other tis- sues or increase disease severity. In contrast, the splice site mutation in BBS1 causes RP, most probably by reducing the amount of functional protein, whereas other tissues remain unaffected. To correct spliced defects a gene therapeutic approach using a modified form of the U1 small nuclear ribonucleoprotein has been developed in our group. U1 is a splicing factor directly involved in the general splicing process. The mutation in BBS1 causes the splice defect most probably by interfering with U1 binding to the transcript. To increase its binding affinity to the transcript and thereby improve recognition of the affected exon, U1 was adapted to the mutation. Treatment of patient-derived fibroblasts with the adapted form ofU1 increased the amount of correctly spliced BBS1 transcripts and completely abolished skipping of exon 5. These results could help to establish a gene therapeutic treatment to correct splice defects in patients. Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-51232 Dissertation Published Version Originally published at: Schmid, Fabian. Identification and treatment of splice defects in ciliary genes RPGR and BBS1 causing Retinitis pigmentosa. 2011, University of Zurich, Faculty of Science. 2 Identification and Treatment of Splice Defects in Ciliary Genes RPGR and BBS1 Causing Retinitis Pigmentosa Dissertation zur Erlangung der naturwissenschaftlichen Doktorwürde (Dr. sc. nat.) vorgelegt der Mathematisch-naturwissenschaftlichen Fakultät der Universität Zürich von Fabian Schmid von Schübelbach (SZ) Promotionskomitee Prof. Dr. Wolfgang Berger (Vorsitz) Dr. John Neidhardt (Leitung der Dissertation) Prof. Dr. Stephan Neuhauss Prof. Dr. Christian Grimm Zürich, 2011 Declaration I declare that the present thesis was composed by myself and the whole experimental work was performed by my own. This dissertation has not been submitted anywhere else in order to get any other degree or professional qualification. Fabian Schmid, 2011 Table of Contents Zusammenfassung 1 Summary 3 1. General Introduction 4 1.1. General structure and function of the eye 4 1.1.1. Structure and function of the retina 4 1.1.2. Rod and Cone photoreceptors 5 1.1.3. The phototransduction cascade 8 1.1.4. The photoreceptor connecting cilium 11 1.2. Inherited disease affecting photoreceptors 14 1.2.1. Retinitis pigmentosa 14 1.2.2. The retinitis pigmentosa GTPase regulator 16 1.2.3. Bardet-Biedl syndrome 18 1.3. Splicing of pre-mRNA transcripts 19 1.3.1. Alternative splicing 21 1.3.2. Splicing and disease 23 1.3.3. Therapeutic approaches to treat splice defects 25 1.4. References General Introduction 28 2. Aims of the thesis 38 3. Results 39 3.1. Mutation- and tissue-specific alterations of RPGR transcripts 39 3.1.1. Abstract 40 3.1.2. Introduction 41 3.1.3. Materials and Methods 43 3.1.4. Results 46 3.1.5. Discussion 50 3.1.6. Acknowledgements 54 3.1.7. References 55 3.1.8. Figures and Tables 60 3.1.9. Own contribution 67 3.2. U1 snRNA-mediated gene therapeutic correction of splice defects 68 caused by an exceptionally mild BBS mutation 3.2.1. Abstract 69 3.2.2. Introduction 70 3.2.3. Materials and Methods 72 3.2.4. Results 77 3.2.5. Discussion 82 3.2.6. Acknowledgements 85 3.2.7. References 86 3.2.8. Figures and Tables 91 3.2.9. Own contribution 99 3.3. Search for downstream target genes of BBS1 100 3.3.1. Abstract 101 3.3.2. Introduction 102 3.3.3. Methods and Results 104 3.3.4. Discussion 107 3.3.5. Acknowledgements 109 3.3.6. References 110 3.3.7. Figures and Tables 112 3.3.8. Supplementary Material 117 3.3.9. Own contribution 136 4. General Discussion 137 