The Role of N-Methyl D-Aspartate Receptors in the Development Of

University of Connecticut OpenCommons@UConn

Doctoral Dissertations University of Connecticut Graduate School

8-24-2016 The Role of N-Methyl D-Aspartate Receptors in the Development of the Human Cerebral Cortex Inseyah Bagasrawala University of Connecticut - Storrs, [email protected]

Follow this and additional works at: https://opencommons.uconn.edu/dissertations

Recommended Citation Bagasrawala, Inseyah, "The Role of N-Methyl D-Aspartate Receptors in the Development of the Human Cerebral Cortex" (2016). Doctoral Dissertations. 1239. https://opencommons.uconn.edu/dissertations/1239 The Role of N-Methyl D-Aspartate Receptors in the Development of

the Human Cerebral Cortex

Inseyah Shabbir Bagasrawala, Ph.D.

University of Connecticut, 2016

Abstract

N-Methyl D-Aspartate receptors (NMDARs), a subtype of glutamate receptors, are important in neural development. The distribution and function of these receptors are well-studied in rodent and adult human brains, but far less is known about NMDARs in the human fetal cerebral cortex. The human cerebral cortex develops from multipotent neural progenitors called the radial glia cells (RGCs) that give rise to intermediate and interneuron progenitors, neurons, and glial cells. In my thesis, I studied the distribution of NMDAR subunits, NR1, NR2A and NR2B, in the human cerebral cortex from 10 to 24 gestational weeks (gw), a period of intense neurogenesis and synaptogenesis. Moreover, I studied the effects of kynurenic acid (KYNA), a neuroactive metabolite of tryptophan degradation that acts as an endogenous NMDAR antagonist. Elevated levels of KYNA have been observed in pregnant women after viral infections and in the cerebrospinal fluid of adult schizophrenic patients. In my thesis work, I used an in vitro system of RGCs enriched from the human cerebral cortex between 16 and 19 gw to study the potential impact of KYNA-induced NMDAR blockade in human corticogenesis. qPCR, in situ hybridization, Western blotting, and double immunolabeling experiments revealed the presence of mRNA and proteins of the NMDAR subunits in cortical progenitors and post-mitotic neurons along the telencephalic wall suggesting possible roles for NMDARs in progenitor proliferation, cell-fate determination, and neuronal differentiation. This was, in fact, observed in the in vitro study where blocking NMDARs either with D-amino phosphovalerate (D-APV) or KYNA significantly decreased survival, proliferation, specification and neuronal differentiation of RGCs, and increased the number of reactive astrocytes, and levels of the pro-inflammatory cytokine IL-6, activating the Jak-STAT signaling pathway. These results suggest a NMDAR-dependent mechanism for impairment of cortical circuitry formation in the human fetal brain.

The Role of N-Methyl D-Aspartate Receptors in the Development of the Human

Cerebral Cortex

Inseyah Shabbir Bagasrawala

B.Sc., The University of Mumbai, 2008

M.Sc., The University of Mumbai, 2010

A Dissertation

Submitted in Partial Fulfillment of the

Requirements for the Degree of

Doctor of Philosophy

at the

University of Connecticut

2016

i APPROVAL PAGE

Doctor of Philosophy Dissertation

The Role of N-Methyl D-Aspartate Receptors in the Development of the Human

Cerebral Cortex

Presented by:

Inseyah S. Bagasrawala, B.Sc., M.Sc.

Major Advisor ______Nada Zecevic, M.D., Ph.D.

Associate Advisor ______Srdjan D. Antic, M.D.

Associate Advisor ______Eric S. Levine, Ph.D.

Associate Advisor ______Elizabeth Eipper, Ph.D.

Associate Advisor ______James Li, Ph.D.

University of Connecticut

2016

Acknowledgments

I thank my thesis advisor, Dr. Nada Zecevic and my co-advisor, Dr. Srdjan Antic, who have supported and guided me throughout this scientific training. I also thank my committee members, Dr. Eric Levine, Dr. Betty Eipper and Dr. James Li for their guidance in my development as a scientist. The young scientists in the Zecevic laboratory, namely Dr. Nevena Radonjic, Dr. Fani Memi and Dr. Alberto Ortega, have served as mentors in my graduate school experience.

I thank the UConn Health Biomedical Sciences Ph.D. program, the Graduate Programs Committee, and the Department of Neuroscience for providing me with the intellectual foresight of advisors, scholars, and fellows from around the world.

I thank Dr. Barbara Kream for being a support system within the scientific community throughout this journey. I thank Miss Stephanie Rauch, Miss Swapna Das, and Miss Jody Gridley for guiding me from the administrative perspective. I specially thank Miss Jaishree Duggal for helping me through administration requirements as an international student.

I thank my parents, my sister and my husband for being there through every step of this challenging journey. I thank my in-laws for their well wishes.

iii

Table of Contents

Chapter 1 1 Introduction 1 Development of the human cerebral cortex 1 Gliogenesis 6 NMDARs in cortical development 7 KYNA in cortical development 11 Conclusion 16 References 19

Chapter 2 29 Expression of NMDAR subunits in the developing human telencephalic wall 29 Abstract 30 Introduction 31 Materials and Methods 33 Results 44 NMDARs are expressed in the human fetal cerebral cortex 44 Distribution of NMDAR messenger RNAs and proteins in the human 45 cerebral wall NMDARs expression in cortical progenitor subtypes 48 Glutamatergic and GABAergic neurons express NMDARs 50 Discussion 53 References 63

Chapter 3 75 Effects of NMDAR antagonist Kynurenic acid on human corticogenesis 75 Abstract 76 Introduction 77 Materials and Methods 79 Results 88 Cortical Progenitors and Neurons express NR1 at midgestation 88 KYNA Affects Cell Survival and Proliferation via blockade of 90 NMDARs KYNA alters RGC specification 92 KYNA modifies the process of neuronal differentiation 94 KYNA treatment Increases the population of Reactive Astrocytes 95 Discussion 99 References 107

Chapter 4 118 Effects of the NMDA receptor specific antagonist D-APV on human cortical 118 development Abstract 118 Introduction 119 Materials and Methods 120 Results 126 NR1 is expressed in RGC cultures 126 NMDAR blockade induces cell death and interferes with cell 128 proliferation RGC specification is altered upon blocking NMDARs 129 Blocking NMDARs shifts differentiation of RGCs towards glia 134 NMDAR blockade leads to an increased activation of astrocytes 137 Discussion 139 References 143 v Chapter 5 148 KYNA elicits an immunological response in human mixed cells cultures 148 Abstract 148 Introduction 149 Materials and Methods 152 Results 160 Human fetal mixed cells consist of progenitors, neurons and 160 astroglia KYNA was equally toxic for human mixed cells cultures as for RGC 164 cultures KYNA treatment increased the number of reactive astrocytes 165 KYNA elicits an inflammatory response 165 Jak-STAT cell signaling pathway is activated by KYNA 168 Discussion 171 References 178

Chapter 6 188 Discussion and Future Directions 188 Discussion 188 Future Directions 196 NMDAR trafficking 196 NMDAR physiology 201 References 208

Chapter 1:

Introduction

Development of the cerebral cortex

The mammalian neocortex has evolved during evolution, and thus, the shape, size, and neuron number in the cerebral cortex of different mammalian species vary widely (Hill and Walsh, 2005). These differences are in a large part due to the organization and behavior of neural progenitor cells during embryonic development. Most of our understanding of neocortical development is based on observations made from cellular and molecular studies of the mouse and rat. Although these species have neocortices that exhibit many of the key features general to all mammals, including a six-layered cortical organization and regionalization into cortical areas, they lack the increased folding and complexity of the cerebral cortex, possessed by higher mammals (Zecevic, 1993; Hill and Walsh, 2005). In contrast to the very large and highly folded (gyrencephalic) neocortex of Homo sapiens (man), the surface area of rodent neocortex is 1000 times smaller and non-folded (lissencephalic). This major morphological difference translates into a deeper significant functional difference in the process of neocortical development.

Thus, in addition to rodents, the most used animal model, we also need to study primate brains.

1 Wilhelm His, and subsequently Magini, Cajal, and Golgi, observed that development of the human neocortex depends on germinal cells known as

“spongioblasts” that line the ventricular surface of the neural tube, capable of rapid cell divisions giving rise to both neurons and glia (His, 1880; Rakic, 1971). These

“spongioblasts”, now universally known as the radial glia cells (RGCs), have a cell body situated in the ventricular epithelium with a short process attached to the ventricular surface and a long fiber that extends to the pial surface. The newly born neurons migrate intimately apposed to these RGC fibers that form scaffolds for the radial neuronal migration (Rakic, 1972). Further studies on cortical development gave rise to the radial unit and proto-map hypothesis (Rakic, 1988), which states that the same ontogeny

(progeny of a given ventricular neuronal progenitor) migrates on a continuous RGC fiber to the cortical plate, forming a radial column of cells that are functionally related, and this organization of cells project a ventricular proto-map onto the developing cortex (Rakic,

2009).

In addition to form a scaffold for neuronal migration, RGCs represent a transient population of precursor cells present in the cortical ventricular zone (VZ) at the beginning of neurogenesis (~6 gw) (Zecevic, 2004; Lui et al., 2011). Many years of dedicated research resulted in our view today that RGCs are multipotent progenitors capable of generating all other neural cell types in rodents (Malatesta et al., 2000; Noctor et al., 2001,

Tamamaki et al., 2001), and humans (Howard et al., 2008; Mo et al., 2007, 2009; Hansen et al., 2010; Yu and Zecevic, 2011; Lui et al., 2011). In humans, RGCs in the dorsal

telencephalon consist of two major subclasses, outer or basal RGCs (oRGCs) that have only a single basal fiber, and ventricular or apical RGCs (vRGCs) that have a short apical fiber and a long basal fiber. Cell bodies of vRGCs situated in the VZ, while those of oRGCs are located in the SVZ (Rakic, 1971; Haubensak, et al., 2004; Noctor et al., 2004;

Hansen et al., 2010; Lui et al., 2011). vRGCs and oRGCs express different sets of genes

(Pollen et al., 2015). For example, in the human telencephalic wall at 17 gw, vRGCs express the transcription factor Pax6, while oRGCs express another transcription factor

Hopx (Figure 1). vRGCs undergo symmetric divisions to enlarge the progenitor pool, and asymmetric divisions giving rise to both, progenitors and neurons (Malatesta et al., 2000;

Noctor et al., 2001, 2004). Some of these progenitor daughter cells migrate to the outer subventricular zone (oSVZ), which lies above the VZ, and transform into oRGCs (Hansen et al., 2010; Lui et al., 2011). oRGCs or basal progenitors undergo asymmetric divisions giving an intermediate progenitor and a neuron (Lui et al., 2011). The intermediate progenitors can undergo multiple rounds of self-renewal causing a trans-amplification of the progenitor pool before undergoing a terminal division to give two neurons. This expansion of progenitors in the human oSVZ lasts for several months and provides for the increased neuron production that is highly relevant for building a larger human brain

(Noctor et al., 2004; Kriegstein et al., 2006; Lui et al., 2011; Zecevic et al., 2011, Radonjic et al., 2014).

Figure 1. Immunolabeling of two types of RGC in coronal sections of the human fetal cerebral cortex at 17 gw. vRGCs express Pax6 (red), a transcription factor expressed during development (left), and oRGCs express Hopx (red), a transcription factor labelling this subset of the primate-specific multipotent neural progenitor cells (right). Nuclei are labeled with bis-benzimide (BB) in blue.

Radial glial fibers in gyrencephalic brains of primates diverge to form a fanned array by the time they reach the pia (Kriegstein et al., 2006, Lui et al., 2011). Fibers of

RGCs are used as scaffolds by migrating neurons to reach the developing cortical plate

(CP) from their birthplace in the VZ or oSVZ (Rakic, 1972, 2009; Reillo et al., 2011).

Neuronal migration ultimately gives rise to the six-layered neocortex in an inside-out fashion with the earliest migrated neurons forming layer VI, and the ones that migrate last form layer II-III (layer I is present from the start and almost devoid of neuronal cell bodies)

(Rakic, 1971, 1972; Rakic et al., 1986; Bystron et al., 2008, Zecevic et al., 2011). In humans, gestation period is 40 weeks long and at midgestation (~20 gw) several important developmental processes are taking place. Synaptogenesis begins and the upper cortical layers are forming. Neurons from these upper layers play a crucial role in establishing cortico-cortical connections and development of higher brain functions that characterize humans (Zecevic, 1998; Hill and Walsh, 2005). One important difference between human and rodent brains is the origin of cortical interneurons. In human the cortical interneurons are derived from RGCs in both ventral (ganglionic eminence) and dorsal (cortical VZ/SVZ) telencephalic regions. Dorsally derived cortical interneurons could be more vulnerable to alterations in the growth environment during development and could be selectively eliminated. This would result in abnormal cortical circuitry, which indeed is a hallmark of neurodevelopmental disorders, including schizophrenia, epilepsy or autism spectrum disorder (Bayatti et al., 2008; Clowry et al., 2010; Sessa et al., 2008;

Zecevic et al., 2011; Jakovcevski et al., 2011, Radonjic et al., 2014). Therefore, studying

5 factors that can affect the proliferation of the dorsal RGCs and their differentiation into cortical neurons is clinically significant for better understanding not only the normal development but also the underlying pathophysiology of psychiatric diseases.

Gliogenesis

Gliogenesis is the generation of glia populations derived from the multipotent RGC progenitors. After giving rise to the majority of neuronal populations, the remaining RGCs undergo subsequent differentiation giving rise to cells of the glial lineage. RGCs generate both astrocytes and oligodendrocytes in human cortical development (Mo et al., 2007,

2009; Yu and Zecevic, 2011; Jakovcevski et al., 2011). Astrocytes are responsible for modulating the chemical microenvironment by modulating growth factor transport and uptake, altering ion gradients, and neurotransmitter transduction during corticogenesis.

Oligodendrocytes are a highly specialized group of glia cells that produce myelin, which facilitate saltatory conduction of action potentials by insulating the entire lengths of axons.

Inflammation is one of the first defense mechanisms of the innate immune system to infection and other physiological insults such as tissue damage or stress (Gallin et al.,

1999). Cytokines are small molecules important for cell signaling with a wide-ranging roles in the innate and adaptive immune systems, where they help regulate the recruitment and activation of immune cells, induce cell apoptosis, and inhibit protein synthesis (Curfs et al., 1997). Astrocytes and microglia are the major immunocompetent

cells in the CNS. They regulate both the induction and limitation of inflammatory processes in the CNS by synthesizing various cytokines like IL-6 and IL-10, and by regulating the expression of various cell surface receptors such as pathogen recognition receptors, cytokine receptors, and numerous receptors crucial for antigen presentation synthesis of (Seth & Koul, 2008; Ransohoff & Perry, 2009).

It has been considered for a long time that the main role of astrocytes is related to neuronal support functions. However, accumulating evidence suggests that astrocytes exert a much wider spectrum of functions, including regulation of neuronal differentiation, axonal guidance, synapse formation, and brain plasticity (Seth & Koul, 2008). During an insult to the cellular environment, there is astrocytic hypertrophy, a huge increase in astrocyte number leading to gliosis, and an increase in the expression of S100β, a protein that is involved in a variety of neuronal and glial signaling mechanisms (Meyer et al.,

2011). It has been suggested that the neuro-inflammatory pathology in schizophrenia involves gliosis. Indeed, one well-established finding in this context is the increase in serum and/or cerebrospinal fluid levels of S100β in schizophrenia (Rothermundt et al.,

2009).

NMDARs in cortical development

RGCs, in rodents, are influenced by the major excitatory and inhibitory neurotransmitters, glutamate and GABA, respectively (LoTurco et al., 1995; Haydar et

7 al., 2000; Letinic et al., 2002; Matta et al., 2013). Glutamate can increase progenitor proliferation in the VZ while having opposite effects in the SVZ of the mouse embryonic cerebral cortex (Haydar et al., 2000). During rodent cortical development glutamate promotes neuronal differentiation, by modulating the cell cycle length of the progenitors in the SVZ (LoTurco et al., 1995). Both neurogenesis and neuronal migration have been shown to be NMDAR-dependent in rodent hippocampal development (Manent et al., 2005; Toriumi et al., 2012). Glutamate exerts these effects through the α-amino-3- hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPARs) and kainate receptors

(Lu et al., 2001; Matta et al., 2013). However, recent investigations in human pluripotent and human embryonic stem cell derived neurons have attributed these effects of glutamate to NMDARs (Gupta et al., 2000; Suzuki et al., 2006).

NMDARs are ligand-gated and voltage-gated ionotropic glutamate receptors composed of four subunits (two NR1 and two NR2 or NR3 subunits). The NR2 subunit possesses four isoforms A, B, C, and D, whose expression is developmentally regulated, with each isoform providing specific physiological features to the complete NMDAR (Cull-

Candy et al., 2001) (Figure 2). Glutamate released from cells of the cerebral wall affects

RGC proliferation non-synaptically (Suzuki et al., 2006) through NMDARs, whose activation increases the intracellular concentration of calcium, a secondary messenger involved in downstream signaling (Haydar et al., 2000; Marin et al., 2001; Li et al., 2015).

Several findings have suggested physiologically relevant interactions between corticogenesis and NMDAR function (Blanton et al., 1990; LoTurco et al., 1991, 1995;

Figure 2. The NMDAR is a membrane-spanning heteromeric glutamate receptor consisting of the obligatory NR1 subunit and any of the four isoforms (A, B, C, D) of the

NR2 subunit. The NR2 subunit binds to the ligand glutamate, while the NR1 subunit binds to the co-agonist glycine.

9 Haydar et al., 2000; Reiprich et al., 2005; Li et al., 2015). These studies were performed in rodents at the neonatal stage which corresponds to the human midgestation (20 gw), the developmental period studied here.

During embryonic and early postnatal development in rodents, NMDARs containing mainly NR1, NR2B, NR2D, and NR3A are present throughout the brain (Cull-

Candy et al., 2001; Henson et al., 2008). The expression of NR2B, NR2D, and NR3A decreases during maturation, while NR2A and/or NR2C become more abundant

(Watanabe et al., 1992; Ciabarra et al., 1995; Laurie et al., 1997; Wenzel et al., 1997).

Arguably, the most studied developmental change in NMDARs is the switch from NR2B- containing NMDARs to NR2A-containing NMDARs noted during maturation of excitatory synapses. In rodents, a change of the major membrane-associated guanylate kinase

(MAGUK) at the postsynaptic end from SAP102 to PSD-95 parallels this change from

NR2B to NR2A subunits of NMDARs. In the adult synapse, NR2A is the most prevalent form although NR2B is still found; PSD-95 is the prevalent MAGUK even though SAP102 remains (Sans et al., 2005; van Zundert et al., 2004; Petralia et al., 2005).

The importance of the correct expression of NMDAR subunits is seen upon ablation of the obligatory subunit NR1 during rodent development. Normal maturation of the hippocampal circuitry is disrupted resulting in schizophrenia-like cognitive decline and behavioral deficits later in adulthood (Rodenas-Ruano et al., 2012). The pathophysiology for most of these disorders essentially remains unknown. Improper functioning of

NMDARs during development, particularly of those expressed in the primate-specific dorsal RGCs and cortical interneurons, could lead to the formation of an aberrant cortical circuitry in adulthood, possibly explaining the developmental etiology of most of the human neuropsychiatric disorders. The NMDARs undoubtedly play significant roles in maintaining a balance between cortical excitation and inhibition, synaptic plasticity, and learning and memory (Malenka et al., 1993; Paoletti et al., 2013). However, there is a lack of knowledge regarding the distribution, subunit composition, and role of NMDARs in human cortical progenitors during corticogenesis. To better understand the role of

NMDARs in human corticogenesis we propose to study the effects of NMDAR subunit specific blockade in RGC cultures established from the human fetal cortex at midgestation

(16 gw to 23 gw).

Kynurenic acid (KYNA) in cortical development

KYNA was identified as a constituent of canine urine (hence its name) as early as1853 (Liebig, 1853). In the early part of this century, KYNA was recognized as a side product of tryptophan metabolism in mammals (Ellinger, 1904) (Figure 3), but no particular biological function was suggested until 1982, when its neuro-inhibitory potency was discovered in neurophysiological experiments in rat cortical neurons (Perkins and

Stone, 1982). Studies from several laboratories soon established a unique pharmacologic profile of KYNA: KYNA is an antagonist to ionotropic excitatory receptors, namely, the nicotinic acetylcholine receptors (nAChRs), and NMDARs in the rodent brain (Stone et

Figure 3. KYNA is a by-product of tryptophan metabolism, with kynurenine aminotransferase (KAT) functioning as the rate-limiting enzyme.

al., 1989). Subsequent receptor binding and physiological studies in rodents demonstrated that KYNA can also competitively act, with higher potency (Kd -8 μM), at the glycine site associated with the NMDAR complex (Kessler et al., 1989). This site, which is clearly essential for receptor function, appears to constitute a primary target of

KYNA (Kleckner and Dingledine, 1988). Conceivably, KYNA can therefore exert control over NMDAR activity, particularly when the modulatory site is not saturated with glycine.

KYNA was first reported in the mammalian brain in 1988 (Moroni et al., 1988; Turski et al., 1989) with tissue concentrations (1- 5 nM) varying between brain regions and, more dramatically, between species. The rat brain, for example, contains 10 times less KYNA than the human brain. Levels of KYNA in the brain increase with age, so that the cerebral cortex of a 2-year old rat has 10 times more KYNA than a 2-month old rat (Moroni et al.,

1989). The concentration of KYNA found extracellularly in the rat brain and in the human cerebrospinal fluid (CSF), as determined by microdialysis, is about ~2 nM (Swartz et al,

1991). Since only extracellular KYNA can interact with neuronal excitatory receptors, normal KYNA concentrations are probably not sufficient to occupy a substantial portion of the receptor site(s).

KYNA can penetrate the blood-brain barrier under physiological conditions via the large amino acid transporter that also transports L-kynurenine, the bio-precursor of

KYNA, and tryptophan, the parent molecule of all the derivatives of the KYNA pathway

(Fukui et al., 1991). Kynurenine pathway metabolites are actively accumulated by astrocytes and neurons in the brain. Uptake of these molecules by astrocytes is a sodium-

13 independent process, which is far more efficient than the sodium-dependent neuronal uptake of these molecules (Speciale and Schwarcz, 1990). Kynurenine aminotransferase

(KAT) is the enzyme that catalyzes the biosynthesis of KYNA from kynurenine. In contrast to the rat brain, the human brain contains two KAT isoforms - KAT I and KAT II, both of which have Km values for kynurenine in the low nanomolar range. Although, KAT II is considered to be predominantly present under physiological conditions, the existence of two distinct enzymes certainly raises questions concerning differential cellular localization, and the possible exclusive participation of only one KAT enzyme in processes related to KYNA dysfunction in the human brain (Okuno et al., 1991).

Upon completing its function as an excitatory receptor antagonist, it is not clear whether KYNA is taken up by the neuronal cells, or exits the brain as it is. Moreover, the fate of KYNA following its emergence in the extracellular compartment in the brain is currently not well studied. Sporadic reports have suggested the existence of specific

KYNA-catabolizing enzymes (Takahashi et al., 1956; Horibata et al., 1961), however, so far no reproducible evidence has been reported either for the selective degradation or the successful reuptake of KYNA in the brain (Turski and Schwarcz, 1988). It has been suggested, though, that KYNA is removed from the brain by a probenecid-sensitive mechanism (Moroni et al., 1988). The question of KYNA removal from the brain needs more attention and the mechanisms need to be elaborated in greater detail in the future.

KYNA induces the secretion of pro-inflammatory cytokines, such as interleukin-6

Figure 4. The activation of JAKs after cytokine stimulation results in the phosphorylation of STATs, which then dimerize and translocate to the nucleus to activate gene transcription.

15 (IL-6), in human fetal astrocytic cultures, which in turn generates reactive astrocytes

(Brown et al., 2010). Binding of IL-6 to its receptor, IL-6 receptor (IL-6R), activates the

Janus kinase-signal transducer and activator of transcription (Jak-STAT) pathway (Figure

4), which is an important pathway in gliogenesis (Brown, 2012). Autophosphorylation of

Jak attracts STATs, including STAT3, phosphorylating STAT that dimerizes and functions as a transcription factor in the nucleus. Phosphorylated STAT3 binds to the promotor of

Gfap gene and induces Gfap transcription. Gfap is a characteristic astrocyte gene, and increased Gfap expression is an indication of gliogenesis in development, and gliosis in an immune response (Meyer et al., 2011).

The emerging picture of KYNA in developmental, molecular and cellular neuroscience is both increasingly complex and fascinating. The interplay between neurons and astrocytes is clearly central to an understanding of most KYNA-related mechanisms, so it appears prudent to focus future efforts on the careful investigation of neuron-glia relationships as they pertain to KYNA.

Conclusion

Numerous neuropsychiatric disorders including schizophrenia and autism spectrum disorders have been hypothesized to have a developmental origin where formation of the cortical circuitry is hampered during growth (Lewis et al., 2002; Haber et al., 2010; Money et al., 2013, Selemon and Zecevic, 2015). Such malformations in the

cortical circuitry can occur by modifications in the proliferation and differentiation of cortical RGCs that can give rise to both cortical neurons and glial cells (Fatemi et al.,

2002; Mo et a;., 2007; Howard et al., 2008; Endele et al., 2010). Previous studies in rodents and recent investigations in human neural precursor cells have described glutamate-mediated effects on proliferation and differentiation of neural precursors

(LoTurco et al., 1991; Haydar et al., 2000; Suzuki et al., 2006). However, there is a lack of knowledge regarding the distribution, subunit composition, and role of NMDARs in human corticogenesis. We propose to explore the role of NMDARs in proliferation and differentiation of dorsal RGCs in human fetal brains at midgestation (~20 gw), which is a period of intense neurogenesis and synapse formation in the human cerebral cortex.

Specifically, we first examined the spatial and temporal expression of the major

NMDAR subunits (NR1, NR2A and NR2B) from 10 gw to 24 gw along various transitory layers (zones) of the cerebral wall in the human fetal cortex using qPCR, Western blotting, in situ hybridization, and immunohistochemistry.

Secondly, we examined the role of NMDARs by blocking these receptors in vitro.

We established mixed human cortical cultures and enriched human RGCs (CD15+) at midgestation (16-19 gw) using magnetic activated cell sorting (MACS). This in vitro system allowed us to use the NMDAR-specific antagonist D-APV, and an endogenous excitatory receptor antagonist KYNA, which possesses a high binding affinity for the NR1

17 subunit of NMDARs. Using the human fetal RGC cultures, we examined the role of

NMDARs on proliferation, specification and differentiation of human cortical progenitors by employing cell survival assay, qPCR, Western blotting, and immunostaining.

Next, to determine if IL-6 is the cytokine released upon KYNA treatment in human fetal mixed cell cultures, we examined the levels of secreted IL-6 using sandwich ELISA.

We further explored the activation of the Jak-STAT pathway by Western blotting for pSTAT3. In this aim we determined the levels of IL-6, and hypothesized that increasing concentrations of KYNA will increase reactive astrocyte population, elevate IL-6 production and activate the Jak-STAT cell signaling pathway necessary for the astrocytic

Gfap gene expression. The experiments in this aim will determine if NMDARs influence human neural progenitors through the Jak-STAT pathway.

A thorough examination of significant molecules, like NMDARs, whose expression is spatially and temporally regulated during cortical development, is required to study the underlying causes for most of the complex brain disorders. The proposed studies, focused on human cerebral cortex development at midgestation will enable us to understand the role of NMDARs in proliferation, specification and differentiation of human cortical progenitors. The results obtained from these studies will give a better insight into the cortical development in humans, and in the future facilitate detection of drug targets and suggest novel therapeutic intervention for neuropsychiatric diseases.

References

Bayatti N, Sarma S, Shaw C, Eyre JA, Vouyiouklis DA, Lindsay S. et al. Progressive loss of PAX6, TBR2, NEUROD and TBR1 mRNA gradients correlates with translocation of

EMX2 to the cortical plate during human cortical development. Eur. J. Neurosci. 28: 1449-

1456 (2008).

Blanton MG, Lo Turco JJ, Kriegstein AR. Endogenous neurotransmitter activates N- methyl-D-aspartate receptors on differentiating neurons in embryonic cortex. Proc. Natl.

Acad. Sci. U. S. A. 87, 8027–30 (1990).

Brown AS, Derkits EJ. Prenatal infection and schizophrenia: A review of epidemiologic and translational studies. Am. J. Psychiatry. 167: 261–280 (2010).

Brown AS. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev. Neurobiol. 72, 1272–1276 (2012).

Bystron I, Blakemore C, Rakic P. Development of the human cerebral cortex: Boulder

Committee revisited. Nat Rev Neurosci 9:110–122 (2008).

Clowry G, Molnar Z, Rakic P. Renewed focus on the developing human neocortex. J.

Anat. 217: 276-288 (2010).

Ciabarra A, et al. Cloning and characterization of chi-1: a developmentally regulated member of a novel class of the ionotropic glutamate receptor family. J Neurosci. 15:6498

(1995).

Cull-Candy S, Brickley S, Farrant M. NMDA receptor subunits: diversity, development and disease. Curr Opin Neurobiol 11:327–335 (2001).

Curfs, J. H., Meis, J. F., & Hoogkamp-Korstanje, J. A.. A primer on cytokines: Sources,

19 receptors, effects, and inducers. Clin Microbiol Rev 10, 742–780 (1997).

Ellinger A. Die Entstehung der Kynurendure. 2. Physiol. Chem. 43: 325-337 (1904).

Endele S. et al. Mutations in GRIN2A and GRIN2B encoding regulatory subunits of NMDA receptors cause variable neurodevelopmental phenotypes. Nat. Genet. 42, 1021–6

(2010).

Fatemi SH. et al. Prenatal viral infection leads to pyramidal cell atrophy and macrocephaly in adulthood: implications for genesis of autism and schizophrenia. Cell. Mol. Neurobiol.

22, 25–33 (2002).

Fukui S, Schwarcz R, Rapoport SI, Twa Y, SMITH QR. Blood-brain transport of kynurenines: Implications for brain synthesis and metabolism. J. Neurochem. 56: 2007-

2017 (1991).

Gallin, J. I., Snyderman, R., Fearon, D. T., Haynes, B. F., & Nathan, C.. Inflammation:

Basic Principles and Clinical Correlates. Philadelphia: Lippincott Williams & Wilkins

(1999).

Gupta A, Wang Y, Markram H. Organizing principles for a diversity of GABAergic interneurons and synapses in the neocortex. Science 287:273–278. (2000).

Haber SN, Rauch SL. Neurocircuitry: a window into the networks underlying neuropsychiatric disease. Neuropsychopharmacology 35:1–3 (2010).

Hansen DV, Lui JH, Parker PRL, Kriegstein, AR. Neurogenic radial glia in the outer subventricular zone of human neocortex. Nature 464:554–561 (2010).

Haubensak W, Attardo A, Denk W, Huttner WB. Neurons arise in the basal neuroepithelium of the earlymammaliantelencephalon: a major site of neurogenesis. Proc

Natl Acad Sci USA 101:3196–3201 (2004).

Haydar TF, Wang F, Schwartz ML, Rakic P. Differential modulation of proliferation in the neocortical ventricular and subventricular zones. J Neurosci 20:5764–5774 (2000).

Henson MA, Roberts AC, Salimi K, Vadlamudi S, Hamer RM, Gilmore JH, et al. 2008.

Developmental regulation of the NMDA receptor subunits, NR3A and NR1, in human prefrontal cortex. Cereb Cortex 18:2560–2573.

Hill RS, Walsh, CA. Molecular insights into human brain evolution. Nature 437:64–67

(2005).

His W. Anatomy of the human embryo, 3 pt and atlas. FCW, Vogel, Leipzig (1880–1885).

Horibatka H, Taniuchmi, Tashiros S, Kuno O, Hayashi I. The metabolism of kynurenic acid. 11. Tracer experiments on the mechanism of kynurenic acid degradation and glutamic acid synthesis by Prcwhmm extracts. J. Biol. Chern. 236 (1961).

Howard BM. et al. Radial glia cells in the developing human brain. Neuroscientist 14:459–

73 (2008).

Jakovcevski I, Mayer N, Zecevic N. Multiple origins of human neocortical interneurons are supported by distinct expression of transcription factors. Cereb. Cortex. 21: 1771–

1782 (2011).

Kessler M, Terramani G, Lynch T, Baudry M. A glycine site associated with N-methyl- paspartic acid receptors: Characterization and identification of a new class of antagonists.

J. Neurochem. 52: 1319-328 (1989).

Kleckner NW, Dingledine R. Requkment for giycine in activation of NMDA receptors expressed in Xenopus oocytes. Science 2.41: 835-836 (1988).

21 Kriegstein A, Noctor S, Martinez-Cerdeno V. Patterns of neural stem and progenitor cell division may underlie evolutionary cortical expansion. Nat Rev Neurosci. 7:883--890

(2006).

Laurie DJ, et al. Regional, developmental and interspecies expression of the four

NMDAR2 subunits, examined using monoclonal antibodies. Brain Res Mol Brain Res.

51:23 (1997).

Letinic K, Zoncu R, Rakic P. Origin of GABAergic neurons in the human neocortex. Nature

417:645–9 (2002).

Lewis DA, Levitt P. Schizophrenia as a disorder of neurodevelopment. Annu. Rev.

Neurosci. 25: 409–432 (2002).

Li D, Takeda N, Jain R, Manderfield LJ, Liu F, Li L, Anderson SA, Epstein JA. Hopx distinguishes hippocampal from lateral ventricle neural stem cells. Stem Cell Res 15:522-

529 (2015).

Liebig J. uber Kynurendure. Justus Liebig's Ann. Chem. 86: 125-126 (1853).

LoTurco JJ, Wanton MG, and Kriegstein AR. Initial Expression and Endogenous

Activation of NMDA Channels in Early Neocortical Development. J Neurosci 17:792–799

(1991).

LoTurco JJ, Owens DF. Heath MJ, Davis MB, Kriegstein AR. GABA and glutamate depolarize cortical progenitor cells and inhibit DNA synthesis. Neuron 15:1287–1298

(1995).

Lu S, Zecevic N, Yeh HH. Distinct NMDA and AMPA Receptor – Mediated Responses in

Mouse and Human Cajal-Retzius Cells. J Neurophysiol 86:2642-2646 (2001).

Lui JH, Hansen DV, Kriegstein AR. Development and evolution of the human neocortex.

Cell 146:18–36 (2011).

Malatesta P, Hartfuss E, Götz M. Isolation of radial glial cells by fluorescent-activated cell sorting reveals a neuronal lineage. Development 127:5253–5263 (2000).

Malenka RC, Nicoll RA. NMDA-receptor-dependent synaptic plasticity: multiple forms and mechanisms. Trends Neurosci 16:521-527 (1993).

