DOCSLIB.ORG

Cyclin-Dependent Kinase 1 (Cdk1) Is Essential for Cell Division and Suppression of DNA Re-Replication but Not for Liver Regeneration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cyclin-Dependent Kinase 1 (Cdk1) Is Essential for Cell Division and Suppression of DNA Re-Replication but Not for Liver Regeneration Cyclin-dependent kinase 1 (Cdk1) is essential for cell division and suppression of DNA re-replication but not for liver regeneration M. Kasim Dirila, Chandrahas Koumar Ratnacarama, V. C. Padmakumarb, Tiehua Duc, Martin Wasserc,d, Vincenzo Coppolab,1, Lino Tessarollob, and Philipp Kaldisa,e,2 aInstitute of Molecular and Cell Biology, Agency for Science, Technology, and Research (A*STAR), Republic of Singapore 138673; Departments of eBiochemistry and dBiological Sciences, National University of Singapore, Republic of Singapore 117597; bMouse Cancer Genetics Program, National Cancer Institute, Frederick, MD 21702-1201; and cBioinformatics Institute, Agency for Science, Technology, and Research (A*STAR), Republic of Singapore 138671 Edited by Charles J. Sherr, Howard Hughes Medical Institute and St. Jude Children’s Research Hospital, Memphis, TN, and approved January 13, 2012 (received for review September 16, 2011) Cyclin-dependent kinase 1 (Cdk1) is an archetypical kinase and viable homozygous knockout mice or embryos at P21 or E10.5, a central regulator that drives cells through G2 phase and mitosis. indicating that Cdk1 is an essential gene for early embryonic Knockouts of Cdk2, Cdk3, Cdk4, or Cdk6 have resulted in viable development. However, genotyping of blastocysts at E3.5 mice, but the in vivo functions of Cdk1 have not been fully ex- revealed that 16% were homozygous knockout, 56% heterozy- gous, and 28% wild type for the Cdk1 locus (Fig. 1B). Detailed plored in mammals. Here we have generated a conditional-knock- NULL out mouse model to study the functions of Cdk1 in vivo. Ablation analysis of Cdk1 blastocysts by microscopy revealed that they had a reduced number of nuclei, which were larger in size of Cdk1 leads to arrest of embryonic development around the fi compared with wild-type and heterozygous littermates (Fig. 1 C blastocyst stage. Interestingly, liver-speci c deletion of Cdk1 is and D). The first few cells divisions in Cdk1-deficient embryos well tolerated, and liver regeneration after partial hepatectomy are possibly achieved because of the presence of maternally is not impaired, indicating that regeneration can be driven by cell deposited Cdk1 mRNA in the oocytes (18). After the maternally growth without cell division. The loss of Cdk1 does not affect S provided mRNA runs out, cells of the Cdk1NULL embryos were phase progression but results in DNA re-replication because of an not able to divide anymore, which suggests Cdk1 is essential for increase in Cdk2/cyclin A2 activity. Unlike other Cdks, loss of Cdk1 cell division in early-stage embryos. in the liver confers complete resistance against tumorigenesis in- To confirm that Cdk1 is essential for cell proliferation, we duced by activated Ras and silencing of p53. turned to primary mouse embryonic fibroblasts (MEFs), in which we could induce the loss of Cdk1 by addition of 4-hydrox- – cancer | knockout mice | cell cycle regulation | polyploidy ytamoxifen (4-OHT) (Fig. S1 C H). When these MEFs were analyzed for proliferation by using techniques such as ala- marBlue or 3T3 assays, Cdk1NULL MEFs did not increase in he activities of cyclin-dependent kinases (Cdks) control all numbers but entered senescence prematurely, demonstrating Taspects of cell division, including entry into the cell cycle from that Cdk1 is essential for cell proliferation (Fig. 1 E and F). quiescence, the G1/S phase transition, DNA replication in S phase, nuclear breakdown, chromosome condensation and seg- Liver Regeneration in the Absence of Cell Division. Because of the regation, and cytokinesis (1). The mammalian genome contains embryonic