City University of New York (CUNY) CUNY Academic Works
Dissertations and Theses City College of New York
2015
The widespread skink Mabuya dorsivittata reveals complex patterns of genetic diversity in South America
Danielle Rivera CUNY City College
How does access to this work benefit ou?y Let us know!
More information about this work at: https://academicworks.cuny.edu/cc_etds_theses/568 Discover additional works at: https://academicworks.cuny.edu
This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] 1
The widespread skink Mabuya dorsivittata reveals complex patterns of genetic
diversity in South America
Danielle Rivera
Department of Biology, City College of New York, City University of New York, New
York, NY 10031, USA
Masters Thesis Committee:
Ana Carnaval, Ph.D. (advisor)
Amy Berkov, Ph.D.
Elizabeth Alter, Ph.D.
10 August 2015 2
Contents
Abstract ...... 3
Introduction ...... 4
Materials & Methods ...... 8
Sampling and Molecular Data ...... 8 Phylogenetic and STRUCTURE Analyses ...... 8 Environmental Analyses...... 10 Multiple Matrix Regression with Randomization (MMRR) ...... 10 Results ...... 12
Phylogenetic and STRUCTURE Analyses ...... 12 Environmental Analyses and MMRR ...... 14 Discussion ...... 16
Acknowledgements ...... 18
References ...... 19
Figures ...... 35
Tables ...... 41
Supplementary Material ...... 42
Methods ...... 42 Figures ...... 43 Tables ...... 47
3
The widespread skink Mabuya dorsivittata reveals complex patterns of genetic diversity in South America
Abstract
It has become increasingly important to document, describe, and understand the mechanisms that shape biodiversity, especially in the species-rich, highly-threatened, and understudied tropics. In this study, I describe the patterns and levels of genetic diversity within a widespread South American skink, Mabuya dorsivittata, and examine whether and how it tracks regional changes in geography and the environment along a complex landscape. First, I assess whether this species is panmictic or if it is comprised of multiple, spatially structured lineages. To that end, I measure levels of genetic diversity, and ask if ecosystem boundaries have acted as barriers to gene flow across its range. I then employ multiple matrix regression with randomization (MMRR) to test the degree to which geographic and environmental differences have shaped spatial genetic structure in
M. dorsivittata. Bayesian inference trees recovered four well supported lineages, many of which overlap in geographic space and are not bound by specific geographic or environmental barriers. A hierarchical analysis of molecular variance (AMOVA) revealed that most of the genetic diversity occurs within ecosystem boundaries.
Although M. dorsivittata is widely-distributed and occurs across a range of environments,
MMRR results indicate that neither environmental nor geographic distances are highly correlated with intraspecific divergence. To shed more light on the drivers of genetic diversity within this species, future studies may benefit from the inclusion of data on physiology, behavior, and historical demography of M. dorsivittata. 4
Introduction
The heterogeneous landscape of South America provides an ideal system for studying how geography and the environment affect biodiversity: the highly contrasting habitat configurations of this continent, spanning from the wet forests of Amazonia and
Atlantic Forests, to the savannahs of the Cerrado and the xeric Caatinga, are known to harbor an expanse of biodiversity and endemic taxa (Carnaval et al., 2014; Carnaval, et al., 2009; Fouquet et al., 2015; Recoder et al., 2014; Smith et al., 2014; Valdujo, et al.,
2013; Werneck, et al., 2015). Studies of narrowly distributed species, especially those restricted to local forests, have been crucial to the documentation, understanding, and conservation of South America’s outstanding biodiversity (Amaro, et al., 2012; Böhm et al., 2013; Carnaval et al., 2009; Erwin, 2009; Fouquet et al., 2012, 2015; Galetti, et al.,
1997; Pelegrin, et al., 2013; Rodrigues et al., 2014; Turchetto-Zolet, et al., 2013). In contrast, much less emphasis has been given to the study of widespread South American taxa which occur over broad geographic areas and diverse environmental gradients – particularly those living in open areas (Recoder et al., 2014; Werneck, 2011; Wynn &
Heyer, 2001). This bias is unfortunate: open-area species that range across diverse eco- regions present a unique opportunity to study patterns and mechanisms of diversification and adaption across complex environmental boundaries (Gehara et al., 2014; Werneck, et al., 2015). This is especially so given the propensity of wide-ranging species to exhibit marked spatial genetic structure and cryptic diversity, even in species with little phenotypic variation (Gamble, et al., 2012; Gehara et al., 2014; Omland, et al., 2000;
Werneck et al., 2015).
Multiple processes are known to influence genetic differentiation across landscapes, including those promoted by geographic, environmental, and behavioral 5
differences (McRae, 2006; Nosil, et al., 2005; Slatkin, 1993; Wang & Bradburd, 2014;
Wang & Summers, 2010; Wright, 1943). In this study, I investigate the role of geography
and the environment as drivers of spatial genetic diversity in a widespread South
American skink, Mabuya dorsivittata. Specifically, I evaluate the potential impacts of
Isolation by Distance, Isolation by Resistance, and Isolation by Environment on the
genetic patterns of this broadly ranged species. The concept of Isolation by Distance
(IBD) has been widely tested and effectively applied in studies of spatial genetic differentiation for decades (McRae, 2006; Wright, 1943). IBD is a widespread phenomenon wherein populations separated by large geographic distances exhibit decreased levels of gene flow, thus diverging genetically over time (Slatkin, 1993;
Wright, 1943). Similarly, Isolation by Resistance (IBR) incorporates resistance to dispersal into the calculation of distance between each point across a landscape (McRae,
2006). Landscape resistance can be imposed by geographic barriers, unsuitable habitat, or
any biologically relevant feature. Resistance-based methods are thought to be better
predictors of actual dispersal distance in landscape genetics analyses than the strict
Euclidean distances represented in IBD (McRae, 2006); however, given the propensity
for widespread species to have more suitable habitat across a large range, it is expected
that Euclidean, least-cost path, and circuit distances will be very similar. The role of
Isolation by Environment (IBE), on the other hand, has reemerged in recent genetic
studies on natural populations, supported by the development of landscape genetics
techniques. IBE focuses on the influence that differing environments have on genetic
variation (McRae & Beier, 2007; Wang & Bradburd, 2014). Under IBE, ecologically
associated mechanisms such as adaptation to local environments, assortative mating, and
migration-balancing selection, reduce gene flow and promote genetic divergence between 6 populations (Edelaar & Bolnick, 2012; Nosil, et al., 2008; Nosil et al., 2005; Rundle &
Nosil, 2005; Wang & Bradburd, 2014; Wang & Summers, 2010). Recent studies have shown that these environmentally driven forces significantly affect population genetic structure, especially in widespread species (Manthey & Moyle, 2015; Wang, et al., 2013).
The focal species in this study, Mabuya dorsivittata, is a widely distributed skink with a range originally thought to include portions of the northern and eastern
Argentinian Chaco, Paraguay, Bolivia, Uruguay, and southeastern Brazil; in addition, a number of populations have recently been identified across the southern Brazilian
Cerrado, as well as additional areas of Uruguay (Carranza & Arnold, 2003; Costa, et al.,
2009; Hedges & Conn, 2012; Recoder & Nogueira, 2007; Valdujo et al., 2009; Vaz-Silva et al., 2007; Williams & Kacoliris, 2011). Furthermore, recent fieldwork revealed previously unknown populations in open areas within the Atlantic forest throughout coastal Brazil, from the southernmost Brazilian states of Rio Grande do Sul and Santa
Catarina, to the montane regions of Bahia (Fig. 1). Yet, little is known about the amount of gene flow across this species’ range. Although Mabuya species are abundant in the
Neotropics, few phylogeographic studies have focused on intra-specific patterns of genetic structure and historical demography across the broad environmental gradients they occupy. Fewer still have addressed these issues through the use of multi-locus nuclear datasets.
The range of M. dorsivittata encompasses multiple contrasting ecosystems and climatic regimes. Individuals in the western range of the species occupy broadly connected, open areas of the Cerrado, the Chaco, the lowland Pampas, and the southern
Atlantic Forest (Fig. 1; Álvarez et al., 2009; Iganci, et al., 2011; Pelegrin & Bucher,
2012). In contrast, in the eastern portion of the range, the species occurs in the naturally 7
fragmented mountain ranges within the Atlantic forest ecosystem, either occupying forest
clearings, highly disturbed areas, or the montane campos rupestres. The latter are open
regions and often rocky grasslands, isolated by a matrix of dense rainforests (Araujo et
al., 2014; Costa et al., 2009; Gainsbury & Colli, 2014; Giulietti & Pirani, 1988; Recoder
& Nogueira, 2007; Townsend, et al., 2004; Valdujo et al., 2009; Vaz-Silva et al., 2007).
In this study, I investigate two major questions about the levels and patterns of
genetic diversity within M. dorsivittata. First, I ask whether M. dorsivittata is a wide-
ranging, panmictic species, or if it is comprised of multiple, spatially structured lineages.
Given the naturally fragmented nature of suitable habitat within the species range in the
Atlantic forest ecosystem relative to the more continuous habitats within the dry-diagonal
and the Pampas of Southern Brazil, I expect to find much higher levels of genetic
structure and differentiation across M. dorsivittata in the former relative to the latter.
