Sustained Effect of Ex Vivo Lung Perfusion on Nitric Oxide Metabolite Levels in Lung Tissue After Transplantation

Home , Canavanine, Exhaled nitric oxide

Sustained effect of Ex Vivo Lung Perfusion on Nitric Oxide Metabolite levels in Lung Tissue after Transplantation

Farshad Tavasoli

A thesis submitted in conformity with the requirements for the degree of Master of Science

Institute of Medical Science University of Toronto

Sustained effect of Ex Vivo Lung Perfusion on Nitric Oxide

Metabolite levels in Lung Tissue after Transplantation

Farshad Tavasoli

Master of Science

Institute of Medical Science University of Toronto

2014

Abstract

Limited availability of donor lungs results in high mortality of patients waiting for lung transplantation. Modern techniques such as ex vivo lung perfusion (EVLP) or interleukin-10 (IL- 10) gene therapy expand the donor pool and may improve the quality of donor organs and outcomes following lung transplantation remain inferior compared to other organ transplantations. Alterations in metabolic pathways, such as L-arginine/nitric oxide (NO) metabolism can contribute to post-transplantation organ dysfunction. We investigated the L- arginine/NO metabolism in pig models of lung transplantation. We found significant differences in the L-arginine/NO metabolism in lungs from brain death compared to non-brain death donors after prolonged hypothermic preservation. Moreover, we found that EVLP decreased NO metabolite concentrations in lung, a sustained effect after transplantation that was unaffected by IL-10 gene therapy during EVLP. In conclusion, donation circumstances and preservation methods may alter the L-arginine/NO metabolism in transplanted lungs, which may contribute to clinical outcomes after transplantation.

Acknowledgments

First and foremost, I would like to acknowledge the support and direction of my supervisor, Dr. Hartmut Grasemann. Not only he gave me an amazing opportunity to study a fascinating project in his lab, he also encouraged me throughout the study with his generous share of knowledge. Further, I would like to give recognition for my colleagues and friends whose presence assisted the completion of this project greatly. I thank Hailu Huang, M.D. for her help with q-PCR experiments and NO measurement. I thank Darakhshanda Shehnaz, Ph.D. for technical help, sample processing, Western blotting and enzyme activity measurements. I thank Jalil Nasiri MSc, Peyman Ghorbani MSc and David Douda Ph.D. for their technical help.

I wish to acknowledge my advisory committee members, Dr. Mingyao Liu, Dr. Nades Palaniyar and Dr. Jaques Belik for their guidance, comments, patience and support. I value their input as it was remarkably beneficial to this thesis.

I would like to give special thanks to Dr. Shaf Keshavjee for his support as well as for his generosity for providing mass spectrometry data and all tissue samples for this study.

I gratefully acknowledge Dr. David Grant and SickKids Research Institute for providing funding for this study.

I would also like to acknowledge Dr. Tiago Machuca and Dr. Riccardo Bonato who performed large animal lung transplantation surgeries. I thank Dr. Marcelo Cypel and Dr. Michael Hsin for providing metabolomic data and helpful discussions.

I thank May Brydges, Jeff Patton, Paul Chartrand and Ivone Ornelas for their administrative help.

Last but not least, I would like to thank my wife Sheida Aminkhadem and my daughter Nikki Tavassoli for their love and support.

iii

Table of contents

Chapter 1: Background & Introduction ...... 1

1.1 Lung transplantation ...... 2

1.1.1 Brain death donors ...... 5

1.1.2 Donation after cardiac death ...... 8

1.2 Preservation of harvested lung ...... 10

1.2.1 Cold static preservation...... 10

1.2.2 Ex vivo perfusion...... 11

1.3 Primary graft dysfunction (PGD) ...... 16

1.3.1 Risk factors for PGD ...... 18

1.3.2 Molecular markers of PGD ...... 20

1.3.3 Prevention and management ...... 20

1.4 Ischemia reperfusion injury ...... 23

1.5 Inter interleukin-10 in lung transplantation ...... 23

1.6 The L-arginine/NO metabolism ...... 25

1.6.1 L-arginine synthesis ...... 25

1.6.2 L-arginine transport ...... 26

1.6.3 L-arginine catabolism ...... 26

1.6.4 Arginase ...... 28

1.6.5 Nitric oxide synthase...... 28

1.6.6 Nitric oxide ...... 28

1.6.7 L-arginine bioavailability...... 29

1.6.8 Asymmetric dimethylarginine ...... 30

1.7 Rationale...... 33

1.8 Hypothesis ...... 35

1.9 Specific aims ...... 35

1.9.1 Specific aim 1 ...... 35

1.9.2 Specific aim 2 ...... 36

Chapter 2: Materials and Methods ...... 37

2.1 Lung transplantation ...... 38

2.1.1 Animals ...... 38

2.1.2 Anesthesia ...... 38

2.1.3 Brain death ...... 38

2.1.4 Lung retrieval ...... 39

2.1.5 Ex vivo lung perfusion ...... 39

2.1.6 Ex vivo viral delivery ...... 41

2.1.7 Ex vivo evaluation of lung function during EVLP ...... 41

2.1.8 Evaluation of lung function after transplantation ...... 41

2.2 Biopsies ...... 41

2.3 Homogenization ...... 42

2.4 Protein assay ...... 42

2.5 Sample preparation for liquid chromatography mass spectrometry...... 44

2.6 LC/MS/MS ...... 44

2.7 NO metabolite measurement ...... 44

2.8 Quantitative polymerase chain reaction ...... 45

2.8.1 Assessing RNA yield and quality ...... 46

2.8.2 Complementary deoxyribonucleic acid ...... 47

2.8.3 Real time PCR...... 47

2.9 Western blotting ...... 48

2.10 Arginase activity measurement ...... 50

2.11 Statistics ...... 51

Chapter 3: The L-arginine metabolic profile in lungs differs between donations after brain death compared to prolonged cold ischemia...... 54

3.1 Abstract ...... 55

3.2 Introduction ...... 57

3.3 Study designs and experimental approach ...... 58

3.4 Results ...... 62

3.4.1 Length of cold static preservation does not affect the levels of L-arginine and its metabolites ...... 62

3.4.2 Reperfusion of lungs from bran death donor after 24 hours cold ischemia results in different L-arginine and L-citrulline levels compared to lungs from non brain death donors after 30 hours of hypothermic preservation ...... 66

3.5 Discussion ...... 71

Chapter 4: NO metabolite and L-citrulline concentrations are decreased after EVLP independent of IL-10 gene therapy and remain decreased after transplantation...... 75

4.1 Abstract ...... 76

4.2 Introduction ...... 78

4.3 Study designs and experimental approach ...... 79

4.4 Results ...... 83

4.4.1 Length of cold ischemia time does not affect L-arginine metabolism...... 83

4.4.2 EVLP decreases NOx concentrations in lung tissue...... 85

4.4.3 NOx is decreased after lung transplantation and reperfusion following EVLP or EVLP+IL-10 ...... 93

4.5 Discussion ...... 97

vii

4.5.1 Cold ischemia does not cause alteration in the L-arginine/NO metabolism ...... 97

4.5.2 NOx and L-citrulline in lung tissue decrease after EVLP and remained below normal after reperfusion ...... 98

Chapter 5: Discussion, conclusion and future directions...... 104

5.1 Regulation of NO production ...... 105

5.1.1 NOS expression and activity ...... 105

5.1.2 ADMA an endogenous NOS inhibitor ...... 106

5.1.3 L-arginine availability for NOS ...... 106

5.1.4 Arginase expression and activity ...... 107

5.2 Other possible causes for decreased NOx and L-citrulline ...... 107

5.3 Interleukin (IL)-10...... 109

5.4 Conclusions ...... 109

5.5 Future directions ...... 110

References ...... 112

Appendix ...... 133

viii

List of Abbreviations

0h CIT Time of harvesting

30h CIT/1h post rep One hour after reperfusion in the non brain death group

30h CIT 30 hours after cold ischemia

6h CIT 6 hours after cold ischemia

ABH 2(S)-amino-6-boronohexanoic acid

ACTH Adrenocorticotropic hormone

ADC Arginine decarboxylase

ADH Anti-diuretic hormone

ADMA Asymmetric dimethylarginine

ALI Acute lung injury

AM Alveolar macrophage

ANOVA Analysis of variance

ARDS Acute respiratory distress syndrome

ASS Argininosuccinate synthetase

ASL Argininosuccinate Lyase

ATP Adenosine tri-phosphate

AUC Area under the curve

BAL Bronchoalveolar lavage

BCP 1-Bromo-3-choloro-propane

BD Brain death

BD+24h CIT Cold ischemia time in the brain death group (24 hours)

BD+24h/1h post rep One hour after reperfusion in the brain death group

BH4 Tetrahydrobiopterin

BOS Bronchiolitis obliterans syndrome

BSA Bovine serum albumin

BUN Blood urea nitrogen

CAT Cationic amino acid transporter

CCL2 Chemokine CC motif ligand 2 cDNA Complementary DNA

CF Cystic fibrosis

CIT Cold ischemia time cNOS Constitutive NOS

COPD Chronic obstructive pulmonary diseases

CPB Cardiopulmonary bypass

CPR Cardiopulmonary resuscitation

CRP C-reactive protein

CVA Cerebrovascular accident

CXC 10 Chemokines motif ligand 10

DC Dendritic cells

DCD Donors after cardiac death

DDAH Dimethylarginine dimethylaminohydrolase,

DEPC Diethylpyrocarbonate

DIC Disseminated intravascular coagulation

DTT Dithiothreitol

ECMO Extracorporeal membrane oxygenation

ED Emergency department

EDTA Ethylenediaminetetraacetate eNOS Endothelial nitric oxide synthaes

EVLP Ex vivo lung perfusion

FAD Flavin adenine dinucleotide

FeNO Fractional exhaled nitric oxide

FiO2 Fraction of inspired oxygen

FMN Flavin mononucleotide

HPLC-MS High-performance liquid chromatography mass spectrometry

I/R Ischemia- reperfusion

ICP Intracranial pressure

ICU Intensive care unit

IFN Interferon

IL Interleukin iNOS Inducible nitric oxide synthase

IP-10 Inducible protein 10

IPF Idiopathic pulmonary fibrosis

ISHLT International Society for Heart and Lung Transplantation

ISPF α-Isonitrosopropiophenone

LA Left atrium

LC/MS/MS Liquid chromatography-tandem mass spectrometry

LPDG Low-potassium dextran glucose

LTx Lung transplantation

MCP Monocyte chemotactic protein

MMA Mono-methylarginine mRNA Messenger RNA

NADPH Nicotinamide adenine dinucleotide phosphate

NF-κB Nuclear factor- κB nNOS Neuronal NOS

NO Nitric oxide

- NO2 Nitrite

NO2 Nitrogen dioxide

- NO3 Nitrate

NOS Nitric oxide synthase

NOS1 (= nNOS) Neuronal NOS

NOS2 (= iNOS) Inducible NOS

NOS3 (= eNOS) Endothelial NOS

NOx Nitric oxide metabolites

NPE Neurogenic pulmonary edema

OAT Ornithine aminotransferase

OD Optical density

ODC Ornithine decarboxylase

xii

OPTN Organ Procurement and Transplantation Network

OTC Ornithine carbamoyltransferase

OTC Ornithine transcarbamoylase

PA Pulmonary artery

PaO2 partial pressure of oxygen in arterial blood

PGD Primary graft dysfunction

PI Protease inhibitor

PMSF Phenylmethylsulfonyl fluoride

PO2 Oxygen pressure

PRMT Protein arginine methyltransferases

PV Pulmonary vein

PVR Pulmonary vascular resistance

REP Reperfusion

RNA Ribonucleic acid

ROS Reactive oxygen species

RPM Rate per minute q-PCR Quantitative polymerase chain reaction sCR1 Soluble complement receptor-1 inhibitor

SDMA Symmetric dimethylarginine

SDS Sodium dodecyl sulfate

SEM Standard error of mean

SLC7 Solute carriers 7

xiii

SNO S-nitrosothiol sRAGE Soluble receptor for advanced glycation end-products

T3 Tri iodothyronine

TGH Toronto General Hospital

TNF Tumor necrosis factor

TOH Time of harvesting

TRALI Transfusion-related lung injury

TSH Thyroid stimulating hormone

V/Q Ventilation perfusion ratio

VEGF Vascular endothelial growth factor vWF Von Willebrand factor

xiv

List of Figures

Figure 1 -1: A, Number of patients on the transplantation waiting list for all organs is much higher than organ donors in Ontario;6 B, Number of patients on lung transplantation waiting list is higher than number of lung donors in Canada.7 ...... 3

Figure 1 -2: Brain death can induce systemic inflammatory responses by 1- Metabolic and hormonal changes, 2- Catecholamine storm, 3- Neuropeptides, 4- Circulating inflammatory mediators.31 ...... 7

Figure 1 -3: Schematic of ex vivo lung perfusion (EVLP) circuit.14 ...... 14

Figure 1 -4: Balance of the L-arginine/NO metabolism by NOS and arginase.99 ...... 27

Figure 1 -5: Biological effects of nitric oxide.116 NO plays essential roles in several physiological responses...... 32

Figure 2 -1: Protocol for measurement of arginase activity in tissue homogenates according to Corraliza. 172 ...... 52

Figure 3‎ -1: Pig lung transplantation study designs. The study was designed to investigate the effects of different lung preservation time and conditions on the L-arginine/NO metabolism. ... 61

Figure 3‎ -2: Different length of cold ischemia time does not affect the levels of amino acids or ADMA in donor lungs (one way ANOVA)...... 63

Figure 3‎ -3: A, The L-arginine metabolism by arginase and NOS; B, Decreased L-ornithine/L- citrulline ratios in donor lungs were observed after 6 h cold ischemia time (6h CIT) but not 30h CIT; *p<0.05, one way ANOVA, Tukey's multiple comparison test...... 67

Figure 3‎ -4: A, Comparing the brain death and non brain death groups, before transplantation L- citrulline was higher in the brain death group, but after transplantation and reperfusion L-

citrulline was higher in the non brain death group ; B, L-ornithine/L-citrulline ratio is higher after transplantation and reperfusion in the brain death group; C, L-arginine after transplantation and reperfusion decreases in the brain death groups (unpaired t test)...... 70

Figure 4‎ -1: Pig lung transplantation study designs. The study was designed to investigate the effects of EVLP and IL10 gene therapy during EVLP on the L-arginine/NO metabolism...... 81

Figure 4 -2: Different length of cold ischemia has no effect on NOx concentration or expression of iNOS, arginase 1 or arginase2 mRNA in lung tissue (Kruskal-Wallis test)...... 84

Figure 4‎ -4: EVLP does not affect iNOS expression but increases arginase1 and arginase2 mRNA expression in lung; * p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test...... 90

xvi

List of Tables

Table 1‎ -1: Traditional criteria for selection of donor lung for lung transplantation.8, 9 ...... 4

Table 1 -2: Modified Maastricht classification of DCD.11 ...... 9

Table 1 -3: Grading schema of primary graft dysfunction according to the International Society for Heart and Lung Transplantation (ISHLT).61 ...... 17

Table 1 -4: Possible risk factors for primary graft dysfunction.65 ...... 19

Table 1 -5: Biomarkers which have been studied for prediction of primary graft dysfunction.60 . 21

Table 1‎ -6: Indicators of L-arginine/NO metabolism ...... 31

Table 2‎ -1: Composition* of STEEN solution™ 163 ...... 40

Table 2 -2: Volume and concentration of standard solution for protein estimation...... 43

Table 2 -3: Details of antibody used for Western blotting...... 49

Table 2 -4: Volumes and concentrations of standard solution for arginase activity measurement 53

Table 3‎ -1: Lung amino acid and ADMA levels at different time points in the brain death and non brain death groups ...... 64

Table 3‎ -2: Indices of L-arginine bioavailability and NOS impairment in lung at different time points in the brain death and non brain death groups ...... 65

Table 4‎ -1: Expression of arginases and iNOS mRNA in lungs at different time points in the “EVLP” and “no EVLP” groups...... 88

Table 4‎ -2: Concentrations of amino acids and ADMA in lung at different time points in the “EVLP” and “no EVLP” groups and in recipient left lungs...... 89

xvii

Table 4‎ -3 Indices of L-arginine bioavailability and NOS impairment in lungs at different time points in the “EVLP” and “no EVLP” groups and in recipient left lungs ...... 91

Table 4‎ -4: Lung NOx concentrations and in vitro arginase activity in “EVLP” and “no EVLP” groups and in recipient left lungs...... 92

xviii

Chapter 1: Background & Introduction

1.1 Lung transplantation

Lung transplantation is considered an ultimate treatment for end-stage pulmonary disease including chronic obstructive pulmonary diseases (COPD), idiopathic pulmonary fibrosis (IPF) and cystic fibrosis (CF).1 The first successful lung transplantation was performed at the Toronto General Hospital by Dr. Joel Cooper in 1983.2 Modern techniques of preservation resulted in improvement of post-transplantation outcomes and median survival.1, 3

In general, based on the Organ Procurement and Transplantation Network (OPTN) data as of June 21, 2013, brain death donors are the main source for all organ donations.4 However, the outcomes of organ transplantation from living donors are better in comparison to brain death donors.5 According to Trillium Gift of Life Network6 and the Canadian Institute for Health Information (CIHI)7 the number of organ donors is much lower than the number of patients on the waiting lists for organ transplantation (Figure 1-1), resulting in progressively longer waiting lists. In addition, the majority of retrieved lungs from deceased donors do not fulfill traditional criteria for lung transplantation4 as highlighted in Table 1‎ -1.8, 9 Different approaches have been taken in order to expand the donor pool such as improving the rate of organ donation or using marginal organs.3 Today, donations after cardiac death (DCD) are considered alternative sources for organ donation.3, 10, 11 Additionally, modern methods of organ preservation, such as normothermic ex vivo preservation, could improve the quality of marginal organs to fulfill transplantation criteria.12-26 These techniques also provide the opportunity for evaluation of organ function and therapeutic modifications before transplantation.12-26 Nevertheless, short and long term complications following organ transplantation such as primary graft dysfunction (PGD), infection, malignancy, and bronchiolitis obliterans (BO) still are serious causes of morbidity and mortality.27 The mechanisms of these complications are complicated and incompletely understood. Understanding the alteration in metabolic pathways, for example the L-arginine/NO metabolism, during and after each step in transplantation could provide additional keys to assess donor lung, improve the quality of donor organ and predict post-transplant outcomes.

A: All organs

2500 Waiting list 2000 Donor

1500

1000

Pateints number Pateints 500

2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 B: Lung

400 Waiting list Transplant 300

200

100 Pateints number Pateints

2002 2003 2004 2005 2006 2007 2008 2009 2010 2011

Figure 1-1: A, Number of patients on the transplantation waiting list for all organs is much higher than organ donors in Ontario;6 B, Number of patients on lung transplantation waiting list is higher than number of lung donors in Canada.7

Table 1‎ -1: Traditional criteria for selection of donor lung for lung transplantation.8, 9 Age, 55 years or less Blood group compatibility Clear chest radiography

PaO2 ≥300 mm Hg on FiO2=1.0, 5cm H2O PEEP Smoking history, 20 pack years or less No chest trauma No evidence of aspiration at broncoscopy No evidence of sepsis No microbiologic endobronchial organisms No purulent secretions at bronchoscopy No evidence of viral infections i.e. HIV, hepatitis B or hepatitis C No history of cardiopulmonary surgery No active malignancy No history of chronic pulmonary disease

HIV, human immunodeficiency virus; PaO2, partial pressure of oxygen in arterial blood; FiO2, fraction of inspired oxygen; PEEP, positive end expiratory pressure.

1.1.1 Brain death donors

Brain death is defined as an irreversible total loss of brain stem function.5 Depending on the damages to different parts of the brain stem, brain death causes distinctive physiological responses.5, 28 It triggers sympathetic storm, inflammatory responses, metabolic modifications and endocrine changes which cause injuries in the donor organs and result in further complications after transplantation such as ischemia reperfusion (I/R) injury.5, 28, 29 Damages in the brain stem result in serious hemodynamic instability.5, 29, 30 Brain death is associated with transient hypertension and bradycardia, followed by a rapid release of catecholamines which is known as the catecholamine storm. The catecholamine storm can result in: 5, 29, 30

1- Intestinal ischemia which can consequently release cytokines. 2- A shift to anaerobic metabolism and consequently activation of nuclear factor- κB (NF-κB). 3- Flow-induced shear stress of the endothelial cells.

Avlonitis et al. summarized different theories and mechanisms which were described for the pathogenesis of lung injuries after brain death. 5 Central nervous system injuries after brain death lead to α-adrenergic stimulation which causes systemic vasoconstriction and consequently increased systemic vascular resistance, decreased left ventricular output and increased left atrial pressure. Simultaneously, due to systemic vasoconstriction, a large volume of blood moves to the pulmonary circulation and results in acute pulmonary artery hypertension.5 Acute immense alterations in pulmonary capillary pressure lead to damages to the capillary endothelium.5 The structural damages in addition to elevated hydrostatic pressure lead to pulmonary edema.5

After a few minutes, in the next phase, vascular tone, cardiac output and peripheral resistance decrease extremely. These changes result in hypotension and extensive reduction in organ perfusion, predominantly in abdominal organs.5, 28 Anaerobic metabolism as a result of poor oxygenation causes acidosis, increased levels of free fatty acids and subsequently reduction in insulin secretion and hyperglycemia.30 In liver, hepatic sinusoidal perfusion decreases and glycogen depletes.29 Peripheral vasodilatation, drop in metabolic rate, loss of muscular activity, and damages to the hypothalamic temperature control after brain death cause hypothermia.29 The

activation of coagulation pathways, as a result of tissue thromboplastin released by brain necrotic tissue, might lead to disseminated intravascular coagulation (DIC).29 The most susceptible organ to the damaging effects of brain death is the lung.31 The rate of rejection and bronchiolitis obliterans is higher in lungs that were transplanted from donors with traumatic brain injury compared to non traumatic brain injury as a result of neuroimmunologic effects.30 Currently only about 20 % of donor lungs satisfactorily meet criteria for transplantation.16, 22, 32 Neurogenic pulmonary edema (NPE), a common lung injury following brain death, is one of the complications which occurs following intracranial injuries.5, 29 Hydrostatic forces and inflammatory responses make the lungs vulnerable to NPE.5, 29 In lung tissue, high pulmonary capillary pressure may cause direct damages to the endothelial bed.5, 29

These changes could make the lungs susceptible to NPE.5, 29 Although the catecholamine storm leads to changes in the permeability of pulmonary capillaries, the mechanisms involved in NPE are incompletely understood.31 Brain death also leads to remarkable endocrine changes mainly by anterior and posterior pituitary failure and disruption of the hypothalamic pituitary axis.5, 28, 29 In the vast majority of brain stem dead organ donors, early reduction in blood levels of anti- diuretic hormone (ADH) results in diabetes insipidus.28, 29 Cortisol blood levels decrease considerably due to the failure of the anterior lobe of the pituitary gland to secrete adrenocorticotropic hormone (ACTH) after brain death, which plays a role in donor stress response impairment.29 A drop in plasma level of insulin following brain death causes intracellular glucose reduction.5, 28-30 A decline in thyroid stimulating hormone (TSH) blood level after brain death leads to a decrease in free plasma tri-iodothyronine (T3).5, 28, 29 These hemodynamic and hormonal alterations trigger extensive cellular and mitochondrial metabolic dysfunction, initiating anaerobic metabolism and lactic acidosis followed by the production of destructive enzymes and reactive oxygen species (ROS) which can be enhanced by cold ischemia and reperfusion.5, 28, 29

Systemic immunologic responses and inflammation are induced by brain death via several mechanisms (Figure 1-2).5, 31 In animal models, levels of circulating inflammatory mediators such as cytokines increase after brain death.31 In humans, the serum level of interleukin (IL)-6

Figure 1-2: Brain death can induce systemic inflammatory responses by 1- Metabolic and hormonal changes, 2- Catecholamine storm, 3- Neuropeptides, 4- Circulating inflammatory mediators.31

increases sharply after brain death, which is associated with an increase in C-reactive protein (CRP) levels in serum.5, 31 Increased levels of inflammatory mediators in donor organs are correlated with poor outcomes after transplantation.31 For instance, the mRNA expression of IL- 6 and cytokines such as tumor necrosis factor (TNF)-α in donor lungs are known to predict recipient mortality in the first 30 days after lung transplantation.33 The nervous system also releases neuropeptides after brain death, which can induce systemic inflammatory response.31

In addition, the etiology and mechanisms of brain death – such as trauma and cerebrovascular accident (CVA), the management and treatment strategies before and after brain death such as mechanical ventilation, cardiopulmonary resuscitation (CPR) and other concurrent incidents such as aspiration and pneumonia – also may be involved in triggering inflammatory responses.31

Activation of proinflammatory mediators, endothelial cells and platelets in organs after brain death, make them more prone to the recipient’s immune system.29 Therefore, the risk of acute rejection of organs from brain death donors is higher when compared with organ transplantation from living donors.29

1.1.2 Donation after cardiac death

The demand for organ transplantation has increased tremendously.7 Marginal cadaveric donors including obese, elderly, and non-heart beating donors are considered potential sources of organs.3, 34 Lungs harvested from DCD are now accepted as an alternative source for lung transplantation.3 Death in donors after cardiac death is confirmed by using circulatory criteria. In 1995 in Maastricht at the first international workshop on DCD, the Maastricht categories of donations after cardiac death were introduced.10 Currently, the modified Maastricht classification is commonly applied to classify DCD (Table 1-2).11 Uncontrolled DCD, including categories I (dead on arrival), II (unsuccessful resuscitation), and V (unexpected arrest in ICU patient), refers to retrieval of donor organ following an irreversible and unexpected cardiac arrest, whereas controlled DCD categories III (anticipated cardiac arrest) and IV (cardiac arrest in a brain-dead donor) indicate organ retrieval subsequent to planned removal of cardiorespiratory support system.11

Table 1-2: Modified Maastricht classification of DCD.11

Category Description

I, uncontrolled Dead on arrival to hospital

II, uncontrolled Dead after unsuccessful resuscitation

III, controlled Cardiac arrest in whom treatment withdrawal is planned

IV, controlled Cardiac arrest in brain-dead patients

V, uncontrolled Unexpected cardiac arrest of admitted patients in hospital

ICU; intensive care unit.

The warm ischemic period, which is the time between the beginning of asystole and the start of cold perfusion in organs from controlled DCD is longer in brain death donors.3, 11 In uncontrolled DCD warm ischemia can be even longer than controlled DCD at the retrieval time.3, 11 Although lungs which are kept inflated with oxygen seem to be less susceptible to warm ischemia than other organs, a longer ischemic period increases the risks of primary graft failure.3, 11 Nonetheless, organs from DCD are not exposed to inflammatory responses and sympathetic storm after brain death.11 Indeed, the outcomes of lung transplantation in controlled DCD donors are predominantly better than brain death donors.3 Moreover, organs from DCD are not exposed to the cardiopulmonary consequences of inflammatory responses after brain death, so lungs from these donors therefore benefit more from ex vivo lung perfusion techniques.11

1.2 Preservation of harvested lung

1.2.1 Cold static preservation

Cooling down the organ is critical in preservation of organ function as hypothermia inhibits cellular metabolic activity, the aerobic pathways, and enzyme activities.21, 26, 35 Cold static preservation is a main part of lung preservation which results in lower metabolic activity to maintain cell viability during ischemia. Six to 9 hours of cold static preservation is considered optimal for harvested lungs in terms of maintaining post-transplantation pulmonary function such as gas exchange.21 Nevertheless, the gold standard temperature for lung cold static preservation is controversial. Generally lungs are kept at 4°C after retrieval; however, some studies have suggested that lung preservation at 10°C resulted in better pulmonary function compared to lungs stored at 4°C.26, 36, 37 On the other hand, hypothermia leads to cell injury and destructive effects to the plasma membranes, microtubules and mitochondria which can lead to serious physiologic disruptions.36, 37 ATPase activity, which is temperature dependent, decreases following hypothermia.36 The decline in ATPase activity interrupts the cellular ATPase- dependent ion balance, which results in membrane disruption, cellular edema and cell death.36 Low temperature in lung tissue causes an increase in extra vascular fluid, pulmonary vasoconstriction and altered oxygen exchange.26, 36 It has been demonstrated that mechanical properties of the lung including airway resistance and tissue elasticity of lung parenchyma were

altered after 9 hours of cold ischemic preservation in a rat model.38 In addition, it has been shown that the innate immune system is activated after reperfusion in response to preservation injuries, which consequently stimulates the adaptive immune system.26, 39

An improvement of the preservation process would ameliorate the long term outcomes of lung transplantation.26 The chemical composition of preservation solutions plays a crucial role in prevention of lung injuries during preservation.37 In the 1980s, lungs were flushed at 4C with modified Euro-Collins solution and the rates of ischemia reperfusion injury and early mortality were considerable.37, 40 Later on, studies on University of Wisconsin solution also did not demonstrate remarkable clinical benefits.37, 41 The use of low-potassium dextran glucose (LPDG) which is similar to extracellular fluids, considerably improved post-transplantation lung function.42-44 In addition, LPDG also decreases the rate of severe primary graft dysfunction.37 In 1990s Perfadex and Celsior were introduced as LPDG.37

1.2.2 Ex vivo perfusion

Ex vivo organ perfusion was reported in 1935 by Carrel and Lindbergh. They demonstrated that organs, such as kidney and heart, were capable of keeping cell proliferation and function for several days while kept in an ex vivo organ perfusion system.45 These ex vivo organ perfusion settings were used primarily for research in physiology. 45 In 2003 Steen et al. used ex vivo lung perfusion for the evaluation of lung function from DCD.46 Afterwards, ex vivo lung perfusion was used for transplantation of initially rejected lung.16

Generally, an ex vivo artificial perfusion system can provide continuous oxygen and nutrient supply to accomplish the organ’s metabolic requirements and remove the metabolic waste materials and toxins to maintain a physiologic environment.12, 13, 23, 32 It also renders a constant circulation to maintain the micro-circulation.34 Currently, the ex vivo organ perfusion is an alternative method in organ preservation.26, 35 Three methods of ex vivo reperfusion has been described, hypothermic, normothermic and subnormothermic perfusion. In hypothermic perfusion organs are kept at 4 to 10°C. Therefore, organs benefit from a low metabolic rate and lower demand of oxygen and essential nutrients in addition to the benefits of ex vivo organ

perfusion.35 However, the risk of shear stress increases due to the rigidity of the endothelium, high viscosity of the solution at low temperatures, and the swelling of the endothelial cells due to Na/K pump dysfunction.47

In normothermic perfusion the organs were kept at 37ºC. Thus, organs can be protected from both ischemia and hypothermia; subsequently, tissue injuries during the preservation period can be minimized.13, 35 Injury to the grafted organ depends on the duration of the cold ischemia period. Direct effects of cooling are avoided in normothermic perfusion. Theoretically, normothermic systems extend the duration of organ storage without increasing the risk of tissue damage.34, 35 Normothermic techniques can reverse injuries sustained by warm and cold ischemia. It improves the quality and condition of the graft from both brain death donors and DCD.34, 48 Tissue repair can be started in the physiologic environment provided by normothermic perfusion systems.34, 35 Viability parameters can be assessed during the preservation period. In addition, normothermic perfusion systems can decrease the risk of non-functioning grafts.35 Ex vivo normothermic perfusion allows the opportunity for pharmacological interventions, such as delivery of cytoprotective and immunoregulatory agents as well as gene therapy to the specific organ itself without side effects on other organs.13

In subnormothermic perfusion the temperature is kept higher than hypothermic but lower than normothermic perfusion systems (between 20-28C). Mitochondrial functions in subnormal temperature are preserved while the side effects of normothermic reperfusion are avoided. However, more investigation is needed to substantiate this finding.35

Disadvantages of the ex vivo reperfusion include:

1- The endothelium could be injured by the perfusion flow itself.