4.1. Ciliopathies 137 4.1.1. Ciliary genes BBS1 and RPGR 138 4.1.2. Genotype-phenotype correlations in BBS1- and RPGR- associated 140 ciliopathies 4.1.3. Splicing as a modifier in RPGR- associated ciliopathies 141 4.2. Therapy of splice defects by adaptation of the U1 snRNA 144 4.2.1. Functional assays 144 4.2.2. Side effects and improvements of the U1-based approach 145 4.3. Concluding remarks 147 4.4. References General Discussion 148 5. Acknowledgements 153 6. Curriculum vitae 154 Zusammenfassung Zusammenfassung Retinitis pigmentosa (RP) ist eine genetisch und klinisch heterogene Krankheit, die zur Degeneration von Photorezeptoren führt und vollständige Blindheit verursachen kann. Zirka eine von 3000 bis 4000 Personen erkrankt an RP und weltweit sind mind. 1.5 Millionen Menschen betroffen. RP kann auch Teil einer syndromalen Krankheit, wie zum Beispiel dem Bardet-Biedl Syndrom (BBS) sein. Wir haben Mutationen in den Genen RPGR und BBS1 gefunden, welche für das Funktionieren des Verbindenden Ziliums (connecting cilium) im Photorezeptor wichtig sind. Die Mutationen führen zu Defekten im Spleissen der pre-mRNA. Mutationen in BBS1 sind normalerweise mit BBS assoziiert, wohingegen die meisten RPGR Mutationen nicht syndromale RP verursachen. Unsere Patienten zeigen aber Symptome, die dem zu erwartenden Krankheitsbild widersprechen. In der Familie des einen Patienten mit Spleissdefekten in RPGR, sind heterozygote Trägerinnen der Mutation ebenfalls betroffen.
Recommended publications
  • Cytogenomic SNP Microarray - Fetal ARUP Test Code 2002366 Maternal Contamination Study Fetal Spec Fetal Cells
    Patient Report |FINAL Client: Example Client ABC123 Patient: Patient, Example 123 Test Drive Salt Lake City, UT 84108 DOB 2/13/1987 UNITED STATES Gender: Female Patient Identifiers: 01234567890ABCD, 012345 Physician: Doctor, Example Visit Number (FIN): 01234567890ABCD Collection Date: 00/00/0000 00:00 Cytogenomic SNP Microarray - Fetal ARUP test code 2002366 Maternal Contamination Study Fetal Spec Fetal Cells Single fetal genotype present; no maternal cells present. Fetal and maternal samples were tested using STR markers to rule out maternal cell contamination. This result has been reviewed and approved by Maternal Specimen Yes Cytogenomic SNP Microarray - Fetal Abnormal * (Ref Interval: Normal) Test Performed: Cytogenomic SNP Microarray- Fetal (ARRAY FE) Specimen Type: Direct (uncultured) villi Indication for Testing: Patient with 46,XX,t(4;13)(p16.3;q12) (Quest: EN935475D) ----------------------------------------------------------------- ----- RESULT SUMMARY Abnormal Microarray Result (Male) Unbalanced Translocation Involving Chromosomes 4 and 13 Classification: Pathogenic 4p Terminal Deletion (Wolf-Hirschhorn syndrome) Copy number change: 4p16.3p16.2 loss Size: 5.1 Mb 13q Proximal Region Deletion Copy number change: 13q11q12.12 loss Size: 6.1 Mb ----------------------------------------------------------------- ----- RESULT DESCRIPTION This analysis showed a terminal deletion (1 copy present) involving chromosome 4 within 4p16.3p16.2 and a proximal interstitial deletion (1 copy present) involving chromosome 13 within 13q11q12.12. This
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Wild Species Genome Ancestry of Domestic Chickens Short Title: Chicken Genome Ancestry