Secondly, I ask if (and to which extent) local environmental conditions better
explain genetic structure compared to geography. In other words, is genetic diversity
within M. dorsivittata largely structured by differences in environmental conditions, as
recently documented for other widespread taxa, or by geographic distance? If local
adaptation has played a major role in shaping genetic structure within M. dorsivittata, I
expect IBE to be a much stronger predictor relative to distance. By identifying potential
key drivers of genetic diversity in M. dorsivittata, I hope to shed light on processes that may be likewise impacting other similarly distributed species across the heterogeneous landscapes of South America. 8
Materials & Methods
Sampling and Molecular Data
Dramatically increasing the sampled range of M. dorsivittata, genetic data from
82 specimens were generated from 35 different localities across the Brazilian Cerrado, the Pampas, the Argentinian Chaco, open areas of the Atlantic forest south of Rio de
Janeiro, and campos rupestres within the inland Espinhaço, Diamantina, and Mantiqueira mountain ranges (Table S1). DNA extraction was performed with a high salt protocol
(Carnaval & Bates, 2007). Three mitochondrial and seven nuclear genes were amplified; they include the mitochondrial 12S, 16S, and Cytochrome b (cytb) genes, and the nuclear markers BTB And CNC Homology 1 (BACH1), Oocyte Stimulating Factor Oocyte
Maturation Factor (CMOS), Dynein Axonemal Heavy Chain 3 (DNAH3),
Recombination Activating Gene 1 (RAG1), Ribosomal Protein L35 (RPL35), Synuclein
Alpha Interacting Protein (SINCAIP), and Myosin Heavy Chain (MYH). One sequence available in Genbank (DQ238876) was used to complement the sequenced panel. Primers and PCR profiles were adapted from the literature (Miralles et al., 2009; Pellegrino, 2001;
Townsend, et al., 2008; Whiting et al., 2006; Table S2).
Phylogenetic and STRUCTURE Analyses
DNA sequences were edited and aligned in Geneious vR6
(http://www.geneious.com, Kearse et al., 2012). Alignments were partitioned by gene;
best-fitting models of evolution were inferred per gene based on AIC scores, using
PartitionFinder v1.1.1 (Lanfear et al., 2012). Nuclear haplotypes of heterozygotes were
estimated with PHASE 2.1.1 (Flot, 2010; Stephens & Donnelly, 2003). Using M.
macrorhyncha as an outgroup, concatenated (mtDNA, nuDNA, mtDNA+nuDNA) 9
Bayesian inference trees were generated in MrBayes v3.2.1 (individual gene and
concatenated nuDNA trees presented in Fig. S1;Heulsenbeck et al., 2001) and run four
times independently, each for 20 million generations, discarding the first 25% of trees as
burn-in. Effective sample size (ESS) scores were assessed in Tracer v1.6 to ensure
stationarity (i.e. ESS>200; Rambaut, et al., 2014). All trees were run using the CUNY
HPC Center cluster.
To test for signals of genetic structure in the nuclear data, the Bayesian Markov
Chain Monte Carlo (MCMC) clustering program STRUCTURE V2.3.4 (Pritchard, et al.,
2000) was implemented in a single analysis that combined sequences of all seven nuclear
loci. STRUCTURE was run with the admixture model of ancestry and correlated allele
frequencies for 500,000 generations; 200,000 generations were discarded as burn-in.
Results were analyzed with the Cluster Markov Packager Across K program
(CLUMPAK; Kopelman, Mayzel, Jakobsson, Rosenberg, & Mayrose, 2015), which
identified an optimal K value using the ΔK method (Evanno, et al., 2005). The software
CLUMPP (Jakobsson & Rosenberg, 2007) was then used to summarize and visualize the
outputs of multiple runs for the optimal K (Earl & vonHoldt, 2011; Pritchard et al.,
2000).
To ask whether discrete ecosystems explain observed genetic structure within this
species, I used pairwise genetic distances to estimate FSTs and implemented an analysis of
molecular variance (AMOVA) with three hierarchal levels in Arlequin v3.5.2.1
(Excoffier & Lischer, 2010). The AMOVA was designed to assess the percentage of
genetic variation across and within three ecosystems: Atlantic forest (including campos rupestres), Cerrado, and Pampas; the Chaco was excluded due to poor sampling. I also 10
built median joining (MJ) networks to portray haplotype relationships within and across
ecosystems in Network v4.6.1.3 (Tamura & Nei, 1993; Tamura, et al., 2013).
Environmental Analyses
To assess whether M. dorsivittata occupies a broad range of climatic regimes, or
if it instead occupies areas of similar climatic conditions across a range of vegetation
types (ecosystems), I ran a Principle Component Analysis (PCA) on species locality data using 19 freely available WorldClim bioclimatic layers (Hijmans, et al., 2005) in SPSS
(IBM Corp., 2012). I used known M. dorsivittata collection sites based on verified georeferenced records from tissue-sampled individuals used in this study, and vetted occurrence records available on VertNet (http://www.vertnet.org), speciesLink
(http://splink.cria.org.br/), GBIF (gbif.org) and literature records (database citations in
Supplements; Álvarez et al., 2009; Araujo et al., 2014; Costa et al., 2009; Filho &
Verrastro, 2012; Gainsbury & Colli, 2014; Iganci et al., 2011; Recoder & Nogueira,
2007; Valdujo et al., 2009; Vaz-Silva et al., 2007; Williams & Kacoliris, 2011). To describe climatic differences across the range of M. dorsivittata relative to the major ecosystems where it is found, I used ArcGIS v.10.2 (ESRI, 2013) to generate random points within the Atlantic forest, Cerrado, Chaco, and Pampas, and incorporated those points into my PCA for visualization purposes.
Multiple Matrix Regression with Randomization (MMRR)
To assess the contribution of environmental vs. geographical conditions on the
spatial genetic structure within M. dorsivittata, I used the multiple matrix regression with
randomization (MMRR) function in R (Wang, 2013), which allows for a number of
independent matrices to be compared to a dependent variable. Specifically, I tested the 11 relative contributions that Isolation by Distance (IBD), Isolation by Resistance (IBR), and
Isolation by Environment (IBE) have in explaining overall genetic diversity (Wang &
Bradburd, 2014; Wang et al., 2013; Wang, 2013). IBD was measured through a matrix of pairwise Euclidean distance between each locality. To evaluate the potential impact of
IBR, I built independent matrices of pairwise distances from the resistance-based methods of least-cost pathways (LCP) and circuit distances generated with ArcGIS and
Circuitscape (McRae & Beier, 2007). These methods have been shown to be more accurate measurements than strict Euclidean distances (McRae & Beier, 2007; McRae,
2006; Spear, et al., 2010; Wang, 2013), as well as to explore both single and multiple likely pathways between points (Howey, 2011; Wang et al., 2013).
To estimate landscape resistance and least-cost pathways, I developed an ecological niche model (ENM) for the species using the spatial jackknifing method in
SDMToolbox (Brown, 2014), which employs the software Maxent (Phillips, et al., 2006).
The model was built using 19 bioclimatic layers (Worldclim; Hijmans et al., 2005), as well as percent vegetation (MODIS) and global land cover (ESA) layers (Arino et al.,
2007; DiMiceli et al., 2011). Occurrence records were spatially rarefied (10 km distance) to reduce the effects of spatial auto-correlation (Boria, et al., 2014; Hijmans, 2012; Veloz,
2009); background selection was limited to a buffered minimum convex polygon. A minimum training presence threshold was applied, and neither clamping nor extrapolation was utilized in the model. The ENM was used to generate a friction layer, wherein grid cells with higher probabilities were assigned lower friction values (1- suitability score). Based on these values, pairwise LCP and circuit distances were calculated between all pairs of localities for which I had collected genetic data. To test the potential role of IBE, I generated pairwise distance matrices using the four principle 12
components extracted from the environmental PCA, as described above, on the same
pairs of M. dorsivittata localities. My response (dependent) variable matrix was comprised of pairwise p-distances for the concatenated mtDNA and nuDNA datasets
estimated in MEGA v6 (http://www.fluxus-engineering.com).
Results
Phylogenetic and STRUCTURE Analyses
Bayesian inference trees based solely on the mitochondrial genes and on
concatenated mitochondrial and nuclear gene sequences recovered four well-supported lineages (Fig. 2). The spatial distribution of the lineages does not clearly follow ecosystem boundaries, and the lineages also fail to clearly segregate in geographical space. Lineage A (blue squares, Fig. 2) is composed of individuals in mid- to high- elevation areas from the mid-Atlantic Forest along southeastern Brazil northward, including the montane campos rupestres (~1500 km), as well as in the Cerrado.
Individuals in lineage B (green circles, Fig. 2) are found in similar elevations in campos rupestres as well as open areas in the coastal, southern Atlantic forest. Lineage C (pink
triangles, Fig. 2) includes samples from a wide range of elevations and occupies sites in
the Cerrado, Chaco, open areas of the Atlantic forest, and the Pampas south and west of
the mid-Atlantic Forest. Lineage D (red diamonds, Fig. 2) is found in an open Atlantic
forest area and in the Pampas in southern Brazil, but also in a much more northern
locality within the Cerrado.
Despite the poor resolution of the individual and concatenated nuclear trees (Fig.