2- Risk of bacterial contamination in ex vivo perfusion methods especially in normothermic perfusion system is higher than cold static preservation.47

3- The perfusion devices are relatively complicated and unmovable; therefore, the organ must be preserved in cold static preservation to be transported to a transplant center.13

4- Perfusion machines are not user friendly and personnel must be specifically trained.

5- The operation of perfusion devises and their maintenance are relatively expensive.13

1.2.2.1 Ex vivo lung perfusion (EVLP)

Ex vivo lung perfusion (EVLP) is a novel strategy which expands the time of preservation and provides the chance for evaluating lung function.17, 46 Post-transplantation outcomes in recipients of lungs after EVLP are similar to recipients of lungs after standards lung preservation.12 In addition, EVLP could provide the opportunity for recovery of lung tissue and possible medical interventions before transplantation.12, 14, 17, 20 In EVLP lung circulation is re-established by a centrifugal pump while the lung is ventilated by a ventilator (Figure 1-3).14

Modern ex vivo lung perfusion was developed by the Steen group to evaluate lung function from DCD.46 In 2005 Steen et.al. reconditioned an initially rejected lung using EVLP and transplanted a single lung in a human successfully.49 Later, their group reported the first six double lung transplantations using EVLP to recondition donor lungs initially rejected for transplantation.50 Cypel et al. for the first time described a reliable technique for long-term (12 h) ex vivo lung perfusion which resulted in excellent lung function during EVLP and after transplantation.14

Lung oxygenation post-transplantation is improved significantly in lungs that went through EVLP compared to lungs preserved at low temperatures.12, 14, 20, 22 Adenosine triphosphate (ATP) levels in the lung tissue are improved by EVLP resulting in recovery of marginal donor lungs.12, 20 Tissue level of ATP, which represents lung tissue energy level, decreases after warm ischemia. Four hours of EVLP causes a significant increase in ATP level in lung tissue.20 In addition, the rate of lung edema formation following transplantation is lower in lungs which underwent EVLP than after cold static preservation.17, 19 To improve pulmonary edema surgeons can use a perfusate solution with physiologic osmolarity and high oncotic pressure. 19, 23

Figure 1-3: Schematic of ex vivo lung perfusion (EVLP) circuit.14 A centrifugal pump (1) circulates the perfusate to a membrane for gas exchange (2) and a filter (3) for leukocyte removal. The perfusate enters into the lung through the pulmonary artery. It is collected from the left atrial cannula to a reservoir (4). The lungs are kept in a specifically designed lung enclosure (XVIVO, Vitrolife) while ventilated with a standard ICU-type ventilator (5).

In a pig model of lung transplantation PVR in lungs after 10 hours of brain death followed by 24 hours of cold ischemia, at the beginning of EVLP, was significantly higher than in control lungs harvested from living donors followed by one hour of cold ischemia before EVLP.25 However, PVR was decreasing during EVLP and it was measured close to the level of PVR in the control group after 12 hours of EVLP.25 In addition, the analysis of data for pulmonary artery (PA) pressure during EVLP in the same animals demonstrated that PA pressure decreases significantly after 6 hours and 12 hours of EVLP compared to the beginning of EVLP in the “EVLP+IL-10” group (Dr. Keshavjee’s lab, not published).

Lung function during EVLP can be assessed using pulmonary dynamic compliance, flow rate, pulmonary artery pressure, peak inspiratory pressure, resistance of small airways and blood gas.12, 18, 23 Therefore, EVLP potentially provides reliable criteria to predict lung function after transplantation.12, 20, 23 Assessment of biological markers in perfusate, bronchoalveolar lavage fluid or lung tissue can help surgeons reassess the lung carefully in order to avoid transplanting an injured lung which is initially considered transplantable, or discarding a lung which is initially considered non-transplantable.12, 18, 20, 23, 51 Metabolic biomarkers are more sensitive indices than physical parameters for evaluating lung quality and function.52 For example, the concentration of lactate in perfusate increases during EVLP in a pig model.53 Lactate is cleared from the circulation by other organs such as muscles, kidney and liver which are not available in EVLP settings.53 In a pig model of EVLP, Valenza et al. showed that lung function was reduced in lungs with higher utilization of glucose during EVLP. They discussed that metabolic rate and glucose consumption in organs with inflammation is higher than in normal organs, thus the metabolic rate of glucose could be used as a biomarker for evaluating lung quality.54

EVLP renders the opportunity to perform therapeutic interventions to the isolated lung tissue.23 Medications could be administered through the perfusate. For example, it has been shown that the administration of dibutyryl cyclic adenosine monophosphate (db-cAMP) and nitroglycerine to the perfusate improved post-transplant lung function.20 Moreover, medical interventions could be performed through the airways. For instance, it has been demonstrated that inhaled NO or carbon monoxide during EVLP can improve lung function.55, 56

As the cellular metabolisms are maintained in lung tissue during EVLP, isolated therapeutic interventions can be performed before transplantation to the lung tissue to avoid side effects to other organs.16 For instance, pulmonary embolisms can be treated without the risk of bleeding or high dose antibiotics can be provided to the isolated lung without the risk of intoxicating other organs.57, 58 Half-lives of medications that are cleared by the liver and kidneys are prolonged in the EVLP system.16 Moreover, novel therapeutic strategies such as stem cell therapy and gene therapy can also be applied in the isolated lung without life threatening side effects on other organs such as liver or kidney.16

1.3 Primary graft dysfunction (PGD)

PGD is a type of severe acute lung injury (ALI) that develops following allograft lung transplantation.1, 59, 60 Non-cardiogenic pulmonary edema within the first 72 hours following transplantation with no other secondary causes is considered PGD.1 The pathogenesis of PGD is multifactorial. Ischemia-reperfusion is considered the main cause of PGD.1, 60 However, other factors during the transplantation process such as inflammatory events, surgical trauma, and lymphatic disruption may play a role in PGD as well.60 PGD is the most common cause of early death following transplantation.59 In recipients with severe PGD, mortality rates in the first month after lung transplantation are up to eightfold higher compared with patients without PGD.60 Moreover, the risk of chronic allograft rejection and BOS is significantly higher in PGD survivors.60 PGD is diagnosed based on the presence of radiographic opacities in the transplanted lung(s) within 72 hours of transplantation, hypoxemia and absence of secondary etiology such as pneumonia, atelectasis, volume overload, obstruction of pulmonary vein outflow and rejection.59

Diffuse microscopic alveolar damage in PGD results in decreased lung compliance and severely impaired oxygenation.60 Diffuse pulmonary infiltrates can be found in radiographic images, comparable to patients with acute respiratory distress syndrome (ARDS).59 The International Society for Heart and Lung Transplantation (ISHLT) suggested a definition and grading system for PGD in 2005. This grading is based on the ratio of partial pressure of oxygen in arterial blood

(PaO2) over fraction of inspired oxygen (FiO2) and the assessment of chest infiltrates at time points up to 72 hours (Table 1-3).61 It has been shown that the length of stay in intensive care

Table 1-3: Grading schema of primary graft dysfunction according to the International Society for Heart and Lung Transplantation (ISHLT).61

Grade PaO2/FiO2 ratio

0 >300 No evidence for pulmonary edema on chest X-ray

1 >300 Signs of pulmonary edema on chest X-ray

2 200–300 Signs of pulmonary edema on chest X-ray

3 <200 Signs of pulmonary edema on chest X-ray

Time points for assessment: 0, 6, 24, 48, and 72 hours after reperfusion. PaO2; partial pressure of oxygen in arterial blood, FiO2, fraction of inspired oxygen.

units (ICU) and hospitals plus short-term and long-term mortality, were significantly higher in patients with a PaO2/FiO2 ratio <200 within 48 hours after lung transplantation. The long-term survival in PGD grades 1 and 2 was not significantly different.60

1.3.1 Risk factors for PGD

All components of the lung transplant procedure, including donor’s cause of death, changes in donor hemodynamics, hypothermic preservation, surgical procedure and organ reperfusion, play crucial roles in the development of PGD (Table 1-4).60 Early detection of PGD in recipients is important in the management of PGD. Understanding the biochemical factors and genetic markers in donor lung and/or recipient that are associated with PGD can result in better donor- recipient matching, facilitate early diagnosis and reduce risks of PGD, ultimately improving outcomes of transplantation.60

1.3.1.1 Donor risk factor

Risk factors associated with PGD in donor lungs include the donor age, gender and race. The risk of PGD is higher in lungs from donors older than 45 or younger than 21 years, females and 59, 60 African-Americans. In addition, low PaO2/FiO2 ratio, prolonged mechanical ventilation, infection, trauma, smoking history, inflammatory response and hemodynamic instability in donors after brain death are associated with higher incidence of PGD.59, 60 An increase in interleukin-8 level in donor bronchoalveolar lavage (BAL) fluid is also associated with a higher risk of severe PGD.59

1.3.1.2 Recipient risk factors

All studies, with the exception of one, regarding recipient-related risk factors for PGD following lung transplantation were unable to demonstrate a significant correlation between PGD and recipient age, gender, race, body weight, diabetes, hepatic failure, renal failure, left heart disease, or medication use such as steroids.60, 62 In contrast, recipient pulmonary artery hypertension is associated with a significantly higher risk of PGD.60, 63, 64 The risk of PGD is higher in recipients

Table 1-4: Possible risk factors for primary graft dysfunction.65

Category Risk Factor for PGD

Donor’s age >45* or <21

Donor’s race African American

Donor’s gender Female

Donor’s history of smoking >10 pack-years

Donor’s clinical conditions Prolonged mechanical ventilation, aspiration, trauma, hemodynamic instability post–brain death

Recipient’s medical conditions Diagnosis of idiopathic pulmonary arterial hypertension*, elevated pulmonary arterial pressure at time of surgery*, diagnosis of diffuse parenchymal lung disease

Pre and post-transplant conditions Preservation solution and flush technique, prolonged ischemic time*, use of cardiopulmonary

bypass, blood product transfusion

*The most consistently reported risk factors.

with higher mean pulmonary arterial pressures at the time of surgery independent of primary condition.60, 63 Diffuse parenchymal lung disease such as idiopathic pulmonary fibrosis is also associated with higher risk of PGD.60, 62 The risk of PGD in recipients with COPD is the lowest.60

1.3.1.3 Operative risk factors

As described earlier, the rate of severe PGD can be decreased by using LPDG.37 The use of cardiopulmonary bypass (CPB) and blood products during and following lung transplantation is associated with a higher risk of PGD development.60 Blood transfusion can lead to transfusion- related lung injury (TRALI).60, 66 The clinical picture in TRALI and PGD is identical.60 The association between the risk of PGD development and type of transplant procedure (single vs. bilateral) has not been consistently demonstrated.60 Similarly, graft ischemic time has not been shown to be an independent risk factor for PGD.59, 60 However, ischemic time beyond 6 hours can be considered a risk factor for PGD.59

1.3.2 Molecular markers of PGD

A practical cost effective and universally accepted biomarker for the prediction of PGD which can lead to earlier diagnosis has not been discovered. Several studies have investigated potential biomarkers (Table 1-5). So far it has been shown that the ratio of interleukin IL-6/IL-10 expression is the most predictive factor of first month mortality.60

1.3.3 Prevention and management

1.3.3.1 Prevention

To prevent I/R injury and PGD, preservation techniques and components of preservation solutions have been studied previously. The composition of preservation solution has been optimized for longer ischemic times and better post-transplant lung function. Inhaled nitric oxide (NO) is a selective and effective pulmonary vasodilator.67, 68 Although NO improves gas

Table 1-5: Biomarkers which have been studied for prediction of primary graft dysfunction.60

Biomarker

Chemokines MCP-1, CCL2 IP-10, CXC10, IFN-γ

Anti-inflammatory cytokines IL-13, IL-10

Proinflammatory cytokines IL-2R, TNF-α, IL-8, IL-6

Others VEGF, sRAGE, protein C, type I plasminogen activator inhibitor, plasma intercellular adhesion molecule-1, vWF

IL, interleukin; IP-10, interferon -inducible protein 10; CXC10, chemokines CXC motif ligand 10; MCP-1, monocyte chemotacticprotein-1; CCL2, chemokine CC motif ligand 2, sRAGE, soluble receptor for advanced glycation end-products; TNF-α, tumor necrosis factor-alpha; VEGF, vascular endothelial growth factor; vWF, von Willebrand factor.

exchange in patients with established PGD it is not considered an effective prophylactic agent.65, 69 The administration of NO at the onset or 10 minutes after reperfusion does not significantly affect the incidence of PGD.65, 69 Other therapeutic interventions are also examined for PGD prevention, for example, using the soluble complement receptor-1 inhibitor (sCR1) results in earlier extubation after lung transplantation, shorter mechanical ventilation time and ICU stay.65, 70 65, 70 Nonetheless, PaO2/FiO2 ratio was not improved significantly by sCR1. In human lung transplantation, the administration of platelet-activating factor antagonist during flushing of the lung and after reperfusion temporarily improves oxygenation scores and radiographic findings up to12 hours.71 Many other investigations for the prevention of PGD are being performed in animal models with new agents and innovative techniques.60, 65

1.3.3.2 Treatment

Treatment of severe PGD is supportive aiming to prevent barotrauma by using low-stretch ventilation and restriction of fluid, similar to the management of patients with ARDS.59, 65 Severely ill patients can be effectively stabilized by inhaled NO and extracorporeal life support in some situations.59 The effect of inhaled NO is controversial.72, 73 In some studies, administration of inhaled NO improved the clinical picture of PGD72, 74 whereas other studies showed patients with PGD did not benefit from inhaled NO.69, 72, 73 Generally, inhaled NO is recommended in the management of PGD while its use is possibly reasonable in selected cases of severe hypoxemia and/or pulmonary hypertension.65, 72, 73 However, the effect of inhaled NO is transient.65, 75

Alveolar collapse following ischemia and reperfusion has been reported as a result of pulmonary surfactant dysfunction.65, 75 It leads to ventilation-perfusion mismatch and decreased oxygenation which can contribute to PGD.65, 75 Administration of exogenous surfactant in animal model of PGD improved pulmonary compliance and oxygenation.65, 73, 76-78 In humans, exogenous surfactant administration via bronchoscopy in patients with severe ischemia reperfusion injury resulted in resolution of radiological infiltrates within 24 hours and improvement of survival within 19 months.79 These strategies among other methods such as extracorporeal membrane

oxygenation (ECMO) and administration of N-acetylcysteine must be investigated for more extensive use.65

1.4 Ischemia reperfusion injury

I/R related injuries can lead to acute and chronic graft dysfunction.80 I/R injury is a common cause of morbidity and mortality after solid organ transplantation and occurs in up to 15% of cases after lung transplantation.81 It has also been identified as a risk factor for bronchiolitis obliterans.80, 82 In lung transplantation, I/R injury is characterized by nonspecific alveolar, epithelial and endothelial cell dysfunction that occurs within 72 hours after transplantation leading to ventilation-perfusion mismatch, lung edema and hypoxemia.72, 83 The mechanisms that lead to I/R injury are incompletely understood, however I/R injury results in decreased tissue perfusion due to an increase in vascular smooth muscle tone and vascular resistance.80

I/R injury in the lung occurs in two phases, an early and a late (delayed) phase.72, 84 In the early phase, activation of donor alveolar macrophages (AM) have been described as a significant contributor.72, 85, 86 The production of proinflammatory cytokines in the early phase of I/R injury mainly by macrophages leads to subsequent activation of neutrophils and induction of the late phase of I/R injury.72

In some cases the administration of inhaled NO, as an effective and selective pulmonary vasodilator, is an essential treatment strategy in reperfusion and management of postoperative graft dysfunction following heart or lung transplantation.67, 69, 87 In experimental rat lung transplantation, I/R injury is associated with increased inducible nitric oxide synthase (iNOS) expression and activity, while the activity of constitutive NOS was found to be decreased.88

1.5 Inter interleukin-10 in lung transplantation

IL-10 can be expressed and produced by different cells in both the innate immune system, such as macrophages, and the adaptive immune systems, such as T helper-1cells.89 The effects of IL- 10 are mostly studied in animal models of infectious diseases. In all infectious models regardless of the source of IL-10, it inhibits the function of macrophage and dendritic cells (DC).

Subsequently, it suppresses the response of T helper-1 and T helper-2 cells.90 IL-10 is an important regulator of inflammatory responses.91 Recently, it has been shown that human IL-10 gene therapy reduced inflammation in injured human donor lung.16

In the setting of ischemia reperfusion injury, proinflammatory cytokines, such as IL-8 and IL-6, and anti-inflammatory cytokines, such as IL-10, play significant roles in induction and/or prevention of I/R injury.33, 92 Pro-inflammatory factors are considered risk factors for post- transplantation mortality. 33 On the other hand, IL-10 is known as a protective factor.33 In donor lung tissue, the ratio of IL-6/IL-10 before transplantation is recognized as an index for post- transplantation mortality in recipients.33 In addition, when the level of IL-8 in the donor lung is higher, the early lung function following lung transplantation is lower and recipient mortality rate is increased.92 In the early phase of I/R injury, IL-10 is a strong inhibitor of production of proinflammatory cytokines.92 IL-10 inhibits synthesis of pro-inflammatory cytokines such as TNF-α by macrophages.93 It has also been shown that the administration of IL-10 in rat lung transplantation reduced lung ischemia-reperfusion injury whereas anti IL-10 intensified lung injury.93

Adenoviral IL-10 gene therapy is considered a novel strategy for reducing inflammation in lung tissue before transplantation.15, 94 Gene therapy could abbreviate the process of recovery in injured donor organs and reduce inflammation before transplantation.94 In a rat model, it has been shown that in vivo human IL-10 gene therapy in donor lungs improved lung function.95 In addition, in injured human lungs it has been demonstrated that ex vivo administration of human IL-10 gene followed by 12 hour EVLP noticeably improved lung function.15 Human IL-10 gene therapy in donor lungs leads to less inflammation, helps repair cytoskeletal structure and enhances lung function. Subsequently, this approach could result in using organs which would otherwise not be considered suitable for transplantation according to current criteria.15

Effective therapeutic levels of gene expression for reperfusion time were attained 6 to 12 hours after the delivery of gene vector to the airways when the lungs were harvested from donors.96 In humans in vivo gene therapy cannot be applied routinely due to important limiting factors such as the inflammatory responses to the adenoviral vector and the side effects on other organs of the

donor.94 During cold static preservation ex vivo adenoviral gene therapy caused low level of gene expression at the time of perfusion and after transplantation, which could be caused by hypothermia.97 Normal temperature and preserved metabolic activity in addition to acellular perfusion in isolated lung during EVLP provide the opportunity for effective gene expression, limited inflammatory responses to the vector and better lung function before and after reperfusion.15, 24 Fascinatingly, the acellular perfusate in EVLP flushes out the inflammatory cells from the lung, thus immune responses to viral vector in EVLP are limited because of the lack of neutrophils and inflammatory cells.16

1.6 The L-arginine/NO metabolism

In animal cells L-arginine (2-amino-5-guanidinovaleric acid) is a precursor for the production of NO, L-citrulline, L-ornithine, urea, creatine, agmatine, polyamines, proline, glutamate, and proteins. In healthy adult humans L-arginine is a non-essential amino acid.98 However; it is considered essential during certain physiological conditions such as development and pregnancy or pathological conditions such as sepsis or trauma.98

1.6.1 L-arginine synthesis

The supplies for plasma L-arginine are diet (exogenous), whole-body protein turnover and synthesis from L-citrulline (endogenous).98, 99 Endogenous L-arginine synthesis changes according to the developmental phase, nutritional condition and species.98 In adult humans 5 to 15% of L-arginine flux derives from de novo synthesis.98, 100 The intestinal-renal axis is responsible for the main part of endogenous arginine synthesis.98, 100 Enterocytes convert glutamine, glutamate and proline to L-citrulline or L-arginine.98-100 L-citrulline released by the small intestine into the blood stream is predominantly absorbed and converted to L-arginine in the proximal convoluted tubules of the kidney.98, 99 In addition, the liver and NO-producing cells such as macrophages are able to produce L-arginine.98, 99

1.6.2 L-arginine transport

L-arginine, in mammalian cells, is transported into the cell by specific transmembrane transporters, cationic amino acid transporters (CAT) such as systems y+, bo,+, Bo,+ or y+L.98, 99 Cationic amino acids, lysine, ornithine and canavanine and positively charged analogues such as certain nitric oxide synthase (NOS) inhibitors can competitively inhibit L-arginine transport.98, 99 In the majority of cell types, system y+ is the most essential transporter mechanism for L-lysine, L-ornithine and L-arginine uptake.98 L-arginine transport systems regulates substrate availability for L-arginine-catabolising enzymes.98 The ratio of L-arginine over L-ornithine and L-arginine over L-ornithine + L-lysine can be used as indicators for intracellular bioavailability of L- arginine for NOS at a given L-arginine concentration.98

Different cell types express different transporters which can be activated and regulated by specific stimuli, such as inflammatory cytokines and bacterial endotoxin.98 The CATs including CAT-1, -2A, -2B, -3 and -4 are part of the family of solute carriers 7 (SLC7).99, 101 At physiological pH all CATs (except CAT-4) are selective, Na+-independent transporters.101 CAT- 1 is expressed in all tissues except liver.99, 101 In the liver CAT-2A is mainly expressed, CAT-3 is expressed during embryonic development in large quantities and in adults it is limited to brain tissue.99, 101 Pro-inflammatory mediators such as lipopolysaccharide (LPS) and interferon-γ (IFN- γ), which induce iNOS, up-regulate L-arginine uptake which is linked with CAT-2B up- regulation.99, 101

1.6.3 L-arginine catabolism

The L-arginine metabolome (Figure 1-4) refers to the complete set of enzymes, metabolites and inhibitors involved in the L-arginine/NO metabolism.102 L-arginine can be catabolised through various pathways. In the same cell different L-arginine catabolising enzymes, for example, iNOS and arginase can be co-expressed, which causes complicated interactions by which the activity of one enzyme may be inhibited by the product of another.98 NOSs and arginases compete for the same substrate, L-arginine.98, 99 Inhibition of arginase can cause increased NO and L-citrulline production from NOS.103

Figure 1-4: Balance of the L-arginine/NO metabolism by NOS and arginase.99 ARG, arginase (EC 3.5.3.1); OTC, ornithine carbamoyltransferase (EC 2.1.3.3); ODC, ornithine decarboxylase (EC 4.1.1.17); ADC, arginine decarboxylase (EC 4.1.1.19); NOS, nitric oxide synthase (EC 1.14.13.39); OAT, ornithine aminotransferase 2.6.1.13); OTC, Ornithine transcarbamoylase (EC2.1.3.3); ASS: argininosuccinate synthetase (EC 6.3.4.5), ASL: argininosuccinate Lyase (EC 4.3.2.1), DDAH, dimethylarginine dimethylaminohydrolase; ADMA, asymmetric dimethylarginine; NO, nitric oxide; PRMT, Protein arginine methyltransferases.

The enzyme expression in different cells varies extensively. However, in almost any cell type iNOS is expressed in response to an appropriate stimulus.98

1.6.4 Arginase

Arginase catabolizes L-arginine to L-ornithine and urea.98 In mammalian cells two isoforms of the enzyme exist.98, 99 These two isoenzymes are coded by different genes.98, 99 Arginase 1 is a cytosolic enzyme which is primarily expressed in liver.98 Arginase 2 is a mitochondrial enzyme and is mainly expressed in the kidney.98, 99 However, both isoforms of arginases are expressed in liver and other tissues including the lung.98, 99, 104 L-ornithine is a precursor for the production of polyamines and collagen, both of which contribute to chronic tissue repair and remodelling.105-107

1.6.5 Nitric oxide synthase

Nitric oxide synthase (NOS) catabolises L-arginine to L-citrulline and NO.98, 99 Three genes encode the different NOS isoenzymes.98 In the absence of inflammation NO is primarily produced by the constitutive NOS (cNOS) isoenzymes, neuronal NOS (nNOS, NOS1) and endothelial NOS (eNOS, NOS3).98, 108 In response to bacterial endotoxin and inflammatory cytokines, inducible NOS (iNOS, NOS2) produces NO. iNOS is essential in acute and chronic inflammatory responses.98, 108, 109 The activity of cNOS is regulated by Ca2+/calmodulin, however iNOS activity is not calcium-dependent.98

1.6.6 Nitric oxide

NOS isoforms produce NO from L-arginine in the presence of oxygen (O2), nicotinamide adenine dinucleotide phosphate (NADPH), tetrahydrobiopterin (BH4), flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN) and heme.98, 99, 110, 111 NO production can be regulated at the pre-transcriptional, transcriptional and post-transcriptional level.111, 112 NO plays important roles in various physiological processes such as relaxation of smooth muscle, inhibition of platelet aggregation, regulation of immune response and neurotransmission (Figure 1-5).73, 98, 99, 104, 113-117 NO is synthesized intracellularly.98 Alterations in the L-arginine/NO metabolism have been shown in either acute or chronic pathological states in the lung.104, 113, 115,

118-123 The fraction of NO in exhaled air (FeNO) is a non-invasive indicator of airway inflammation.124-126 FeNO decreases in airways in pathologic conditions such as COPD and cystic fibrosis.124, 125

The L-arginine/NO metabolism is important in innate and acquired immunity and inflammation.109 Most interestingly, the balance between NOS and arginase expression is crucial in polarization and function of alveolar macrophages with iNOS being expressed by M1 and arginase by M2 subtypes.127 Macrophages are able to convert their phenotype in response to environmental stimuli, proinflammatory cytokines such as IL-8 and anti-inflammatory cytokines such as IL-10. NO produced by macrophages and neutrophils plays a critical role in pathological situations including I/R injury.127

1.6.7 L-arginine bioavailability

Availability of L-arginine and cofactors play a critical role in post-transcriptional regulation of NO production by NOS.109 The substrate for NOS, L-arginine, is also the substrate for arginase.128 Pulmonary vascular resistance (PVR) can be decreased by L-arginine as a vasodilator agent in the pulmonary circulation.129-131 The limitation of L-arginine availability for NOS by increased arginase activity has recently been shown to represent an important posttranscriptional mechanism for the regulation of NOS activity in different cardio-vascular and lung conditions.88, 105, 132-134

The ratio of L-arginine/L-ornithine (arginase substrate/product) is considered an indirect index of arginase activity and consequently L-arginine bioavailability for NOS.115 The ratio of L-arginine/ (L-ornithine+L-lysine) is considered an index for intracellular L-arginine bioavailability for NOS as these amino acids compete for CAT for intracellular uptake.98, 99 The ratio of L-arginine/ (L- ornithine+L-citrulline) is defined as global L-arginine bioavailability and is considered an indirect index for arginase activity and consequently L-arginine bioavailability.115 Recently, many studies have demonstrated the correlation of global arginine bioavailability and prognosis of cardiovascular events.115, 135, 136 All above ratios was calculated in serum at a given concentration of L-arginine.