Manent JB, Demarque M, Jorquera I, Pellegrino C, Ben-Ari Y, Aniksztejn L et al. A noncanonical release of GABA and glutamate modulates neuronal migration. J. Neurosci.

25: 4755–4765 (2005).

Marin O, Rubenstein JL. A long, remarkable journey: tangential migration in the telencephalon. Nat Rev Neurosci 2:780–790 (2001).

Matta JA et al. Developmental origin dictates interneuron AMPA and NMDA receptor subunit composition and plasticity. Nat. Neurosci. 16:1032–41 (2013).

Meyer U, Weiner I, McAlonan GM, Feldon J. The neuropathological contribution of prenatal inflammation to schizophrenia. Expert Rev. Neurother. 11: 29–32 (2011).

Mo Z. et al. Human cortical neurons originate from radial glia and neuron-restricted progenitors. J. Neurosci. 27:4132–45 (2007).

Mo Z, Zecevic, N. Human fetal radial glia cells generate oligodendrocytes in vitro. Glia

57:490–498 (2009).

Money KM, Stanwood GD. Developmental origins of brain disorders: roles for dopamine.

Front. Cell. Neurosci. 7:260 (2013).

Moroni F, et al. Presence of kynurenic acid in the mammalian brain. J. Neumhem. 51:

23 177-180 (1988).

Moroni F, et al. Kynurenic acid in the mammalian brain incrrascs during the aging process or after the administration of its precursors. In Frontiers in Excitatory Amino Acid

Research. 629-636. (1989).

Noctor SC, Flint AC, Weissman TA, Dammerman RS, Kreigstein AR. Neurons derived from radial glial cells establish radial units in neocortex. Nature 409:714–720 (2001).

Noctor SC, Martínez-Cerdeño V, Ivic L, Kriegstein AR. Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat.

Neurosci. 7:136–44 (2004).

Okuno E, Nakamura M, Schwarcz R. Two kynurenine aminotransferases in human brain.

Brain Rcs. 542: 307-312 (1991).

Paoletti, P, Bellone C, Zhou Q. NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci 14:383–400 (2013).

Perkins MN, Stone TW. An iontophoretic invesdgation of the actions of convulsant kynurenines and their interaction with the endogcnous excitant quinolinic acid. Brain Res.

247: 184-187 (1982).

Petralia R, et al. Specific endosomal associations during the trafficking of synaptic glutamate receptors. Soc Neurosci Abs949:1 (2005).

Radonjic, N. V. et al. The Role of Sonic Hedgehog in the Specification of Human Cortical

Progenitors In Vitro. Cereb. Cortex doi:10.1093/cercor/bhu183 (2014).

Rakic P. Neuron-glia relationship during granule cell migration in developing cerebellar cortex. A Golgi and electronmicroscopic study in Macacus rhesus. J Comp Neurol

141:283–312 (1971).

Rakic P. Mode of cell migration to the superficial layers of fetal monkey neocortex. J

Comp Neurol 145:61–83 (1972).

Rakic P, Bourgeois J-P, Eckenhoff MF, Zecevic N, Goldman-Rakic PS.. Concurrent overproduction of synapses in diverse regions of the primate cerebral cortex. Sci-ence

232:232–35 (1986).

Rakic P. Specification of cerebral cortical areas Science 241:170–176 (1988).

Rakic P. Evolution of the neocortex: a perspective from developmental biology. Nat. Rev.

Neurosci. 10:724–735 (2009).

Ransohoff, R. M., & Perry, V. H. Microglial physiology: Unique stimuli, specialized responses. Annu Rev Immunol 27, 119–145 (2009).

Reillo I, de Juan Romero C, García-Cabezas MÁ, Borrell VA. role for intermediate radial glia in the tangential expansion of the mammalian cerebral cortex. Cereb. Cortex 21,

1674–94 (2011).

Reiprich P, Kilb W, Luhmann HJ. Neonatal NMDA receptor blockade disturbs neuronal migration in rat somatosensory cortex in vivo. Cereb Cortex 15:349–358 (2005).

Rodenas-Ruano A, Chávez AE, Cossio MJ, Castillo PE, Zukin, RS. REST-dependent epigenetic remodeling promotes the developmental switch in synaptic NMDA receptors.

Nat Neurosci 15:1382–90 (2012).

Rothermundt, M., Ahn, J. N., & Jörgens, S. S100B in schizophrenia: An update. Gen

Physiol Biophys 28, F76–F81 (2009).

Sans N, et al. Mpins modulates PSD-95 and SAP102 trafficking and influences NMDAR

25 surface expression. Nat Cell Biol. 7:1179 (2005).

Selemon L., & Zecevic, N. Schizophrenia: A Tale of Two Critical Periods for Prefrontal

Cortical Development. Translational Psychiatry 5, e623; doi:10.1038/tp.2015.115.

Review (2015).

Sessa A, Mao CA, Hadjantonakis AK, Klein WH, Broccoli V. Tbr2 directs conversion of radial glia into basal precursors and guides neuronal amplification by indirect neurogenesis in the developing neocortex. Neuron 60, 56–69 (2008).

Seth, P., & Koul, N. Astrocyte, the star avatar: Redefined. J Biosci 33, 405–421(2008).

Speciale C, Schwarcz R. Uptake of kynurenine into rat brain slices. J. Neurochem. 54:

156163 (1990).

Stone TW, Burton NR, Smith DAS. Elecuuphysiology of quinolinic acid and other kynurenines, and their potential roles in the CNS. In QuinoliNc Acid and the Kynurenines.

T. W. Stone, Ed.: 114-148. CRC Press. Boca Raton, FL (1989).

Suzuki M, Nelson AD, Eickstaedt JB, Wallace K, Wright LS, and Svendsen CN.

Glutamate enhances proliferation and neurogenesis in human neural progenitor cell cultures derived from the fetal cortex. Eur J Neurosci 24:645–653 (2006).

Swartz K, During JMJ, Frefse A, Beu MF. Cerebral synthesis and release of kynurenic acid: an endogenous antagonist of excitatory amino acid receptors. J. Neurosci. 10: 2965-

2973 (1991).

Takahashhi M, Price MA. The conversion of kynurenic acid in quinaldic acid by humans and rats. J. Biol. Chem. 223: 705-708 (1956).

Tamamaki N, Nakamura K, Okamoto K, Kaneko T. Radial glia is a progenitor of

neocortical neurons in the developing cerebral cortex. Neurosci Res 41:51–60 (2001)

Toriumi K, Mouri A, Narusawa S, Aoyama Y, Ikawa N, Lu L et al. Prenatal NMDA

Receptor Antagonism Impaired Proliferation of Neuronal Progenitor, Leading to Fewer

Glutamatergic Neurons in the Prefrontal Cortex. Neuropharmacology 37: 1387–1396

(2012).

Turski WI, Nakamubaw M, Todd P, Carpenter BK, Whetsell O, Sschwarcz R.

Identification and quantification of kynurenic acid in human brain tissue. Brain Res. 454:

164-169 (1988).

Turski WA, Schwarcz R. On the disposition of intrahippocampally injected kynurenic acid in the rat. Exp. Brain Rcs. 71: 563-567 (1988).

Van Zundert B, Yoshii A, Constantine-Paton M. Receptor compartmentalization and trafficking at glutamate synapses: a developmental proposal. Trends Neurosci. 27:428

(2004).

Watanabe M, et al. Developmental changes in distribution of NMDAR channel subunit mrnas. Neuroreport. 3:1138 (1992).

Wenzel A, et al. N-methyl-D-aspartate receptors containing the NR2D subunit in the retina are selectively expressed in rod bipolar cells. Neuroscience. 78:1105 (1997).

Yu X, Zecevic N. Dorsal radial glial cells have the potential to generate cortical interneurons in human but not in mouse brain. J. Neurosci. 31:2413–20 (2011).

Zecevic N: Cellular composition of the telencephalic wall in human embryos. Early Human

Dev. 32:131-149 (1993)

Zecevic N Synaptogenesis in Layer I of the Human Cerebral Cortex in the First Half of

27 Gestation. Cereb.Cortex, 8(3): 245-252(1998).

Zecevic N. Specific characteristics of radial glia in the human fetal telencephalon. GLIA,

48:27-35 (2004).

Zecevic N, HuF, Jakovcevski I. Cortical interneurons in the developing human neocortex.

J Neurobiol 71:18–33 (2011).

Chapter 2

N-methyl D-aspartate receptor expression patterns in the

human fetal cerebral cortex

Submitted to Cerebral Cortex journal

Authors: Inseyah Bagasrawala, Fani Memi, Nevena Radonjic and Nada Zecevic

Author contributions:

IB: Performed all experiments, data analysis, and major writing

FM: Assisted with ISH

NR: Suggested the concept of study, contribute in analyzing data and writing of the manuscript

NZ: Suggested the concept of study, contribute in in analyzing data and writing of the manuscript

Abstract

N-methyl D-aspartate receptors (NMDARs), a subtype of glutamate receptor, have important functional roles in cellular activity and neuronal development. They are well- studied in rodent and adult human brains, but limited information is available about their distribution in the human fetal cerebral cortex. Here we show that three NMDAR subunits,

NR1, NR2A, and NR2B, are expressed in the human cerebral cortex during the second trimester of gestation, a period of intense neurogenesis and synaptogenesis. With increasing fetal age, expression of the NMDAR-encoding genes Grin1 (NR1) and Grin2a

(NR2A) increased while Grin2b (NR2B) expression decreased. The protein levels of all three subunits paralleled the changes in gene expression. On cryosections, all three subunits were expressed in proliferative ventricular and subventricular zones, in radial glia, and in intermediate progenitor cells, consistent with their role in the proliferation of cortical progenitor cells and in the determination of their respective fates. The detection of NR1, NR2A, and NR2B in both glutamatergic and GABAergic neurons of the cortical plate suggests the involvement of NMDARs in the maturation of human cortical neurons and in early synapse formation. Our results and previous studies in rodents suggest that

NMDAR expression in the developing human brain is evolutionarily conserved.

Introduction

N-methyl D-aspartate receptors (NMDARs) are ligand- and voltage-gated ionotropic glutamate receptors that play critical roles in synaptic plasticity, development, learning, and memory. Impairments in their function underlie the pathophysiology of several neurological diseases, including schizophrenia, autism spectrum disorder, and epilepsy (Malenka and Nicoll 1993; Naegele 2009; Endele et al. 2010; Wang et al. 2012,

Sanz-Clemente et al. 2013, Cohen et al. 2015). In the developing brain, functional

NMDARs are present even before synapses are established, to allow the influx of calcium

(Ca2+) necessary for cellular activities such as signal transduction, gene transcription, and neuronal maturation (Pearce et al. 1987; Ben-Ari et al. 1988; Brewer and Cotman

1989; reviewed in Spitzer 2006; Jansson and Akerman 2014). Physiologically relevant interactions between corticogenesis and NMDAR function have been demonstrated in several studies (LoTurco et al. 1991, 1995; Haydar et al. 2000). The early expression of

NMDARs in the ventricular and subventricular zones (VZ/SVZ) is a prerequisite for the proliferation of neural stem cells, their differentiation into neurons and glia, and their proper migration through NMDAR-mediated Ca2+ transients (Rakic and Komuro 1995;

Weissman et al. 2004; Manent et al. 2005; Toriumi et al. 2012).

NMDARs are composed of four subunits, two NR1 and two NR2 or NR3 subunits, with NR1 being the obligatory subunit (Cull-Candy et al. 2001). In the developing rodent,

NMDAR subunits undergo major changes in their expression levels, reflecting the specific

31 physiological function of each receptor isoform in cell proliferation, synaptogenesis, and activity-dependent remodeling (Kleinschmidt et al. 1987, Bear et al. 1987; Constantine-

Paton et al. 1990; Monyer et al. 1994; Dumas 2005; Sanz-Clemente et al. 2013).

Additional studies in rodents have shown age-related shifts in the expression levels of the

NMDAR subunits, with the expression of NR2A increasing and that of NR2B decreasing with age (Barria and Malinow 2002; Rodenas-Ruano et al. 2012; Sanz-Clemente et al.

2013). This shift has functional significance with respect to development of the cortical circuitry and cortical function (Dumas 2005).

To better understand the functional role of NMDARs in human corticogenesis, it is essential to first study their expression pattern in the developing cerebral cortex. NMDARs distribution in the human fetal cortex has been explored in much less detail than in animal models. In humans, NMDARs distribution has been examined in late gestational and neonatal ages and in the adult brain (Conti et al. 1999; Law et al. 2003; Suzuki et al, 2006;

Henson et al. 2008, Jantzie et al. 2015). The focus of the present study was the first half of gestation (10–24 gw), as in the human fetal cortex this is a critical period for neurogenesis, migration, and the beginning of synaptogenesis (Kostovic and Rakic 1990;

Zecevic 1998; Rakic 2009; Marin-Padilla 1998; Zecevic et al. 1999; Meyer et al. 2000;

Bayatti et al. 2008; Clowry et al. 2010; Malik et al., 2013). Using different methods, we demonstrated that NMDARs subunits are expressed by cortical progenitor cells and by young neurons. This cell-type specific distribution suggests roles for NMDARs in the proliferation and fate determination of cortical progenitor cells, and in maturation and

synaptogenesis of young cortical neurons during human corticogenesis.

Material and Methods

Human fetal brain tissue

Human brain tissue (n = 11) from fetuses aged 10–24 gestational weeks (gw)

(Table 1) and free of any developmental abnormalities was obtained from the Tissue

Repository of The Albert Einstein College of Medicine (Bronx, NY) and the Human

Developmental Biology Resource (http://hdbr.org), Newcastle upon Tyne, England. The tissues were handled according to the requirements and regulations of Institutional Ethics

Committees. The age of the tissues was determined based on crown-rump length, number of weeks after donor ovulation, and anatomical landmarks. The tissues were transported on ice in Hank’s balanced salt solution (HBSS; Life Technologies, Grand

Island, NY, USA) from the aforementioned brain repositories to our labortatory. Blocks of tissue cut in a coronal plane at the level of the thalamus were fixed, and cryopreserved, for in situ hybridization and immunohistochemistry. In addition small samples (1cm2) of unfixed tissue were taken from the whole width of dorsal and medial telencephalic wall for Western blot and qPCR. Whenever possible we used multiple methods on the same case, but not all the fetal ages or regions were available for every method used in this study. This is specified in Table 1 and in the Results.

Immunohistochemistry

33 Table 1 Description of human fetal tissue and methods used.

Case Gestational Method Used number Week

1 10 In situ hybridization (ISH)

2 15 qPCR, Western blot

3 16 Immunohistochemistry, ISH

4 17 qPCR, Western blot, Immunohistochemistry, ISH

5 17 qPCR, Western blot, Immunohistochemistry, ISH

6 18 qPCR, Western blot, Immunohistochemistry

7 19 qPCR, Western blot, Immunocytochemistry, ISH

8 21 qPCR, Western blot, Immunocytochemistry, ISH

9 22 qPCR, Western blot, Immunocytochemistry, ISH

10 23 qPCR, Western blot, Immunocytochemistry, ISH

11 24 qPCR, Western blot, Immunocytochemistry, ISH

Cryopreserved coronal sections (22 μm) of the mid-gestational human fetal brain

(Table 1) were dried at 37°C for 3 h and then incubated in citrate buffer (pH 9.0) at 80°C for 7 min for antigen retrieval, placed in a humidifying chamber, and washed with phosphate-buffered saline containing 0.01% Triton X-100 (PBS-T). Unspecific antibody binding was inhibited by incubating the sections in a blocking solution consisting of 10% normal goat serum in PBS-T (NGS-PBS-T) for 1 h at room temperature (RT). Primary antibodies (Table 2) were diluted in 1% NGS-PBS-T. The sections were treated with primary antibody diluted in blocking solution, and incubated at 4°C overnight. After three

5-min washes with PBS, the sections were incubated at RT for 2 h with flourophore- conjugated secondary antibodies diluted in PBS. After a second PBS washing step (3 ×

5 min each), the sections were incubated with the nuclear stain bisbenzimide (BB) for 1 min at RT.

Immunohistochemistry image analysis

Immunolabeled sections were visualized using an Axioscope microscope (Zeiss,

Germany) with Axiovision software and photographed using a digital camera. Twelve images were taken from predesignated adjacent optical fields in dorsal or dorso-medial portion of the telencephalic wall and from three different human samples per experimental group for cell counting. Optical sectioning (in steps of 1 μm thickness) were taken from

20 μm cryosections to clearly observe the co-localization of the immunostaining. The images were compressed in the Z-plane to obtain maximum intensity projection images, and assembled in Adobe Photoshop (v. 7.0), with consistent quality adjustments for

Table 2 Antibodies used for immunocytochemistry and Western blotting.

Primary Antibody Cell Type Identified Species Dilution Company

NR1 - mouse 1:200 NeuroMab

NR2A - mouse 1:200 NeuroMab

NR2B - mouse 1:200 NeuroMab

Hopx Basal RGC Rabbit 1:200 Santa Cruz

Ki67 Proliferating Cells rabbit 1:500 Abcam

Pax6 RGC rabbit 1:250 Abcam

Tbr2 Intermediate Progenitor rabbit 1:200 Abcam

Nkx2.1 Interneuron Progenitor rabbit 1:200 Abcam

βIII tubulin Neuron rabbit 1:5000 Sigma-Aldrich

Tbr1 Glutamatergic Neuron rabbit 1:200 Proteintech

GABA Interneuron rabbit 1:500 Sigma-Aldrich

CalR Interneuron rabbit 1:500 Swant

GAPDH Housekeeping mouse 1:5000 Millipore

contrast, brightness and color balance. Immunolabeled cells were counted in separate channels corresponding to each antibody. Cells that showed immunoreaction for both applied antibodies were quantified as a percentage of the total cell number in the optical fields labeled with the nuclear dye bisbensimide (BB). One-way ANOVA followed by a

Bonferroni post hoc test was used for comparisons of the three groups categorized by age.

Western blot

Human cortical tissue (Table 1), was homogenized in hypotonic phosphate buffer containing protease and phosphatase inhibitors (PMSF (1 mM), NaF (5 mM), Na- orthovanadate (1 mM), PIC (1 mM; Thermo Scientific)), freeze-thawed, and centrifuged at 600 × g. The supernatant was mixed with RIPA buffer (150 mM NaCl, 1.0% Triton X-

100, 0.5% Na-deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) containing protease and phosphatase inhibitors (same as above), freeze-thawed, and centrifuged at 13000 × g for

15 min and the resulting supernatant was collected. To obtain membrane proteins the pellet was re-suspended in RIPA buffer containing protease and phosphatase inhibitors, freeze-thawed, and then centrifuged at 10000 × g for 15 min and the resulting supernatant was used for experimental analysis. The protein concentration of the samples was determined using the BCA protein assay kit (Thermo Fisher Scientific). Polyacrylamide gels (4–12%; Bio-Rad) were then used to separate the proteins based on their molecular mass at 110 Volts for 90 min. Samples were run, on three separate gels, to obtain results in triplicates. The separated proteins were electro-transferred onto a polyvinylidene

37 fluoride membrane at 100 Volts for 60 min. A Ponceau stain on every blot, and a

Coomassie stain for every gel was performed to confirm complete transfer of separated proteins. The membrane (blot) was blocked with 5% milk in TBS-T (1.0% Tween-20, PBS,

0.1% Triton X-100, distilled water; pH 7.4) and then incubated overnight at 4°C with primary antibodies (Table 2) diluted in blocking solution (0.1 M Tris, 2% non-fat dry milk,

0.15 M NaCl, 0.01% Na-azide, pH 7.4) against the proteins of interest. After three washes, the blot was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Millipore) for 2 h at RT. After three washes, blots were incubated with

SuperSignal West Dura Extended Duration Substrate (Thermo Scientific), and imaged on

ChemiDoc MP (Bio-Rad) digital imaging system. The loading control for each blot was

GAPDH (primary antibody dilution 1:5000). The density of each band was determined in

Adobe Photoshop (v.7.0) using histogram analysis. The values obtained for each band were divided by the value of the corresponding GAPDH band. The averaged values obtained from groups 18-21 gw and 22-24 gw were normalized to the group 15-17 gw to overcome individual differences between tissue samples.

RT-PCR and qPCR

Human cerebral cortex tissue (15–24 gw, Table 1), dissected as described above, was used for RNA isolation and qPCR analysis. The tissue was treated with ice-cold

TRIZOL® reagent (Invitrogen) for 10 min followed by mechanical homogenization. After the addition of chloroform (200 μl) to the homogenates, the tubes were vortexed and incubated for 15 min at 4°C. They were then centrifuged at 13000 × g for 15 min at 4°C.

Table 3 Primers used for qPCR.

Genes Forward Primer Sequence Reverse Primer Sequence

5`-CCA GTC AAG AAG GTG 5`-TTC ATG GTC CGT GCC Grin1 ATC TGC AC-3` AGC TTG A-3`

5`-CTC TCC TTG GAA GAG 5`-TGG CTG CTC ATC ACC Grin2a GCA GAT C-3` TCG TTC T-3`

5`-TTC CAC TGG CTA TGG 5`-GAC AAA TGC CAG TGA Grin2b CAT TGC C-3` GCC AGA G-3`

5`-ACC ACC ATG GAG AAG 5`-GGC ATG GAC TGT GGT Gapdh GC-3` CAT GA-3`

39 The upper transparent phase was collected in sterile tubes and incubated with isopropanol (500 μl/ tube) for 20 min at RT, followed by centrifugation at 13000 × g for

15 min at 4°C. The pellets were incubated with 75% ethanol at 4°C and then centrifuged at 13000 × g for 15 min to pellet the RNA. The air-dried RNA was dissolved in 5%

RNase Out solution. RNA concentrations were determined using NanoDrop technology

(260/280 ratio obtained was between 1.93 and 2.0). cDNAs (40 μl) were synthesized from 1-μg RNA samples using reverse transcriptase-PCR and the first-strand synthesis

SuperScript III kit (Invitrogen). cDNA concentrations were determined using NanoDrop technology with 260/280 ratios between 1.79 and 1.81. We pooled aliquots of all the cDNA samples to generate a standard curve (samples run in triplicates on the same plate) with the log (DNA copy#) plotted on the Y-axis and the cycle of threshold (Ct) value plotted on the X-axis, to determine the efficiency of the qPCR protocol. The slope determined from the standard curve was used to calculate the efficiency of the qPCR process. The SYBR Green (Applied Biosystems, Cheshire, UK) protocol was applied to the cDNA samples to analyze the mRNA expression levels of the genes of interest.

Gene specific primers are presented in Table 3.. The qPCR protocol involved a heating step at 95°C for 2 min followed by 40 cycles at 95°C for 15 s, 55°C for 15 s, and 68°C for 20 s. The cycle of threshold (Ct) values of GAPDH were subtracted from those of the genes of interest to obtain a ΔCt value. The ΔCt values were averaged for each age group. The ΔCt values of groups 18-21 gw and 22-24 gw were then subtracted from the value of the age group 15-17 gw to obtain the ΔΔCt value. The formula 2-ΔΔCt was used to determine the fold change in mRNA expression level in group 18-21 gw and 22-

24 gw relative to the group 15-17 gw, which was assigned an arbitrary value of 1. This normalization aids in dealing with the variations between the qualities of the original tissues used to generate the cDNA samples.

In situ hybridization

The genes Grin1, Grin2a, and Grin2b encode the NMDAR subunits NR1, NR2A, and NR2B, respectively. Plasmids containing the Grin1, Grin2a, and Grin2b coding sequences (pEYFP-NR1a, pEGFP-NR2A, and pEGFP-NR2B, respectively) were used for probe synthesis (Luo et al., 2002). The plasmids pEGFP-NR1a (Addgene plasmid

#17926), pEGFP-NR2A (Addgene plasmid #17924), and pEGFP-NR2B (Addgene plasmid #17925) were gifts from Stefano Vicini (Department of Pharmacology &

Physiology, Georgetown University Medical Center, Washington DC). Riboprobes were generated by in vitro transcription of a PCR fragment (primer sequences in Table 4) containing part of the gene sequence flanked by T3/SP6 promoter sequences, using digoxigenin (DIG)-UTP (Roche) as the label. In situ hybridization was performed as previously described (Radonjic et al., 2014). Briefly, cryosections (20 μm) were dried at

RT for 2 h, fixed for 10 min with 4% paraformaldehyde in PBS, washed twice in diethyl pyrocarbonate (DEPC)-treated PBS, and incubated overnight at 68°C in hybridization buffer containing 1× DEPC-treated salts [200 mM NaCl, 5 mM EDTA, 10 mM Tris, pH 7.5,

5 mM NaH2PO4·2H2O, 5 mM Na2HPO4; Sigma-Aldrich), 50% deionized formamide

(Roche), 0.1 mg RNase-free yeast tRNA (Invitrogen, Carlsbad, CA, USA)/mL, 1×

Denhardts (RNase/DNase free; Invitrogen), and 10% dextran sulfate (Sigma-Aldrich)]

41 Table 4 Primers used for riboprobe synthesis.

Gene Forward Primer Sequence Reverse Primer Sequence

Grin1 with 5`-CCG ATT TAG GTG ACA CTA - SP6 TAG GAC TGA-3`

5`-CCG GCA ATT AAC CCT Grin1 with - CAC TAA AGG CGT AGA TAA T3 ACT TGT CCG AGG G-3`

5`-GCA ATT AAC CCT CAC TAA Grin2a with AGG TCT CCC TGG TGA CCA - T3 CTA TCT T-3`

5`-ATT TAG GTG ACA CTA Grin2a with - TAG TGA TAG ACC ACT TCA SP6 CCG ATC A-3`

5`- GCA ATT AAC CCT CAC TAA Grin2b with AGG AGT TCA ACC AGA GGG - T3 GTG TGA A-3`

5`-ATT TAG GTG ACA CTA Grin2b with - TAG GGT GGG TTG TCA SP6 CAG TCG TAG-3`

and 100–500 ng DIG-labeled RNA probe/ml. After hybridization, the sections were washed three times at 65°C in a solution containing 50% formamide, 1× saline-sodium citrate (Invitrogen), and 0.1% Tween 20 (Sigma-Aldrich) and three times at RT in 1×

MABT (20 mM maleic acid, 30 mM NaCl, 0.1% Tween 20; Sigma-Aldrich). They were then incubated for 1 h at RT in a solution containing 2% blocking reagent (11096176001;

Roche) and 10% heat-inactivated sheep serum in MABT, followed by an overnight incubation at 4 oC in alkaline-phosphatase-conjugated anti-DIG antibody (1:1500; Roche

Applied Science, catalogue no. 11093274910 RRID:AB_514497). The specificity of the procedure was assessed with probes corresponding to the sense strands of Grin1,

Grin2a, and Grin2b. The whole section pictures (4X magnification) that are part of Figure

2 were done on the Aperio Versa (LeicaBiosystems.com), following manufactures instructions.

Statistical analysis

For all Western Blot and qPCR experiments, triplicate values were averaged to obtain a mean value for each brain. Three groups, each consisting of at least three brains, were established according to the gestational age: 15-17 gw, 18–21 gw, and 22–24 gw.

The means obtained from each brain in a group were averaged to obtain a group mean.

Variations were expressed as the mean ± standard error (SEM). One-way ANOVA followed by Bonferroni’s post-hoc test was used to evaluate statistical significance, defined as a p value <0.05.

43 Results

NMDARs are expressed in the human fetal cerebral cortex

The quantitative expression of the genes encoding the major NMDAR subunits,

NR1, NR2A, and NR2B, was assessed by qPCR and Western blot analysis in three age groups – 15-17 gw, 18-21 gw and 22-24 gw. Our results demonstrate that the expression of Grin1, gene encoding NR1 subunit, increases with age (p<0.05; Figure 5A). The same trend was observed in expression of the gene encoding the NR2A subunit, Grin2a (Figure

5A). In contrast, expression of the NR2B gene, Grin2b, decreased with increasing age studied here (p<0.05; Figure 5A). To determine whether these changes in gene expression also occurred at the protein level, tissue lysates obtained from human fetal cerebral cortex of the same gestational ages were analyzed by Western blotting (Figure

5B). Expression of NR1 protein between all three age groups was fairly uniform (Figure

5B,C). We hypothesize that the discrepancy between the NR1 gene and protein expression is due to the high rate of Grin1 transcription accompanied by a high turnover rate of the NR1 transcript. At the same time, translation of the NR1 transcript is dependent on the cellular activity (reviewed in Paoletti et al., 2013). The expression of NR2A protein increased across the three age groups while that of NR2B decreased across the three age groups studied (Figure 5C) (p<0.05), congruent with qPCR results. Although the relatively short developmental time span studied here does not allow firm conclusions about the timing of the developmental switch from NR2B to NR2A in human cerebral cortex, our results suggest that it begins during midgestation (22–24 gw).

Figure 5. The three NMDAR subunits, NR1, NR2A, and NR2B, are expressed in human fetal brain at mid-gestation. (A) Expression of the genes Grin1 and Grin2a increases with age, while that of Grin2b decreases from the youngest group 15-17 gw to the oldest group

22-24 gw (n=3 per age group; p<0.05). The mean values are plotted; the error bars represent ± the SEM. (B) Western blot of the NR1, NR2A, and NR2B subunits across all ages studied. GAPDH is the loading control. (C) Densitometric analysis confirms that NR1 protein expression does not change with age, while NR2A and NR2B protein levels parallel the trend in the expression of their respective genes, with an age-dependent increase in NR2A and decrease in NR2B (n=3 per age group; p<0.05). The mean values are plotted; the error bars represent ± the SEM.

44 Distribution of NMDAR mRNAs and proteins in the human cerebral wall

The distribution of the NR1, NR2A, and NR2B transcripts were examined in sagittal

(10gw) and coronal cryosections (Figure 6 A,B), while the NR1, NR2A, and NR2B proteins were examined on coronal cryosections (Figure 7 A,B) of fetal brains taken at the level of the thalamus (16- 24gw, Table 1). In situ hybridization experiments revealed that the mRNAs of all three subunits were distributed in the developing cortex as early as

10 gw (Figure 6A) and were also present during midgestation, at 17-22 gw (Figure 6B).

High levels of expression were seen in the proliferative VZ/SVZ compartments, in the transient migratory zones, the intermediate zone (IZ) and the subplate (SP), and in the neuron-rich cortical plate (CP). High magnification images of the VZ and CP (Figure 6A,B) at 10 and 22 gw indicates that the transcripts of the NMDAR subunits, exhibiting both a punctate and diffuse pattern of expression, are present in almost every cell. These findings suggest that both cortical progenitors and neurons actively transcribe the

NMDAR subunit genes during neurogenesis. Immunolabeling with NMDAR subunit- specific antibodies revealed the presence of NR1, NR2A, and NR2B in the cell bodies and processes across the telencephalic wall at all examined ages, as shown in representative samples of 17 gw (Figure 7A), and 22 gw (Figure 7B). The immunoreactivity has a transverse pattern along the VZ and SVZ suggestive of the expression of NMDAR subunits along efferent and afferent fibers/processes, as expression of NMDARs was reported at both the pre-synaptic and post-synaptic sites

(Herkert et al., 1998). In the SP and CP, the immunoreactivity for the NMDAR subunits exhibits a radial pattern that corresponds to the radial glial fibers and organization of cell

Figure 6. Distributions of NR1, NR2A, and NR2B transcripts in the telencephalic wall. In situ hybridization reveals the presence of Grin1, Grin2a, and Grin2b mRNAs in the proliferative ventricular zone (VZ) and neuron-rich cortical plate (CP) as early as (A) 10 gw (sagittal section) and (B) at 22 gw (coronal section). Higher magnifications of the CP and VZ are shown in the insets. (C) Sense (control) probes for Grin1, Grin2a, and Grin2b shown for 10 gw. D-dorsal, M-medial, R-rostral. The whole sections images are captured by Aperio Versa (LeicaBiosystems.com), at 4X.

Figure 7. Immunohistochemistry of NR1, NR2A, and NR2B (green) along the various zones of the telencephalic wall of a representative case at 17 gw (A) and 22 gw (B).

Greater immunolabeling intensity is seen for NR2A at 22 gw compared to 17gw, whereas the opposite is seen for NR2B subunit.(C) NR1 (green) expression on proliferative progenitors (Ki67+; red) in the VZ and (D) on basal radial glia (Hopx+; red) in the SVZ.

Arrows point to double-labelled cells. Cell nuclei stained blue with bisbenzimide (BB).

bodies in the CP. The highest levels of these proteins were detected in the same regions containing the highest levels of their respective transcripts, namely, in the VZ/SVZ, and

CP. Proliferating cells (Ki67+ cells) in the VZ expressed the NR1 subunit (Figure 7C) as well as the NR2A and NR2B subunits. Moreover, primate-specific basal radial glial cells

(RGCs), recognized by their expression of the transcription factor Hopx (Pollen et al.

2015; Li et al. 2015; Thomsen et al. 2016), also expressed NR1 (Figure 7D) as well as

NR2A and NR2B.

NMDAR expression by cortical progenitor subtypes

The abundant expression of NR1, NR2A, and NR2B mRNA and protein in the proliferative and neuron-rich zones of the fetal brain suggested that the three subunits would be expressed by multipotent cortical progenitors, RGCs, intermediate progenitors, and cortical neurons. To detect expression in particular cell types at these sites, coronal cryosections of fetal forebrains at different gestational ages were evaluated using double- labeling immunohistochemistry to co-localize cell-type specific markers and each of the

NMDAR subunits (Figure 8A; Table 2). Quantification of the double-labeled cells showed that the vast majority of RGCs labeled with the Pax6 antibody expressed all three NMDAR subunits. The NR1 subunit was present in 90–95% of the RGCs in all age groups studied.

In RGCs of the youngest age group (16–18 gw, n= 3), the expression of NR2B was higher than that of NR2A (85% vs. 75%), whereas in subsequent gestational weeks (18–21 gw, n=3) expression of these two subunits was nearly equal. As development proceeded to

22–24 gw (n=3), however, a higher percentage of RGCs expressed NR2A (88%) than

Figure 8. Expression of NMDAR subunits on cortical progenitors. (A) Representative images of coronal cryosections at 17 gw. Double immunolabeling experiments with antibodies against the NR1, NR2A, and NR2B NMDAR subunits (green) and the progenitor subtypes (red) Pax6 (RGCs), Tbr2 (intermediate progenitors) and Nkx2.1

(interneuron progenitors) in the proliferative VZ/SVZ. Cell nuclei stained blue with BB.

Boxed areas are presented on higher magnification in the inset. (B) Quantification of the percentage of Pax6+, Tbr2+, and Nkx2.1+ progenitors expressing the three NMDAR subunits in the three age groups (n=3 per age group; p<0.05); The mean values are plotted; the error bars represent ± the SEM.

NR2B (64%) (Figure 8B). Thus, during an 8-week period in the second trimester of gestation the expression of NR2B in RGCs decreased while that of NR2A increased.

