Distribution Patterns of Ammonia-Oxidizing Bacteria and Anammox Bacteria in the Freshwater Marsh of Honghe Wetland in Northeast China
Total Page：16
File Type：pdf, Size：1020Kb
Ecotoxicology DOI 10.1007/s10646-014-1333-4 Distribution patterns of ammonia-oxidizing bacteria and anammox bacteria in the freshwater marsh of Honghe wetland in Northeast China Kwok-Ho Lee • Yong-Feng Wang • Guo-Xia Zhang • Ji-Dong Gu Accepted: 9 August 2014 Ó Springer Science+Business Media New York 2014 Abstract Community characteristics of aerobic ammonia- suggesting that the utilization of hzo biomarker for detecting oxidizing bacteria (AOB) and anaerobic ammonium-oxi- anammox bacteria in freshwater marsh might have serious dizing (anammox) bacteria in Honghe freshwater marsh, a limitations. Results with 16S rRNA gene showed that Ramsar-designated wetland in Northeast China, were ana- Candidatus Kuenenia was detected in only the Experimental lyzed in this study. Samples were collected from surface and Zone, whereas Ca. Scalindua including different lineages low layers of sediments in the Experimental, Buffer, and was observed in both the Buffer and Experimental Zones but Core Zones in the reserve. Community structures of AOB not the Core Zone. These results indicated that both AOB were investigated using both 16S rRNA and amoA (encod- and anammox bacteria have specific distribution patterns in ing for the a-subunit of the ammonia monooxygenase) the ecosystem corresponding to the extent of anthropogenic genes. Majority of both 16S rRNA and amoA gene-PCR impact. amplified sequences obtained from the samples in the three zones affiliated with Nitrosospira, which agreed with other Keywords Nitrification Á Anammox Á Wetland Á wetland studies. A relatively high richness of b-AOB amoA Anthropogenic pollution Á Hydrazine oxidoreductase gene detected in the freshwater marsh might suggest mini- mal external pressure was experienced, providing a suitable habitat for b-AOB communities. Anammox bacteria com- Introduction munities were assessed using both 16S rRNA and hzo (encoding for hydrazine oxidoreductase) genes. However, Wetlands are an important ecosystem on earth, supporting PCR amplification of the hzo gene in all samples failed, a high diversity of a wide range of organisms and in turn serve a important function in food production and nutrients Kwok-Ho Lee and Yong-Feng Wang are contributed to this work cycling (Gopal and Ghosh 2008; Nagelkerken et al. 2008). equally. They act as an important breeding site for endangered wildlife species, such as protected and threatened flora and K.-H. Lee Á J.-D. Gu (&) avifauna (Nagelkerken et al. 2008). They also play a vital Laboratory of Environmental Microbiology and Toxicology, role in cycling of different nutrients and mitigation of School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, SAR, People’s Republic of China climate change through the marsh ecosystem (Zhou et al. e-mail: [email protected] 2009). Hence the ecological functions of wetland have important implications to both the terrestrial and aquatic Y.-F. Wang environments nearby and beyond. The biogeochemical Laboratory of Microbial Ecology, Guangdong Academy of Forestry, No. 233, Guangshan 1st Road, Guangzhou, People’s nitrogen cycle in marsh is a unique characteristics, which Republic of China plays a critical role in decomposition and pollution control (Birol et al. 2006). G.-X. Zhang With the high microbial biodiversity, microbial nitrifi- Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University cation and denitrification facilitate the nitrogen removal in Guangzhou, Guangdong 510515, People’s Republic of China the marsh (Zhu et al. 2010). Denitrification takes place 123 Kwok-Ho Lee et al. under anoxic environment in which nitrate is reduced 2013), coastal wetlands (Wang and Gu 2014; Wang et al. stepwise to dinitrogen gas (N2) as the end-product released 2014a), freshwater lake (Schubert et al. 2006), freshwater into the atmosphere by heterotrophic organisms with high river (Sun et al. 2014), and various soils types (Humbert diversity of bacteria (You et al. 2009). Nitrification is et al. 2009; Humbert et al. 2012; Wang et al. 2013a). carried out by two steps: aerobic process in which However, only a few reports are available on the anammox ammonia is oxidized to nitrite via hydroxylamine, and then bacteria in natural saline and constructed wetlands (Erler nitrite further conversion to nitrate. The first process is et al. 2008; Humbert et al. 2009). For our knowledge, carried out by both ammonia-oxidizing bacteria (AOB) and anammox bacteria have not been reported in freshwater more recently archaea (AOA) (Cao et al. 2013;Ko¨nneke marshes. et al. 2005). The intermediate nitrite is seldom accumulated In this study, we reported the diversity of AOB and in natural environments due to the rate-limiting step of anammox bacteria in Honghe National Freshwater Marsh ammonia oxidation process. The nitrite produced by the sediments using molecular analysis approaches to amplify first nitrification step would be utilized by