S1), the STRUCTURE analysis of the pooled nuclear data identified four genetic clusters. 13
Similar to the mtDNA lineage arrangement, the spatial distribution of these nuclear gene
clusters does not clearly follow ecosystem boundaries, and also fail to clearly segregate in
geographical space (ΔK method; Fig. 3). Those individuals belonging to STRUCTURE clusters 1 and 2 (blue and orange; Fig. 3) are found solely in the Atlantic forest (open areas and campos rupestres). Conversely, those in STRUCTURE clusters 3 and 4 (purple and grey; Fig. 3) are broadly distributed; both contain individuals spanning the entirety of the species range in all ecosystems sampled (Fig. 3).
A comparison between the mtDNA genealogy and the STRUCTURE analyses demonstrates that individuals carrying mitochondrial lineages A and B, which are mostly distributed in the northern Atlantic forest and campos rupestres, usually belong to nuclear clusters 1 and 2 (blue and orange; Fig. 3). The only exceptions seem to happen in interior sites, where individuals with mitochondrial lineages A and B are inferred to have higher levels of admixture and assigned to nuclear clusters 3 and 4 (grey and purple; Fig 3). The latter, however, are pervasive in the Cerrado, Chaco, Pampas, and the southern Atlantic
Forest.
Between-site mitochondrial FSTs indicate that the levels of genetic structure across
the fragmented northern Atlantic forest are analogous to those across the open-area
localities of the Cerrado and Pampas, though many FST values were not significant (Table
S3). Overall high FSTs across sites in the Northern Atlantic forest (campos rupestres and
open forest; mean 0.81) reflect the observed phylogenetic structure in this region (Fig. 1).
Average FSTs within the Cerrado (0.82) and Pampas (0.71) were similarly high, as
individuals within these ecosystems shared membership with more than one
mitochondrial lineage (Fig. 2; Table S3). Comparatively, FSTs within the southern
Atlantic forest were much lower (open and cleared forest; 0.54; Table S3). 14
Mitochondrial FSTs across ecosystems demonstrate significant genetic
differentiation between individuals from the Atlantic forest, Pampas, and Cerrado (Table
1). Yet, an AMOVA shows that most of the genetic differentiation within this species
(61.43 %) is observed among sites within ecosystems; genetic differentiation between ecosystems and within sites explains only 24.60 % and 13.97 %, respectively, of the total variation (Table 1). While haplotype networks show that private alleles are found within
ecosystems, many of the most abundant nuclear haplotypes are shared across ecosystem boundaries (Fig. 4).
Environmental Analyses and MMRR
An ecological niche model (EMN) of the species predicts high climatic suitability
in the highlands of the Atlantic forest, including the narrowly ranged campos rupestres
and the Southern Highland Grasslands of Brazil, northern Pampas, and eastern Chaco
(Fig. 5). This model also predicts small patches of high suitability in portions of the
southeastern Cerrado and northern Chaco. Variable contributions (lambda values) and
variable jackknife responses indicate that land cover was not only an important feature,
but it also greatly influenced the resulting suitability across the landscape; the
incorporation of land cover data visibly fragmented suitable areas compared to models
generated without this information, especially outside of the Atlantic forest (Fig. 5).
The ecosystems occupied by M. dorsivittata span a wide range of climatic
conditions, not all of them exclusive to a particular ecosystem. The Cerrado, Chaco, and
Pampas regions, for instance, can be visually distinguished from each other through an
environmental PCA (Fig. 6A). However, the Atlantic forest climate, as described at the
spatial scale of the bioclimatic layers utilized here, partially overlaps with those of the 15
three ecosystems, particularly in its southern range (Fig. 6A); M. dorsivittata largely
occurs across this overlap, but is also found in climatic regimes specific to single
ecosystems (Fig. 6A).
M. dorsivittata occurs in a wide range of available temperatures and precipitation
regimes (annual mean temperature, 11 °C – 26 °C; annual precipitation, 679 mm – 2412
mm). Approximately 70% of the variation in the environmental space occupied by the
species is explained by PC1 (characterized mostly by temperature metrics; 42.7%) and
PC2 (characterized by precipitation metrics; 27.5%; Table S4).
Neither the mitochondrial lineages nor the nuclear STRUCTURE clusters within
M. dorivittata clearly segregate in environmental space: the environmental PCA shows overlap across multiple mtDNA lineages (Fig. 6B) and nuDNA STRUCTURE clusters
(Fig. 6C). The MMRR analysis broadly agrees with these findings, revealing that while
both environmental distance (IBE) and geographic distance (measured by either IBD or
IBR) are both significantly correlated to genetic structure patterns, neither strongly
explains genetic diversity within the species (Table 2). Environmental distance alone, characterized by pairwise differences of PC scores derived from the environmental PCA, explained about 21% of both mitochondrial and nuclear genetic differences (Table 2).
Resistance distances alone, which included least-cost pathway and circuit distances,
explained about 28% of mitochondrial and about 11% of nuclear genetic differences,
(Table 2). Similarly to resistance distances, Euclidean distance explained about 21% or
mitochondrial and 14% of nuclear distances (Table 2). 16
Discussion
M. dorsivittata shows considerable spatial structure across its broad range. We detect deep mitochondrial lineage divergence between lineages A and C in the mid-
Atlantic Forest, a region known to harbor phylogeographic breaks within other amphibian, reptile, avian, and invertebrate species (Amaro et al., 2012; Batalha-Filho, et al., 2012; Batalha-Filho, et al., 2010; Cabanne, et al., 2008; Grazziotin, et al., 2006).
Genetic discontinuities around this region are found not only in the mtDNA data, but are also largely supported by the nuclear STRUCTURE analysis. Though the mechanism maintaining concurrent phylogenetic breaks in this region has not been clarified, it has been hypothesized that the reactivation of tectonic plates during the late Miocene promoted isolation and lineage divergence (Riccomini, et al., 2010).
Minor spatial structuring of the nuDNA STRUCTURE clusters correspond to mtDNA lineages; this pattern could be further supported through improved sampling both within and between individual localities. High levels of genetic structure were also detected in the northern Atlantic Forest. The naturally fragmented and open high elevation areas within the Atlantic forest (campos rupestres) seem to serve as sky islands, isolating populations on mountaintops and deterring gene flow despite the high inferred climatic suitability between these peaks, as observed both in the correlative distribution model and the mitochondrial data. This could indicate, as known localities corroborate, a preference for little-to-no forest cover, which would isolate and promote genetic divergence between individuals on open mountain peaks isolated by dense forest cover.
Mitochondrial data also show disjunct phylogeographic patterns. Lineage D, for instance, is found to occur in the Cerrado, but also in the southern Atlantic Forest and
Pampas, with no intervening populations found. Similar patterns have been observed in 17
Tropidurus catalenensis lizards (Sena, 2015), yet the taxonomic instability of that group, tied to poor sampling, renders any meaningful comparison difficult at best. It is plausible that improved sampling in intermediate areas (Mato Grosso do Sul, Paraná and Santa
Catarina in Brazil, as well as Argentina, and Paraguay) could reveal this lineage to be more widespread than presently known.
Levels of gene flow (average FSTs) measured within the fragmented northern
Atlantic forest were not markedly different from that of areas outside of the Atlantic forest. However, mitochondrial divergence was greater across sites in the northern
Atlantic forest than in the cooler southern Atlantic forest. It is possible that genetic
structure in these areas was influenced by paleoclimatic events and effects of historical
climatic stability. In the Atlantic forest, late Quaternary climatic fluctuations have been
associated with geographic shifts in the distribution of several species (Carnaval et al.,
2014, 2009). Given its association with cooler environmental conditions (e.g. mountain
tops), I expect that correlative paleodistribution models for M. dorsivittata might suggest range expansions in the Atlantic forest during the Last Glacial Maximum, and range contraction during the comparatively warmer Interglacial periods. These montane lineages are likely experiencing bottlenecks in their current climatically and geographically restricted ranges. However, if vegetation (or landscape) configuration is essential for species occurrence, as suggested by the species distribution models and the genetic data, then paleoclimatic distribution models of M. dorsivittata must include information about past vegetation configuration, and not only past climates. To appropriately model the former range of this species, and likely other open-area taxa, it will be necessary to incorporate inferences about changes in vegetation structure over time. 18
The contributions from IBD and IBR to both mitochondrial and nuclear genetic
divergence were very similar, supporting the expectation that these two metrics would
yield nearly identical results in a widespread species. Environmental differences were
previously found to have an underestimated amount of influence on the genetic diversity
of widespread taxa (Wang, 2013). However, most of the genetic variation within M.
dorsivittata occurs within, instead of across, ecosystems. This indicates that ecosystem
boundaries have not been acting as strong barriers to dispersal and gene flow. Still, the
MMRR analysis detects significant, although low, correlation between environmental and
genetic distance, suggesting that environmental conditions do play some role in shaping
genetic diversity in M. dorsivittata, or are correlated with other important processes not
yet described. Process-based studies that explore plausible mechanisms underscoring
patterns of genetic diversity will likely shed more light on the drivers of genetic structure
in this and similarly distributed species.
Acknowledgements
I thank the members of the Carnaval Lab, both past and present, for years of research
guidance and support, as well as those from the other Ecology, Evolution, and Behavior
Labs at The City College of New York. I also thank Miguel T. Rodrigues and his lab at the
Universidade de São Paulo for collecting and providing all tissue samples used in this study, assistance in the field, and vital information regarding ideas presented in this paper. I thank
Ivan Prates and Diego Alvarado-Serrano for unyielding support, valued feedback, and
company during late lab sessions. Jason L. Brown and Maria Strangas provided
invaluable feedback and assistance with analyses presented here. Gustavo Monteiro,
Pedro Peloso, Silvia Pavan, Robert Boria, Peter Galante, and Beth Gerstner provided 19 much-needed temporary respite from lab work. Finally, I’d like to thank my mentor, Dr. Ana
Carnaval, for her unrelenting positivity, support, and significance in guiding my present and future endeavors.
