DOCSLIB.ORG

Atypical 11Q Deletions Identified by Array CGH May Be Missed by FISH

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Atypical 11Q Deletions Identified by Array CGH May Be Missed by FISH Letters to the Editor 1011 1 2 2 2 1 AC Ng , SK Kumar , SJ Russell , SV Rajkumar and MT Drake 2 Axelrod L. Glucocorticoid therapy. Medicine (Baltimore) 1976; 55: 1 Division of Endocrinology, Department of Medicine, 39–65. Mayo Clinic, Rochester, MN, USA and 3 Krasner AS. Glucocorticoid-induced adrenal insufficiency. JAMA 2Division of Hematology, Department of Medicine, 1999; 282: 671–676. Mayo Clinic, Rochester, MN, USA 4 Schlaghecke R, Kornely E, Santen RT, Ridderskamp P. The effect of E-mail: [email protected] long-term glucocorticoid therapy on pituitary-adrenal responses to exogenous corticotropin-releasing hormone. N Engl J Med 1992; 326: 226–230. References 5 Grinspoon SK, Biller BM. Clinical review 62: laboratory assessment of adrenal insufficiency. J Clin Endocrinol Metab 1994; 79: 1 Rajkumar SV, Jacobus S, Callander N, Fonseca R, Vesole D, Williams 923–931. M et al. A randomized trial of lenalidomide plus high-dose 6 Nieman LK. Dynamic evaluation of adrenal hypofunction. dexamethasone (RD) versus lenalidomide plus low-dose dexametha- J Endocrinol Invest 2003; 26 (7 Suppl): 74–82. sone (Rd) in newly diagnosed multiple myeloma (E4A03): a trial 7 Hagg E, Asplund K, Lithner F. Value of basal plasma cortisol assays coordinated by the Eastern Cooperative Oncology Group. Blood in the assessment of pituitary-adrenal insufficiency. Clin Endocrinol (ASH Annual Meeting Abstracts) 2006; 108:799. (Oxf) 1987; 26: 221–226. Atypical 11q deletions identified by array CGH may be missed by FISH panels for prognostic markers in chronic lymphocytic leukemia Leukemia (2009) 23, 1011–1017; doi:10.1038/leu.2008.393; results were because of small clonal cell populations that published online 22 January 2009 comprised o25–30% of the total sample. Interestingly, two CLL cases with cryptic (B1 Mb) 13q14 deletions detected Genomic alterations have increasingly gained importance as by array CGH were missed by both of the 13q14 region prognostic markers in B-cell chronic lymphocytic leukemia (CLL). FISH probes used in this study. These findings suggested that The identification of genetic alterations of prognostic importance array CGH had advantages over FISH for the identification of in CLL is accomplished currently using commercially available certain types of genomic alterations in CLL. In this study, fluorescence in situ hybridization (FISH) panels that can detect the we present four additional CLL cases with atypical 11q most common recurrent aberrations in CLL, involving chromo- deletions, including two cases that were not identified properly somes 11q, 13q, 14q, 17p and whole chromosome 12.1–4 by a commercially available five-probe FISH panel that Although the use of FISH analysis has improved the detection also included an 11q22.3 Vysis LSI ATM probe (Abbott rate of genomic alterations in CLL from B50% using conventional Molecular, Des Plaines, IL, USA). This study is also the first to cytogenetics to 480%,5 there is a need for improved methods to report CLL cases with large 11q deletions that do not include identify prognostic markers that can aid in the risk-stratification of the ATM (Ataxia telangiectasia mutated) gene, suggesting that these patients. The identification of high-risk patients is essential additional genes in this region may be important for the for treatment planning and is of particular importance in early- pathogenesis of CLL. stage, asymptomatic CLL patients, for whom rapid disease Bacterial artificial chromosome array-based array GCH progression and a poor prognosis can be predicted by the was used to detect recurrent genomic alterations in 190 presence of specific genomic abnormalities such as 11q and 17p cases of CLL using a clinically validated array designed to deletions.6–8 Recently, array comparative genomic hybridization interrogate all