Quantification of intermediate progenitor cells labeled with Tbr2 and a subtype of interneuron progenitors labeled with Nkx2.1 that express NR1 showed a similar age- dependent increase (Figure 8B). Specifically, NR1 was expressed in 25% of Tbr2+ cells and 35% of Nkx2.1+ cells, with expression during the subsequent weeks of gestation increasing to >40% in both subtypes. These results suggested an age-dependent increase in NR1 and NR2A expression in intermediate progenitors (Tbr2+) and Nkx2.1+ interneuron progenitors. However, in contrast to RGCs, NR2B expression in the oldest group did not change in Nkx2.1+ cells and it increased only slightly in Tbr2+ progenitors

(Figure 8B).

Glutamatergic and GABAergic neurons express NMDARs

To determine the expression levels of the NMDAR subunits across post-mitotic neurons in their final positions in the CP, immunolabeling experiments were carried out similar to those described above, but with antibodies specific to the different neuronal subtypes (Figure 9A; Table 2). Double-labeling immunohistochemistry of tissues between

16 and 24 gw revealed that all embryonic neurons labeled with a pan-neuronal marker

βIII tubulin expressed NR1, the obligatory NMDAR subunit (Figure 9B). This is in agreement with results showing that mature neurons are electrically active and express

NMDARs (Lu et al. 2001; Cull-Candy et al. 2001, 2004; Henson et al. 2008). The expression of NR2B and NR2A in cortical neurons (βIII tubulin+ cells), however, changed

Figure 9. Expression of NMDAR subunits on cortical neurons. (A) Representative images at 17 gw. Double immunolabeling experiments with antibodies against the NR1, NR2A, and NR2B NMDAR subunits (green) and the neuronal subtypes (red) βIII tubulin

(neurons), Tbr1 (glutamatergic), GABA (interneurons), and calretinin (interneuron subtype) in the cortical plate (CP) and the transient intermediate zone (IZ). Cell nuclei stained blue with BB. Arrows point to cells presented on higher magnification in the inset.

(B) Quantification of the percentage of βIII tubulin+ neurons, Tbr1+ glutamatergic neurons, and GABA+ interneurons expressing the three NMDAR subunits in the three age groups studied (n=3 per age group; p<0.05). The mean values are plotted; the error bars represent ± the SEM.

over the 8-week developmental period studied. In the youngest group (16–18 gw, n=3), 92% of all neurons expressed NR2B whereas only 70% expressed NR2A. In the next studied stage, 18–21 gw brains (n=3), almost equal number of neurons expressed

NR2B (85%) and NR2A (83%). In the oldest group of brains studied (22–24 gw, n=3), the expression of NR2A (91%) was higher than that of NR2B (84%) (Figure 9B). These semi- quantitative results on the neuronal expression of the three subunits were comparable to those obtained with the cortical RGC progenitors, in which an increase in the expression of NR2A vs. NR2B was demonstrated.

We then quantified expression of the NMDAR subunits by Tbr1+ glutamatergic neurons and GABA+ interneurons. In all three age groups studied, nearly all Tbr1+ cells (98%) expressed the obligatory NR1 subunit, whereas with increasing age, expression of the

NR2B subunit by these cells decreased (90% to 83%; p<0.05) and that of the NR2A subunit increased (67% to 94%; p<0.05) (Figure 5B). Similarly, a majority of GABAergic cortical interneurons (92%), expressed NR1 across all studied ages (16–24 gw).and with increasing age, the number of NR2B-positive GABAergic cells decreased (83% to 79%; p<0.05) whereas the number of NR2A-positive cells increased (77% to 83%; p<0.05)

(Figure 9B).

These results revealed that all three subunits are expressed on glutamatergic and

GABAergic neuronal subpopulations during the second trimester of human gestation, with a specific temporal distribution pattern determined for each one.

52 Discussion

This study demonstrated the expression of the major NMDAR subunits, NR1,

NR2A, and NR2B, at both the mRNA and protein levels, in the human fetal cerebral cortex during the second trimester of gestation. It also showed that between 16 and 24 gw the subunits are expressed by specific cell types within the different layers of the telencephalic wall. These findings extend previous studies on human brain tissue obtained at older stages of fetal development and from the adult brain (Conti et al. 1999;

Law et al. 2003; Suzuki et al, 2006; Henson et al. 2008, Jantzie et al. 2015). The early distribution of NR1, NR2A, and NR2B in the human cerebral cortex suggests their early and distinct roles in cortical progenitor proliferation and specification, and in the maturation and synaptogenesis of excitatory and inhibitory neurons in this brain region.

NMDAR in cortical progenitor cells

From 16 gw onwards, all three NMDAR subunits were expressed on RGCs, the multipotent cortical progenitors in the VZ/SVZ. Both proliferating (Ki67+) RGCs in the VZ and basal RGCs (Hopx+) in the SVZ expressed NR1, NR2A, and NR2B. The three subunits were also expressed, although less abundantly, by cells in the next stage of

RGC specification, that is, intermediate (Tbr2+) and interneuron (Nkx2.1+) progenitors.

This suggests that glutamate is more important in the proliferation of RGCs than in their specification into a particular intermediate progenitor cell type. The different age-related patterning of expression of NR2B in RGC, intermediate and interneuron progenitors

suggests a role of this subunit in the specification of cortical progenitors, while NR2A containing NMDARs might be important for further neuronal differentiation. However, we cannot exclude the possibility that technical difficulties related to simultaneous labeling of nuclear transcription factors (Tbr2, Nkx2.1), and membrane receptor proteins (such as

NMDARs) affect the efficiency of the method.

The major excitatory neurotransmitter glutamate acts non-synaptically as a trophic factor during the early stages of development (Balasz 1996; Haydar et al. 2000). In rodents, glutamate increases progenitor proliferation in the VZ and promotes neuronal differentiation in the SVZ by modulating the length of the cell cycle (LoTurco et al. 1991;

Takahashi et al. 1996; Haydar et al. 2000). These effects of glutamate on cortical progenitors are exerted through both AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazole propionate) receptors and NMDARs (LoTurco et al. 1995; Jansson et al. 1996; Behar et al. 1999). The early expression of NMDARs influences both the proliferation and differentiation of neural stem cells and the correct migration of newly generated neurons

(Rakic and Komuro 1995; Manent et al. 2005; Toriumi et al. 2012). Experiments in which the activity of the NMDAR subunits was pharmacologically blocked or their expression genetically knocked out confirmed the significance of these receptors in cortical development. In rodents, pharmacological inhibition of the three NMDAR subunits during development was shown to induce severe neurodegeneration followed by death (Reiprich et al. 2005; Ikonomidou et al. 1999), whereas homozygous knockouts of NR1 and NR2B are neonatally lethal (Ikeda et al. 1992; Forrest et al. 1994; Kutsuwada et al. 1996;

54 Sakimura et al. 1995). Other studies in rodents have shown that NMDARs play a crucial role in maintaining the stemness of RGCs in the adult dentate gyrus, by regulating the proliferation of these cells; NMDARs also participate in the establishment of hippocampal circuits (Bernabeu and Sharp 2000; Deisseroth et al. 2004; Nacher et al. 2006). In accordance with these observations, our recent in vitro study showed that antagonizing

NMDARs on human fetal RGCs not only increases cell death but decreases progenitor specification and neurogenesis (Bagasrawala et al. in revision). These results provide strong evidence of the importance of NMDARs in the survival, proliferation, and differentiation of RGCs during human cortical development.

NMDAR expression in cortical neurons

All the βIII-tubulin-labeled neurons in the CP at mid-gestation (16–24 gw) expressed NR1, and a subpopulation of neurons expressed NR2B and NR2A.

Specifically, both Tbr1+ glutamatergic and GABAergic neurons expressed all three

NMDAR subunits during the second trimester of human gestation. NMDAR presence in neurons of the emerging CP suggests a role for this receptor in neuronal maturation and the establishment of the early synapses that appear in the human cortex at that time/stage

(Zecevic 1998; Zecevic et al. 1999; Kostovic et al. 2002). Our previous electrophysiological studies, in which patch-clamp recordings were obtained from human fetal slice cultures, showed that glutamate acts through both AMPA receptors and

NMDARs on Cajal-Retzius cells at mid-gestation (Lu et al. 2001). In another study, we demonstrated the presence of functional ionotropic glutamate receptors in human fetal

cortical neurons in acute brain slices (Moore et al. 2011).

In the present work, we established that, in the oldest age group examined, the percentage of Tbr1+ neurons expressing NR2B and NR2A was slightly higher than the percentage of GABAergic cells expressing these subunits, compared to their respective percentages in the youngest age group. This finding suggests the functional differences or/and non-uniform maturation of cortical neurons at this developmental stage. The distribution of NMDARs in different subtypes of cortical neurons has clinical relevance, as the abnormal excitation of GABAergic interneurons due to NMDAR hypofunction results in cortical disinhibition and impairment of the synchronized activity of cortical projection neurons (Belforte et al. 2010; Nakazawa et al. 2012). In animal models, this disruption in cortical circuitry function leads to the development of behavioral deficits, such as anhedonia, disruption of the prepulse acoustic startle response, and anxiety, behaviors that closely resemble those observed in schizophrenia patients (Belforte et al. 2010).

Furthermore, midgestation, when, as we determined here, all three NMDARs subunits are expressed by cortical neurons, is the period of upper cortical layer development, and the formation of the cortico-cortical connections necessary for establishing the higher cognitive functions that characterize humans (Rakic 1998; Hill and Walsh 2005). The disruption of cognitive processes is one of the major symptoms observed in complex neuro-developmental disorders, such as schizophrenia and autism spectrum disorder

(Hill and Walsh 2005; Nakazawa et al. 2012).

56 NMDAR expression on glia

It is not surprising that the NMDAR subunits were detected on glial cells in the human fetal brain tissue. In the last two decades there have been several attempts to detect NMDAR subunits in astrocytes. The astrocytic protein marker GFAP was demonstrated on cells expressing the NR1 subunit mRNA in rat brain cortical slices (Aoki et al., in 1994). Other in situ hybridization studies in adult rat cerebellar Bergmann glial cells confirmed the presence of NR2C and NR2B mRNA transcripts (Akazawa et al.,

1994; Luque and Richards, 1995). However, functional NMDARs cannot be formed without the NR1 subunit. Even though NMDAR-mediated calcium currents are observed in astrocytes (Palygin et al., 2010; Lalo et al., 2011), the role of NMDARs in astrocytes still remains controversial. NMDARs play an important role in many CNS pathologies such as multiple sclerosis (Matute, 2011), as well as certain neurodegenerative diseases, such as Huntington’s (Hardingham, 2009) by maintaining the excitability of neuronal circuits.

The mechanisms underlying NMDAR-dependent apoptosis are uncertain, but are likely to involve the release of apoptotic factors such as cytochrome c from mitochondria and the activation of stress-induced pathways such as that of p38 MAP kinase or c-Jun N- terminal kinase (Hardingham and Badding, 2003).

The expression of NMDAR subunits on oligodendrocytes was unexpected since not many studies have reported the expression or function of NMDARs in oligodendrocyte-specific activities. Oligodendrocytes were thought to express predominantly non-NMDA glutamate ionotropic receptors, and initial reports also

disclosed that oligodendrocytes do not respond to NMDA (Cull-Candy and Wyllie, 1991).

However, in 1996, Yoshioka and colleagues showed, for the first time, that NMDARs are expressed in oligodendrocytes, using RT-PCR and Southern blotting in the rat oligodendroglial lineage CG-4. Furthermore, the expression of NR1, NR2A-D and NR3A has been demonstrated in the oligodendrocytes of the optic nerve (Salter and Fern in

2005). As for the myelination process, several studies have shown the importance of

NMDARs in immature oligodendrocytes, since even small calcium signals can influence the stabilization/retraction of the myelinating projections from oligodendrocytes due to the small intracellular space (Salter and Fern, 2005; Karadottir et al., 2005; Wong, 2006).

Few studies have characterized the functional expression of ionotropic glutamate receptors in microglial cells. The expression of functional NMDARs in microglia in normal brain has not been reported (Gottlieb and Matute, 1997). Similar to these observations, our results also suggest that microglia do not express NMDARs in human cortical tissue at midgestation. However, NMDA injection into the somatosensory cortex of newborn rats triggers transient microglial activation (Acarin et al., 1996). Whether NMDAR controls microglial activation directly or indirectly remains to be determined. Therefore, additional studies are necessary to characterize the existence of functional ionotropic glutamate receptors in the resident and activated microglia of slices, which could respond to glutamate release during synaptic activity or damage.

58 NMDAR composition

The obligatory NR1 subunit was expressed in almost all of the investigated cell types. This was not surprising since the importance of this subunit in rodents is well- established. For example, the controlled ablation of NR1 during development was shown to disrupt the normal maturation of the cell circuitry in the hippocampus, resulting in a schizophrenia-like cognitive decline and behavioral deficits later in life (Rodenas-Ruano et al. 2012). Our finding of the age-dependent expression of subunits NR2A and NR2B in human fetal cortex is in line with the results of animal studies. Synaptic activity is one of the factors regulating NMDAR subunit expression (Sanz-Clemente et al. 2013). NR2B- rich NMDARs are found in abundance on developing synapses, where they generate slow currents with shorter amplitudes but lasting twice as long compared to NR2A-mediated currents. This allows for a large influx of Ca2+ that promotes gene transcription and extends the period of membrane depolarization, which is crucial for generating a strong and stable synapse (Yasuda et al. 2011). At the beginning of cortical synaptogenesis,

NR2B is needed for the formation of the synaptic connections essential for circuitry formation. Many of these synapses undergo pruning, a process that is dependent on environmental experiences, the nature of the stimulus, and age (Rakic et al. 1986; Dumas

2005; Sanz-Clemente et al. 2013; reviewed in Paoletti et al. 2013). In the adult brain, the strong circuitry connections established by NMDARs mainly containing the NR2B subunit ensure memory formation through long-term potentiation (Sanz-Clemente et al. 2010).

Experiments using antagonists of the NR2A and NR2B subunits in monkey prefrontal cortical slices (Wang et al. 2011) showed that NR2B-type activity on postsynaptic spines

participates in working memory and learning. Similar results were obtained in mice genetically modified to lack the NR2B subunit during their postnatal development (von

Engelhardt et al. 2008). As corticogenesis in rodents proceeds into the second postnatal week, the NR2B subunits translocate to extrasynaptic sites and are replaced at the synapse by NR2A-rich NMDARs (Malenka and Nicoll 1999; Dumas 2005). These synapses generate the fast currents required for strong and transient synaptic connections in response to sensory stimuli (Nakagawa et al. 1996; Paupard et al. 1997;

Malenka and Nicoll 1999; Malatesta et al. 2000). Thus, in rats reared in the dark without appropriate sensory input, the NR2B-NR2A switch in the visual cortex is impaired, but the impairment can be reversed by exposing the animals to light (Philpot et al. 2001). During activity-dependent synaptic plasticity, NR2B-rich NMDARs move into synaptic sites from their previous extrasynaptic location via lateral diffusion (Tovar and Westbrook 2002;

Groc et al. 2006). The timing of the switch coincides with the development of associative learning abilities, indicating the significance of this process in modifying and tweaking neuronal circuits (Dumas 2005; Sanz-Clemente et al. 2013). Notably, the change in

NMDAR subunits is related to the shift from the greater plasticity that characterizes development to the greater stability that marks adult life (Bear et al. 1987; Kleinschmidt et al. 1987; Constantine-Patton et al. 1990; reviewed in Dumas 2005). The NR2B to NR2A switch in NMDAR subunit expression is conserved from frogs to mammals (Dumas 2005; reviewed in Paoletti et al. 2013), but it has not been widely studied in the developing human cerebral cortex (Scherzer et al. 1998; Henson et al. 2008; Jantzie et al. 2015).

60 We observed that in the human fetal cortex from 16 to 24 gw, the percentage of

NR2B-expressing RGCs decreased from 92% to 84% (p<0.05), while expression of the

NR2A subunit increased from 70% to 91% (p<0.05). A similar change occurred in cortical neurons of the same developmental period. These results suggest that in human cortical development the switch from NR2B to NR2A begins quite early, around 22–24 gw. A larger shift can be assumed to occur postnatally, especially between the juvenile and adult stages of development, when cognitive functions mature (Dumas 2005; Sanz-

Clemente et al. 2013). A more comprehensive picture of the NR2B to NR2A switch in human fetal cortex requires the study of a broader range of brain tissues of different gestational ages as well as neonatal and adult tissue samples.

NMDARs play a major role in brain development, as evidenced by the fact that several neurodevelopmental disorders such as schizophrenia, autism, learning disabilities, epilepsy and mental retardation, as well as auto-immune anti-NMDAR encephalitis, are thought to have a NMDAR-based pathophysiology. A number of studies have clearly shown that compromising the expression of the NMDAR subunits or manipulating their function during development can impair both the formation of neuronal circuits and their fine-tuning, which is essential in learning and working memory (Monyer et al. 1994; Dumas 2005; Groc et al. 2006; Kozela and Popik 2007; Naegele 2009; Liu et al. 2010; Arnsten et al. 2012). Taken together, our results show that changes in NMDAR subunit expression during midgestation could affect cortical development, including the maintenance of the balance between cortical excitation and inhibition. Further studies on

NMDAR subunit composition in human cortical development will contribute to a better understanding of the role of these receptors in brain development and in the pathophysiology of neuropsychiatric diseases. Such studies can be expected to provide the basis for the discovery of novel therapeutics that specifically modulate NMDAR activity.

62 References

Arnsten AF, Wang MJ, Paspalas CD. 2012. Neuromodulation of thought: flexibilities and vulnerabilities in prefrontal cortical network synapses. Neuron 76: 223-239.

Balasz R. 2006. Trophic effect of glutamate. Curr Top Med Chem 6:961–968.

Barria A, Malinow R. 2002. Subunit-specific NMDA receptor trafficking to synapses.

Neuron 35:345–353.

Barria A1, Malinow R. 2005. NMDA receptor subunit composition controls synaptic plasticity by regulating binding to CaMKII. 48:289-301.

Bayatti N, Moss JA, Sun L, Ambrose P, Ward JFH, Lindsay S, et al. 2008. A molecular neuroanatomical study of the developing human neocortex from 8 to 17 postconceptional weeks revealing the early differentiation of the subplate and subventricular zone. Cereb

Cortex 18:1536–1548.

Bear MF, Cooper LN, Ebner FF. 1987. A physiological basis for a theory of synapse modification. Science. 237:42-48.

Behar TN, Scott CA, Greene CL, Wen X, Smith SV, Maric D, et al. 1999. Glutamate acting at NMDA receptors stimulates embryonic cortical neuronal migration. J Neurosci

19:4449–4461.

Belforte JE, Zsiros V, Sklar ER, Jiang Z, Yu G, Li Y. et al. 2010. Postnatal NMDA receptor ablation in corticolimbic interneurons confers schizophrenia-like phenotypes. Nat

Neurosci 13:76–83.

Bellone C, Nicoll RA. 2007. Rapid bidirectional switching of synaptic NMDA receptors.

Neuron 55:779–785.

Ben-Ari Y, Cherubini E, Kmjevic K. 1988. Changes in voltage de- pendence of NMDA currents during development. Neurosci Lett 94: 88-92.

Bernabeu R, Sharp FR. 2000. NMDA and AMPA/kainate glutamate receptors modulate dentate neurogenesis and CA3 synapsin-I in normal and ischemic hippocampus. J Cereb

Blood Flow Metab 20:1669-80.

Brewer CL, Cotman CW. 1989. NMDA receptor regulation of neuronal morphology in cultured hippocampal neurons. Neurosci Lett 99:268-273.

Clowry G, Molna´r Z, Rakic P. 2010. Renewed focus on the developing human neocortex. J Anat 217:276–288.

Cohen SM, Tsien RW, Goff DC, Halassa MM. 2015. The impact of NMDA receptor hypofunction on GABAergic neurons in the pathophysiology of schizophrenia. Schizophr

Res 167:98-107.

Constantine-Paton M, Cline HT, Debski E. 1990. Patterned activity, synaptic convergence, and the NMDA receptor in developing visual pathways. Annu Rev Neurosci

13:129-154.

Conti F, Barbaresi P, Melone M, Ducati A. 1999. Neuronal and glial localization of NR1 and NR2A/B subunits of the NMDA receptor in the human cerebral cortex. 9:110-120.

Cull-Candy S, Brickley S, Farrant M. 2001. NMDA receptor subunits: diversity, development and disease. Curr Opin Neurobiol 11:327–335.

Cull-Candy SG, Leszkiewicz DN. 2004. Role of distinct NMDA receptor subtypes at central synapses. 255:re16.

Deisseroth K, Singla S, Toda H, Monje M, Palmer TD, Malenka RC. 2004. Excitation-

64 neurogenesis coupling in adult neural stem/progenitor cells. Neuron 42:535-552.

Dumas TC. 2005. Developmental regulation of cognitive abilities: modified composition of a molecular switch turns on associative learning. Prog Neurobiol 76:189–211.

Endele S, Rosenberger G, Geider K, Popp B, Tamer C, Stefanovaet I et al. 2010.

Mutations in GRIN2A and GRIN2B encoding regulatory subunits of NMDA receptors cause variable neurodevelopmental phenotypes. Nat Genet 42, 1021–1026.

Espinosa JS, Wheeler DG, Tsien RW, Luo L. 2009. Uncoupling dendrite growth and patterning: single-cell knockout analysis of NMDA receptor 2B. Neuron 62:205-17.

Forrest D, Yuzaki M, Soares HD, Ng L, Luk DC, Sheng M, et al. 1994. Targeted disruption of NMDA receptor 1 gene abolishes NMDA response and results in neonatal death.

Neuron 13:325–338.

Gray JA, Shi Y, Usui H, During MJ, Sakimura K, Nicoll RA. 2011. Distinct modes of AMPA receptor suppression at developing synapses by GluN2A and GluN2B: single-cell NMDA receptor subunit deletion in vivo. Neuron 71: 1085-1101.

Groc L, Heine M, Cousins SL, Stephenson FA, Lounis B, Cognet L, Choquet D. 2006.

NMDA receptor surface mobility depends on NR2A-2B subunits. 103:18769-18774.

Hall BJ, Ripley B, Ghosh A. 2007. NR2B signaling regulates the development of synaptic

AMPA receptor current. J Neurosci 27:13446-13456.

Haydar TF, Wang F, Schwartz ML, Rakic P. 2000. Differential modulation of proliferation in the neocortical ventricular and subventricular zones. J Neurosci 20:5764–5774.

Henson MA, Roberts AC, Salimi K, Vadlamudi S, Hamer RM, Gilmore JH, et al. 2008.

Developmental regulation of the NMDA receptor subunits, NR3A and NR1, in human

prefrontal cortex. Cereb Cortex 18:2560–2573.

Herkert M, Rottger S, Becker CM. 1998. The NMDAR subunit NR2B of neonatal rat brain: complex formation and enrichment in axonal growth cones. Eur J Neurosci. 10:1553.

Hill RS, and Walsh CA. 2005. Molecular insights into human brain evolution. Nature 437:

64–67.

Ikeda K, Nagasawa M, Mori H, Araki K, Sakimura K, Watanabe M, Inoue Y, Mishina M.

1992. Cloning and expression of the ε4 subunit of the NMDA receptor channel. FEBS Lett

313:34–38.

Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K. et al. 1999. Blockade of NMDA Receptors and Apoptotic Neurodegeneration in the Developing Brain. Science

283:70–74.

Jansson LC, Åkerman KE. 2014. The role of glutamate and its receptors in the proliferation, migration, differentiation and survival of neural progenitor cells. J Neural

Transm (Vienna) 121:819-836.

Jantzie LL, Talos DM, Jackson MC, Park HK, Graham DA, Lechpammer M, et al. 2015.

Developmental expression of N-methyl-D-aspartate (NMDA) receptor subunits in human white and gray matter: potential mechanism of increased vulnerability in the immature brain. Cereb Cortex 25:482-495.

Kitayama T, Yoneyama M, Yoneda Y. 2003. Possible regulation by N-methyl-d-aspartate receptors of proliferative progenitor cells expressed in adult mouse hippocampal dentate gyrus. J Neurochem 84:767-780.

Kleinschmidt A, Bear MF, Singer W. 1987. Blockade of "NMDA" receptors disrupts

66 experience-dependent plasticity of kitten striate cortex. Science 238:355-358.

Kostovic I, Rakic P. 1990. Developmental history of the transient subplate zone in the visual and somatosensory cortex of the macaque monkey and human brain. J Comp

Neurol 297:441– 470.

Kostović I, Judas M, Rados M, Hrabac P. 2002. Laminar organization of the human fetal cerebrum revealed by histochemical markers and magnetic resonance imaging. Cereb

Cortex 12:536-544.

Kozela E, Popik P. 2006. A complete analysis of NMDA receptor subunits in periaqueductal grey and ventromedial medulla of morphine tolerant mice. Drug Alcohol

Depend 86:290-293.

Kutsuwada T, Sakimura K, Manabe T, Takayama C, Katakura N, Kushiya E, et al. 1996.

Impairment of suckling response, trigeminal neuronal pattern formation, and hippocampal

LTD in NMDA receptor ε2 subunit mutant mice. Neuron 16:333–344.

Lavezzari G1, McCallum J, Dewey CM, Roche KW. 2004. Subunit-specific regulation of

NMDA receptor endocytosis J Neurosci. 24:6383-6391.

Law AJ, Weickert CS, Webster MJ, Herman MM, Kleinman JE, Harrison PJ. 2003.

Expression of NMDA receptor NR1, NR2A and NR2B subunit mRNAs during development of the human hippocampal formation. Eur J Neurosci 18:1197-1205.

Lee MC, Yasuda R, Ehlers MD. 2010. Metaplasticity at single glutamatergic synapses.

Neuron 66:859-870.

Li D, Takeda N, Jain R, Manderfield LJ, Liu F, Li L, Anderson SA, Epstein JA. 2015. Hopx distinguishes hippocampal from lateral ventricle neural stem cells. Stem Cell Res 15:522-

529.

Liu X, Hunter C, Weiss HR, Chi OZ. 2010. Effects of blockade of ionotropic glutamate receptors on blood-brain barrier disruption in focal cerebral ischemia. Neurol Sci 31:699-

703.

LoTurco JJ, Wanton MG, and Kriegstein AR. 1991. Initial Expression and Endogenous

Activation of NMDA Channels in Early Neocortical Development. J Neurosci 17:792–799.

LoTurco JJ, Owens DF. Heath MJ, Davis MB, Kriegstein AR. 1995. GABA and glutamate depolarize cortical progenitor cells and inhibit DNA synthesis. Neuron 15:1287–1298.

Lu S, Zecevic N, Yeh HH. 2001. Distinct NMDA and AMPA Receptor – Mediated

Responses in Mouse and Human Cajal-Retzius Cells. J Neurophysiol 86:2642-2646.

Luo JH, Fu ZY, Losi G, Kim BG, Prybylowski K, Vissel B, Vicini S. 2002. Functional expression of distinct NMDA channel subunits tagged with green fluorescent protein in hippocampal neurons in culture. Neuropharmacology 42:306-18.

Malatesta P, Hartfuss E, and Götz M. 2000. Isolation of radial glial cells by fluorescent- activated cell sorting reveals a neuronal lineage. Development 127:5253–5263.

Malenka RC, Nicoll RA. 1993. NMDA-receptor-dependent synaptic plasticity: multiple forms and mechanisms. Trends Neurosci 16:521-527.

Malenka RC, Nicoll RA. 1999. Long-term potentiation—a decade of progress? Science.

285:1870–1874.

Malik, S. Vinukonda G, Rose, LR, Diamond D, Bhimavarapu BBR, Hu F, et al. 2013.

Neurogenesis continues in the third trimester of pregnancy and is suppressed by premature birth. J Neurosci 33:411–23.

68 Manent JB, Demarque M, Jorquera I, Pellegrino C, Ben-Ari Y, Aniksztejn L. et al. 2005.

A noncanonical release of GABA and glutamate modulates neuronal migration. J

Neurosci 25:4755–4765.

Marín-Padilla M. 1998. Cajal-Retzius cells and the development of the neocortex. Trends

Neurosci 21:64-71.

Meyer G, Schaaps J-P, Moreau L, Goffinet AM. 2000. Embryonic and early fetal development of the human neocortex. J Neurosci 20:1858–1868.

Monyer H, Burnashev N, Laurie DJ, Sakmann B, Seeburg PH. 1994. Developmental and regional expression in the rat brain and functional properties of four NMDA receptors.

Neuron 12:529–540.

Moore A, Zhou W, Jakovcevski I, Zecevic N, Antic S. 2011. Spontaneous electrical activity in the human fetal cortex in vitro. J Neurosci 31:2391–2398.

Nacher J, McEwen BS. 2006. The role of N-methyl-D-asparate receptors in neurogenesis.

Hippocampus 16:267-270.

Naegele J. 2009. Epilepsy and the Plastic Mind. Epilepsy Curr 6:166–169.

Nakagawa S, Watanabe M, Inoue Y. 1996. Altered gene expression of the N-methyl-D- aspartate receptor channel subunits in Purkinje cells of the staggerer mutant mouse. Eur

J Neurosci 8:2644-2651.

Nakazawa K, Zsiros V, Jiang Z, Nakao K, Kolata S, Zhang S, Belforte JE. 2012.

GABAergic interneuron origin of schizophrenia pathophysiology. 62:1574-1583.

Paoletti, P, Bellone C, Zhou Q. 2013. NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci 14:383–400.

Paupard MC, Friedman LK, Zukin RS. 1997. Developmental regulation and cell-specific expression of N-methyl-D-aspartate receptor splice variants in rat hippocampus.

Neuroscience 79:399-409.

Pearce IA, Cambray-Deakin MA, Burgoyne RD. 1987. Glutamate acting on NMDA receptors stimulates neurite outgrowth from cerebellar granule cells. FEBS Lett 223:143-

147

Philpot BD, Sekhar AK, Shouval HZ, Bear MF. 2001. Visual experience and deprivation bidirectionally modify the composition and function of NMDA receptors in visual cortex.

Neuron 29:157–69.

Pollen AA, Nowakowski TJ, Chen J, Retallack H, Sandoval-Espinosa C, Nicholas CR,

Shuga J, Liu SJ, Oldham MC, Diaz A, Lim DA, Leyrat AA, West JA, Kriegstein AR. 2015.

Molecular identity of human outer radial glia during cortical development. Cell 163:55-67.

Radonjić NV, Memi F, Ortega JA, Glidden N, Zhan H, Zecevic N. 2014. The Role of Sonic

Hedgehog in the Specification of Human Cortical Progenitors In Vitro. Cereb Cortex

26:131–143.

Rakic P, Bourgeois JP, Eckenhoff ME, Zecevic N, Goldman-Rakic P. 1986. Concurrent overproduction of synapses in diverse regions of the primate cerebral cortex. Science.

232:232-235.

Rakic P, Komuro H. 1995. The role of receptor ⁄ channel activity in neuronal cell migration.

J Neurobiol 26:299–315.

Rakic P. 1998. Young neurons for old brains? Nat Neurosci 1:645-647.

Rakic P. 2009. Evolution of the neocortex: a perspective from developmental biology. Nat

70 Rev Neurosci 10:724–735.

Reiprich P, Kilb W, Luhmann HJ. 2005 Neonatal NMDA receptor blockade disturbs neuronal migration in rat somatosensory cortex in vivo. Cereb Cortex 15:349–358.

Rodenas-Ruano A, Chávez AE, Cossio MJ, Castillo PE, Zukin, RS. 2012. REST- dependent epigenetic remodeling promotes the developmental switch in synaptic NMDA receptors. Nat Neurosci 15:1382–90.

Sakimura K, Kutsuwada T, Ito I, Manabe T, Takayama C, Kushiya E, et al. 1995. Reduced hippocampal LTP and spatial learning in mice lacking NMDA receptor ε1 subunit. Nature

373:151–155.

Sanz-Clemente A, Matta JA, Isaac JT, Roche KW. 2010. Casein kinase 2 regulates the

NR2 subunit composition of synaptic NMDA receptors. Neuron 67:984–996.

Sanz-Clemente A, Nicoll RA, Roche KW. 2012. Diversity in NMDA Receptor Composition:

Many Regulators, Many Consequences. The Neurosci 19:62-75.

Scherzer CR, Landwehrmeyer GB, Kerner JA, Counihan TJ, Kosinski CM, Standaert DG. et al. 1998. Expression of N-methyl-D-aspartate receptor subunit mRNAs in the human brain: hippocampus and cortex. 390:75-90.

Sobczyk A1, Scheuss V, Svoboda K. 2005. NMDA receptor subunit-dependent [Ca2+] signaling in individual hippocampal dendritic spines. 25:6037-6046.

Spitzer NC. 2006. Electrical activity in early neuronal development. Nature 444: 707-712.

Suzuki M, Nelson AD, Eickstaedt JB, Wallace K, Wright LS, and Svendsen CN. 2006.

Glutamate enhances proliferation and neurogenesis in human neural progenitor cell cultures derived from the fetal cortex. Eur J Neurosci 24:645–653.

Takahashi T, Nowakowski RS, Caviness VS Jr. 1996. The leaving or Q fraction of the murine cerebral proliferative epithelium: a general model of neocortical neuronogenesis.

J Neurosci 16:6183–6196.

Takahashi M, Kakita A, Futamura T, Watanabe Y, Mizuno M, Sakimura K, et al. 2006.

Sustained brain-derived neurotrophic factor up-regulation and sensorimotor gating abnormality induced by postnatal exposure to phencyclidine: comparison with adult treatment. J Neurochem 99:770–780.

Tang TT, Badger JD 2nd, Roche PA, Roche KW. 2010. Novel approach to probe subunit- specific contributions to N-methyl-D-aspartate (NMDA) receptor trafficking reveals a dominant role for NR2B in receptor recycling. 285:20975-20981.

Thomsen ER, Mich JK, Yao Z, Hodge RD, Doyle AM, Jang S, Shehata SI, Nelson AM,

Shapovalova NV, Levi BP, Ramanathan S. 2016. Fixed single-cell transcriptomic characterization of human radial glial diversity. Nat Methods 13:87-93.

Toriumi K, Mouri A, Narusawa S, Aoyama Y, Ikawa N, Lu L. et al. 2012. Prenatal NMDA

Receptor Antagonism Impaired Proliferation of Neuronal Progenitor, Leading to Fewer

Glutamatergic Neurons in the Prefrontal Cortex. Neuropharmacology 37:1387–1396.

Tovar KR, Westbrook GL. 2002. Mobile NMDA receptors at hippocampal synapses.

34:255-264. von Engelhardt J, Doganci B, Jensen V, Hvalby Ø, Göngrich C, Taylor A. et al. 2008.

Contribution of hippocampal and extra-hippocampal NR2B-containing NMDA receptors to performance on spatial learning tasks. Neuron 60:846-860.