lethality, we generated mice that were specifically at least 20 different Cdks, and widespread compensation among targeted to ablate the expression of Cdk1 in the liver (hep- Cdks and cyclins has been reported (2, 3). Cdk1 was the first Cdk atocytes; Cdk1FLOX/FLOX mice expressing the albumin-Cre − − identified (4, 5), is conserved in all organisms, plays important transgene, referred to as Cdk1Liv / ). We chose the liver as an roles in mitosis, and can drive S phase in the absence of Cdk2 in vivo model system because hepatocytes rarely divide in adult (6). Mouse knockouts of Cdk2 (7, 8), Cdk3 (9), Cdk4 (10, 11), or animals unless regeneration is induced by partial hepatectomy Cdk6 (12, 13) are viable, indicating that any single Cdk in- (PH; ref. 19 and below). Albumin-Cre expression starts during dependently is not essential for survival of mice. Interestingly, embryonic development but only reaches sufficiently high levels double knockouts of Cdk2/Cdk4 (14) and Cdk4/Cdk6 (13) but to cause efficient recombination approximately 3 wk after birth not Cdk2/Cdk6 (13) are embryonic lethal, suggesting genetic (20), a time when liver development and hematopoiesis are al- − − interactions. Therefore, Cdk2 and Cdk4 (as well as Cdk4 and ready completed. Cdk1Liv / mice were viable and did not dis- Cdk6) display overlapping functions and can substitute for each play any adverse phenotypes. We prepared Feulgen-stained − − other (3, 15). In the absence of Cdk2 and Cdk4, we have dem- sections of Cdk1Liv / and control livers (Fig. 2A). The diameter − − onstrated an accumulation of hypophosphorylated Retinoblas- of the Cdk1Liv / nuclei was increased by 28%, and the cell density was decreased by 35%. To force hepatocytes to reenter toma protein (Rb), which represses E2F-mediated transcription − − the cell cycle, we subjected Cdk1Liv / mice to 70% PH. In- leading to decreased expression of E2F-target genes like Cdk1 − − and others (14). terestingly, PH in both wild-type and Cdk1Liv / mice led to Constitutive gene disruption mutations in the Cdk1 locus have complete regeneration of liver mass within 3 wk (Fig. 2 B and C). been reported, but neither of these approaches yielded homo- However, Cdk1-deficient hepatocytes were unable to enter zygous Cdk1NULL cells or tissues for further analysis (16, 17). To study the in vivo functions of Cdk1, tissue specificity, and re- quirement in adult mice, we have generated conditional knock- Author contributions: P.K. designed research; M.K.D., C.K.R., and V.C.P. performed re- out mice by inserting LoxP sites on both sides of exon 3 in the search; V.C. and L.T. contributed new reagents/analytic tools; T.D. and M.W. analyzed Cdk1 locus (Fig. 1A and Fig. S1 A and B). data; and P.K. wrote the paper. The authors declare no conflict of interest. Results This article is a PNAS Direct Submission. Cdk1 Is Essential for Cellular Proliferation and Early Embryonic 1Present address: Department of Molecular Virology, Immunology, and Medical Genetics, Development. To investigate the effects of loss of Cdk1 in Ohio State University, Columbus, OH 43210. +/NULL mouse development, we crossed Cdk1 animals with each 2To whom correspondence should be addressed. E-mail: [email protected]. other and monitored the progeny at postnatal day 21 (P21), This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. embryonic day 10.5 (E10.5), and E3.5. We could not detect 1073/pnas.1115201109/-/DCSupplemental. 