Supported to D. Rivera was provided by the Louis Stokes Alliance for Minority
Participation and The City College Academy for Professional Preparation. Research was funded by FAPESP (BIOTA, 2013/50297-0), NSF (DEB 1343578) and NASA, through the Dimensions of Biodiversity Program. This research benefited from the City
University of New York High Performance Computing Center at the College of Staten
Island (NSF CNS-0958379, CNS-0855217, ACI-1126113).
References
Álvarez, B. B., García, J. A. A. R., Céspedez, J. A., Hernando, A. B., Zaracho, V. H.,
Calamante, C. C., & Aguirre, R. H. (2009). Herpetofauna, provinces of Chaco and
Formosa, Chaco Oriental region, north-eastern Argentina. Check List, 5(1), 74–82.
Amaro, R. C., Rodrigues, M. T., Yonenaga-Yassuda, Y., & Carnaval, A. C. (2012).
Demographic processes in the montane Atlantic rainforest: Molecular and
cytogenetic evidence from the endemic frog Proceratophrys boiei. Molecular
Phylogenetics and Evolution, 62(3), 880–888.
http://doi.org/10.1016/j.ympev.2011.11.004
Araujo, C., Maffei, F., Corrêa, D., Moya, G., Nascimento, B., & Santos, S. (2014).
Lizards from Estação Ecológica de Santa Bárbara, a remnant of Cerrado in the state 20
of São Paulo, Brazil. Check List, 10(5), 1038–1043.
http://doi.org/10.15560/10.5.1038
Arino, O., Gross, D., Ranera, F., Bourg, L., Leroy, M., Bicheron, P., … Weber, J. L.
(2007). GlobCover: ESA service for global land cover from MERIS. In Geoscience
and Remote Sensing Symposium, 2007. IGARSS 2007. IEEE International (pp. 2412
– 2415). Barcelona, Spain: IEEE. http://doi.org/10.1109/IGARSS.2007.4423328
Batalha-Filho, H., Cabanne, G. S., & Miyaki, C. Y. (2012). Phylogeography of an
Atlantic forest passerine reveals demographic stability through the last glacial
maximum. Molecular Phylogenetics and Evolution, 65(3), 892–902.
http://doi.org/10.1016/j.ympev.2012.08.010
Batalha-Filho, H., Waldschmidt, A. M., Campos, L. a. O., Tavares, M. G., & Fernandes-
Salomão, T. M. (2010). Phylogeography and historical demography of the
neotropical stingless bee Melipona quadrifasciata (Hymenoptera, Apidae):
incongruence between morphology and mitochondrial DNA. Apidologie, 41(5),
534–547. http://doi.org/10.1051/apido/2010001
Böhm, M., Collen, B., Baillie, J. E. M., Bowles, P., Chanson, J., Cox, N., … Zug, G.
(2013). The conservation status of the world’s reptiles. Biological Conservation,
157, 372–385. http://doi.org/10.1016/j.biocon.2012.07.015
Boria, R. A., Olson, L. E., Goodman, S. M., & Anderson, R. P. (2014). Spatial filtering to
reduce sampling bias can improve the performance of ecological niche models.
Ecological Modelling, 275, 73–77. http://doi.org/10.1016/j.ecolmodel.2013.12.012 21
Brown, J. L. (2014). SDMtoolbox: a python-based GIS toolkit for landscape genetic,
biogeographic and species distribution model analyses. Methods in Ecology and
Evolution, 5(7), n/a–n/a. http://doi.org/10.1111/2041-210X.12200
Cabanne, G. S., d’Horta, F. M., Sari, E. H. R., Santos, F. R., & Miyaki, C. Y. (2008).
Nuclear and mitochondrial phylogeography of the Atlantic forest endemic
Xiphorhynchus fuscus (Aves: Dendrocolaptidae): biogeography and systematics
implications. Molecular Phylogenetics and Evolution, 49(3), 760–73.
http://doi.org/10.1016/j.ympev.2008.09.013
Carnaval, A. C., & Bates, J. M. (2007). Amphibian DNA shows marked genetic structure
and tracks Pleistocene climate change in northeastern Brazil. Evolution, 61(12),
2942–2957. http://doi.org/10.1111/j.1558-5646.2007.00241.x
Carnaval, A. C., Hickerson, M. J., Haddad, C. F. B., Rodrigues, M. T., & Moritz, C.
(2009). Stability predicts genetic diversity in the Brazilian Atlantic forest hotspot.
Science (New York, N.Y.), 323(5915), 785–789.
http://doi.org/10.1126/science.1166955
Carnaval, A. C., Waltari, E., Rodrigues, M. T., Rosauer, D., VanDerWal, J., Damasceno,
R., … Moritz, C. (2014). Prediction of phylogeographic endemism in an
environmentally complex biome. Proceedings of the Royal Society B: Biological
Sciences, 281(1792). http://doi.org/10.1098/rspb.2014.1461
Carranza, S., & Arnold, E. N. (2003). Investigating the origin of transoceanic
distributions: Mtdna shows Mabuya lizards (Reptilia, Scincidae) crossed the Atlantic 22
twice. Systematics and Biodiversity, 1(2), 275–282.
http://doi.org/10.1017/S1477200003001099
Costa, H. C., Fernandes, V. D., Rodrigues, A. C., & Feio, R. N. (2009). Lizards and
Amphisbaenians , municipality of Viçosa , state of Minas Gerais , southeastern
Brazil. Check List, 5(3), 732–745.
DiMiceli, C. M., Carroll, M. L., Sohlberg, R. A., Huang, C., Hansen, M. C., &
Townshend, J. R. G. (2011). Annual Global Automated MODIS Vegetation
Continuous Fields (MOD44B) at 250 m Spatial Resolution for Data Years
Beginning Day 65, 2000 - 2010. College Park, Maryland: University of Maryland.
Dolman, G., & Phillips, B. (2004). Single copy nuclear DNA markers characterized for
comparative phylogeography in Australian wet tropics rainforest skinks. Molecular
Ecology Notes, 4(2), 185–187. http://doi.org/10.1111/j.1471-8286.2004.00609.x
Earl, D. A., & vonHoldt, B. M. (2011). STRUCTURE HARVESTER: a website and
program for visualizing STRUCTURE output and implementing the Evanno
method. Conservation Genetics Resources, 4(2), 359–361.
http://doi.org/10.1007/s12686-011-9548-7
Edelaar, P., & Bolnick, D. I. (2012). Non-random gene flow: an underappreciated force
in evolution and ecology. Trends in Ecology & Evolution, 27(12), 659–65.
http://doi.org/10.1016/j.tree.2012.07.009
Erwin, D. H. (2009). Climate as a driver of evolutionary change. Current Biology : CB,
19(14), R575–83. http://doi.org/10.1016/j.cub.2009.05.047 23
ESRI. (2013). ArcGIS Desktop: Release 10.2. Redlands, CA: Environmental Systems
Research Institute.
Evanno, G., Regnaut, S., & Goudet, J. (2005). Detecting the number of clusters of
individuals using the software STRUCTURE: a simulation study. Molecular
Ecology, 14(8), 2611–20. http://doi.org/10.1111/j.1365-294X.2005.02553.x
Excoffier, L., & Lischer, H. E. L. (2010). Arlequin suite ver 3.5: a new series of
programs to perform population genetics analyses under Linux and Windows.
Molecular Ecology Resources, 10(3), 564–7. http://doi.org/10.1111/j.1755-
0998.2010.02847.x
Filho, G. A. de S., & Verrastro, L. (2012). Reptiles of the Parque Estadual de Itapua, state
of Rio Grande do Sul, southern Brazil. Check List, 8(5), 847–851.
Flot, J. F. (2010). seqphase: a web tool for interconverting phase input/output files and
fasta sequence alignments. Molecular Ecology Resources, 10(1), 162–6.
http://doi.org/10.1111/j.1755-0998.2009.02732.x
Fouquet, A., Recoder, R., Teixeira, M., Cassimiro, J., Amaro, R. C., Camacho, A., …
Rodrigues, M. T. (2012). Molecular phylogeny and morphometric analyses reveal
deep divergence between Amazonia and Atlantic Forest species of
Dendrophryniscus. Molecular Phylogenetics and Evolution, 62(3), 826–838.
http://doi.org/10.1016/j.ympev.2011.11.023
Fouquet, A., Souza, S. M., Nunes, P. M. S., Kok, P. J. R., Curcio, F. F., de Carvalho, C.
M., … Rodrigues, M. T. (2015). Two new endangered species of Anomaloglossus 24
(Anura: Aromobatidae) from Roraima State, northern Brazil. Zootaxa, 3926(2),
191–210.