72 Wang CC, Held RG, Chang S-C, Yang L, Delpire E, Ghosh A, et al., 2011. A critical role for GluN2B-Containing NMDA receptors in cortical development and function. Neuron.

72:789-805.

Wang J, Chen Y, Carlson S, Li L, Hu X, Ma Y. 2012. Interactive effects of morphine and scopolamine, MK-801, propanolol on spatial working memory in rhesus monkeys.

Neurosci Lett 523: 119-124.

Weissman TA, Riquelme PA, Ivic L, Flint AC, Kriegstein AR. 2004. Calcium waves propagate through radial glial cells and modulate proliferation in the developing neocortex. Neuron 43: 647–661.

Xu B, Xu ZF, Deng Y. 2009. Effect of manganese exposure on intracellular Ca2+ homeostasis and expression of NMDA receptor subunits in primary cultured neurons.

Neurotoxicology 30: 941-949.

Yashiro K, Philpot BD. 2008. Regulation of NMDA receptor subunit expression and its implications for LTD, LTP, and metaplasticity. Neuropharmacology 55:1081–1094.

Yasuda M, Johnson-Venkatesh EM, Zhang H, Parent JM, Sutton MA, Umemori H. 2011.

Multiple forms of activity-dependent competition refine hippocampal circuits in vivo.

Neuron 70:1128–42.

Yoshimizu T, Chaki S. 2004. Increased cell proliferation in the adult mouse hippocampus following chronic administration of group II metabotropic glutamate receptor antagonist,

MGS0039. Biochem Biophys Res Commun 315: 493-496.

Zecevic N. 1998. Synaptogenesis in layer I of the human cerebral cortex in the first half

of gestation. Cereb Cortex 8:245–252.

Zecevic N, Milosevic A, Rakic S, Marín-Padilla M. 1999. Early development and composition of the human primordial plexiform layer: An immunohistochemical study. J

Comp Neurol412:241-254.

74 Chapter 3

Effects of the N-Methyl D-Aspartate Receptor Antagonist Kynurenic Acid on

Human Cortical Development

Submitted to Frontiers in Neuroscience journal

Authors: Inseyah Bagasrawala, Nada Zecevic and Nevena Radonjic

Author contributions:

IB: Performed all experiments, data analysis, and major writing

NR: Suggested the concept of study, contribute in analyzing data and writing of the manuscript

NZ: Suggested the concept of study, contribute in in analyzing data and writing of the manuscript

Abstract

Kynurenic acid (KYNA), a neuroactive metabolite of tryptophan degradation, acts as an endogenous N-methyl-D-aspartate receptor (NMDAR) antagonist. Elevated levels of KYNA have been observed in pregnant women after viral infections and are considered to play a role in neurodevelopmental disorders. However, the consequences of KYNA- induced NMDAR blockade in human cortical development still remain elusive. To study the potential impact of KYNA on human neurodevelopment, we used an in vitro system of multipotent cortical progenitors, i.e., radial glia cells (RGCs), enriched from the human cerebral cortex at midgestation (16-19 gw). KYNA treatment significantly decreased RGC proliferation and survival, and further resulted in a reduced number of cortical progenitors and neurons, while the number and activation of astrocytes increased. KYNA treatment reduced differentiation of RGCs into GABAergic neurons, while differentiation into glutamatergic neurons was relatively spared. Although KYNA activated astrocytes in enriched RGC cultures, we did not observe a significant increase in the levels of the pro- inflammatory cytokine IL-6, which is secreted by activated astrocytes. In conclusion, elevated levels of KYNA play a significant role in human RGC fate determination by antagonizing NMDARs and the altered cell composition observed suggests a pathological mechanism for impairment of cortical circuitry formation in the fetal brain as seen in neurodevelopmental disorders such as schizophrenia.

76 Introduction

Kynurenic acid (KYNA) is an intermediate metabolite of the kynurenine pathway and the only naturally occurring antagonist of the glutamatergic NMDA receptor (NMDAR) in the human brain (Stone, 1993). In the brain, KYNA is synthesized in astrocytes by the irreversible transamination of L-kynurenine, the first major catabolic product of tryptophan. Elevated levels of KYNA have been found in the cerebrospinal fluid and in post-mortem brains of adult schizophrenia patients (Erhardt et al., 2001; Schwarcz et al.,

2001; Sathyasaikumar et al., 2011; Holtze et al., 2012). Both stress and infections in rats activated indoleamine 2,3 dioxygenase (IDO), a cytokine responsive enzyme that catalyzes the formation of kynurenine, which may impair brain development (Pocivavsek et al., 2014; Notarangelo and Pocivavsek, 2016). Furthermore, environmental influences during development, such as maternal influenza infection, increase the risk for

Schizophrenia and related disorders (Wright et al., 1995; Stober et al., 2002; Limosin et al, 2003; Brown 2012). In rodents, KYNA can cross the placental and fetal blood-brain barriers (Heyes et al., 1990; Scharfman et al., 1998) and induce secretion of various pro- inflammatory cytokines, such as interferon gamma (IFN-γ) and interleukin 6 (IL-6), from fetal astrocytes (Meyer et al., 2011). Additionally, in vitro studies have demonstrated that

IFN-γ and IL-6 can activate human fetal astrocytes to synthesize increased levels of

KYNA (Guillemin et al., 2001). Thus, exposure of the fetal brain to KYNA may establish a positive feed-back loop whereby KYNA levels are further enhanced (Guillemin et al.,

2001; Meyer et al., 2011; Schwieler et al., 2015).

Glutamate acting via NMDARs has a trophic effect during development, and may play an important role in determining the selective survival of neurons and their proper connections (LoTurco et al., 1991; Haydar et al., 2000; Balasz, 2006). This is particularly pertinent to a possible role for disturbed NMDAR function in schizophrenia as an alteration or reduction of NMDARs have been demonstrated in medication-free schizophrenia patients (Akbarian et al., 1996, Pilowsky et al., 2006), and abnormal glutamatergic activity has been reported in the pathophysiology of schizophrenia

(Deutsch et al., 1989; Coyle, J.T., 1996; Belforte et al., 2010). Many animal models of schizophrenia mimic a transient NMDAR hypofunction during development using NMDAR antagonists such as MK-801 (Ikonomidou et al., 1999), phencyclidine (PCP; Wang et al.,

2001; Radonjic et al., 2008) and ketamine (Breier et al., 1997; Rujescu et al., 2006).

Even though it is known that there is a higher incidence of schizophrenia in fetuses exposed to viral infections in utero (Bale et al., 2010; Brown and Derkits, 2010, Selemon and Zecevic, 2015), presumably due to an inflammatory response and increased levels of KYNA, it is still unclear how elevated levels of KYNA affect the developing human brain.

The goal of this study was to elucidate the role of KYNA as an endogenous NMDAR antagonist in human fetal brain. As experimental manipulation of the developing human brain in vivo is not possible, we established an in vitro system to test the effects of KYNA on human cortical progenitor cells.

Radial glia cells (RGCs) are multipotent cortical progenitor cells capable of

78 generating all neural cell types, including subpopulations of intermediate and interneuron progenitors, neurons, astrocytes and oligodendrocytes (Howard et al., 2006;

Mo et al., 2007; Mo and Zecevic, 2009; Yu and Zecevic, 2011; Lui et al., 2011; Hansen et al., 2010, 2013; Ma et al., 2013; Radonjic et al., 2014). Specifically, we were interested in how exposure to KYNA affects survival, proliferation, and specification of RGCs into various cell types, including cortical interneurons and pyramidal cells. We demonstrated that elevated levels of KYNA not only reduced survival and proliferation of RGCs, but significantly altered the progeny of cortical RGCs. Similar effects are observed with the specific blockade of NMDARs using D-APV, as demonstrated in Chapter 4. Treatment with KYNA promoted gliogenesis at the expense of neurogenesis, and increased activation of astrocytes. These combined effects of KYNA could impair cortical circuitry formation in utero and in doing so contribute to the pathophysiology of neurodevelopmental illnesses, possibly including the adult-onset disorder of schizophrenia.

Materials and Methods

Human Fetal Brain Tissue

Human fetal brain tissue (n = 4), free of any developmental abnormalities, at 16 to 19 gw was obtained with the approval of the Ethics Committees and with written informed consent, from Human Developmental Biology Resource (Newcastle University,

Newcastle upon Tyne, England) and the Tissue Repository of The Albert Einstein

College of Medicine (Bronx, NY, USA). The age of the tissue was determined by the following criteria: crown-rump length, weeks after ovulation, and anatomical landmarks.

The tissue was transported on ice in Hank’s Balanced Salt Solution (HBSS; Life

Technologies, Grand Island, NY, USA) from the aforementioned brain repositories to the lab. A small piece (1 cm2) of the dorsal telencephalic region was used to generate dissociated cell cultures (Zecevic et al. 2005; Radonjic et al., 2014).

Dissociated Mixed Cell Culture and Enrichment of RGCs

A previously published protocol (Mo and Zecevic, 2007) was used to establish dissociated mixed cell cultures. As briefly described here, the isolated tissue was dissociated mechanically and enzymatically at 37°C for 30 minutes with 0.025% trypsin

(Gibco, Beverly, MA, USA), followed by addition of DNase (Sigma-Aldrich, St Louis, MO,

USA; 2 mg/mL), washing with HBSS (Life Technologies) and suspension in proliferation medium (PM; Figure 10A). The PM consisted of DMEM/F12 (Life Technologies) supplemented with 10 ng/mL of basic fibroblast growth factor (bFGF, Peprotech, Rocky

Hill, NJ, USA), 10 ng/mL of epidermal growth factor (EGF, Millipore, Billerica, MA, USA), and B27 (Life Technologies). Seven to ten days after plating, the cells proliferated in PM and reached 80% confluency whereupon they were used for to generate RGC cultures.

80 Figure 10. Enriched RGCs from human fetal cortex using MACS. (A) Dissociated mixed cell cultures are established from the telencephalic wall (red box), and RGCs are enriched from these cultures through magnetic sorting (MACS) using anti-CD15 micro-beads. (B)

Enriched RGCs are co-labeled for CD15 and radial glia markers BLBP or GFAP after 3

DIV of proliferation. Nuclear stain: bis-benzimide (BB).

RGCs were isolated from mixed cell cultures using the cell surface glycan marker

CD15 via MACS columns (Miltenyi Biotec, Auburn, CA, USA) with magnetic anti-CD15 antibody beads (Mo et al. 2007; Radonjic et al., 2014). Enriched RGCs were co-labeled for surface antigen CD15 and either brain lipid binding protein or glial fibrillary acidic protein, both markers of RGCs (Figure 10B), demonstrating that the enriched RGC cultures were 98% pure. RGCs were plated on poly-D-lysine (Sigma-Aldrich) coated coverslips (12 mm) at a density of 250,000 cells/ml and were used for immunocytochemistry. Poly-D-lysine coated six wells (10 cm2 growth area/well) were plated with 2 million cells/ml and the collected cell lysates were used for total protein and

RNA isolation. After 3 DIV in PM, the culture medium was change to differentiation medium (DM) devoid of growth factors and cells were allowed to differentiate for 7 DIV.

Pharmacological Treatments of Cell Cultures

RGC cultures were treated with each of these substances: KYNA, NMDAR-specific antagonist D-amino phosphonovalerate (D-APV), and nicotinic acetylcholine receptor antagonist Tubocurarine chloride (TBC), in order to determine if the effect of KYNA was mediated through NMDARs or nAChRs. Concentration-response curves were first plotted

48 h after RGC cultures underwent treatments with eight different concentrations (0.001

μM to 100.0 μM) of KYNA (Sigma Aldrich), D-APV (Tocris Biosciences, Bristol, UK) and

TBC. KYNA was dissolved in DMSO (Dimethyl sulphoxide, Sigma Aldrich), and therefore two sets of controls were maintained: 1) RGCs grown only in PM, 2) RGCs grown in PM

82 containing DMSO. In all analyzed experiments there was no difference between control

PM and PM+DMSO, hence PM+DMSO results were represented in graphs as the control.

The effective concentration at which 50% of the cell population was affected (EC50) was determined in both assays to decide the treatment concentrations to be used for further experiments, where cells were analyzed after 3 DIV in PM, and after 7 DIV in DM.

Cell Survival Assay

A live/dead assay (Molecular Probes, Eugene, OR, USA) was performed after 48 h of KYNA treatment to assess its effect on cell viability. The kit enables detection of live cells via the cell-permeant molecule calcein acetoxymethyl that gives a green fluorescence in the presence of intracellular esterases. Dead cells which have lost the intact cell membrane appear red due to incorporation of an ethidium homodimer into their degrading nucleic acids.

Proliferation Assay

At the end of the 48 h KYNA treatment period, cells were fixed and immunostained with anti-Ki67 antibody. Ki67 is a marker of cells undergoing mitotic divisions or proliferation. The percentage of Ki67+ cells was determined from the total number of cells marked with the nuclear stain bisbenzimide (BB).

Table 5 Antibodies used for immunocytochemistry and Western blotting.

Primary Cell Type Catalog Species Dilution Company Antibody Identified number Radial Glia Thermo CD15 mouse 1:100 MS-1259-P (RGC) Scientific

BLBP RGC rabbit 1:250 ab32423 Abcam

RGC, mouse, GFAP 1:3000 Z0334 Dako Astrocyte rabbit

Intermediate Tbr2 rabbit 1:200 ab23345 Abcam Progenitor

Interneuron Nkx2.1 rabbit 1:200 ab76013 Abcam Progenitor

mouse, Sigma- βIII tubulin Neuron 1:5000 PRB-435P rabbit Aldrich

Glutamatergic 20932-1- Tbr1 rabbit 1:200 Proteintech Neuron AP

Sigma- GABA Interneuron rabbit 1:500 A2052 Aldrich

CalR Interneuron rabbit 1:500 7699/4 Swant

Proliferating Ki67 rabbit 1:500 ab15580 Abcam Cells

GAPDH Housekeeping mouse 1:5000 AB2302 Millipore

NR1 - mouse 1:200 P35439-2 NeuroMab

84 Immunocytochemistry (ICC)

Cells growing in vitro on coverslips were fixed with 4% paraformaldehyde, washed with

PBS (phosphate buffer saline), blocked (0.2% bovine serum albumin (BSA), 0.01 % Triton

X-100, PBS) for 1 h at RT, and incubated with two primary antibodies raised in different species (typically mouse and rabbit) (Table 5) at 4oC overnight. The following day, appropriate secondary antibodies were applied for 2 h at RT, followed by the nuclear stain

BB for 1 min. All immunostained coverslips were mounted using the anti-fade reagent

Fluoromount-G (Southern Biotech, Birmingham, AL, USA) to preserve the fluorescence.

Image analysis and statistical tests

Immunolabeled samples were visualized using an Axioscope microscope (Zeiss,

Germany) together with Axiovision software and photographed using a digital camera.

During acquisition of images of double immunolabeled sections the focus, brightness and contrast were kept constant. The images were taken with 63X lens and assembled in

Adobe Photoshop (v. 7.0), with consistent quality adjustments for contrast, brightness and color balance. Immunolabeled cells from 10 predesignated adjacent optical fields and from four different human samples (n=4, tissue samples of different gestational age) per experiment were analyzed using Adobe Photoshop (v. 7.0). We quantified each marker in its respective channel in Photoshop, and then by switching channels in Photoshop looked for cells that show immunoreaction for both applied antibodies. The total cell

number in the optical fields was determined by quantifying cell nuclei labeled with a nuclear dye BB. The percentage of double labeled cells was then calculated from a total cell count.

Western Blot (WB)

Cells were homogenized in lysis buffer (50 mM Tris–HCl pH 7.4, 150 mM NaCl,

1% NP-40, 1 mM phenylmethylsulfonyl fluoride, Sigma Aldrich, and protease and phosphatase inhibitors (PMSF (1 mM), NaF (5 mM), Na-orthovanadate (1 mM), PIC (1 mM; Thermo Scientific)) on ice for 30 min, centrifuged at 14000 × g for 15 min at 4oC, and the supernatants were collected as the cell lysates. Protein concentration was determined using the BCA colorimetric assay (Thermo Scientific). Proteins were separated on a 4-

15% gradient polyacrylamide gel (Bio-Rad, Portland. ME, USA) at 110 volts for 75 min, and were transferred onto the polyvinylidene fluoride (PVDF) membrane at 100 volts for

60 min. After blocking with 5% milk in TBS-T, the membrane (blot) was incubated with primary antibodies diluted in blocking buffer at 4oC overnight. The blot was washed with

1X TBS-T (10% Tween, PBS, 0.1% TritonX-100, distilled water), and incubated with secondary antibodies for 2 h at RT. Blots were analyzed for the proteins of interest (Table

5). Blots were incubated with SuperSignal West Dura Extended Duration Substrate

(Thermo Scientific), and were imaged on ChemiDoc MP (Bio-Rad) digital imaging system, taking images that were not saturated. Protein levels were quantified by densitometric analysis and normalized to GAPDH levels, determined using an anti-GAPDH antibody

(1:5000).

86 Reverse-transcriptase polymerase chain reaction (RT-PCR) and quantitative PCR

(qPCR)

Cells were treated with ice-cold TRIZOL® reagent (Invitrogen, Carlsbad, CA, USA; 1 ml/

10 cm2) and were homogenized using three freeze-thawing cycles with each cycle consisting of samples remaining in dry ice for 10 minutes followed by incubation in ice for

10 minutes. Chloroform (200 μl) was added to the homogenates, and tubes were vortexed, incubated (15 min at 4 oC), and centrifuged (13000 X g for 15 min at 4 oC). The upper transparent phase was collected in sterile tubes, incubated with isopropanol (500

μl/ tube; 20 min at RT), and centrifuged (13000 X g for 15 min at 4oC). The pellets were incubated with 75% ethanol (4 oC) and centrifuged (13000 X g for 15 min). The pellets containing RNA were air dried and dissolved in 5% RNase Out solution. RNA concentrations were determined using the NanoDrop technology (260/280 ratios obtained were between 1.93 and 2.0). cDNA was synthesized by RT-PCR using the First Strand

Synthesis SuperScript III kit (Invitrogen). The SYBR Green (Applied Biosystems,

Cheshire, UK) protocol was used to analyze the expression levels of mRNA from the cDNA samples (Table 6) by performing qPCR using the CFX96 Connect™ thermocycler

(Bio-Rad). The qPCR protocol involves a heating step to 95oC for 2 min followed by 40 cycles at 95oC for 15 seconds, at 55oC for 15 seconds, and at 68oC for 20 seconds. Cycle

-ΔΔ t of threshold (Ct) values were used to calculate the ΔΔCt values, and the formula 2 C was used to determine the mRNA expression level relative to the control sample which has an arbitrary value of 1.

Table 6 Primers used for qPCR

Cell Type Genes Forward Primer Sequence Reverse Primer Sequence Identified 5`-GCC CTG ACC ACT 5`-GGA GTC CTG GAT TTC Nestin RGC CCA GTT TA-3` CTT CC-3`

Intermediat 5`-GGG CAC CTA TCA 5`-AAG GAA ACA TGC GCC Tbr2 e GTA CAG CCA-3` TGC-3` Progenitor

Interneuro 5`-CAC GCA GGT CAA 5`-TTG CCG TCT TTC ACC Nkx2.1 n GAT CTG GTT-3` AGG A-3` Progenitor

5`- Neuroge 5`-GCATCAAGA Neuron TCTCGATCTTGGTTAGCTTG nin AGACACGCAGACTGA-3` GCGT-3`

Glutamater 5`-TCT GAG CTT CGT 5`-GCT GTT GTA GGC TCC Tbr1 gic neuron CAC AGT TTC-3` GTT G-3`

Interneuro 5`-CCT CAA CTA TGT 5`-TGT GCG AAC CCC ATA Gad65 n CCG CAA GAC-3` CTT CAA-3`

5`-CTG CGG CTC GAT 5`-TCC AGC GAC TCA ATC Gfap Astrocyte CTG GTT-3` TTC CTC-3`

5`-CCA GTC AAG AAG 5`-TTC ATG GTC CGT GCC Grin1 - GTG ATC TGC AC-3` AGC TTG A-3`

Sandwich Enzyme Linked Immunosorbent Assay (Sandwich ELISA)

The eBioscience High Sensitivity human anti-IL6 ELISA (San Diego, CA) kit was used for the sandwich ELISA experiments on dissociated mixed cell cultures prepared from four fetal brains (16-19gw). The assay was performed according to manufacturer’s instructions. We used Origin to plot the standard curve and analyze results from the

ELISA experiment.

Statistics

All data were expressed as mean + standard error of mean (SEM). Mean, SEM and p-values were calculated in Microsoft Excel. For all Western Blot and qPCR experiments, triplicate values were averaged across the four brains (n=4; 16-19 gw) for each treatment to obtain a mean value for each treatment. The means obtained from each brain in a treatment group were averaged to obtain a group mean. Variations were expressed as the mean ± standard error (SEM). One-way ANOVA followed by

Bonferroni’s post-hoc test was used to evaluate statistical significance, defined as a p value <0.05.

Results

Cortical Progenitors and Neurons express NR1 at midgestation

Using the enriched dorsal RGCs cultures (see Methods; Figure 10) we explored whether isolated RGCs express NMDARs, particularly the obligatory subunit NR1, as KYNA has specific affinity towards the glycine site of NR1 subunit (Zhuravlev et al., 2007). Indeed, cultured human RGCs express the NR1 subunit (Figure 11) after 3 DIV of proliferation and 7 DIV of differentiation in all fetal brains studied (n=4, 16-19 gw). In order to determine which progenitor subtypes express the NR1 subunit after 3 DIV we used double immunolabeling with antibodies against NR1 and the markers of cortical progenitors

(Figure 11A). We demonstrated that RGCs labeled with BLBP, intermediate progenitors labeled with Tbr2, and a subpopulation of interneuron progenitors labeled with Nkx2.1, all express the NR1 subunit (Figure 11B; top panel). After 7 DIV of differentiation, the newly generated neurons labeled with βIII tubulin, and also with Tbr1 or GABA, markers of glutamatergic and cortical interneurons, respectively, express NR1 (Figure 11B; bottom panel). In humans, GFAP is a marker for differentiated astrocytes, and both cell types express NR1 subunit. Thus, based on these co-labeling experiments, we conclude that at midgestation, both cortical progenitors, two neuronal subtypes, glutamatergic and interneurons, and astroglia cells express the NR1 subunit of NMDARs.

Figure 11. Cell types that express NR1 subunit at mid-gestation. (A) Timeline showing that NR1 expression was analyzed on progenitors after 3 DIV in PM and on mature cell types after 7 DIV in DM; n =4. (B) Representative double immunolabeling images taken from 17 gw cultures for NR1 (green) with either progenitor, neuronal or astroglial markers

(red). After 3 DIV in PM, NR1 was expressed on BLBP+ RGCs, Tbr2+ intermediate progenitors, Nkx2.1+ interneuron progenitors, and on GFAP+ astroglia. After additional 7

DIV in DM, NR1 was expressed on neurons labeled with βIII tubulin, Tbr1, GABA, and on astrocytes labeled with GFAP. Double-labeled cells are yellow. Nuclear stain: BB.

KYNA Affects Cell Survival and Proliferation via blockade of NMDARs

We further examined the effects of KYNA on proliferation and survival of human

RGCs. KYNA antagonizes the NMDARs as well as the nAChRs, though at significantly different concentrations. To determine if the effect of KYNA on cell cycle and cell death was mediated through NMDARs or nAChRs, we used receptor specific antagonists: D-

APV is specific to NMDARs and TBC for nAChRs (Figure 12A).

Response curves were first plotted 48 h after RGC cultures underwent treatments with eight different concentrations of KYNA, D-APV, and TBC. The effect of KYNA on

RGCs proliferation and on cell survival was measured, and the effective concentration at which 50% of the cell population was affected (EC50) was determined in both assays.

Considering that concentration 0.05 μM effectively induced 50% cell death and concentration 0.01 μM effectively inhibited 50% of cell proliferation (Figure 12B,C), we used the following treatment concentrations for further experiments: 0.001 μM, 0.005 μM and 0.01 μM of KYNA for 48 h. Furthermore, KYNA concentration-response curves in both assays were similar to that of D-APV while TBC curves were shifted to the right, suggesting that in human RGC cultures KYNA acts very similar to the NMDAR-specific antagonist D-APV.

Figure 12. Concentration-response curve for the in vitro KYNA treatment. (A) Timeline of the experiment. (B) The live/dead assay: live (green) and dead cells (red) for control

(DMSO) and drug treatments. (C) Ki67+ proliferating cells (red); nuclear stain BB (blue); n =4; p < 0.05 between DMSO and each treatment. Error bars represent mean+SEM;

DMSO-Dimethyl sulfoxide,TBC- Tubocurarine chloride, D-APV- D-amino phosphonovalerate.

KYNA alters RGC specification

To examine the effects of KYNA on the specification of human cortical progenitors, we followed the progeny of RGCs after 3 DIV of proliferation. Real-time PCR revealed that after KYNA treatment expression of genes specific to progenitor subtypes is decreased in a concentration-dependent manner, while expression of the astroglial gene,

Gfap is increased with the highest KYNA concentration of 0.01 μM (p < 0.05; Figure 13A).

Protein expression, examined in whole cell lysates using Western blotting, revealed that treatment with KYNA significantly reduced expression levels of proteins specific for cortical progenitors. While only the highest concentration of KYNA (0.01 μM) had significant (p < 0.05) effects on RGC protein BLBP and intermediate progenitor protein

Tbr2, all three concentrations of KYNA reduced expression of protein Nkx2.1 present in a subpopulation of cortical interneuron progenitors (p < 0.05). In accordance with gene expression levels, astroglial protein GFAP showed an increase after KYNA treatment in a concentration-dependent manner (p < 0.05; Figure 13B, C).

Looking at the effects of KYNA on the cell types using immunocytochemistry, we found that the percentage of BLBP+ RGCs and Tbr2+ intermediate progenitors from all cells in the culture were significantly reduced with the two highest concentrations (0.005

μM and 0.01 μM), while all three concentrations of KYNA significantly decreased the percentage of Nkx2.1+ interneuron progenitors (p<0.05). These results were in line with those observed from the qPCR and Western blotting experiments. Similar to data on gene

Figure 13. Blocking NMDAR affects cell fate determination in vitro. (A) KYNA treatment decreased progenitors but increased astroglia specific gene expression in a concentration-dependent manner, (B) Western blot from 17 gw KYNA treated cell lysates, and (C) the densitometric analysis showed a decrease in progenitor, but increase in astroglia protein expression in a concentration-dependent manner. (D) Representative images at 17 gw for immunolabeling with specific progenitor and astroglia markers (red), and nuclear stain: BB (blue). (E) The immunolabeling quantification showed a decrease in percentage of progenitor subtypes, but an increase in astroglia population (n=4; p <

0.05). Scale bar 50μm.

and protein expression, we found a significant increase in the GFAP+ astroglial population in KYNA treated cultures (p < 0.05; Figure 13D, E). These results indicate that KYNA significantly altered the specification of the cortical radial glia progenitor cells by reducing the number of progenitor subtypes (Tbr2, Nkx2.1) while increasing the number of GFAP+ astroglial cells, the first type of glia to appear once neurogenesis is completed in vivo.

This alteration in the progenitor specification timeline is likely to alter the downstream process of neurogenesis and gliogenesis. .

KYNA modifies the process of neuronal differentiation

Since KYNA negatively affected RGCs and altered their specification process, we hypothesized that the process of progenitor cells differentiating into cortical neurons is also affected. In order to test our hypothesis, we added differentiation medium (DM) to our progenitor cell cultures for 7 DIV and then assessed their differentiation into either neurons or astrocytes.

Gene expression analysis using qPCR showed that KYNA decreased expression of neuronal genes Neurogenin 1/2, Tbr1, and Gad65 in a concentration-dependent manner, but increased expression of astrocytic gene Gfap (p < 0.05; Figure 14A). This finding was further supported by the decrease in neuronal proteins βIII tubulin and Tbr1, but an increase in astrocytic protein GFAP after KYNA treatment (p < 0.05; Figure 14B,

C).

94 To analyze the effect on specific cell-types, we performed immunocytochemistry using antibodies specific to neuronal proteins. We observed a significant decrease in the number of cells labeled with neuronal markers (β-III-tubulin, Tbr1, GABA, Calretinin) and this decrease was KYNA concentration-dependent. Moreover, the decrease of

GABAergic neurons was 50% and glutamatergic (Tbr1) neurons 17% comparing to controls, suggesting a greater effect of KYNA on interneuron versus glutamatergic neurogenesis. Once again, we found an increase in the number of GFAP+ astrocytes, indicating a drive towards astrocyte formation (p < 0.05; Figure 14D, E). We have not, however, observed any differences in oligodendrocyte progenitors (O4+ cells) or mature oligodendrocytes (MBP+ cells) in our KYNA treated cultures (not shown).

Combined results obtained with a battery of methods demonstrated that KYNA influenced the RGC specification and differentiation process by increasing the astroglial cell population at the expense of neuronal cells. Developmentally, this shift in gliogenesis occurring before neurogenesis could be detrimental to cortical circuitry formation and function.

KYNA treatment Increases the population of Reactive Astrocytes

It has been previously reported that KYNA triggers activation of astrocytes and generates an inflammatory response that involves secretion of pro-inflammatory cytokines (Guillemin et al., 2001; Meyer et al., 2011). To test this possibility, we

Figure 14. Differential effect of KYNA treatment on neural cell types. (A) q-PCR showed that KYNA treatment decreased neuronal specific (Neurogenin, Tbr1, Gad65), but increased astrocytic gene (Gfap) expression (B) Western blot from 17 gw KYNA treated cell lysates, and (C) Densitometric analysis showed a decrease in expression for neuron specific proteins, but an increase for astrocytic protein (D) Immunostaining at 17 gw for neuron and astrocytic markers (red); nuclei labeled with BB (blue). (E) Quantification of the immunolabeling showed a decrease in neuronal cell populations but an increase in the astrocyte cell population (n=4; p < 0.05).

immunolabeled KYNA treated RGC cultures with an antibody to S100β, a cytoplasmic marker for reactive astrocytes (Figure 15A). The quantification of the number of S100β+ cells immediately after the 48 h KYNA treatment revealed that treatment with KYNA induced a significant increase in S100β+ cells, from 0.5% in control conditions to 30% when treated with 0.01 μM KYNA (p < 0.05; Figure 15B). These S100β+ astrocytes were large cells with multiple processes. Reactive astrocytes are a well-known source of pro- inflammatory cytokines, one of which is IL-6, a primary cytokine released in almost all inflammatory responses (Guillemin et al; 2001; Islam et al., 2009). Since we observed a strong gliosis reaction in our KYNA-treated RGC cultures, we determined the level of secreted cytokine IL-6. We examined, using ELISA, the IL-6 concentration in our media obtained from KYNA treated RGC cultures at two time points, 24 h and 48 h immediately after the treatment. We observed that even the highest dose of KYNA did not induce secretion of a significantly high amount of IL-6 after 24 h (0.001 pg/ml in control versus

0.003 pg/ml in 10 nM KYNA, p = 0.07), and 48 h (0.003 pg/ml in control versus 0.005 pg/ml in 10 nM KYNA, p = 0.09). However, previous studies with human subjects have reported that the levels of IL-6 in the cerebrospinal fluid in normal patients is ~1 pg/ml, while their age and sex matched schizophrenic counterparts show levels closer to 4 pg/ml of IL-6 (Garver et al., 2003; Schwieler et al., 2015). Taking these small levels of IL-6 into consideration, our in vitro IL-6 levels demonstrate a potentially important upward trend

(Figure. 15C). We

Figure 15. KYNA activates astrocytes. (A) Immunocytochemistry for S100β, a marker for reactive astrocytes, was performed on KYNA treated RGC cultures. (B) Quantification of the immunocytochemistry reveals that KYNA treatment triggered generation of reactive astrocytes in a dose-dependent manner after 48 h, and cultures partly recovered after 7

DIV in DM. (C) KYNA treated RGC cultures at 24 and 48 h time points did not exhibit a significant increase in IL-6 secretion as compared to control. Nuclear stain: BB; n =4; p<0.05. Error bars represent mean+SEM.

98 measured concentration of secreted IL-6 in the medium after 24 and 48 h after KYNA treatment, and failed to observe significant increases in levels of IL-6 in KYNA treated cultures, at both time points (Figure 15C). Our failure to observe differences in IL-6 levels between different concentrations of KYNA could be a consequence of the homogeneous

RGC cultures we use to study effects of KYNA treatment, since RGC cultures could be incapable of producing a high enough number of reactive astrocytes needed to secrete large amounts of detectable IL-6 levels.

Discussion

In the present study, we explored the effects of KYNA on human cerebral cortical development in cell cultures derived from midgestational human tissue. Previous studies in rodents (Malatesta et al., 2000; Miyata et al., 2001; Noctor et al., 2001; Noctor et al.,

2004), and humans (Hansen et al., 2010; Clowry et al., 2010; Betizeau et al., 2013, Malik et al., 2013; Radonjic et al., 2014) have shown significant species-specific differences demonstrating critical need for studies of cortical development in human cultures. Three major findings from this study demonstrate that KYNA, similar to the NMDAR-specific antagonist D-APV, significantly alters proliferation, specification and differentiation of cortical cells generated from enriched RGC cultures. First, after KYNA treatment, RGC proliferation and survival decreased resulting in a reduced number of cortical progenitors

(Nkx2.1+ and Tbr2+ cells), neurons (βIII tubulin+), and interneurons (GABA+, CalR+).

Second, KYNA treatment effectively pushed the specification of RGCs toward the

astroglial lineage, as evidenced by the increase in number of GFAP+ cells after 3 DIV of proliferation. Third, not only did the number of GFAP+ astrocytes increase, but in addition, astrocytes were activated as demonstrated by morphological changes and S100β labeling. In sum, these results indicate that altered levels of KYNA in human gestation, as can result from maternal infection and immune activation, may have profound effects on cortical development.

KYNA disrupts neurogenesis and reduces the pool of cortical progenitors in vitro

KYNA is a product of the kynurenine pathway, the main metabolic route of tryptophan degradation, and is responsible for a broad spectrum of effects, including the endogenous regulation of neuronal excitability and the initiation of immune tolerance.

KYNA is the only known endogenous antagonist of the NMDAR in vivo, and binds strongly to the NR1 subunit (Kessler et al., 1989; Wang et al., 2006). However, KYNA also inhibits nAChRs (Hilmas et al., 2001; Alkondon et al., 2004), and both NMDAR and nAChRs are expressed early during human development (4-5 gw; Kostovic et al., 1989; Hellstrom-

Lindahl et al., 1998; Suzuki et al., 2006). Therefore, it was necessary to distinguish toward which receptor KYNA exhibits a stronger affinity, in order to study KYNA effects on the early developing brain. In this study, we showed that in RGCs, KYNA has a higher affinity for NMDARs over nAChRs, corroborating previous studies that showed KYNA’s inability to block nAChR-dependent electrical activity in cultured adult rat cortical and hippocampal

100 cells (Hilmas et al., 2001; Mok et al., 2009; Dobelis et al., 2012).