3826–3831 | PNAS | March 6, 2012 | vol. 109 | no. 10 www.pnas.org/cgi/doi/10.1073/pnas.1115201109 Downloaded by guest on September 27, 2021 mitosis (Fig. S2), indicating that liver regeneration can be ach- ieved by cell growth in the absence of cell division. PH induced − − expression of Cdk1 in control but not in Cdk1Liv / animals (Fig. 2D; note that the Cdk1 band in lanes 7–12 originates from liver cells other than hepatocytes). In control mice, the cell density and nuclear diameter did not change significantly by 96 h after PH (Fig. 2 E and F). In contrast, we measured a 27% decrease in cell density (Fig. 2 E and G) and a 67% increase in nuclear di- ameter (Fig. 2 F and G), which is consistent with ablated cell − − division and a substantial increase in cell growth in Cdk1Liv / mice. As a measure of DNA replication after PH, we deter- mined BrdU incorporation and detected a peak at 48 h after PH (Fig. 2 H and I), which is consistent with published results (21). − − Cdk1Liv / livers displayed BrdU incorporation rates similar to − − those of wild type, and therefore we hypothesized that Cdk1Liv / cells must be able to undergo some form of DNA replication. Cdk1 Is Dispensable for DNA Replication but Regulates Cdk2 Activity to Suppress DNA Re-replication. DNA replication in S phase is promoted by Cdk2 in complex with cyclins E and A2 (22). However, there are no detectable replicative deficiencies in Cdk2- knockout mice because Cdk1 can fully compensate for the ab- sence of Cdk2 (6–8). To further investigate whether Cdk1 activity is required for initiation and progression of DNA replication in presence of Cdk2, we turned to our conditional knockout primary MEFs, in which we can study cell-cycle progression kinetics in a controlled fashion (Fig. S1 C and D). MEFs were synchronized in the G0/G1 phase by serum star- vation, and Cdk1 knockout was simultaneously induced by addi- tion of 4-OHT. After synchronization, MEFs were released into S phase in the presence of serum and labeled by BrdU as a measure for DNA replication. During the first cell cycle, Cdk1NULL cells progressed through S phase like wild-type MEFs did (Fig. 3 A and B and Fig. S3). Therefore, the loss of Cdk1 does not affect S phase progression in the presence of wild-type Cdk2. However, Cdk1NULL MEFs cannot initiate early events of mitotic entry such as cytoskeletal reorganization and rounding up of the cell body (Fig. S1H) and therefore arrest in G2 without entering mitosis. A detailed analysis of the FACS data indicated an additional 8N peak, suggesting DNA re-replication in the absence of cell division (Fig. 3C). We found that ∼30% of the Cdk1-deficient cells had undergone DNA re-replication, compared with 6% in wild-type MEFs (Fig.
Load more

Recommended publications
  • DNA Damage Checkpoint Dynamics Drive Cell Cycle Phase Transitions
    bioRxiv preprint doi: https://doi.org/10.1101/137307; this version posted August 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. DNA damage checkpoint dynamics drive cell cycle phase transitions Hui Xiao Chao1,2, Cere E. Poovey1, Ashley A. Privette1, Gavin D. Grant3,4, Hui Yan Chao1, Jeanette G. Cook3,4, and Jeremy E. Purvis1,2,4,† 1Department of Genetics 2Curriculum for Bioinformatics and Computational Biology 3Department of Biochemistry and Biophysics 4Lineberger Comprehensive Cancer Center University of North Carolina, Chapel Hill 120 Mason Farm Road Chapel Hill, NC 27599-7264 †Corresponding Author: Jeremy Purvis Genetic Medicine Building 5061, CB#7264 120 Mason Farm Road Chapel Hill, NC 27599-7264 [email protected] ABSTRACT DNA damage checkpoints are cellular mechanisms that protect the integrity of the genome during cell cycle progression. In response to genotoxic stress, these checkpoints halt cell cycle progression until the damage is repaired, allowing cells enough time to recover from damage before resuming normal proliferation. Here, we investigate the temporal dynamics of DNA damage checkpoints in individual proliferating cells by observing cell cycle phase transitions following acute DNA damage. We find that in gap phases (G1 and G2), DNA damage triggers an abrupt halt to cell cycle progression in which the duration of arrest correlates with the severity of damage. However, cells that have already progressed beyond a proposed “commitment point” within a given cell cycle phase readily transition to the next phase, revealing a relaxation of checkpoint stringency during later stages of certain cell cycle phases.