    Supplementary Materials Full title: The wild species genome ancestry of domestic chickens Short title: Chicken genome ancestry Raman Akinyanju Lawal1,2*#, Simon H. Martin3,4, Koen Vanmechelen5, Addie Vereijken6, Pradeepa Silva7, Raed Mahmod Al-Atiyat8, Riyadh Salah Aljumaah9, Joram M. Mwacharo10, Dong-Dong Wu11,12, Ya-Ping Zhang11,12, Paul M. Hocking13†, Jacqueline Smith13, David Wragg14 & Olivier Hanotte1, 14,15* 1Cells, Organisms and Molecular Genetics, School of Life Sciences, University of Nottingham, NG7 2RD, Nottingham, United Kingdom 2,#The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, USA 3Institute of Evolutionary Biology, University of Edinburgh, EH9 3FL, Edinburgh, United Kingdom 4Department of Zoology, University of Cambridge, CB2 3EJ, Cambridge, United Kingdom 5Open University of Diversity - Mouth Foundation, Hasselt, Belgium 6Hendrix Genetics, Technology and Service B.V., P.O. Box 114, 5830, AC, Boxmeer, The Netherlands 7Department of Animal Sciences, Faculty of Agriculture, University of Peradeniya, Sri Lanka 8Genetics and Biotechnology, Animal Science Department, Agriculture Faculty, Mutah University, Karak, Jordan 9Department of Animal Production, King Saud University, Saudi Arabia 10Small Ruminant Genomics, International Centre for Agricultural Research in the Dry Areas (ICARDA), P.O. Box 5689, ILRI-Ethiopia Campus, Addis Ababa, Ethiopia 11Center for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences, 650223 Kunming, China 12State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, 650223 Kunming, China. 13The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Easter Bush Campus, Midlothian, EH25 9RG, UK 14Centre for Tropical Livestock Genetics and Health, The Roslin Institute, EH25 9RG, Edinburgh, UK 15LiveGene, International Livestock Research Institute (ILRI), P.
    [Show full text]
  • Screening Differentially Expressed Genes of Pancreatic Cancer
    Xu et al. BMC Cancer (2020) 20:298 https://doi.org/10.1186/s12885-020-06722-7 RESEARCH ARTICLE Open Access Screening differentially expressed genes of pancreatic cancer between Mongolian and Han people using bioinformatics technology Jiasheng Xu1†, Kaili Liao2†, Zhonghua Fu3* and Zhenfang Xiong1* Abstract Background: To screen and analyze differentially expressed genes in pancreatic carcinoma tissues taken from Mongolian and Han patients by Affymetrix Genechip. Methods: Pancreatic ductal cell carcinoma tissues were collected from the Mongolian and Han patients undergoing resection in the Second Affiliated Hospital of Nanchang University from March 2015 to May 2018 and the total RNA was extracted. Differentially expressed genes were selected from the total RNA qualified by Nanodrop 2000 and Agilent 2100 using Affymetrix and a cartogram was drawn; The gene ontology (GO) analysis and Pathway analysis were used for the collection and analysis of biological information of these differentially expressed genes. Finally, some differentially expressed genes were verified by real-time PCR. Results: Through the microarray analysis of gene expression, 970 differentially expressed genes were detected by comparing pancreatic cancer tissue samples between Mongolian and Han patients. A total of 257 genes were significantly up-regulated in pancreatic cancer tissue samples in Mongolian patients; while a total of 713 genes were down-regulated. In the Gene Ontology database, 815 differentially expressed genes were identified with clear GO classification, and CPB1 gene showed the highest increase in expression level (multiple difference: 31.76). The pathway analysis detected 28 signaling pathways that included these differentially expressed genes, involving a total of 178 genes. Among these pathways, the enrichment of differentially expressed genes in the FAK signaling pathway was the strongest and COL11A1 gene showed the highest multiple difference (multiple difference: 5.02).