During embryonic development in rodents and humans, NMDARs are important for proliferation of neural stem cells, their differentiation into neurons and glia, and proper migration of the differentiated cell types to their correct position in the six-layered cerebral cortex (Manent et al., 2005, Suzuki et al., 2006, Toriumi et al., 2012). In vivo blockade of

NMDARs during rat cortical development induces apoptosis of neuronal and glial cells leading to severe neurodegeneration and ultimately death of the animal (Ikonomidou et al., 1999). In vitro, we observed that blocking NMDARs with D-APV induces similar effects of increasing cell death and decreasing neuronal differentiation (Chapter 4). Here, we show that elevated levels of KYNA, an endogenous NMDAR antagonist, increased cell death of cortical progenitors and decreased RGC proliferation, showing the detrimental effects of elevated KYNA levels on human cortical progenitors during the second trimester of gestation.

KYNA-induced changes in cell fate determination

An important issue is whether KYNA has differential effects on generation of principal neurons and interneurons in the developing cortex. This was important because our results with NMDAR-specific antagonist D-APV showed that GABAergic neurons are more sensitive to NMDAR blockade than Tbr1+ glutamatergic neurons (Chapter 4). To study this question, we used various transcription factors to label distinct neuronal

101

populations in vitro. In accordance with previous studies (Rakic and Zecevic 2003;

Zecevic et al. 2005; Jakovcevski et al. 2011), we found that RGC cultures in this study, successfully generated progenitors of the glutamatergic (Tbr2+) and interneuronal

(Nkx2.1+) progenitors (Bayatti et al., 2008b; Yu and Zecevic 2011; Malik et al., 2013;

Pollen et al., 2015) that further give rise to glutamatergic neurons (Tbr1+) and interneurons (GABA+) (Englund et al., 2005; Yu and Zecevic 2011). Most notably, we have shown that a KYNA-induced decrease in Nkx2.1 and Tbr2 expression resulted in a decrease of GABAergic interneurons which was more pronounced than the decrease of

Tbr1+ glutamatergic neurons. These data suggest that a KYNA-induced alteration in the cortical progenitor pool disrupts neurogenesis in a manner similar to that observed with

NMDAR-specific antagonist D-APV. Such changes can subsequently affect the proportionate balance of cortical cell types and the ensuing cortical circuitry formation.

KYNA failed to elicit a pro-inflammatory response in cortical progenitor cultures

Mounting evidence suggests a link between maternal immune activation and neuropsychiatric illness (Gilmore and Jarskog, 1997; Buka et al., 2001). The KYNA- mediated NMDAR blockade favored astrocyte generation, as had been shown previously in human fetal astrocyte cultures (Guillemin et al. 2001), and in addition induced the activation of resting astrocytes in both RGC cultures and mixed cell cultures. The morphology of S100β+ cells changed, and their number increased, implying a pro- inflammatory response. Interestingly, astrocytic hypertrophy has been reported in the

102 prefrontal cortex of patients with neuropsychiatric disorders (Rajkowska et al., 2001), indicating that reactive astrocytic changes can be a major component of disease pathology.

Even though we showed increased numbers of reactive astrocytes in our enriched

RGC cultures, we did not observe any increase in the levels of secreted IL-6, a pro- inflammatory cytokine, in our RGC culture medium following KYNA treatment. This was an unexpected outcome since several reports in mice have indicated that KYNA causes the release of inflammatory cytokines, especially IL-6 and IFN-γ (Islam et al., 2009).

Moreover, in vitro, both IFN-γ and IL-6 activate human fetal astrocytes to synthesize large amounts of KYNA (Guillemin et al., 2001; Islam et al., 2009; Meyer et al., 2011; Schwieler et al., 2015). Activation of cytokines is directly relevant to schizophrenia as studies in human subjects found elevated levels of IL-6 in the cerebrospinal fluid of Sch patients in comparison to their age and sex-matched healthy counterparts (Garver et al., 2003;

Schwieler et al., 2015). These studies suggest that there are certain cell types present in vivo that are responsible for the increased amounts of IL-6, and this further suggests that our enriched RGC cultures are devoid of those cell types. To determine if KYNA treatment indeed elicits a pro-inflammatory response during human development, we need to establish cultures consisting of all cell types in the human fetal brain. Such cultures called mixed cell cultures will enable us to completely understand the mechanistic pathway through which KYNA functions in human cortical development.

103

Consequences of elevated KYNA levels during fetal neurodevelopment

Metabolites of the kynurenine pathway have important roles in the CNS, and recent data imply a role in brain development as well (reviewed in Notarangelo and Pocivavsek,

2016). Physiological levels of KYNA are higher in the developing brain compared to the immediate postnatal period and adulthood (Beal et al., 1992; Walker et al., 1999;

Ceresoli-Borroni and Schwarcz, 2000). It has been suggested that KYNA might protect the fetal brain from over-excitation via NMDARs (Badawy, 2014). At the same time, glutamate via activation of NMDARs has an important trophic role in neurodevelopment.

Various insults during pregnancy can lead to direct physiological changes in the fetal environment, thereby influencing the normal course of prenatal brain development. For example, the anesthetic ketamine and drugs of abuse such as PCP and ethanol antagonize normal function of fetal cortical NMDARs (Anis et al., 1983; Krystal et al.,

1994; Lahti et al., 1995; Lieberman et al., 2012; Xiang et al., 2015). These disruptions may have long-lasting consequences for subsequent brain and behavioral development and might lead to structural and functional brain abnormalities in adult life (Iaccarino et al., 2013).

Even though it is well established that KYNA acts as an antagonist of NMDAR and nAChR, the consequences of pathological levels of KYNA in the developing brain have not been fully explored. Our in vitro study shows that KYNA negatively influences the proliferation of human RGCs and pushes RGC specification towards astrocytes, versus

104 neurons, observations that resound the effects of D-APV on human RGC progenitors

(Chapter 3). In addition, higher KYNA concentrations, while negatively impacting both interneurons and principle neurons, results in larger deficits in GABA+ interneurons (50% decrease compared to control) compared to a Tbr1+ subpopulation of projection neurons

(17% decrease compared to control). The preferential vulnerability of interneurons might be clinically relevant since impaired function of cortical interneurons is reported in neurodevelopmental disorders including schizophrenia and autism spectrum disorder

(DeFelipe, 1999; Gleeson and Walsh, 2000; Akbarian et al., 1995; Knable, 1999; Lewis and Levitt, 2002; Levitt, 2003; Baraban and Tallent, 2004; Lewis et al., 2005). In our study human cortical progenitors were isolated at mid-gestation (16-19 gw), an important period of active neurogenesis when upper cortical layers are formed (Hill and Walsh, 2005). As these layers are crucial for formation of cortico-cortical connections and subsequently for emergence of higher brain functions, interference with glutamate receptor function at this developmentally sensitive period may lead to widespread effect on formation of the cortical circuitry. Together, these changes can have a negative impact on maturation of cortical functions during adolescence, a stage when cognitive executive functions, such as planning, rational thinking, attention, and emotion-related impulsivity control develop and a time point at which schizophrenia symptoms often first manifest (Uhlhaas, 2011).

Certainly, in vitro systems have limitations, and further studies are needed to discern the complexity of developmental disruption caused by elevated levels of the endogenous NMDAR antagonist, KYNA. Since live human fetuses cannot be used for

105

research purposes, our in vitro system of human progenitor cells enriched from aborted fetuses serves as an innovative tool for understanding the possible effects of endogenous molecules, when present at pathological levels, on human fetal cortical development.

106 References

Akbarian S, Huntsman MM, Kim JJ, Tafazzoli A, Potkin SG, Bunney WE Jr et al. GABAA receptor subunit gene expression in human prefrontal cortex: comparison of schizophrenics and controls. Cereb. Cortex 5: 550–560 (1995).

Akbarian S, Sucher NJ, Bradley D, Tafazzoli A, Trinh D, Hetrick WP et al. Selective alterations in gene expression for NMDA receptor subunits in prefrontal cortex of schizophrenics. J. Neurosci. 6: 19–30 (1996).

Alkondon M, Pereira EF, Yu P, Arruda EZ, Almeida LE, Guidetti P et al. Targeted deletion of the kynurenine aminotransferase ii gene reveals a critical role of endogenous kynurenic acid in the regulation of synaptic transmission via alpha7 nicotinic receptors in the hippocampus. J. Neurosci. 24: 4635–4648 (2004).

Anis NA, Berry SC, Burton NR, Lodge D. The dissociative anaesthetics, ketamine and phencyclidine, selectively reduce excitation of central mammalian neurones by N-methyl- aspartate. Br. J. Pharmacol. 79: 565–75 (1983).

Badawy AAB. The tryptophan utilization concept in pregnancy. Obstet. Gynecol. Sci. 57:

249–59 (2014).

Balasz R. Trophic effect of glutamate. Curr. Top. Med. Chem. 6: 961–968 (2006).

Bale TL, Baram TZ, Brown AS, Goldstein JM, Insel TR, McCarthy MM et al. Early life programming and neurodevelopmental disorders. Biol. Psychiatry 68: 314–319 (2010).

Baraban SC, Tallent M. Interneuron Diversity series: Interneuronal neuropeptides-- endogenous regulators of neuronal excitability. Trends Neurosci. 27: 135–142 (2004).

Bayatti N, Sarma S, Shaw C, Eyre JA, Vouyiouklis DA, Lindsay S et al. Progressive loss

107

of PAX6, TBR2, NEUROD and TBR1 mRNA gradients correlates with translocation of

EMX2 to the cortical plate during human cortical development. Eur. J. Neurosci. 28: 1449-

1456 (2008).

Beal MF, Swartz KJ, Isacson O. Developmental changes in brain kynurenic acid concentrations. Brain Res. Dev. Brain Res. 68: 136–139 (1992).

Belforte JE, Zsiros V, Sklar ER, Jiang Z, Yu G, Li Y et al. Postnatal NMDA receptor ablation in corticolimbic interneurons confers schizophrenia-like phenotypes. Nat.

Neurosci. 13: 76–83 (2010).

Betizeau M, Cortay V, Patti D, Pfister S, Gautier E, Bellemin-Menard A et al. Precursor

Diversity and Complexity of Lineage Relationships in the Outer Subventricular Zone of the Primate. Neuron 80: 442–457 (2013).

Breier A, Malhotra AK, Pinals DA, Weisenfeld NI, Pickar D. Association of ketamine- induced psychosis with focal activation of the prefrontal cortex in healthy volunteers. Am.

J. Psychiatry 154: 805–811 (1997).

Brown AS, Derkits EJ. Prenatal infection and schizophrenia: A review of epidemiologic and translational studies. Am. J. Psychiatry 167: 261–280 (2010).

Brown AS. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev. Neurobiol. 72: 1272-1276 (2012).

Buka SL, Tsuang MT, Torrey EF, Klebanoff MA, Bernstein D, Yolken RH: Maternal infections and subsequent psychosis among offspring. Arch Gen Psychiatry 58:1032–

1037 (2001).

Ceresoli-Borroni G, Schwarcz R. Perinatal kynurenine pathway metabolism in the normal

108 and asphyctic rat brain. Amino Acids 19: 311–323 (2000).

Clowry G, Molnar Z, Rakic P. Renewed focus on the developing human neocortex. J.

Anat. 217: 276-288 (2010).

Coyle JT. The glutamatergic dysfunction hypothesis for schizophrenia. Harv. Rev.

Psychiatry 3: 241–253 (1996).

Deutsch SI, Mastropaolo J, Schwartz BL, Rosse RB, Morihisa JM. A ‘glutamatergic hypothesis’ of schizophrenia. Rationale for pharmacotherapy with glycine. Clin.

Neuropharmacol. 12: 1–13 (1989).

DeFelipe J. Chandelier cells and epilepsy. Brain 122: 1807–1822 (1999).

Dobelis P, Staley KJ, Cooper DC. Lack of modulation of Nicotinic Acetylcholine alpha-7 receptor currents by Kynurenic acid in adult hippocampal interneurons. PLoS One 7: 1–

6 (2012).

Englund C, Fink A, Lau C, Pham D, Daza RAM, Bilfone A et al. Pax6, Tbr2, and Tbr1 Are

Expressed Sequentially by Radial Glia, Intermediate Progenitor Cells, and Postmitotic

Neurons in Developing Neocortex. J. Neurosci. 25: 247–251 (2005).

Erhardt S, Blennow K, Nordin C, Skogh E, Lindstrom LH, Engberg G. Kynurenic acid levels are elevated in the cerebrospinal fluid of patients with schizophrenia. Neurosci.

Lett313: 96–98 (2001).

Garver DL, Tamas RL, Holcomb JA. Elevated interleukin-6 in the cerebrospinal fluid of a previously delineated schizophrenia subtype. Neuropsychopharmacology 28: 1515–

1520 (2003).

Gilmore JH, Jarskog LF: Exposure to infection and brain development: cytokines in the

109

pathogenesis of schizophrenia. Schizophr Res 24:365–367 (1997).

Gleeson JG, Walsh CA. Neuronal migration disorders: from genetic diseases to developmental mechanisms. Trends Neurosci. 23: 352–359 (2000).

Guillemin GJ, Kerr SJ, Smythe GA, Smith DG, Kapoor V, Armati PJ et al. Kynurenine pathway metabolism in human astrocytes: A paradox for neuronal protection. J.

Neurochem. 78: 842–853 (2001).

Hansen DV, Lui JH, Parker PR, Kriegstein AR. Neurogenic radial glia in the outer subventricular zone of human neocortex. Nature 464: 554–561 (2010).

Hansen DV, Lui JH, Flandin P, Yosjikawa K, Rubenstein JL, Alvarez-Buylla A et al. Non- epithelial stem cells and cortical interneuron production in the human ganglionic eminences. Nat. Neurosci. 16: 1576–87 (2013).

Haydar TF, Wang F, Schwartz ML, Rakic P. Differential modulation of proliferation in the neocortical ventricular and subventricular zones. J. Neurosci. 20: 5764–5774 (2000).

Heyes MP, Mefford IN, Quearry BJ, Dedhia M, Lackner A. Increased ratio of quinolinic acid to kynurenic acid in cerebrospinal fluid of D retrovirus-infected rhesus macaques: relationship to clinical and viral status. Ann. Neurol. 27: 666–675 (1990).

Hellström-Lindahl E, Gorbounova O, Seiger A, Mousavi M, Nordberg A. Regional distribution of nicotinic receptors during prenatal development of human brain and spinal cord. Brain Res. Dev. Brain Res. 108: 147–160 (1998).

Hill RS, Walsh C. a. Molecular insights into human brain evolution. Nature 437: 64–67

(2005).

Hilmas C, Pereira EF, Alkondon M, Rassoulpour A, Schwarcz R, Albuquerque EX. The

110 brain metabolite kynurenic acid inhibits alpha7 nicotinic receptor activity and increases non-alpha7 nicotinic receptor expression: physiopathological implications. J. Neurosci.

21: 7463–7474 (2001).

Holtze M, Saetre P, Engberg G, Schweiler L, Werge T, Andreassen OA et al. Kynurenine

3-monooxygenase polymorphisms: Relevance for kynurenic acid synthesis in patients with schizophrenia and healthy controls. J. Psychiatry Neurosci. 37: 53–57 (2012).

Howard B, Chen Y, Zecevic N. Cortical progenitor cells in the developing human telencephalon. Glia 53: 57–66 (2006).

Iaccarino HF, Suckow RF, Xie S, Bucci DJ. The effect of transient increases in kynurenic acid and quinolinic acid levels early in life on behavior in adulthood: Implications for schizophrenia. Schizophr. Res. 150: 392–397 (2013).

Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K et al. Blockade of

NMDA Receptors and Apoptotic Neurodegeneration in the Developing Brain. Science

283: 70–74 (1999).

Islam O, Gong X, Rose-John S, Heese K. Interleukin-6 and neural stem cells: more than gliogenesis. Mol. Biol. Cell 20: 188–199 (2009).

Jakovcevski I, Mayer N, Zecevic N. Multiple origins of human neocortical interneurons are supported by distinct expression of transcription factors. Cereb. Cortex 21: 1771–

1782 (2011).

Kessler M, Terramani T, Lynch G, Baudry M. A glycine site associated with N-methyl-D- aspartic acid receptors: characterization and identification of a new class of antagonists.

J. Neurochem. 52: 1319–1328 (1989).

111

Knable MB. Schizophrenia and bipolar disorder: Findings from studies of the Stanley

Foundation Brain Collection. Schizophr. Res. 39: 149–152 (1999).

Kostović I, Lukinović N, Judas M, Bogdanović N, Mrzljak L, Zecević N et al. Structural basis of the developmental plasticity in the human cerebral cortex: the role of the transient subplate zone. Metab. Brain Dis. 4: 17–23 (1989).

Krystal JH, Karper LP, Seibyl JP, Freeman GK, Delaney R, Bremner JD et al.

Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans.

Psychotomimetic, perceptual, cognitive, and neuroendocrine responses. Arch. Gen.

Psychiatry 51: 199–214 (1994).

Lahti AC, Koffel B, LaPorte D, Tamming CA. Subanesthetic doses of ketamine stimulate psychosis in schizophrenia. Neuropsychopharmacology 31: 9–19 (1995).

Levitt P. Structural and functional maturation of the developing primate brain. J. Pediatr.

143: 35–45 (2003).

Lewis DA, Levitt P. Schizophrenia as a disorder of neurodevelopment. Annu. Rev.

Neurosci. 25: 409–432 (2002).

Lewis DA, Hashimoto T, Volk DW. Cortical inhibitory neurons and schizophrenia. Nat.

Rev. Neurosci. 6: 312–324 (2005).

Lieberman R, Levine ES, Kranzler HR, Abreu C, Covault J. Pilot Study of iPS-Derived

Neural Cells to Examine Biologic Effects of Alcohol on Human Neurons In Vitro. Alcohol.

Clin. Exp. Res. 36: 1678–1687 (2012).

Limosin F, Rouillon F, Payan C, Cohen JM, Strub N. Prenatal exposure to influenza as a risk factor for adult schizophrenia. Acta Psychiatr. Scand. 107: 331–335 (2003).

112 LoTurco JJ, Wanton MG, Kriegstein AR. Initial Expression and Endogenous Activation of

NMDA Channels in Early Neocortical Development. J. Neurosci. 17: 792–799 (1991).

Lui JH, Hansen DV, Kriegstein AR. Development and evolution of the human neocortex.

Cell 146: 18–36 (2011).

Ma T, Wang C, Wang L, Zhou X, Tian M, Zhang Q et al. Subcortical origins of human and monkey neocortical interneurons. Nat. Neurosci. 16: 1588–1597 (2013).

Malatesta P, Hartfuss E, Götz M. Isolation of radial glial cells by fluorescent-activated cell sorting reveals a neuronal lineage. Development 127: 5253–5263 (2000).

Malik S, Vinukonda G, Vose LR, Diamond D, Bhimvarapu BBR, Hu F et al. Neurogenesis continues in the third trimester of pregnancy and is suppressed by premature birth. J.

Neurosci. 33: 411–23 (2013).

Manent JB, Demarque M, Jorquera I, Pellegrino C, Ben-Ari Y, Aniksztejn L et al. A noncanonical release of GABA and glutamate modulates neuronal migration. J. Neurosci.

25: 4755–4765 (2005).

Meyer U, Weiner I, McAlonan GM, Feldon J. The neuropathological contribution of prenatal inflammation to schizophrenia. Expert Rev. Neurother. 11: 29–32 (2011).

Miyata T, Kawaguchi A, Okano H, Ogawa M. Asymmetric inheritance of radial glial fibers by cortical neurons. Neuron 31: 727–741 (2001).

Mo Z, Moore AR, Filipovic R, Ogawa Y, Kazuhiro I, Antic SD et al. Human cortical neurons originate from radial glia and neuron-restricted progenitors. J. Neurosci. 27: 4132–4145

(2007).

Mo Z, Zecevic N. Human fetal radial glia cells generate oligodendrocytes in vitro. Glia 57:

113

490–498 (2009).

Mok MH, Fricker AC, Weil A, Kew JN. Electrophysiological characterisation of the actions of kynurenic acid at ligand-gated ion channels. Neuropharmacology 57: 242–249 (2009).

Noctor SC, Flint AC, Weissman TA, Dammerman RS, Kriegstein AR. Neurons derived from radial glial cells establish radial units in neocortex. Nature 409: 714–720 (2001).

Noctor SC, Martínez-Cerdeño V, Ivic L, Kriegstein AR. Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat.

Neurosci. 7: 136–144 (2004).

Notarangelo FM, Pocivavsek A. Elevated kynurenine pathway metabolism during neurodevelopment: Implications for brain and behavior. Neuropharmacology 16: 30073-

30079 (2016).

Pilowsky LS, Bressan RA, Stone JM, Erlandsson K, Mulligan RS, Krystal JH et al. First in vivo evidence of an NMDA receptor deficit in medication-free schizophrenic patients. Mol.

Psychiatry 11: 118–119 (2006).

Pocivavsek A, Thomas MAR, Elmer GI, Bruno JP, Schwarcz R. Continuous kynurenine administration during the prenatal period, but not during adolescence, causes learning and memory deficits in adult rats. Psychopharmacology (Berl). 231: 2799–2809 (2014).

Pollen AA, Nowakowski TJ, Chen J, Retallack H, Sandoval-Espinosa C, Nicholas CR et al. Molecular Identity of human outer radial glia during cortical development. Cell 163: 55-

67 (2015).

Radonjić NV, Petroijevic ND, Vuckovic SM, Prostran MS, Nesic ZI, Todorovic VR et al.

Baseline temperature in an animal model of schizophrenia: Long-term effects of perinatal

114 phencyclidine administration. Physiol. Behav. 93: 437–443 (2008).

Radonjić NV, Memi F, Ortega JA, Glidden N, Zhan H, Zecevic N. The Role of Sonic

Hedgehog in the Specification of Human Cortical Progenitors In Vitro. Cereb. Cortex 26:

131–143 (2014).

Rajkowska G, Halaris A, Selemon LD. Reductions in neuronal and glial density characterize the dorsolateral prefrontal cortex in bipolar disorder. Biol. Psychiatry. 49:

741-752 (2001).

Rakic S, Zecevic N. Emerging complexity of layer I in human cerebral cortex. Cereb.

Cortex 13: 1072–1083 (2003).

Rujescu D, Bender A, Keck M, Hartmann AM, Ohl F, Raeder H et al. A pharmacological model for psychosis based on N-methyl-D-aspartate receptor hypofunction: molecular, cellular, functional and behavioral abnormalities. Biol. Psychiatry 59: 721–729 (2006).

Sathyasaikumar KV, Stachowski EK, Wonodi I, Roberts RC, Rassoulpour A, McMahon

RP et al. Impaired kynurenine pathway metabolism in the prefrontal cortex of individuals with schizophrenia. Schizophr. Bull. 37: 1147–1156 (2011).

Schwarcz R, Rassoulpour A, Wu HQ, Medoff D, Tamminga CA, Roberts RC. Increased cortical kynurenate content in schizophrenia. Biol. Psychiatry 50: 521–530 (2001).

Scharfman HE, Goodman JH. Effects of central and peripheral administration of kynurenic acid on hippocampal evoked responses in vivo and in vitro. Neuroscience 86:

751–764 (1998).

Schwieler L, Larsson MK, Skogh E, Kegel ME, Orhan F, Abdelmaoty S et al. Increased levels of IL-6 in the cerebrospinal fluid of patients with chronic schizophrenia--significance

115

for activation of the kynurenine pathway. J. Psychiatry Neurosci. 40: 126–33 (2015).

Selemon LD, Zecevic N. Schizophrenia: a tale of two critical periods for prefrontal cortical development. Transl. Psychiatry. 5, 1-11 (2015).

Stöber G, Franzek E, Beckmann H, Schmidtke A. Exposure to prenatal infections, genetics and the risk of systematic and periodic catatonia. J. Neural Transm. 109: 921–

929 (2002).

Stone TW. Neuropharmacology of quinolinic and kynurenic acids. Pharmacol. Rev. 45:

309–379 (1993).

Suzuki M, Nelson AD, Eickstaedt JB, Wallace K, Wright LS, Svendsen CN. Glutamate enhances proliferation and neurogenesis in human neural progenitor cell cultures derived from the fetal cortex. Eur. J. Neurosci. 24: 645–653 (2006).

Toriumi K, Mouri A, Narusawa S, Aoyama Y, Ikawa N, Lu L et al. Prenatal NMDA

Receptor Antagonism Impaired Proliferation of Neuronal Progenitor, Leading to Fewer

Glutamatergic Neurons in the Prefrontal Cortex. Neuropharmacology 37: 1387–1396

(2012).

Uhlhaas PJ. The adolescent brain: Implications for the understanding, pathophysiology, and treatment of schizophrenia. Schizophr. Bull. 37: 480–483 (2011).

Walker DW, Curtis B, Lacey B, Nitsos I. Kynurenic acid in brain and cerebrospinal fluid of fetal, newborn, and adult sheep and effects of placental embolization. Pediatr. Res. 45:

820–826 (1999).

Wang C, McInnis J, Ross-Sanchez M, Shinnick-Gallagher P, Wiley JL, Johnson KM.

Long-term behavioral and neurodegenerative effects of perinatal phencyclidine

116 administration: Implications for schizophrenia. Neuroscience 107: 535–550 (2001).

Wang J, Simonavicius N, Wu X, Swaminath G, Raegan J, Tian H et al. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. J. Biol. Chem. 281: 22021–22028

(2006).

Wright P, Takei N, Rifkin L, Murray RM. Maternal influenza, obstetric complications, and schizophrenia. Am. J. Psychiatry 152: 1714–1720 (1995).

Xiang Y, Kim KY, Gelernter J, Park IH, Zhang H. Ethanol Upregulates NMDA Receptor

Subunit Gene Expression in Human Embryonic Stem Cell-Derived Cortical Neurons. Plos

One 10: 1–11 (2015).

Yu X, Zecevic N. Dorsal radial glial cells have the potential to generate cortical interneurons in human but not in mouse brain. J. Neurosci 31: 2413–2420 (2011).

Zecevic N, Chen Y, Filipovic R. Contributions of cortical subventricular zone to the development of the human cerebral cortex. J. Comp. Neurol. 491: 109–122 (2005).

Zhuravlev AV, Shchegolev BF, Savvateeva-Popova EV, Popov AV. Stacking-interactions in the control-gear binding of kynurenic acid with NR2A- and GluR2-subunits of glutamate ionotropic receptors. Ross Fiziol Zh Im I M Sechenova 93: 609–624 (2007).

117

Chapter 4

Effects of the NMDAR specific antagonist D-APV on human cortical development

Note: Experiments in this Chapter are similar to those in Chapter 3, and help us compare results between D-APV, and the endogenous excitatory receptor antagonist KYNA.

Abstract

The NMDAR specific antagonist D-APV, is a fast-acting, competitive antagonist that binds to the glutamate-binding site on the NR2 subunit of the NDMAR. NMDARs are important for many cellular processes such as LTP, working memory, and cell survival in adulthood. Studies have shown that NMDARs are important in fetal development since autoantibodies generated against NMDARs hamper brain development and lead to an autoimmune disease called anti-NMDAR-encephalitis. However, the exact consequences of the NMDAR blockade still remain unknown in human cortical development. To study the potential role of NMDARs in human neurodevelopment, we used an in vitro system of multipotent cortical progenitors, i.e., radial glia cells (RGCs), enriched from human cerebral cortex at mid-gestation (16-19 gestational weeks; gw). Treatment with D-APV significantly reduced the population of proliferating progenitors in a concentration- dependent manner. D-APV treatment significantly decreased progenitor populations after 3 days in vitro (DIV) and impeded neuronal differentiation after 7 DIV. Moreover, D-APV favored the specification of progenitors into the glial lineage by increasing the number of astrocytes, and more importantly, reactive astrocytes. Thus, blocking NMDARs with D- APV negatively influences the proliferation, specification and differentiation of cortical progenitors. The transformed cell-type specific populations observed in our D-APV treated cortical progenitor cultures suggests significant roles for NMDARs in the normal development of the human cerebral cortex. 118 Introduction

Glutamate receptors involved in cellular excitation are of three types, AMPA,

Kainate and NMDA, named after the synthetic agonists that activate these receptors viz.,

α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), kainate, and N-methyl

D-aspartate (NMDA), respectively (Watkins and Evans, 1981; Foster and Fagg, 1984;

McLennan, 1984; Mayer and Westbrook, 1987). In the brain, these receptors are activated by their endogenous ligand glutamate. Activation of the AMPA and kainate receptors mediates fast excitatory postsynaptic potentials, but the NMDARs have functions that are highly dependent on their subunit composition (Dingledine, 1986;

Cotman and Iversen, 1987). Physiological studies have indicated that this receptor has the unusual property of becoming active only on depolarization (Dingledine, 1983) due to a voltage-dependent block of the associated ion channel by magnesium (Mayer et al.,

1984; Nowak et al., 1984). This intriguing property of NMDARs makes it a ligand- and voltage-gated ion channel with wide variety of roles in development and adulthood.

The availability of several potent and selective NMDAR antagonists, such as D-

APV (D-amino phosphonovalerate, Watkins and Olverman, 1987), has provided the necessary pharmacological tools for understanding many aspects of NMDAR action. D-

APV blocks depolarization induced by iontophoretic application of NMDA but is without effect on kainate and AMPA-induced depolarization (Crunelli et al., 1983; Harris et al.,

1984). It can block low-frequency synaptic transmission in the cerebral cortex (Thomson

119

et al., 1985), the induction of sustained depolarization by high-frequency stimulation and the propagation of epileptiform discharges in hippocampal slices (Herron et al., 1986). NMDAR antagonists are potent muscle relaxants (Turski et al., 1985) and anticonvulsants (Croucher et al., 1982; Patel et al., 1988) and can also protect neurons against ischemia (Simon et al., 1984; Meldrum, 1985). Important as these latter observations undoubtedly are, it seems unlikely that the normal function of NMDARs is to “lurk malevolently in the surface membrane, waiting to cause epilepsy” (Dingledine,

1986). What, then, might be their function?

The use of selective NMDAR antagonists such as D-APV offers a new avenue for exploring the hypothesis that NMDARs play a significant role in human cortical development. Specifically, it allows for the first time investigation of the molecular and physiological capacities of human cortical progenitor cells, such as their proliferation and differentiation, process that require functional NMDARs in rodent neurodevelopment. The hypothesis makes an important and testable prediction that D-APV should impair a subset of developmental processes that are critically important in corticogenesis. The following series of experiments will enable identification of cellular events that are dependent on

NMDAR function in human cortical development at midgestation.

Material and Methods

Human Fetal Brain Tissue

120 The same tissue characterized in Chapter 3 will be used in experiments described in this

Chapter.

Human fetal brain tissue (n = 4) between 16 gw and 19 gw (case numbers 3, 4, 5,

7 from Table 1) free of any developmental abnormalities was obtained, handled and processed as described in detail in Chapter 3, strictly following regulations of the Ethics

Committee at UConn Health. A small piece (1 cm2) of the dorsal telencephalic region was used to generate dissociated cell cultures (Zecevic et al. 2005; Radonjic et al., 2014).

Dissociated Mixed Cell Culture and Enrichment of RGCs

Establishment of dissociated mixed cell cultures and enrichment of RGCs using MACS were was performed as previously described in Mo et al., 2007 and Radonjic et al., 2014.

These protocols were described in detail in Chapter 3. The enriched RGCs were plated on poly-D-lysine (Sigma-Aldrich) coated coverslips (12 mm) at a density of 250,000 cells/ml and subjected to double immunocytochemistry experiments with antibodies against RGC markers CD15, brain lipid binding protein (BLBP) or glial fibrillary acidic protein (GFAP). Counting cells that co-labeled with CD15 and BLBP or CD15 and GFAP from total number of cells (BB+) revealed that the RGC cultures were 98% homogenous

(Figure 16). Poly-D-lysine coated six wells (10 cm2 growth area/well) were then plated with 2 million cells/ml and the collected cell lysates were used for total protein and RNA

121

Figure 16. (A) Timeline of experiment showing that enriched RGC cultures were studied for their homogeneity after 3 DIV in PM. (B) Double immunocytochemistry showing CD15

(green) expression on BLBP+ and GFAP+ RGCs.

122 isolation. After 3 DIV in proliferation medium (PM), the culture medium was change to differentiation medium (DM) devoid of growth factors and cells were allowed to differentiate for additional 7 DIV.

Pharmacological Treatments of Cell Cultures

RGCs cultures were treated for 48 h with NMDAR-specific antagonist D-APV

(Tocris Biosciences, Bristol, UK) dissolved in PM. The EC50 for D-APV was determined in Chapter 3 using cell survival and proliferation assays and was determined to be ~ 0.05

μM. These assays enabled us to decide the treatment concentrations to be used for further experiments, where cells were analyzed after 3 DIV in PM, and after 7 DIV in DM.

Cell Survival Assay

A live/dead assay (Molecular Probes, Eugene, OR, USA) was used to determine the effects of NMDAR blockade on cell survival, as described in detail in Chapter 3.

Briefly, calcein-AM penetrates the living cells, and upon cleavage by intracellular esterases calcein fluoresces green (emission at 515 nm). In contrast, EthD-III intercalates with the exposed DNA of dead cells emitting red light at 620 nm. Since both Calcein and

EthD-III can be excited at 490 nm, a simultaneous monitoring of viable and dead cells is possible using a fluorescence microscope.

123

Proliferation Assay

Comparing the percent of proliferating cells [(Ki67+/BB+)*100] between control and

D-APV treated cultures revealed the effect of NMDAR blockade on cell proliferation, as described in Chapter 3.

Immunocytochemistry (ICC)

Control and D-APV treated cells fixed in 4% paraformaldehyde were washed in

PBS, blocked (blocking buffer: 10% BSA< 10% NGS, 0.05% Triton X-100 in PBS) for 1 h at RT, and incubated with primary antibodies (diluted in blocking solution; Table 5) at 4oC overnight. Cells were then washed, incubated with fluorophore-conjugated secondary antibodies for 2 h at RT, stained for nuclei using bis-benzimide (BB) for 1 min at RT, and coverslipped using the anti-fade reagent Fluoromount-G (Southern Biotech, Birmingham,

AL) to preserve fluorescence.

Image analysis

Immunolabeled samples were visualized using an Axioscope microscope (Zeiss,

Germany) together with Axiovision software and photographed using a digital camera.

Imaging analysis criteria were strictly followed as described in Chapter 3.

