Chromatin-Regulating Genes Are Associated with Postoperative Prognosis and Isocitrate Dehydrogenase Mutation in Astrocytoma
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The Nurd Complex Cooperates with Dnmts to Maintain Silencing of Key Colorectal Tumor Suppressor Genes
Oncogene (2014) 33, 2157–2168 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE The NuRD complex cooperates with DNMTs to maintain silencing of key colorectal tumor suppressor genes Y Cai1,6, E-J Geutjes2,6, K de Lint2, P Roepman3, L Bruurs2, L-R Yu4, W Wang1, J van Blijswijk2, H Mohammad1, I de Rink5, R Bernards2 and SB Baylin1 Many tumor suppressor genes (TSGs) are silenced through synergistic layers of epigenetic regulation including abnormal DNA hypermethylation of promoter CpG islands, repressive chromatin modifications and enhanced nucleosome deposition over transcription start sites. The protein complexes responsible for silencing of many of such TSGs remain to be identified. Our previous work demonstrated that multiple silenced TSGs in colorectal cancer cells can be partially reactivated by DNA demethylation in cells disrupted for the DNA methyltransferases 1 and 3B (DNMT1 and 3B) or by DNMT inhibitors (DNMTi). Herein, we used proteomic and functional genetic approaches to identify additional proteins that cooperate with DNMTs in silencing these key silenced TSGs in colon cancer cells. We discovered that DNMTs and the core components of the NuRD (Mi-2/nucleosome remodeling and deacetylase) nucleosome remodeling complex, chromo domain helicase DNA-binding protein 4 (CHD4) and histone deacetylase 1 (HDAC1) occupy the promoters of several of these hypermethylated TSGs and physically and functionally interact to maintain their silencing. Consistent with this, we find an inverse relationship between expression of HDAC1 and 2 and these TSGs in a large panel of primary colorectal tumors. We demonstrate that DNMTs and NuRD cooperate to maintain the silencing of several negative regulators of the WNT and other signaling pathways. -
The Functions of DNA Damage Factor RNF8 in the Pathogenesis And
Int. J. Biol. Sci. 2019, Vol. 15 909 Ivyspring International Publisher International Journal of Biological Sciences 2019; 15(5): 909-918. doi: 10.7150/ijbs.31972 Review The Functions of DNA Damage Factor RNF8 in the Pathogenesis and Progression of Cancer Tingting Zhou 1, Fei Yi 1, Zhuo Wang 1, Qiqiang Guo 1, Jingwei Liu 1, Ning Bai 1, Xiaoman Li 1, Xiang Dong 1, Ling Ren 2, Liu Cao 1, Xiaoyu Song 1 1. Institute of Translational Medicine, China Medical University; Key Laboratory of Medical Cell Biology, Ministry of Education; Liaoning Province Collaborative Innovation Center of Aging Related Disease Diagnosis and Treatment and Prevention, Shenyang, Liaoning Province, China 2. Department of Anus and Intestine Surgery, First Affiliated Hospital of China Medical University, Shenyang, Liaoning Province, China Corresponding authors: Xiaoyu Song, e-mail: [email protected] and Liu Cao, e-mail: [email protected]. Key Laboratory of Medical Cell Biology, Ministry of Education; Institute of Translational Medicine, China Medical University; Collaborative Innovation Center of Aging Related Disease Diagnosis and Treatment and Prevention, Shenyang, Liaoning Province, 110122, China. Tel: +86 24 31939636, Fax: +86 24 31939636. © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.12.03; Accepted: 2019.02.08; Published: 2019.03.09 Abstract The really interesting new gene (RING) finger protein 8 (RNF8) is a central factor in DNA double strand break (DSB) signal transduction. -
CHD4/Nurd Complex Regulates Complement Gene Expression And
Shao et al. Clinical Epigenetics (2020) 12:31 https://doi.org/10.1186/s13148-020-00827-3 RESEARCH Open Access CHD4/NuRD complex regulates complement gene expression and correlates with CD8 T cell infiltration in human hepatocellular carcinoma Simin Shao1†, Haowei Cao1†, Zhongkun Wang1, Dongmei Zhou2, Chaoshen Wu1, Shu Wang1, Dian Xia1 and Daoyong Zhang1* Abstract Backgrounds: The NuRD (Nucleosome Remodeling and Deacetylation) complex is a repressive complex in gene transcription by modulating chromatin accessibility of target genes to transcription factors and RNA polymerase II. Although individual subunits of the complex have been implicated in many other cancer types, the complex’s role in human hepatocellular carcinoma (HCC) is not fully understood. More importantly, the NuRD complex has