Fujita, M. K., McGuire, J. a., Donnellan, S. C., & Moritz, C. (2010). Diversification and
persistence at the arid-monsoonal interface: Australia-wide biogeography of the
bynoe’s gecko (heteronotia binoei; gekkonidae). Evolution, 64(8), 2293–2314.
http://doi.org/10.1111/j.1558-5646.2010.00993.x
Gainsbury, A. M., & Colli, G. R. (2014). Effects of abandoned Eucalyptus plantations on
lizard communities in the Brazilian Cerrado. Biodiversity and Conservation, 3155–
3170. http://doi.org/10.1007/s10531-014-0771-x
Galetti, M., Martuscelli, P., Olmos, F., & Aleixo, A. (1997). Ecology and conservation of
the jacutinga Pipile jacutinga in the Atlantic forest of Brazil. Biological
Conservation, 82(1), 31–39. http://doi.org/10.1016/S0006-3207(97)00004-9
Gamble, T., Colli, G. R., Rodrigues, M. T., Werneck, F. P., & Simons, A. M. (2012).
Phylogeny and cryptic diversity in geckos (Phyllopezus; Phyllodactylidae; Gekkota)
from South America’s open biomes. Molecular Phylogenetics and Evolution, 62(3),
943–53. http://doi.org/10.1016/j.ympev.2011.11.033
Gartner, G. E. a, Gamble, T., Jaffe, A. L., Harrison, A., & Losos, J. B. (2013). Left-right
dewlap asymmetry and phylogeography of Anolis lineatus on Aruba and Cura??ao.
Biological Journal of the Linnean Society, 110(2), 409–426.
http://doi.org/10.1111/bij.12131 25
Gehara, M., Crawford, A. J., Orrico, V. G. D., Rodríguez, A., Lötters, S., Fouquet, A., …
Köhler, J. (2014). High levels of diversity uncovered in a widespread nominal taxon:
continental phylogeography of the neotropical tree frog Dendropsophus minutus.
PloS One, 9(9), e103958. http://doi.org/10.1371/journal.pone.0103958
Giulietti, A. M., & Pirani, J. R. (1988). Patterns of geographic distribution of some plant
species from the Espinhaco Range, Minas Gerais and Bahia, Brazil. In P. E.
Vanzolini & W. R. Heyer (Eds.), PROCEEDINGS OF A WORKSHOP ON
NEOTROPICAL DISTRIBUTION PATTERNS (pp. 39–69). Rio de Janeiro:
Academia Brasileira de Ciencias.
Grazziotin, F. G., Monzel, M., Echeverrigaray, S., & Bonatto, S. L. (2006).
Phylogeography of the Bothrops jararaca complex (Serpentes: Viperidae): past
fragmentation and island colonization in the Brazilian Atlantic Forest. Molecular
Ecology, 15(13), 3969–82. http://doi.org/10.1111/j.1365-294X.2006.03057.x
Hedges, S. B., & Conn, C. E. (2012). A new skink fauna from Caribbean islands
(Squamata, Mabuyidae, Mabuyinae). Zootaxa, 3288, 1–244.
Hijmans, R. J. (2012). Cross-validation of species distribution models: Removing spatial
sorting bias and calibration with a null model. Ecology, 93(3), 679–688.
http://doi.org/10.1890/11-0826.1
Hijmans, R. J., Cameron, S. E., Parra, J. L., Jones, P. G., & Jarvis, A. (2005). Very high
resolution interpolated climate surfaces for global land areas. International Journal
of Climatology, 25(15), 1965–1978. http://doi.org/10.1002/joc.1276 26
Howey, M. C. L. (2011). Multiple pathways across past landscapes: circuit theory as a
complementary geospatial method to least cost path for modeling past movement.
Journal of Archaeological Science, 38(10), 2523–2535.
http://doi.org/10.1016/j.jas.2011.03.024
IBM Corp. (2012). IBM SPSS Statistics for Windows. Armonk, NY: IBM Corp.
Iganci, J. R. V, Heiden, G., Miotto, S. T. S., & Pennington, R. T. (2011). Campos de
Cima da Serra: The Brazilian Subtropical Highland Grasslands show an unexpected
level of plant endemism. Botanical Journal of the Linnean Society, 167(4), 378–393.
http://doi.org/10.1111/j.1095-8339.2011.01182.x
Irwin, D. M., Kocher, T. D., & Wilson, a C. (1991). Evolution of the cytochrome b gene
of mammals. Journal of Molecular Evolution, 32(2), 128–44. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/1901092
Jakobsson, M., & Rosenberg, N. A. (2007). CLUMPP: a cluster matching and
permutation program for dealing with label switching and multimodality in analysis
of population structure. Bioinformatics (Oxford, England), 23(14), 1801–6.
http://doi.org/10.1093/bioinformatics/btm233
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., …
Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop
software platform for the organization and analysis of sequence data. Bioinformatics
(Oxford, England), 28(12), 1647–9. http://doi.org/10.1093/bioinformatics/bts199 27
Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V, Pääbo, S., Villablanca, F. X.,
& Wilson, A. C. (1989). Dynamics of mitochondrial DNA evolution in animals:
amplification and sequencing with conserved primers. Proceedings of the National
Academy of Sciences of the United States of America, 86(16), 6196–200.
Kopelman, N. M., Mayzel, J., Jakobsson, M., Rosenberg, N. A., & Mayrose, I. (2015).
Clumpak: a program for identifying clustering modes and packaging population
structure inferences across K. Molecular Ecology Resources.
http://doi.org/10.1111/1755-0998.12387
Lyons, L. a, Laughlin, T. F., Copeland, N. G., Jenkins, N. a, Womack, J. E., & O’Brien,
S. J. (1997). Comparative anchor tagged sequences (CATS) for integrative mapping
of mammalian genomes. Nature Genetics, 15(1), 47–56.
http://doi.org/10.1038/ng0197-47
Manthey, J. D., & Moyle, R. G. (2015). Isolation by environment in White-breasted
Nuthatches (Sitta carolinensis) of the Madrean Archipelago sky islands: a landscape
genomics approach. Molecular Ecology, 24(14), 3628–38.
http://doi.org/10.1111/mec.13258
McRae, B. H. (2006). Isolation by resistance. Evolution; International Journal of
Organic Evolution, 60(8), 1551–1561. http://doi.org/10.1554/05-321.1
McRae, B. H., & Beier, P. (2007). Circuit theory predicts gene flow in plant and animal
populations. Proceedings of the National Academy of Sciences of the United States
of America, 104(50), 19885–90. http://doi.org/10.1073/pnas.0706568104 28
Miralles, A., Rivas Fuenmayor, G., Bonillo, C., Schargel, W. E., Barros, T., García-
perez, J. E., & Barrio-amorós, C. L. (2009). Molecular systematics of Caribbean
skinks of the genus Mabuya ( Reptilia , Scincidae ), with descriptions of two new
species from Venezuela. Zoological Journal of the Linnean Society, 156, 598–616.
Nosil, P., Egan, S. P., & Funk, D. J. (2008). Heterogeneous genomic differentiation
between walking-stick ecotypes: “isolation by adaptation” and multiple roles for
divergent selection. Evolution; International Journal of Organic Evolution, 62(2),
316–36. http://doi.org/10.1111/j.1558-5646.2007.00299.x
Nosil, P., Vines, T. H., & Funk, D. J. (2005). Reproductive isolation caused by natural
selection against immigrants from divergent habitats. Evolution; International
Journal of Organic Evolution, 59(4), 705–719. http://doi.org/10.1554/04-428
Olson, D. M., Dinerstein, E., Wikramanayake, E. D., Burgess, N. D., Powell, G. V. N.,
Underwood, E. C., … Kassem, K. R. (2001). Terrestrial Ecoregions of the World: A
New Map of Life on Earth. BioScience, 51(11), 933. http://doi.org/10.1641/0006-
3568(2001)051[0933:TEOTWA]2.0.CO;2
Omland, K. E., Tarr, C. L., Boarma, W. I., Marzluff, J. M., & Fleischer, R. C. (2000).
Cryptic genetic variation and paraphyly in ravens. Proceedings. Biological Sciences
/ The Royal Society, 267(1461), 2475–82. http://doi.org/10.1098/rspb.2000.1308
Pelegrin, N., & Bucher, E. H. (2012). Effects of habitat degradation on the lizard
assemblage in the Arid Chaco, central Argentina. Journal of Arid Environments, 79,
13–19. http://doi.org/10.1016/j.jaridenv.2011.11.004 29
Pelegrin, N., Chani, J. M., Echevarria, a. L., & Bucher, E. H. (2013). Habitat degradation
may affect niche segregation patterns in lizards. Acta Oecologica, 51, 82–87.
http://doi.org/10.1016/j.actao.2013.06.006
Pellegrino, K. (2001). A molecular perspective on the evolution of microteiid lizards
(Squamata, Gymnophthalmidae), and a new classification for the family. Biological
Journal of the Linnean Society, 74(3), 315–338.
http://doi.org/10.1006/bijl.2001.0580
Phillips, S. J., Anderson, R. P., & Schapire, R. E. (2006). Maximum entropy modeling of
species geographic distributions. Ecological Modelling, 190(3-4), 231–259.
http://doi.org/10.1016/j.ecolmodel.2005.03.026
Pritchard, J. K., Stephens, M., & Donnelly, P. (2000). Inference of population structure
using multilocus genotype data. Genetics, 155(2), 945–59.
Rambaut, A., Suchard, M., Xie, D., & Drummond, A. (2014). No Title. Retrieved from
http://beast.bio.ed.ac.uk/Tracer
Recoder, R., & Nogueira, C. (2007). Composição e diversidade de répteis na região sul
do Parque Nacional Grande Sertão Veredas , Brasil Central. Biota Neotropica, 7(3),
267–278.