    [Show full text]
  • Hepatic Malignancy in an Infant with Wolf--Hirschhorn Syndrome
    Fetal and Pediatric Pathology ISSN: 1551-3815 (Print) 1551-3823 (Online) Journal homepage: https://www.tandfonline.com/loi/ipdp20 Hepatic Malignancy in an Infant with Wolf–Hirschhorn Syndrome Sara Rutter, Raffaella A Morotti, Steven Peterec & Patrick G. Gallagher To cite this article: Sara Rutter, Raffaella A Morotti, Steven Peterec & Patrick G. Gallagher (2017) Hepatic Malignancy in an Infant with Wolf–Hirschhorn Syndrome, Fetal and Pediatric Pathology, 36:3, 256-262, DOI: 10.1080/15513815.2017.1293201 To link to this article: https://doi.org/10.1080/15513815.2017.1293201 Published online: 07 Mar 2017. Submit your article to this journal Article views: 90 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=ipdp20 FETAL AND PEDIATRIC PATHOLOGY ,VOL.,NO.,– http://dx.doi.org/./.. CASE REPORT Hepatic Malignancy in an Infant with Wolf–Hirschhorn Syndrome Sara Ruttera, Raffaella A Morottia,b, Steven Peterecb, and Patrick G. Gallaghera,b,c aDepartment of Pathology, Yale University School of Medicine, New Haven, Connecticut, USA; bDepartment of Pediatrics, Yale University School of Medicine, New Haven, Connecticut, USA; cDepartment of Genetics, Yale University School of Medicine, New Haven, Connecticut, USA ABSTRACT ARTICLE HISTORY Introduction: Wolf–Hirschhorn syndrome (WHS) is a contiguous gene Received November syndrome involving deletions of the chromosome 4p16 region asso- Revised January ciated with growth failure, characteristic craniofacial abnormalities, Accepted January cardiac defects, and seizures. Case Report: This report describes a KEYWORDS six-month-old girl with WHS with growth failure and typical craniofacial Liver; malignancy; neonate; features who died of complex congenital heart disease.
    [Show full text]
  • Individual Functions and Substrate Specificities of Importin Alpha
    From the Max-Delbrück-Center for Molecular Medicine Berlin Head of the research group: Prof. Dr. M. Bader “Individual functions and substrate specificities of importin α subtypes” Dissertation for Fulfillment of Requirements for the Doctoral Degree of the University of Lübeck from the Department of Natural Sciences Submitted by Stefanie Hügel from Hennigsdorf Lübeck 2013 First referee: Prof. Dr. M. Bader Second referee: Prof. Dr. N. Tautz Date of oral examination: 21.02.13 Approved for printing. Lübeck, 22.02.2013 2 1 TABLE OF CONTENTS 1 TABLE OF CONTENTS _______________________________________________________ 3 2 ABSTRACT _______________________________________________________________ 6 3 ZUSAMMENFASSUNG ______________________________________________________ 7 4 INTRODUCTION ___________________________________________________________ 9 4.1 Nucleocytoplasmic protein transport ____________________________________________ 9 4.1.1 The nuclear pore complex – gateway to the nucleus ______________________________________ 10 4.1.1 Transport factors __________________________________________________________________ 11 4.1.2 Nothing happens without RanGTP _____________________________________________________ 12 4.2 The classical nuclear protein import pathway ____________________________________ 13 4.2.1 Structure and function of importin α ___________________________________________________ 13 4.2.2 Importin α:β mediated nuclear protein import___________________________________________ 15 4.2.3 The importin α protein family ________________________________________________________
    [Show full text]
  • Lineage-Specific Evolution of the Vertebrate Otopetrin Gene Family Revealed by Comparative Genomic Analyses Belen Hurle National Institutes of Health