The role of L-arginine bioavailability for NO production has been shown in several studies and in different diseases. For example, in asthma and cystic fibrosis substrate availability for NO production was decreased. It also has been demonstrated that increased arginase activity led to decreased NO.119, 122

Decrease in L-arginine availability results in iNOS uncoupling. Uncoupling of iNOS leads to the production of reactive oxygen species including superoxide.99 The reaction between NO and superoxide anion generates peroxynitrite which plays an important role in airway inflammation and hyperresponsiveness.137 In addition to substrate availability, the activity of NOS is also dependent on endogenous inhibitors such as asymmetric dimethylarginine (ADMA).138, 139 Increased ADMA in lung contributes to smooth muscle constriction and airway obstruction in patients with cystic fibrosis and in asthma.140, 141

The ratio of products of competing enzymes –L-ornithine/L-citrulline – can be used as an index of the balance between arginase and NOS the L-arginine metabolizing enzymes. A change in this ratio is a sign of a change in NOS activity (Table 1‎ -1).121

1.6.8 Asymmetric dimethylarginine

Protein arginine residues are methylated by protein arginine methyltransferases (PRMT), a family of 9 enzymes.142 These enzymes in mammalian cells are classified depending on their specific activity into type I, II, III and IV. In the first step, types I and II produce mono- methylarginine (MMA) from L-arginine. In the next step, type I PRMTs (PRMT1, 3, 4, 6 and 8) produces ADMA, whereas types II PRMTs (PRMT5, PRMT7) produce symmetric dimethylarginine (SDMA). 142 Free MMA, SDMA, or ADMA are released from cells following proteolytic degradation of methylated intracellular proteins.123, 142 They can be cleared from the body through kidney and liver.123, 142

Table 1‎ -6: Indicators of L-arginine/NO metabolism

L-arginine/L-ornithine L-arginine bioavailability (Indirect index of arginase activity

L-arginine/(L-ornithine+L-lysine) L-arginine bioavailability (Amino acids compete for CAT)

L-arginine/(L-ornithine+L-citrulline) L-arginine bioavailability (Indirect index for arginase activity)

L-ornithine/L-citrulline Arginase- NOS balance (Index of the balance between arginase and NOS)

L-arginine/ADMA NOS impairment (Index for NOS inhibition)

CAT, cationic amino acid transporter; NOS, nitric oxide synthase; ADMA, Asymmetric dimethylarginine

Figure 1-5: Biological effects of nitric oxide.116 NO plays essential roles in several physiological responses.

Furthermore, dimethylarginine dimethylaminohydrolases (DDAH) 1 and 2 metabolize MMA and ADMA to L-citrulline and mono- or di- methylamines.123, 142 DDAH is predominantly expressed in the liver, but it is also expressed in the kidney, endothelial cells, the pancreas and the lung.123 ADMA is removed to some extent through urinary excretion.123 Cells can uptake ADMA via the cationic amino acid (y+) transporters.123 ADMA is a competitive inhibitor of all isoforms of NOS and is an endogenous regulator of the L-arginine/NO metabolism in vivo.143 NOS activity depends on the ratio of L-arginine over ADMA concentrations.144 This ratio is considered a better index for NOS inhibition than ADMA concentration alone (Table 1‎ -6).144 An increase in ADMA concentration in normal L-arginine concentration results in decreased NO production.118 However, increase in L-arginine levels can compensate the inhibitory effect of ADMA.118 The correlation of increased ADMA concentration and cardiovascular diseases has been demonstrated previously.145 In patients with chronic heart failure with elevated ADMA concentrations, the administration of L-arginine resulted in improved endothelium-dependent vasodilatation.118 In healthy participants, however, endothelium-dependent vasodilatation is not altered by L-arginine supplementation.118

Changes in ADMA concentration are associated with the pathogenesis of many clinical disorders including pulmonary hypertension, cystic fibrosis and asthma.140, 141, 146 The important role of the L-arginine bioavailability and the presence of endogenous NOS inhibitor ADMA for NO production and airways obstruction in patients with CF and asthma have just recently established.140, 141 However, the role of the L-arginine/NO metabolism has not been reported in the setting of lung transplantation.

1.7 Rationale

The role of changes in the L-arginine/NO metabolism including increased arginase expression and activity, changes in L-arginine availability for NOS, decrease in NO production and release of reactive oxygen species has been demonstrated in primary graft dysfunction for liver, kidney and heart.147-149 However, changes in the arginine metabolism following transplantation of the lung have not been characterized extensively so far. Moreover, qualities of potential donor lungs are assessed subjectively by experienced surgeons using criteria including clinical history, the

external appearance, bronchoscopic finding and gas exchange.8, 9 Clinical assessments of donor lungs prior to transplantation might not provide sufficient information for the prediction of short term and long term complications after transplantation. For instance, in a pig model of injured lung for transplantation, it has been demonstrated that ex vivo PO2 by itself cannot be considered a first indicator of lung injury.25 Additional biomarkers could potentially help the evaluation of donor lungs and predict outcomes of transplantation.

The roles of NO in many physiological processes such as regulation of smooth muscle tone and regulation of immune response have been described previously.73, 98, 99, 104, 113-117 Noticeable vasodilatation is induced as a result of smooth muscle relaxation due to the effect of NO.112, 150 Inhaled NO suppresses pulmonary hypertension after lung reperfusion following ischemia without disturbing systemic arterial pressure, and is used to manage pulmonary hypertension following transplantation.72

Clinically, I/R injury leads to acute increased smooth muscle contractility with subsequent reduction in organ perfusion, ventilation perfusion (V/Q) mismatch in the lungs, and chronic tissue damages such as fibrosis and remodelling of the transplanted organ.72 Pre-treatment with low doses of inhaled NO prior to harvesting of lungs decreases the rate of early lung allograft reperfusion injury.151 Additionally, administration of low doses NO prior to the harvesting of the lung results in lower IL-8 levels and consequently lower risk of I/R injury.151

The effects of cold ischemia and reperfusion on the L-arginine/NO metabolism have been shown in some studies in lung transplantation.73 NO production decreases in lung allograft for the duration of the perioperative period.152 In a pig model of lung transplantation, administration of L-arginine in the first 10 minutes of reperfusion resulted in improvement of pulmonary function.153 These findings suggested that the L-arginine/NO metabolism was altered in the lung after reperfusion. Decreased NO production due to increased arginase expression and activity in I/R injury following warm ischemia in coronary artery obstruction has been already demonstrated in a pig model. Interestingly, in this setting vasodilatation was restored by either arginase inhibitor or L-arginine supplementation.154 The concentrations of L-arginine,

endogenous NOS inhibitors and L-arginine in the lung during different steps of transplantation have not been investigated yet.

IL-10 gene therapy during EVLP is an innovative approach to reduce inflammation in donor lung. IL-10 gene therapy decreases the rate of primary graft dysfunction and results in improvement of lung function but the mechanisms leading to these improvements are incompletely understood.155 We are interested in investigation of L-arginine/NO metabolism in donor lungs after IL-10 gene therapy because NO production and iNOS expression can be suppressed by IL-10 in macrophages.51, 156-158 IL-10 also reduces transcription of CAT 2, a transporter for L-arginine, and leads to decreased L-arginine bioavailability for intracellular NOS in murine activated macrophages.51 Therefore, it is possible that some of the effects of IL-10 gene therapy could be related to an effect on the L-arginine/NO metabolism51, 155 but, the alterations in the L-arginine/NO metabolism following lung transplantation and the effect of IL- 10 gene therapy on the L-arginine/NO metabolism have not been published yet.

1.8 Hypothesis

We hypothesize that lung transplantation results in dysregulation of the L-arginine/NO metabolism and a reduction in L-arginine availability which leads to a decrease in NO production. Some of the beneficial effects of IL-10 will be mediated through the L-arginine/NO metabolism. IL-10 gene therapy will prevent these alteration and results in better lung function.

1.9 Specific aims

1.9.1 Specific aim 1

The first specific aim for this project is to characterize alterations in the L-arginine/NO metabolism at different steps of lung transplantation. Therefore, we analyzed data from a model of pig lung transplantation using lung samples after different lengths of hypothermic preservation, after brain death followed by cold ischemia and after transplantation of these lungs. This study design allowed us to investigate the concentrations of L-arginine and its metabolites

at different time points to understand whether different stages in lung transplantation caused an alteration of the L-arginine/NO metabolism.

1.9.2 Specific aim 2

The second specific aim for this thesis is to study the effects of EVLP and of IL-10 gene therapy during EVLP on the L-arginine/NO metabolism in lung tissue at the steps between harvesting and lung transplantation. To achieve this specific aim, we processed samples from another model of lung transplantation in pigs. In this model we collected samples at different time points before and after transplantation from pig lungs which underwent prolonged hypothermic preservation, EVLP or IL-10 gene therapy during EVLP, and transplantation.

Chapter 2: Materials and Methods

2.1 Lung transplantation

Pig Lung tissue from different studies was generously provided by Dr. Keshavjee’s lab, Latner Thoracic Surgery Research Laboratories, University Health Network, Toronto General Hospital (TGH).

2.1.1 Animals

Male Yorkshire domestic pigs (25 to 35 kg) were used for the experiments. All animals were treated humanely based on the “Principles of Laboratory Animal Care” prepared by the National Society for Medical Research and the “Guide for the Care of Laboratory Animals” by the National Institutes of Health. The experimental protocol had been approved by the Animal Care Committee of the Toronto General Hospital Research Institute.24, 25

2.1.2 Anesthesia

Ketamine (40 mg/kg intramuscularly) was used for sedation followed by inhaled Isoflurane 5% volume/volume (v/v) for induction of anesthesia. Propofol (5–8 mg/kg/hour) and fentanyl citrate (2–20 mg/kg/hour) were infused intravenously to maintain anesthesia during surgery. Pigs were intubated with an appropriate endotracheal tube and ventilated using a volume-controlled ventilator.24, 159

2.1.3 Brain death

Brain death induction in pigs was performed as previously described in the baboon by Novitzky et al.160 In brief, temporal bone was drilled after anesthesia and a Foley catheter was place in the extradural space. The Foley catheter was inflated slowly while the intracranial pressure (ICP) was monitored. The goal was to keep the ICP at least 50 mmHg higher than mean arterial pressure.160 The criteria for confirmation of brain death include:

1- Absence of cerebral blood flow, which was confirmed by cerebral angiography.

2- Absence of motor exam.

3- Absence of brainstem reflexes.

4- Negative atropine stimulation test. The atropine stimulation test is considered negative when the increase in heart rate is less than 3% in response to intravenous injection of atropine.161

2.1.4 Lung retrieval

Lungs retrieval process from donor animals was described previously by Pierre et al.162 Harvested lungs were flushed through the pulmonary artery using Perfadex (low-potassium dextran glucose preservation solution) while the lungs were ventilated. Then lungs were inflated and the trachea was clamped and cut. At the end of retrieval, removed lungs were flushed retrogradely with Perfadex.162 In the non brain death group, double lung block retrieval was performed after anesthesia of living pigs. In the brain death group, lungs were harvested 10 hours after brain death. After sedation and intubation, animals were ventilated by a volume-controlled ventilator. The lungs were kept at 4 C for various periods of time depending on study design. Following cold ischemia the lungs went through normothermic ex vivo lung perfusion for 12 hours and then the left lung was transplanted to the recipient animal.

2.1.5 Ex vivo lung perfusion

Normothermic acellular ex vivo lung perfusion (EVLP) in an isolated circuit was performed as described by Steen and others.14, 46 In brief, the trachea was intubated and cannulae were attached to the left atrium (LA) and the pulmonary artery (PA).15 A retrograde flow with an acellular perfusate (Steen solution, Vitrolife) containing heparin 10,000 U, Solu-Medrol 500 mg, and Cefazolin 1g (Table 2‎ -1) was started slowly to eliminate air from the circuit.15, 24 Then the PA cannula was connected to the system and anterograde flow initiated at 150 ml/min at room temperature.14 The perfusate temperature was increased slowly to 37°C.14, 15 Mechanical ventilation was started when temperature reached 32°C to 34°C (usually within 30 min) at a rate of 7 breaths/minute, and the flow rate of the perfusate was increased gradually.15, 24 Meanwhile, carbon dioxide was added to the inflow perfusate using a gas exchange membrane.14

Table 2‎ -1: Composition* of STEEN solution™ 163 Water Human serum albumin Dextran 40 Glucose Sodium chloride Potassium chloride Sodium dihydrogen phosphate Sodium bicarbonate Calcium chloride Magnesium chloride

* Concentrations are not available as STEEN solution™ is a trade mark product.

The lung block temperature was reduced in the circuit to 20°C following the last ex vivo 14 assessment. Subsequently, FiO2 was increased to 0.5 for lung storage before perfusion and ventilation were stopped.14 In order to keep the lungs inflated, the trachea was clamped.14 Then the lungs were stored in Perfadex in a standard sterile organ bag at 4°C until transplantation.14

2.1.6 Ex vivo viral delivery

One hour after establishing EVLP one group of pigs was treated with an adenovector to deliver the human IL-10 gene.159 The diluted adenoviral vector was delivered through a flexible fiber- optic bronchoscope into each segmental bronchus at the beginning of EVLP as previously described by Cypel et.al. In brief, following vector delivery, an inspiratory hold was performed (recruitment maneuver), and then for the next 15 min lungs were ventilated with a tidal volume of 6-8 ml/kg to facilitate distribution of the vehicle throughout the lung. All donor lungs were transplanted after 12 hours of EVLP.14, 15, 24

2.1.7 Ex vivo evaluation of lung function during EVLP

To evaluate lung function during EVLP, PO2 of the perfusate was measured in the left atrium and pulmonary artery every hour following a recruitment maneuver. In addition, pulmonary vascular resistance, pulmonary artery flow, peak airway pressure, and airway plateau pressure were monitored simultaneously.14

2.1.8 Evaluation of lung function after transplantation

Blood gas was measured in left pulmonary vein blood samples in order to analyze gas-exchange one hour after transplantation.14

2.2 Biopsies

Lung biopsies were taken from the superficial tissue at the lower lobe of the right lung at time points before transplantation and from the lower lobe of the left lung after transplantation. The samples were immediately snap frozen and kept at – 80ºC for further processing.

2.3 Homogenization

Tissue samples were homogenized with lysis buffer for the measurement of in vitro arginase activity, Western blotting, quantitative polymerase chain reaction (q-PCR) and measurement of NO metabolites. Frozen tissue samples were kept on ice and the lysis buffer containing 25 mM tris-HCl (pH=7.4), 10% (v/v) glycerol and 1% (v/v) Triton X100, 1 mM phenylmethylsulfonyl fluoride (PMSF) (Calbochem, LaJolla, CA, USA), 2 mM ethylenediaminetetraacetate (EDTA), 2 μg/ml pepstatin A, 2 μg/ml leupeptin and 1mM dithiothreitol (DTT) were added approximately 1:5 weight/volume (w/v). Samples were chopped the using a pair of scissors and homogenised in 2 ml microtubes with a hand held rotor stator (Polytron PT 1200 E, Kinematica AG, Switzerland) for 30 sec homogenization and 10 sec pause followed by another 30 sec homogenization. The homogenates were kept on ice for one hour and vortexed every 10 min. Tubes were centrifuged for 20 min at 14500 × g at 4C. The supernatant was aliquotted into 1.5 ml micro tubes and stored in -80C.

2.4 Protein assay

Protein content of the extracts was determined using the Bradford protein assay.164, 165 We prepared the standards in acrylic cuvettes using bovine serum albumin (BSA) according to Table 2-2. Samples were diluted with water to fit into the standard curve range, and then 4 μl of diluted sample plus 796 μl milli Q water and 200 μl of Bradford dye reagent were pipetted to the cuvettes. All samples and standards were prepared in duplicate. The cuvettes were incubated at room temperature for 5 min and the light absorption was measured by spectrophotometer at 595nm. The spectrophotometer deducted the blank value of absorbance automatically. The standard curve was plotted using Microsoft Excel program according to the absorbance values of BSA concentration. Protein concentrations in the samples were calculated according to the equation of the standard curve and dilution factor.164, 165

Table 2-2: Volume and concentration of standard solution for protein estimation.

BSA (0.05 mg/ml) μl H2O μl Final protein content μg*

0 800 Blank 50 750 2.5 100 700 5 200 600 10 300 500 15 400 400 20

* BSA, Bovine serum albumin. 200l Bradford dye reagent were added to all standards.

2.5 Sample preparation for liquid chromatography mass spectrometry

Samples were deproteinized, butylated, and reconstituted for liquid chromatography-tandem mass spectrometry (LC/MS/MS) for the measurement of amino acids and ADMA according to the method developed previously in Dr. Grasemann’s lab in conjunction with Dr. Pencharz’s lab. In brief, in order to deproteinize the samples, 30- 50 μl of tissue homogenate was mixed with 2 volumes of methanol and vortexed. The mixture was centrifuged for 20 min at 14,500 RPM at 4C. The supernatant was collected and 10 μl of internal standard mixture of all analytes, labelled with stabilized isotopes, was used to spike samples and standards to identify the peaks of analytes and calculate the ratio of the unlabelled and labelled peak. The mixture was evaporated to dryness under nitrogen stream. 100 μl of 3 M hydrochloric acid in butanol was added and topped with nitrogen gas. The mixture was incubated at 65C for 20 minutes followed by

evaporating to dryness under nitrogen gas stream. The dried contents were reconstituted with 0.1% (v/v) formic acid and submitted for LC/MS/MS. The concentrations were calculated according to the equation of the calibration curves, made from standards butylated in parallel with the samples, and dilution factor. Standard curve concentrations for ADMA were 0.01 μM to 10 μM whereas, for L-arginine, L-ornithine and L-citrulline the standard concentrations were 0.1 μM to 100 mΜ.140

2.6 LC/MS/MS

The concentrations of L-arginine, L-ornithine, and ADMA in lung tissue homogenates were measured using LC/MS/MS provided by the Analytical Facility for Bioactive Molecules of The Centre for the Study of Complex Childhood Diseases at The Hospital for Sick Children, Toronto, Canada. The results were normalized based on the protein concentration of the homogenates.

2.7 NO metabolite measurement

¯ ¯ Nitric oxide metabolites (NOx) were measured, including nitrates (NO3 ), nitrites (NO2 ) and S- nitrosothiols (SNOs) using chemiluminescence analyzer (Eco Physics, Switzerland) as 166, 167 previously reported. The NO analyzer generates ozone (O3) in its reaction cell. NO reacts

with O3 to form O2 and nitrogen dioxide (NO2). A portion of NO2 is produced in an electrically excited state with unstable electrons. These electrons release energy when they return to their original ground state and emit photons which can be converted into measurable electrical signals. The method is highly sensitive and specific for NO and can detect NO in a range of 0-5,000 ppb and detection level is 0.06 ppb. 168 NO and its oxidation products can be measured with the NO analyzer using the liquid purge vessel system. Chemical reducing agents in the vessel convert products of NO including nitrate/ nitrite/ nitrosothiols to NO. Vanadium (V) (III) chloride (0.05 M in 1N hydrochloric acid is used to convert nitrate, nitrite and S-nitrosothiol compounds to NO ¯ 3+ + + 169 (2 NO3 + 3 V + 2 H2O  2 NO + 3 VO2 + 4 H ). Five mM sodium nitrate was serially diluted to prepare standard solutions. 100 μl stock nitrate was added to 900 μl milli Q water to make 500μM nitrate, next 100 μl of 500 mM was added to 400 μl to make 100 μM (Tube S1) and then serially diluted using μl milli Q water (S2-S9). (Standard concentrations = 100 (S1), 50 (S2), 25 (S3), 12.5 (S4), 6.25 (S5), 3.125 (S6), 1.5625 (S7).

All samples were deproteinated using Amicon Ultracel-0.5 10K centrifugal filters (Millipore catalogue # UFC501096) and centrifuged at 14,500 × g for 15 min. Twenty five μl of samples were injected in the liquid purge vessel system of the NO analyzer, then Δt and mean were measured and area under the curve (AUC) for each samples were calculated. Subsequently, based on the standard curve, the concentration for NOx concentration was calculated. Limit of

blank (mean blank + 1.645(SD blank) for AUC measurement in our assay was 351.1913 and limit of

detection (limit of blank + 1.645 (SD low concentration sample) was 825.5216. We calculated and normalized our results base on protein concentrations on our samples. These calculations cannot be applied to blanks as they do not contain proteins. However, all measurements were in the detection range of the NO analyzer.

2.8 Quantitative polymerase chain reaction

q-PCR was used to quantify gene expression of enzymes involved in the L-arginine/NO metabolism.170 In this set of samples we measured changes in arginase and iNOS gene expression in comparison to the beta actin gene expression used as a house keeping gene. We

considered the first time point, time of harvesting (0h CIT), as control and calculated the gene expression at other time points as fold change from 0h CIT.

Pig lung tissue samples were homogenized for q-PCR in TRI reagent solution (1/10 w/v) and incubated for 5 min at room temperature. Then the homogenates were centrifuged at 12,000 × g for 10 min at 4ºC and the supernatants were transferred to fresh tubes. 100 μl of 1-bromo-3- choloro-propane (BCP) per 1 ml of TRI reagent solution was added, mixed well for 15 sec, and incubated at room temperature for 5-15 min. The tubes were centrifuged again at 12,000 × g for another 10-15 min at 4ºC, and then the aqueous phase was transferred to a fresh tube. 500 μl of isopropanol was added per 1 ml of TRI reagent solution, vortexed at moderate speed for 5-10 sec, and incubated at room temperature for 5-10min. The mixture was centrifuged at 12,000 × g for 10 min at 4ºC, and the supernatant was discarded. 1 ml of 75% (v/v) ethanol was added per 1 ml TRI reagent solution, and then centrifuged at 7,500 × g for 5 min at 4ºC. The centrifugation was repeated at 12,000 × g for 5 min to consolidate the pellet at the bottom of the tube. Ethanol was removed and the tubes were centrifuged again to remove all residual ethanol by removing the ethanol that collects with a fine tip pipette. In the next step ribonucleic acid (RNA) was air- dried for 3-5 min. RNA pellet was dissolved in the nuclease-free water and stored at 4ºC for immediate analysis (for long storage, stored at -70ºC or colder).170 All Reagents were purchased from Invitrogen (Life Technologies Inc. Burlington, ON).

2.8.1 Assessing RNA yield and quality

To assess the concentration of mRNA solution, the absorbance was read in a traditional spectrophotometer at 260 nm and calculated the concentration RNA (μg /ml) = A260dilution factor  40). To test the quality of RNA, agarose gel electrophoresis was run and we calculated the ratios of 28S and 18S bands which should be around 2 and then we checked RNA purity – A 260/ A 280 ratio which should be around 1.8-2.2.170

2.8.2 Complementary deoxyribonucleic acid

Reagents: SuperScript II First-Strand Synthesis SuperMix for q-PCR with Random Hexamers (Invitrogen). RT Reaction mix, RT Enzyme Mix, RNA and DEPC water were added into one tube and gently mixed and incubated at 25°C for 10 min. Then the tube was incubated at 50°C for 30 min for the reaction. After that, the reaction was terminated at 85°C at 5 min, followed by cooling down on ice. Next, RNase H was added and the tube was incubated at 37°C for 20 min, and then stored at -20°C.170

2.8.3 Real time PCR

Reagent: Power SYBR Green PCR Master Mix with Ampli Taq Gold Polymerase (Invitrogen).

Primers:

Pig arginase1: Sus scrofa arginase, liver (arginase1), Messenger RNA (mRNA)

Product length = 163

Forward primer 1: ACAATCCATCGGGATCATCGGAGC 24

Reverse primer 1: AGGGACATCAGCAAAGCACAGGT 23

Pig arginase: Sus scrofa arginase, type II (arginase 2), mRNA

Product length = 229

Forward primer 1: TGCATTTGACCCTACCCTGGCT 22

Reverse primer 1: TCCCTCCCTTGTCTGCCCAAAACT 24

Pig –iNOS: Sus scrofa iNOS, mRNA

Product length = 187

Forward primer 1: TTTCAGGAAGCATCACCCCCGT 22

Reverse primer 1: TGCATGAGCACAGCGGCAAAGA 22

Complementary deoxyribonucleic acid (cDNA) was diluted 10 times, reagents, primer-F, primer- R, cDNA, and diethylpyrocarbonate (DEPC) water were added followed by thermal cycle (95°C, 10 min → denature 95°C 15 sec, 60°C 1min, for 40 cycles on the machine).170

2.9 Western blotting

The expression of proteins was analyzed in pig lung tissue extracts as follows. Polyacrylamide gel electrophoresis was prepared on denaturing gels using the mini –PROTEAN 3 gel system (Bio-Rad Laboratories, Hercules, CA). Arginase isoforms were separated on a 10% (w/v) acrylamide gel. Sample buffer contained 30% (v/v) glycerol, 0.012% (w/v) bromophenol blue, 10% (w/v) sodium dodecyl sulfate (SDS) and 0.6 M DTT. Samples were diluted according to the protein concentration target for 100 μg protein in 25 μl. Then samples were mixed with sample buffer and incubated in 95C for 10 min. Each well was loaded with 25 μl samples and electrophoresis ran on running buffer, containing tris base 0.3% (w/v), 1.44% (w/v) glycine, 0.1% (w/v) SDS, at 140 volts (V) for approximately 70 min. Proteins were transferred to nitrocellulose membrane in transfer buffer – containing tris base 0.3% (w/v), 1.44% (w/v) glycine, 20% (v/v) Methanol – at 100 V for 75 min. Membranes were blocked in 1% (w/v) skimmed milk over night at 4C. The membranes were washed, and then incubated at room temperature with primary antibodies for 60 min followed by washing and incubation with secondary antibody for another 60 min also at room temperature. Membranes were incubated with Super Signal West Pico chemiluminescent substrate (Thermo scientific, IL) for 5 min and exposed to autoradiography film (HyBlot, DENEVILLI scientific INC, NJ). All antibodies were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA). Details of each antibody are provided in Table 2-3. In this set of data the changes in arginases protein expression were measured in comparison to protein expression of a house keeping protein  actin in the same sample and expressed as relative of target protein to  actin density.171

Table 2-3: Details of antibody used for Western blotting.

Target Epitope Catalogue number Isotype

Actin C-terminus (Human) sc-1616 (I-19) Goat polyclonal IgG

Arginase 1 N-terminus (Human) sc-18531 (N-20) Goat polyclonal IgG

Arginase 2 C-terminus (Human) sc-18537 (N-20) Goat polyclonal IgG

IgG, immunoglobulin G; all antibodies purchased from Santa Cruz Biotechnology Inc.

2.10 Arginase activity measurement

Arginase activity in lung tissue extract was measured according to the method published by Corraliza et al.172 Briefly, in 2 ml boil-proof micro tubes (PROGENE) samples were diluted to a final protein concentration of 4 mg/ml with lysis buffer, containing proteinase inhibitors. The

samples were mixed with manganese chloride (MnCl2)10 mM in 25 mM tris–HCl, pH= 7.4 in equal volume as the enzyme cofactor, and incubated at 56C for 10 min to activate the enzyme. The substrate of arginase, L-arginine (20mM, pH=9.7), was added to the extract containing activated enzyme and incubated at 37C for 60 min. The reaction was stopped with an acid

mixture containing 1% (v/v) sulphuric acid (H2SO4) and 3% (v/v) phosphoric acid (H3PO4). Standards were prepared according to Table 2-4. All samples and standards were prepared in triplicate (Table 2-4).172 The dye, α-isonitrosopropiophenone (ISPF), was added to standards and samples and all tubes were incubated at 100C for 90 min followed by 15 min incubation at room temperature in the dark. The samples and standards were pipetted into FALCON 96 well plate. The reaction of urea with ISPF was evaluated by absorbance values measured at 540 nm

(Figure 2-1). Limit of blank (mean blank + 1.645(SD blank) for optical density (OD) measurement

in our assay was 0.09 and limit of detection (limit of blank + 1.645(SD low concentration sample) was 0.13.173 The blank value of absorbance was deducted automatically by the spectrophotometer. This method is highly sensitive. Urea amounts of 0.02-0.05 mol can be measured by this assay. In addition, the method is highly specific and does not interfere with other metabolites in the homogenates.172 The standard curve was plotted using the absorbance values of urea concentration. Urea concentrations in the samples were calculated from the equation of the standard curve and the dilution factor. The activity of the enzyme was calculated based on the amount of substrate converted to product per unit of time. The arginase activity was calculated using the urea concentration in each tube divided by 60 min to calculate the unit (μ mol/min). We corrected the values based on the protein concentration and expressed data as munit/ mg protein. Data for blanks were not normalized based on protein concentrations as they do not contain proteins. However, all OD measurements were in the detection range of the assay.

2.11 Statistics

All data were shown as mean± standard error of the mean (SEM). For comparison between three groups or more, one-way ANOVA and Tukey’s multiple comparison test, or Kruskal-Wallis test and Dunn's multiple comparison test were used based on the distribution of data. For comparison between two groups unpaired or paired t-test, Wilcoxon matched paired test or Mann-Whitney test were used where appropriate. Statistical software package in Prism 5 (GraphPad Software, San Diego, CA) was used for statistical analysis. Probability values less than 0.05 (p values<0.05) were considered to represent statistically significant differences between group of samples.