Recoder, R. S., De Pinho Werneck, F., Teixeira, M., Colli, G. R., Sites, J. W., &
Rodrigues, M. T. (2014). Geographic variation and systematic review of the lizard
genus Vanzosaura (Squamata, Gymnophthalmidae), with the description of a new 30
species. Zoological Journal of the Linnean Society, 171(1), 206–225.
http://doi.org/10.1111/zoj.12128
Riccomini, C., Grohmann, C. H., Sant’Anna, L. G., & Hiruma, S. T. (2010). A captura
das cabeceiras do Rio Tietê pelo Rio Paraíba do Sul. In A. Bartorelli, V. Mantesso-
Neto, C. D. R. Carneiro, & M. B. A. L. Lisboa (Eds.), Modenesi-Gauttieri, M.C.
(pp. 157–169). Becca, São Paulo: O geógrafo Aziz Nacib Ab’Sáber.
Rodrigues, M. T., Bertolotto, C. E. V., Amaro, R. C., Yonenaga-Yassuda, Y., Freire, E.
M. X., & Pellegrino, K. C. M. (2014). Molecular phylogeny, species limits, and
biogeography of the Brazilian endemic lizard genus Enyalius (Squamata:
Leiosauridae): An example of the historical relationship between Atlantic Forests
and Amazonia. Molecular Phylogenetics and Evolution, 81, 137–146.
http://doi.org/10.1016/j.ympev.2014.07.019
Rundle, H. D., & Nosil, P. (2005). Ecological speciation. Ecology Letters, 8(3), 336–352.
http://doi.org/10.1111/j.1461-0248.2004.00715.x
Sena, M. A. De. (2015). Phylogeny and evolution of Tropidurus of the torquatus group
(Squamata: Tropiduridae). Universidade de São Paulo.
Slatkin, M. (1993). Isolation by Distance in Equilibrium and Non-Equilibrium
Populations on JSTOR. Evolution, 47(1), 264–279.
Smith, B. T., McCormack, J. E., Cuervo, A. M. A. M., Hickerson, M. J., Aleixo, A.,
Cadena, C. D., … Brumfield, R. T. (2014). The drivers of tropical speciation.
Nature, 515(7527), 406–409. http://doi.org/10.1038/nature13687 31
Spear, S. F., Balkenhol, N., Fortin, M.-J., McRae, B. H., & Scribner, K. (2010). Use of
resistance surfaces for landscape genetic studies: considerations for parameterization
and analysis. Molecular Ecology, 19(17), 3576–91. http://doi.org/10.1111/j.1365-
294X.2010.04657.x
Stephens, M., & Donnelly, P. (2003). A comparison of bayesian methods for haplotype
reconstruction from population genotype data. American Journal of Human
Genetics, 73(5), 1162–9. http://doi.org/10.1086/379378
Tamura, K., & Nei, M. (1993). Estimation of the number of nucleotide substitutions in
the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol.
Evol., 10(3), 512–526.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:
Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and
Evolution. http://doi.org/10.1093/molbev/mst197
Townsend, T., Larson, A., Louis, E., & Macey, J. R. (2004). Molecular phylogenetics of
squamata: the position of snakes, amphisbaenians, and dibamids, and the root of the
squamate tree. Systematic Biology, 53(5), 735–57.
http://doi.org/10.1080/10635150490522340
Townsend, T. M., Alegre, R. E., Kelley, S. T., Wiens, J. J., & Reeder, T. W. (2008).
Rapid development of multiple nuclear loci for phylogenetic analysis using genomic
resources: an example from squamate reptiles. Molecular Phylogenetics and
Evolution, 47(1), 129–42. http://doi.org/10.1016/j.ympev.2008.01.008 32
Turchetto-Zolet, a. C., Pinheiro, F., Salgueiro, F., & Palma-Silva, C. (2013).
Phylogeographical patterns shed light on evolutionary process in South America.
Molecular Ecology, 22(5), 1193–1213. http://doi.org/10.1111/mec.12164
Valdujo, P. H., Carnaval, A. C. O. Q., & Graham, C. H. (2013). Environmental correlates
of anuran beta diversity in the Brazilian Cerrado. Ecography, 36(6), 708–717.
http://doi.org/10.1111/j.1600-0587.2012.07374.x
Valdujo, P. H., Nogueira, C. de C., Baumgarten, L., Rodrigues, F. H. G., Brandão, R. A.,
Etweovic, A., … Marques, O. A. V. (2009). Squamate Reptiles from Parque
Nacional das Emas and surroundings, Cerrado of Central Brazil. Check List, 5(3),
405–417.
Vaz-Silva, W., Guedes, A. G., de Azevedo-Silva, P. L., Gontijo, F. F., Barbosa, R. S.,
Aloísio, G. R., & de Oliveira, F. C. G. (2007). Herpetofauna, Espora Hydroelectric
Power Plant, state of Goiás, Brazil. Check List, 3(4), 338–345.
Veloz, S. D. (2009). Spatially autocorrelated sampling falsely inflates measures of
accuracy for presence-only niche models. Journal of Biogeography, 36(12), 2290–
2299. http://doi.org/10.1111/j.1365-2699.2009.02174.x
Wang, I. J. (2013). Examining the full effects of landscape heterogeneity on spatial
genetic variation: A multiple matrix regression approach for quantifying geographic
and ecological isolation. Evolution, 67(12), 3403–3411.
http://doi.org/10.1111/evo.12134 33
Wang, I. J., & Bradburd, G. S. (2014). Isolation by Environment. Ecology Letters, 23,
5649–5662. http://doi.org/10.1111/mec.12938
Wang, I. J., Glor, R. E., & Losos, J. B. (2013). Quantifying the roles of ecology and
geography in spatial genetic divergence. Ecology Letters, 16(2), 175–182.
http://doi.org/10.1111/ele.12025
Wang, I. J., & Summers, K. (2010). Genetic structure is correlated with phenotypic
divergence rather than geographic isolation in the highly polymorphic strawberry
poison-dart frog. Molecular Ecology, 19(3), 447–58. http://doi.org/10.1111/j.1365-
294X.2009.04465.x
Werneck, F. P. (2011). The diversification of eastern South American open vegetation
biomes: Historical biogeography and perspectives. Quaternary Science Reviews,
30(13-14), 1630–1648. http://doi.org/10.1016/j.quascirev.2011.03.009
Werneck, F. P., Leite, R. N., Geurgas, S. R., & Rodrigues, M. T. (2015). Biogeographic
history and cryptic diversity of saxicolous Tropiduridae lizards endemic to the
semiarid Caatinga. BMC Evolutionary Biology, 15(1), 94.
http://doi.org/10.1186/s12862-015-0368-3
Whiting, A. S., Bauer, A. M., & Sites Jr, J. W. (2003). Phylogenetic relationships and
limb loss in sub-Saharan African scincine lizards (Squamata: Scincidae). Molecular
Phylogenetics and Evolution, 29(3), 582–598. http://doi.org/10.1016/S1055-
7903(03)00142-8 34
Whiting, A. S., Sites, J. W., Pellegrino, K. C. M., & Rodrigues, M. T. (2006). Comparing
alignment methods for inferring the history of the new world lizard genus Mabuya
(Squamata: Scincidae). Molecular Phylogenetics and Evolution, 38(3), 719–30.
http://doi.org/10.1016/j.ympev.2005.11.011
Williams, J., & Kacoliris, F. (2011). Distribution extension in Buenos Aires province,
Argentina. Check List, 7(3), 388.
Wright, S. (1943). Isolation by Distance. Genetics, 28(2), 114–38. Retrieved from
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1209196&tool=pmcentr
ez&rendertype=abstract
Wynn, A., & Heyer, W. (2001). Do geographically widespread species of tropical I
amphibians exist? An estimate of genetic relatedness I within the neotropical frog
Leptodactylus fuscus (Schneider 1799) (Anura Leptodactylidae). Tropical Zoology,
14, 255–285.
35
Figures
Figure 1. Map of major ecosystems, classified by combined eco-regions defined by
World Wildlife Fund (Olson et al., 2001).
36
Figure 2: Left. Map of M. dorsivittata sampling localities. Right. Bayesian inference tree of M. dorsivittata based on the mtDNA dataset. Loci are listed in Table S2. Asterisks indicate posterior probability >0.99.
37
Figure 3. Left. Map of M. dorsivittata localities. Colors correspond to STRUCTURE clusters. Right. STRUCUTRE plots. Levels of admixture are indicated at each locality.
38
Figure 4. Haplotype networks for each gene used in this study, colored by ecoregion.
39
Figure 5. Ecological niche model (ENM) developed for Mabuya dorsivittata. Warmer
colors indicate higher suitability.
40
Figure 6. Environmental PCAs. Symbols and colors represent (A) all M. dorsivittata known locality points with background ecosystem points identified, (B) a subset of M. dorsivittata sampled localities identified by mtDNA lineages, and (C) the same sampled subset identified by nuDNA Structure clusters. Variation: PC1=42.7%; PC2=27.5; total=70.2%.
41
Tables
Table 1. (A) Pairwise mtDNA FSTs calculated between ecosystems using pairwise differences, and (B) AMOVA results based on mtDNA distances. Populations are grouped by major ecosystem. Significant values are bolded.