the nitrite-oxi- both 16S rRNA gene (i.e. 16S rDNA) and functional genes dizing bacteria (NOB) in later process of the nitrification of both microbial groups. This research provides important (Kowalchuk and Stephen 2001). information whether freshwater marsh ecosystem is a It was believed nitrification could only occur under aer- suitable environment for AOB and anammox bacteria. obic condition as ammonia remains in inert ionic state under anoxic conditions until the discovery and confirmation of anaerobic ammonium oxidation (anammox) from a study in Materials and methods which nitrogen gas was evolved from anaerobic fluidized bed bioreactors of a wastewater treatment plant (Mulder et al. Site description and sample collections 1995). Coupling of nitrification and denitrification in the marsh ecosystem is mainly confined in saturated sediment Honghe National Freshwater Marsh is listed as a Ramsar and other submerged subsurface including the rhizosphere of protected wetland and belongs to one of the typical natural vegetation (Ruiz-Rueda et al. 2009). AOB was first isolated inland freshwater marshes in Sanjiang Plain (Fig. 1), which 100 years ago (Frankland and Frankland 1890), but up to is an extensive area between three big rivers: the Heilong now, the phylogeny of AOB includes family Nitrosomo- River, the Songhua River and the Wusuli River in the nadaceae in the b-proteobacteria with the two genera, northeast of China (Zhou et al. 2009). The wetland is Nitrosomonas and Nitrosospira (Purkhold et al. 2000; located at the boundary area of Tongjiang City and Fuyuan Purkhold et al. 2003) and c-proteobacteria formed from a County, and within the Jiansanjiang Sub-bureau of General single genus Nitrosococcus which is strictly aerobic and only Bureau of Heilongjiang State Farms and Land Reclamation detected in marine environments (Kowalchuk and Stephen Administrative region with an area of around 21,835 hm2 2001). The b-AOB were observed in diverse habitats, (Liu 2009). Honghe wetland has been divided into three including bays (O’Mullan and Ward 2005), coastal wetlands management parts, namely Experimental Zone (E) (2,000 (Cao et al. 2012; Wang et al. 2013c; Wang and Gu 2013; hm2), Buffer Zone (B) (12,835 hm2) and Core Zone Zheng et al. 2013), saline lake (Jiang et al. 2009), freshwater (C) (7,000 hm2). The Core Zone is the main feeding ground marsh (Laanbroek and Speksnijder 2008), saline wetland and breeding habitat for the endangered birds species like (Dorador et al. 2008), paddy soils (Wang et al. 2013b; Wang Glycine soja, Acanthlpanax senticosus, Astragalus mem- et al. 2014b), volcanic soil (Herna´ndez et al. 2014) and ter- branaceus, Phellodendron amurense, Juglans mandshurica restrial soils (Jiang et al. 2014; Nicol et al. 2008; Norman and and Fraxinus mandshurica. Barrett 2014; Sher et al. 2013; Strauss et al. 2014; Zhou et al. In this study, surface layer (1–2 cm) and low layer 2014). (20–22 cm) of sediment samples from each of the three zones The bacteria responsible for the anammox process were collected in August 2008 and immediately transferred belong to the phylum Planctomycetes. Five genera of back to the laboratory in an ice packed cooler. Each sample anammox bacteria have been reported so far: Candidatus was separated into three equal parts from which one part was Brocadia (Kuenen and Jetten 2001), Ca. Kuenenia (Schmid for DNA extraction with two replicates per sample, second et al. 2000), Ca. Scalindua (Kuypers et al. 2003), Ca. part was for chemical analysis, and the third part was stored Anammoxoglobus (Kartal et al. 2007) and Ca. Jettenia under -80 °C for further investigation if needed. (Quan et al. 2008). Anammox bacteria have a wide dis- tribution in various oxygen-limited marine environments Analysis of chemical characteristics (Stevens and Ulloa 2008), marine surface water (Rich et al. 2008), marine sediment and water (Li et al. 2010; Shao Concentrations of ammonium-N, nitrate–N, and nitrite-N et al. 2014; Song et al. 2014; van de Vossenberg et al. were measured by extracting 100 g of sediments in 2.0 M 123 Distribution patterns of ammonia-oxidizing bacteria Fig. 1 Sampling sites in the Honghe National Nature Reserve at Sanjiang Plain, Northeast China Table 1 A list of primer combinations and corresponding PCR protocols used in this study Target group Primer Primer sequences (50-30) Amplicon Thermal profile for PCR Reference length (bp) Bacterial 16S 27F GTGCTGCAGAGAGTTTGATCCTGGCTCAG 1,365 95 °C for 5 min followed by 34 (Rochelle rDNA gene 1392R CACGGATCCACGGGCGGTGTGTRC cycles of 45 s at 94 °C, 1 min at et al. 1995) 55 °C, 1 min at 72 °C AOB 16S NitA CTTAAGTGGGGAATAACGCATCG 1,055 95 °C for 2 min followed by 30 (Voytek and rDNA gene NitB TTACGTGTGAAGCCCTACCCA cycles of 30 s at 95 °C, 30 s at Ward 1995) 57 °C, 3 min at 73 °C AOB amoA amoA-1F GGGGTTTCTACTGGTGGT 491 94 °C for 3 min followed by 37 (Okano et al. gene amoA-2R CCCCTCKGSAAAGCCTTCTTC cycles of 30 s at 94 °C, 30 s at 2004) 55 °C, 45 s at 72 °C Anammox Amx368F TTCGCAATGCCCGAAAGG 452 94 °C for 4 min followed by 36 (Schmid et al.