not yet been investigated as a whole in cancers. Methods: We analyzed the expression of the NuRD complex in HCC and evaluated the prognostic value of NuRD complex expression in HCC using the RNA-seq data obtained from the TCGA project. We examined the effect of CHD4 knockdown on HCC cell proliferation, apoptosis, migration, invasion, epithelial-mesenchymal transition, colony-forming ability, and on complement gene expression. We also performed bioinformatic analyses to investigate the correlation between the NuRD complex expression and immune infiltration. Results: We found that nine subunits, out of 14 subunits of the NuRD complex examined, were significantly overexpressed in HCC, and their expression levels were positively correlated with cancer progression. More importantly, our data also demonstrated that these subunits tended to be overexpressed as a whole in HCC. Subsequent studies demonstrated that knockdown of CHD4 in HCC cells inhibits cell proliferation, migration, invasion, and colony-forming ability and promotes apoptosis of HCC cells, indicating that the CHD4/NuRD complex plays oncogenic roles in HCC. -
The Gene Repressor Complex Nurd Interacts with the Histone Variant H3.3
Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press The gene repressor complex NuRD interacts with the histone variant H3.3 at promoters of active genes Daniel C. Kraushaar1,3,4, Zuozhou Chen2,4, Qingsong Tang1, Kairong Cui1, Junfang Zhang2,*, Keji Zhao1,* 1 Systems Biology Center, National Heart, Lung, and Blood Institute, NIH, MD 2 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources (Shanghai Ocean University), Ministry of Education; International Research Center for Marine Biosciences at Shanghai Ocean University, Ministry of Science and Technology; National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China. 3 Current address: Genomic and RNA Profiling Core, Baylor College of Medicine, TX 4These authors contributed equally to this work *Correspondence: Junfang Zhang ([email protected]); Keji Zhao ([email protected]) Key words: histone variant H3.3; chromatin modification; epigenetics; ChIP-seq; protein interaction; NuRD; histone modification 1 Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The histone variant H3.3 is deposited across active genes, regulatory regions and telomeres. It remains unclear how H3.3 interacts with chromatin modifying enzymes and thereby modulates gene activity. In this study, we performed a co- immunoprecipitation-mass spectrometry analysis of proteins associated with H3.3-containing nucleosomes and identified the Nucleosome Remodeling and Deacetylase complex (NuRD) as a major H3.3-interactor. We show that the H3.3- NuRD interaction is dependent on the H3.3 lysine 4 residue and that NuRD binding occurs when lysine 4 is in its unmodified state. -
Supporting Information
Supporting Information Pouryahya et al. SI Text Table S1 presents genes with the highest absolute value of Ricci curvature. We expect these genes to have significant contribution to the network’s robustness. Notably, the top two genes are TP53 (tumor protein 53) and YWHAG gene. TP53, also known as p53, it is a well known tumor suppressor gene known as the "guardian of the genome“ given the essential role it plays in genetic stability and prevention of cancer formation (1, 2). Mutations in this gene play a role in all stages of malignant transformation including tumor initiation, promotion, aggressiveness, and metastasis (3). Mutations of this gene are present in more than 50% of human cancers, making it the most common genetic event in human cancer (4, 5). Namely, p53 mutations play roles in leukemia, breast cancer, CNS cancers, and lung cancers, among many others (6–9). The YWHAG gene encodes the 14-3-3 protein gamma, a member of the 14-3-3 family proteins which are involved in many biological processes including signal transduction regulation, cell cycle pro- gression, apoptosis, cell adhesion and migration (10, 11). Notably, increased expression of 14-3-3 family proteins, including protein gamma, have been observed in a number of human cancers including lung and colorectal cancers, among others, suggesting a potential role as tumor oncogenes (12, 13). Furthermore, there is evidence that loss Fig. S1. The histogram of scalar Ricci curvature of 8240 genes. Most of the genes have negative scalar Ricci curvature (75%). TP53 and YWHAG have notably low of p53 function may result in upregulation of 14-3-3γ in lung cancer Ricci curvatures. -
