Dual-Specificity Phosphatases In
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
CDC25B Mediates Rapamycin-Induced Oncogenic Responses in Cancer Cells
Published OnlineFirst March 10, 2009; DOI: 10.1158/0008-5472.CAN-08-3222 Research Article CDC25B Mediates Rapamycin-Induced Oncogenic Responses in Cancer Cells Run-qiang Chen,1 Qing-kai Yang,1 Bing-wen Lu,2 Wei Yi,1 Greg Cantin,2 Yan-ling Chen,1 Colleen Fearns,3 John R. Yates III,2 and Jiing-Dwan Lee1 Departments of 1Immunology and Microbial Science, 2Chemical Physiology, and 3Chemistry, The Scripps Research Institute, La Jolla, California Abstract expression of PTEN, increased PI3K activity, and increased expression or activation of AKT in advanced prostate cancer Because the mammalian target of rapamycin (mTOR) pathway (8–10). These aberrations also are indicators of a poor prognosis is commonly deregulated in human cancer, mTOR inhibitors, for prostate cancer patients (11, 12). More importantly, long-term rapamycin and its derivatives, are being actively tested in androgen deprivation treatment for prostate cancer patients that cancer clinical trials. Clinical updates indicate that the reinforces the PI3K/AKT pathway also up-regulates mTOR anticancer effect of these drugs is limited, perhaps due to activation in prostate tumor (9, 10). These abovementioned rapamycin-dependent induction of oncogenic cascades by an experimental and clinical data lead to the supposition that mTOR as yet unclear mechanism. As such, we investigated rapamy- inhibitors (rapamycin and its derivatives) should be effective in cin-dependent phosphoproteomics and discovered that 250 treating human cancer. Unfortunately, recent clinical data indicates phosphosites in 161 cellular proteins were sensitive to that rapamycin shows therapeutic potential in only few types of rapamycin. Among these, rapamycin regulated four kinases human cancer: endometrial carcinoma, renal cell carcinoma, and and four phosphatases. -
Deciphering the Functions of Ets2, Pten and P53 in Stromal Fibroblasts in Multiple
Deciphering the Functions of Ets2, Pten and p53 in Stromal Fibroblasts in Multiple Breast Cancer Models DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Julie Wallace Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2013 Dissertation Committee: Michael C. Ostrowski, PhD, Advisor Gustavo Leone, PhD Denis Guttridge, PhD Dawn Chandler, PhD Copyright by Julie Wallace 2013 Abstract Breast cancer is the second most common cancer in American women, and is also the second leading cause of cancer death in women. It is estimated that nearly a quarter of a million new cases of invasive breast cancer will be diagnosed in women in the United States this year, and approximately 40,000 of these women will die from breast cancer. Although death rates have been on the decline for the past decade, there is still much we need to learn about this disease to improve prevention, detection and treatment strategies. The majority of early studies have focused on the malignant tumor cells themselves, and much has been learned concerning mutations, amplifications and other genetic and epigenetic alterations of these cells. However more recent work has acknowledged the strong influence of tumor stroma on the initiation, progression and recurrence of cancer. Under normal conditions this stroma has been shown to have protective effects against tumorigenesis, however the transformation of tumor cells manipulates this surrounding environment to actually promote malignancy. Fibroblasts in particular make up a significant portion of this stroma, and have been shown to impact various aspects of tumor cell biology. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Analysis of the Stability of 70 Housekeeping Genes During Ips Reprogramming Yulia Panina1,2*, Arno Germond1 & Tomonobu M
www.nature.com/scientificreports OPEN Analysis of the stability of 70 housekeeping genes during iPS reprogramming Yulia Panina1,2*, Arno Germond1 & Tomonobu M. Watanabe1 Studies on induced pluripotent stem (iPS) cells highly rely on the investigation of their gene expression which requires normalization by housekeeping genes. Whether the housekeeping genes are stable during the iPS reprogramming, a transition of cell state known to be associated with profound changes, has been overlooked. In this study we analyzed the expression patterns of the most comprehensive list to date of housekeeping genes during iPS reprogramming of a mouse neural stem cell line N31. Our results show that housekeeping genes’ expression fuctuates signifcantly during the iPS reprogramming. Clustering analysis shows that ribosomal genes’ expression is rising, while the expression of cell-specifc genes, such as vimentin (Vim) or elastin (Eln), is decreasing. To ensure the robustness of the obtained data, we performed a correlative analysis of the genes. Overall, all 70 genes analyzed changed the expression more than two-fold during the reprogramming. The scale of this analysis, that takes into account 70 previously known and newly suggested genes, allowed us to choose the most stable of all genes. We highlight the fact of fuctuation of housekeeping genes during iPS reprogramming, and propose that, to ensure robustness of qPCR experiments in iPS cells, housekeeping genes should be used together in combination, and with a prior testing in a specifc line used in each study. We suggest that the longest splice variants of Rpl13a, Rplp1 and Rps18 can be used as a starting point for such initial testing as the most stable candidates. -