known CLL prognostic loci.11 This array contains (array CGH) has been gaining acceptance as a diagnostic tool that 179 CLL prognostic marker probes along with a backbone of can also be applied to detect genomic gains and losses of 914 FISH-mapped linearly distributed clones for whole- prognostic importance in CLL, because of the advantages afforded genome coverage at an average resolution of B2.5 Mb. This by simultaneous genome-wide and locus-specific assessment of analysis identified 22 CLL cases with 11q deletions, with 20 theleukemiawithasingleassay.9–14 cases that included the ATM gene in the deleted region. Array CGH is well suited for the identification of genomic However, four of the CLL cases showed atypical 11q deletions, alterations of prognostic importance in CLL, because the most with two cases (Cases 1 and 2) exhibiting a centromeric common and important aberrations are comprised of genomic breakpoint just proximal to the ATM locus, and two cases losses and gains, whereas chromosomal translocations are (Cases 3 and 4) exhibiting proximal breakpoints telomeric to the relatively rare. Although translocations do occur in CLL, their ATM gene (Figure 1). Oligonucleotide-based array CGH prognostic significance is currently controversial. In a number of analysis (Agilent Technologies 44 K or 105 K arrays, Santa Clara, recent studies evaluating the use of array CGH as a clinical tool CA, USA) was also used to confirm the 11q deletions and to map for genomic alteration detection in CLL, array CGH results have the deletion breakpoints in 15 of the 22 chromosome 11q exhibited a high concordance with parallel FISH studies, except deletion cases identified by the BAC array. This analysis when FISH aberrations are present in less than B25–30% of the identified a minimal region of deletion on 11q of B2.94 Mb cells.9–14 In a recent report from our laboratory, we analyzed (Table 1). 174 cases of CLL by bacterial artificial chromosome (BAC)- Bacterial artificial chromosome array CGH analysis of Case 1 based array CGH and found that we could identify correctly the revealed a 2.4 Mb deletion of 13q and an B11 Mb deletion of aberrations identified by FISH 96% of the time.12 The discordant 11q23 involving 19 clones at linear positions 107.57–118.29 Leukemia 1012 Leukemia Letters to the Editor Figure 1 Atypical 11q deletions in four cases of chronic lymphocytic leukemia (CLL) identified by bacterial artificial chromosome (BAC) array comparative genomic hybridization (CGH) analysis. BAC array CGH analysis was performed using the HemeScan microarray (Combimatrix Molecular Diagnostics, Irvine, CA, USA). Differentially Cy3 and Cy5 fluorescence-labeled patient and normal sex-matched reference samples were co-hybridized to the microarray, scanned with a Gene-Pix 4000B microarray scanner and quantified using GenePix Pro microarray image analysis software (Molecular Devices, Sunnyvale, CA, USA). A loss of a particular clone is manifested as the simultaneous deviation of the ratio plots from a modal value of 1.0, with the red ratio plot showing a positive deviation (to the right), whereas the blue ratio plot shows a negative deviation at the same locus (to the left). Conversely, DNA copy number gains show the opposite pattern. A ‘typical’ 11q deletion involving the ATM gene is shown in the panel on the far left. Atypical 11q deletions involving the ATM gene near the proximal breakpoint of the deletion (Cases 1 and 2) and with proximal deletion breakpoints distal to the ATM gene (Cases 3 and 4). Letters to the Editor 1013 Table 1 Sizes and linear positions of atypical 11q deletion cases, were also confirmed by oligonucleotide array analysis and ATM gene locus endpoints, and minimal region of deletion on 11q found to be 8.8, 1.5 and 4.8 Mb in size, respectively. defined by oligonucleotide array CGH analysis of 15 CLL cases Bacterial artificial chromosome array CGH analysis of Case 4 showed a relatively large 18 Mb deletion of 11q23 represented Start Stop Size by the loss of 