Figure 2-1: Protocol for measurement of arginase activity in tissue homogenates according to Corraliza. 172 OD, optical density; ISPF, α-isonitrosopropiophenone.

Table 2-4: Volumes and concentrations of standard solution for arginase activity measurement

Urea 0.5mg/ml (μl) Lysis buffer mixture* 0 50 2 48 4 46 8 42 16 34 24 26 32 18 40 10

PI, protease inhibitor; Tris-HCl, Trizma® base (SIGMA- ALDRICH®) + HCl. 50l 25 mM tris–HCl pH= 9.7 and 800 l of acid mixture (1% (v/v) H2SO4+ 3% (v/v) H3PO4 in water) was added to all tubes.* Lysis buffer mixture contained lysis buffer + PIs+ MnCl2 10 mM in 25 mM tris–HCl , pH= 7.4 (μl).

Chapter 3: The L-arginine metabolic profile in lungs differs between donations after brain death compared to prolonged cold ischemia.

3.1 Abstract

Background: Currently, brain death donors are the major source of donation for lung transplantation. However, brain death leads to metabolic changes which can contribute to I/R injury and PGD. NO plays important roles in both development and management of I/R injury. Therefore, this study was designed to characterize the L-arginine/NO metabolism after different length of cold ischemia and after EVLP followed by transplantation and reperfusion in different types of donors. However, the effects of EVLP on the L-arginine/NO metabolism in lungs have not been studied previously.

Methods: Pig lung samples were taken from lungs which were preserved in cold ischemia for different length of time, and lungs obtained after brain death and cold ischemia. Lungs from brain death and lungs preserved for 30h were subjected to 12 hours EVLP followed by transplantation. Levels of amino acids involved in the L-arginine/NO metabolism were measured using high performance liquid chromatography mass spectrophotometery (HPLC-MS) by Metabolon Inc.

Results: Duration of hypothermia has no effects on L-arginine, L-ornithine, L-lysine or ADMA levels or on indices of L-arginine bioavailability and NOS impairment. However L-citrulline levels were higher after cold ischemia in the brain death group. The L-ornithine/L-citrulline ratio was decreased after 6 hours of cold ischemia, but not after prolonged cold ischemia. After EVLP and transplantation of lung in the non brain death donors L-citrulline levels were higher than in lungs from brain death donors resulting in a lower ratio of L-ornithine/L-citrulline in the non brain death group. In prolonged hypothermic preserved lung L-citrulline levels were higher after EVLP and transplantation compared to after cold ischemia. Additionally, in lungs from the brain death donors L-arginine levels were lower after EVLP followed by transplantation and reperfusion compared to after cold ischemia.

Conclusion: Based on these findings we conclude that changes in the L-ornithine/L-citrulline ratio after 6 hours of cold preservation may reflect a shift in the metabolism of L-arginine toward NOS. In addition, the L-arginine metabolic profile in lungs from the prolonged hypothermic

preserved group when compared to “brain death” group at different stages of lung transplantation were significantly different, which could potentially correlate with the short term outcomes after transplantation.

3.2 Introduction

NO plays crucial roles in numerous physiological processes such as regulation of smooth muscle tone, inhibition of platelet aggregation, regulation of immune response and neurotransmission.73, 98, 99, 104, 113-117 It has been shown that some complications after lung transplantation are correlated with alterations of the L-arginine/NO metabolism.73 The amino acid L-arginine is a substrate of NOSs for NO production.98 Studies have demonstrated that alterations in L-arginine metabolism and availability result in changes in NO production.109, 111, 112, 132 The production of NO is decreased in the lung following cold preservation.152, 174 While NO is known to act as a vasodilator,68, 175, 176 it can also react with oxygen species to produce toxic radicals, which plays an important role in the development of I/R injury and PGD.72, 81

PGD is a serious complication that can occur within 72 hours following lung transplantation,1, 59, 60 and is a type of severe acute lung injury which in some cases can be managed clinically by inhaled NO.74, 177, 178As mentioned earlier in this thesis, I/R injury can result in acute and chronic graft dysfunction.83, 179 I/R injury leads to increased vascular smooth muscle tone, vascular resistance and decreased tissue perfusion.72 Inhaled NO in some cases is effective in management of I/R injury.67, 83 Moreover, in a rabbit model of lung transplantation, L-arginine supplementation resulted in lower rates of I/R injury by maintaining NO production and endothelium function.180 In a pig model of isolated reperfusion of heart and lung, the administration of L-arginine improved oxygenation and lung compliance.153 In a model of isolated lung perfusion in rabbits, L-arginine supplementation resulted in maintained endothelial function and NO production.153, 180

Prolonged hypothermic preservation is a risk factor for PGD.59 Cell injuries following hypothermia such as decreased ATPase activity and subsequently interruption in ion balance lead to cellular edema and cell death.36, 37 Specifically in the lung, hypothermia causes altered oxygen exchange due to increase in extravascular fluid and pulmonary vasoconstriction.26, 36

In North America, lungs for transplantation are typically harvested from donors after brain death or in some cases after cardiac death.4, 6 Brain death leads to hydrostatic insults and inflammatory

responses and hormonal changes in lung tissue resulting in massive changes in cellular metabolism such as lactic acidosis and production of ROS, which can be deteriorated by hypothermic preservation and reperfusion.5, 28-31 Donor organs obtained after cardiac death experience warm ischemia which can also result in lung tissue damage.3, 11

EVLP is a modern technique which provides opportunity for prolonged preservation, evaluation of lung function and possible medical interventions,12, 14, 17, 20 without increasing the risk of complications such as I/R injury.12 In injured lungs in the brain death pigs with significantly higher PVR after cold ischemia compared to the control, 12 hours EVLP lead to a significant decrease in PVR.25 In addition, administration of inhaled NO during EVLP resulted in improvement of lung function in a rat model.55, 56

Possible alterations in the L–arginine/NO metabolism at different steps of lung transplantation may contribute to I/R induced lung injuries. Therefore, the objective of the present study is to examine metabolites related to the L-arginine/NO metabolism in lung tissues at different time points in a pig model of lung transplantation to characterize the L-arginine/NO metabolism during lung transplantation.

3.3 Study designs and experimental approach

Samples were taken by a group of surgeons at the Latner Thoracic Surgery Research Laboratories, University Health Network, Toronto General Hospital (TGH). This animal model of lung transplantation was designed to study the effects of different lung preservation times and conditions on the L-arginine/NO related metabolism.

As described earlier in previous chapter 2, based on current regulations and guidelines male Yorkshire domestic pigs (25 to 35 kg) were used for these experiments.24, 25Animals were anesthetized and intubated.24, 159 In the brain death group brain death was induced by inflating a foley catheter to increase the ICP.181 In all animals lungs were retrieved from donor animals and flushed antegradely and retrogradely using Perfadex.162 Depending on study design lungs were kept at 4C for different periods of time. Next, for 12 hours lungs underwent normothermic acellular EVLP in an isolated circuit14, 46 followed by left lung transplantation and reperfusion.

Samples were taken from the lungs and immediately snap frozen in liquid nitrogen and then kept at -80ºC. Samples from studies of lung transplantation in pig models were collected as follows (Figure 3‎ -1). In this study lungs were preserved at 4ºC beyond the time period that is clinically accepted. Therefore, in this study lungs were severely injured to magnify metabolic alterations.

A. In the “control” group, samples were taken from normal pig lung immediately after organ retrieval. These lungs were flushed with Perfadex and did not undergo cold ischemia preservation. Therefore, they were named 0h CIT and considered normal controls (n=5). B. In the “less injured lung” group samples were taken after 6 hours of cold static preservation which simulates current clinical practice. This group was named 6h CIT (n=6). C. In the prolonged hypothermic preservation group lungs were harvested from normal animals and kept at 4C for 30 hours, which was denoted as 30h CIT (n=5) prolonged cold ischemia leads to severe injuries in donor lung which could magnify metabolic alterations. D. In the brain death group lungs were harvested 10 hours after induction of brain death in animals followed by 24 hours of cold static preservation. Samples were collected after 24 hours of cold ischemia, which was marked as BD+24h CIT (n=4).

The lungs in the brain death group were also preserved in cold ischemia for longer period than in real clinical conditions (24 hours). Although this period is shorter than the preservation time in the non brain death group (30hours), alterations in metabolic biomarkers in these lungs could provide evidences for further investigations. In addition, in human lung transplantation, donor lung are preserved in cold ischemia of different lengths of time. Therefore, in this study we included and analysed data from donor lungs after brain death.

All above samples were blood free. However, the following samples which were taken after lung transplantation and reperfusion contained blood. Lung transplantation after prolonged preservation leads to I/R injury. Therefore, another sample was taken after 12 hours of EVLP followed by 1 hour reperfusion.

E. In the non brain death group 1 hour after transplantation and reperfusion which was named 30h CIT/1h post rep (n=5). F. In the brain death group 1 hour after transplantation and reperfusion, BD+24h/1h post rep (n=5).

All samples were sent to Metabolon Inc. Durham, NC, USA, for processing and measuring several biomarkers in lung tissue homogenates using HPLC-MS in collaboration with Dr. Keshavjee’s lab. Data for the levels of L-arginine, L-ornithine, L-citrulline, L-lysine and ADMA were provided to us by Dr. Keshavjee’s lab for detailed analysis.

These data were not expressed as true concentrations. Metabolon Inc. used a standard method to log-normalize the data and present the results as a scaled intensity (relative quantification).182 All data are shown as mean±SEM. For comparison between three groups or more, one-way ANOVA and Tukey’s multiple comparison test, or Kruskal-Wallis test and Dunn's multiple comparison test, and for comparison between two groups unpaired or paired t-test were used where appropriate. Statistical software package in Prism 5 (GraphPad Software, San Diego, CA) was used. A p values<0.05 was considered to represent significant differences between group of samples.

Figure 3-1: Pig lung transplantation study designs. The study was designed to investigate the effects of different lung preservation time and conditions on the L-arginine/NO metabolism. Samples were taken at different time points as follows: A:0h CIT, after harvesting the lung from donor and flushing with Perfadex; B:6h CIT, after 6 hours of cold ischemia in the non brain death animals; C:30h CIT, after 30 hours of cold ischemia in the non brain death group; D:BD+24h CIT, after 24 hours of cold ischemia in the brain death group; E: 30h CIT/1h post rep , after transplantation and reperfusion of 30h CIT group; F:BD+24h/1h post rep, after transplantation and reperfusion of BD+24h CIT group, EVLP, ex vivo lung perfusion; CIT, Cold ischemia time; TOH, time of harvesting; LTx, lung transplantation.

3.4 Results

Analysis of the levels of L-arginine and its metabolites at different time points allowed us to study the effects of length of cold ischemia on L-arginine metabolism. Additionally, we were able to investigate whether the levels of L-arginine and its metabolites were different in lungs after prolonged cold preservation (30h CIT) compared to lungs after brain death followed by cold preservation (BD+24h CIT). This study design also allowed us to assess if and at what time point the cause of death leads to differences in the L-arginine metabolism after lung transplantation and reperfusion.

3.4.1 Length of cold static preservation does not affect the levels of L-arginine and its metabolites

The levels of L-arginine, L-ornithine, L-citrulline, L-lysine and ADMA in lung tissue at the time of harvesting, 6 hours after cold ischemia and 30 hours after cold ischemia are provided in Table 3‎ -1. There were no significant differences between the groups (one way ANOVA) (Figure 3‎ -2).

ADMA is a competitive endogenous NOS inhibitor.143 High concentration of ADMA in serum is correlated with impairment in NO-mediated vasodilatation.144 Several studies have shown that the L-arginine/ADMA ratio is correlated with NO-mediated vasodilation.144 This ratio is considered an index for NOS impairment.144 The L-arginine/ADMA ratio was also not different at various lengths of cold ischemia points in our study (Table 3‎ -2) (one-way ANOVA).

The substrate-to-product ratio for arginase, L-arginine/L-ornithine, can be used as an index for L-arginine bioavailability for NOS.115 Arginase and NOS are intracellular enzymes and L- arginine competes with L-ornithine and L-lysine for transport into the cell by CATs. Intracellular L-arginine bioavailability for NOS can also be expressed as the ratios of L-arginine/ (L- ornithine+L-lysine).98, 99 These ratios were not different at different time points after cold ischemia compared to the time of harvesting (Table 3‎ -2) (one way ANOVA).

A B 3 2

L-arginine 1

L-ornithine

log-normalized data log-normalized

as a scaled intensity scaled a as as a scaled intensity scaled a as 0 0

0h CIT 6h CIT 0h CIT 6h CIT 30h CIT 30h CIT

C D 2.5 6

2.0 4 1.5

1.0 L-lysine

2 L-citrulline

0.5

log-normalized data log-normalized

as a scaled intensity scaled a as

log-normalized data log-normalized as a scaled intensity scaled a as 0.0 0

0h CIT 6h CIT 0h CIT 6h CIT 30h CIT 30h CIT

E 4

2 ADMA

log-normalized data log-normalized as a scaled intensity scaled a as 0

0h CIT 6h CIT 30h CIT

Figure 3‎ -2: Different length of cold ischemia time does not affect the levels of amino acids or ADMA in donor lungs (one way ANOVA). A, L-arginine; B, L-ornithine; C, L-citrulline; D, L-lysine; E, ADMA; log-normalized data as a scaled intensity; samples were taken at different time points as follows: 0h CIT, time of harvesting lung from donor; 6h CIT, after 6 hours of cold ischemia in the non brain death group; 30h CIT, after 30 hours of cold ischemia in the non brain death group.

Table 3‎ -1: Lung amino acid and ADMA levels at different time points in the brain death and non brain death groups

L L

Number of

- - L

samples

ADMA

ornithine citrulline

arginine

lysine

0h CIT 5 1.120.25 0.850.19 0.700.09 2.120.90 1.530.62

6h CIT 6 1.540.35 0.670.17 1.100.23 0.950.15 1.110.20

30h CIT 5 1.240.21 0.900.11 0.570.12 0.950.11 1.010.13

BD+24h CIT 4 1.69.0.33 2.591.39 1.090.19 2.211.03 2.551.22

30h CIT/1h post 5 0.710.09 1.320.26 1.360.08 0.860.12 0.740.08 rep

BD+24h/1h post 5 0.590.09 1.850.15 1.060.09 0.880.13 0.770.11 rep Log-normalized data as a scaled intensity for amino acids and ADMA are shown as meanSEM. Samples were taken at different time points as follows: 0h CIT, time of harvesting lung from donor; 6h CIT, after 6 hours of cold ischemia in the non brain death group; 30h CIT, after 30 hours of cold ischemia in the non brain death group; BD+24h CIT, after 10 hours of brain death followed by 24 hours of cold ischemia; 30h CIT/1h post rep , 1 hour after transplantation and reperfusion of 30h CIT group; BD+24h/1h post rep , 1 hour after transplantation and reperfusion of BD+24h CIT group.

Table 3‎ -2: Indices of L-arginine bioavailability and NOS impairment in lung at different time points in the brain death and non brain death groups

L L

ornithine+L ornithine+L

- -

Number of

arginine arginine

citrulline)

ornithine/L

ornithine citrulline

arginine/L

samples

ADMA

lysine)

arginine/

/ ( / (

L L

- -

0h CIT 5 1.450.37 0.50.16 0.700.11 1.300.32 1.210.35

6h CIT 6 2.590.64 0.910.18 0.880.19 0.580.10 1.320.23

30h CIT 5 1.380.14 0.670.08 0.830.04 1.750.32 1.240.14

BD+24h CIT 4 1.791.10 0.560.25 0.740.31 2.350.88 0.920.21

30h CIT/1h post 5 0.620.12 0.350.05 0.270.04 0.970.18 0.980.13 rep

BD+24h/1h post 5 0.340.07 0.220.04 0.210.04 1.750.08 0.7600.4 rep Ratios for L-arginine availability and NOS impairment are shown as meanSEM. Samples were taken at different time points as follows: 0h CIT, time of harvesting lung from donor; 6h CIT, after 6 hours of cold ischemia in the non brain death group; 30h CIT, after 30 hours of cold ischemia in the non brain death group; BD+24h CIT, after 10 hours of brain death followed by 24 hours of cold ischemia; 30h CIT/1h post rep , 1 hour after transplantation and reperfusion of 30h CIT group; BD+24h/1h post rep , 1 hour after transplantation and reperfusion of BD+24h CIT group.

The L-ornithine/L-citrulline ratio can be used as a measure of the balance between arginase and NOS, as L-ornithine is the product of arginase and L-citrulline the product of NOS activity. This ratio is inversely related to the consumption of L-arginine toward NOS and NO production. Therefore, a change in the ratio can be considered an indicator of a change in arginase/NOS balance.121 Lower L-ornithine/L-citrulline ratio in lungs after 6 hours cold ischemia compared to the control suggests that a short period of cold preservation may alter the L-arginine/NO metabolism. In lungs after 30 hours of cold ischemia this ratio was significantly higher than in lungs after 6 hours of cold ischemia (p<0.05, one way ANOVA, Tukey's multiple comparison test) (Figure 3-3). This finding suggests that the effects of hypothermic preservation on the L- arginine/NO metabolism cannot be sustained in prolonged hypothermic preservation.

It is known that prolonged preservation (30h CIT) and brain death donation followed by 24 hours of cold preservation can induce acute lung injury after transplantation. EVLP may provide a time-window to resume lung metabolism and improve lung function after transplantation. To determine whether EVLP and lung transplantation procedure can affect the L-arginine/NO metabolism in donor lung, we examined the levels of L-arginine and its metabolites one hour after transplantation and reperfusion.

To avoid over expression, the data were demonstrated on one graph. Data for after transplantation and reperfusion in lungs from the brain death animals (BD+24h CIT/1h post rep) are incomparable to data for after 30 hours of cold ischemia (30h-CIT). Similarly, the comparison of data from the non brain death animals after transplantation and reperfusion (30h CIT/1h post rep) to the brain death group after cold ischemia (BD+24h CIT) is invalid. No three sets of data were comparable; therefore, ANOVA is an inappropriate test. Thus, we used unpaired t test.

* 3

1 L-ornithine/L-citrulline 0

0h CIT 6h CIT 30h CIT

Figure 3-3: A, The L-arginine metabolism by arginase and NOS; B, Decreased L-ornithine/L- citrulline ratios in donor lungs were observed after 6 h cold ischemia time (6h CIT) but not 30h CIT; *p<0.05, one way ANOVA, Tukey's multiple comparison test. Samples were taken at different time points as follows: 0h CIT, time of harvesting lung from donor; 6h CIT, after 6 hours of cold ischemia in the non brain death group; 30h CIT, after 30 hours of cold ischemia in the non brain death group.

The L-citrulline level in the brain death group after cold ischemia (BD+24h CIT) was higher than in the prolonged hypothermic group (30h CIT) (p=0.049, unpaired t test). However, for other amino acids and ADMA comparing between these two groups did not show differences. It was reported that the outcome of lung transplantation and reperfusion in the brain death group was worse than in prolonged hypothermic group.25 Therefore, higher L-citrulline level after cold preservation, may be relevant to the clinical condition of the recipient after transplantation and reperfusion.

Levels of L-arginine, L-ornithine, L-lysine and ADMA were not different (unpaired t test) after transplantation and reperfusion in lungs from the brain death animals (BD+24h CIT/1h post rep) compared to the non brain death animals (30h CIT/1h post rep ). The ratios of L-arginine/L- ornithine or L-arginine/ (L-ornithine+L-lysine) as well as L-arginine/ADMA in lungs from both the brain death and the non brain death animals were similar after transplantation and reperfusion. The level of L-citrulline in lung tissues from the non brain death group was higher after transplantation and reperfusion than in the brain death group after transplantation and reperfusion (p=0.04, unpaired t test) (Figure 3-4-A).

In the prolonged preservation group levels of L-arginine, L-ornithine, L-lysine or ADMA in lung tissues after cold ischemia were not different compared to after transplantation and reperfusion (unpaired t test). However, L-citrulline in lungs after transplantation and reperfusion (30h CIT/1h post rep ) was higher compared to after 30 hours of cold ischemia (30h-CIT) (p= 0.0006, unpaired t test) (Figure 3-4-A).

The ratio of L-ornithine/L-citrulline in lungs from the brain death donors was higher than in lungs from the non brain death donors after transplantation and reperfusion (p=0.004, unpaired t test) (Figure 3-4-B). This finding could be a reflection of shift of L-arginine metabolism toward consumption by NOS after transplantation and reperfusion in the non brain death group as previously described.

In the brain death group, levels of L-ornithine, L-citrulline, L-lysine or ADMA were not different in lungs before transplantation compared to after transplantation and reperfusion

(unpaired t test). However, the level of L-arginine in lung tissues homogenates after transplantation and reperfusion (BD+24h/1h post rep ) was lower compared to after cold ischemia (BD+24h CIT) (p= 0.008, unpaired t test) (Figure 3-4-C).

0.0006 0.049 A B 0.042 0.004 2.0 5

4 1.5

3 1.0 2

L-citrulline 0.5

log-normalizeddata

as a scaled intensity L-ornithine/L-citrulline 0.0 0

30h CIT 30h CIT BD+24h CIT BD+24h CIT

30 CIT /1h post rep 30 CIT /1h post rep

BD+24h CIT/1-h post rep BD+24h CIT/1-h post rep

C 3 0.008

L-arginine 1

log-normalizeddata as a scaled intensity

30h CIT BD+24h CIT

30 CIT /1h post rep

BD+24h CIT/1-h post rep

Figure 3-4: A, Comparing the brain death and non brain death groups, before transplantation L- citrulline was higher in the brain death group, but after transplantation and reperfusion L- citrulline was higher in the non brain death group ; B, L-ornithine/L-citrulline ratio is higher after transplantation and reperfusion in the brain death group; C, L-arginine after transplantation and reperfusion decreases in the brain death groups (unpaired t test). Hollow symbols represent blood free samples; solid symbols represent samples containing blood; log-normalized data as a scaled intensity; Samples were taken at different time points as follows: 30h CIT, after 30 hours of cold ischemia in the non brain death group; 30h CIT/1h post rep, 1 hour after transplantation and reperfusion of 30h CIT group; BD+24h CIT, after 10 hours of brain death followed by 24 hours of cold ischemia; BD+24h/1h post rep, 1 hour after transplantation and reperfusion of BD+24h CIT group; data for 30h CIT in Figure 3-4-B are identical to the same data in Figure 3‎ -2 and Figure 3-3.

3.5 Discussion

In this chapter we found that length of cold ischemia time did not result in changes in the levels of L-arginine and its metabolites, indices of L-arginine bioavailability or NOS impairment. However, the index for balance in L-arginine metabolism by arginase and NOS, the L- ornithine/L-citrulline ratio, was lower after 6 hours of cold ischemia, suggesting a possible alteration in the L-arginine/NO metabolism. In addition, after cold ischemia in lung from the non brain death donors, the L-citrulline level was lower than in the brain death donors. However, after transplantation and reperfusion in lung from the non brain death donors, the L-citrulline level was higher than in the brain death donors. This observation suggested that NOS activity was increased in prolonged hypothermic preserved lungs after transplantation. Decreased L- ornithine/L-citrulline ratio in the non brain death group may also reflect an imbalance in L- arginine metabolism by arginase and NOS.

Cold preservation is a necessary step in lung transplantation, but prolonged cold ischemia causes oxidative stress, sodium pump inactivation and intracellular calcium overload.72 These changes can lead to cell death and release of pro-inflammatory mediators and consequently alterations in the expression and activity of enzymes including those involved in L-arginine homeostasis such as NOSs.72, 183

Analysis of data showed that the length of cold ischemia did not significantly affect L-arginine, L-ornithine, L-citrulline, L-lysine or ADMA. Interestingly however, a lower L-ornithine/L- citrulline ratio in lungs after 6 hours of cold ischemia compared to the lungs at the time of harvesting and to the lungs after 30 hours of cold ischemia was observed. A decrease in L- ornithine/L-citrulline ratio can be explained by either a decrease in L-ornithine or an increase in L-citrulline, or disproportional changes in activities of arginase and NOS. The L-ornithine/L- citrulline ratio can be considered an index to estimate the balance in L-arginine metabolism by arginase and NOS121 and the observed changes in the L-ornithine/L-citrulline ratio may indicate changes in the balance of arginase and NOS.

In a rat model of lung transplantation NO production was decreased after 6 hours of cold preservation in 4C compared to fresh lungs.174 In addition, it was demonstrated that hypothermia suppressed iNOS and nNOS activity in endothelial cells independent of L-arginine concentration which resulted in reduced NO production.184 In our study the decrease in L- ornithine/L-citrulline ratio could reflect of a shift in L-arginine metabolism toward consumption by NOS.121 However, these data were not expressed as true concentration and changes in the ratios may therefore not accurately reflect changes in arginase/NOS balance. Measuring NOx concentrations would provide a better estimate of NOS activity.

As described earlier, the L-arginine/L-ornithine ratio and L-arginine/ (L-ornithine+L-lysine) in serum are indices of L-arginine bioavailability for intra-cellular NOS at a given L-arginine concentration.98, 99, 115 It is possible that these indices in tissue homogenate may not reflect intracellular L-arginine availability for NOS.

We did not find evidence for inhibition of NOS by ADMA. ADMA is a competitive endogenous inhibitor of NOS143 and impairment in NO-mediated vasodilatation correlates with high concentration of serum ADMA and low L-arginine/ADMA ratio.144 Cold ischemia did not affect ADMA concentration nor the L-arginine/ADMA ratio in lung tissue.

Catecholamine storm following brain death results in increased intracellular calcium ion and induces inflammatory responses which could result in activation of inflammatory biomarkers and iNOS.31, 181 Analysis of data for L-arginine and its metabolites in lung comparing different organ damage severity showed that in lungs after 24 hour of cold ischemia in the brain death group levels of L-citrulline were significantly higher than in lungs after prolonged (30 h) hypothermic preservation in non brain death group.

Evaluation of L-arginine and its metabolites in the lungs after transplantation and reperfusion in the brain death group compared to the non brain death group is important because the type of donors would result in differences in the rate of complications after lung transplantation such as I/R injury.185, 186 After transplantation and reperfusion L-citrulline levels were higher in lungs from the non brain death group compared to the brain death group. A significantly lower L-

ornithine/L-citrulline ratio in the non brain death group was also observed. As previously discussed, the decreased L-ornithine/L-citrulline ratio could reflect a shift of L-arginine metabolism toward NOS.

We compared the levels of L-arginine and its metabolites in lung tissue after cold ischemia to after transplantation and reperfusion in both the brain death and non brain death group. We observed changes from before to after transplantation and reperfusion in L-arginine levels in the brain death group. L-citrulline levels changed from before to after transplantation and reperfusion in the non brain death group. These differences are important because the L-arginine level in the same samples were low while L-citrulline levels were high, which demonstrates that different donor types have different L-arginine metabolic profiles. Therefore, these changes might be caused by a metabolic change in lung tissue. However, the comparisons of lungs after cold ischemia to lungs after transplantation and reperfusion must be interpreted with caution as blood contamination may cause changes in the levels of biochemical markers in the tissue homogenates. In addition, starvation, blood loss, dehydration and renal failure due to the surgery could result in differences in concentration of biochemical markers.187, 188 For instance, L- citrulline concentration depends on renal function and it is therefore considered a marker for acute and chronic renal failure.189 Blood levels of amino acids were not measured in recipient animals. Therefore, it is not clear whether the differences in pre-transplantation compared to post-transplantation and reperfusion samples were caused by alteration in L-arginine metabolism in lung tissue or reflect changes of metabolisms in other organs of the recipient. These findings suggest that after EVLP and reperfusion the L-arginine/NO metabolism was altered differently in the brain death group compared to prolonged preserved group.

These findings also indicated that changes occurred after cold ischemia, but levels of L-arginine and its metabolites were not measured after EVLP. Therefore the differences are due to combined effects of EVLP and transplantation and reperfusion. It is unclear whether they were caused by EVLP or, transplantation and reperfusion or both.

It has been previously demonstrated that gene expression of iNOS and protein expression of iNOS and eNOS in a rat model were increased after transplantation of lung tissue.190 Other

studies also showed that NO production increased after ischemia and reperfusion.179 This increase in NO production was a result of an increase in expression and activity of iNOS.179 In all previously reported models donor lung was harvested from the non brain death animals. In the present study although L-citrulline levels, another product of NOS activity, after transplantation and reperfusion in the non brain death group was higher compared to after cold ischemia, the NO concentration was not measured. Therefore, we are not able to comment on changes in NO production by NOS.

There are other limitations to this study. In this experiment proper controls for lungs after transplantation and reperfusion were not available. Unflushed normal lungs could be an appropriate reference for concentrations of amino acids and ADMA after transplantation and reperfusion in lung tissue. In addition, these samples were collected from different studies specifically to measure several metabolites using HPLC-MS. Changes in the expression and activity of enzymes as well as the concentration of NO and its metabolites were not investigated in these samples. The concentrations of L-arginine metabolites in lung tissue were not measured before transplantation (after EVLP). As a result the effects of EVLP on the L-arginine metabolism in lung tissue could not be evaluated. Data were expressed as log-normalized data on scale intensity. Therefore, the numbers as well as the ratios must be interpreted carefully. For a better understanding of the changes in the L-arginine/NO metabolism, specifically interpretation of L-arginine availability ratios, accurate concentrations of amino acids and ADMA should be determined.