ZNF410 Represses Fetal Globin by Devoted Control of CHD4/Nurd
bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.272856; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title ZNF410 represses fetal globin by devoted control of CHD4/NuRD Authors Divya S. Vinjamur1, Qiuming Yao1,2, Mitchel A. Cole1, Connor McGuckin1, Chunyan Ren1, Jing Zeng1, Mir Hossain1, Kevin Luk3, Scot A. Wolfe3, Luca Pinello2, Daniel E. Bauer1,4 1Division of Hematology/Oncology, Boston Children’s Hospital, Department of Pediatric Oncology, Dana-Farber Cancer Institute, Harvard Stem Cell Institute, Broad Institute, Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02115, USA 2Molecular Pathology Unit, Center for Cancer Research, and Center for Computational and Integrative Biology, Massachusetts General Hospital, Department of Pathology, Harvard Medical School, Boston, Massachusetts 02129, USA 3Department of Molecular, Cell and Cancer Biology, Li Weibo Institute for Rare Diseases Research, University of Massachusetts Medical School, Worcester, Massachusetts 01605, USA 4Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.272856; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Major effectors of adult-stage fetal globin silencing include the transcription factors (TFs) BCL11A and ZBTB7A/LRF and the NuRD chromatin complex, although each has potential on- target liabilities for rational �-hemoglobinopathy therapeutic inhibition. -
HMG20B Antibody (N-Term) Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap21913a
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 HMG20B Antibody (N-Term) Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP21913a Specification HMG20B Antibody (N-Term) - Product Information Application WB,E Primary Accession Q9P0W2 Other Accession Q32L68 Reactivity Human Predicted Bovine Host Rabbit Clonality polyclonal Isotype Rabbit Ig Calculated MW 35813 HMG20B Antibody (N-Term) - Additional Information Gene ID 10362 Other Names All lanes : Anti-HMG20B Antibody (N-Term) SWI/SNF-related matrix-associated at 1:2000 dilution Lane 1: A549 whole cell actin-dependent regulator of chromatin lysate Lane 2: Jurkat whole cell lysate subfamily E member 1-related, Lysates/proteins at 20 µg per lane. SMARCE1-related protein, Secondary Goat Anti-Rabbit IgG, (H+L), BRCA2-associated factor 35, HMG Peroxidase conjugated at 1/10000 dilution. box-containing protein 20B, HMG domain-containing protein 2, HMG Predicted band size : 36 kDa domain-containing protein HMGX2, Sox-like Blocking/Dilution buffer: 5% NFDM/TBST. transcriptional factor, Structural DNA-binding protein BRAF35, HMG20B, BRAF35, HMGX2, HMGXB2, SMARCE1R HMG20B Antibody (N-Term) - Background Target/Specificity Required for correct progression through G2 This HMG20B antibody is generated from a phase of the cell cycle and entry into mitosis. rabbit immunized with a KLH conjugated Required for RCOR1/CoREST mediated synthetic peptide between 11-43 amino repression of neuronal specific gene acids from human HMG20B. promoters. Dilution HMG20B Antibody (N-Term) - References WB~~1:2000 Sumoy L.,et al.Cytogenet. Cell Genet. Format 88:62-67(2000). Purified polyclonal antibody supplied in PBS Marmorstein L.Y.,et al.Cell 104:247-257(2001). -
Histone Deacetylases 1 and 2 Regulate the Transcriptional Programs Of
© 2018. Published by The Company of Biologists Ltd | Development (2018) 145, dev153619. doi:10.1242/dev.153619 STEM CELLS AND REGENERATION RESEARCH ARTICLE Histone deacetylases 1 and 2 regulate the transcriptional programs of nephron progenitors and renal vesicles Hongbing Liu*, Shaowei Chen, Xiao Yao, Yuwen Li, Chao-Hui Chen, Jiao Liu, Zubaida Saifudeen and Samir S. El-Dahr ABSTRACT Six2, a homeodomain transcription factor, is a key factor within Nephron progenitor cells (NPCs) are Six2-positive metanephric the kidney metanephric mesenchyme that maintains the NPC pool mesenchyme cells, which undergo self-renewal and differentiation (Kobayashi et al., 2008; Self et al., 2006). In Six2 null mice, ectopic to give rise to nephrons until the end of nephrogenesis. Histone renal vesicles (the earliest epithelialized forms of nascent nephrons) deacetylases (HDACs) are a group of epigenetic regulators that develop at the onset of nephrogenesis and the progenitor pool is – control cell fate, but their role in balancing NPC renewal and rapidly lost (Self et al., 2006). Many transcriptional regulators differentiation is unknown. Here, we report that NPC-specific such as Osr1, WT1 and Sall1/Mi-2b (Chd4)/nucleosome deletion of Hdac1 and Hdac2 genes in mice results in early remodeling and deacetylase (NuRD), which function to maintain – postnatal lethality owing to renal hypodysplasia and loss of NPCs. the NPC pool display genetic interactions with Six2 (Basta et al., HDAC1/2 interact with the NPC renewal regulators Six2, Osr1 and 2014; Denner and Rauchman, 2013; Hartwig et al., 2010; Kanda Sall1, and are co-bound along with Six2 on the Six2 enhancer. et al., 2014; Xu et al., 2014). -