124 Western Blot

Cell lysates were collected from control and D-APV treated cultures following the detailed protocol described in Chapter 3. Protein concentration was determined using the

BCA colorimetric assay (Thermo Scientific). Samples were run, and transferred as described in Chapter 3. The blot was blocked with 5% milk in TBS-T, incubated with primary antibodies diluted in blocking buffer (Table 5) at 4oC overnight, washed with 1X

TBS-T (10% Tween, PBS, 0.1% TritonX-100, distilled water), incubated with HRP- conjugated secondary antibodies (Millipore) for 2 hours at RT, washed again, and then incubated with SuperSignal West Dura Extended Duration Substrate (Thermo Scientific).

The blots were imaged on ChemiDoc MP (Bio-Rad) digital imaging system, and densitometric analysis was performed as described in Chapter 3.

Real-time polymerase chain reaction (RT-PCR) and quantitative PCR (qPCR)

RNA isolation and cDNA synthesis were performed on cell lysates of control and

D-APV treated cultures using the protocol described in Chapter 3. RNA and cDNA concentrations were determined using the NanoDrop technology (260/280 ratios obtained were between 1.93 and 2.0). cDNA was synthesized by reverse transcriptase-PCR (RT-

PCR) using the First Strand Synthesis SuperScript III kit (Invitrogen). The SYBR Green

(Applied Biosystems, Cheshire, UK) protocol was used to analyze the expression levels

125

of many gene transcripts (Table 6) by performing quantitative PCR (qPCR) using the

CFX96 Connect™ thermocycler (Bio-Rad). The qPCR protocol and data analysis are described in detail in Chapter 3.

Statistics

Bonferroni’s post-hoc test was used to evaluate statistical significance, defined as a p value <0.05.

Results

NR1 is expressed in RGC cultures

We examined the expression of the NMDAR subunit NR1 in our enriched dorsal

RGC cultures (see Methods; Figure 16). Since D-APV acts on NMDARs, it was important to determine if the enriched progenitor population expressed NMDARs, and to confirm our result on NMDAR expression in the human fetal brain cryosections (Chapter 2).

126 Figure 17. NR1 subunit expression at mid-gestation in vitro. (A) Timeline showing that

NR1 expression was analyzed on progenitors after 3 DIV in PM and on mature cell types

127

Furthermore, NR1 is the obligatory subunit of NMDARs (Cull-Candy et al., 2001), and it is known that NMDARs do not assemble and function without the NR1 subunit (Standley et al., 2000). Therefore, we examined the expression of the NR1 subunit in the enriched

RGC cultures before we treated them with D-APV. We found that cultured human RGCs, after 3 DIV of proliferation and 7 DIV of differentiation (Figure 17A), indeed express the

NR1 subunit gene, Grin1 (Figure 17B) and protein (Figure 17C) in all fetal brains studied

(n=4; 16-19 gw). Thus, we conclude that at mid-gestation, the NR1 subunit is expressed in human cortical progenitor cells in vitroafter 7 DIV in DM; n =4. (B) qPCR and (C)

Western blot showing NR1 gene and protein expression, respectively, mean+SEM.

NMDAR blockade induces cell death and interferes with cell proliferation

In order to determine the concentrations of D-APV that can be used in our in vitro system for future studies, we measured responses such as cell death and proliferation in our D-APV treated RGC cultures. The enriched RGC cultures were treated with eight different concentrations of D-APV for a period of 48 h (Figure 18A). The effect of D-APV on RGC proliferation and cell survival was measured, and these responses were plotted against the eight different concentrations (0 μM to 100 μM) of D-APV to obtain the concentration-response curves. These plots helped identify the effective concentration at which 50% of the cell population was affected (EC50), and thereby pinpoint the minimum inhibitory concentration (MIC) for D-APV in human RGC cultures. We observed that the concentration 0.05 μM effectively induced 50% cell death and concentration 0.01 μM

128 effectively inhibited 50% of cell proliferation (Figure 18B,C), we used the following treatment concentrations for further experiments: 0.001 μM, 0.005 μM and 0.01 μM of D-

APV for 48 h. The cell survival and proliferation assays also indicated that blocking

NMDARs negatively influences processes of cell survival and proliferation. This data suggests that NMDARs play a significant role in basic cellular processes in human RGC cultures at mid-gestation.

RGC specification is altered upon blocking NMDARs

In order to examine the role of NMDARs in cortical progenitor specification, we allowed the D-APV treated RGC cultures to proliferate for 3 DIV in PM, following which we analyzed the expression of progenitor genes and proteins. RT-PCR revealed that after

D-APV treatment, expression of progenitor specific genes such as Nestin expressed in all neural progenitors, Tbr2 expressed in intermediate progenitors, and Nkx2.1 expressed in interneuron progenitors, all decreased in a concentration-dependent manner, while expression of the astroglial gene, Gfap increased, notably with the highest D-APV concentration of 0.01 μM (p < 0.05; Figure 19A). Protein expression, examined in whole cell lysates using Western blotting, revealed that the 48 h D-APV treatment significantly reduced expression levels of a protein specific for the radial glia cortical progenitors. The

Western blots showed that the two highest concentrations of D-APV – 0.005 μM and 0.01

μM – led to a decrease in expression of the RGC specific protein BLBP, while the astroglial protein GFAP showed an increase in expression (Figure 19B). This was

129

Figure 18. Concentration-response curve for in vitro D-APV treatment. (A) Timeline of the experiment. (B) The live/dead assay: live (green) and dead cells (red) for control and drug treatments. (C) Ki67+ proliferating cells (red); nuclear stain BB (blue); n =4; p < 0.05 between DMSO and each treatment. Error bars represent mean+SEM; DMSO-Dimethyl sulfoxide, D-APV- D-amino phosphonovalerate.

130 evidenced in D-APV treated RGC cultures across all four ages tested (16-19 gw). These observations at the protein levels were in accordance with those observed at the gene expression levels, and the effects of D-APV on progenitor gene and protein expression were found to be concentration-dependent.

Looking at the effects of D-APV on the cell types using immunocytochemistry

(Figure 20A), we found that the percentage of Tbr2+ intermediate progenitors, and

Nkx2.1+ interneuron progenitors from total number of cells in the culture were significantly reduced with the two highest concentrations (0.005 μM and 0.01 μM), while all three concentrations of D-APV significantly decreased the percentage of Pax6+ RGCs (p<0.05).

These results were in line with those observed from the qPCR and Western blotting experiments. Similar to the data on gene and protein expression, we found a significant increase in the GFAP+ astrocytic population in D-APV treated cultures (p < 0.05; Figure

20B).

These results indicate that specification of human cortical progenitors requires

NMDARs, and blocking these receptors with a specific antagonist D-APV alters the of progenitor specification by reducing the number of progenitor subtypes (Tbr2, Nkx2.1) and increasing the number of GFAP+ astroglial cells, way before they are programmed to do so. This shortens the time period of progenitor pool expansion, reducing the number of progenitors available to differentiate into neurons. Further, blocking NMDARs induced gliogenesis in cortical RGC cultures that usually occurs after completion of neurogenesis in vivo. This alteration in the progenitor specification process timeline is likely to alter the downstream process of neurogenesis and gliogenesis.

131

Figure 19. Blocking NMDAR affects cell fate determination in vitro. (A) D-APV treatment decreased progenitors but increased astroglia specific gene expression in a concentration-dependent manner, (B) Western blot from 17 gw D-APV treated cell lysates showed a decrease in progenitor, but increase in astroglia protein expression in a concentration-dependent manner.

132

Figure 20. Blocking NMDARs with D-APV affects progenitor cell populations in vitro. (A)

Representative images at 17 gw for immunolabeling with specific progenitor and astroglia markers (red), and nuclear stain: BB (blue). (B) The immunolabeling quantification showed a decrease in percentage of progenitor subtypes, but an increase in astroglia population (n=4; p < 0.05). Scale bar 15 μm.

133

Blocking NMDARs shifts differentiation of RGCs towards glia

Since D-APV negatively affected RGCs and altered their specification process, we hypothesized that the process of progenitor cells differentiating into cortical neurons is also affected. In order to test our hypothesis, we added differentiation medium (DM) to our progenitor cell cultures for 7 DIV and then assessed their differentiation into either neurons or astrocytes. Gene expression analysis using qPCR showed that D-APV decreased expression of neuronal genes Neurogenin 1/2, Tbr1, and Gad65 in a concentration-dependent manner, but increased expression of astrocytic gene Gfap (p <

0.05; Figure 21A). This finding was further supported by a decrease in the neuronal protein βIII tubulin, but an increase in the astrocytic protein GFAP after D-APV treatment

(Figure 21B). To analyze the effect of D-APV treatment on specific cell-types, we performed immunocytochemistry using antibodies specific to neuronal proteins (Figure

22A). We observed a significant concentration-dependent decrease in the number of cells labeled with neuronal markers (β-III-tubulin, Tbr1, GABA). Moreover, the D-APV treatment had a significantly greater effect on GABAergic interneurons depleting half their population, compared to the Tbr1+ glutamatergic neuronal population that decreased by

15%. This bias suggests that blocking NMDARs during neurogenesis hampers the differentiation of cortical progenitor cells into GABAergic interneurons while relatively sparing the glutamatergic neuronal subpopulation. Once again, we found an increase in the number of GFAP+ astrocytes, indicating a drive towards astrocytes formation Figure

22B).

134

Figure 21. Blocking NMDAR affects neuronal differentiation in vitro. (A) D-APV treatment decreased neuronal but increased astroglia specific gene expression in a concentration- dependent manner, (B) Western blot from 17 gw D-APV treated cell lysates showed a decrease in neuronal, but increase in astroglia protein expression in a concentration- dependent manner.

135

15 μm

Figure 22. Blocking NMDARs with D-APV affects progenitor populations in vitro. (A)

Representative images at 17 gw for immunolabeling with specific neuronal and astroglia markers (red), and nuclear stain: BB (blue). (B) The immunolabeling quantification showed a decrease in percentage of neuronal subtypes, but an increase in astroglia population (n=4; p < 0.05). Scale bar 15 μm.

136 Our results demonstrated that D-APV influenced the specification and differentiation of cortical RGC progenitors by depleting the number of progenitors available for neurogenesis. Furthermore, it caused an untimely increase in the astroglial population. This developmental shift in gliogenesis occurring before neurogenesis could be detrimental to cortical circuitry formation and function.

NMDAR blockade leads to an increased activation of astrocytes

It has been reported that NMDAR hypofunction triggers S100β expression activating cerebral astroglia in primary rat astrocyte cultures established from Wistar rats at P1-P2

(Tramontina et al., 2006; Nardin et al., 2009). Reactive astrocytes are known to generate an inflammatory response that involves secretion of pro-inflammatory cytokines

(Guillemin et al., 2001; Meyer et al., 2011). To test this possibility in our cultures, we first immunolabeled D-APV treated RGC cultures with S100β, a cytoplasmic marker for reactive astrocytes (Figure 23).

The number of S100β+ cells was quantified after the 48 h of D-APV treatment to examine if the activation of astrocytes occurs immediately after the treatment. We found that 0.01 µM D-APV triggered the activation of astrocytes, as evidenced by the increased number of S100β+ cells in the immunocytochemistry (Figure 23). Such an increase in the reactive astrocyte population during development could result in a neuro-immunological response.

137

Figure 23. Blocking NMDARs activates astrocytes. Immunocytochemistry for S100β, a marker for reactive astrocytes, was performed on D-APV treated RGC cultures. The immunostaining reveals an increase in the number of S100β+ cells in cultures treated with the highest concentration of D-APV (0.01 µM; bottom) as compared to control (top).

138 Discussion

A significant feature of this study includes the exploration of NMDAR-specific blockade on human cortical development in cell cultures at midgestation. Major findings from this study demonstrate that D-APV, a NMDAR-specific antagonist, affects human cortical progenitors on several developmental levels. First, after D-APV treatment, the survival and proliferation of RGCs decreased. Second, further specification of RGCs into intermediate progenitors is impaired. Third, significant shifts occur in the specification and differentiation of human neural progenitor cells after blocking NMDARs. Fourth, D-APV treatment effectively gives rise to an increased number of astrocytes, as evidenced by the increase in number of GFAP+ cells. Upon further analysis, it was revealed that these astrocytes are activated as demonstrated by an increase in S100β expression, a cytoplasmic marker abundantly expressed in reactive astrocytes. In summation, these results indicate that blocking NMDARs during cortical development at midgestation, a time point of active neurogenesis and synaptogenesis in the human cerebral cortex, can change the cellular makeup, and possibly induce an immunological response, all building up towards impairing cortical development.

D-APV reduces the progenitor pool and disrupts neurogenesis in vitro

D-APV is a non-competitive antagonist of NMDARs, and is responsible for a broad spectrum of effects, including the regulation of NMDAR-dependent excitability and the

139

initiation of astrocyte-dependent neuro-immunological response (Davies et al., 1981,

1982; Nargi-Aizenman and Griffin, 2001). In this study, we showed that blocking NMDARs with D-APV induces cell death of human cortical progenitors (RGCs, Tbr2, Nkx2.1). Our results are in agreement with studies in rodents (Ciani et al., 1997), and in vitro studies on human neural precursor cells (Suzuki et al., 2006).

NMDARs are important for many events during embryonic development in rodents and humans (Manent et al., 2005, Suzuki et al., 2006, Toriumi et al., 2012). In vivo blockade of NMDARs induces apoptosis during rat cortical development ultimately leading death of the animal (Ikonomidou et al., 1999). In our in vitro study, we observed that antagonizing NMDARs with D-APV increases cell death, and decreases proliferation of human cortical progenitors, showing the importance of NMDARs for both survival and proliferation of RGCs during the second trimester of gestation.

NMDARs are important for cell fate determination

It is important to understand if NMDARs have differential roles in determining the cell fate of RGCs to generate intermediate progenitors and two subtypes of cortical neurons, the excitatory glutamatergic neurons (Tbr1+ cells), and GABAergic interneurons.

To study this question, we used various transcription factors to label distinct progenitor populations in vitro, like in Chapter 3. In this Chapter, we have shown that a NMDAR- dependent decrease in Nkx2.1 and Tbr2 expression resulted in a decrease of GABAergic

140 interneurons which was more pronounced than the decrease of Tbr1+ glutamatergic neurons. These data suggest that a NMDAR-dependent alteration in the cortical progenitor pool disrupts neurogenesis and subsequently may affect the proportionate balance of cortical cell types and formation of the cortical circuitry. The NMDAR blockade induced an increase in astrocyte population, as well as an enhanced expression of S100β implying the beginning of a neuro-immunological response. Interestingly, astrocytic hypertrophy has been reported in the prefrontal cortex of patients with bipolar disorder

(Rajkowska et al., 2001), Alzheimer Disease (Nardin et al., 2009), and Sindbis virus brain infection (Nargi-Aizenman and Griffin, 2001) indicating that reactive astrocytes can be a major component of neuropsychiatric illness.

Consequences of NMDAR-blockade during human fetal neurodevelopment

NMDARs have important roles in the CNS, and data over the years have implied the role of NMDARs in numerous processes of brain development (reviewed in Paoletti et al., 2013). Specifically, exposure to NMDAR antagonists and channel blockers like ketamine, and PCP during fetal development have long-lasting consequences for subsequent brain and behavioral development and might lead to structural and functional brain abnormalities in adult life (Iaccarino et al., 2013).

The consequences of NMDAR blockade in human cortical development are not well recognized or understood, and therefore, our purpose in this study was to identify

141

and highlight the significance of these receptors in human cortical development. Our in vitro study shows that D-APV results in larger deficits in GABA+ interneurons compared to a Tbr1+ subpopulation of projection neurons at midgestation when upper cortical layers crucial for the formation of cortico-cortical connections and emergence of higher brain functions are formed. The preferential vulnerability of interneurons might be clinically relevant since hypofunction of NMDARs on cortical interneurons is well-reported and hypothesized to be the key element in explaining the pathophysiology of neurodevelopmental disorders including schizophrenia and autism spectrum disorder

(DeFelipe, 1999; Gleeson and Walsh, 2000; Baraban and Tallent, 2004; Lewis et al.,

2005). This is the basis of the glutamate hypothesis of schizophrenia (Belforte et al., 2010;

Nakazawa et al., 2012). Together, these changes can have a negative impact on cortical functions during adolescence, a stage when complex cognitive and emotion-based functions develop, and a time point at which schizophrenia symptoms often first manifest

(Uhlhaas, 2011).

142 References

Baraban SC, T. M. Interneuron Diversity series: Interneuronal neuropeptides-- endogenous regulators of neuronal excitability. Trends Neurosci. 27, 135–142 (2004).

Belforte, J. E. et al. Postnatal NMDA receptor ablation in corticolimbic interneurons confers schizophrenia-like phenotypes. Nat. Neurosci. 13, 76–83 (2010).

Ciani E, Rizzi S, Paulsen RE, Contestabile A. Chronic pre-explant blockade of the NMDA receptor affects survival of cerebellar granule cells explanted in vitro. Brain Res Dev Brain

Res. Mar 17;99(1):112-7 (1997).

Cotman CW, Iversen LL. Excitatory amino acids in the brain-focus on NMDA receptors.

Trends Neurosci. 10: 263- 265 (1987).

Croucher MJ, Collins JF, Meldrum BS. Anticonvulsant action of excitatory amino-acid antagonists. Science 216: 899-901 (1982).

Crunelli V, Forda S, Kelly JS. Blockade of amino acid induced depolarizations and inhibition of excitatory post-synaptic potentials in rat dentate gyrus. J. Physiol. (Lond.)

341: 627-640 (1983).

Davies J, Francis AA, Jones AW, Watkins JC. 2-Amino-5-phosphonovalerate (2APV), a potent and selective antagonist of amino acid-induced and synaptic excitation. Neurosci

Lett. Jan 1;21(1):77-81 (1981).

DeFelipe, J. Chandelier cells and epilepsy. Brain 122, 1807–1822 (1999).

Dingledine R. N-methyl aspartate activates voltage-dependent calcium conductance in rat hippocampal pyramidal cells. J. Physiol. (Lond.) 343: 385-405 (1983).

Dingledine R. NMDA receptors: What do they do? Trends Neurosci. 9: 47-49 (1986).

143

Foster AC, Fagg GE. Acidic amino-acid binding sites in mammalian neuronal membranes: Their characteristics and relationship to synaptic receptors. Brain Res. Rev.

7: 103-164 (1984).

Gleeson JG, W. C. Neuronal migration disorders: from genetic diseases to developmental mechanisms. Trends Neurosci. 23, 352–359 (2000).

Harris EW, Ganong AH, Cotman CW. Long-term potentiation in the hippocampus involves activation of N-methyl-Daspartate receptors. Brain Res. 323: 132-l 37 (1984).

Herron CE, Lester RA, Coan EJ, Collineridee RJ. Frequency-dependent involvement of

NMDA receptors ii the hippocampus: A novel synaptic mechanism. Nature 322: 265-268

(1986).

Iaccarino, H. F., Suckow, R. F., Xie, S. & Bucci, D. J. The effect of transient increases in kynurenic acid and quinolinic acid levels early in life on behavior in adulthood: Implications for schizophrenia. Schizophr. Res. 150, 392–397 (2013).

Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K. et al. Blockade of

NMDA Receptors and Apoptotic Neurodegeneration in the Developing Brain. Science

283:70–74 (1999).

Lewis DA, Hashimoto T, V. D. Cortical inhibitory neurons and schizophrenia. Nat. Rev.

Neurosci. 6, 312–324 (2005).

Manent JB, Demarque M, Jorquera I, Pellegrino C, Ben-Ari Y, Aniksztejn L. et al. A noncanonical release of GABA and glutamate modulates neuronal migration. J Neurosci

25:4755–4765 (2005).

Mayer MC, Westbrook GL, and Guthrie PB. Voltage dependent block by Mg2+ of NMDA

144 response in spinal cord neurones. Nature 309: 261-263 (1984).

Mayer MC, Westbrook GL. The physiology of excitatory amino acids in the vertebrate central nervous system. Prog. Neurobiol. 28: 197-276 (1987).

McLennan H. Receptors for the excitatory amino acids in the mammalian central nervous system. Prog. Neurobiol. 20: 251-271 (1984).

Meldrum BS. Possible therapeutic applications of antagonists of excitatory amino acid neurotransmitters. Clin. Sci. 68: 113-l 22 (1985).

Mo Z, Moore AR, Filipovic R, Ogawa Y, Kazuhiro I, Antic SD, Z. N. Human cortical neurons originate from radial glia and neuron-restricted progenitors. J. Neurosci. 27,

4132–4145 (2007).

Nakazawa K, Zsiros V, Jiang Z, Nakao K, Kolata S, Zhang S, Belforte JE. GABAergic interneuron origin of schizophrenia pathophysiology. 62:1574-1583 (2012).

Nardin P, Tortorelli L, Quincozes-Santos A, de Almeida LM, Leite MC, Thomazi AP,

Gottfried C, Wofchuk ST, Donato R, Gonçalves CA. S100B secretion in acute brain slices: modulation by extracellular levels of Ca(2+) and K (+). Neurochem ResSep;34(9):1603-

11. doi: 10.1007/s11064-009-9949-0. Epub 2009 Mar 15 (2009).

Nargi-Aizenman JL1, Griffin DE. Sindbis virus-induced neuronal death is both necrotic and apoptotic and is ameliorated by N-methyl-D-aspartate receptor antagonists. J Virol.

Aug;75(15):7114-21 (2001).

Nowak L, Bregestovski P, Ascher P, Herbet A, Prochiantz A. Magnesium gates glutamate-activated channels in mouse central neurones. Nature 307: 462-465 (1984).

145

Patel S, Chapman AG, Millan MH, Meldrum BS. Epilepsy and excitatory amino acid antagonists. In Excitatory Amino Acids in Health and Disease, D. Lodge, ed., pp. 353-

378, Wiley, Chichester, UK (1988).

Paoletti, P, Bellone C, Zhou Q. NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci 14:383–400 (2013).

Radonjić NV, Memi F, Ortega JA, Glidden N, Zhan H, Z. N. The Role of Sonic Hedgehog in the Specification of Human Cortical Progenitors In Vitro. Cereb. Cortex 26, 131–143

(2014).

Rajkowska G, Halaris A, Selemon LD. Biol Psychiatr 49: 741-752 (2001).

Simon RP, Swan JH, Griffiths T, Meldrum BS. N-methyl-D-aspartate receptor blockade prevents ischaemic brain damage. Science 226: 850-852 (1984).

Suzuki M, Nelson AD, Eickstaedt JB, Wallace K, Wright LS, and Svendsen CN (2006).

Thomson AM, West DC, Lodge D. A N-methyl-naspartate receptor-mediated synapse in rat cerebral cortex: A site of action of ketamine? Nature 3i3: 479-481 (1985).

Toriumi K, Mouri A, Narusawa S, Aoyama Y, Ikawa N, Lu L. et al. Prenatal NMDA

Receptor Antagonism Impaired Proliferation of Neuronal Progenitor, Leading to Fewer

Glutamatergic Neurons in the Prefrontal Cortex. Neuropharmacology 37:1387–1396

(2012).

Turski L, Schwarz M, Turski WA, Klockgether T, Sontag KH, Collins JH. Muscle-relaxant action of excitatorv amino acid antagonists. Neurosci. Lett. 53: 321-326 (1985).

Uhlhaas, P. J. The adolescent brain: Implications for the understanding, pathophysiology, and treatment of schizophrenia. Schizophr. Bull. 37, 480–483 (2011).

146 Watkins JC, Evans RH. Excitatory amino acid neurotransmitters. Annu. Rev. Pharmacol.

Toxicol. 21: 165-204 (1981).

Watkins JC, Olverman HO. Agonists and antagonists for excitatory amino acid receptors.

Trends Neurosci. 17: 265-272 (1987).

Zecevic N, Chen Y, F. R. Contributions of cortical subventricular zone to the development of the human cerebral cortex. J. Comp. Neurol. 491, 109–122 (2005).

147

Chapter 5

KYNA elicits an immune response in cultured human cortical cells

Note: To evaluate whether treatment with KYNA can lead to an immune response, we used mixed cell cultures, and all experimental approaches are as those described for enriched RGCs in Chapter 3.

Abstract

Kynurenic acid (KYNA), an NMDAR antagonist has been hypothesized to activate astrocytes and elicit an immune response. Data about this mechanism, which could play an important role in neurodevelopmental disorders, are not available for human. To evaluate the neuro-immunological role of KYNA, we treated human fetal cortical mixed cell cultures (16-19 gw) with different concentrations of KYNA. A cell survival and proliferation assay determined that the EC50 for KYNA is 0.05 μM in our in vitro system. Treatment with three concentrations of KYNA below the EC50 (0.001 μM, 0.005 μM, 0.01 μM) for 48 h showed a concentration dependent increase in the number of reactive astrocytes (S100β+ cells) with 40% of cells being S100β+ in the highest concentration (0.01 μM). Furthermore, a significant increase in the concentration of cytokine IL-6 in cell media supernatants was demonstrated after 24 and 48 h of KYNA treatment. Moreover, higher levels of a cell signaling molecule, phosphorylated STAT3 (pSTAT3) indicated activation of the Jak-STAT pathway. pSTAT3 induces transcription of astrocytic gene Gfap, and the observed increase in levels of pSTAT3 are indicative of increased gliogenesis. Taken together, these results are in line with previous studies in animals and suggest that elevated levels of KYNA can trigger an immune response and activate downstream transcription machinery within 48 h in human fetal cortical mixed cell cultures. 148 Introduction

Glutamate is firmly established as the major excitatory neurotransmitter in the mammalian brain and is actively involved in most aspects of neurophysiology (Curtis and

Johnson, 1974; Mitchell et al., 1994; Watkins, 2000). Moreover, glutamatergic impairments are associated with a wide variety of dysfunctional states, and both hypo- and hyper-function of glutamate have been plausibly linked to the pathophysiology of neurological and psychiatric diseases (Schoepp and Conn, 1993; Belforte et al., 2010;

Plitman et al., 2014). Kynurenines are metabolites of the kynurenine pathway, the major catabolic route of the essential amino acid tryptophan, that influence glutamatergic activity in several distinct ways (Moroni et al., 1988; Pocivavsek et al., 2011; Liu et al., 2014).

This includes direct effects of kynurenines on ionotropic and metabotropic glutamate receptors or vesicular glutamate transport (Setiadi et al., 2015), and indirect effects like upregulating expression of non-α7 nicotinic acetylcholine receptors (nAChR), which are initiated by actions at various other recognition sites like the α7nAChR (Hilmas et al.,

2001). In addition, some KP metabolites affect glutamatergic functions by generating or scavenging highly reactive free radicals (Giles et al., 2003; Robert et al., 2014). Our study summarizes and discusses the implications of elevated KYNA levels in human cortical development through the use of human primary mixed cortical cultures.

Over the past years, there has been increasing evidence that inflammations/infections might be the causal factors, underlying the pathophysiology of

149

schizophrenia and bipolar disorder. Indeed, epidemiological studies suggest that early- life infections are associated with the development of neuropsychiatric disorders later in life (review in Selemon and Zecevic, 2015). In particular, earl-life exposure to herpes simplex virus type 2, cytomegalovirus, rubella and influenza viruses, as well as to

Toxoplasma gondii, is associated with an increased risk of developing schizophrenia

(Karlsson, 2003; Yolken and Torrey, 2008). Furthermore, epidemiological studies show that children whose mothers were seropositive for a number of different pathogens during pregnancy have increased risk of developing schizophrenia or psychosis (Canetta and

Brown, 2012). Several epidemiological studies have also investigated cytokines, small communicative proteins of the immune system. A recent meta-analysis study found significant increase in serum levels of IL-1β, sIL-2R, IL-6 and TNF-α in first episode of psychosis, suggesting that the increase in these cytokines is unrelated to anti-psychotic treatment (Upthegrove et al., 2014). With regard to central levels of cytokines, the increased cerebrospinal fluid levels of IL-6 (Garver et al., 2003; Sasayama et al., 2013;

Schwieler et al., 2015) and IL-1β (Söderlund et al., 2009) were demonstrated in schizophrenia. Cytokines, beside their classical immune actions, play multiple non- inflammatory and non-immune roles in development, plasticity and function (Estes and

McAllister, 2014) and interestingly, both IL-1β and IL-6 are able to induce the kynurenine pathway (Urata et al., 2014; Sellgren et al., 2015; Schwieler et al., 2015). The neuro- inflammatory pathology in schizophrenia involves abnormal astrocyte functions as seen by the increased levels of S100β in serum and/or cerebrospinal fluid. S100β is a protein involved in a variety of neuronal and glial signaling mechanisms, which is primarily

150 produced by activated astrocytes, so elevated central levels of this protein likely reflect astrocyte over-activation (Rothermundt et al., 2009). An increase in cytosolic calcium concentration is necessary for IL-6 secretion from reactive astrocytes (Codeluppi et al.,

2014). Furthermore, the Janus kinase/signal transducer and activator of transcription 3

(JAK/STAT3) pathway is associated with the production of reactive astrocytes (Haim et al., 2015; Lee et al., 2016) downstream of IL-6 signaling (Campbell et al., 2014). All these compelling theories, and observations are however, obtained from studies in rodents. We, therefore, set forth to examine the effects of elevated levels of KYNA, and the KYNA- mediated inflammatory response and signaling pathways in human cortical mixed cell cultures.

Primary brain and neuron cultures are used for neurobiological, neurodevelopmental, pharmacological and toxicological studies of various neuropsychiatric disorders. To date, the majority of the neuron cultures are prepared from embryonic (Bailey et al., 2011; Vicario-Abejon, 2004) or adult rodent brains (Brewer and

Torricelli, 2007; Ray et al., 2009). However, human neurodevelopmental disorders such as schizophrenia and autism need to be studied in human tissue because these diseases are known to occur only in humans, and it is well-reported that the cerebral cortex exhibits species-specific differences (refer to Chapter 3). Our laboratory has previously developed and characterized primary neural cultures derived from the human fetal cerebral cortex

(see Methods). In this study we established primary human mixed cell cultures from fetal brains between 16 gw and 19 gw (the entire gestational period in humans is 40 weeks

151

long). Development of the human cerebral cortex begins in the first trimester (7-8 gw) and continues through the second trimester and beyond (Bystron et al., 2008, Malik et al.,

2013). Since we used brain tissue from fetuses during the second trimester of gestation, the majority of the cells are neural progenitors and the neurons are still young and immature. At the initial phase of the cultures (3 DIV), the cells co-express markers of both neuronal and glial origin, consistent with their immature nature. After 10 DIV, mature neurons and glia are also present (Howard et al., 2006). This in vitro system of human cortical mixed cells closely represents the in vivo scenario by containing all the cell types present in the fetal brain, and is therefore, better than the enriched radial glia cultures used in Chapter 3 and 4 for evaluating the effects of KYNA on various cell types, and to identify the mechanism through which KYNA exerts these effects in human cortical development.

Materials and Methods

Human Fetal Brain Tissue

The same tissue characterized in Chapter 3 will be used in experiments described in this

Chapter.

152 Newcastle upon Tyne, England) and the Tissue Repository of The Albert Einstein College of Medicine (Bronx, NY, USA). Handling of the human material was done with special care following all necessary requirements and regulations set by the Institutional Ethics

Committees. The age of the tissue was determined by the following criteria: crown-rump length, weeks after ovulation, and anatomical landmarks. The tissue was transported on ice in Hank’s Balanced Salt Solution (HBSS; Life Technologies, Grand Island, NY, USA) from the aforementioned brain repositories to the lab. A small piece (1 cm2) of the dorsal telencephalic region was used to generate dissociated cell cultures (Zecevic et al. 2005;

Radonjic et al., 2014).

Dissociated Mixed Cell Culture and Enrichment of RGCs

Cell cultures were established exactly in the same way as stated in Chapter 3.

A previously published protocol (Mo et al., 2007) was used to establish dissociated mixed cell cultures. As briefly described here, the isolated tissue was dissociated mechanically and enzymatically at 37°C for 30 min with 0.025% trypsin (Gibco, Beverly,

MA, USA), followed by addition of DNase (Sigma-Aldrich, St Louis, MO, USA; 2 mg/mL), washing with HBSS (Life Technologies) and suspension in proliferation medium (PM;

Figure 34A). The PM consisted of DMEM/F12 (Life Technologies) supplemented with 10 ng/mL of basic fibroblast growth factor (bFGF, Peprotech, Rocky Hill, NJ, USA), 10 ng/mL of epidermal growth factor (EGF, Millipore, Billerica, MA, USA), and B27 (Life

Technologies). The dissociated mixed cells were plated on T-75 flasks coated with poly-

153

D-lysine (Sigma-Aldrich), and were allowed to proliferate in PM containing Rock inhibitor

(1 μM) till 80% confluency was reached (five days after plating). The Rock inhibitor aids in the adherence and spread of cellular processes in 2D cultures. Cultures are then trypsinized (0.05% Trypsin-EDTA; Life technologies, Billerica, MA, USA), concentrated, and the cell density is calculated using a hemocytometer. Cells were plated on poly-D- lysine coated coverslips (12 mm) at a density of 250,000 cells/ml and on poly-D-lysine coated six wells (10 cm2 growth area/well) at a density of 2 million cells/ml. After 3 DIV in PM, the culture medium was changed to differentiation medium (DM) devoid of growth factors and cells were allowed to differentiate for 7 DIV. Cells on coverslips were used for characterization of the cultures using immunocytochemistry, and for studying the effects of KYNA on cell-fate specification. Cell lysates were collected for total protein and RNA isolation to study the effect of KYNA on neuronal differentiation and astrogliogenesis.

KYNA treated cells were also used for determining secreted levels of IL-6 via sandwich

ELISA, and to examine levels of phosphorylated STAT (pSTAT) by SDS-PAGE.

Pharmacological Treatments of Cell Cultures

Mixed cell cultures were treated with eight different concentrations (0.001 μM to

100.0 μM) of KYNA for 48 h, and concentration-response curves were first plotted to identify the minimum inhibitory concentration (MIC) of KYNA in this in vitro system.

Responses measured were cell survival and cell proliferation. KYNA was dissolved in

DMSO, and therefore, two sets of controls were maintained: 1) RGCs grown only in PM,

154 2) RGCs grown in PM containing DMSO. In all analyzed experiments there was no difference between control PM and PM+DMSO, hence PM+DMSO results were represented in graphs as the control. The effective concentration at which 50% of the cell population was affected (EC50) was determined in both cell survival, and proliferation assays to decide the treatment concentrations to be used for further experiments, where cells were analyzed after 3 DIV in PM, and after 7 DIV in DM. We previously established that the obligatory NMDAR subunit NR1 is expressed from 10 gw – 24 gw in the human fetal telencephalon, and is present in progenitor, neuronal and astroglial populations in vitro.

Cell Survival Assay

A live/dead assay (Molecular Probes, Eugene, OR, USA) was performed after 48 h of KYNA treatment to assess its effect on cell viability. The cell-permeant molecule calcein acetoxymethyl detects live cells that fluoresce green. Dead cells take up the DNA- binding dye ethidium homodimer and fluoresce red.