In brief, in a pig model of lung transplantation, analysis of data revealed that 6 hours of hypothermic preservation leads to a shift in consumption of L-arginine toward NOS, an effect that was not seen in prolonged cold preservation. However, this alteration was not driven by changes in L-arginine bioavailability or NOS impairment. Clinical outcomes after transplantation of these lungs to recipients were recently reported by Yeung et al.25 Clinical outcomes after lung transplantation in the brain death group were worse than in prolonged cold preservation group.25 Our study demonstrated that L-arginine metabolic profiles in prolonged hypothermic preservation group were different from the brain death group.

Chapter 4: NO metabolite and L-citrulline concentrations are decreased after EVLP independent of IL-10 gene therapy and remain decreased after transplantation.

4.1 Abstract

Background: The availability of donor lungs for transplantation is one of the major obstacles in lung transplantation resulting in high wait list mortality. EVLP renders the opportunity to evaluate marginal organs and to perform medical interventions such as IL-10 gene therapy in order to improve the quality of the organs and expand the donor pool. However, our knowledge of the biochemical alterations, including the L-arginine/NO metabolism, is limited. In this study we investigated the effects of EVLP and IL-10 gene therapy during EVLP on the L-arginine/NO metabolism in lungs before and after transplantation.

Methods: In a pig model, we collected samples from lungs preserved in hypothermia of different lengths. We also collected samples after EVLP, after EVLP+IL-10 and after transplantation and reperfusion of these lungs. We measured concentrations of L-arginine, L-ornithine, L-citrulline LC/MS/MS. We used a chemiluminescence analyzer to measure concentration of NO metabolites. In addition, we measured iNOS and arginases mRNA expression using quantitative polymerase chain reaction (q-PCR). Moreover, we quantified in vitro arginase activity based on the rate of urea production.

Results: We show that cold ischemia had no effect on the concentration of NO metabolites, mRNA expression of iNOS, mRNA expression of arginases or in vitro arginase activity. However, after EVLP or after EVLP+IL-10 gene therapy, NOx levels were significantly lower than 6h CIT (before EVLP). L-citrulline and NOx levels were also lower after EVLP compared to the timed control group, 18h CIT. Additionally, EVLP or EVLP+IL-10 led to an increase in arginase 1 and 2 expressions, which may be responsible for the observed decrease in NO production. Furthermore, after transplantation and reperfusion of lungs which underwent EVLP or EVLP+IL-10, NOx and L-citrulline levels were lower than normal. Moreover, after transplantation and reperfusion arginase1 and 2 mRNA expression was still higher in these lungs than normal control.

Conclusion: These findings suggest that cold ischemia do not cause changes in the L- arginine/NO metabolism. EVLP may cause a reduction in NOS activity independent of IL-10

gene therapy which may be driven by an increase in arginase expression. These differences were still appearing after transplantation and reperfusion. Importantly, the metabolic profile of the L- arginine/NO metabolism in lungs after cold ischemia followed by EVLP or EVLP+IL-10 is different from lungs which preserved only in hypothermia. These differences could contribute to clinical outcomes of transplantation.

4.2 Introduction

In the last decade the number of lung transplantations in Canada increased almost two fold.7 Donor lungs are usually selected based on traditional criteria such as donor’s age, clear chest radiography, clinical history and gas exchange capacity (Table 1‎ -1).8, 9 Currently less than 20% of lungs from multi-organ donors fulfill criteria for transplantation22, 32, while the Canadian Institute for Health Information (CIHI) reported that more than 21% of patients in Canada died waiting on the lung transplantation lists in 2011.7 Using marginal organs and donation after cardiac death could be immediate solutions to expand the donor pool, increase organ availability and decrease wait list mortality.3, 10, 11 However, transplantation of marginal lungs could potentially result in an increase in complications and consequently increased post-transplant morbidity and mortality. 3, 11 EVLP allows surgeons to evaluate lung function after organ harvest but prior to transplantation.18, 23 EVLP provides physiological conditions for maintaining cellular metabolism in the lungs as well as the opportunity for recovery from tissue injury.12, 14, 17, 20 In addition, EVLP provides the opportunity for therapeutic interventions before transplantation.12, 14, 17, 20, 46 For instance, IL-10 gene can be delivered during EVLP.15 IL-10 gene therapy is a potential therapeutic intervention to ameliorate inflammatory injuries in the donor lung as a result of anti-inflammatory effects of IL-10.15, 94

Lung function during EVLP is usually assessed using physiological parameters such as pulmonary dynamic compliance and blood gas analysis.12, 18, 23 Physical factors such as dry/wet weight ratio, flow rate and perfusion pressure are also considered important factors.52 However, metabolic biomarkers are more sensitive indices than physical parameter for the evaluation of lung quality and function.52 Metabolites of the L-arginine/NO metabolism could potentially be used as biomarkers to assess lung function during and after EVLP, but the L-arginine/NO metabolism has not been studied in the setting of EVLP and IL-10 gene therapy in lung transplantation.

NO is an endogenous regulator of many physiological responses.104, 113, 114, 124, 151, 190 NO plays important roles in vascular resistance and in inflammatory responses.68, 116 For instance, NO is a smooth muscle relaxant which can reduce vascular resistance.68, 98, 114, 130 Inhaled NO can be used

therapeutically as a pulmonary vasodilator agent to decrease PVR.176 Gas exchange and oxygenation properties, the ratio of arterial oxygen tension to inhaled oxygen fraction (PaO2/FiO2), was improved in patients that underwent inhaled NO therapy for treatment or prevention of early allograft dysfunction following lung transplantation.87 In addition, it was shown that administration of inhaled NO during EVLP led to improvement in oxygenation of lungs and pulmonary artery blood flow after transplantation in a rat model.56

The cytokine IL-10 plays crucial roles in the regulation of inflammatory responses.91 IL-10 inhibits macrophages and dendritic cells function and subsequently suppresses T helper-1 and -2 cell responses.90 In addition, in macrophages IL-10 inhibits synthesis of pro-inflammatory cytokines such as TNF-α.93 While IL-6 and IL-8, are considered risk factors for post- transplantation mortality, IL-10 is known as a protective factor.33 In the donor lung the ratio of IL-6 to IL-10 prior to transplantation has been demonstrated as a predictor for early mortality following lung transplantation.33 Increased IL-8 levels in the donor lung are associated with early lung dysfunction and higher mortality rate following lung transplantation.92 IL-10 can reduce NO production in macrophages.51, 156-158 In a study of murine activated macrophages it was shown that in addition to inhibition of iNOS protein expression, IL-10 causes suppression of CAT 2 transcription, a transporter for cationic amino acids including L-arginine, which can result in reduce L-arginine bioavailability for intracellular NOS.51 It has been demonstrated that IL-10 gene therapy reduced inflammation and improved lung function in the human lungs that were rejected for transplantation.15

In this chapter we characterized the L-arginine/NO metabolism at different time points in a pig model of lung transplantation (specific aim 1). Furthermore, we investigated the effects of IL-10 gene therapy on the L-arginine/NO metabolism in lung transplantation to accomplish specific aim 2.

4.3 Study designs and experimental approach

Lung tissue samples were taken from a pig model of lung transplantation study performed by a group of surgeons at the Latner Thoracic Surgery Research Laboratories, University Heath

Network, Toronto General Hospital (TGH). This study was designed to understand different effects of EVLP and EVLP+IL-10 gene therapy during EVLP on the L-arginine/NO metabolism.

In chapter 2 we described the procedure of lung transplantation. In brief, according to regulations and guidelines male Yorkshire domestic pigs (25 to 35 kg) were used in our model.24, 25 Following induction of anesthesia and intubation24, 159, lungs were retrieved, flushed with Perfadex162 from animals in all groups and kept at 4ºC. There were different experimental groups in the study design. In the “no EVLP” group, lungs were kept at 4 C for 18 hours followed by left lung transplantation. In the “EVLP” group lung were kept at 4 C for 6 hours before undergoing 12 hours of EVLP followed by left lung transplantation and reperfusion.14, 46 In the “EVLP+IL-10”group, lungs were preserved at 4C for 6 hours followed by 12 hours of EVLP. Adenoviral vector containing the human IL-10 gene was delivered to the airways through a flexible fiber-optic bronchoscope approximately one hour after EVLP was started.24 The left lungs were then transplanted into the recipient animals.

To study the L-arginine/NO metabolism during different stages of lung transplantation and following therapeutic interventions, we collected lung tissue samples at different time points as specified below (Figure 4‎ -1):

A. 0h CIT: time of harvesting the lungs in all animals, samples were taken from flushed lungs with Perfadex prior to CIT.

6h CIT: in the “EVLP” and “EVLP+IL-10” groups samples were taken 6 hours after cold static preservation. Six hours is accepted as an optimal time for lungs to maintain pulmonary function after transplantation.21

B. 18h CIT (timed control): in the “no EVLP” group samples were collected after 18 hours of cold ischemia. This group was the timed control group in this study as in other groups the lungs were transplanted after 6 hours of cold ischemia followed by 12 hours of EVLP. C. 6h CIT+12h EVLP: in the “EVLP” group samples were taken after 12 hours of EVLP using acellular perfusate, STEEN solution™.

Figure 4‎ -1: Pig lung transplantation study designs. The study was designed to investigate the effects of EVLP and IL10 gene therapy during EVLP on the L-arginine/NO metabolism. Samples were taken at different time points as follows: A:0h CIT, Time of harvesting of the lung from donor after flushing with Perfadex; B:6h CIT, after 6 hours of cold ischemia; C:18h CIT (timed control), after 18 hours of cold ischemia; D:6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP; E: 6h CIT+12h EVLP+IL-10, after 6 hours of cold ischemia followed by IL-10 gene therapy and 12 hours of EVLP, F: 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; G:EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; H:EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group; I: recipient left lung, immediately after removal of lung from recipient animals; EVLP, ex vivo lung perfusion; CIT, cold ischemia time; TOH, time of harvesting; LTx, lung transplantation; RLL, recipient left lung; IL-10, interleukin-10.

6h CIT+12h EVLP+IL-10: in the “EVLP+IL-10” group samples were taken after 12 hours of EVLP using a cellular perfusate, STEEN solution™. Twelve hours of EVLP provides a time window after delivery of the IL-10 gene vector to the airways for effective therapeutic levels of gene expression at reperfusion time.96

D. 18h CIT/1h post rep: in the “no EVLP” group samples were taken 1 hour after transplantation and reperfusion. E. EVLP/1h post rep: in the “EVLP” group samples were taken 1 hour after transplantation and reperfusion. F. EVLP+IL-10/1h post rep: in the “EVLP+IL-10” group samples were taken 1 hour after transplantation and reperfusion. G. Recipient left lung: samples were collected immediately after removal of the left lungs in recipients as normal control lungs. These samples allow a comparison of lung after transplantation and reperfusion with perfused normal lung.

We analysed the samples as follows, which are explained in detail in chapter 2:

1. L-arginine, L-ornithine, L-citrulline and ADMA concentrations were measured using LC/MS/MS. Concentrations were measured in lung tissue homogenates from recipient left lung as well as in lungs before and after transplantation and reperfusion in the “no EVLP” and “EVLP” groups. These data were expressed as true concentrations and normalized for protein content in the homogenates.

¯ ¯ NOx including NO3 , NO2 and SNOs were measured using chemiluminescence analyzer (Eco Physics, Dűrnten, Switzerland).168

2. Arginase 1, arginase 2 and iNOS mRNA expression in lung tissue was measured using q- PCR. The data for mRNA expressions in normal lungs and donor tissue samples at the time of harvesting (0h CIT) were expressed as a ratio of target mRNA over beta actin mRNA expression for other time points data were expressed as fold changes from 0h CIT. 3. Protein expression of arginase 1 and arginase 2 were measured using Western blot analysis.

In vitro arginase activity was measured based on the rate of urea production from L-arginine, according to a protocol previously published by Corraliza.172

NOx concentrations, mRNA expression, protein expression and arginase activity were measured in lung tissue homogenates at all time point in all groups.

All data are shown as the mean ± SEM. Comparison between three groups or more was done using one-way ANOVA and Tukey’s multiple comparison test, or Kruskal-Wallis test and Dunn's multiple comparison test was used. Between two groups unpaired or paired t-test was used where appropriate. Statistical software package in Prism 5 (GraphPad Software, San Diego, CA) was used for statistical analysis. p values of <0.05 were considered to represent significant differences between group of samples.

4.4 Results

In the previous chapter we described evidence for possible changes in the balance of arginase and NOS activity. However, concentrations of NOx were not measured in those samples. The present study design allowed us to measure NOx concentrations in tissue samples after cold ischemia of different lengths. These data help us understand whether the length of the cold ischemia time has any effect on NO production. The current study design also let us investigate whether EVLP or EVLP plus IL-10 gene therapy lead to changes in the L-arginine/NO metabolism compared to the lungs after 6 hours of cold ischemia (before EVLP) or to the lungs after 18 hours of cold ischemia (timed control). Furthermore we were able to compare the L- arginine/NO metabolism in transplanted lungs to naive control lung (recipient left lung).

4.4.1 Length of cold ischemia time does not affect L-arginine metabolism.

NOx concentration after different lengths of cold ischemia was measured to study if the duration of hypothermic preservation causes changes in NOx. Our data showed that concentrations of NOx in lungs obtained after different lengths of cold ischemia time were not different from those of normal control lung at the time of harvesting (0h CIT) (Kruskal-Wallis test)(Figure 4-2-A). Expression of mRNA for iNOS (Figure 4-2- B) arginase 1(Figure 4-2-C), and arginase 2

A B

6 10

8 4 6

4 mol/g protein) mol/g

 2 iNOS mRNA iNOS

2 NOx ( NOx

0 from 0h-CIT) change (Fold 0

0h CIT 6h CIT 0h CIT 6h CIT

18h CIT (timed control) 18h CIT (timed control)

C D

25 60 20 40 10 20 8 15 6 10

4 Arginase 2 mRNA 2 Arginase

Arginase 1 mRNA 1 Arginase 2 5 (Fold change from 0h-CIT) change (Fold (Fold change from 0h-CIT) change (Fold 0 0

0h CIT 6h CIT 0h CIT 6h CIT

18h CIT (timed control) 18h CIT (timed control)

Figure 4-2: Different length of cold ischemia has no effect on NOx concentration or expression of iNOS, arginase 1 or arginase2 mRNA in lung tissue (Kruskal-Wallis test). A, NOx (mol/g protein); B, iNOS mRNA (fold change to time of harvesting); C, arginase1 mRNA (fold change to time of harvesting); D, arginase 2 mRNA (fold change to time of harvesting). Samples were taken at different time points as follows: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 18h CIT (timed control), 18 hours after cold ischemia. Data for 6h CIT and 18h CIT are identical to Figure 4-3.

(Figure 4-2-D) (Table 4‎ -1) were also not different between groups (Kruskal-Wallis test). Importantly, this finding confirms the observation in previous chapter which levels of L-arginine and its metabolites also were not different after different length hypothermic preservation.

4.4.2 EVLP decreases NOx concentrations in lung tissue.

Effects of EVLP and IL-10 gene therapy during EVLP on the L-arginine/NO metabolism have not been studied previously. Therefore, we analyzed the samples to understand if EVLP and/or IL-10 gene therapy affect the L-arginine/NO metabolism. Interestingly, compared to 6h CIT, NOx levels were significantly reduced after EVLP (p<0.05, one way ANOVA, Tukey's multiple comparison test) or after EVLP + IL-10 (p<0.01, one way ANOVA, Tukey's multiple comparison test). NOx levels after EVLP were also lower than in the timed control (18h CIT) group. Although this did not quite reach statistical significance, demonstrated that NOx was not reduced over the time. After EVLP+IL-10 NOx concentration was significantly lower than timed control group (p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test) (Figure 4-3-A). The concentration of L-citrulline, was also lower after EVLP compared to timed controls and again did not quite reach statistical significance (p= 0.067, unpaired t test) (Figure 4-3-B).

Parallel decreases in NOx and L-citrulline concentrations after EVLP likely reflect a decrease in NOS activity. Increased levels of NOS inhibitors can result in decreased NO production. However, the concentration of ADMA, as well as the L-arginine/ADMA ratio, an index for NOS impairment, was not different after EVLP compared to timed controls. In addition, there were no changes in the expression of iNOS mRNA comparing 6h CIT and to timed controls (Figure 4-4-

A, Table 4‎ -1, Table 4‎ -2).

On the other hand, compared to 6h CIT, arginase 1 mRNA expression was significantly increased after EVLP (p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test or EVLP+IL-10 (p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test (Figure 4‎ -4-B). Similarly, arginase 2 mRNA expression was increased after EVLP (p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test of after EVLP + IL-10 (p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test compared to 6h CIT (Figure 4‎ -4-C). Arginase competes for L-arginine

as substrate which can cause low L-arginine bioavailability for NOS and decreased NO production. The indices for L-arginine bioavailability, L-arginine/L-ornithine ratio and L- arginine/ (L-ornithine+L-citrulline) ratio were not different after EVLP compared to timed controls (Table 4‎ -3). Moreover, in vitro arginase activity was not different comparing lungs before and after EVLP in all groups (Table 4‎ -4). These findings suggest that EVLP could cause alterations in the L-arginine/NO metabolism and low NO production which cannot be explained by measures of L-arginine availability or NOS expression. The changes in the L-arginine/NO metabolism which caused by EVLP cannot be prevented by IL-10 gene therapy.

B 0.067 A * 2.0 8

1.5 6

1.0 4

mol/g protein) mol/g

 L-citrulline

0.5 2

nmol/mgprotein NOx ( NOx 0.0 0

6h CIT+12h EVLP 6h CIT+12h EVLP

18-h CIT (timed control) 18h CIT (timed control) 6h CIT+12h EVLP+IL-10

Figure 4-3: Concentrations of NOx and L- citrulline was decreased after EVLP (* p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test); A, NOx (mol/g protein); B, L-citrulline (nmol/mg protein). Samples were taken at different time points: 6h CIT, 6 hours after cold ischemia; 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by 12 hours of EVLP in the “EVLP+IL-10” group. Data for 18h CIT is identical to Figure 4-2.

Table 4‎ -1: Expression of arginases and iNOS mRNA in lungs at different time points in the “EVLP” and “no EVLP” groups.

Arginase1 mRNA Arginase2 mRNA

iNOS mRNA iNOS mRNA

Number of Number of Number of

expression expression expression

sample samples samples

0h CIT 10 1±0 10 1±0 10 1±0

6h CIT 10 1.26±0.27 12 9.50±5.34 11 1.70±0.40

18 h CIT (timed 4 1.88±0.82 4 4.51±2.57 4 3.74±1.64 control)

6h CIT+12h EVLP 5 7.00±3.46 5 13.68±9.76 4 2.56±0.86

6h CIT+12h EVLP 6 4.35±1.21 5 6.89±1.94 5 1.02±0.26 +IL-10

18h CIT/1h post rep 4 2.73±.073 4 13.60±5.75 4 3.55±1.67

EVLP/1h post rep 6 6.67±1.99 5 8.13±2.76 6 1.39±0.35

EVLP+IL-10/1h post 5 8.93±2.64 5 10.85±3.11 5 0.87±0.42 rep Fold changes of mRNA expression to the time of harvesting for arginase1, 2 and NOS are shown as meanSEM. Samples were taken at different time points as follows: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by 12 hours of EVLP in the “EVLP+IL-10” group; 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group.

Table 4‎ -2: Concentrations of amino acids and ADMA in lung at different time points in the “EVLP” and “no EVLP” groups and in recipient left lungs.

L L

Number

- -

samples

ADMA

ornithine citrulline

arginine

18 h CIT (timed 4 28.402.23 5.800.68 3.540.58 0.190.04 control)

6h CIT+12h EVLP 6 42.82±11.61 4.70±1.54 1.60±0.50 0.22±0.05

18h CIT/1h post rep 4 35.23±4.16 8.43±1.29 5.06±0.66 0.16±0.03

EVLP/1h post rep 6 32.31±5.16 4.93±0.80 3.11±0.48 0.13±0.02

Recipient left lung 5 30.81±2.03 6.85±1.14 5.82±0.28 0.16±0.01 Concentrations of amino acids and ADMA (nmol/mg protein) are shown as meanSEM. Samples were taken at different time points: 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; Recipient left lung, normal lung tissue samples.

A 10

4 iNOS mRNA iNOS 2

(Fold change from 0h-CIT) from change (Fold 0

6hCIT

6h CIT+12h EVLP

18h CIT (timed control) 6h CIT+12h EVLP+IL-10

* B * C * 25 * 60 20 40 10 20 8 15 6 10

4 Arginase 1 mRNA 1 Arginase

2 mRNA 2 Arginase 5 (Fold hange from 0h-CIT) from hange (Fold (Fold change from 0h-CIT) from change (Fold 0 0

6hCIT 6hCIT

6h CIT+12h EVLP 6h CIT+12h EVLP

18h CIT (timed control) 6h CIT+12h EVLP+IL-10 18h CIT (timed control) 6h CIT+12h EVLP+IL-10

Figure 4‎ -4: EVLP does not affect iNOS expression but increases arginase1 and arginase2 mRNA expression in lung; * p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test.

A, iNOS mRNA (fold change to time of harvesting); B, arginase1 mRNA (fold change to time of harvesting); C, arginase2 mRNA (fold change to time of harvesting). Samples were taken at different time points: 6h CIT, 6 hours after cold ischemia; 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by 12 hours of EVLP in the “EVLP+IL-10” group. Data for 6h CIT and 18h CIT are identical to Figure 4-2.

Table 4‎ -3 Indices of L-arginine bioavailability and NOS impairment in lungs at different time points in the “EVLP” and “no EVLP” groups and in recipient left lungs

ornithine+L

Number of

arginine

ornithine/L

ornithine citrulline

arginine/L

samples

itrulline) ADMA

arginine/

/ (

18 h CIT (timed 4 5.18±0.97 3.07±0.36 1.80±0.35 159.7±26.88 control)

6h CIT+12h EVLP 6 11.65±3.03 7.89±1.79 3.29±0.69 188.1±19.86

18h CIT/1h post rep 4 4.55±0.91 2.77±0.48 1.71±0.30 232.1±26.15

EVLP/1h post rep 6 7.12±1.14 4.13±0.37 1.62±0.20 240.5±17.29

Recipient left lung 5 4.93±0.82 2.51±0.27 1.16±0.16 194.4±20.63 Ratios for amino acids availability and NOS impairment are shown as meanSEM. Samples were taken at different time points: 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; Recipient left lung, normal lung tissue samples.

Table 4‎ -4: Lung NOx concentrations and in vitro arginase activity in “EVLP” and “no EVLP” groups and in recipient left lungs.

Number of Number of

Arginase

samples samples

activity

NOx

0h CIT 16 11.12±1.81 15 2.14±0.39

6h CIT 11 10.6±1.54 9 2.26±0.52

18 h CIT (timed control) 4 10.22±2.85 4 1.37±0.21

6h CIT+12h EVLP 6 6.71±0.83 6 0.71±0.19

6h CIT+12h EVLP +IL-10 8 8.15±2.02 7 0.47±0.15

18h CIT/1h post rep 4 9.80±2.41 4 1.79±0.29

EVLP/1h post rep 6 9.78±1.37 6 1.32±0.16

EVLP+IL-10/1h post rep 8 8.58±1.86 7 1.30±0.37

Recipient left lung 13 13.24±1.27 9 2.56±0.22 Concentrations of NOx (mol/g protein) and in vitro arginase activity(mUnit/ mg protein) are shown as meanSEM. Samples were taken at different time points as follows: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by 12 hours of EVLP in the “EVLP+IL-10” group; 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; EVLP/1h post rep , 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group ; Recipient left lung, normal lung tissue samples.

4.4.3 NOx is decreased after lung transplantation and reperfusion following EVLP or EVLP+IL-10

To investigate the effects of EVLP and IL-10 gene therapy during EVLP on the L-arginine/NO metabolism in lungs after transplantation and reperfusion, we analyzed the samples from lungs 1 hour after transplantation and reperfusion. We found that NOx concentrations were decreased after transplantation and reperfusion in the “EVLP” group (p<0.05, Kruskal-Wallis test, Dunn’s multiple comparison) or the “EVLP+IL-10” group (p<0.05, Kruskal-Wallis test, Dunn’s multiple comparison) when compared to control recipient left lung, respectively (Figure 4-5-A).

In addition, L-citrulline levels in the “EVLP” group were lower after 1 hour of transplantation and reperfusion than in control recipient left lung (p<0.05, Kruskal-Wallis test, Dunn’s multiple comparison) (Figure 4-5-B). In contrast, concentrations of L-arginine, L-ornithine and ADMA were not different in lung 1 hour after transplantation and reperfusion after EVLP or after 18h hypothermic preservation (timed control) when compared to the normal control group (Kruskal- Wallis test) (Table 4‎ -2). Again, similar changes in NOx and L-citrulline are suggestive of reduced NOS activity. iNOS expression was not different after reperfusion in any groups compared to the time of harvesting (Kruskal-Wallis test) (Table 4‎ -1). However, in the “EVLP” or “EVLP+IL-10” groups arginase 1 mRNA expression was significantly higher 1 hour after transplantation and reperfusion than at the time of harvesting (0h CIT) (p<0.01, Kruskal-Wallis test, Dunn’s multiple comparison) (Figure 4-6-B). Additionally, arginase 2 expression 1 hour after transplantation and reperfusion was significantly higher than at the time of harvesting (0h CIT) in all groups (p<0.05 for 18h CIT/1h post rep and EVLP/1h, p<0.01 for EVLP+IL-10/1h post rep, Kruskal-Wallis test , Dunn’s multiple comparison). Increased arginase activity could contribute to decreased NO production. Interestingly, however, the L-arginine/ (L-ornithine+L-citrulline) ratio, an index of global L-arginine bioavailability, was higher in lungs 1 hour after transplantation and reperfusion in the “EVLP” group than in normal lungs (p<0.05, Kruskal-Wallis test, Dunn’s multiple

comparison) (Figure 4-6-D). Moreover, in vitro arginase activity was not different in any groups after transplantation and reperfusion compared to normal controls (Kruskal-Wallis test) (Table

4‎ -4).

We must mention that, the mRNA expression for arginase 1 and arginase 2 (ratio of arginases/actin) was not different in recipient left lung (unpaired t test), which contained blood, and donor lungs at the time of harvesting (0h CIT), which were blood free (Figure 4-6-A, Figure 4-6-C). Thus for analysis of arginase mRNA expression we used data from lungs at the time of harvesting for comparison of all time points including sample from lungs 1 hour after transplantation and reperfusion.

These analyses revealed that NO production is reduced after EVLP, EVLP + IL-10 or one hour after transplantation and reperfusion of lungs.

A * 6 *

4 mol/g protein) mol/g

 2 NOx ( NOx 0

Recipient left lung EVLP/1-h post rep 18h CIT/1-h post rep EVLP+IL-10/1-h post rep * B C 8 * 6

6 4

2 L-citrulline

2 nmol/mgprotein

0 0 L-arginine/L-ornithine+L-citrulline

Recipient left lung EVLP/1h post rep Recipient left lung EVLP/1h post rep 18h CIT/1h post rep 18h CIT/1h post rep

Figure 4-5: NOx and L-citrulline levels decrease after lung transplantation and reperfusion while global L-arginine availability increases (* p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test). A, NOx (mol/g protein); B, L-citrulline (nmol/mg protein); C, global L-arginine availability. Samples were taken at different time points as follows: 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group (timed control); EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group; Recipient left lung, normal lung tissue samples.

A B 6 10

8 4

actin actin

  4

Arg 1/ Arg 2/ Arg 2

0 0

0h CIT 0h CIT

Recipient left lung Recipient left lung

** C * ** D 25 60 * ** 40 20 20

15 15

10 10 Arginase 2 mRNA 2 Arginase

Arginase 1 mRNA 1 Arginase 5 5 (Fold Change from 0h-CIT) from Change (Fold (Fold Change from 0h-CIT) from Change (Fold 0 0

0h CIT 0h CIT

EVLP/1-h post rep EVLP/1-h post rep 18h CIT/1-h post rep 18h CIT/1-h post rep EVLP+IL-10/1-h post rep EVLP+IL-10/1-h post rep

Figure 4-6: Arginase1 and arginase2 mRNA expression is not different in recipient left lung compared to 0h CIT (unpaired t test). Arginase1 and arginase2 mRNA expressions increase after lung transplantation and reperfusion (**p<0.01; * p<0.05, Kruskal-Wallis test, Dunn's multiple comparison test). A, arginase1 mRNA (arginase1/β actin); B, arginase2 mRNA (arginase2/β actin); C, arginase1 (fold change to time of harvesting); D, arginase2 (D) mRNA (fold change to time of harvesting). Samples were taken at different time points: 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group (timed control); EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group; Recipient left lung, normal lung tissue samples.