(A) (B) Atlantic Cerrado Forest Source of variation % of variation Atlantic 0.16 --- among ecosystems 24.6 Forest among sites within Pampas 0.21 0.29 61.43 ecosystems within sites 13.97
Table 2. Multiple Matrix Regression with Randomization (MMRR) results for Mabuya dorsivittata. Included are the fit of the model (R2) and regression coefficients (β) for each matrix used to explain Isolation by Environment (IBE), Isolation by Resistance (IBR), and Isolation by Distance (IBD). Significant values are bolded.
2 IBE R βPC1 βPC2 βPC3 βPC4 mtDNA 0.212 0.041 0.053 0.314 0.3 nuDNA 0.213 0.137 -0.069 0.446 0.007 2 2 IBR R βLCP βCIR IBD R βEuclid mtDNA 0.283 0.163 0.396 0.226 0.476 nuDNA 0.112 0.239 0.114 0.135 0.367
42
Supplementary Material
Methods
Locality sources:
HerpNet: California Academy of Sciences: CAS Herpetology (HERP), California
Academy of Sciences. Museum of Comparative Zoology, Harvard University (MCZ),
Harvard University. TCWC Herpetology (TCWC), Texas Cooperative Wildlife
Collection. The National Collection of Amphibians and Reptiles (USNM), National
Museum of Natural History. http://portal.vertnet.org/search?q=mabuya+dorsivittata
(accessed 2015-06-14), CM Herps Collection (CM), Carnegie Museums. The National
Collection of Amphibians and Reptiles (USNM), National Museum of Natural History
http://portal.vertnet.org/search?q=aspronema+dorsivittatum (accessed 2015-06-14)
speciesLink: Coleção de Répteis (MCP-Repteis), Sistema de Informação do Programa
Biota/Fapesp (SinBiota), Coleção de Répteis do Centro de Coleções Taxonômicas da
UFMG (UFMG-REP), Coleção Zoológica da UFMT- Setor Herpetologia-Répteis
(UFMT-R), Coleção de Répteis do Museu de Zoologia da UNICAMP (ZUEC-REP), available at speciesLink network (http://www.splink.org.br) in 2015, April 14.
GBIF: Museum of Vertebrate Zoology: MVZ Herp Collection (Arctos), 2015-03-20.
Accessed via http://www.gbif.org/occurrence/1050956142 on 2015-07-01
43
Figures
Figure S1. Bayesian inference nuclear trees of M. dorsivittata: (a) concatenated nuDNA
(all seven loci); (b) BACH1; (c) CMOS; (d) DNAH3; (e) MYH; (f) RAG1; (g)
RPL35; (h) SINCAIP. 44
45
46
47
Tables
Table S1: Sample field numbers and localities. Abbreviations: (countries) BR – Brazil;
ARG – Argentina; (states) BA – Bahia; CR – Corrientes; ES – Espirito Santo; MG –
Minas Gerais; MS – Matto Grosso do Sul; MT – Matto Grosso; RJ – Rio de Janeiro; RS
– Rio Grande do Sul; SC – Santa Catarina; SP - São Paulo.
Field Number Locality State 3410 Cunha SP, BR 3411 Santana do Parnaíba SP, BR 3529 Cunha SP, BR 3578 Cunha SP, BR 3579 Cunha SP, BR AAGARDA7024 Chapada Diamantina, Palmeiras BA, BR CTMZ03172 Par. Nacional da Serra da Canastra MG, BR CTMZ03197 Estação Ecológica de Bananal SP, BR CTMZ03203 Par. Nacional da Serra da Canastra MG, BR CTMZ03207 Estação Ecológica de Bananal SP, BR CTMZ03266 Estação Ecológica de Bananal SP, BR CTMZ03288 Área Alfa DF, BR CTMZ03300 Estação Ecológica do Bananal SP, BR CTMZ03341 Estação Ecológica do Bananal SP, BR CTMZ03351 Estação Ecológica de Bananal SP, BR CTMZ03361 Estação Ecológica de Bananal SP, BR CTMZ03579 P. E. Jacupiranga, Núcleo Caverna do Diabo SP, BR CTMZ03630 P. E. Carlos Botelho SP, BR GJC27 Botucatu, Fazenda Edgardia SP, BR H0368 Buri SP, BR LG0173 São Paulo SP, BR LG0941 São Paulo SP, BR LG1089 São Paulo, Cidade Universitária SP, BR LG1273 Ribeirão Grande SP, BR LG1274 Ribeirão Grande SP, BR LG1784 Cotia SP, BR LG2173 Par. Nacional do Caparaó MG, BR LGE01527 Estancia Santo Domingo, Ituzaingó CR, ARG MCP11037 Dom Feliciano RS, BR MCP14737 São Jerônimo RS, BR MTR10550 UHE Ponte de Pedra MS/MT, BR MTR10553 UHE Ponte de Pedra MS/MT, BR MTR10713 Par. Nacional do Caparaó MG, BR MTR10714 Par. Nacional do Caparaó, acima da Tronqueira MG, BR MTR10821 Par. Nacional do Caparaó, Linha 5 MG, BR MTR10906 Par. Nacional do Caparaó MG, BR MTR10910 Par. Nacional do Caparaó MG, BR MTR10920 Par. Nacional do Caparaó MG, BR MTR11605 Par. Nacional do Caparaó, Pico da Bandeira MG, BR MTR11606 Par. Nacional do Caparaó, Pico da Bandeira MG, BR MTR15551 Flor. Nacional de Ipanema SP, BR MTR15552 Iperó, Flor. Nacional de Ipanema SP, BR MTR17039 E.B. Boracéia SP, BR MTR19446 Serra do Cipó MG, BR MTR19617 Serra do Cipó MG, BR MTR20104 Pico do Barbado BA, BR MTR20363 Serra do Cipó MG, BR MTR20364 Serra do Cipó MG, BR MTR21342 E.B. Boracéia SP, BR MTR21942 Serra do Cipó MG, BR MTR26063 Par. Nacional de Itatiaia RJ, BR MTR26094 Par. Nacional de Itatiaia RJ, BR MTR26124 Par. Nacional do Caparaó, acima terreirão MG, BR 48
MTR26126 Par. Nacional do Caparaó MG, BR MTR26127 Par. Nacional do Caparaó MG, BR MTR26161 Par. Nacional do Caparaó MG/ES, BR MTR26218 Par. Nacional do Caparaó, Pedra Menina ES, BR MTR26219 P.N. Caparaó, Pedra Menina ES, BR MTR26252 Par. Nacional do Caparaó ES, BR MTR26254 Par. Nacional do Caparaó ES, BR MTR26261 Par. Nacional do Caparaó ES, BR MTR26262 Par. Nacional do Caparaó ES, BR MTR26874 ParNa São Joaquim SC, BR MTR26875 ParNa São Joaquim SC, BR MTR26890 ParNa São Joaquim SC, BR MTR6147 Presidente Epitácio/Rio do Peixe MS, BR MTR9824 UHE Ponte de Pedra MS/MT, BR MTR9827 UHE Ponte de Pedra MS/MT, BR MTR9830 UHE Ponte de Pedra MS/MT, BR RPD137 P.E. Sete Passagens, Miguel Calmon BA, BR RPD182 P.E. Sete Passagens, Miguel Calmon BA, BR RPD183 P.E. Sete Passagens, Miguel Calmon BA, BR RPD192 P.E. Sete Passagens, Miguel Calmon BA, BR RPD232 P.E. Sete Passagens, Miguel Calmon BA, BR RPD233 P.E. Sete Passagens, Miguel Calmon BA, BR UFRGST0122 Alegrete RS, BR UFRGST0344 Bom Jesus RS, BR UFRGST0823 Bom Jesus RS, BR UFRGST0824 Bom Jesus RS, BR UFRGST1292 São Francisco de Assis RS, BR UFRGST1293 São Francisco de Assis RS, BR UFRGST1849 Eldorado do Sul RS, BR UFRGST1946 Caibaté RS, BR UFRGST2324 Pedras Altas RS, BR UFRGST2766 São Jerônimo RS, BR UFRGST2790 São Jerônimo RS, BR UFRGST2957 São Jerônimo RS, BR UFRGST3177 Balneário Gaivota SC, BR UFUB497 Poços de Caldas MG, BR
Table S2: Primers, Sequences, and PCR Protocols
Gene/primers Sequence Profile Reference 12S (Kocher et al., 12Saa CTG GGA TTA GAT ACC CCA CTA [94°C (3:00); 94°C (0:45); 50°C (0:45); 1989) 12Sba TGA GGA GGG TGA CGG GCG GT 72°C (1:30) for 35 cycles; 72°C (7:00)] 16S (Whiting, Bauer, 16Sar CGCCTGTTTAYCAAAAACAT [94°C (3:00); 94°C (0:45); 55°C (0:45); & Sites Jr, 2003) 16Sbr CCGGTCTGAACTCAGATCACGT 72°C (1:30) for 35 cycles; 72°C (7:00)] BACH1 (Townsend et al., Bach1 f1 GATTTGAHCCYTTRCTTCAGTTTGC [94°C (3:00); 94°C (0:45); 54°C (0:45); 2008) Bach1 r2 ACCTCACATTCYTGTTCYCTRGC 72°C (1:30) for 35 cycles; 72°C (7:00)] CMOS (Whiting et al., Mos-F CTCTGGKGGCTTTGGKKCTGTSTACAAG [95°C (12:00); 94°C (1:00); 56°C (1:00); 2003) Mos-R GGTGATGGCAAANGAGTAGATGTCTGC 72°C (1:00) for 35 cycles; 72°C (5:00)] Cyt b (Irwin, et al., L15146 CATGAGGACAAATATCATTCTGAG [94°C (3:00); 94°C (0:45); 53°C (0:45); 1991) H15915sh TTCATCTCTCCGGTTTACAAGAC 72°C (1:30) for 35 cycles; 72°C (7:00)] DNAH3 (Townsend et al., Dnah3 f1 GGTAAAATGATAGAAGAYTACTG [94°C (3:00); 94°C (0:45); 54°C (0:45); 2008) Dnah3 r6 CTKGAGTTRGAHACAATKATGCCAT 72°C (1:30) for 35 cycles; 72°C (7:00)] RAG1 (Gartner, et al., RAG1-AnF1 GAAATTCAAGCTCTTCAAAGTGAGAT [94°C (3:00); 94°C (0:45); 58°C (0:45); 2013) RAG1-AnR1 TGTCAAKGAAAGTAAGTGTTGTCTTG 72°C (1:30) for 35 cycles; 72°C (7:00)] RPL35 (Fujita, et al., rpl35 ex2 CAGAGTGCTGACATCATTAACCAGAC [95°C (10:00); 94°C (0:30); 54°C (0:35); 2010) rlp35 ex3 GTCTTCAGACCCTCTTCGTGCTTG 72°C (1:00) for 35 cycles; 72°C (10:00)] MYH (Dolman et al., Myh2 F GAACACCAGCCTCATCAACC [94°C (3:00); 94°C (0:45); 62°C (0:45); 2004; Lyons et Myh2_R TGGTGTCCTGCTCCTTCTTC 72°C (1:30) for 35 cycles; 72°C (7:00)] al., 1997) SINCAIP (T. M. Townsend Sincaip-F10 CGCCAGYTGYTGGGRAARGAWAT [94°C (3:00); 94°C (0:45); 55°C (0:45); 49
Sincaip-R13 GGWGAYTTGAGDGCACTCTTRGGRCT 72°C (1:30) for 35 cycles; 72°C (7:00)] et al., 2008)
Table S3. Pairwise FSTs between sites within the (a) fragmented northern Atlantic Forest,
(b) Cerrado, and (c) Pampas. Significant values are bolded.