23 probes (RP11-54P20-RP11-378D7) at linear positions 108.97–124.95 (Figure 1). The two probes covering Case 1 11q del 107 327 853 118 429 797 11.1 Mb Case 2 11q del 107 390 044 116 803 762 9.41 Mb the ATM locus (RP11-56J3 and RP11-27I22) at linear positions Case 3 11q del 111 926 277 117 510 598 5.58 Mb 107.57 and 107.81 were proximal to the breakpoint and not Case 4 11q del 108 775 680 126 456 923 17.68 Mb included in the deletion. In addition to the 11q deletion, BAC ATM gene locus 107 672 911 107 709 905 36 995 bp array CGH revealed complex genomic alterations with losses Minimal region of 111 962 277 114 899 282 2.94 Mb on chromosomes 8p, 8q, 13q, 14q, 17p, 18p, 18q and a gain on deletion on 11q 22q (data not shown). Oligonucleotide array CGH analysis, of CGH, comparative genomic hybridization; CLL, chronic lymphocytic this case, identified a 17.68 Mb deletion extending from leukemia. 11q22.3-q24.2 (Figure 2d and Table 1) and also confirmed the other genomic alterations detected by the BAC array. FISH analysis with a LSI ATM probe did not detect the 11q23 (RP11-56J3-RP11-317A5; Figure 1). Although BAC array CGH deletion, but additional FISH probes confirmed the genomic suggested that the ATM gene might be involved directly in the losses on 13q and 17p. Losses of chromosomes 8p, 8q, 14q, proximal breakpoint region, further analysis using oligo- 18p, 18q and 22q were also not detected by FISH. nucleotide array CGH revealed an 11.1 Mb deletion extending It has previously been assumed that the LSI ATM B500 Kb from 11q22.3-q23.3 that included the CUL5, ACAT, NPAT FISH probe provided adequate coverage for the detection of and ATM gene loci and STS markers D11S1828 and D11S1294 deletions of the 11q22.3q23 region in CLL. The protein encoded near the proximal breakpoint of the deletion (Figures 2a, 3 and by the ATM gene is a cell cycle checkpoint kinase and upstream Table 1).
Load more

Recommended publications
  • PLZF Targets Developmental Enhancers for Activation During Osteogenic Differentiation of Human Mesenchymal Stem Cells
    RESEARCH ARTICLE PLZF targets developmental enhancers for activation during osteogenic differentiation of human mesenchymal stem cells Shuchi Agrawal Singh1,2,3*, Mads Lerdrup1,3, Ana-Luisa R Gomes1,3, Harmen JG van de Werken4,5,6, Jens Vilstrup Johansen1,3,7, Robin Andersson1,3,7, Albin Sandelin1,3,7, Kristian Helin8,9,10, Klaus Hansen1,3* 1Biotech Research and Innovation Centre (BRIC), Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark; 2Department of Hematology, Cambridge Institute for Medical Research and Welcome Trust/MRC Stem Cell Institute, University of Cambridge, Cambridge, United Kingdom; 3Centre for Epigenetics, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark; 4Department of Cell Biology, University Medical Center, Rotterdam, Netherlands; 5Cancer Computational Biology Center, University Medical Center, Rotterdam, Netherlands; 6Department of Urology, University Medical Center, Rotterdam, Netherlands; 7Department of Biology, The Bioinformatics Centre, University of Copenhagen, Copenhagen, Denmark; 8The Novo Nordisk Center for Stem Cell Biology, Faculty of Health and Medical Sciences University of Copenhagen, Copenhagen, Denmark; 9Cell Biology Program, Memorial Sloan Kettering Cancer Center, New York, United States; 10Center for Epigenetics Research, Memorial Sloan Kettering Cancer Center, New York, United States *For correspondence: [email protected]; Abstract The PLZF transcription factor is essential for osteogenic differentiation of hMSCs; [email protected] (SAS); however, its regulation and molecular function during this process is not fully understood. Here, we [email protected] (KHA) revealed that the ZBTB16 locus encoding PLZF, is repressed by Polycomb (PcG) and H3K27me3 in Competing interests: The naive hMSCs. At the pre-osteoblast stage of differentiation, the locus lost PcG binding and authors declare that no H3K27me3, gained JMJD3 recruitment, and H3K27ac resulting in high expression of PLZF.