4.5 Discussion

In this section we measured NOx concentrations as well as the expression and activity of arginases in lung tissue in order to study effects of cold ischemia on the balance of arginase and NOS activity. We also measured concentrations of L-arginine and its metabolites as well as tissue expression of arginase isoforms and total arginase activity to study the effects of EVLP and of IL-10 gene therapy during EVLP on the L-arginine/NO metabolism in the lung. In addition, we studied the effects of these interventions during lung preservation on concentrations of L-arginine and its metabolites as well as on arginase expression and activity in lungs 1 hour after transplantation and reperfusion. Our data demonstrated that 6 or 18 hours of cold preservation had no effects on the L-arginine/NO metabolism in lung tissue. In contrast, after EVLP or EVLP+IL10 gene therapy NOx levels were lowered. L-citrulline levels in lungs after EVLP were also lower than timed control. Moreover, arginase 1 and 2 mRNA expressions were increased in lungs after EVLP or EVLP+IL-10 compared to normal controls. We also observed reduced NOx and L-citrulline levels in addition to increased arginase1 and 2 mRNA expression in the EVLP and EVLP+IL-10 groups one hour after transplantation and reperfusion. Therefore, EVLP caused changes in the L-arginine/NO metabolism in lungs an effect that was sustained one hour after transplantation and reperfusion. IL-10 gene therapy during EVLP did not affect these alterations.

4.5.1 Cold ischemia does not cause alteration in the L-arginine/NO metabolism

It is well known that cold ischemia results in metabolic changes in the lung.72, 183 In the previous chapter however, we had found that cold ischemia had no significant effect L-arginine, L- ornithine, L-citrulline or ADMA in lung homogenates, when expressed as log-normalize data as a scaled intensity (relative quantification). Small differences did however result in a lower L- ornithine/L-citrulline ratio after 6 hours of cold ischemia compare to the time of harvesting (0h CIT). This observation could be reflective of a change in the balance of arginase and NOS activity.121

In the previous chapter HPLC-MS was used to quantify the L-arginine metabolites but NOx, a surrogate marker of NOS activity, was not measured in those samples. Therefore, for this part of the thesis, we processed lung tissue samples after cold ischemia of different lengths for NOx measurements, iNOS gene expression, arginases gene expression and total arginase activity. Our data showed that none of these measures were affected by 6 or 18 hours of cold ischemia (Table 4‎ -1, Table 4‎ -4). Therefore, we concluded that cold ischemia has no effect on the L-arginine/NO metabolism in lung tissue.

In a different study of lung transplantation in the rat it was shown that NO production after 6 hours of cold preservation was decreased compared to fresh lungs.174 In this model NO was directly measured using an electrode on the surface of the lung tissue,174 which is different from our study as we measured stable NO metabolites including nitrites, nitrates and S-nitrosothiols in lung tissue homogenates. NO is produced intracellular and NO production on the surface of lung tissue might not represent NO production by all cell types in the lung tissue. On the other hand, similar to our study in pigs, in a model of lung transplantation in the rat the expression of all isoforms of NOS remained unchanged after 12 hour of cold preservation compared to the baseline.190 Results from this study also supports the idea that hypothermic preservation does not affect the L-arginine/NO metabolism.

4.5.2 NOx and L-citrulline in lung tissue decrease after EVLP and remained below normal after reperfusion

Normothermic EVLP provides physiological conditions12, 14, 17, 25 but may cause changes in cellular metabolism in lung tissue over time.191 However, to our knowledge, the NO metabolism in lung tissue has not been previously described after EVLP. Thus, in the next step we tried to determine whether EVLP had an effect on the L-arginine metabolism.

Our data revealed that lung NOx concentrations after 12 hours of EVLP were lower than after 6h CIT (before EVLP) (Figure 4-3-A). In addition, NOx and L-citrulline concentrations, both products of NOS activity, were lowered after EVLP compared to the timed control group (18h CIT) (Figure 4-3-A, B). Similar to our study, it was shown that FeNO, one other surrogate

measure of lung NO production, was reduced in the isolated perfused and ventilated pig lung.192 Decreased NOx and L-citrulline concentrations were also demonstrated after transplantation and reperfusion in the “EVLP” group (Figure 4-5-A, B). Hence, based on parallel changes of both products of NOS we concluded that EVLP resulted in decreased NOS activity which was not resolved 1 hour after transplantation and reperfusion. Interestingly, IL-10 gene therapy during EVLP had no measurable effect on NO metabolites after EVLP or after transplantation and 1 hour reperfusion.

Members of Dr, Keshavjee’s lab from the Toronto lung transplant program reported that the physiological assessment of animals, such as PaO2, after transplantation and reperfusion in the no EVLP (timed control) group was lower than in EVLP group (unpublished data). Thus, it is possible that changes in NO production from NOS contribute to clinical outcomes. IL-10 gene therapy during EVLP resulted in better lung function 7 days after transplantation (Dr, Keshavjee’s lab, unpublished data). Hence, evaluation of the L-arginine/NO metabolism after EVLP and 1 hour after reperfusion may not be an indicator for long term effects of IL-10.

To investigate potential causes of decreased NOx and L-citrulline concentrations, the NOS inhibitor ADMA, mRNA expression of iNOS and arginase isoforms as well as in vitro arginase activity were measured. As explained earlier, L-arginine is metabolized to L-citrulline and NO by NOS isoforms, ADMA is an endogenous competitive inhibitor of NOS and arginase competes with NOS for L-arginine as substrate.98, 99 Alterations in the expression and activity of NOS can lead to changes in NO production. We did not find significant changes in mRNA expression of iNOS. NOS expression and activity were investigated in a few earlier studies in lung transplantation, with conflicting results.56, 190, 193 Similar to our study, 15 minutes after EVLP using STEEN solution™ as perfusate, iNOS gene expression was not affected in lungs in a rat model of EVLP.56 Conversely, the expression of iNOS mRNA in allograft lungs after ex vivo reperfusion was higher than in normal lung in other rat models of lung transplantation190, 193 while eNOS expression decreased.190 These models were designed to mimic the acute rejection or I/R injury after lung transplantation. In our study samples were collected from lungs that mimicked clinically accepted lungs without serious injuries. Sever lung injuries may contribute to high expression of iNOS in response to inflammation in other studies.190

We found similar levels of ADMA and L-arginine/ADMA ratios at different time points in all groups (Table 3‎ -1). The L-arginine/ADMA ratio can be used as an index for NOS impairment, as ADMA acts as a competitive and reversible inhibitor of NOS.144 These findings indicated that ADMA is not responsible for reduced NO production. In the previous chapter we also observed that ADMA levels after transplantation and reperfusion in lungs from different types of donor were similar.

The availability of L-arginine for NOS is a critical factor for NO production.98, 99 Other authors used indices such as L-arginine/L-ornithine and arginine/L-ornithine+L-citrulline in serum to estimate the L-arginine bioavailability for intracellular NOS at a given L-arginine concentration.98, 99, 115, 135, 136 We used tissue homogenates to measure concentrations of amino acids. Therefore, changes in intracellular L-arginine availability may not be reflected by these ratios in tissue homogenates. We did not find changes in these indices at different time points with the exception of an increased L-arginine/ (L-ornithine+L-citrulline) ratio at 1 hour post- transplantation and reperfusion in the “EVLP” group compared to control (recipient left lung) (p=0.0083, unpaired t test) (Figure 4-5-C). However, measurements of expression and activity of amino acid transporters are needed to understand changes in the cellular L-arginine uptake during transplantation.

Another contributor for decreased L-arginine bioavailability for NOS is increased expression and activity of arginases, competing enzymes for NOS.122 The expression of arginase isoforms and in vitro arginase activity after lung transplantation and reperfusion were not published previously. Our data showed that mRNA expression of arginase isoforms was increased after EVLP, and transplantation and reperfusion of the “EVLP” and “EVLP+ IL-10” groups compared to the time of harvesting which could explain reduced NO production. However, in vitro arginase activity was not changed. Moreover, concentration of L-ornithine, a product of arginase activity, was similar at all time points.

Urea, the other product of arginase activity,99 cannot be used as a reliable indicator for in vivo arginase activity as urea concentrations depend on other variables such as dehydration and renal function. Blood urea nitrogen (BUN) is higher in dehydrated patients because urine flow rate

100

decreases and renal urea reabsorption increases in dehydration state.187 In addition, insufficient clearance of urea from the blood because of renal dysfunction during and after surgery can result in very high concentration of urea.188 There are also other important sources of urea. For example, urea can be produced from ammonium by hepatocytes via the urea cycle.194 Therefore we did not measured urea concentrations in our study.

There was a possibility that in the isolated circuit of EVLP the differences in NOx and L- citrulline were caused by dilution effects of acellular perfusate, which contained human serum albumin, dextran, electrolyte, heparin, Solu-Medrol, and Cefazolin (Table 2‎ -1).15, 24, 163 NOx concentration in the perfusate was significantly lower than in lung tissue homogenates (2.417±0.3708 in perfusate vs. 197.1±19.53 µM before correction with protein concentration in tissue homogenates, p<0.0001, unpaired t test). However, importantly no differences were found for any of the other amino acids that were measured and of ADMA (Table 4‎ -2). If acellular perfusate had dilution effects on L-citrulline and NOx, we should expect that concentrations of other amino acids after EVLP should also be lower than before EVLP. Therefore, lower NOx and L-citrulline concentrations after EVLP are unlikely to be caused by a dilution effect of the perfusate.

Systemic changes in the L-arginine metabolism in the recipient during the transplantation procedure may contribute to changes in L-citrulline and NOx levels in lungs after transplantation and reperfusion compared to recipient left lung. Samples from the recipient left lung were taken about 2 hours after induction of anesthesia in the recipient, while the samples from re-perfused lungs were taken from the same animals 3 to 4 hours later. Therefore, longer period of surgery and longer starvation time as well as blood loss, dehydration and renal failure due to the surgery could result in differences in biochemical markers.188, 195 However, transplantation and reperfusion had no effect on concentrations of L-arginine, L-ornithine or ADMA in lungs compared to recipient left lungs (Table 4‎ -2). Thus, we have evidence that systemic changes in the L-arginine/NO metabolism are not responsible for the decrease in NOx and L-citrulline concentrations. Decreased NO production after transplantation and reperfusion has been previously described in a rat model of lung transplantation, which is in agreement with our conclusion.174

101

There are a number of limitations of this study. Western blotting for protein expression of arginase isoforms were not run in a same blot for electrophoresis because only 15 wells were available in each blot. Therefore, a comparison of data from Western blotting could be problematic and must be interpreted with caution. Although we calculated the ratio of target proteins to housekeeping protein (β actin), the observed differences might be influenced by other factors. For instance, films are extremely sensitive to chemiluminescent signals but the dynamic range of quantification is limited, small differences in the length of exposure time to the films would result in remarkable differences in the density.196 Therefore, data from western blotting were not used in this study (appendix).

Moreover, the expression of eNOS and nNOS mRNA as well as the protein expression for all isoforms of NOSs and activity of each isoforms of NOS were not measured in the present study. Therefore we can only speculate that changes in NOx concentration would not be driven by changes iNOS at mRNA transcriptional level. Furthermore, in the present study concentrations of L-arginine, L-ornithine, L-citrulline and ADMA in the lungs were not measured at the time of harvesting (0h CIT) and at 6 hours cold ischemia in the “EVLP” and “no EVLP” groups as well as all time points in the “EVLP+IL-10” group. Data for these time points may have allowed us to understand whether IL-10 gene therapy had an effect on the L-arginine/NO metabolism in lung tissue.

To quantify arginase activity in vitro, we provided high concentrations of L-arginine, i.e. 20 mM172 compare to normal plasma concentration of 150-250 µM.197 Consequently, the effect of substrate availability and the role of endogenous competitive enzyme inhibitors are eliminated. Therefore, the results of in vitro arginase activity may not accurately reflect in vivo enzyme activity. However, we did not find differences in the concentration of L-ornithine, a product of arginase activity, in lung homogenates at different time points in different groups which suggested that arginase activity was not altered in vivo.

Furthermore, the L-arginine ratios might not be appropriate indices in our study as we measured these amino acids in tissue homogenate but not serum. Therefore, these ratios in our study might not reflect the bioavailability of L-arginine for intracellular NOS.

102

In summary, in this chapter we found that hypothermic preservation of up to 18 hours did not result in changes in the L-arginine/NO metabolism in lung tissue. These finding are consistent with findings in the previous chapter, where concentrations of L-arginine, L-ornithine and L- citrulline after different lengths of cold ischemia remained unchanged. Interestingly, NO production by NOS in lung tissue was decreased after EVLP and stayed below normal 1 hour after transplantation and reperfusion. These alterations were not driven by changes in iNOS mRNA expression or ADMA concentration. After EVLP, transplantation and reperfusion the expression of arginases was increased. IL-10 gene therapy during EVLP did not prevent changes in the L-arginine/NO metabolism introduced by EVLP.

Further investigations of for instance the L-arginine transporters systems may help understand causes of the observed alteration in the L-arginine/NO metabolism. Overall, our findings suggest that EVLP resulted in a decrease in lung NOS activity that was sustained after transplantation and reperfusion and was unaffected by IL-10 gene therapy during EVLP.

103

Chapter 5: Discussion, conclusion and future directions

104

NO plays important roles in I/R injury and in rejection following lung transplantation.88, 179 The design of our study allowed us to investigate effects of different length of cold ischemia on the L-arginine/NO metabolism. We were able to characterize the L-arginine/NO metabolism in the lungs of brain death donors in comparison to lungs with prolonged preservation. The model also provided an opportunity to investigate effects of EVLP and of IL-10 gene therapy during EVLP on the L-arginine/NO metabolism at different stages of lung transplantation. We observed that different lengths of cold ischemia had no effect on concentration of L-arginine and its metabolites in lung tissue. Metabolic profile of the L-arginine metabolism was different in lungs of brain death donors compared to lungs after prolonged cold preservation. Importantly, we found that lung L-citrulline and NOx concentrations following EVLP were decreased, and remained decreased after transplant and reperfusion. IL-10 gene therapy during EVLP had no effect on NOx or L-citrulline levels after transplantation.

5.1 Regulation of NO production

5.1.1 NOS expression and activity

NO production by iNOS in cells can be regulated at gene transcription levels in response to inflammation.111, 112 Therefore, iNOS mRNA expression at different stages of lung transplantation was investigated in our study. Expression and activity of NOS have been investigated in other studies in lung transplantation settings. For instance, in a rat model of lung transplantation, it was shown that 12 hours of cold preservation had no effect on iNOS mRNA expression, however, iNOS was increased significantly 2 hours after reperfusion.190, 193 Increased iNOS expression and higher NO production was described at the early phases of acute lung rejection after transplantation.193, 198, 199 The severity of acute lung rejection after transplantation was attenuated after inhibition of iNOS in a rat model.200 Protein expression of iNOS and eNOS in lung tissue increased significantly after reperfusion while total NOS activity was not changed and stayed at very low levels in a rat model.190 We did not find any differences in iNOS mRNA expression at different time points which means that cold ischemia, EVLP, IL-10 gene therapy during EVLP or transplantation and reperfusion did not result in detectable induction of iNOS expression in lung.

105

5.1.2 ADMA an endogenous NOS inhibitor

NOS inhibitors such as ADMA can cause a significant decrease in NO production.77, 118 Changes in ADMA concentration contribute to the pathogenesis of pulmonary diseases such as asthma and cystic fibrosis.118, 139 The ratio of L-arginine/ADMA is considered as an index for impairment of NOS activity.144 Our data did not show differences in ADMA concentration or L- arginine/ADMA ratio at different time points of lung transplantation, suggesting that ADMA did not contribute to changes in NOS activity following lung transplantation.

5.1.3 L-arginine availability for NOS

Changes in concentration and availability of substrate L-arginine would result in changes in NO production by NOS.98 Arginase and NOS are intracellular enzymes.98, 99 L-arginine, L-ornithine and L-lysine compete for intracellular uptake via amino acid transporters.98, 99 Thus, the ratios of L-arginine/L-ornithine and of L-arginine/ (L-ornithine+L-lysine) in serum can be used as indices for L-arginine availability for intracellular NOS at a given L-arginine serum concentration.98, 99, 115 Additionally, in studies of cardiovascular disease, the ratio of L-arginine/ (L-ornithine+L- citrulline) in serum, the products of enzymatic conversion from L-arginine by arginase and NOS, is used as an index for global L-arginine availability.135, 136 The use of L-arginine bioavailability indices has not been reported in lung transplantation previously. However, effects of L-arginine supplementation during and after lung transplantation were investigated in some studies.73, 153, 180, 201 For instance, L-arginine supplementation in preservation solution during prolonged lung preservation in a dog model of lung transplantation improved pulmonary endothelium dependent relaxation.201 We did not find differences in L-arginine concentration at different time points in our model. However, the L-arginine/ (L-ornithine+L-citrulline) ratio in lung from the “EVLP” group was higher after transplantation and reperfusion than in normal control lungs, suggesting that substrate availability was increased, not decreased.

In our study, amino acids and ADMA were measured in lung tissue homogenates. Calculation of ratios in lung tissue may not accurately represent intracellular L-arginine availability for NOS as these indices in serum represent L-arginine bioavailability. However, differences in these ratios

106

at different time points may reflect alterations in the L-arginine/NO metabolism. Additional studies are needed for an interpretation of the evidence for increased global L-arginine bioavailability after transplantation and reperfusion. For example, measurement of amino acid concentration in serum and perfusate would be helpful. Investigation of expression and activity of arginases would also provide supporting data for possible changes in L-arginine availability.

5.1.4 Arginase expression and activity

Changes in arginase expression and activity can alter L-arginine bioavailability for NO production, as arginase and NOS compete for L-arginine as substrate. Increased arginase expression and activity leads to reduced L-arginine availability for NOS and consequently decreased NO production.132, 202, 203 Increased protein expression of arginase isoforms and arginase activity have been shown in acute rejection in a rat model of lung transplantation204 where they resulted in higher peak airway pressure and increased collagen deposition.204 These changes could be prevented by pirfenidone, an antifibrotic medication which reduces arginase expressions and activity.204 Furthermore, administration of the arginase inhibitor 2(S)-amino-6- boronohexanoic acid (ABH) during EVLP improved dynamic compliance in human lungs which were deemed unacceptable for transplantation.205 In this study, the authors did not find differences in arginase 1 and arginase 2 expression, using Western blotting at different time points.205 We demonstrated that the length of cold ischemia had no effect on the concentration of L-ornithine, a product of arginase activity, expression of arginase 1 and arginase 2 mRNA, or in vitro activity of arginase. However, after EVLP mRNA expression of arginase 1 and 2 in lung homogenates was higher than in controls, which did not result in differences in L-ornithine concentration or arginase activity in vitro. Therefore, the observed effects of transplantation on lung tissue levels of products of NOS activity (NOx and L-citrulline) are unlikely to be caused by decreased L-arginine availability due to increased arginase activity.

5.2 Other possible causes for decreased NOx and L-citrulline

Decreased NO production in the presence of L-arginine and unchanged NOS mRNA expression

could be caused by co-factor deficiency. Co-factors including NADPH, BH4, FMN and FAD are

107

essential for the activity of NOS isoforms.98, 99, 110, 111 Ischemia causes oxidative stress which results in oxidation of BH4 and consequently uncoupling of NOS. This means that BH4 deficiency causes decreased NO but increased oxygen free radical production by NOS.206 This 81 process can contribute to I/R injury following lung transplantation. Therapeutic effects of BH4 via the NO pathway after ischemia and reperfusion were previously demonstrated. In a pig model administration of BH4 during preservation and after reperfusion ameliorated post- transplant edema and I/R injury.207 Concentrations of co-factors for NOS were not measured in our study.

Consumption of NO rather than decreased production would also result in decreased NOx concentrations. For example, limited L-arginine availability for iNOS leads to iNOS uncoupling and production of oxygen radicals which then interact with NO to produce peroxynitrite.99 It was shown in humans that after acute lung injuries peroxynitrite was produced, which may contribute to inflammatory responses.208 Peroxynitrite was not measured in our study. It is also conceivable that NO after reperfusion is bound to circulating haemoglobin, which would result in decreased NOx concentration in lung tissue.

The metabolism of L-citrulline is complex as it can be produced by NOS but also other pathways. For example, OTC metabolizes L-ornithine to form L-citrulline and phosphate, while DDAH uses ADMA to produce L-citrulline and dimethylamine. L-citrulline can also be produced by proteolysis activities. On the other hand argininosuccinate synthetase (ASS) can convert L-citrulline to argininosuccinate.195 Therefore, alterations in L-citrulline production or catabolism through other pathways can also change L-citrulline concentrations, and L-citrulline concentrations may not accurately reflect NOS activity.

There are other factors, e.g. changes in pH, which may results in changes in NO production.99, 111, 150, 209 Acidosis for instance can result in up-regulation of iNOS activity in macrophages.210 However, in this thesis the pH of lung tissue samples was not measured. Endogenous NOS inhibitors other than ADMA may also result in decreased NO production. For example, in a mouse model of allergic asthma it was shown that the polyamine spermin contributed to NOS inhibition causing airways hyper-responsiveness.211 Polyamines are interesting as they are L-

108

ornithine derived and changes in arginase activity may therefore result in differences in polyamine biosynthesis.119, 122 However, polyamines were not measured in this study and are unlikely to be affected in our model as L-ornithine concentration was not altered.

5.3 Interleukin (IL)-10

IL-10 is an immunoregulatory cytokine that has been shown to suppress iNOS212, 213 and decrease NO production in mouse macrophages and human keratinocytes.51, 158 Alveolar macrophages in donor lung contribute to the early phase of I/R injury72, 85, 86 as they are a primary source of cytokines (specifically IL-8, IL-10 and TNF-α) and peroxynitrite.214 The balance between iNOS and arginase expression has been demonstrated to play an important role in polarization of alveolar macrophages in response to environmental stimuli.127 Plasticity of macrophages (i.e. phenotype switch) results in alterations of the production of proinflammatory and anti-inflammatory cytokines such as IL-8 and IL-10 by macrophages, which are important in the induction and prevention of I/R injury, respectively.72

Beneficial effects of IL-10 gene therapy during EVLP were reported previously.15, 24 In our

study, PaO2/FiO2, an indicator of lung quality, was not different one hour after reperfusion when comparing the “EVLP+IL-10” and “EVLP” groups. However, seven days after transplantation

PaO2/FiO2 was significantly higher in the “EVLP+IL-10” group compared to the “EVLP” group (Dr. Keshavjee’s lab, not published). Therefore, IL-10 gene therapy during EVLP resulted in better long term lung function following lung transplantation compared to lungs which underwent EVLP but no IL-10 gene therapy. Thus, beneficial effects reported at later time points may not be reflected in metabolic changes at the earlier time points. Whether IL-10 gene therapy during EVLP may have effects on the L-arginine/NO metabolism at later time points needs to be investigated.

5.4 Conclusions

Marginal organs, such as donations after cardiac death, are considered an immediate solution to expand the donor pool for solid organ transplantation. 3, 10, 11 The rate of morbidity and mortality following transplantation of marginal lungs is potentially higher than those from standard

109

donors. 3, 11 Understanding alterations in biochemical pathways such as the L-arginine/NO metabolism in lung tissue during transplantation has the potential to not only provide new biomarkers for the assessment of donor lungs, but may also help identify pathways that can serve as targets for novel therapeutic interventions.

In this thesis we demonstrated that the concentrations of L-arginine and its metabolites in lung remained unchanged during hypothermic preservation independent of the length of cold ischemia in organs from non-brain death donors. L-citrulline in lungs from brain death donors after 24 hours of cold ischemia was higher compared to lungs after 30 hours of cold ischemia in non brain death group. We did find evidence for a shift of the L-arginine metabolism toward NOS after 6 hours of cold ischemia however, a similar effect was not observed after 30 hours of hypothermic preservation.

The L-arginine/NO metabolism was dissimilar in lungs of different types of donation (i.e. brain death vs. non-brain death donors). Differences in the L-arginine/NO metabolism could potentially contribute to the physiological responses and clinical outcomes after transplantation, as injured lungs from brain death donors had significantly higher PVR after cold ischemia (at the beginning of EVLP) and the worst post-transplant outcome.25 NOx concentrations were decreased after EVLP an effect that was sustained after transplantation and reperfusion of these lungs. Interestingly, arginase mRNA expression was found to be higher than normal after transplantation and reperfusion, which may lead to decreased L- arginine availability for NOS and thus contribute to decreased NO production. IL-10 gene therapy did not affect these alterations in the L-arginine metabolism. Our findings suggest that EVLP results in alterations in the L-arginine/NO metabolism in lung and strongly support the first part of the hypothesis that dysregulation of the L-arginine/NO metabolism after transplantation leads to a decrease in NO production in lung.

5.5 Future directions

This study provided evidence of alterations in the L-arginine/NO metabolism in lung after EVLP and after transplantation and reperfusion. These changes may have consequences for the clinical

110

outcome after transplantation. Further investigations using different models of lung transplantation would help to better understand the correlations between alterations in the L- arginine/NO metabolism and lung function after transplantation. Assessment of the L- arginine/NO metabolism 7 days after transplantation and reperfusion, where IL-10 treatment resulted in a difference in physiological measures, would be interesting as this could help link the metabolism to lung transplantation outcomes.

The investigation of the L-arginine/NO metabolism in serum, bronchoalveolar lavage fluid, exhaled NO or perfusates from EVLP also could be considered additional approaches to detect changes in the L-arginine/NO metabolism. Possible correlation between these measures and lung function could help surgeons make better decisions in selecting donor lungs for transplantation.

The effect of therapeutic interventions during EVLP, for example a study using NO donors or inhaled NO, or the use of arginase inhibitors may also be worth studying. Arginase inhibitors decrease arginase activity and thus increase arginine availability for NOS, which could potentially result in increased NO production and better post-transplantation outcomes.

111

References

112

1. Kotloff R. M., Thabut G. (2011) Lung transplantation. Am. J. Respir. Crit. Care Med. 184, 159-171. 10.1164/rccm.201101-0134CI

2. Cooper J., Pearson F., Patterson G., Todd T., Ginsberg R., Goldberg M. & DeMajo W. (1987) Technique of successful lung transplantation in humans. J. Thorac. Cardiovasc. Surg. 93, 173.

3. Dark J. H. (2008) Lung transplantation from the non-heart beating donor. Transplantation 86, 200-201. 10.1097/TP.0b013e31817c87b6

4. Organ Procurement and Transplantation Network, OPTN. (2011) Annual report of the U.S. organ procurement and transplantation network and the scientific registry of transplant recipients: transplant data 2001, 2006 &2011. Department of Health and Human Services, Health Resources and Services Administration, Healthcare Systems Bureau, Division of Transplantation, Rockville, MD; United Network for Organ Sharing, Richmond, VA; University Renal Research and Education Association, Ann Arbor, MI. Available from: http://srtr.transplant.hrsa.gov/annual_reports/2011/flash/06_lung/index.html#/16/. Accessed September 25, 2013-Homepage/Web site: http://optn.transplant.hrsa.gov/latestData/step2.asp?.

5. Avlonitis V. S., Fisher A. J., Kirby J. A. & Dark J. H. (2003) Pulmonary transplantation: the role of brain death in donor lung injury. Transplantation 75, 1928-1933. 10.1097/01.TP.0000066351.87480.9E

6. Trillium Gift of Life Network. (2013) Availablefrom: http://www.giftoflife.on.ca/en/stats.htm. Accessed September 25, 2013-Homepage/Web site: http://www.giftoflife.on.ca/en/.

7. The Canadian Institute for Health Information (CIHI). Availablefrom: https://secure.cihi.ca/free_products/2013_CORR_Annua_Report_EN.pdf. Accessed November 7,2013-Homepage/Web site: http://http.myaccess.library.utoronto.ca//www.cihi.ca.

8. Botha P. (2009) Extended donor criteria in lung transplantation. Curr. Opin. Organ. Transplant. 14, 206-210. 10.1097/MOT.0b013e328326c834

9. Sommer W., Kuhn C., Tudorache I., Avsar M., Gottlieb J., Boethig D., Haverich A. & Warnecke G. (2013) Extended criteria donor lungs and clinical outcome: Results of an alternative allocation algorithm. J. Heart Lung Transplant. 32, 1065-1072. 10.1016/j.healun.2013.06.021

10. Kootstra G., Daemen J. H. & Oomen A. P. (1995) Categories of non-heart-beating donors. Transplant. Proc. 27, 2893-2894.