    [Show full text]
  • Cell Cycle Arrest and DNA Endoreduplication Following P21waf1/Cip1 Expression
    Oncogene (1998) 17, 1691 ± 1703 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc Cell cycle arrest and DNA endoreduplication following p21Waf1/Cip1 expression Stewart Bates, Kevin M Ryan, Andrew C Phillips and Karen H Vousden ABL Basic Research Program, NCI-FCRDC, Building 560, Room 22-96, West 7th Street, Frederick, Maryland 21702-1201, USA p21Waf1/Cip1 is a major transcriptional target of p53 and there are an increasing number of regulatory mechan- has been shown to be one of the principal mediators of isms that serve to inhibit cdk activity. Primary amongst the p53 induced G1 cell cycle arrest. We show that in these is the expression of cdk inhibitors (CDKIs) that addition to the G1 block, p21Waf1/Cip1 can also contribute can bind to and inhibit cyclin/cdk complexes (Sherr to a delay in G2 and expression of p21Waf1/Cip1 gives rise and Roberts, 1996). These fall into two classes, the to cell cycle pro®les essentially indistinguishable from INK family which bind to cdk4 and cdk6 and inhibit those obtained following p53 expression. Arrest of cells complex formation with D-cyclins, and the p21Waf1/Cip1 in G2 likely re¯ects an inability to induce cyclin B1/cdc2 family that bind to cyclin/cdk complexes and inhibit kinase activity in the presence of p21Waf1/Cip1, although the kinase activity. inecient association of p21Waf1/Cip1 and cyclin B1 The p21Waf1/Cip1 family of CDKIs include p21Waf1/Cip1, suggests that the mechanism of inhibition is indirect. p27 and p57 and are broad range inhibitors of cyclin/ Cells released from an S-phase block were not retarded cdk complexes (Gu et al., 1993; Harper et al., 1993; in their ability to progress through S-phase by the Xiong et al., 1993; Firpo et al., 1994; Polyak et al., presence of p21Waf1/Cip1, despite ecient inhibition of 1994; Toyoshima and Hunter, 1994; Lee et al., 1995; cyclin E, A and B1 dependent kinase activity, suggesting Matsuoka et al., 1995).
    [Show full text]
  • Investigating the Role of Cdk11in Animal Cytokinesis
    Investigating the Role of CDK11 in Animal Cytokinesis by Thomas Clifford Panagiotou A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto © Copyright by Thomas Clifford Panagiotou (2020) Investigating the Role of CDK11 in Animal Cytokinesis Thomas Clifford Panagiotou Master of Science Department of Molecular Genetics University of Toronto 2020 Abstract Finely tuned spatio-temporal regulation of cell division is required for genome stability. Cytokinesis constitutes the final stages of cell division, from chromosome segregation to the physical separation of cells, abscission. Abscission is tightly regulated to ensure it occurs after earlier cytokinetic events, like the maturation of the stem body, the regulatory platform for abscission. Active Aurora B kinase enforces the abscission checkpoint, which blocks abscission until chromosomes have been cleared from the cytokinetic machinery. Currently, it is unclear how this checkpoint is overcome. Here, I demonstrate that the cyclin-dependent kinase CDK11 is required for cytokinesis. Both inhibition and depletion of CDK11 block abscission. Furthermore, the mitosis-specific CDK11p58 kinase localizes to the stem body, where its kinase activity rescues the defects of CDK11 depletion and inhibition. These results suggest a model whereby CDK11p58 antagonizes Aurora B kinase to overcome the abscission checkpoint to allow for successful completion of cytokinesis. ii Acknowledgments I am very grateful for the support of my family and friends throughout my studies. I would also like to express my deep gratitude to Wilde Lab members, both past and present, for their advice and collaboration. In particular, I am very grateful to Matthew Renshaw, whose work comprises part of this thesis.