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2011 Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses Belen Hurle National Institutes of Health Tomas Marques-Bonet Institut de Biologia Evolutiva Francesca Antonacci University of Washington - Seattle Campus Inna Hughes University of Rochester Joseph F. Ryan National Institutes of Health See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Part of the Medicine and Health Sciences Commons Recommended Citation Hurle, Belen; Marques-Bonet, Tomas; Antonacci, Francesca; Hughes, Inna; Ryan, Joseph F.; Comparative Sequencing Program, NISC; Eichler, Evan E.; Ornitz, David M.; and Green, Eric D., ,"Lineage-specific ve olution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses." BMC Evolutionary Biology.,. 23. (2011). https://digitalcommons.wustl.edu/open_access_pubs/35 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Belen Hurle, Tomas Marques-Bonet, Francesca Antonacci, Inna Hughes, Joseph F. Ryan, NISC Comparative Sequencing Program, Evan E. Eichler, David M. Ornitz, and Eric D. Green This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/35
    [Show full text]
  • An AP-MS- and Bioid-Compatible MAC-Tag Enables Comprehensive Mapping of Protein Interactions and Subcellular Localizations
    ARTICLE DOI: 10.1038/s41467-018-03523-2 OPEN An AP-MS- and BioID-compatible MAC-tag enables comprehensive mapping of protein interactions and subcellular localizations Xiaonan Liu 1,2, Kari Salokas 1,2, Fitsum Tamene1,2,3, Yaming Jiu 1,2, Rigbe G. Weldatsadik1,2,3, Tiina Öhman1,2,3 & Markku Varjosalo 1,2,3 1234567890():,; Protein-protein interactions govern almost all cellular functions. These complex networks of stable and transient associations can be mapped by affinity purification mass spectrometry (AP-MS) and complementary proximity-based labeling methods such as BioID. To exploit the advantages of both strategies, we here design and optimize an integrated approach com- bining AP-MS and BioID in a single construct, which we term MAC-tag. We systematically apply the MAC-tag approach to 18 subcellular and 3 sub-organelle localization markers, generating a molecular context database, which can be used to define a protein’s molecular location. In addition, we show that combining the AP-MS and BioID results makes it possible to obtain interaction distances within a protein complex. Taken together, our integrated strategy enables the comprehensive mapping of the physical and functional interactions of proteins, defining their molecular context and improving our understanding of the cellular interactome. 1 Institute of Biotechnology, University of Helsinki, Helsinki 00014, Finland. 2 Helsinki Institute of Life Science, University of Helsinki, Helsinki 00014, Finland. 3 Proteomics Unit, University of Helsinki, Helsinki 00014, Finland. Correspondence and requests for materials should be addressed to M.V. (email: markku.varjosalo@helsinki.fi) NATURE COMMUNICATIONS | (2018) 9:1188 | DOI: 10.1038/s41467-018-03523-2 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-03523-2 ajority of proteins do not function in isolation and their proteins.
    [Show full text]
  • LYAR, a Novel Nucleolar Protein with Zinc Finger DNA-Binding Motifs, Is Involved in Cell Growth Regulation
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press LYAR, a novel nucleolar protein with zinc finger DNA-binding motifs, is involved in cell growth regulation Lishan Su, R. Jane Hershberger, ~ and Irving L. Weissman Departments of Developmental Biology and Pathology, Stanford University, Stanford, California 94305 USA A cDNA encoding a novel zinc finger protein has been isolated from a mouse T-cell leukemia line on the basis of its expression of a Ly-1 epitope in a kgtl 1 library. The putative gene was mapped on mouse chromosome 1, closely linked to Idh-1, but not linked to the Ly-1 (CD5) gene. The cDNA is therefore named Ly-1 antibody reactive clone (LYAR). The putative polypeptide encoded by the cDNA consists of 388 amino acids with a zinc finger motif and three copies of nuclear localization signals. Antibodies raised against a LYAR fusion protein reacted with a protein of 45 kD on Western blots and by immunoprecipitation. Immunolocalization indicated that LYAR was present predominantly in the nucleoli. The LYAR mRNA was not detected in brain, thymus, bone marrow, liver, heart, and muscle. Low levels of LYAR mRNA were detected in kidney and spleen. However, the LYAR gene was expressed at very high levels in immature spermatocytes in testis. The LYAR mRNA is present at high levels in early embryos and preferentially in fetal liver and fetal thymus. A number of B- and T-cell leukemic lines expressed LYAR at high levels, although it was not detectable in bone marrow and thymus.