    [Show full text]
  • Genome-Wide Screen of Cell-Cycle Regulators in Normal and Tumor Cells
    bioRxiv preprint doi: https://doi.org/10.1101/060350; this version posted June 23, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genome-wide screen of cell-cycle regulators in normal and tumor cells identifies a differential response to nucleosome depletion Maria Sokolova1, Mikko Turunen1, Oliver Mortusewicz3, Teemu Kivioja1, Patrick Herr3, Anna Vähärautio1, Mikael Björklund1, Minna Taipale2, Thomas Helleday3 and Jussi Taipale1,2,* 1Genome-Scale Biology Program, P.O. Box 63, FI-00014 University of Helsinki, Finland. 2Science for Life laboratory, Department of Biosciences and Nutrition, Karolinska Institutet, SE- 141 83 Stockholm, Sweden. 3Science for Life laboratory, Division of Translational Medicine and Chemical Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, S-171 21 Stockholm, Sweden To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that tumor and normal cells are differentially sensitive to loss of the histone genes transcriptional regulator CASP8AP2. In cancer cells, loss of CASP8AP2 leads to a failure to synthesize sufficient amount of histones in the S-phase of the cell cycle, resulting in slowing of individual replication forks. Despite this, DNA replication fails to arrest, and tumor cells progress in an elongated S-phase that lasts several days, finally resulting in death of most of the affected cells.
    [Show full text]
  • Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
    ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Paternal Finasteride Treatment Can Influence the Testicular
    Article Paternal Finasteride Treatment Can Influence the Testicular Transcriptome Profile of Male Offspring—Preliminary Study Agnieszka Kolasa 1,* , Dorota Rogi ´nska 2 , Sylwia Rzeszotek 1 , Bogusław Machali ´nski 2 and Barbara Wiszniewska 1 1 Department of Histology and Embryology, Pomeranian Medical University (PMU), Powsta´nców Wlkp. 72 Avene, 70-111 Szczecin, Poland; [email protected] (S.R.); [email protected] (B.W.) 2 Department of General Pathology, Pomeranian Medical University, Powsta´nców Wlkp. 72 Avene, 70-111 Szczecin, Poland; [email protected] (D.R.); [email protected] (B.M.) * Correspondence: [email protected]; Tel.: +48-91-466-16-77 Abstract: (1) Background: Hormone-dependent events that occur throughout spermatogenesis during postnatal testis maturation are significant for adult male fertility. Any disturbances in the T/DHT ratio in male progeny born from females fertilized by finasteride-treated male rats (F0:Fin) can result in the impairment of testicular physiology. The goal of this work was to profile the testicular transcriptome in the male filial generation (F1:Fin) from paternal F0:Fin rats. (2) Methods: The subject material for the study were testis from immature and mature male rats born from females fertilized by finasteride-treated rats. Testicular tissues from the offspring were used in microarray analyses. (3) Results: The top 10 genes having the highest and lowest fold change values were mainly those that encoded odoriferous (Olfr: 31, 331, 365, 633, 774, 814, 890, 935, 1109, 1112, 1173, 1251, 1259, 1253, 1383) Citation: Kolasa, A.; Rogi´nska,D.; Vmn1r 50 103 210 211 Vmn2r 3 23 99 RIKEN cDNA 5430402E10 Rzeszotek, S.; Machali´nski,B.; and vomeronasal ( : , , , ; : , , ) receptors and , Wiszniewska, B.