113

11. Manara A., Murphy P. & O'Callaghan G. (2012) Donation after circulatory death. Br. J. Anaesth. 108, i108-i121. 10.1093/bja/aer357

12. Aigner C., Slama A., Hotzenecker K., Scheed A., Urbanek B., Schmid W., Nierscher F. J., Lang G. & Klepetko W. (2012) Clinical ex vivo lung perfusion--pushing the limits. Am. J. Transplant. 12, 1839-1847. 10.1111/j.1600-6143.2012.04027.x

13. Brockmann J., Reddy S., Coussios C., Pigott D., Guirriero D., Hughes D., Morovat A., Roy D., Winter L. & Friend P. J. (2009) Normothermic perfusion: a new paradigm for organ preservation. Ann. Surg. 250, 1. 10.1097/SLA.0b013e3181a63c10

14. Cypel M., Yeung J. C., Hirayama S., Rubacha M., Fischer S., Anraku M., Sato M., Harwood S., Pierre A. & Waddell T. K. (2008) Technique for prolonged normothermic ex vivo lung perfusion. J Heart Lung Transplant. 27, 1319-1325. 10.1016/j.healun.2008.09.003

15. Cypel M., Liu M., Rubacha M., Yeung J. C., Hirayama S., Anraku M., Sato M., Medin J., Davidson B. L. & de Perrot M. (2009) Functional repair of human donor lungs by IL-10 gene therapy. Sci Transl Med 1, 4ra9. 10.1126/scitranslmed.3000266

16. Cypel M., Keshavjee S. (2012) The clinical potential of ex vivo lung perfusion. Expert Rev. Respir. Med. 6, 27-35. 10.1586/ers.11.93

17. Cypel M., Rubacha M., Yeung J., Hirayama S., Torbicki K., Madonik M., Fischer S., Hwang D., Pierre A., Waddell T. K., de Perrot M., Liu M. & Keshavjee S. (2009) Normothermic ex vivo perfusion prevents lung injury compared to extended cold preservation for transplantation. Am. J. Transplant. 9, 2262-2269. 10.1111/j.1600- 6143.2009.02775.x

18. Cypel M., Yeung J. C., Liu M., Anraku M., Chen F., Karolak W., Sato M., Laratta J., Azad S., Madonik M., Chow C. W., Chaparro C., Hutcheon M., Singer L. G., Slutsky A. S., Yasufuku K., de Perrot M., Pierre A. F., Waddell T. K. & Keshavjee S. (2011) Normothermic ex vivo lung perfusion in clinical lung transplantation. N. Engl. J. Med. 364, 1431-1440. 10.1056/NEJMoa1014597

19. Erasmus M. E., Fernhout M. H., Elstrodt J. M. & Rakhorst G. (2006) Normothermic ex vivo lung perfusion of non-heart-beating donor lungs in pigs: from pretransplant function analysis towards a 6-h machine preservation. Transpl. Int. 19, 589-593. 10.1111/j.1432- 2277.2006.00318.x

20. Nakajima D., Chen F., Yamada T., Sakamoto J., Ohsumi A., Bando T. & Date H. (2012) Reconditioning of lungs donated after circulatory death with normothermic ex vivo lung perfusion. J. Heart Lung Transplant. 31, 187-193. 10.1016/j.healun.2011.11.007

21. Pegg D. E. (1986) Organ preservation. Surg. Clin. North Am. 66, 617-632.

114

22. Sanchez P. G., D'Ovidio F. (2012) Ex-vivo lung perfusion. Curr. Opin. Organ. Transplant. 17, 490-495. 10.1097/MOT.0b013e328357f865

23. Sanchez P. G., Bittle G. J., Burdorf L., Pierson R. N.,3rd & Griffith B. P. (2012) State of art: clinical ex vivo lung perfusion: rationale, current status, and future directions. J. Heart Lung Transplant. 31, 339-348. 10.1016/j.healun.2012.01.866

24. Yeung J. C., Wagnetz D., Cypel M., Rubacha M., Koike T., Chun Y. M., Hu J., Waddell T. K., Hwang D. M., Liu M. & Keshavjee S. (2012) Ex vivo adenoviral vector gene delivery results in decreased vector-associated inflammation pre- and post-lung transplantation in the pig. Mol. Ther. 20, 1204-1211. 10.1038/mt.2012.57

25. Yeung J. C., Cypel M., Machuca T. N., Koike T., Cook D. J., Bonato R., Chen M., Sato M., Waddell T. K., Liu M., Slutsky A. S. & Keshavjee S. (2012) Physiologic assessment of the ex vivo donor lung for transplantation. J. Heart Lung Transplant. 31, 1120-1126. 10.1016/j.healun.2012.08.016

26. Yuan X., Theruvath A. J., Ge X., Floerchinger B., Jurisch A., Garcia-Cardena G. & Tullius S. G. (2010) Machine perfusion or cold storage in organ transplantation: indication, mechanisms, and future perspectives. Transpl. Int. 23, 561-570. 10.1111/j.1432-2277.2009.01047.x

27. Ailawadi G., Lau C. L., Smith P. W., Swenson B. R., Hennessy S. A., Kuhn C. J., Fedoruk L. M., Kozower B. D., Kron I. L. & Jones D. R. (2009) Does reperfusion injury still cause significant mortality after lung transplantation? J. Thorac. Cardiovasc. Surg. 137, 688-694. 10.1016/j.jtcvs.2008.11.007

28. Marshall, V(2001) Pathophysiology of brain death: effects on allograft function. Transplant. Proc. 33, 845-846. 10.1016/S0041-1345(00)02342-3

29. Smith M. (2004) Physiologic changes during brain stem death—lessons for management of the organ donor. J. Heart Lung Transplant. 23, S217-S222. 10.1016/j.healun.2004.06.017

30. Floerchinger B., Oberhuber R. & Tullius S. G. (2012) Effects of brain death on organ quality and transplant outcome. Transplant. Rev. 26, 54-59. 10.1016/j.trre.2011.10.001

31. Barklin A. (2009) Systemic inflammation in the brain‐dead organ donor. Acta Anaesthesiol. Scand. 53, 425-435. 10.1111/j.1399-6576.2008.01879.x

32. Roman M. A., Nair S., Tsui S., Dunning J. & Parmar J. S. (2013) Ex vivo lung perfusion: a comprehensive review of the development and exploration of future trends. Transplantation 10.1097/TP.0b013e318295eeb7

33. Kaneda H., Waddell T., De Perrot M., Bai X. H., Gutierrez C., Arenovich T., Chaparro C., Liu M. & Keshavjee S. (2006) Pre‐implantation multiple cytokine mRNA expression

115

analysis of donor lung grafts predicts survival after lung transplantation in humans. Am J Transplant. 6, 544-551. 10.1111/j.1600-6143.2005.01204.x

34. Vogel T., Brockmann J. G. & Friend P. J. (2010) Ex-vivo normothermic liver perfusion: an update. Curr. Opin. Organ. Transplant. 15, 167. 10.1097/MOT.0b013e328337349d

35. Monbaliu D., Brassil J. (2010) Machine perfusion of the liver: past, present and future. Curr. Opin. Organ. Transplant. 15, 160-166. 10.1097/MOT.0b013e328337342b

36. Kelly R. F. (2000) Current strategies in lung preservation. J. Lab. Clin. Med. 136, 427- 440. 10.1067/mlc.2000.110906

37. Van Raemdonck D. (2010) Thoracic organs: current preservation technology and future prospects; part 1: lung. Curr. Opin. Organ. Transplant. 15, 150. 10.1097/MOT.0b013e3283373b7e

38. Ikeyama K., Sakai H., Omasa M., Nakamura T., Hamakawa H., Fujinaga T., Fukuse T. & Wada H. (2005) Effects of cold preservation on the lung mechanical properties in rats. Eur. Surg. Res. 37, 85-91. 10.1159/000084538

39. Kim I. K., Bedi D. S., Denecke C., Ge X. & Tullius S. G. (2008) Impact of innate and adaptive immunity on rejection and tolerance. Transplantation 86, 889-894. 10.1097/TP.0b013e318186ac4a

40. Haverich A., Aziz S., Scott W. C., Jamieson S. W. & Shumway N. E. (1986) Improved lung preservation using Euro-Collins solution for flush-perfusion. Thorac. Cardiovasc. Surg. 34, 368-376. 10.1055/s-2007-1022176

41. Hardesty R. L., Aeba R., Armitage J. M., Kormos R. L. & Griffith B. P. (1993) A clinical trial of University of Wisconsin solution for pulmonary preservation. J. Thorac. Cardiovasc. Surg. 105, 660-666.

42. Keshavjee S. H., Yamazaki F., Cardoso P. F., McRitchie D. I., Patterson G. A. & Cooper J. D. (1989) A method for safe twelve-hour pulmonary preservation. J. Thorac. Cardiovasc. Surg. 98, 529-534.

43. Maccherini M., Keshavjee S. H., Slutsky A. S., Patterson G. A. & Edelson J. D. (1991) The effect of low-potassium-dextran versus Euro-Collins solution for preservation of isolated type II pneumocytes. Transplantation 52, 621-626. 10.1097/00007890- 199110000-00008

44. Yamazaki F., Yokomise H., Keshavjee S. H., Miyoshi S., Cardoso P. F., Slutsky A. S. & Patterson G. A. (1990) The superiority of an extracellular fluid solution over Euro- Collins' solution for pulmonary preservation. Transplantation 49, 690-694. 10.1097/00007890-199004000-00007

116

45. Carrel A., Lindbergh C. A. (1935) The culture of whole organs. Science 81, 621-623. 10.1126/science.81.2112.621

46. Steen S., Liao Q., Wierup P. N., Bolys R., Pierre L. & Sjöberg T. (2003) Transplantation of lungs from non–heart-beating donors after functional assessment ex vivo. Ann. Thorac. Surg. 76, 244-252. 10.1016/S0003-4975(03)00191-7

47. Vekemans K., Liu Q., Pirenne J. & Monbaliu D. (2008) Artificial circulation of the liver: machine perfusion as a preservation method in liver transplantation. Anat. Rec. (Hoboken) 291, 735-740. 10.1002/ar.20662

48. García-Valdecasas J. C., Fondevila C. (2010) In-vivo normothermic recirculation: an update. Curr. Opin. Organ. Transplant. 15, 173. 10.1097/MOT.0b013e3283373488

49. Steen S., Ingemansson R., Eriksson L., Pierre L., Algotsson L., Wierup P., Liao Q., Eyjolfsson A., Gustafsson R. & Sjöberg T. (2007) First human transplantation of a nonacceptable donor lung after reconditioning ex vivo. Ann. Thorac. Surg. 83, 2191- 2194. 10.1016/j.athoracsur.2007.01.033

50. Ingemansson R., Eyjolfsson A., Mared L., Pierre L., Algotsson L., Ekmehag B., Gustafsson R., Johnsson P., Koul B. & Lindstedt S. (2009) Clinical transplantation of initially rejected donor lungs after reconditioning ex vivo. Ann. Thorac. Surg. 87, 255- 260. 10.1016/j.athoracsur.2008.09.049

51. Huang C. J., Stevens B. R., Nielsen R. B., Slovin P. N., Fang X., Nelson D. R. & Skimming J. W. (2002) Interleukin-10 inhibition of nitric oxide biosynthesis involves suppression of CAT-2 transcription. Nitric Oxide 6, 79-84. 10.1006/niox.2001.0402

52. Rhoades R. A. (1984) Isolated perfused lung preparation for studying altered gaseous environments. Environ. Health Perspect. 56, 43-50. 10.2307/3429834

53. Koike T., Yeung J. C., Cypel M., Rubacha M., Matsuda Y., Sato M., Waddell T. K., Liu M. & Keshavjee S. (2011) Kinetics of lactate metabolism during acellular normothermic ex vivo lung perfusion. J. Heart Lung Transplant. 30, 1312-1319. 10.1016/j.healun.2011.07.014

54. Valenza F., Rosso L., Pizzocri M., Salice V., Umbrello M., Conte G., Stanzi A., Colombo J., Gatti S., Santambrogio L., Iapichino G. & Gattinoni L. (2011) The consumption of glucose during ex vivo lung perfusion correlates with lung edema. Transplant. Proc. 43, 993-996. 10.1016/j.transproceed.2011.01.122

55. Dong B., Stewart P. W. & Egan T. M. (2013) Postmortem and ex vivo carbon monoxide ventilation reduces injury in rat lungs transplanted from non-heart-beating donors. J. Thorac. Cardiovasc. Surg. 146, 429-36.e1. 10.1016/j.jtcvs.2012.11.005

117

56. Dong B. M., Abano J. B. & Egan T. M. (2009) Nitric oxide ventilation of rat lungs from non-heart-beating donors improves posttransplant function. Am. J. Transplant. 9, 2707- 2715. 10.1111/j.1600-6143.2009.02840.x

57. Inci I., Zhai W., Arni S., Inci D., Hillinger S., Lardinois D., Vogt P. & Weder W. (2007) Fibrinolytic treatment improves the quality of lungs retrieved from non-heart-beating donors. J. Heart Lung Transplant. 26, 1054-1060. 10.1016/j.healun.2007.07.033

58. Machuca T. N., Hsin M. K., Ott H. C., Chen M., Hwang D. M., Cypel M., Waddell T. K. & Keshavjee S. (2013) Injury-specific ex vivo treatment of the donor lung: pulmonary thrombolysis followed by successful lung transplantation. Am. J. Respir. Crit. Care Med. 188, 878-880. 10.1164/rccm.201302-0368LE

59. Christie J. D., Sager J. S., Kimmel S. E., Ahya V. N., Gaughan C., Blumenthal N. P. & Kotloff R. M. (2005) Impact of primary graft failure on outcomes following lung transplantation. Chest 127, 161-165. 10.1378/chest.127.1.161

60. Lee J. C., Christie J. D. & Keshavjee S. (2010) Primary graft dysfunction: definition, risk factors, short- and long-term outcomes. Semin. Respir. Crit. Care. Med. 31, 161-171. 10.1055/s-0030-1249111

61. Christie J. D., Carby M., Bag R., Corris P., Hertz M. & Weill D. (2005) Report of the ISHLT working group on primary lung graft dysfunction part II: definition. A consensus statement of the International Society for Heart and Lung Transplantation. J. Heart Lung Transplant. 24, 1454-1459. 10.1016/j.healun.2004.11.049

62. Barr M. L., Kawut S. M., Whelan T. P., Girgis R., Bottcher H., Sonett J., Vigneswaran W., Follette D. M., Corris P. A. & ISHLT Working Group on Primary Lung Graft Dysfunction. (2005) Report of the ISHLT working group on primary lung graft dysfunction part IV: recipient-related risk factors and markers. J. Heart Lung Transplant. 24, 1468-1482. 10.1016/j.healun.2005.02.019

63. Diamond J. M., Lee J. C., Kawut S. M., Shah R. J., Localio A. R., Bellamy S. L., Lederer D. J., Cantu E., Kohl B. A., Lama V. N., Bhorade S. M., Crespo M., Demissie E., Sonett J., Wille K., Orens J., Shah A. S., Weinacker A., Arcasoy S., Shah P. D., Wilkes D. S., Ware L. B., Palmer S. M., Christie J. D. & Lung Transplant Outcomes Group. (2013) Clinical risk factors for primary graft dysfunction after lung transplantation. Am. J. Respir. Crit. Care Med. 187, 527-534. 10.1164/rccm.201210-1865OC

64. Whitson B. A., Nath D. S., Johnson A. C., Walker A. R., Prekker M. E., Radosevich D. M., Herrington C. S. & Dahlberg P. S. (2006) Risk factors for primary graft dysfunction after lung transplantation. J. Thorac. Cardiovasc. Surg. 131, 73-80. 10.1016/j.jtcvs.2005.08.039

65. Lee J. C., Christie J. D. (2009) Primary graft dysfunction. Proc. Am. Thoracic Soc. 6, 39- 46. 10.1513/pats.200808-082GO

118

66. Webert K. E., Blajchman M. A. (2003) Transfusion-related acute lung injury. Transfus. Med. Rev. 17, 252-262. 10.1016/S0887-7963(03)00039-7

67. Lindberg L., Sjöberg T., Ingemansson R. & Steen S. (1996) Inhalation of nitric oxide after lung transplantation. Ann. Thorac. Surg. 61, 956-962.

68. Palmer R., Ferrige A. & Moncada S. (1987) Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 327, 524-526.

69. Meade M. O., Granton J. T., Matte-Martyn A., McRae K., Weaver B., Cripps P., Keshavjee S. H. & Toronto Lung Transplant Program. (2003) A randomized trial of inhaled nitric oxide to prevent ischemia-reperfusion injury after lung transplantation. Am. J. Respir. Crit. Care Med. 167, 1483-1489. 10.1164/rccm.2203034

70. Keshavjee S., Davis R. D., Zamora M. R., de Perrot M. & Patterson G. A. (2005) A randomized, placebo-controlled trial of complement inhibition in ischemia-reperfusion injury after lung transplantation in human beings. J. Thorac. Cardiovasc. Surg. 129, 423- 428. 10.1016/j.jtcvs.2004.06.048

71. Wittwer T., Grote M., Oppelt P., Franke U., Schaefers H. J. & Wahlers T. (2001) Impact of PAF antagonist BN 52021 (Ginkolide B) on post-ischemic graft function in clinical lung transplantation. J. Heart Lung Transplant. 20, 358-363. 10.1016/S1053- 2498(00)00226-6

72. de Perrot M., Liu M., Waddell T. K. & Keshavjee S. (2003) Ischemia-reperfusion- induced lung injury. Am J Respir Crit Care Med. 167, 490. 10.1164/rccm.200207-670SO

73. Mehl A., Grasemann H. (2010) Alterations in L-arginine metabolism after lung transplantation. Open Nitric Oxide J 2, 55-63. 10.2174/1875042701002020055

74. Date H., Triantafillou A. N., Trulock E. P., Pohl M. S., Cooper J. D. & Patterson G. A. (1996) Inhaled nitric oxide reduces human lung allograft dysfunction. J. Thorac. Cardiovasc. Surg. 111, 913-919. 10.1016/S0022-5223(96)70364-1

75. Shargall Y., Guenther G., Ahya V. N., Ardehali A., Singhal A., Keshavjee S. & ISHLT Working Group on Primary Lung Graft Dysfunction. (2005) Report of the ISHLT working group on primary lung graft dysfunction part VI: treatment. J. Heart Lung Transplant. 24, 1489-1500. 10.1016/j.healun.2005.03.011

76. Hohlfeld J. M., Struber M., Ahlf K., Hoeper M. M., Fraund S., Krug N., Warnecke G., Harringer W., Haverich A. & Fabel H. (1999) Exogenous surfactant improves survival and surfactant function in ischaemia-reperfusion injury in minipigs. Eur. Respir. J. 13, 1037-1043. 10.1034/j.1399-3003.1999.13e17.x

119

77. Kimoto M., Whitley G. S., Tsuji H. & Ogawa T. (1995) Detection of NG,NG- dimethylarginine dimethylaminohydrolase in human tissues using a monoclonal antibody. J. Biochem. 117, 237-238. 10.1093/jb/117.2.237

78. Warnecke G., Struber M., Fraud S., Hohlfeld J. M. & Haverich A. (2001) Combined exogenous surfactant and inhaled nitric oxide therapy for lung ischemia-reperfusion injury in minipigs. Transplantation 71, 1238-1244. 10.1097/00007890-200105150-00010

79. Kermeen F. D., McNeil K. D., Fraser J. F., McCarthy J., Ziegenfuss M. D., Mullany D., Dunning J. & Hopkins P. M. (2007) Resolution of severe ischemia-reperfusion injury post-lung transplantation after administration of endobronchial surfactant. J. Heart Lung Transplant. 26, 850-856. 10.1016/j.healun.2007.05.016

80. Fiser S. M., Tribble C. G., Long S. M., Kaza A. K., Kern J. A., Jones D. R., Robbins M. K. & Kron I. L. (2002) Ischemia-reperfusion injury after lung transplantation increases risk of late bronchiolitis obliterans syndrome. Ann. Thorac. Surg. 73, 1041-1048. 10.1016/S0003-4975(01)03606-2

81. den Hengst W. A., Gielis J. F., Lin J. Y., Van Schil P. E., De Windt L. J. & Moens A. L. (2010) Lung ischemia-reperfusion injury: a molecular and clinical view on a complex pathophysiological process. Am. J. Physiol. Heart Circ. Physiol. 299, H1283-99. 10.1152/ajpheart.00251.2010

82. van der Kaaij Niels, K.J., Jack H., den Bakker Michael L. B., Burkhard L. & de Bruin Ron B. A. (2008) Ischemia of the lung causes extensive long-term pulmonary injury: an experimental study. Respir. Res. 9, 28. 10.1186/1465-9921-9-28

83. Solomon M., Grasemann H. & Keshavjee S. (2010) Pediatric lung transplantation. Pediatr. Clin. North Am. 57, 375-391. 10.1016/j.pcl.2010.01.017

84. Fiser S. M., Tribble C. G., Long S. M., Kaza A. K., Cope J. T., Laubach V. E., Kern J. A. & Kron I. L. (2001) Lung transplant reperfusion injury involves pulmonary macrophages and circulating leukocytes in a biphasic response. J. Thorac. Cardiovasc. Surg. 121, 1069. 10.1067/mtc.2001.113603

85. Gazoni L. M., Tribble C. G., Zhao M. Q., Unger E. B., Farrar R. A., Ellman P. I., Fernandez L. G., Laubach V. E. & Kron I. L. (2007) Pulmonary macrophage inhibition and inhaled nitric oxide attenuate lung ischemia-reperfusion injury. Ann. Thorac. Surg. 84, 247-253. 10.1016/j.athoracsur.2007.02.036

86. Naidu B. V., Krishnadasan B., Farivar A. S., Woolley S. M., Thomas R., Van Rooijen N., Verrier E. D. & Mulligan M. S. (2003) Early activation of the alveolar macrophage is critical to the development of lung ischemia-reperfusion injury. J. Thorac. Cardiovasc. Surg. 126, 200-207. 10.1016/S0022-5223(03)00390-8

120

87. Yerebakan C., Ugurlucan M., Bayraktar S., Bethea B. T. & Conte J. V. (2009) Effects of inhaled nitric oxide following lung transplantation. J. Card. Surg. 24, 269-274. 10.1111/j.1540-8191.2009.00833.x

88. Lu Y. T., Liu S. F., Mitchell J. A., Malik A. B., Hellewell P. G. & Evans T. W. (1998) The role of endogenous nitric oxide in modulating ischemia-reperfusion injury in the isolated, blood-perfused rat lung. Am. J. Respir. Crit. Care Med. 157, 273. 10.1164/ajrccm.157.1.97-03057

89. Moore K. W., O'garra A., Malefyt R. W., Vieira P. & Mosmann T. R. (1993) Interleukin- 10. Annu. Rev. Immunol. 11, 165-190. 10.1146/annurev.iy.11.040193.001121

90. Couper K. N., Blount D. G. & Riley E. M. (2008) IL-10: the master regulator of immunity to infection. J. Immunol. 180, 5771-5777.

91. Fiorentino D. F., Zlotnik A., Mosmann T., Howard M. & O'garra A. (1991) IL-10 inhibits cytokine production by activated macrophages. J Immunol. 147, 3815-3822.

92. Fisher A. J., Donnelly S. C., Hirani N., Haslett C., Strieter R. M., Dark J. H. & Corris P. A. (2001) Elevated levels of interleukin-8 in donor lungs is associated with early graft failure after lung transplantation. Am. J. Respir. Crit. Care Med. 163, 259-265. 10.1164/ajrccm.163.1.2005093

93. Eppinger M. J., Ward P. A., Bolling S. F. & Deeb G. M. (1996) Regulatory effects of interleukin-10 on lung ischemia-reperfusion injury. J. Thorac. Cardiovasc. Surg. 112, 1301-1306. 10.1016/S0022-5223(96)70144-7

94. Moore D. J., Markmann J. F. & Deng S. (2006) Avenues for immunomodulation and graft protection by gene therapy in transplantation. Transplant Int. 19, 435-445. 10.1111/j.1432-2277.2006.00314.x

95. Fischer S., Liu M., MacLean A. A., de Perrot M., Ho M., Cardella J. A., Zhang X. M., Bai X. H., Suga M., Imai Y. & Keshavjee S. (2001) In vivo transtracheal adenovirus- mediated transfer of human interleukin-10 gene to donor lungs ameliorates ischemia- reperfusion injury and improves early posttransplant graft function in the rat. Hum. Gene Ther. 12, 1513-1526. 10.1089/10430340152480249

96. Cassivi S. D., Cardella J. A., Fischer S., Liu M., Slutsky A. S. & Keshavjee S. (1999) Transtracheal gene transfection of donor lungs prior to organ procurement increases transgene levels at reperfusion and following transplantation. J. Heart Lung Transplant. 18, 1181-1188. 10.1016/S1053-2498(99)00095-9

97. Chapelier A., Danel C., Mazmanian M., Bacha E. A., Sellak H., Gilbert M. A., Herve P. & Lemarchand P. (1996) Gene therapy in lung transplantation: feasibility of ex vivo adenovirus-mediated gene transfer to the graft. Hum. Gene Ther. 7, 1837-1845. 10.1089/hum.1996.7.15-1837

121

98. Wu G., Morris Jr S. M. (1998) Arginine metabolism: nitric oxide and beyond. Biochem. J. 336, 1.

99. Racké K., Warnken M. (2010) L-arginine metabolic pathways. Open Nitric Oxide J 2, 9- 19. 10.2174/1875042701002010001

100. Selamnia M., Robert V., Mayeur C., Delpal S. & Blachier F. (1998) De novo synthesis of arginine and ornithine from citrulline in human colon carcinoma cells: metabolic fate of L-ornithine. Biochim. Biophys. Acta 1425, 93-102. 10.1016/S0304-4165(98)00056-7

101. Closs E., Boissel J. P., Habermeier A. & Rotmann A. (2006) Structure and function of cationic amino acid transporters (CATs). J. Membr. Biol. 213, 67-77. 10.1007/s00232- 006-0875-7

102. Lara A., Khatri S. B., Wang Z., Comhair S. A. A., Xu W., Dweik R. A., Bodine M., Levison B. S., Hammel J. & Bleecker E. (2008) Alterations of the arginine metabolome in asthma. Am. J. Respir. Crit. Care Med. 178, 673. 10.1164/rccm.200710-1542OC

103. Tenu J. P., Lepoivre M., Moali C., Brollo M., Mansuy D. & Boucher J. L. (1999) Effects of the new arginase inhibitor N (omega)-hydroxy-nor-L-arginine on NO synthase activity in murine macrophages. Nitric Oxide 3, 427. 10.1006/niox.1999.0255

104. Ashutosh K. (2000) Nitric oxide and asthma: a review. Curr. Opin. Pulm. Med. 6, 21-25. 10.1097/00063198-200001000-00005

105. North M. L., Khanna N., Marsden P. A., Grasemann H. & Scott J. A. (2009) Functionally important role for arginase 1 in the airway hyperresponsiveness of asthma. Am. J. Physiol. Lung Cell. Mol. Physiol. 296, L911. 10.1152/ajplung.00025.2009

106. Maarsingh H., Pera T. & Meurs H. (2008) Arginase and pulmonary diseases. Naunyn Schmiedebergs Arch. Pharmacol. 378, 171-184. 10.1007/s00210-008-0286-7

107. Belik J., Shehnaz D., Pan J. & Grasemann H. (2008) Developmental changes in arginase expression and activity in the lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 294, L498. 10.1152/ajplung.00242.2007

108. Ricciardolo F. (2003) Multiple roles of nitric oxide in the airways. Thorax 58, 175. 10.1136/thorax.58.2.175

109. Li P., Yin Y. L., Li D., Woo Kim S. & Wu G. (2007) Amino acids and immune function. Br. J. Nutr. 98, 237-252. 10.1017/S000711450769936X

110. Chen K., Pittman R. N. & Popel A. S. (2008) Nitric oxide in the vasculature: where does it come from and where does it go? A quantitative perspective. Antioxid. Redox Signal. 10, 1185-1198. 10.1089/ars.2007.1959

122

111. Luiking Y. C., Engelen M. P. & Deutz N. E. (2010) Regulation of nitric oxide production in health and disease. Curr. Opin. Clin. Nutr. Metab. Care 13, 97-104. 10.1097/MCO.0b013e328332f99d

112. Forstermann U., Sessa W. C. (2012) Nitric oxide synthases: regulation and function. Eur. Heart J. 33, 829-37, 837a-837d. 10.1093/eurheartj/ehr304

113. Grasemann H., Ratjen F. (2012) Nitric oxide and L-arginine deficiency in cystic fibrosis. Curr. Pharm. Des. 18, 726-736. 10.2174/138161212799315911

114. Ignarro L. J. (2002) Nitric oxide as a unique signaling molecule in the vascular system: a historical overview. J. Physiol. Pharmacol. 53, 503-514.

115. Morris C. R., Kato G. J., Poljakovic M., Wang X., Blackwelder W. C., Sachdev V., Hazen S. L., Vichinsky E. P., Morris Jr S. M. & Gladwin M. T. (2005) Dysregulated arginine metabolism, hemolysis-associated pulmonary hypertension, and mortality in sickle cell disease. J. Am. Med. Assoc. 294, 81-90. 10.1001/jama.294.1.81

116. Stamler J. S., Singel D. J. & Loscalzo J. (1992) Biochemistry of nitric oxide and its redox-activated forms. Science 258, 1898-1902. 10.1126/science.1281928

117. Xie Q., Nathan C. (1994) The high-output nitric oxide pathway: role and regulation. J. Leukoc. Biol. 56, 576-582.

118. Boger R. H. (2004) Asymmetric dimethylarginine, an endogenous inhibitor of nitric oxide synthase, explains the "L-arginine paradox" and acts as a novel cardiovascular risk factor. J. Nutr. 134, 2842S-2847S; discussion 2853S.