Cytokine-Driven Cell Cycling Is Mediated Through Cdc25a
JCB: ARTICLE Cytokine-driven cell cycling is mediated through Cdc25A Annette R. Khaled,1,3 Dmitry V. Bulavin,2 Christina Kittipatarin,1 Wen Qing Li,3 Michelle Alvarez,1 Kyungjae Kim,3,5 Howard A. Young,4 Albert J. Fornace,2 and Scott K. Durum3 1University of Central Florida, BioMolecular Science Center, Orlando, FL 32628 2Division of Basic Sciences, National Cancer Institute, Bethesda, MD 20892 3Laboratory of Molecular Immunoregulation and 4Laboratory of Experimental Immunology, National Cancer Institute at Frederick, Frederick, MD 21702 5Department of Pharmacy, Sahm-Yook University, Seoul, Korea, 139-742 ymphocytes are the central mediators of the im- the critical mediator of proliferation. Withdrawal of IL-7 mune response, requiring cytokines for survival and or IL-3 from dependent lymphocytes activates the stress L proliferation. Survival signaling targets the Bcl-2 kinase, p38 MAPK, which phosphorylates Cdc25A, in- family of apoptotic mediators, however, the pathway for ducing its degradation. As a result, Cdk/cyclin com- the cytokine-driven proliferation of lymphocytes is poorly plexes remain phosphorylated and inactive and cells understood. Here we show that cytokine-induced cell arrest before the induction of apoptosis. Inhibiting p38 cycle progression is not solely dependent on the synthe- MAPK or expressing a mutant Cdc25A, in which the two sis of cyclin-dependent kinases (Cdks) or cyclins. Rather, p38 MAPK target sites, S75 and S123, are altered, ren- we observe that in lymphocyte cell lines dependent on ders cells resistant to cytokine withdrawal, restoring the interleukin-3 or interleukin-7, or primary lymphocytes activity of Cdk/cyclin complexes and driving the cell cycle dependent on interleukin 7, the phosphatase Cdc25A is independent of a growth stimulus. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage. -
9. Atypical Dusps: 19 Phosphatases in Search of a Role
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital.CSIC Transworld Research Network 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Emerging Signaling Pathways in Tumor Biology, 2010: 185-208 ISBN: 978-81-7895-477-6 Editor: Pedro A. Lazo 9. Atypical DUSPs: 19 phosphatases in search of a role Yolanda Bayón and Andrés Alonso Instituto de Biología y Genética Molecular, CSIC-Universidad de Valladolid c/ Sanz y Forés s/n, 47003 Valladolid, Spain Abstract. Atypical Dual Specificity Phosphatases (A-DUSPs) are a group of 19 phosphatases poorly characterized. They are included among the Class I Cys-based PTPs and contain the active site motif HCXXGXXR conserved in the Class I PTPs. These enzymes present a phosphatase domain similar to MKPs, but lack any substrate targeting domain similar to the CH2 present in this group. Although most of these phosphatases have no more than 250 amino acids, their size ranges from the 150 residues of the smallest A-DUSP, VHZ/DUSP23, to the 1158 residues of the putative PTP DUSP27. The substrates of this family include MAPK, but, in general terms, it does not look that MAPK are the general substrates for the whole group. In fact, other substrates have been described for some of these phosphatases, like the 5’CAP structure of mRNA, glycogen, or STATs and still the substrates of many A-DUSPs have not been identified. In addition to the PTP domain, most of these enzymes present no additional recognizable domains in their sequence, with the exception of CBM-20 in laforin, GTase in HCE1 and a Zn binding domain in DUSP12. -
Review Article PTEN Gene: a Model for Genetic Diseases in Dermatology