    [Show full text]
  • Newly Identified Gon4l/Udu-Interacting Proteins
    www.nature.com/scientificreports OPEN Newly identifed Gon4l/ Udu‑interacting proteins implicate novel functions Su‑Mei Tsai1, Kuo‑Chang Chu1 & Yun‑Jin Jiang1,2,3,4,5* Mutations of the Gon4l/udu gene in diferent organisms give rise to diverse phenotypes. Although the efects of Gon4l/Udu in transcriptional regulation have been demonstrated, they cannot solely explain the observed characteristics among species. To further understand the function of Gon4l/Udu, we used yeast two‑hybrid (Y2H) screening to identify interacting proteins in zebrafsh and mouse systems, confrmed the interactions by co‑immunoprecipitation assay, and found four novel Gon4l‑interacting proteins: BRCA1 associated protein‑1 (Bap1), DNA methyltransferase 1 (Dnmt1), Tho complex 1 (Thoc1, also known as Tho1 or HPR1), and Cryptochrome circadian regulator 3a (Cry3a). Furthermore, all known Gon4l/Udu‑interacting proteins—as found in this study, in previous reports, and in online resources—were investigated by Phenotype Enrichment Analysis. The most enriched phenotypes identifed include increased embryonic tissue cell apoptosis, embryonic lethality, increased T cell derived lymphoma incidence, decreased cell proliferation, chromosome instability, and abnormal dopamine level, characteristics that largely resemble those observed in reported Gon4l/udu mutant animals. Similar to the expression pattern of udu, those of bap1, dnmt1, thoc1, and cry3a are also found in the brain region and other tissues. Thus, these fndings indicate novel mechanisms of Gon4l/ Udu in regulating CpG methylation, histone expression/modifcation, DNA repair/genomic stability, and RNA binding/processing/export. Gon4l is a nuclear protein conserved among species. Animal models from invertebrates to vertebrates have shown that the protein Gon4-like (Gon4l) is essential for regulating cell proliferation and diferentiation.
    [Show full text]
  • THE ROLE of HISTONE LOCUS BODY (HLB) ASSEMBLY and the CELL CYCLE in HISTONE Mrna BIOSYNTHESIS
    THE ROLE OF HISTONE LOCUS BODY (HLB) ASSEMBLY AND THE CELL CYCLE IN HISTONE mRNA BIOSYNTHESIS Esteban Alejandro Terzo A dissertation submitted in the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biology. Chapel Hill 2015 Approved by: Robert J. Duronio William F. Marzluff Jeff Sekelsky Jean Cook Greg Matera © 2015 Esteban Alejandro Terzo ALL RIGHTS RESERVED ii ABSTRACT Esteban Alejandro Terzo: The role of histone locus body (HLB) assembly and the cell cycle in histone mRNA biosynthesis (Under the direction of Robert J. Duronio) The spatial compartmentalization of nuclear processes such as transcription, ribosome biogenesis, cellular response to stress, and histone mRNA biosynthesis into discrete territories is essential for precisely orchestrating diverse gene expression programs. The genome organizes structures called nuclear bodies (NBs) that concentrate factors (proteins, RNA, and Ribonucleoproteins) required for the efficient regulation of gene expression. The levels of the molecular components that constitute NBs fluctuate due to a continuous exchange with the nucleoplasm in response to diverse physiological inputs. Therefore, gaining insight into how NBs assemble and function is essential for understanding their contribution to genome function. We used the Drosophila histone locus body (HLB) as a model to ask how HLB assembly and function contribute to the replication-dependent histone gene expression. HLBs form at the histone locus and concentrate factors required for histone mRNA biosynthesis. In addition, CycE/Cdk2 is known to be required for cell cycle-dependent histone mRNA biosynthesis. Our laboratory previously demonstrated that the Multi Sex Combs (Mxc) protein is required for HLB assembly and efficient histone mRNA biosynthesis and is also phosphorylated by CycE/Cdk2.