119. Grasemann H., Shehnaz D., Enomoto M., Leadley M., Belik J. & Ratjen F. (2012) L- ornithine derived polyamines in cystic fibrosis airways. PLoS One 7, e46618. 10.1371/journal.pone.0046618

120. Maarsingh H., Bossenga B. E., Bos I. S., Volders H. H., Zaagsma J. & Meurs H. (2009) L-arginine deficiency causes airway hyperresponsiveness after the late asthmatic reaction. Eur. Respir. J. 34, 191-199. 10.1183/09031936.00105408

121. Maarsingh H., Dekkers B. G., Zuidhof A. B., Bos I. S., Menzen M. H., Klein T., Flik G., Zaagsma J. & Meurs H. (2011) Increased arginase activity contributes to airway remodelling in chronic allergic asthma. Eur. Respir. J. 38, 318-328. 10.1183/09031936.00057710

122. Morris C. R., Poljakovic M., Lavrisha L., Machado L., Kuypers F. A. & Morris S. M.,Jr. (2004) Decreased arginine bioavailability and increased serum arginase activity in asthma. Am. J. Respir. Crit. Care Med. 170, 148-153. 10.1164/rccm.200309-1304OC

123

123. Zakrzewicz D., Eickelberg O. (2009) From arginine methylation to ADMA: a novel mechanism with therapeutic potential in chronic lung diseases. BMC Pulm. Med. 9, 5- 10.1186/1471-2466-9-5. 0.1186/1471-2466-9-5

124. Habib S. S. (2008) Exhaled nitric oxide: an emerging marker of inflammation in respiratory diseases. Saudi Med. J. 29, 1697-1702.

125. Kharitonov S. A., Barnes P. J. (2006) Exhaled biomarkers. Chest 130, 1541-1546. 10.1378/chest.130.5.1541

126. Silkoff P. E., Caramori M., Tremblay L., McClean P., Chaparro C., Kesten S., Hutcheon M., Slutsky A. S., Zamel N. & Keshavjee S. (1998) Exhaled nitric oxide in human lung transplantation. A noninvasive marker of acute rejection. Am. J. Respir. Crit. Care Med. 157, 1822-1828. 10.1164/ajrccm.157.6.9707159

127. Gordon S. (2003) Alternative activation of macrophages. Nat. Rev. Immunol. 3, 23-35. 10.1038/nri978

128. Kepka-Lenhart D., Mistry S. K., Wu G. & Morris S. M.,Jr. (2000) Arginase I: a limiting factor for nitric oxide and polyamine synthesis by activated macrophages? Am. J. Physiol. Regul. Integr. Comp. Physiol. 279, R2237-42.

129. Vainikka T., Heikkilä L., Kukkonen S. & Toivonen H. J. (2001) L-Arginine in lung graft preservation and reperfusion. J. Heart Lung Transplant. 20, 559-567. 10.1016/S1053- 2498(00)00332-6

130. Bueno M., Wang J., Mora A. L. & Gladwin M. T. (2013) Nitrite signaling in pulmonary hypertension: mechanisms of bioactivation, signaling, and therapeutics. Antioxid. Redox Signal. 18, 1797-1809. 10.1089/ars.2012.4833

131. Goret L., Tanguy S., Guiraud I., Dauzat M. & Obert P. (2008) Acute administration of l- arginine restores nitric oxide-mediated relaxation in isolated pulmonary arteries from pulmonary hypertensive exercise trained rats. Eur. J. Pharmacol. 581, 148-156. 10.1016/j.ejphar.2007.11.037

132. Li H., Meininger C. J., Hawker J. R., Haynes T. E., Kepka-Lenhart D., Mistry S. K., Morris S. M. & Wu G. (2001) Regulatory role of arginase I and II in nitric oxide, polyamine, and proline syntheses in endothelial cells. Am. J. Physiol. Endocrinol. Metab. 280, E75.

133. Forstermann U., Munzel T. (2006) Endothelial nitric oxide synthase in vascular disease: from marvel to menace. Circulation 113, 1708. 10.1161/CIRCULATIONAHA.105.602532

124

134. Grasemann H., Schwiertz R., Matthiesen S., Racke K. & Ratjen F. (2005) Increased arginase activity in cystic fibrosis airways. Am. J. Respir. Crit. Care Med. 172, 1523. 10.1164/rccm.200502-253OC

135. Nicholls S. J., Wang Z., Koeth R., Levison B., DelFraino B., Dzavik V., Griffith O. W., Hathaway D., Panza J. A. & Nissen S. E. (2007) Metabolic profiling of arginine and nitric oxide pathways predicts hemodynamic abnormalities and mortality in patients with cardiogenic shock after acute myocardial infarction. Circulation 116, 2315-2324. 10.1161/CIRCULATIONAHA.107.693986

136. Tang W. H. W., Wang Z., Cho L., Brennan D. M. & Hazen S. L. (2009) Diminished global arginine bioavailability and increased arginine catabolism as metabolic profile of increased cardiovascular risk. J. Am. Coll. Cardiol. 53, 2061-2067. 10.1016/j.jacc.2009.02.036

137. Pacher P., Beckman J. S. & Liaudet L. (2007) Nitric oxide and peroxynitrite in health and disease. Physiol. Rev. 87, 315-424. 10.1152/physrev.00029.2006

138. Klein E., Weigel J., Buford M. C., Holian A. & Wells S. M. (2010) Asymmetric dimethylarginine potentiates lung inflammation in a mouse model of allergic asthma. Am. J. Physiol. Lung Cell. Mol. Physiol. 299, L816. 10.1152/ajplung.00188.2010

139. Wells, S M,Buford, M C,Migliaccio, C T & Holian, A(2009) Elevated asymmetric dimethylarginine alters lung function and induces collagen deposition in mice. Am. J. Resp. Cell Mol. Biol. 6, 332. 10.1165/rcmb.2008-0148OC

140. Grasemann H., Al-Saleh S., Scott J. A., Shehnaz D., Mehl A., Amin R., Rafii M., Pencharz P., Belik J. & Ratjen F. (2011) Asymmetric dimethylarginine contributes to airway nitric oxide deficiency in patients with cystic fibrosis. Am. J. Respir. Crit. Care Med. 201012-1995OCv1. 10.1164/rccm.201012-1995OC

141. Scott J. A., North M. L., Rafii M., Huang H., Pencharz P., Subbarao P., Belik J. & Grasemann H. (2011) Asymmetric dimethylarginine is increased in asthma. Am. J. Respir. Crit. Care Med. 201011-1810OCv1. 10.1164/rccm.201011-1810OC

142. Bedford M. T. (2007) Arginine methylation at a glance. J. Cell. Sci. 120, 4243-4246. 10.1242/jcs.019885

143. Vallance P., Leone A., Calver A., Collier J. & Moncada S. (1992) Accumulation of an endogenous inhibitor of nitric oxide synthesis in chronic renal failure. Lancet 339, 572- 575. 10.1016/0140-6736(92)90865-Z

144. Bode-Boger S. M., Scalera F. & Ignarro L. J. (2007) The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 114, 295-306. 10.1016/j.pharmthera.2007.03.002

125

145. Achan V., Broadhead M., Malaki M., Whitley G., Leiper J., MacAllister R. & Vallance P. (2003) Asymmetric dimethylarginine causes hypertension and cardiac dysfunction in humans and is actively metabolized by dimethylarginine dimethylaminohydrolase. Arterioscler. Thromb. Vasc. Biol. 23, 1455-1459. 10.1161/01.ATV.0000081742.92006.59

146. Sasaki A., Doi S., Mizutani S. & Azuma H. (2007) Roles of accumulated endogenous nitric oxide synthase inhibitors, enhanced arginase activity, and attenuated nitric oxide synthase activity in endothelial cells for pulmonary hypertension in rats. Am. J. Physiol. Lung Cell. Mol. Physiol. 36, 10.1152/ajplung.00360.2006

147. Reid K. M., Tsung A., Kaizu T., Jeyabalan G., Ikeda A., Shao L., Wu G., Murase N. & Geller D. A. (2007) Liver I/R injury is improved by the arginase inhibitor, NΩ-hydroxy- nor-L-arginine (nor-NOHA). Am. J. Physiol. Gastrointest. Liver Physiol. 292, G512. 10.1152/ajpgi.00227.2006

148. Rhoden E. L., Rhoden C. R., Lucas M. L., Pereira-Lima L., Zettler C. & Bello-Klein A. (2002) The role of nitric oxide pathway in the renal ischemia-reperfusion injury in rats. Transpl. Immunol. 10, 277-284. 10.1016/S0966-3274(02)00079-5

149. Gao X., Xu X., Belmadani S., Park Y., Tang Z., Feldman A. M., Chilian W. M. & Zhang C. (2007) TNF-α contributes to endothelial dysfunction by upregulating arginase in ischemia/reperfusion injury. Arterioscler. Thromb. Vasc. Biol. 27, 1269. 10.1161/ ATVBAHA.107.142521

150. Tennyson A. G., Lippard S. J. (2011) Generation, translocation, and action of nitric oxide in living systems. Chem. Biol. 18, 1211-1220. 10.1016/j.chembiol.2011.09.009

151. Gomez C. B., del Valle H. F., Bertolotti A., Negroni J. A., Cuniberti L., Martinez V., Osses J., Laguens R. P. & Favaloro R. R. (2005) Effects of short-term inhaled nitric oxide on interleukin-8 release after single-lung transplantation in pigs. J. Heart Lung Transplant. 24, 714-722. 10.1016/j.healun.2004.03.017

152. Marczin N., Riedel B., Gal J., Polak J. & Yacoub M. (1997) Exhaled nitric oxide during lung transplantation. Lancet 350, 1681-1682. 10.1016/S0140-6736(05)64281-X

153. Shiraishi Y., Lee J. R., Laks H., Waters P. F., Meneshian A., Blitz A., Johnson K., Lam L. & Chang P. A. (1996) L-arginine administration during reperfusion improves pulmonary function. Ann. Thorac. Surg. 62, 1580-6; discussion 1586-7. 10.1016/S0003- 4975(96)00884-3

154. Hein T. W., Zhang C., Wang W., Chang C. I., Thengchaisri N. & Kuo L. (2003) Ischemia-reperfusion selectively impairs nitric oxide-mediated dilation in coronary arterioles: counteracting role of arginase. FASEB J. 17, 2328-2330. 10.1096/fj.03-0115fje

126

155. Boehler A. (2002) The role of interleukin-10 in lung transplantation. Transpl. Immunol. 9, 121-124. 10.1016/S0966-3274(02)00045-X

156. Kling K. M., Kirby L., Kwan K. Y., Kim F. & McFadden D. W. (1999) Interleukin-10 inhibits inducible nitric oxide synthase in an animal model of necrotizing enterocolitis. Int. J. Surg. Investig. 1, 337-342.

157. Ogando D., Cella M., Ribeiro M. L., Weissmann C., Aisemberg J. & Franchi A. (2004) IL-10 inhibits nitric oxide synthesis in murine uterus. Neuroimmunomodulation 11, 127- 132. 10.1159/000075322

158. Maru A., Jackson S. K. (1996) Opposite effects of interleukin-4 and interleukin-10 on nitric oxide production in murine macrophages. Mediators Inflamm. 5, 110-112. 10.1155/S096293519600018X

159. Martins S., De Perrot M., Imai Y., Yamane M., Quadri S., Segall L., Dutly A., Sakiyama S., Chaparro A. & Davidson B. (2004) Transbronchial administration of adenoviral- mediated interleukin-10 gene to the donor improves function in a pig lung transplant model. Gene Ther. 11, 1786-1796. 10.1038/sj.gt.3302357

160. Novitzky D., Horak A., Cooper D. K. & Rose A. G. (1989) Electrocardiographic and histopathologic changes developing during experimental brain death in the baboon. Transplant. Proc. 21, 2567-2569.

161. Huttemann E., Schelenz C., Sakka S. G. & Reinhart K. (2000) Atropine test and circulatory arrest in the fossa posterior assessed by transcranial Doppler. Intensive Care Med. 26, 422-425. 10.1007/s001340051176

162. Pierre A. F., Xavier A. M., Liu M., Cassivi S. D., Lindsay T. F., Marsh H. C., Slutsky A. S. & Keshavjee S. H. (1998) Effect of complement inhibition with soluble complement receptor 1 on pig allotransplant lung function. Transplantation 66, 723-732. 10.1097/00007890-199809270-00006

163. Steen S., Sjoberg T., Pierre L., Liao Q., Eriksson L. & Algotsson L. (2001) Transplantation of lungs from a non-heart-beating donor. Lancet 357, 825-829. 10.1016/S0140-6736(00)04195-7

164. Bio-Rad Laboratories U. Bio-Rad protein assay. Http://Labs.Fhcrc.Org/Fero/Protocols/BioRad_Bradford.Pdf

165. Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. 10.1006/abio.1976.9999; 10.1016/0003-2697(76)90527-3

127

166. Mateos-Corral D., Coombs R., Grasemann H., Ratjen F. & Dell S. D. (2011) Diagnostic value of nasal nitric oxide measured with non-velum closure techniques for children with primary ciliary dyskinesia. J. Pediatr. 10.1016/j.jpeds.2011.03.007

167. Belik J., Stevens D., Pan J., Shehnaz D., Ibrahim C., Kantores C., Ivanovska J., Grasemann H. & Jankov R. P. (2009) Chronic hypercapnia downregulates arginase expression and activity and increases pulmonary arterial smooth muscle relaxation in the newborn rat. Am. J. Physiol. Lung Cell. Mol. Physiol. 297, L777. 10.1152/ajplung.00047.2009

168. Pinder A. G., Rogers S. C., Khalatbari A., Ingram T. E. & James P. E. (2008) The measurement of nitric oxide and its metabolites in biological samples by ozone-based chemiluminescence. Methods Mol. Biol. 476, 11-28. 10.1007/978-1-59745-129-1_2

169. ECO PHYSICS I.
. Available from:www.ecophysics-us.com/wp- content/uploads//2012/03/Liquid-NO-Application-V10-US.pdf. Accessed September 25, 2013.-Homepage/Web site:http://www.ecophysics-us.com/.

170. Li X., Hanson C., Cmarik J. L. & Ruscetti S. (2009) Neurodegeneration induced by PVC- 211 murine leukemia virus is associated with increased levels of vascular endothelial growth factor and macrophage inflammatory protein 1 alpha and is inhibited by blocking activation of microglia. J. Virol. 83, 4912-4922. 10.1128/JVI.02343-08

171. Kurien B. T., Scofield R. H. (2006) Western blotting. Methods 38, 283-293.

172. Corraliza I., Campo M., Soler G. & Modolell M. (1994) Determination of arginase activity in macrophages: a micromethod. J. Immunol. Methods 174, 231-235. 10.1016/0022-1759(94)90027-2

173. Armbruster D. A., Pry T. (2008) Limit of blank, limit of detection and limit of quantitation. Clin. Biochem. Rev. 29 Suppl 1, S49-52.

174. Pinsky D. J., Naka Y., Chowdhury N. C., Liao H., Oz M. C., Michler R. E., Kubaszewski E., Malinski T. & Stern D. M. (1994) The nitric oxide/cyclic GMP pathway in organ transplantation: critical role in successful lung preservation. PROC. NATL. ACAD. SCI. U. S. A. 91, 12086.

175. Rossaint R., Falke K. J., Lopez F., Slama K., Pison U. & Zapol W. M. (1993) Inhaled nitric oxide for the adult respiratory distress syndrome. N. Engl. J. Med. 328, 399-405. 10.1056/NEJM199302113280605

176. Rich G. F., Lowson S. M., Johns R. A., Daugherty M. O. & Uncles D. R. (1994) Inhaled nitric oxide selectively decreases pulmonary vascular resistance without impairing oxygenation during one-lung ventilation in patients undergoing cardiac surgery. Anesthesiology 80, 57-62; discussion 27A. 10.1097/00000542-199401000-00012

128

177. Moreno I., Vicente R., Mir A., Leon I., Ramos F., Vicente J. L. & Barbera M. (2009) Effects of inhaled nitric oxide on primary graft dysfunction in lung transplantation. Transplant. Proc. 41, 2210-2212. 10.1016/j.transproceed.2009.05.019

178. Pasero D., Martin E. L., Davi A., Mascia L., Rinaldi M. & Ranieri V. M. (2010) The effects of inhaled nitric oxide after lung transplantation. Minerva Anestesiol. 76, 353-361.

179. Sedoris K. C., Ovechkin A. V., Gozal E. & Roberts A. M. (2009) Differential effects of nitric oxide synthesis on pulmonary vascular function during lung ischemia-reperfusion injury. Arch. Physiol. Biochem. 115, 34-46. 10.1080/13813450902785267

180. Normandin L., Herve P., Brink C., Chapelier A. R., Dartevelle P. G. & Mazmanian G. M. (1995) L-arginine and pentoxifylline attenuate endothelial dysfunction after lung reperfusion injury in the rabbit. The Paris-Sud University Lung Transplant Group. Ann. Thorac. Surg. 60, 646-650. 10.1016/0003-4975(95)00484-3

181. Novitzky D. (1997) Detrimental effects of brain death on the potential organ donor. Transplant. Proc. 29, 3770-3772. 10.1016/S0041-1345(97)01149-4

182. Gall W. E., Beebe K., Lawton K. A., Adam K. P., Mitchell M. W., Nakhle P. J., Ryals J. A., Milburn M. V., Nannipieri M., Camastra S., Natali A., Ferrannini E. & RISC Study Group. (2010) Alpha-Hydroxybutyrate is an Early Biomarker of Insulin Resistance and Glucose Intolerance in a Nondiabetic Population. PLoS One 5, e10883. 10.1371/journal.pone.0010883

183. Redondo J., Manso A. M., Pacheco M. E., Hernandez L., Salaices M. & Marin J. (2000) Hypothermic storage of coronary endothelial cells reduces nitric oxide synthase activity and expression. Cryobiology 41, 292-300. 10.1006/cryo.2000.2285

184. Venturini G., Colasanti M., Fioravanti E., Bianchini A. & Ascenzi P. (1999) Direct effect of temperature on the catalytic activity of nitric oxide synthases types I, II, and III. Nitric Oxide 3, 375-382. 10.1006/niox.1999.0250

185. Lehmann S., Barten M. J., Topf C., Garbade J., Dhein S., Mohr F. W. & Bittner H. B. (2012) Donor type impact on ischemia-reperfusion injury after lung transplantation. Ann. Thorac. Surg. 93, 913-9; discussion 919-20. 10.1016/j.athoracsur.2011.11.033

186. Weyker P. D., Webb C. A., Kiamanesh D. & Flynn B. C. (2013) Lung ischemia reperfusion injury: a bench-to-bedside review. Semin. Cardiothorac. Vasc. Anesth. 17, 28-43. 10.1177/1089253212458329

187. Kokko J. P. (1987) The role of the collecting duct in urinary concentration. Kidney Int. 31, 606-610. 10.1038/ki.1987.41

188. Rocha P. N., Rocha A. T., Palmer S. M., Davis R. D. & Smith S. R. (2005) Acute renal failure after lung transplantation: incidence, predictors and impact on perioperative

129

morbidity and mortality. Am. J. Transplant. 5, 1469-1476. 10.1111/j.1600- 6143.2005.00867.x

189. Moinard C., Cynober L. (2007) Citrulline: a new player in the control of nitrogen homeostasis. J. Nutr. 137, 1621S-1625S.

190. Liu M., Tremblay L., Cassivi S. D., Bai X. H., Mourgeon E., Pierre A. F., Slutsky A. S., Post M. & Keshavjee S. (2000) Alterations of nitric oxide synthase expression and activity during rat lung transplantation. Am. J. Physiol. Lung Cell. Mol. Physiol. 278, L1071.

191. Hsin M., Cypel M., Zamel R., Machuca T., Chen M., Liu M. & Keshavjee S. (2013) Metabolites in human ex vivo lung perfusates are differentially affected in brain death (BDD) vs. cardiac death donors (DCD) and modified by duration of normothermic perfusion. J. Heart Lung Transplant. 32, S151-S152. 10.1016/j.healun.2013.01.347

192. Cremona G., Higenbottam T., Takao M., Hall L. & Bower E. A. (1995) Exhaled nitric oxide in isolated pig lungs. J. Appl. Physiol. (1985) 78, 59-63.

193. Worrall N. K., Boasquevisque C. H., Misko T. P., Sullivan P. M., Ferguson T. B.,Jr & Patterson G. A. (1997) Inducible nitric oxide synthase is expressed during experimental acute lung allograft rejection. J. Heart Lung Transplant. 16, 334-339.

194. Adeva M. M., Souto G., Blanco N. & Donapetry C. (2012) Ammonium metabolism in humans. Metabolism 61, 1495-1511. 10.1016/j.metabol.2012.07.007

195. Curis E., Nicolis I., Moinard C., Osowska S., Zerrouk N., Bénazeth S. & Cynober L. (2005) Almost all about citrulline in mammals. Amino Acids 29, 177-205. 10.1007/s00726-005-0235-4

196. Taylor S. C., Berkelman T., Yadav G. & Hammond M. (2013) A defined methodology for reliable quantification of Western blot data. Mol. Biotechnol. 55, 217-226. 10.1007/s12033-013-9672-6

197. Bult H. (1996) Nitric oxide and atherosclerosis: possible implications for therapy. Mol. Med. Today 2, 510-518. 10.1016/S1357-4310(97)81455-4

198. Soccal P. M., Jani A., Chang S., Leonard C. T., Pavlakis M. & Doyle R. L. (2000) Inducible nitric oxide synthase transcription in human lung transplantation. Transplantation 70, 384-385. 10.1097/00007890-200007270-00026

199. Utsumi T., Mizuta T., Fujii Y., Shiono H., Okumura M., Minami M., Takeda S., Miyoshi S. & Matsuda H. (1999) Nitric oxide production by bronchoalveolar cells during allograft rejection in the rat. Transplantation 67, 1622-1626. 10.1097/00007890-199906270- 00019

130

200. Worrall N. K., Boasquevisque C. H., Botney M. D., Misko T. P., Sullivan P. M., Ritter J. H., Ferguson T. B.,Jr & Patterson G. A. (1997) Inhibition of inducible nitric oxide synthase ameliorates functional and histological changes of acute lung allograft rejection. Transplantation 63, 1095-1101. 10.1097/00007890-199704270-00008

201. Chu Y., Wu Y. C., Chou Y. C., Chueh H. Y., Liu H. P., Chu J. J. & Lin P. J. (2004) Endothelium-dependent relaxation of canine pulmonary artery after prolonged lung graft preservation in University of Wisconsin solution: role of L-arginine supplementation. J. Heart Lung Transplant. 23, 592-598. 10.1016/S1053-2498(03)00304-8

202. Morris S. M.,Jr. (2002) Regulation of enzymes of the urea cycle and arginine metabolism. Annu. Rev. Nutr. 22, 87-105. 10.1146/annurev.nutr.22.110801.140547

203. Que L. G., George S. E., Gotoh T., Mori M. & Huang Y. C. (2002) Effects of arginase isoforms on NO Production by nNOS. Nitric Oxide 6, 1-8. 10.1006/niox.2001.0355

204. Liu H., Drew P., Gaugler A. C., Cheng Y. & Visner G. A. (2005) Pirfenidone Inhibits Lung Allograft Fibrosis through L‐Arginine–Arginase Pathway. Am J Transplant. 5, 1256-1263. 10.1111/j.1600-6143.2005.00876.x

205. George T. J., Arnaoutakis G. J., Beaty C. A., Jandu S. K., Santhanam L., Berkowitz D. E. & Shah A. S. (2012) A physiologic and biochemical profile of clinically rejected lungs on a normothermic ex vivo lung perfusion platform. J. Surg. Res. 10.1016/j.jss.2012.11.012

206. Scott-Burden T. (1995) Regulation of nitric oxide production by tetrahydrobiopterin. Circulation 91, 248-250. 10.1161/01.CIR.91.1.248

207. Schmid R. A., Hillinger S., Walter R., Zollinger A., Stammberger U., Speich R., Schaffner A., Weder W. & Schoedon G. (1999) The nitric oxide synthase cofactor tetrahydrobiopterin reduces allograft ischemia-reperfusion injury after lung transplantation. J. Thorac. Cardiovasc. Surg. 118, 726-732. 10.1016/S0022- 5223(99)70019-X

208. Kooy N. W., Royall J. A., Ye Y. Z., Kelly D. R. & Beckman J. S. (1995) Evidence for in vivo peroxynitrite production in human acute lung injury. Am. J. Respir. Crit. Care Med. 151, 1250-1254. 10.1164/ajrccm.151.4.7697261

209. Andrew P. J., Mayer B. (1999) Enzymatic function of nitric oxide synthases. Cardiovasc. Res. 43, 521-531. 10.1016/S0008-6363(99)00115-7

210. Bellocq A., Suberville S., Philippe C., Bertrand F., Perez J., Fouqueray B., Cherqui G. & Baud L. (1998) Low environmental pH is responsible for the induction of nitric-oxide synthase in macrophages. Evidence for involvement of nuclear factor-kappaB activation. J. Biol. Chem. 273, 5086-5092. 10.1074/jbc.273.9.5086

131

211. North M. L., Grasemann H., Khanna N., Inman M. D., Gauvreau G. M. & Scott J. A. (2013) Increased ornithine-derived polyamines cause airway hyperresponsiveness in a mouse model of asthma. Am. J. Respir. Cell Mol. Biol. 48, 694-702. 10.1165/rcmb.2012- 0323OC

212. Becherel P. A., Le Goff L., Ktorza S., Ouaaz F., Mencia-Huerta J. M., Dugas B., Debre P., Mossalayi M. D. & Arock M. (1995) Interleukin-10 inhibits IgE-mediated nitric oxide synthase induction and cytokine synthesis in normal human keratinocytes. Eur. J. Immunol. 25, 2992-2995. 10.1002/eji.1830251042

213. Seyler I., Appel M., Devissaguet J. P., Legrand P. & Barratt G. (1997) Modulation of nitric oxide production in RAW 264.7 cells by transforming growth factor-beta and interleukin-10: differential effects on free and encapsulated immunomodulator. J. Leukoc. Biol. 62, 374-380.

214. Naidu B. V., Fraga C., Salzman A. L., Szabo C., Verrier E. D. & Mulligan M. S. (2003) Critical role of reactive nitrogen species in lung ischemia-reperfusion injury. J. Heart Lung Transplant. 22, 784-793. 10.1016/S1053-2498(02)00556-9

132

Appendix

133

Figure A-1: Western blotting; arginase 1 and  actin in recipient left lung and in donor lung tissue in the “no EVLP” group at different time points. Samples were taken at different time points: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 18h CIT (timed control), 18 hours after cold ischemia; 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; Recipient left lung, normal lung tissue samples; at some time points same blot for β actin was used for both arginase 1 and 2.

134

Figure A-2: Western blotting; arginase 1 and  actin in donor lung tissue in the “EVLP” group at different time points. Samples were taken at different time points: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by 12 hours of EVLP; EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; at some time points same blot for β actin was used for both arginase 1 and 2.

135

Figure A-3: Western blotting; arginase 1 and  actin in donor lung tissue in the “EVLP+IL-10” group at different time points. Samples were taken at different time points: Recipient left lung, normal lung tissue samples; 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by IL-10 gene therapy and 12 hours of EVLP; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group; at some time points same blot for β actin was used for both arginase 1 and 2.

136

Figure A-4: Western blotting; arginase 2 and  actin in recipient left lung and in donor lung tissue in the “no EVLP” group at different time points. Samples were taken at different time points: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 18h CIT (timed control), 18 hours after cold ischemia; 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; Recipient left lung, normal lung tissue samples; at some time points same blot for β actin was used for both arginase 1 and 2.

137

Figure A-5: Western blotting; arginase 2 and  actin in donor lung tissue in the “EVLP” group at different time points. Samples were taken at different time points: 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by 12 hours of EVLP; EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; at some time points same blot for β actin was used for both arginase 1 and 2.

138

Figure A-6: Western blotting; arginase 2 and  actin in donor lung tissue in the “EVLP+IL-10” group at different time points. Samples were taken at different time points: Recipient left lung, normal lung tissue samples; 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by IL-10 gene therapy and 12 hours of EVLP; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group; at some time points same blot for β actin was used for both arginase 1 and 2.

139

Table A-1: Protein expression in lungs at different time points in “EVLP”, “EVLP+IL-10” and “no EVLP” groups and in recipient left lungs.

Arginase1 / Arginase2 /

Number of Number of

samples samples

β actin β actin

0h CIT 17 0.70±0.10 17 0.74±0.11

6h CIT 12 0.83±0.09 12 0.78±0.12

18 h CIT (timed control) 4 2.12±0.24 4 1.33±0.22

6h CIT+12h EVLP 6 1.09±0.15 6 0.51±0.16

6h CIT+12h EVLP +IL-10 8 0.84±0.10 9 0.76±0.25

18h CIT/1h post rep 4 1.64±0.15 4 1.33±0.15

EVLP/1h post rep 6 0.85±0.07 6 0.54±0.18

EVLP+IL-10/1h post rep 9 0.74±0.15 9 1.64±0.56

Recipient left lung 12 0.82±0.09 13 1.03±0.09 Protein expressions are shown as meanSEM. Samples were taken at different time points; 0h CIT, after harvesting the lung from donor and flushing with Perfadex; 6h CIT, 6 hours after cold ischemia; 18h CIT (timed control), 18 hours after cold ischemia; 6h CIT+12h EVLP, 6 hours of cold ischemia followed by 12 hours of EVLP, 6h CIT+12h EVLP+IL-10, 6 hours of cold ischemia followed by IL-10 gene therapy and 12 hours of EVLP; 18h CIT/1h post rep, 1 hour after transplantation and reperfusion of 18h CIT group; EVLP/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP group; EVLP+IL-10/1h post rep, 1 hour after transplantation and reperfusion of 6h CIT+12h EVLP+IL-10 group; Recipient left lung, normal lung tissue samples.

140