Proliferation Assay

At the end of the 48 h KYNA treatment period, cells were fixed and immunostained with anti-Ki67 antibody. Ki67 is a mitotic marker indicative of cell proliferation. The percentage of Ki67+ cells was determined from the total number of cells marked with the nuclear stain bisbenzimide (BB).

155

Immunocytochemistry (ICC)

Cells growing in vitro on coverslips were fixed with 4% paraformaldehyde in PBS, washed with PBS (phosphate buffer saline), blocked (0.2% bovine serum albumin (BSA),

0.01 % Triton X-100, PBS) for 1 h at RT, and incubated with primary antibodies diluted in blocking buffer (Table 5, Chapter 3) at 4oC overnight. The following day, secondary antibodies conjugated to Alexa Fluor 488, and 555 (Invitrogen) were applied for 2 h at

RT, followed by the nuclear stain BB for 1 min. All immunostained coverslips were mounted using the anti-fade reagent Fluoromount-G (Southern Biotech, Birmingham, AL,

USA) to preserve the fluorescence.

Image analysis

The method described in Chapter 3 was used. In short, immunolabeled samples were visualized using an Axioscope microscope (Zeiss, Germany) together with

Axiovision software and photographed using a digital camera. The images were assembled in Adobe Photoshop (v. 7.0), with consistent quality adjustments for contrast, brightness and color balance. Immunolabeled cells from 10 predesignated adjacent optical fields and from four different human samples per experiment were analyzed using

Adobe Photoshop (v. 7.0).

156 Western Blot (WB)

Cells were homogenized in lysis buffer (50 mM Tris–HCl pH 7.4, 150 mM NaCl,

1% NP-40, 1 mM phenylmethylsulfonyl fluoride, Sigma Aldrich, protease and phosphatase inhibitors (PMSF (1 mM), NaF (5 mM), Na-orthovanadate (1 mM), PIC (1 mM; Thermo Scientific)) on ice for 30 min, centrifuged at 14,000 × g for 15 min at 4oC, and the supernatants were collected. Protein concentration was determined using the

BCA colorimetric assay (Thermo Scientific). Proteins were separated on a 4-15% gradient polyacrylamide gel (Bio-Rad, Portland. ME, USA) at 110 volts for 75 min, and were transferred onto the polyvinylidene fluoride (PVDF) membrane at 100 volts for 60 min.

After blocking with 5% milk in TBS-T, the membrane (blot) was incubated with primary antibodies diluted in blocking buffer (Table 5, Chapter 3) at 4oC overnight. The blot was washed with 1X TBS-T (10% Tween, PBS, 0.1% TritonX-100, distilled water), and incubated with HRP- conjugated secondary antibodies (Millipore) for 2 hours at RT. After three washes, blots were incubated with SuperSignal West Dura Extended Duration

Substrate (Thermo Scientific), and were imaged on ChemiDoc MP (Bio-Rad) digital imaging system, taking images that were not saturated. Protein levels were quantified by densitometric analysis and normalized to GAPDH levels, determined using an anti-

GAPDH antibody (1:5000).

Sandwich Enzyme Linked Immunosorbent Assay (Sandwich ELISA)

157

The eBioscience High Sensitivity human anti-IL6 ELISA (San Diego, CA) kit was used for the sandwich ELISA experiments on dissociated mixed cell cultures prepared from four fetal brains (16-19gw). The assay was performed according to manufacturer’s instructions, using samples that were diluted 1:2. We used Origin to plot the standard curve and analyze concentrations of IL-6. Graphs were plotted in Excel.

Statistical methods

Bonferroni’s post-hoc test was used to evaluate statistical significance, defined as a p value <0.05.

158 Figure 24. Human cortical mixed cell cultures contain GFAP+ astroglia, BLBP+ RGCS,

βIII tubulin+ neurons, and GABA+ interneurons, cell types that represent major cellular populations in the developing human cerebral cortex at mid-gestation. Representative images are taken from 17 gw mixed cell cultures growing for 5 DIV in PM.

159

Results

Human fetal mixed cells consist of progenitors, neurons and astroglia

Using the dissociated mixed cell cultures (see Methods), we explored whether the isolated cells express the major cell-type specific protein markers. Indeed, human fetal cortical cultures from all fetal brains studied (n=4, 16-19 gw) after 5 DIV in PM express

BLBP, a marker for RGCs, GFAP, a marker for astroglia, βIII tubulin, a marker for neurons, and GABA, a marker for the interneurons (Figure 24). Further, to determine if these cell types express the NR1 subunit of the NMDAR after 3 DIV in PM, we used double-immunolabeling with anti-NR1 antibody and found that RGCs, labeled with BLBP, intermediate progenitors labeled with Tbr2, a subpopulation of interneuron progenitors labeled with Nkx2.1, all express the NR1 subunit. After 7 DIV of differentiation

(differentiation always involves incubating cells in differentiation medium), the newly generated neurons labeled with βIII tubulin, or with Tbr1 and GABA, markers of glutamatergic and cortical interneurons, respectively, expressed NR1 (Figure 25). In humans, GFAP is a marker of both RGCs and differentiated astrocytes, and both cell types express NR1 subunit. Thus, based on these co-labeling experiments, we conclude that at midgestation all the major cortical cell types express the NR1 subunit of NMDARs.

160 Figure 25. Double immunolabeling of mixed cell cultures after 3 DIV in PM indicate that

GFAP+ astroglia and BLBP+ RGCs (red) express the obligatory NR1 subunit (green).

Furthermore, NR1 expression is retained after 7 DIV of differentiation and is expressed on βIII tubulin+ neurons and GABA+ interneurons (red). Co-labeled cells are yellow.

Representative images are taken from 17 gw mixed cell cultures.

161

Figure 26. Representative images of the live/dead assay: live (green) and dead cells (red) for control (DMSO) and drug treatment (left). Graph shows that the cell death increases in concentration- dependent manner after KYNA treatment (right). n = 4; p<0.05; Error bars represent mean+SEM.

162

Figure 27. Representative images of the proliferation assay: proliferating cells (red); nuclear stain BB (blue) for control and drug treatments (left). Graph on the right shows that KYNA induced a concentration-dependent decrease in cell proliferation as compared to the control (DMSO). n = 4; p<0.05; Error bars represent mean+SEM.

163

KYNA was equally toxic for human mixed cells cultures as for RGC cultures

Next, we examined the effects of KYNA on survival and proliferation of human mixed cells, in a similar way that was done for enriched RGCs (Chapter 3). Previously, in enriched RGC cultures, it was determined, using a cell survival assay that the EC50 for

KYNA was around 0.05 μM. Three concentrations below the EC50, 0.001 μM, 0.005 μM and 0.01 μM were chosen for experiments in mixed cell cultures. Moreover, the effects of

KYNA on cell proliferation and cell death were due to its higher affinity for NMDARs as compared to nAChRs, as evidenced by the shift in the dose-response curve to the left for the NMDAR-specific antagonist D-APV when compared to the response curves for AChR- specific antagonist TBC, in the enriched RGC cultures (Figure 12). Response curves for mixed cell cultures treated with KYNA were first plotted 48 h after the treatment with three concentrations of KYNA mentioned above. The effects of KYNA on cortical cell survival and proliferation were measured at the end of 48 h. We observed that the highest concentration of KYNA, 0.01 μM, induced a 30% cell death compared to control (Figure

26), similar to the effect of KYNA treatment in RGC cultures. Moreover, this effect on cell death was concentration-dependent. With regards to cell proliferation, KYNA decreased cell proliferation in a concentration-dependent manner, much as it was observed with enriched RGC cultures. In mixed cell cultures, only 50% of cells were proliferating with treatment with the highest concentration of KYNA, 0.01 μM (Figure 27).

164 KYNA treatment increased the number of reactive astrocytes

It has been previously reported that mixed cell cultures established from human fetal cortices contain a much higher number of GFAP+ astroglia than do the enriched RGC cultures (Mo et al., 2007). Keeping this in mind, we hypothesized that treatment with

KYNA in mixed cell cultures should show a much higher increase in the number of reactive astrocytes than those observed in enriched RGC cultures. It is also fairly well established, through rodent studies, that KYNA triggers activation of astrocytes and generates an inflammatory response that involves secretion of pro-inflammatory cytokines (Guillemin et al., 2001; Meyer et al., 2011).

Quantifying the number of S100β+ cells from the total number of cells in mixed cell cultures after the 48 h KYNA treatment, revealed that all three concentration of KYNA induced a significant increase in the number of S100β+ cells compared to control.

Moreover, the highest concentration of KYNA, 0.01 μM, triggered an approximate 10 times higher increase in the number of S100β+ cells, reaching almost 50% in 0.01 μM

KYNA and lingering at 0.5% in control conditions (p<0.05; Figure 28).

KYNA elicits an inflammatory response

Reactive astrocytes are a well-known source of pro-inflammatory cytokines, one of which is Il-6, a primary cytokine released in inflammatory responses (Guillemin et al;

165

S100β/BB

Figure 28. Immunocytochemistry for S100β (green), a marker for reactive astrocytes, in

KYNA treated mixed cell cultures (left). Graph to the right shows that the number of S100+ cells in the control (DMSO) is very small (0.2%) and increases in cultures treated with the highest concentration of KYNA (0.01 µM) to almost 40% of all cells.

166

Figure 29. Sandwich ELISA for human IL-6 in cell media supernatant from KYNA treated mix cells cultures at 24 h and 48 h. The two highest concentrations of KYNA 0.005 μM and 0.01 μM significantly increased the levels of secreted IL-6 compared to control

(p<0.05; n=4). Error bars represent mean+SEM.

167

2001; Islam et al., 2009). Using sandwich ELISA, we examined the concentration of IL-6 in the cell culture supernatant media obtained from KYNA treated mixed cell cultures at two time points, 24 h and 48 h, immediately after the KYNA treatment. IL-6 levels increase above normal within the first 24 h of an immune response (Garver et al., 2003). Therefore, we chose to measure IL-6 levels after both these treatment time points (24 and 48 h). We observed a significant concentration-dependent increase in the levels of IL-6 in KYNA treated mixed cell cultures, at both time points. (Figure 29). After 24 h, the amount of IL-

6 secreted in the cell media supernatant increased, but significance was achieved only for the two highest concentrations 0.005 μM, and 0.01 μM of KYNA (p < 0.05), as compared to DMSO (control). After 48 h, the concentration of IL-6 showed significant increases in mixed cells treated with all three concentrations, 0.001 μM, 0.005 μM and

0.01 μM, of KYNA compared to control (p < 0.05). Previous studies with human subjects have reported that the levels of IL-6 in the cerebrospinal fluid in normal patients is ~1 pg/ml, while their age and sex matched schizophrenic counterparts show levels closer to

4 pg/ml of IL-6 (Garver et al., 2003; Schwieler et al., 2015). Taking these small levels of

IL-6 into consideration, our in vitro IL-6 levels measured in KYNA treated mixed cell cultures demonstrate a potentially significant increase in this pro-inflammatory primary cytokine (Figure 29), after 24 h and 48 h of KYNA treatment.

Jak-STAT cell signaling pathway is activated by KYNA

We observed that KYNA induced the secretion of the pro-inflammatory cytokine

168

Figure 30. Western blotting for pSTAT3 on cell lysates collected from KYNA treated mixed cell cultures (left). Graph to the right shows that the expression levels of pSTAT3 increased compared to control (DMSO); n=4; p<0.05; Error bars represent mean+SEM.

169

IL-6 in human fetal mixed cell cultures, in agreement to similar observations made in human fetal astrocytic cultures (Guillemin et al., 2001). Binding of IL-6 to its receptor IL-

6R triggers the auto-phosphorylation of the downstream Jak, which then phosphorylates

STAT. Two phosphorylated STAT molecules come together to dimerize and enter the nucleus where they promote the transcription of specific genes. One of the STATs called

STAT3 is known to induce transcription of the astrocytic gene Gfap. Based on the previous literature, and our finding of elevated IL-6 levels in KYNA treated cultures, we determined the levels of phosphorylated STAT (pSTAT) (normalized against GAPDH), the active form that brings about gene transcription, using Western blotting. We observed that expression levels of pSTAT increased in mixed cells treated with the highest concentration (0.01M) of KYNA, as compared to control (Figure 30). This result suggests that with increasing concentrations of KYNA, the production of IL-6 increases, which activates the Jak-STAT cell signaling pathway known to initiate gene expression of

Gfap. Notably, even though the concentrations of IL-6 obtained from all three KYNA concentrations is nearly the same, the amount of pSTAT is significantly higher only in the highest concentration of KYNA. This could be due to the fact that reactive astrocytes can secrete other pro-inflammatory cytokines like IL-1β, and may be the highest concentration of KYNA elicits a huge secretion of both IL-6 and IL-1β, enough for it to significantly trigger phosphorylation of STAT3.

170 Discussion

In the present study, we explored the effects of KYNA on mixed cortical cell cultures derived from the human fetal telencephalic tissue at mid-gestation from 16 gw to

19 gw (n=4) Species-specific differences in cortical development between rodents and humans calls for studying important biological events in tissue or cell cultures established from human brains. Many continuous cell lines, such as human neuroblastoma or rat pheochromocytoma (PC12), are used as surrogate models for mature neurons by stimulating neuronal-type differentiation of the culture. However, these cancer cells may behave differently than CNS neurons. Recently, major emphasis has been given to differentiate human neurons from induced pluripotent stem cells (iPSC). This method is very promising, but the iPSCs are artificially transduced with several transcription factors, that can affect the results. Another approach is to prepare neuron cultures from the fetus of nonhuman primates (Geiger, 1958; Negishi et al., 2003).

Three major findings from this study demonstrate that KYNA significantly induces a neuro-immunological response. First, after KYNA treatment, the number of S100β+ reactive astrocytes increases. Second, treatment with KYNA increased levels of IL-6 secreted from mixed cell cultures, successfully initiating an inflammatory response. Third,

KYNA exposure triggered activation of cytokine responsive Jak-STAT signaling pathway that in turn could enhance astrogliogenesis. In sum, these results indicate that altered

171

levels of KYNA during the second trimester of gestation in humans, as can result from maternal infections and immune activation, may elicit inflammatory responses that can have profound effects on cortical development.

KYNA disrupts cortical cells survival and proliferation in vitro

KYNA, a product of the kynurenine pathway of tryptophan degradation, and the only known endogenous antagonist of the NMDAR in vivo, is responsible for a broad spectrum of effects, including the endogenous regulation of neuronal excitability and the initiation of immune tolerance (Kessler et al., 1989; Wang et al., 2006). NMDARs are important for progenitor proliferation, differentiation and neuronal migration during embryonic development in rodents (Manent et al., 2005, Suzuki et al., 2006, Toriumi et al., 2012). Blockade of NMDARs during rat cortical development (Ikonomidou et al.,

1999), and in human RGC cultures (Chapter 4) induces cell death, reduces progenitor proliferation and induces astrocyte hypertrophy. Antagonizing NMDARs with its endogenous antagonist KYNA, in vitro, also exhibits similar effects – an increase in cell death, a decrease in cell proliferation, and an increase in gliogenesis, showing the importance of maintaining the balance between serum tryptophan, and degradation of tryptophan to metabolites of the kynurenine pathway, during the second trimester of gestation in humans.

172

KYNA elicits a pro-inflammatory response in cortical mixed cultures

The KYNA-mediated NMDAR blockade favored astrocyte generation, and in addition induced the activation of resting astrocytes in both RGC cultures (Chapter 3) and mixed cell cultures. The morphology of S100β+ cells changed, and their number increased, implying a pro-inflammatory response, and such astrocytic hypertrophy is well- reported in post-mortem studies on brains of schizophrenia patients (Rajkowska et al.,

2001). Increased cerebrospinal fluid levels of pro-inflammatory cytokines such as IL-1β and IL-6 (Garver et al., 2003; Söderlund et al., 2009) as well as up-regulated cyclooxygenase (COX) expression (Das and Khan, 1998) have also been noted in schizophrenic patients, providing additional support for the hypothesis of activated central inflammatory responses in affected individuals. Consistent with this impression, Müller et al. 1997a demonstrated that the levels of the soluble IL-6 receptor (sIL-6R) are increased in the CSF of schizophrenic patients. In contrast to other soluble cytokine receptors such is sIL-1RA or sIL-2R, sIL-6R does not inhibit IL-6 signaling, but instead enhances IL-6 functions by acting as an agonist in combination with IL-6 (Knüpfer and Preiss, 2008).

Taken together, there seems to be a relative shift towards enhanced pro- inflammatory activity in the CNS of schizophrenic patients.

Here, we showed increased numbers of reactive astrocytes in our mixed cell cultures, and further observed an increase in the concentration of IL-6 secreted from

173

KYNA treated cultures. Such observations are in corroboration from previous studies that support a pro-inflammatory hypothesis in the developmental pathophysiology of certain neuropsychiatric diseases including schizophrenia (Meyer et al., 2011).

Consequences of elevated KYNA levels during fetal neurodevelopment

The cortex is richly endowed from an early age in two key receptor targets of

KYNA, the NMDARs and nAChRs (Ben-Ari et al., 1997; Dwyer et al., 2009). In that regard, a range of studies suggest that dysfunctional neurotransmission at these receptors from early neurodevelopment may be causally related to CNS abnormalities in a variety of disorders, including schizophrenia, autism-spectrum disorder, and attention deficit hyperactivity disorder (ADHD) (Martin and Freedman, 2007; Young et al., 2007; Deutsch et al., 2011; Timofeeva and Levin, 2011; Chang et al., 2014).

Glutamate receptors play an essential role in brain development and particularly the NMDARs. NMDARs have been implicated in modulating neuronal migration, synapse formation (Udin and Grant, 1999; Dikranian et al., 2001), neurite outgrowth and the formation of spines (Ultanir et al., 2007), and other factors that contribute to neuronal plasticity that rapidly occurs during neurodevelopment (Drian et al., 2001; du Bois and

Huang, 2007) in rodents. The significance of NMDAR malfunction developmentally has been studied using agents to directly block the receptors in rodents (Dikranian et al., 2001;

174 Ikonomidou et al., 1999), and humans (Chapter 3). Structural and behavioral abnormalities that occur as a result of blocking these receptors are relevant for the study of various neuropsychiatric disorders (du Bois and Huang, 2007; Lindahl et al., 2008).

KYNA concentrations in the developing brain fluctuate in response to environmental stimuli, such as maternal infection, maternal stress or an insult such as hypoxia. Maternal exposure to infection or stressful conditions adversely affect brain development and increases the risk for the offspring to develop psychiatric symptoms

(Brown and Patterson, 2011; Fineberg and Ellman, 2013). In line with this notion, in rodents, both immune activation and stress during pregnancy cause rapid elevations of

KYNA in the fetal brain (Notarangelo and Schwarcz, 2014; Notarangelo et al., 2015); however, the impact of these insults on long-lasting changes of KYNA in the offspring are still under investigation.

Despite the breadth of literature on the importance of NMDARs in neurodevelopment, not much is known about the regulation of their function during development. KYNA may contribute to the regulation of these receptors developmentally and in return influence cortical maturation. In that regard, a number of studies have modeled an increase in KYNA concentrations during different stages of pre- and postnatal development in rodents, as maturation of the brain is a dynamic process that begins embryonically and continues into young adulthood. Several of these approaches have

175

found that neurodevelopment is quite susceptible to alterations in KYNA concentrations and studies have focused on molecular and behavioral phenotypes in adulthood after manipulations during various developmental periods.

In our study, we used human cortical mixed cells isolated at midgestation (16-19 gw), an important period of active neurogenesis when upper cortical layers are formed

(Hill and Walsh, 2005), to study the effects of elevated levels of KYNA in human cortical development. As these layers are crucial for formation of cortico-cortical connections and subsequently for emergence of higher brain functions, interference with NMDAR functions at this developmentally sensitive period may lead to widespread effect on formation of the cortical circuitry, and negatively influence cortical functional maturation in adulthood

(Uhlhaas, 2011).

KYNA treatment activates the Jak-STAT pathway

With respect to the potential developmental pathways involved, KYNA has been shown to elicit a pro-inflammatory response that can activate the JAK-STAT pathway in mice (Schwarz et al. 2001, Holtze et al. 2011; Erhardt et al, 2012). This would result in cytokine-receptor interactions and could interfere with the normal specification of cortical progenitors at midgestation. When IL-6R dimerizes upon binding with IL-6, the tyrosine residues on Jak get autophosphorylated, and trigger the activation of the Jak-STAT signaling pathway. STATs possess the phosphotyrosine-binding Src-homology 2

176 domains that have a high affinity for the Jak-phosphorylated tyrosine residues. Binding of

STATs to these phosphorylated tyrosine residues further leads to dimerization of the

STAT molecules. STATs are of three types, STAT1, STAT2 or STAT3, and upon phosphorylation these can form either hetero- or homo- dimers. The STAT hetero-or homo-dimers get recruited to the nucleus, and in embryonic rat coritcal cultures STATs activate transcription of one of their target genes, Gfap.

We showed an increase in expression levels of pSTAT3, and this result is concurrent with current literature that reports the activation of Jak-STAT pathway downstream of KYNA exposure in rodents. Furthermore, these results provide helpful insight into understanding the cell signaling pathways possibly involved downstream of

KYNA’s binding to its target receptors such as NMDARs.

In conclusion, our study extends previous findings on the effects of KYNA in neurodevelopment. Our study enables the identification of the novel targets like KYNA or pSTAT3 in the therapy of pathological conditions such as schizophrenia where KYNA levels are elevated.

177

References

Bailey JA, Ray B, Greig NH, Lahiri DK: Rivastigmine lowers A beta and increases sAPPalpha levels, which parallel elevated synaptic markers and metabolic activity in degenerating primary rat neurons. PLoS One, 6:e21954. doi:10.1371/journal.pone.0021954 (2011).

Belforte JE, Zsiros V, Sklar ER, Jiang Z, Yu G, Li Y. et al. Postnatal NMDA receptor ablation in corticolimbic interneurons confers schizophrenia-like phenotypes. Nat

Neurosci 13:76–83 (2010).

Ben-Ari Y, Khazipov R, Leinekugel X, Caillard O, Gaiarsa JL. GABAA, NMDA and AMPA receptors: a developmentally regulated 'menage a trois'. Trends Neurosci. 20, 523e529

(1997).

Ben Haim L, Ceyzériat K, Carrillo-de Sauvage MA, Aubry F, Auregan G, Guillermier M,

Ruiz M, Petit F, Houitte D, Faivre E, Vandesquille M, Aron-Badin R, Dhenain M, Déglon

N, Hantraye P, Brouillet E, Bonvento G, Escartin C. The JAK/STAT3 pathway is a common inducer of astrocyte reactivity in Alzheimer's and Huntington's diseases. J

Neurosci. Feb 11;35(6):2817-29 (2015).

Brewer GJ, Torricelli JR: Isolation and culture of adult neurons and neurospheres. Nat

Protoc 2:1490–1498. doi:10.1038/nprot.2007.207 (2007).

Brown AS, Patterson PH. Maternal infection and schizophrenia: implications for prevention. Schizophr. Bull. 37, 284e290 (2011).

Bystron I, Blakemore C, Rakic P: Development of the human cerebral cortex: Boulder

Committee revisited. Nature Rev Neurosci 9:110–122. doi:10.1038/nrn2252 (2008).

178 Campbell IL, Erta M, Lim SL, Frausto R, May U, Rose-John S, Scheller J, Hidalgo J.

Trans-signaling is a dominant mechanism for the pathogenic actions of interleukin-6 in the brain. J Neurosci. Feb 12;34(7):2503-13. doi: 10.1523/JNEUROSCI.2830-13.2014

(2014).

Chang JP, Lane HY, Tsai GE. Attention deficit hyperactivity disorder and Nmethyl- D- aspartate (NMDA) dysregulation. Curr. Pharm. Des. 20, 5180e518 (2014).

Codeluppi S, Fernandez-Zafra T, Sandor K, Kjell J, Liu Q4, Abrams M, Olson L, Gray NS,

Svensson CI, Uhlén P. Interleukin-6 secretion by astrocytes is dynamically regulated by

PI3K-mTOR-calcium signaling. PLoS One. Mar 25;9(3):e92649 (2014).

Curtis DR, Johnston GA. Amino acid transmitters in the mammalian central nervous system. Ergebnisse der Physiologie, Biologischen Chemie und Experimentellen

Pharmakologie, 69, 97–188 (1974).

Das I, Khan NS. Increased arachidonic acid induced platelet chemiluminescence indicates cyclooxygenase overactivity in schizophrenic subjects. Prostaglandins Leukot

Essent Fatty Acids 58, 165–168(1998).

Deutsch SI, Urbano MR, Burket JA, Herndon AL, Winebarger EE. Pharmacotherapeutic implications of the association between genomic instability at chromosome 15q13.3 and autism spectrum disorders. Clin. Neuropharmacol. 34, 203e205 (2011).

Dikranian K, Ishimaru MJ, Tenkova T, Labruyere J, Qin YQ, Ikonomidou C, Olney JW.

Apoptosis in the in vivo mammalian forebrain. Neurobiol. Dis. 8, 359e379 (2001).

Drian MJ, Bardoul M, Konig N. Blockade of AMPA/kainate receptors can either decrease or increase the survival of cultured neocortical cells depending on the stage of maturation.

179

Neurochem. Int. 38, 509e517 (2001). du Bois TM, Huang XF. Early brain development disruption from NMDA receptor hypofunction: relevance to schizophrenia. Brain Res. Rev. 53, 260e270 (2007).

Dwyer JB, McQuown SC, Leslie FM. The dynamic effects of nicotine on the developing brain. Pharmacol. Ther. 122, 125e139 (2009).

Estes ML, McAllister AK. Alterations in immune cells and mediators in the brain: it’s not always neuroinflammation! Brain Pathol. 24 (6), 623e630 (2014).

Erhardt S, Lim CK, Linderholm KR, Janelidze S, Lindqvist D, Samuelsson M et al.

Connecting inflammation with glutamate agonism in suicidality.

Neuropsychopharmacology 38: 743–752 (2012).

Fineberg AM, Ellman LM, Inflammatory cytokines and neurological and neurocognitive alterations in the course of schizophrenia. Biol. Psychiatry 73, 951e966 (2013).

Garver DL, Tamas RL, Holcomb JA. Elevated interleukin-6 in the cerebrospinal fluid of a previously delineated schizophrenia subtype. Neuropsychopharmacology 28: 1515–

1520 (2003).

Geiger RS: Subcultures of adult mammalian brain cortex in vitro. Exp Cell Res 14:541–

566 (1958).

Giles GI, Collins CA, Stone TW, Jacob C. Electrochemical and in vitro evaluation of the redox-properties of kynurenine species. Biochemical and Biophysical Research

Communications, 300, 719–724 (2003).

Guillemin GJ, Kerr SJ, Smythe GA, Smith DG, Kapoor V, Armati PJ et al. Kynurenine pathway metabolism in human astrocytes: A paradox for neuronal protection. J.

180 Neurochem. 78: 842–853 (2001).

Hill RS, Walsh CA. Molecular insights into human brain evolution. Nature 437: 64–67

(2005).

Hilmas C, Pereira EF, Alkondon M, Rassoulpour A, Schwarcz R, Albuquerque EX. The brain metabolite kynurenic acid inhibits alpha7 nicotinic receptor activity and increases non-alpha7 nicotinic receptor expression: physiopathological implications. J Neurosci

21:7463–7473 (2001).

Holtze, M., Saetre, P., Erhardt, S., Schwieler, L., Werge, T., Hansen, T., Nielsen, J.,

Djurovic, S., Melle, I., Andreassen, O.A., Hall, H., Terenius, L., Agartz, I., Engberg, G.,

J€onsson, E.G., Schalling, M., Apr. Kynurenine 3- monooxygenase (KMO) polymorphisms in schizophrenia: an association study. Schizophr. Res. 127 (1e3), 270-

272 (2011).

Howard B, Chen Y, Zecevic N. Cortical progenitor cells in the developing human telencephalon. Glia 53: 57–66 (2006).

Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K, Tenkova TI,

Stefovska V, Turski L, Olney JW. Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science 283, 70e74 (1999).

Islam O, Gong X, Rose-John S, Heese K. Interleukin-6 and neural stem cells: more than gliogenesis. Mol. Biol. Cell 20: 188–199 (2009).

Karlsson H. Viruses and schizophrenia, connection or coincidence? Neuroreport 14 (4),

535e542 (2003).

181

Kessler M, Terramani T, Lynch G, Baudry M. A glycine site associated with N-methyl-D- aspartic acid receptors: characterization and identification of a new class of antagonists.

J. Neurochem. 52: 1319–1328 (1989).

Knüpfer H, Preiss R. sIL-6R: More than an agonist? Immunol Cell Biol 86, 87–91(2008).

Lee HC, Tan KL, Cheah PS, Ling KH.Potential Role of JAK-STAT Signaling Pathway in the Neurogenic-to-Gliogenic Shift in Down Syndrome Brain. Neural Plast. 2016 Review

(2016).

Lindahl JS, Kjellsen BR, Tigert J, Miskimins R. In utero PCP exposure alters oligodendrocyte differentiation and myelination in developing rat frontal cortex. Brain Res.

1234, 137e147 (2008).

Liu XC, Holtze M, Powell SB, Terrando N, Larsson MK, Persson A, et al. Behavioral disturbances in adult mice following neonatal virus infection or kynurenine treatment—

Role of brain kynurenic acid. Brain, Behavior, and Immunity, 36, 80–89 (2014).

Malik S, Vinukonda G, Vose LR, Diamond D, Bhimvarapu BBR, Hu F et al. Neurogenesis continues in the third trimester of pregnancy and is suppressed by premature birth. J.

Neurosci. 33: 411–23 (2013).

Manent JB, Demarque M, Jorquera I, Pellegrino C, Ben-Ari Y, Aniksztejn L et al. A noncanonical release of GABA and glutamate modulates neuronal migration. J. Neurosci.

25: 4755–4765 (2005).

Martin LF, Freedman R. Schizophrenia and the alpha7 nicotinic acetylcholine receptor.

Int. Rev. Neurobiol. 78, 225e246 (2007).

Meyer U, Weiner I, McAlonan GM, Feldon J. The neuropathological contribution of

182 prenatal inflammation to schizophrenia. Expert Rev. Neurother. 11: 29–32 (2011).

Mitchell KM, Albahadily FN, Michaelis EK, Wilson GS. Direct measurement of glutamate release in the brain using a dual enzyme-based electrochemical sensor. Brain Research,

659, 117–125(1994).

Mo Z, Moore AR, Filipovic R, Ogawa Y, Kazuhiro I, Antic SD et al. Human cortical neurons originate from radial glia and neuron-restricted progenitors. J. Neurosci. 27: 4132–4145

(2007).

Moroni F, Russi P, Lombardi G, Beni M, Carlà V. Presence of kynurenic acid in the mammalian brain. Journal of Neurochemistry, 51, 177–180 (1988).

Negishi T, Ishii Y, Kyuwa S, Kuroda Y, Yoshikawa Y: Primary culture of cortical neurons, type-1 astrocytes, and microglial cells from cynomolgus monkey (Macaca fascicularis) fetuses. J Neurosci Methods 131:133–140 (2003).

Notarangelo FM, Schwarcz R. Restraint stress during pregnancy raises kynurenic acid levels in placenta and fetal brain. Soc. Neurosci. Abstr. 39, 348.316 (2014).

Notarangelo FM, Wons KS, Schwarcz R. Prenatal LPS exposure preferentially increases kynurenine pathway metabolism in the fetal brain. Soc. Neurosci. Abstr. 40, 74.02 (2015).

Plitman E, Nakajima S, De La Fuente-Sandoval C, Gerretsen P, Chakravarty MM,

Kobylianskii J, et al. Glutamate-mediated excitotoxicity in schizophrenia: A review.

European Neuropsychopharmacology, 24, 1591–1605 (2014).

Pocivavsek A, Wu H Q, Potter MC, Elmer GI, Pellicciari R, Schwarcz R. Fluctuations in endogenous kynurenic acid control hippocampal glutamate and memory.

Neuropsychopharmacology, 36, 2357–2367 (2011).

183

Radonjić NV, Memi F, Ortega JA, Glidden N, Zhan H, Zecevic N. The Role of Sonic

Hedgehog in the Specification of Human Cortical Progenitors In Vitro. Cereb. Cortex 26:

131–143 (2014).

Rajkowska G, Halaris A, Selemon LD. Reductions in neuronal and glial density characterize the dorsolateral prefrontal cortex in bipolar disorder. Biol. Psychiatry. 49:

741-752 (2001).

Ray B, Bailey JA, Sarkar S, Lahiri DK: Molecular and immunocytochemical characterization of primary neuronal cultures from adult rat brain: Differential expression of neuronal and glial protein markers. J Neurosci Methods 2009, 184:294–302. doi:10.1016/j.jneumeth..08.018 (2009).

Robert SM, Ogunrinu-Babarinde T, Holt KT, Sontheimer H. Role of glutamate transporters in redox homeostasis of the brain. Neurochemistry International, 73, 181–

191 (2014)

Rothermundt, M., Ahn, J. N., & Jörgens, S. S100B in schizophrenia: An update. Gen

Physiol Biophys 28, F76–F81 (2009).

Schoepp DD, Conn PJ. Metabotropic glutamate receptors in brain function and pathology.

Trends in Pharmacological Sciences, 14, 13–20 (1993).

Schwieler L, Larsson MK, Skogh E, Kegel ME, Orhan F, Abdelmoaty S, Finn A, Bhat M,

Samuelsson M, Lundberg K, Dahl ML, Sellgren C, Schuppe- Koistinen I, Svensson C,

Erhardt S, Engberg G. Increased levels of IL-6 in the cerebrospinal fluid of patients with chronic schizophrenia significance for activation of the kynurenine pathway. J. Psychiatry

Neurosci. 40 (2), 126e133 (2015).

184 Selemon L. and N. Zecevic 2015 Schizophrenia: A Tale of Two Critical Periods for

Prefrontal Cortical Development. Translational Psychiatry 5, e623; doi:10.1038/tp.2015.115. Review. PMID: 26285133.

Sellgren CM, Kegel ME, Bergen SE, Ekman CJ, Olsson S, Larsson M, Vawter MP,

Backlund L, Sullivan PF, Sklar P, Smoller JW, Magnusson PK, Hultman CM, Walther-

Jallow L, Svensson CI, Lichtenstein P, Schalling M, Engberg G, Erhardt S, Landen M, 15

A genome-wide association study of kynurenic acid in cerebrospinal fluid: implications for psychosis and cognitive impairment in bipolar disorder. Mol. Psychiatry. http://dx.doi.org/

10.1038/MP.2015.186 (2015).

Setiadi J, Heinzelmann G, Kuyucak S. Computational studies of glutamate transporters.