    [Show full text]
  • Upregulation in Pregnancy Cells Correlates with IL-10 and Bcl-2
    Published June 3, 2013, doi:10.4049/jimmunol.1203165 The Journal of Immunology Fetal–Maternal Alignment of Regulatory T Cells Correlates with IL-10 and Bcl-2 Upregulation in Pregnancy Brigitte Santner-Nanan,*,1 Kathrin Straubinger,†,1 Peter Hsu,*,‡,1 Grant Parnell,* Ben Tang,* Bei Xu,x Angela Makris,x Annemarie Hennessy,x,{ Michael J. Peek,* Dirk H. Busch,†,‖ Clarissa Prazeres da Costa,† and Ralph Nanan* Transplacental immune regulation refers to the concept that during pregnancy, significant cross-talk occurs between the maternal and fetal immune system with potential long-term effects for both the mother and child. In this study, we made the surprising observation that there is a strong correlation of peripheral blood regulatory T (Treg) cells between the mother and the fetus. In contrast, there is no significant Treg cell correlation between paternal fetal dyads (pairs), suggesting that the specific context of pregnancy, rather than the genetic parental similarity to the fetus, is responsible for this correlation. Gene microarray analysis of Treg cells identified a typical IL-10–dependent signature in maternal and fetal Treg cells. In addition, a direct correlation of serum IL-10 protein levels between maternal fetal dyads was observed. Furthermore, we show that maternal serum IL-10 levels correlate with serum estradiol and estriol, implicating hormonal involvement in this alignment. Interestingly, we show that Treg cells possess higher expression of IL-10 receptor a and that Treg cell IL-10 receptor a expression directly correlates with their Bcl-2 expression. Indeed, in vitro data in both humans and mice demonstrate that IL-10 upregulates Bcl-2 specifically in Treg cells but not non-Treg cells.
    [Show full text]
  • The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia
    cancers Article The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia Jonathan Lukas Lühmann 1,† , Marie Stelter 1,†, Marie Wolter 1, Josephine Kater 1, Jana Lentes 1, Anke Katharina Bergmann 1, Maximilian Schieck 1 , Gudrun Göhring 1, Anja Möricke 2, Gunnar Cario 2, Markéta Žaliová 3 , Martin Schrappe 2, Brigitte Schlegelberger 1, Martin Stanulla 4 and Doris Steinemann 1,* 1 Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany; [email protected] (J.L.L.); [email protected] (M.S.); [email protected] (M.W.); [email protected] (J.K.); [email protected] (J.L.); [email protected] (A.K.B.); [email protected] (M.S.); [email protected] (G.G.); [email protected] (B.S.) 2 Department of Pediatrics I, ALL-BFM Study Group, Christian-Albrechts University Kiel and University Medical Center Schleswig-Holstein, 24105 Kiel, Germany; [email protected] (A.M.); [email protected] (G.C.); [email protected] (M.S.) 3 Department of Paediatric Haematology and Oncology, 2nd Faculty of Medicine, Charles University and University Hospital Motol, CZ-15006 Prague, Czech Republic; [email protected] 4 Pediatric Hematology and Oncology, Hannover Medical School, 30625 Hannover, Germany; [email protected] * Correspondence: [email protected] † These authors equally contributed to this work. Citation: Lühmann, J.L.; Stelter, M.; Wolter, M.; Kater, J.; Lentes, J.; Bergmann, A.K.; Schieck, M.; Simple Summary: The stratification of childhood ALL is currently based on various diagnostic Göhring, G.; Möricke, A.; Cario, G.; assays.