Sites: 1: Área Alfa, DF 17: Presidente Epitácio/Rio do Peixe, MS 2: ParNa São Joaquim, SC 18: Balneário Gaivota, SC 3: P.E. Sete Passagens, Miguel Calmon, BA 19: P. E. Carlos Botelho, SP 4: Par. Nacional da Serra da Canastra, MG 20: São Paulo, SP 5: Pico do Barbado, BA 21: Santana do Parnaíba, SP 6: Par. Nacional de Itatiaia, RJ 22: Cotia, SP 7: Par. Nacional do Caparaó, MG 23: Flor. Nacional de Ipanema, SP 8: Serra do Cipó, MG 24: P. E. Jacupiranga, Núcleo Caverna do Diabo, SP 9: Chapada Diamantina, Palmeiras, BA 25: UHE Ponte de Pedra, MS/MT 10: E.B. Boracéia, SP 26: Caibaté, RSc 11: Estação Ecológica de Bananal, SP 27: São Francisco de Assis, RS 12: Bom Jesus, BA 28: Alegrete, RS 13: Cunha, SP 29: Eldorado do Sul, RS 14: Botucatu, Fazenda Edgardia, SP 30: São Jerônimo, RS 15: Buri, SP 31: Dom Feliciano, RS 16: Ribeirão Grande, SP 32: Pedras Altas, RS
Pairwise FST (sites) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
1 -
2 0.99 -
3 0.98 1.00 -
4 0.98 1.00 1.00 -
5 0.94 0.77 0 0 -
6 0.98 1.00 1.00 1.00 0 -
7 0.99 1.00 1.00 1.00 0.90 1.00 -
8 0.98 0.95 0.97 0.97 0.93 0.97 0.97 -
9 0.98 0.81 0.95 0.95 0.86 0.95 0.98 0.95 -
10 0.99 1.00 1.00 1.00 0.77 1.00 1.00 0.80 0.93 -
11 0.98 1.00 1.00 1.00 0.73 1.00 1.00 0.96 0.94 1.00 -
12 0.99 0.95 0.98 0.98 0.86 0.98 0.99 0.96 0.85 0.98 0.98 -
13 0.77 0.58 0.60 0.63 0.64 0.61 0.44 0.71 0.60 0.58 0.34 0.59 -
14 0.97 0.81 0.95 0.95 0.91 0.95 0.96 0.95 0.09 0.93 0.94 0.81 0.64 -
15 0.99 1.00 1.00 1.00 0.77 1.00 1.00 0.80 0.93 1.00 1.00 0.98 0.59 0.93 -
16 0.99 1.00 1.00 1.00 0.89 1.00 1.00 0.96 0.95 1.00 1.00 0.99 0.61 0.93 1.00 - 17 0.96 0.87 0.94 0.94 0.91 0.94 0.93 0.92 0.88 0.89 0.91 0.89 0.68 0.89 0.89 0.63 18 0.99 0.99 0.95 0.86 0.49 0.94 0.99 0.98 0.98 0.99 0.99 0.99 0.70 0.97 0.99 0.99 19 0.97 1.00 1.00 1.00 0.80 1.00 1.00 0.97 0.96 1.00 1.00 0.99 0.71 0.96 1.00 1.00 20 0.98 1.00 1.00 1.00 0 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.61 0.95 1.00 1.00 21 0.98 0.98 0 0.90 0.30 0.83 0.99 0.97 0.97 0.98 0.97 0.98 0.67 0.96 0.98 0.99 22 0.98 1.00 0 1.00 0 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.60 0.95 1.00 1.00 23 0.98 1.00 0 1.00 0 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.60 0.95 1.00 1.00 24 0.98 0.98 0 0.93 0.12 0.87 0.99 0.97 0.97 0.98 0.98 0.98 0.65 0.96 0.98 0.99 25 0.95 0.80 0.88 0.89 0.86 0.88 0.91 0.90 0.84 0.82 0.85 0.85 0.64 0.87 0.82 0.07 26 0.98 1.00 1.00 1.00 0 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.64 0.95 1.00 1.00 27 0.99 1.00 1.00 1.00 0.30 1.00 1.00 0.97 0.98 1.00 1.00 0.99 0.68 0.96 1.00 1.00 28 0.98 1.00 1.00 1.00 0 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.64 0.95 1.00 1.00 50
29 0.99 1.00 1.00 1.00 0.07 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.66 0.95 1.00 1.00 30 0.99 1.00 1.00 1.00 0.60 1.00 1.00 0.98 0.99 1.00 1.00 1.00 0.71 0.97 1.00 1.00 31 0.98 1.00 1.00 1.00 0 1.00 1.00 0.97 0.95 1.00 1.00 0.98 0.64 0.95 1.00 1.00 32 0.97 1.00 1.00 1.00 0.80 1.00 1.00 0.97 0.96 1.00 1.00 0.99 0.71 0.96 1.00 1.00 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 17 - 18 0.95 - 19 0.95 0.99 - 20 0.94 0.96 1.00 - 21 0.95 0.93 0.98 0.50 - 22 0.94 0.95 1.00 1.00 0 - 23 0.94 0.95 1.00 1.00 0 0.00 - 24 0.94 0.95 0.99 0.60 0 0 0 - 25 0.41 0.93 0.90 0.88 0.92 0.88 0.88 0.91 - 26 0.94 0.60 1.00 1.00 0.91 1.00 1.00 0.93 0.89 - 27 0.95 0.37 1.00 1.00 0.94 1.00 1.00 0.96 0.92 1.00 - 28 0.94 0.00 1.00 1.00 0.89 1.00 1.00 0.92 0.89 1.00 0 - 29 0.94 0.88 1.00 1.00 0.93 1.00 1.00 0.95 0.90 1.00 1.00 1.00 - 30 0.96 0.58 1.00 1.00 0.96 1.00 1.00 0.98 0.95 1.00 0 0 1.00 - 31 0.94 0.00 1.00 1.00 0.90 1.00 1.00 0.93 0.89 1.00 0 0 1.00 0 - 32 0.95 0.99 1.00 1.00 0.98 1.00 1.00 0.99 0.90 1.00 1.00 1.00 1.00 1.00 1.00 -
Average FST: N-AF = 0.814 S-AF = 0.54 Cerrado = 0.821 Pampas = 0.714
Table S4. Principal component loadings, based on environmental PCA (Fig. 6).
Component Loadings PC1 PC2 PC3 PC4 Precipitation of Driest Mean Temperature of Precipitation of Temperature seasonality Quarter Warmest Quarter Warmest Quarter Temperature annual Precipitation of Driest Max Temperature of Vegetation Continuous range Month Warmest Month Fields Precipitation of Coldest Mean Temperature of Isothermality Quarter Wettest Quarter Minimum Temperature Annual Mean Precipitation Seasonality of the Coldest Month Temperature Precipitation of Wettest Mean Temperature of Mean Diurnal Range Quarter Coldest Quarter Mean Temperature of
Coldest Quarter Precipitation of Wettest
Month Mean Temperature of
Driest Quarter Annual Mean
Temperature