Biomolecules, 5, 3067–3086 (2015).

Soderlund J, Schr€oder J, Nordin C, Samuelsson M, Walther-Jallow L, Karlsson H,

Erhardt S, Engberg G. Activation of brain interleukin- 1beta in schizophrenia. Mol.

Psychiatry 14 (12), 1069e1071 (2009).

Timofeeva OA, Levin ED. Glutamate and nicotinic receptor interactions in working memory: importance for the cognitive impairment of schizophrenia. Neuroscience 195,

21e36 (2011).

Toriumi K, Mouri A, Narusawa S, Aoyama Y, Ikawa N, Lu L et al. Prenatal NMDA

185

Receptor Antagonism Impaired Proliferation of Neuronal Progenitor, Leading to Fewer

Glutamatergic Neurons in the Prefrontal Cortex. Neuropharmacology 37: 1387–1396

(2012).

Udin SB, Grant S. Plasticity in the tectum of Xenopus laevis: binocular maps. Prog.

Neurobiol. 59, 81e106 (1999).

Uhlhaas PJ. The adolescent brain: Implications for the understanding, pathophysiology, and treatment of schizophrenia. Schizophr. Bull.; 37: 480–483 (2011).

Ultanir SK, Kim JE, Hall BJ, Deerinck T, Ellisman M, Ghosh A. Regulation of spine morphology and spine density by NMDA receptor signaling in vivo. Proc. Natl. Acad. Sci.

U. S. A. 104, 19553e19558 (2007).

Upthegrove R, Manzanares-Teson N, Barnes NM. Cytokine function in medication-naive first episode psychosis: a systematic review and meta-analysis. Schizophr. Res. 155

(1e3), 101e108 (2014).

Urata Y, Koga K, Hirota Y, Akiyama I, Izumi G, Takamura M, et al. IL- 1beta increases expression of tryptophan 2,3-dioxygenase and stimulates tryptophan catabolism in endometrioma stromal cells. Am. J. Reproduct. Immunol. 72 (5), 496e503 (2014).

Vicario-Abejon C: Long-term culture of hippocampal neurons. In Current Protocols in

Neuroscience, Chapter 3, Unit 3 2. Edited by Crawley JN; doi:10.1002/0471142301.ns0302s26 (2004).

Wang J, Simonavicius N, Wu X, Swaminath G, Raegan J, Tian H et al. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. J. Biol. Chem. 281: 22021–22028

(2006).

186 Watkins JC. L-glutamate as a central neurotransmitter: Looking back. Biochemical

Society Transactions, 28, 297–309 (2000).

Yolken RH, Torrey EF. Are some cases of psychosis caused by microbial agents? A review of the evidence. Mol. Psychiatry 13 (5), 470e479 (2008).

Young JW, Crawford N, Kelly JS, Kerr LE, Marston HM, Spratt C, Finlayson K, Sharkey

J. Impaired attention is central to the cognitive deficits observed in alpha 7 deficient mice.

Eur. Neuropsychopharmacol. 17, 145e155 (2007).

Zecevic N, Chen Y, Filipovic R. Contributions of cortical subventricular zone to the development of the human cerebral cortex. J. Comp. Neurol. 491: 109–122 (2005).

187

Chapter 6

Discussion and Future Directions

Discussion

NMDARs distribution and their role in various physiological processes in the brain are very well studied in animal models, but are sparse with regards to human cortical development (Suzuki et al., 2006; Jantzie et al., 2015). These studies are, however, necessary to better understand normal cortical development in humans, because the human fetal brain consists of a large and diverse set of progenitors, some of which do not exist in rodents, and NMDARs, (as we have seen in Chapters 2, 3 and 4) are present in the human fetal brain and do play an important role in the specification of human cortical progenitors and neuronal differentiation. Moreover, it is necessary to study NMDARs in human cortical tissue because environmental insults that can compromise NMDAR function, and interfere with cortical progenitors can lay down the etiological basis of neurodevelopmental disorders like schizophrenia and autism that are known to occur only in humans. We studied a collection of fetal brains around midgestation using a variety of techniques to answer these questions:

1) Are NMDARs present in the fetal cerebral cortex?

2) When and where are they localized, and what is their subunit composition?

3) Which cell types express the obligatory NR1 subunit, and NR2A and NR2B

subunits?

4) What is the role of NMDARs in human corticogenesis?

188 In our study, questions related to NMDARs distribution were answered by immunolabeling of the cryosections through the cerebral hemisphere using antibodies to

NMDAR subunits and cell-type specific markers (for example Pax6, GFAP, β-III-tubulin).

Because there are relatively big individual variations between human samples, we tried to increase the number of studied cases and to group them by age. In addition, wherever possible we applied a variety of methods, such as in situ hybridization, Western blot and qPCR on each sample to obtain a more complete picture of NMDARs distribution in the human fetal cortex.

We demonstrated that the NR1, NR2A and NR2B subunits are expressed in all progenitor and neuronal populations, as well as in astrocytes. Each cell population occupies a specific location along the telencephalic wall, with progenitors localized in the proliferative VZ/SVZ layers, migrating neurons in the transient intermediate zone (IZ) and subplate (SP) layers, and neurons that have reached their final location in the cortical plate (CP) layer. The immunoreactivity for the NMDAR subunits had a transverse pattern across the VZ and SVZ, suggestive of the expression of NMDAR subunits along efferent and afferent fibers/processes, as expression of NMDARs was reported at both the pre- synaptic and post-synaptic sites (Herkert et al., 1998). In the SP and CP, the immunoreactivity for the NMDAR subunits exhibits a radial pattern that corresponds to the radial glial fibers and organization of cell bodies in the CP. Moreover, we observed a difference in the immunostaining pattern of different subunits. For example, the NR1 subunit exhibited a more diffuse immunostaining in the VZ compared to the CP, where it

189

looked more punctate (Figure 31A,B), possibly indicating trafficking of NR1 through the secretory pathway in the VZ, and membrane expression of NR1 in the CP. This will be discussed in detail in the next section of this chapter. Thus, based on NMDAR distribution in different cortical cell populations that occupy different zones (Chapter 2), our results suggest multiple roles for these receptors during corticogenesis at midgestation. For example, presence of NMDAR subunits on RGCs in the VZ, and on Ki67+ cells could indicate a role of NMDARs in progenitor proliferation, while expression of NMDAR subunits on intermediate progenitors in the oSVZ suggests their role in progenitor differentiation, and expression of NMDAR subunits on glutamatergic neurons in the IZ could be indicative of NMDAR’s role in neuronal migration. The different age-related patterning of expression of NR2B in RGC, intermediate and interneuron progenitors suggests a role of this subunit in the specification of cortical progenitors, while NR2A containing NMDARs might be important for further neuronal differentiation. Our finding of the age-dependent expression of subunits NR2A and NR2B in human fetal cortex corroborates with the results of animal studies, and is known to be regulated by synaptic activity in rodents (Sanz-Clemente et al. 2013). NR2B-rich NMDARs are found in abundance on developing synapses (Yasuda et al. 2011). NR2B-rich NMDARs generate slow currents with smaller amplitudes but lasting twice as long compared to NR2A- mediated current. This allows for a large influx of calcium that promotes gene transcription and extends the period of membrane depolarization, which is crucial for generating a strong and stable synapse (Yasuda et al. 2011). NR2B is needed at the beginning of cortical synaptogenesis; it may be essential for circuitry formation. Many of

190 these synapses undergo pruning, a process that is dependent on environmental experiences, the nature of the stimulus, and age (Rakic et al. 1986; Dumas 2005; Sanz-

Clemente et al. 2013; reviewed in Paoletti et al. 2013). In the adult brain, the strong circuitry connections required for long-term potentiation are rich in NR2B- containing

NMDARs (Tovar and Westbrook 2002; Groc et al. 2006; Sanz-Clemente et al. 2010).

Experiments using antagonists of the NR2A and NR2B subunits in monkey prefrontal cortical slices (Wang et al. 2012) showed that NR2B-type activity on postsynaptic spines participates in working memory and learning. Similar results were obtained in mice genetically modified to lack the NR2B subunit during their postnatal developmental (von

Engelhardt et al. 2008). On the other hand, NR2A-rich NMDARs generate the fast currents required for strong and transient synaptic connections in response to sensory stimuli (Nakagawa et al. 1996; Paupard et al. 1997; Malenka and Nicoll 1999; Malatesta et al. 2000). Moreover, NR2A-rich NMDARs occupy synaptic locations as development proceeds postnatally in rodents (Malenka and Nicoll 1999; Dumas 2005). This shift from

NR2B-rich to NR2A-rich NMDARs also occurs postnatally (second week) in rodents, and the timing of the switch coincides with the development of associative learning abilities, indicating the significance of this process in modifying and tweaking neuronal circuits

(Dumas 2005; Sanz-Clemente et al. 2013). Thus, in rats reared in the dark without appropriate sensory input, the NR2B-NR2A switch in the visual cortex is impaired, but the impairment can be reversed by exposing the animals to light (Philpot et al. 2001), indicating that the switch is regulated by environmental stimuli, and is plastic in nature.

Notably, the change in NMDAR subunits is related to the shift from the greater plasticity

191

that characterizes development to the greater stability that marks adult life (Bear et al.

1987; Kleinschmidt et al. 1987; Constantine-Patton et al. 1990; reviewed in Dumas 2005).

The NR2B to NR2A switch in NMDAR subunit expression is highly conserved from frogs to mammals (Dumas 2005; reviewed in Paoletti et al. 2013), but it has not been widely studied in the developing human cerebral cortex (Scherzer et al. 1998; Henson et al.

2008; Jantzie et al. 2015).

We observed that in the human fetal cortex from 16 to 24 gw, the percentage of

NR2B-expressing cortical RGCs and neurons decreased, while expression of the NR2A subunit increased during the same developmental period of 22-24 gw. These results suggest that in human cortical development the switch from NR2B to NR2A begins quite early, around 22–24 gw. A larger shift can be assumed to occur postnatally, especially between the juvenile and adult stages of development, when cognitive functions mature

(Dumas 2005; Sanz-Clemente et al. 2013). A more comprehensive picture of the NR2B to NR2A switch in human fetal cortex requires the study of a broader range of brain tissues of different gestational ages as well as neonatal and adult tissue samples. The early distribution of NR1, NR2A, and NR2B in the human cerebral cortex suggests their early and distinct roles in cortical progenitor proliferation and specification, and in the maturation and synaptogenesis of excitatory and inhibitory neurons in this brain region.

However, the role of NMDARs in these developmental processes in humans can only be speculated upon and not proven. In order to determine if NMDARs are indeed significant to processes of cortical development in humans, we established in vitro systems of

192 primary human cell cultures that mirror the in vivo scenario with respect to cells types present in the fetal cerebral cortex. For this purpose, we generated both mixed cell cultures from the fetal cerebral cortex that are more representative of the fetal brain tissue, and enriched RGC cultures that allow us to ascertain the role of NMDARs in regulating, specifically, the cortical multipotent progenitor population. The advance in our thinking of the importance of NMDARs in human cortical development comes from in vitro experiments performed in Chapters 3, 4, 5.

In vitro systems allowed us to antagonize NMDARs with either its endogenous antagonist KYNA (Chapter 3) or its synthetic antagonist D-APV (Chapter 4). These studies revealed that NMDARs are involved in progenitor proliferation, specification into other progenitor subtypes, and differentiation of progenitors into neurons and astrocytes.

Moreover, we found that the interneuron progenitor population (Nkx2.1+) and the interneuron population (GABA+) are more sensitive to NMDAR antagonism than the intermediate progenitor (Tbr2+) and glutamatergic neuron (Tbr1+) cell populations.

Furthermore, the progenitor differentiation is shifted to astrocyte rather than neuronal genesis. To appreciate the changes in cell-type specific populations, the average number of cells immunostained for each progenitor and neural cell marker, and the average number of total cells, for all KYNA concentrations after 3 DIV of proliferation and 7 DIV of differentiation are shown in Table 7. Changes in the average number of cell types during cortical development as shown here, can lead to modifications in the development of cortical circuits that depend on precise number of neurons and astrocytes as their building

193

blocks. Our data from the concentration-response curves (Chapter 4) indicates that KYNA has a higher affinity towards NMDARs than nAChRs. Moreover, our observations on the effects of D-APV and KYNA on human cortical progenitors in vitro suggest that KYNA acts very similar to D-APV (Chapter 3 and 4). Therefore, elevated levels of KYNA inhibit

NMDARs that play a significant role in many developmental processes, thereby affecting the normal course of corticogenesis in humans.

Our results are in line with observations that elevated levels of KYNA (physiological levels are 1 nM) are found in the CSF of schizophrenic patients, as well as in pregnant mothers with an activated immune system due to infections with viruses such as Influenza type A, and Sindbis virus (Wright et al., 1995). The proposed hypothesis to explain the developmental pathology of schizophrenia states that elevated levels of KYNA in the maternal serum can activate astrocytes in the fetal brain leading to secretion of pro- inflammatory cytokines that further induce secretion of KYNA in the fetal brain. This feedforward loop of synthesizing more KYNA and aggravation of the immune responses in the brain may interfere with the process of brain development, possibly laying the foundation for the onset of schizophrenia symptoms in adulthood. Our results show that indeed treatment of human cortical progenitors with elevated levels of KYNA (0.01 μM) increased the number of reactive astrocytes (S100β+ cells), increased secretion of the pro-inflammatory cytokine IL-6, and increased phosphorylation of STAT3, a signaling protein downstream of cytokine receptor activation that induces transcription of Gfap,

194 Table 7 Averaged immunostained cell numbers in KYNA treated cultures

3 DIV Proliferation 7 DIV Differentiation KYNA Cell-type specific Cell-type specific Treatment Cell Cell number/ number/ (48h) type type total number (BB+ cells) total number (BB+ cells) 98/105 72/111 DMSO βIII 92/109 + 60/114 0.001 μM BLBP+ tubulin 83/107 45/109 0.005 μM

76/110 41/112 0.01 μM

27/95 28/136 DMSO

28/107 Tbr1+ 23/121 0.001 μM Tbr2+ 24/101 21/121 0.005 μM

21/108 19/114 0.01 μM

45/114 59/127 DMSO

37/111 GABA+ 45/129 0.001 μM Nkx2.1+ 30/107 37/121 0.005 μM

23/105 24/110 0.01 μM

44/103 42/131 DMSO 56/118 GFAP+ 57/129 0.001 μM GFAP+ 71/127 83/125 0.005 μM 104/129 102/118 0.01 μM 195

gene characteristically expressed by astrocytes (Chapter 5). Astrogliosis that we found as one of the effects of elevated KYNA in our in vitro system, is also a major anatomical observation in brains of schizophrenia patients (Rajkowska et al., 2001).

Future Directions

NMDAR trafficking

Since the subunit compositions of NMDARs influence the different functional properties, the question remains how these complexes are formed and how is their distribution regulated? While the NMDAR has been intensely studied with respect to its physiology and pharmacology in rodents, its distribution, function, subunit assembly, and trafficking, are poorly addressed in human studies.

The NR1 subunit is synthesized in considerable excess (estimated to be about 10- fold) of NR2 subunit, and the production of receptor complexes is limited by the amount of NR2 subunits. Therefore, an increase in the production of NMDAR receptor complexes indicates an ongoing synthesis of NR2 subunits (Prybylowski, et al., 2001). A large proportion of the glutamate receptor clusters, including NMDARs, in young cortical neurons are present on the surface of dendrites before synapses are formed and these surface-exposed transport packets are mobile. A large proportion of the transport packets, tubulovesicular organelles associated with early endosome antigen 1 (EEA1) and synapse-associated protein 102 (SAP102), cycle through the dendritic plasma

196 membrane before synapse formation (Washbourne et al., 2004). A number of functions of the NMDAR are regulated by the multiple intracellular proteins called membrane associated guanylate kinase (MAGUKs) like EEA1 and SAP102 that interact with the cytoplasmic domains of the NMDAR subunits (Sans et al., 2003, 2005). Such interactions in the rodent brain are widely reported in synaptogenesis, and could happen much earlier while the NMDARs are still undergoing synthesis, and preparing for trafficking from the endoplasmic reticulum (ER) to the plasma membrane (Hawkins et al., 2004). Identifying the specific MAGUKs that govern the subunit assembly and trafficking of NMDARs will enable us to identify the NMDAR subunit composition in development. This might play a role in the developing neuron when NR2B is replaced by NR2A as the predominant subunit leading to a functional change that produces a receptor with faster kinetics and a tendency to be more synaptic than extra-synaptic (Kohr, 2006; Groc et al., 2004). Since the subunit composition of NMDARs dictates its functional properties, drugs specific to subunits can be used to study the significance of each subunit in coritcal developmental processes, and can help in furthering our understanding of the NR2B-NR2A switch. It should also be noted that the NR1 subunit can assemble with the NR3 subunit to produce a functional glycine receptor (Perez-Otano et al., 2001; Matsuda et al., 2003).

Trafficking of NMDARs employs MAGUKs and depending on the cellular activity,

NMDARs can undergo a full cycle of exocytosis and clathrin-dependent endocytosis during transport (Roche et al., 2001). Enhanced forward trafficking from the ER to the trans-Golgi network (TGN) results in an increased co-localization of NMDAR subunits

197

with the cis-Golgi marker GM130 (Tovar and Westbrook, 1999; Li et al., 2002). GM130 is a members of the Golgin family of proteins and plays significant roles in establishing and maintaining Golgi structure and transport (Barr and Short, 2003), ensuring uniform distribution of Golgi enzymes (Puthenveedu et al., 2006), facilitating ER-Golgi transport, and is implicated in signal transduction regulating invasion, migration, and cell polarization via its interaction with serine/threonine kinases (Preisinger et al., 2004).

Based on these observations, we performed preliminary experiments to identify if

NMDAR subunits NR1, NR2A and NR2B undergo a similar trafficking mechanism in human cortical development. This idea came from a difference in the immunostaining pattern of different subunits. Immuno-reaction for the NR1 subunit is more diffuse in the

VZ (Figure 31A), and punctate in the CP (Figure 31B). As a preliminary study, we co- labeled the NMDAR subunits with the cis-Golgi marker GM130 in cryopreserved coronal sections of the 18 gw human fetal brain. Our results were similar to that observed in transfection studies in rodents where all three subunits were localized within the intracellular organelles (McIlhinney et al., 1998). We observed that in the proliferative VZ the NMDAR subunits NR1, NR2A and NR2B co-localized with GM130, not only in the cell body, but also along the processes of progenitor cells (Figure 32A). This pattern was, however, different in neuronal cells in the CP, where highest amounts of co-localization was observed along the cell processes (Figure 32B)., suggesting that NMDAR subunits have completed ER processing, and are moving along the forward-trafficking path in the

VZ and CP at 18 gw.

198

Figure 31. Immunohistochemistry for NR1 subunit at 18 gw. Immunostaining pattern appears diffuse in the VZ (A), and punctate in the CP (B). Nuclei are stained with BB.

199

Figure 32. NMDAR subunits are present in the Golgi network in the human fetal brain at

18 gw. Immunohistochemistry with NMDAR subunits NR1, NR2A and NR2B (green) shows co-localization with the cis-Golgi marker GM130 (red) in the proliferative VZ (A) and in the neuron-rich CP (B).

200 Future studies involving triple-immunolabeling with primary antibodies against NMDAR subunits and anti-GM130 antibody, will enable us to examine the trafficking of subunits during development of the human cortex. Also, co-localization studies of the NMDAR subunits with clathrin would entertain the possibility of endocytosis of specific subunits during synaptogenesis in humans. This would enable us to observe if NR2Bsubunits are endocytosed post-midgestation (~22 gw) resulting in their reduced expression with increasing age. Furthermore, the phosphorylation status of various intracellular MAGUKs, specifically, SAP102, and PSD-95, would be interesting to explore. Both of these molecules have high binding affinities to the PDZ domains present on the cytoplasmic C- termini of the NR1 and NR2 subunits. Association of these MAGUKs with NMDAR subunits could indicate the assembly of receptor complexes in the ER, as well as identify the specific MAGUKs associated with the NMDAR subunits at the plasma membrane during human corticogenesis.

NMDAR physiology

NMDARs require simultaneous agonist and co-agonist binding, and membrane depolarization to open the channel pore, which remains blocked by magnesium ions at resting membrane potentials (Mayer et al., 1984; Nowak et al., 1984). The role of

NMDARs has been most widely studied by blocking the ion flux through these receptors using pharmacological agents such as D-APV, a competitive antagonist of the glutamate- binding site on NR2; 7-chlorokynurenate, or 7-CK, a competitive antagonist of the co-

201

agonist site on NR1 (7-CK is an early derivative of the naturally occurring KYNA, which is a non-selective antagonist of NMDARs as well as the α7nAChR); MK-801, an uncompetitive blocker of the channel pore (Zito and Scheuss, 2009). NMDARs function as ion channels mediating the influx of extracellular calcium, a secondary messenger involved in signal transduction pathways, and in regulation of gene expression

(Hardingham et al., 2001).

Recent studies have provided provocative evidence suggesting NMDARs ability to signal in the absence of ion flux through its channel pore (Dore et al., 2015). It is hypothesized that agonist binding to the NMDAR causes conformational changes in the cytoplasmic domain of the receptor subunits via a non-ionotropic signaling mechanism independent of channel opening that induces a conformational change in the transmembrane segments of the receptor subunits (Tamburri et al., 2013; Aow et al.,

2015; Stein et al., 2015). Indeed, Dore et al. in 2015 demonstrated that binding of the specific agonist NMDA to the glutamate site on the NR2 subunit led to conformational changes in the NMDAR intracellular domains in the presence of 7-CK and MK-801, but not in the presence of D-APV, providing evidence for agonist-induced, but ion flow- independent, conformational changes in the NMDAR C-terminal tails. This new knowledge of NMDAR-mediated signaling, if proven true, can entice an exciting new era that challenges the current understanding of synaptogenesis and synaptic plasticity.

202

Figure 33. (A) Control human RGC cultures incubated with calcium indicating dye OGB1-

AM. The red traces indicate possible electrical activity-dependent calcium transients. (B)

Calcium recordings performed on KYNA treated RGC cultures. Calcium transients seen in normal saline (first panel) indicate that these cells are undergoing a change in intracellular concentration. The calcium transients remain unaffected by NMDAR antagonist D-APV (middle panel), but they decrease upon Ryanodine application (last panel).

203

Activation of NMDARs independent of ion flux through its channel pore is an important mechanism that induces endocytosis of NMDARs (Vissel et al., 2001), as well as phosphorylation of extracellular signal-regulated kinase (ERK) and increased c-Fos expression (Yang et al., 2004). Non-ionotropic NMDAR-mediated signaling through Src kinase is also central to pathological processes that lead to neuronal death during excitotoxicity (Weilinger et al., 2016). In addition to glutamate, co-agonist binding to the glycine site on the NR1 subunits may also be involved in non-ionotropic signaling, as glycine binding has been found to prime the NMDAR for subsequent clathrin-mediated endocytosis in the presence of D-APV but not glycine site antagonists like KYNA (Nong et al., 2003).

Human fetal RGCs and other cortical progenitors, possess excitable membranes and can generate abortive action potentials upon receiving a current stimulus (Howard et al., 2008). In rodents, progenitor cells in the VZ possess large calcium waves (Weissman et al., 2004). These functions are intricately tied to the predisposition of progenitors to a neuronal lineage, and maturation of young neurons. The large calcium transients, have in most cases, been fueled by the intracellular calcium stores. This is evidenced from studies showing that large calcium transients are abolished upon application of IP3 receptor blockers or Ryanodine (Weissman et al., 2004). In light of the previous studies, we tested our human RGC cultures for the presence of calcium activity that was NMDAR- dependent. It is important to identify if developmental processes depend on NMDARs ability to transport calcium ions through the channel’s pore and how KYNA affects this

204 NMDAR feature. If calcium activity in RGCs is detected and is non-NMDAR dependent, then we need to understand the mechanism through which KYNA affects intracellular calcium concentrations, since calcium is an important secondary messenger involved in the transcription of many developmental genes including Tbr1 (Kristiansen et al., 2010).

As a preliminary experiment, we incubated our control RGCs and KYNA treated

(0.01 μM) RGCs, with a light excitable calcium indicator Oregon Green BAPTA 1-

Acetoxymethyl (OGB1-AM) for 30 min at 37oC. Oregon Green is a dye that is excited by the blue wavelength (480 nm) and emits fluorescence in the green wavelength (520 nm) in the visible range of the electromagnetic spectrum. AM allows this dye to diffuse across an intact plasma membrane, and is cleaved by intracellular esterases that prevents the diffusion of dye out of the cell. BAPTA is a potent calcium chelator, and when calcium binds to OGB1-AM, a conformational change occurs in the structure of this dye allowing it to fluoresce green. We applied the calcium imaging protocol to our cell cultures incubated with OGB1-AM in the Antic laboratory at UConn Health. We found that human

RGCs exhibit spontaneous calcium transients (Figure 33A), and some of these were indicative to be dependent on the electrical activity of the cells (Figure 33A; red traces).

The presence of fast calcium transients resembling action potential mediated calcium transients in neuronal lineage has four potential explanations:

1. Our cultures contained cells of neuronal lineage on the day of the experiment (3

DIV of proliferation).

2. Though highly unlikely, it is possible that human RGCs exposed to postmortem

205

handling followed by several days in culture begin to exhibit some electrical excitability and fire spontaneous action potentials. This idea that RGCs fire action potentials needs to be demonstrated in acute brain slices, by patching RGCs with dye-filled electrodes.

3. We are dealing with a specific form of calcium internal release characterized by small amplitude and narrow duration.

4. We may have sick cells in culture. These injured cells may produce pathological transients. Instead of big and wide (Figure 33A, white traces) the unhealthy transients are small and narrow.

The following experiments need to be performed in the future to resolve the origin of small-amplitude narrow-duration calcium transients.

Experiment 1: Human RGCs need to be re-cultured and controlled optical measurements will need to be made (Figure 33A), followed by bath application of sodium channel blocker, tetradotoxin (TTX). If sharp calcium transients are action potential mediated, then TTX would eliminate them.

Experiment 2: Control optical measurements (Figure 33A), followed by bath application of potent inhibitors of the sarcoplasmic reticulum calcium-ATPases such as thapsigarging and cyclopiazonic acid needs to be done. If sharp calcium transients are mediated by action potentials and wide calcium signals are mediated by internal release, then bath application of thapsigarging and cyclopiazonic acid would eliminate wide transients and spare the narrow ones.

206 Moreover, calcium transients in Figure 33B (second panel) remained unaffected in the presence of D-APV, but were reduced in number and amplitude upon addition of

Ryanodine (Figure 33B; fourth panel). There can be three justifications for this observation:

1) Since KYNA had already compromised the function of NMDARs, these receptors could not pass calcium through, and therefore, no change was observed in the calcium transient profile upon D-APV addition. It further suggests that the initial calcium transients seen in

KYNA-treated cells were due to the release of calcium from intracellular stores consistent with observations after Ryanodine application (Figure 33B).

2) Due to KYNA treatment there could be increased NMDAR endocytosis and less number of functional NMDARs present at the cell surface to exhibit NMDAR-dependent calcium activity. It would be interesting to study if KYNA triggers NMDAR endocytosis.

3) Based on our new knowledge that NMDARs can function in an ion-independent manner, the calcium activity we see in our control RGCs could be from calcium influx through gap junctions or hemichannels, expression of which have been shown in young human neuronal cultures (Belinsky et al., 2014).

207

References

Akerboom J. et al. Optimization of a GCaMP calcium indicator for neural activity imaging.

J. Neurosci. 32, 13819–40 (2012).

Aow J, Dore K, Malinow R: Conformational signaling required for synaptic plasticity by the NMDA receptor complex. Proc Natl Acad Sci U S A. 112(47): 14711–6 (2015).

Barr FA, Short B. Golgins in the structure and dynamics of the Golgi apparatus. Curr Opin

Cell Biol. 15(4):405-13 (2003).

Belinsky, G. S. et al. Patch-clamp recordings and calcium imaging followed by single-cell

PCR reveal the developmental profile of 13 genes in iPSC-derived human neurons. Stem

Cell Res. 12, 101–18 (2014).

Birnbaum JH, Bali J, Rajendran L, et al.: Calcium flux-independent NMDA receptor activity is required for Aβ oligomer-induced synaptic loss. Cell Death Dis. 6(6): e1791

(2015).

Bressloff P. Stochastic model of protein receptor trafficking prior to synaptogenesis. Phys

Rev E Stat Nonlin Soft Matter Phys. 74:031910 (2006).

Dore K, Aow J, Malinow R: Agonist binding to the NMDA receptor drives movement of its cytoplasmic domain without ion flow. Proc Natl Acad Sci U S A. 112(47): 14705–10

(2015).

Fukaya M, et al. Retention of NMDAR NR2 subunits in the lumen of endoplasmic reticulum in targeted NR1 knockout mice. Proc Natl Acad Sci USA. 100:4855 (2003).

Groc L, et al. Differential activity-dependent regulation of the lateral mobilities of AMPA and NMDARs. Nat Neurosci. 7:695 (2004).

208 Hardingham GE, Arnold FJ, Bading H: A calcium microdomain near NMDA receptors: on switch for ERK-dependent synapse-to-nucleus communication. Nat Neurosci. 4(6): 565–

6 (2001).

Hawkins L, et al. Export from the endoplasmic reticulum of assembled N-methyl-D- aspartic acid receptors is controlled by a motif in the C terminus of the NR2 subunit. J

Biol Chem. 279:28903 (2004).

Howard BM. et al. Radial glia cells in the developing human brain. Neuroscientist 14,

459–73 (2008).

Jantzie LL, Talos DM, Jackson MC, Park HK, Graham DA, Lechpammer M, et al.

Kessels HW, Nabavi S, Malinow R: Metabotropic NMDA receptor function is required for

β-amyloid-induced synaptic depression. Proc Natl Acad Sci U S A. 110(10): 4033–8

(2013).

Kohr G. NMDAR function: Subunit composition versus spatial distribution. Cell Tissue

Res. 326:439 (2006).

Li B, et al. Differential regulation of synaptic and extrasynaptic NMDARs. Nat Neurosci.

5:833 (2002).

Matsuda K, et al. Specific assembly with the NMDAR 3B subunit controls surface expression and calcium permeability of NMDARs. J Neurosci. 23:10064 (2003).

Mayer ML, Westbrook GL, Guthrie PB. Voltage-dependent block by Mg2+ of NMDA

209

responses in spinal cord neurones. Nature. 309(5965): 261–3 (1984).

Mcilhinney R, et al. Assembly intracellular targeting and cell surface expression of the human N-methyl-D-aspartate receptor subunits NR1a and NR2A in transfected cells.

Neuropharmacology. 37:1355 (1998).

Nong Y, Huang YQ, Ju W, et al.: Glycine binding primes NMDA receptor internalization.

Nature. 422(6929): 302–7 (2003).

Nowak L, Bregestovski P, Ascher P, et al.: Magnesium gates glutamate-activated channels in mouse central neurones. Nature. 307(5950): 462–5 (1984).

Perez-Otano I, Ehlers MD. Homeostatic plasticity and NMDAR trafficking. Trends

Neurosci. 28:229 (2005).

Preisinger C, Short B, De Corte V, Bruyneel E, Haas A, Kopajtich R, Gettemans J, Barr

FA. YSK1 is activated by the Golgi matrix protein GM130 and plays a role in cell migration through its substrate 14-3-3zeta. J Cell Biol. 164(7):1009-20 (2004).

Prybylowski K, et al. Relationship between availability of NMDAR subunits and their expression at the synapse. J Neurosci. 22:8902 (2002).

Puthenveedu MA, Bachert C, Puri S, Lanni F, Linstedt AD. GM130 and GRASP65- dependent lateral cisternal fusion allows uniform Golgi-enzyme distribution. Nat Cell Biol.

8(3):238-48 (2006).

Rajkowska G, Halaris A, Selemon LD. Reductions in neuronal and glial density characterize the dorsolateral prefrontal cortex in bipolar disorder. Biol. Psychiatry. 49:

741-752 (2001).

Roche KW, et al. Molecular determinants of NMDAR internalization. Nat Neurosci. 4:794

210 (2001).

Sans N, et al. Synapse-associated protein 97 selectively associates with a subset of

AMPA receptors early in their biosynthetic pathway. J Neurosci. 21:7506 (2001).

Sans N, et al. NMDAR trafficking through an interaction between PDZ proteins and the exocyst complex. Nat Cell Biol. 5:520 (2003).

Sans N, et al. Mpins modulates PSD-95 and SAP102 trafficking and influences NMDAR surface expression. Nat Cell Biol. 7:1179 (2005).

Stein IS, Gray JA, Zito K: Non-Ionotropic NMDA Receptor Signaling Drives Activity-

Induced Dendritic Spine Shrinkage. J Neurosci. 35(35): 12303–8 (2015).

Suzuki M, Nelson AD, Eickstaedt JB, Wallace K, Wright LS, and Svendsen CN.

Glutamate enhances proliferation and neurogenesis in human neural progenitor cell cultures derived from the fetal cortex. Eur J Neurosci 24:645–653 (2006).

Tamburri A, Dudilot A, Licea S, et al.: NMDA-receptor activation but not ion flux is required for amyloid-beta induced synaptic depression. PLoS One. 8(6): e65350 (2013).

Tovar KR, Westbrook GL. Mobile NMDARs at hippocampal synapses. Neuron. 34:255

(2002).

Vissel B, Krupp JJ, Heinemann SF, et al.: A use-dependent tyrosine dephosphorylation of NMDA receptors is independent of ion flux. Nat Neurosci. 4(6): 587–96 (2001).

Washbourne P, et al. Cycling of NMDARs during trafficking in neurons before synapse formation. J Neurosci.24:8253 (2004).

Weilinger NL, Lohman AW, Rakai BD, et al.: Metabotropic NMDA receptor signaling couples Src family kinases to pannexin-1 during excitotoxicity. Nat Neurosci. 19(3): 432–

211

42 (2016).

Weissman TA, Riquelme PA, Ivic L, Flint AC, Kriegstein AR. Calcium waves propagate through radial glial cells and modulate proliferation in the developing neocortex. Neuron

43, 647–61 (2004).

Wright P, Takei N, Rifkin L, Murray RM. Maternal influenza, obstetric complications, and schizophrenia. Am. J. Psychiatry 152: 1714–1720 (1995).

Yang L, Mao L, Tang Q, et al.: A novel Ca2+-independent signaling pathway to extracellular signal-regulated protein kinase by coactivation of NMDA receptors and metabotropic glutamate receptor 5 in neurons. J Neurosci. 24(48): 10846–57 (2004).

Zito K, Scheuss V: NMDA Receptor Function and Physiological Modulation. In

Encyclopedia of Neuroscience. Squire LR, Editor, Oxford: Academic Press. 1157–1164

(2009).

212