The Scientific World Journal Volume 2012, Article ID 252457, 8 pages The cientificWorldJOURNAL doi:10.1100/2012/252457 Review Article PTEN Gene: A Model for Genetic Diseases in Dermatology Corrado Romano1 and Carmelo Schepis2 1 Unit of Pediatrics and Medical Genetics, I.R.C.C.S. Associazione Oasi Maria Santissima, 94018 Troina, Italy 2 Unit of Dermatology, I.R.C.C.S. Associazione Oasi Maria Santissima, 94018 Troina, Italy Correspondence should be addressed to Carmelo Schepis, [email protected] Received 19 October 2011; Accepted 4 January 2012 Academic Editors: G. Vecchio and H. Zitzelsberger Copyright © 2012 C. Romano and C. Schepis. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. PTEN gene is considered one of the most mutated tumor suppressor genes in human cancer, and it’s likely to become the first one in the near future. Since 1997, its involvement in tumor suppression has smoothly increased, up to the current importance. Germline mutations of PTEN cause the PTEN hamartoma tumor syndrome (PHTS), which include the past-called Cowden, Bannayan- Riley-Ruvalcaba, Proteus, Proteus-like, and Lhermitte-Duclos syndromes. Somatic mutations of PTEN have been observed in glioblastoma, prostate cancer, and brest cancer cell lines, quoting only the first tissues where the involvement has been proven. The negative regulation of cell interactions with the extracellular matrix could be the way PTEN phosphatase acts as a tumor suppressor. PTEN gene plays an essential role in human development. A recent model sees PTEN function as a stepwise gradation, which can be impaired not only by heterozygous mutations and homozygous losses, but also by other molecular mechanisms, such as transcriptional regression, epigenetic silencing, regulation by microRNAs, posttranslational modification, and aberrant localization. -
DUSP10 Regulates Intestinal Epithelial Cell Growth and Colorectal Tumorigenesis
Oncogene (2016) 35, 206–217 © 2016 Macmillan Publishers Limited All rights reserved 0950-9232/16 www.nature.com/onc ORIGINAL ARTICLE DUSP10 regulates intestinal epithelial cell growth and colorectal tumorigenesis CW Png1,2, M Weerasooriya1,2, J Guo3, SJ James1,2,HMPoh1,2, M Osato3, RA Flavell4, C Dong5, H Yang3 and Y Zhang1,2 Dual specificity phosphatase 10 (DUSP10), also known as MAP kinase phosphatase 5 (MKP5), negatively regulates the activation of MAP kinases. Genetic polymorphisms and aberrant expression of this gene are associated with colorectal cancer (CRC) in humans. However, the role of DUSP10 in intestinal epithelial tumorigenesis is not clear. Here, we showed that DUSP10 knockout (KO) mice had increased intestinal epithelial cell (IEC) proliferation and migration and developed less severe colitis than wild-type (WT) mice in response to dextran sodium sulphate (DSS) treatment, which is associated with increased ERK1/2 activation and Krüppel-like factor 5 (KLF5) expression in IEC. In line with increased IEC proliferation, DUSP10 KO mice developed more colon tumours with increased severity compared with WT mice in response to administration of DSS and azoxymethane (AOM). Furthermore, survival analysis of CRC patients demonstrated that high DUSP10 expression in tumours was associated with significant improvement in survival probability. Overexpression of DUSP10 in Caco-2 and RCM-1 cells inhibited cell proliferation. Our study showed that DUSP10 negatively regulates IEC growth and acts as a suppressor for CRC. Therefore, it could be targeted for the development of therapies for colitis and CRC. Oncogene (2016) 35, 206–217; doi:10.1038/onc.2015.74; published online 16 March 2015 INTRODUCTION development. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Bioinformatics-Based Screening of Key Genes for Transformation of Liver
Jiang et al. J Transl Med (2020) 18:40 https://doi.org/10.1186/s12967-020-02229-8 Journal of Translational Medicine RESEARCH Open Access Bioinformatics-based screening of key genes for transformation of liver cirrhosis to hepatocellular carcinoma Chen Hao Jiang1,2, Xin Yuan1,2, Jiang Fen Li1,2, Yu Fang Xie1,2, An Zhi Zhang1,2, Xue Li Wang1,2, Lan Yang1,2, Chun Xia Liu1,2, Wei Hua Liang1,2, Li Juan Pang1,2, Hong Zou1,2, Xiao Bin Cui1,2, Xi Hua Shen1,2, Yan Qi1,2, Jin Fang Jiang1,2, Wen Yi Gu4, Feng Li1,2,3 and Jian Ming Hu1,2* Abstract Background: Hepatocellular carcinoma (HCC) is the most common type of liver tumour, and is closely related to liver cirrhosis. Previous studies have focussed on the pathogenesis of liver cirrhosis developing into HCC, but the molecular mechanism remains unclear. The aims of the present study were to identify key genes related to the transformation of cirrhosis into HCC, and explore the associated molecular mechanisms. Methods: GSE89377, GSE17548, GSE63898 and GSE54236 mRNA microarray datasets from Gene Expression Omni- bus (GEO) were analysed to obtain diferentially expressed genes (DEGs) between HCC and liver cirrhosis tissues, and network analysis of protein–protein interactions (PPIs) was carried out. String and Cytoscape were used to analyse modules and identify hub genes, Kaplan–Meier Plotter and Oncomine databases were used to explore relationships between hub genes and disease occurrence, development and prognosis of HCC, and the molecular mechanism of the main hub gene was probed using Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway analysis.