    [Show full text]
  • AI-Driven Deep Visual Proteomics Defines Cell Identity and Heterogeneity
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.25.427969; this version posted January 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. AI-driven Deep Visual Proteomics defines cell identity and heterogeneity Andreas Mund1,*,#, Fabian Coscia1,*, Réka Hollandi4, Ferenc Kovács4,5,, András Kriston4,5, Andreas-David Brunner6, Michael Bzorek7, Soraya Naimy7, Lise Mette Rahbek Gjerdrum7,13, Beatrice Dyring-Andersen1,8,14, Jutta Bulkescher3, Claudia Lukas2,3, Christian Gnann9, Emma Lundberg9,10,11, Peter Horvath4,5,12,#, Matthias Mann1,6,#,§ 1Proteomics Program, 2Protein Signaling Program, and 3Protein Imaging Platform, NNF Center for Protein Research, Faculty of Health and Medical Sciences, University of Copenhagen, 2200 Copenhagen, Denmark 4Synthetic and Systems Biology Unit, Biological Research Centre, Eötvös Loránd Research Network, Szeged 6726, Hungary 5Single-Cell Technologies Ltd, Szeged 6726, Hungary 6Proteomics and Signal Transduction, Max-Planck Institute of Biochemistry, 82152 Martinsried, Germany 7Department of Pathology, Zealand University Hospital, Roskilde, Denmark 8Department of Dermatology and Allergy, Herlev and Gentofte Hospital, University of Copenhagen, Hellerup, Denmark 9Science for Life Laboratory, School of Engineering Sciences in Chemistry, Biotechnology and Health, KTH - Royal Institute of Technology, Stockholm, 17121, Sweden. 10Department of Genetics, Stanford University, Stanford, CA 94305,
    [Show full text]
  • Screening Differentially Expressed Genes of Pancreatic Cancer Between Mongolian and Han People Using Bioinformatics Technology
    Screening differentially expressed genes of pancreatic cancer between Mongolian and Han people using bioinformatics technology Jiasheng Xu First Aliated Hospital of Nanchang University Kaili Liao Second Aliated Hospital of Nanchang University ZHONGHUA FU First Aliated Hospital of Nanchang University ZHENFANG XIONG ( [email protected] ) The First Aliated Hospital of Nanchang University https://orcid.org/0000-0003-2062-9204 Research article Keywords: Pancreatic ductal cell carcinoma, Affymetrix gene expression prole, Gene differential expression, GO analysis, Pathway analysis, Mongolian Posted Date: July 9th, 2019 DOI: https://doi.org/10.21203/rs.2.11118/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at BMC Cancer on April 9th, 2020. See the published version at https://doi.org/10.1186/s12885-020-06722-7. Page 1/18 Abstract Objective To screen and analyze differentially expressed genes in pancreatic carcinoma tissues taken from Mongolian and Han patients by Affymetrix Genechip. Methods: Pancreatic ductal cell carcinoma tissues were collected from the Mongolian and Han patients undergoing resection in the Second Aliated Hospital of Nanchang University during March 2015 to May 2018 and the total RNA was extracted. Differentially expressed genes were selected from the total RNA qualied by Nanodrop 2000 and Agilent 2100 using Affymetrix and a cartogram was drawn; The gene ontology (GO) analysis and Pathway analysis were used for the collection and analysis of biological information of these differentially expressed genes. Finally, some differentially expressed genes were veried by real-time PCR. Results Through the microarray analysis of gene expression, 970 differentially expressed genes were detected by comparing pancreatic cancer tissue samples between Mongolian and Han patients.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Cell growth-regulating nucleolar protein Gene Symbol Lyar Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.137862 Ensembl Gene ID ENSRNOG00000005374 Entrez Gene ID 289707 Assay Information Unique Assay ID qRnoCID0009985 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000007154 Amplicon Context Sequence TTGTGTGTTTTGGCTTCATAGCCTTTGCCTCCGTATTTCTGATCTTCACTGATGCA TTTCACATGGTTTTTGTAGTCGTCACCCCAGAAATCTTTCCCACAGTCAATGCAA GAAAGACATTCACAGTTTCTGCAAATAGACACGTGCTTT Amplicon Length (bp) 120 Chromosome Location 14:77298354-77299321 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9994 cDNA Cq 20.38 cDNA Tm (Celsius) 81 gDNA Cq 42.15 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Lyar, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]