    [Show full text]
  • The HIST1 Locus Escapes Reprogramming in Cloned Bovine Embryos
    INVESTIGATION The HIST1 Locus Escapes Reprogramming in Cloned Bovine Embryos Byungkuk Min,*,† Sunwha Cho,* Jung Sun Park,* Kyuheum Jeon,*,† and Yong-Kook Kang*,†,1 *Development and Differentiation Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, 305-806, South Korea, †Department of Functional Genomics, University of Science and Technology, Daejeon, 305-350, South Korea ORCID ID: 0000-0002-5419-6964 (B.M.) ABSTRACT Epigenetic reprogramming is necessary in somatic cell nuclear transfer (SCNT) embryos in KEYWORDS order to erase the differentiation-associated epigenetic marks of donor cells. However, such epigenetic RNA-seq memories often persist throughout the course of clonal development, thus decreasing cloning efficiency. SCNT Here, we explored reprogramming-refractory regions in bovine SCNT blastocyst transcriptomes. We HIST1 cluster observed that histone genes residing in the 1.5 Mb spanning the cow HIST1 cluster were coordinately reprogramming downregulated in SCNT blastocysts. In contrast, both the nonhistone genes of this cluster, and histone epigenetics genes elsewhere remained unaffected. This indicated that the downregulation was specifictoHIST1 histone HDAC inhibitor genes. We found that, after trichostatin A treatment, HIST1 histone genes were derepressed, and DNA DNA methylation methylation at their promoters was decreased to the level of in vitro fertilization embryos. Therefore, our results indicate that the reduced expression of HIST1 histone genes is a consequence of poor epigenetic reprogramming in SCNT blastocysts. Successful cloning by somatic cell nuclear transfer (SCNT) depends and SCNT blastocysts (Min et al. 2015). Additionally, we also reported onaccuratereprogrammingprocessesinwhichthedifferentiatedstateof features unique to SCNT blastocysts, including consistently aberrant the donor cell genome drifts to a totipotent, embryonic ground state expression of genes that function in either trophectoderm development (Kang et al.
    [Show full text]
  • Development and Validation of a Six-RNA Binding Proteins Prognostic Signature and Candidate Drugs for Prostate Cancer
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.28.175984; this version posted June 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Development and validation of a six-RNA binding proteins prognostic signature and candidate drugs for prostate cancer Lei Gao1†, Jialin Meng2†, Yong Zhang1, Junfei Gu1, Zhenwei Han1, Shenglin Gao3*, Xiaolu Wang1* 1Department of Urology, the second Hospital of Hebei Medical University, Shijiazhuang, China 2Department of Urology, The First Affiliated Hospital of Anhui Medical University, Institute of Urology, Anhui Medical University, Anhui Province Key Laboratory of Genitourinary Diseases, Anhui Medical University, Hefei, China 3 Department of Urology, The Affiliated Changzhou No. 2 People's Hospital of Nanjing Medical University, Changzhou, China † Authors contributed equally Correspondence: Xiaolu Wang: [email protected] Shenglin Gao: [email protected] Abstract The dysregulation of RNA binding proteins (RBPs) play critical roles in the progression of several cancers. However, the overall functions of RBPs in prostate cancer (PCa) remain poorly understood. Therefore, we first identified 144 differentially expressed RBPs in tumors compared to normal tissues based on the TCGA dataset. Next, six RBP genes (MSI1, MBNL2, LENG9, REXO2, RNASE1, PABPC1L) were screened out as prognosis hub genes by univariate, LASSO and multivariate Cox regression and used to establish the prognostic signature. Further analysis indicated that high risk group was significantly associated with poor RFS, which was validated in the MSKCC cohort.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protein NPAT Gene Symbol Npat Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.18968 Ensembl Gene ID ENSRNOG00000024934 Entrez Gene ID 315666 Assay Information Unique Assay ID qRnoCID0004641 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000049076 Amplicon Context Sequence TTACAGACGCCACCTAAGTCTAACAGTGCATTTGCTGTCAGCCAAGCCGTGTCA CCAAACTTTTCACAAGGATCTGCCATCATAATTGCTTCTCCAGTACAGCCTGTTCT TCAAGGAATGGTGGGGATGATACCTGTGTCTGTA Amplicon Length (bp) 114 Chromosome Location 8:56728555-56732168 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 102 R2 0.9993 cDNA Cq 21.63 cDNA Tm (Celsius) 82 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Npat, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]