Transcription Factor PU.1 Represses and Activates Gene Expression in Early T Cells by Redirecting Partner Transcription Factor Binding
HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Immunity Manuscript Author . Author manuscript; Manuscript Author available in PMC 2019 June 19. Published in final edited form as: Immunity. 2018 June 19; 48(6): 1119–1134.e7. doi:10.1016/j.immuni.2018.04.024. Transcription factor PU.1 represses and activates gene expression in early T cells by redirecting partner transcription factor binding Hiroyuki Hosokawa#1, Jonas Ungerbäck#1,2, Xun Wang1, Masaki Matsumoto3, Keiichi I. Nakayama3, Sarah M. Cohen1, Tomoaki Tanaka4,5, and Ellen V. Rothenberg†,1 1Division of Biology & Biological Engineering, California Institute of Technology, Pasadena, CA, USA 2Division of Molecular Hematology, Lund University, Sweden 3Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, Japan 4Department of Molecular Diagnosis, Graduate School of Medicine, Chiba University, Japan 5AMED-CREST # These authors contributed equally to this work. SUMMARY Transcription factors normally regulate gene expression through their action at sites where they bind to DNA. However, the balance of activating and repressive functions that a transcription factor can mediate is not completely understood. Here, we showed that the transcription factor PU. 1 regulated gene expression in early T cell development both by recruiting partner transcription factors to its own binding sites and by depleting them from the binding sites that they preferred when PU.1 was absent. The removal of partner factors Satb1 and Runx1 occurred primarily from sites where PU.1 itself did not bind. Genes linked to sites of partner factor ‘theft’ were enriched for genes that PU.1 represses despite lack of binding, both in a model cell line system and in normal T cell development. -
Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases. -
GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen; -
Role of Histone Deacetylases in Gene Expression and RNA Splicing
Role of Histone Deacetylases in Gene Expression and RNA Splicing by Dilshad Hussain Khan A Thesis submitted to the Faculty of Graduate Studies of The University of Manitoba In partial fulfillment of the requirements of the degree of Doctor of Philosophy Department of Biochemistry and Medical Genetics University of Manitoba Winnipeg, Manitoba, Canada Copyright 2013 by Dilshad Hussain Khan Thesis Abstract Histone deacetylases (HDAC) 1 and 2 play crucial role in chromatin remodeling and gene expression regimes, as part of multiprotein corepressor complexes. Protein kinase CK2-driven phosphorylation of HDAC1 and 2 regulates their catalytic activities and is required to form the corepressor complexes. Phosphorylation-mediated differential distributions of HDAC1 and 2 complexes in regulatory and coding regions of transcribed genes catalyze the dynamic protein acetylation of histones and other proteins, thereby influence gene expression. During mitosis, highly phosphorylated HDAC1 and 2 heterodimers dissociate and displace from mitotic chromosomes. Our goal was to identify the kinase involved in mitotic phosphorylation of HDAC1 and 2. We postulated that CK2-mediated increased phosphorylation of HDAC1 and 2 leads to dissociation of the heterodimers, and, the mitotic chromosomal exclusions of HDAC1 and 2 are largely due to the displacement of HDAC-associated proteins and transcription factors, which recruit HDACs, from chromosomes during mitosis. We further explored the role of un- or monomodified HDAC1 and 2 complexes in immediate-early genes (IEGs), FOSL1 (FOS-like antigen-1) and MCL1 (Myeloid cell leukemia-1), regulation. Dynamic histone acetylation is an important regulator of these genes that are overexpressed in a number of diseases and cancers.