    [Show full text]
  • CDK1/Cyclin A2, Active (C0244)
    CDK1/Cyclin A2, active, GST-tagged, human PRECISIOÒ Kinase recombinant, expressed in Sf9 cells Catalog Number C0244 Storage Temperature –70 °C Synonyms: Figure 1. CDK1: CDC2, CDC28A, DKFZp686L20222, SDS-PAGE Gel of Typical Lot: MGC111195 ³70% (SDS-PAGE, densitometry) Cyclin A2: CCN1, CCNA 170 130 Product Description 95 Cyclin A2 CDK1 or Cell Division Control protein 1 is essential for 72 the completion of START, the controlling event in the 56 CDK1 cell cycle that is required to initiate mitosis. CDK1 is a 43 catalytic subunit of a protein kinase complex, called the M-Phase Promoting Factor that induces entry into 34 mitosis and is universal among eukaryotes.1 Phosphorylation of Bcl-2 in G2/M phase-arrested cells following photodynamic therapy with hypericin involves Figure 2. a CDK1-mediated signal and delays the onset of Specific Activity of Typical Lot: apoptosis. Therapeutic potential of the CDK inhibitor, 151–205 nmole/min/mg NU2058, in androgen-independent prostate cancer has also been demonstrated.2 520,000 This recombinant product was expressed by 390,000 baculovirus in Sf9 insect cells using an N-terminal cpm) GST-tag. The gene accession numbers are NM 001786 260,000 and NM 001237. It is supplied in 50 mM Tris-HCl, 130,000 pH 7.5, with 150 mM NaCl, 0.25 mM DTT, 0.1 mM Activity ( EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% 0 glycerol. 0 40 80 120 160 Protein (ng) Molecular mass: CDK1 ~59 kDa Procedure Cyclin A2 ~78 kDa Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7.2, 12.5 mM Precautions and Disclaimer glycerol 2-phosphate, 25 mM MgCl2, 5 mM EGTA, and This product is for R&D use only, not for drug, 2 mM EDTA.
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Mitosis Vs. Meiosis
    Mitosis vs. Meiosis In order for organisms to continue growing and/or replace cells that are dead or beyond repair, cells must replicate, or make identical copies of themselves. In order to do this and maintain the proper number of chromosomes, the cells of eukaryotes must undergo mitosis to divide up their DNA. The dividing of the DNA ensures that both the “old” cell (parent cell) and the “new” cells (daughter cells) have the same genetic makeup and both will be diploid, or containing the same number of chromosomes as the parent cell. For reproduction of an organism to occur, the original parent cell will undergo Meiosis to create 4 new daughter cells with a slightly different genetic makeup in order to ensure genetic diversity when fertilization occurs. The four daughter cells will be haploid, or containing half the number of chromosomes as the parent cell. The difference between the two processes is that mitosis occurs in non-reproductive cells, or somatic cells, and meiosis occurs in the cells that participate in sexual reproduction, or germ cells. The Somatic Cell Cycle (Mitosis) The somatic cell cycle consists of 3 phases: interphase, m phase, and cytokinesis. 1. Interphase: Interphase is considered the non-dividing phase of the cell cycle. It is not a part of the actual process of mitosis, but it readies the cell for mitosis. It is made up of 3 sub-phases: • G1 Phase: In G1, the cell is growing. In most organisms, the majority of the cell’s life span is spent in G1. • S Phase: In each human somatic cell, there are 23 pairs of chromosomes; one chromosome comes from the mother and one comes from the father.
    [Show full text]
  • The Expression of P21/WAF-1 and Cyclin B1 Mediate Mitotic Delay in X-Irradiated Fibroblasts
    ANTICANCER RESEARCH 25: 1123-1130 (2005) The Expression of p21/WAF-1 and Cyclin B1 Mediate Mitotic Delay in x-Irradiated Fibroblasts MICKAEL J. CARIVEAU1,2, CHARLES J. KOVACS2, RON R. ALLISON2, ROBERTA M. JOHNKE2, GERHARD W. KALMUS3 and MARK EVANS2 1Department of Physics, East Carolina University, Greenville NC, 27858; 2Department of Radiation Oncology, The Brody School of Medicine, East Carolina University, Greenville NC, 27858; 3Department of Biology, East Carolina University, Greenville NC, 27858, U.S.A. Abstract. Background: To better understand the relationship Initiation and maintenance of cell cycle arrest is regulated between mitotic delay and the disruption of cyclin B1 and p21 in by a group of proteins known as the cyclins which function x-irradiated fibroblasts, studies were carried out to establish by coupling to their corresponding cyclin dependent kinases correlations between the downregulation of cyclin B1 by the cyclin (CDK) (6-9). Of particular interest to cell cycle arrest in kinase inhibitor (CKI) p21 and the induction of mitotic delay in response to DNA damage is the G2/M damage checkpoint the NIH3T3 fibroblast. Materials and Methods: Cell cycle kinetics which is regulated by cyclin B1/CDK1 and initiated by DNA were used to analyze mitotic delay in irradiated NIH3T3 cells and damage activation of the cyclin kinase inhibitor p21(10-14). immunocytochemistry incorporated to assess the expression of The inhibitory potential of p21 is well established; however, cyclin B1 and p21, following 2 or 4Gy x-irradiation. Results and there is still much confusion about the role of p21 in the Discussion: Results indicate a dose dependent increase in mitotic irradiated cell (15, 16).
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
    [Show full text]
  • Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase
    cells Review Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase Jaroslav Kalous *, Denisa Jansová and Andrej Šušor Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska 89, 27721 Libechov, Czech Republic; [email protected] (D.J.); [email protected] (A.Š.) * Correspondence: [email protected] Received: 28 April 2020; Accepted: 24 June 2020; Published: 27 June 2020 Abstract: Cyclin dependent kinase 1 (CDK1) has been primarily identified as a key cell cycle regulator in both mitosis and meiosis. Recently, an extramitotic function of CDK1 emerged when evidence was found that CDK1 is involved in many cellular events that are essential for cell proliferation and survival. In this review we summarize the involvement of CDK1 in the initiation and elongation steps of protein synthesis in the cell. During its activation, CDK1 influences the initiation of protein synthesis, promotes the activity of specific translational initiation factors and affects the functioning of a subset of elongation factors. Our review provides insights into gene expression regulation during the transcriptionally silent M-phase and describes quantitative and qualitative translational changes based on the extramitotic role of the cell cycle master regulator CDK1 to optimize temporal synthesis of proteins to sustain the division-related processes: mitosis and cytokinesis. Keywords: CDK1; 4E-BP1; mTOR; mRNA; translation; M-phase 1. Introduction 1.1. Cyclin Dependent Kinase 1 (CDK1) Is a Subunit of the M Phase-Promoting Factor (MPF) CDK1, a serine/threonine kinase, is a catalytic subunit of the M phase-promoting factor (MPF) complex which is essential for cell cycle control during the G1-S and G2-M phase transitions of eukaryotic cells.
    [Show full text]
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers
    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
    [Show full text]
  • Interferon-A-Induced G1 Phase Arrest Through Up-Regulated Expression of CDK Inhibitors, P19ink4d and P21cip1 in Mouse Macrophages
    Oncogene (1998) 16, 2075 ± 2086 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc Interferon-a-induced G1 phase arrest through up-regulated expression of CDK inhibitors, p19Ink4D and p21Cip1 in mouse macrophages Masaaki Matsuoka, Kenzaburo Tani and Shigetaka Asano Department of Hematology and Oncology, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan The mechanism of cell cycle arrest induced by interferon-a dependent kinases or cdks (reviewed by Sherr, 1993). (IFN-a) was analysed using a mouse macrophage cell line, D-type cyclins (Lew et al., 1991; Matsushime et al., 1991) BAC1.2F5A. IFN-a added in media before mid-G1 and cyclin E (Ko et al., 1991; Lew et al., 1991) govern the prohibited cells from entering S phase. The blockage of G1/S transition in association with their proper G1/S transition was associated with diminuition of both physiological partners, cdk4 (Matsushime et al., 1992) cyclin D1/cdk4- and cyclin E/cdk2-associated kinase or cdk6 (Meyerson and Harlow, 1994), and cdk2 (Dulic et activities. G1 cyclin-associated kinase activities were al., 1992; Ko et al., 1992), respectively. When cells enter down-regulated quickly after the addition of IFN-a. Cells G1 phase with mitogenic stimuli, the synthesis and the treated with IFN-a contained excess amounts of cdk active complex formation of D-type cyclins and cdk4 are inhibitors which down-regulated G1 cyclin/cdk-associated induced in early to middle G1 phase, and their complex kinase activities in the proliferating cells and this action formation and activities reach maximal levels at late G1 was counteracted by exogenously-supplied recombinant (Matsushime et al., 1992, 1994).
    [Show full text]